WO2016181979A1

WO2016181979A1 - Method for using syt7, mfsd4, and etnk2 expression levels to detect metastasis of gastric cancer to liver, detection kit, method for screening molecular targeted therapeutic agent, and pharmaceutical composition

Info

Publication number: WO2016181979A1
Application number: PCT/JP2016/063956
Authority: WO
Inventors: 光郎神田
Original assignee: 国立大学法人名古屋大学
Priority date: 2015-05-13
Filing date: 2016-05-11
Publication date: 2016-11-17
Also published as: JPWO2016181979A1

Abstract

Provided are a detection method for predicting the metastasis of gastric cancer to the liver, a detection kit, and a method for screening a medicine which selectively acts on liver metastasis. By targeting SYT7, MFSD4, and ETNK2, the expression of which specifically changes during metastasis of gastric cancer to the liver, postoperative liver metastasis can be predicted or a molecular targeted therapeutic agent can be screened.

Description

SYT7 / MFSD4 / ETNK2 expression level gastric cancer liver metastasis test method, test kit, molecular target therapeutic drug screening method, pharmaceutical composition

The present invention relates to a prognostic marker for gastric cancer and a method for testing using the same. In particular, the present invention relates to a method for examining gastric cancer having a high risk of progressing to liver metastasis that affects the prognosis of gastric cancer, a test kit, a screening method for a molecular target therapeutic agent, and a pharmaceutical composition.

Gastric cancer is a common cancer in Asia, such as Japan, China, and South Korea, and South America. Looking at cancer mortality by region in Japan, the mortality rate of gastric cancer is decreasing year by year, but it is the second highest after lung cancer in men, and the third highest after colon cancer and lung cancer in women. (According to 2012 statistics.) With the spread of cancer screening, early detection has progressed and the mortality from gastric cancer has decreased. However, advanced gastric cancer still has a poor prognosis and is an important disease to be overcome in Japan, where gastric cancer prevalence is high.

Recurrent metastasis greatly affects the prognosis of gastric cancer. At present, gastric cancer with distant metastasis is treated in a lump and its treatment policy is not distinguished. However, there are three completely different pathways for recurrent metastasis of gastric cancer: peritoneal dissemination metastasis, hematogenous metastasis, and lymph node metastasis.

A multi-step process is required for free cancer cells arising from the primary lesion to engraft and proliferate to form a metastatic focus. Adhesion molecules, proteolytic enzymes, growth factors, angiogenic factors, chemokines, and many other molecules Has been reported to be involved. In gastric cancer, the three pathways of recurrent metastasis are greatly different, so the molecules involved in metastasis are also different, and the properties of metastasized cancer cells are also considered to be greatly different. Nevertheless, it is considered that the same treatment is performed by using three pathways with different metastasis formation mechanisms as distant metastases, which may contribute to the difficulty of complete cure of metastatic cancer.

Chemotherapy for recurrent gastric cancer and advanced gastric cancer that may recur. Currently used as a standard regimen is a therapy based on the administration of S-1, whose mechanism of action is inhibition of DNA synthesis. As a result of a large-scale cohort study, treatment of advanced gastric cancer has been shown to be effective by taking S-1 as an adjunct therapy after gastrectomy, and postoperative S-1 is the standard treatment. S-1 is a drug that is generally effective for cancers with proliferating cells, and does not act specifically on metastatic gastric cancer. Actually, the main cause of S-1 monotherapy significantly extending the survival period of patients with advanced gastric cancer is a decrease in the rate of recurrence of peritoneal dissemination, which is controlled in hematogenous and lymph node metastasis including liver metastasis. It's hard to say.

As a form of recurrent metastasis of gastric cancer, hematogenous metastasis that metastasizes to other organs in the bloodstream is the second most common after peritoneal dissemination metastasis. In the case of gastric cancer, there are many liver metastases among the hematogenous metastases that metastasize to the liver. It is becoming important for follow-up of gastric cancer after surgery to detect and treat liver metastasis recurrence as soon as S-1 is not so effective against recurrence and subjective symptoms are difficult to occur.

In recent years, highly specific tumor markers have been identified by comprehensive gene analysis methods such as microarrays and next-generation sequencers. Methods for predicting and detecting recurrence of gastric cancer are also disclosed (Patent Documents 1 to 3). Moreover, although there is a report regarding a marker having a high risk of liver metastasis regardless of the cancer type, research has not been made on a marker for predicting liver metastasis specific to gastric cancer (Patent Document 4).

Also, in the treatment of cancer, development of molecular targeted therapeutic agents capable of reducing side effects has become active. A molecular target therapeutic agent refers to a drug that is made to act efficiently by capturing the properties of diseased cells such as cancer cells at the molecular level and targeting proteins or genes expressed on the surface. There are only a few molecular targeted therapeutic agents for gastric cancer, and only Trastuzumab for HER2-positive gastric cancer has received domestic approval. In addition, ramucilumab is approved for advanced gastric cancer in the United States.

In addition, for advanced gastric cancer, as described above, different molecular targeted therapeutic agents have not been developed, although different types of recurrent metastasis have been developed. In particular, molecular targeted therapeutic agents effective for hematogenous metastases, such as liver metastases, have been developed. It has not been done.

JP 2013-102716 A JP 2005-516215 Gazette International Publication No. 2005/010180 JP 2006-119064 A

As described above, although markers for evaluating the risk of recurrence and metastasis have been disclosed, few markers specific to liver metastasis of gastric cancer have been reported. Moreover, since the accuracy is not so high, it has not been put into practical use yet. Therefore, identification of a marker specific to liver metastasis that can accurately evaluate the risk of recurrence is desired. If a marker highly specific for liver metastasis can be found, more effective individualized treatment can be provided.

In addition, trastuzumab, which is currently approved in Japan as a molecular targeted therapy for gastric cancer, is only effective for HER2-positive gastric cancer, which accounts for about 20% of advanced and recurrent gastric cancer. In addition, lamusilmab, which is approved for the treatment of advanced gastric cancer in the United States, is not very effective in prognostic extension. Therefore, the development of new molecular targeted therapeutic agents for advanced and recurrent gastric cancer is desired.

It is an object of the present invention to clarify a gene involved in different types of recurrent metastasis of gastric cancer, establish a novel marker capable of predicting prognosis, and provide a method and a test kit for examining the risk of liver metastasis with a poor prognosis. To do. Another object of the present invention is to develop a method for screening a molecular target drug using the marker as an index.

The present invention relates to the following test methods, kits, screening methods, and pharmaceutical compositions.
(1) A test method for predicting liver metastasis after gastrectomy for gastric cancer, wherein the patient serum collected from the subject and / or at least one of SYT7, MFSD4, and ETNK2 in gastric cancer tissue in gastrectomy The above expression level is obtained, and when at least one expression level of SYT7, MFSD4, ETNK2 in the sample is significantly different from a predetermined value, it is determined that the risk of liver metastasis is high Inspection method.
(2) The test method according to (1), wherein the expression levels of SYT7, MFSD4, and ETNK2 measure the mRNA and / or protein expression levels of SYT7, MFSD4, and ETNK2.
(3) The test method according to (2), wherein the mRNA expression level of SYT7, MFSD4, and ETNK2 is measured by quantitative PCR or a next-generation sequencer.
(4) The test method according to (1), wherein the expression level of MFSD4 is determined by analyzing the DNA methylation state of the MFSD4 gene promoter region.
(5) A test kit for diagnosing or predicting liver metastasis after gastrectomy for gastric cancer, a primer for quantitative PCR for measuring the expression level of SYT7, MFSD4, or ETNK2, an anti-SYT7 antibody, A test kit comprising one or more of an anti-MFSD4 antibody, an anti-ETNK2 antibody, or a methylation detection reagent for the MFSD4 gene promoter region.
(6) A method for screening a molecular target therapeutic agent for treating liver metastasis after gastrectomy for gastric cancer, comprising suppressing SYT7, ETNK2 expression level, increasing MFSD4 expression level, or MFSD4 gene promoter region A molecular targeted therapeutic drug screening method comprising screening a substance using at least one of methylation as an index.
(7) A pharmaceutical composition for suppressing liver metastasis after gastrectomy, comprising at least one siRNA of SYT7 and ETNK2.

According to the present invention, since the risk of liver metastasis can be predicted immediately after gastrectomy, it can be used for subsequent treatment. Specifically, a group of patients with a high risk of liver metastasis can be treated with a follow-up plan with a view to liver metastasis after gastrectomy. Furthermore, it becomes possible to screen a medicine using the expression level of SYT7, MFSD4, and ETNK2 as an index. Therefore, it is possible to develop a medicament for treating recurrence of liver cancer metastasis targeting these molecules.

The figure which shows the correlation with the expression level of SYT7, MFSD4, and ETNK2 and liver metastasis. FIG. 1A shows SYT7, FIG. 1B shows MFSD4, and FIG. 1C shows the correlation between the expression level of ETNK2 and liver metastasis. The expression levels of SYT7, MFSD4, and ETNK2 in the resected tissue of 200 gastric cancer patients are shown as an average value and a plot diagram. The figure which shows the sensitivity and specificity analysis by a ROC curve. The figure which shows the liver metastasis recurrence rate in the high expression group of each gene, and a low expression group. The figure which shows the amount of SYT7 protein by the progress degree of the gastric cancer in serum. The figure which shows the gene by which a correlation is seen with the expression of SYT7, MFSD4, and ETNK2 in a human gastric cancer cell line. The figure which analyzed the change of the cell migration ability by the expression suppression of SYT7, MFSD4, and ETNK2. The figure which analyzed the change of the invasive ability by the expression suppression of MFSD4. The figure which shows the methylation abnormality of MFSD4. (A) The figure which shows the CpG island by the sequence analysis of the promoter region of MFSD4. (B) The figure which shows the analysis result of the gastric cancer cell line by methylation specific PCR. The figure which shows the methylation abnormality of MFSD4, and the change of the expression level by demethylation. (A) The figure which shows a primer position. (B) The figure which shows the change of MFSD4 expression level by the demethylation in each cell, and the state of methylation. The figure which shows the correlation with methylation of MFSD4 in a serum sample, and the progress degree of gastric cancer.

The present inventor classified the cases after gastrectomy according to the course, and conducted comprehensive expression analysis using a next-generation sequencer for mRNA obtained from gastric cancer primary tissue. As a result, it was revealed that SYT7 and ETNK2 were specifically highly expressed and the expression level of MFSD4 was specifically decreased in gastric cancer with liver metastasis. When the expression level is higher or lower than a certain value, it can be diagnosed that the case has a high risk of causing liver metastasis.

SYT7 is a membrane protein belonging to the synaptotagmin (SYT) family. It has been identified as a calcium / phospholipid-binding molecule present on synaptic vesicles, suggesting that it functions as a calcium sensor. In humans, the presence of 17 isoforms has been reported, and it is reported that it is mainly distributed in brain tissue. SYT7 is also mainly expressed in the brain and has been reported to be involved in neurotransmitter exocytosis (Non-Patent Documents 1 and 2).

ETNK2 (Ethanolamine kinase 2) is an enzyme involved in the first synthesis step in the CDP-ethanolamine pathway, which is one of the synthesis pathways of phosphatidylethanolamine, which is a major phospholipid of biological membranes. It is highly expressed in the liver and genital organs, and it has been suggested from knockout mouse experiments that it is involved in placental homeostasis (Non-patent Document 3).

MFSD4 (major facilitator superfamily domaining 4) has been reported to be expressed in nerve tissue, but its function is unknown (Non-patent Document 4).

None of these three proteins has ever been reported to be associated with gastric expression, cancer, or metastasis. In addition, in gastric cancer cases in which recurrence of liver metastasis was observed at an early stage, the expression levels of SYT7 and ETNK2 increased compared to normal tissues, and the expression level of MFSD4 decreased. This is the first discovery by the present inventor.

If the expression level of any of SYT7, MFSD4, and ETNK2 in a sample of resected gastric cancer tissue after gastrectomy is significantly different from the predetermined value, it may cause liver metastasis even if it cannot be confirmed visually It is predicted that there is a high possibility of spontaneous liver metastasis and risk of liver metastasis in the future. Therefore, the risk of metastasis to the liver can be evaluated by quantifying the expression level of at least one of SYT7, MFSD4, and ETNK2.

SYT7, MFSD4, and ETNK2 are considered to be released from the gastric primary tissue or released from the disintegrated tumor into the blood and circulate in the blood. Therefore, by detecting the expression of SYT7, MFSD4, and ETNK2 in the serum using not only gastric cancer tissue but also serum as a sample, the risk of transition to liver metastasis can be evaluated. Moreover, methylation of MFSD4 described later can be detected not only by analyzing tissues but also by analyzing DNA obtained from serum samples.

SYT7, MFSD4, and ETNK2 can quantify their expression levels by quantifying mRNA and protein. Any method may be used as long as mRNA and protein can be quantitatively measured. For example, mRNA may be measured using quantitative PCR, next-generation sequencer, Northern blotting, DNA chip for gene expression analysis, or the like. In particular, the quantitative PCR method is preferable because it can be measured in a short time. As the quantitative PCR method, a known method such as SYBR Green method, TaqMan probe method, RT-PCR method or the like can be used.

The protein may be measured using an anti-SYT7 antibody, an anti-MFSD4 antibody, or an anti-ETNK2 antibody. Antibodies may be prepared by immunizing animals such as rabbits, goats, mice and the like with conventional methods. The protein can be quantified by a known method such as a protein chip, ELISA method, RIA method, or Western blotting. By measuring mRNA and protein, the expression level of SYT7, MFSD4, and ETNK2 can be quantified with high sensitivity, and the risk of liver metastasis can be evaluated.

Furthermore, it was clarified that the promoter region of the MFSD4 gene has a CpG island and its expression is inactivated by DNA methylation. Therefore, the decrease in the expression of the MFSD4 gene may be analyzed for the degree of methylation of the promoter region. For DNA methylation, known assay methods such as quantitative methylation-specific PCR, pyrosequencing, HELP assay, and chip-on-chip assay can be used.

Since there was a correlation between the expression level of SYT7, MFSD4, and ETNK2 and recurrence of liver metastases, PCR primers capable of quantifying the expression of these genes, antibodies capable of detecting the protein, or methyl in the promoter region of the MFSD4 gene By using a kit containing reagents necessary for detection of gasification, a test kit for predicting the prognosis of liver metastasis recurrence after gastric cancer resection can be obtained. As a result, it is possible to follow up closely after the operation of advanced gastric cancer.

The kit for examining the expression level of the SYT7, MFSD4, and ETNK2 genes can be configured to include enzymes, reagents, and the like that are optimal for quantification in addition to a PCR primer set that can quantify the expression level of each gene. As the primer, any sequence may be used as long as it can quantitatively measure SYT7, MFSD4, and ETNK2. In order to normalize the expression level, a control primer such as a primer for amplifying GAPDH may be included.

In addition, kits for examining the expression levels of SYT7, MFSD4, and ETNK2 proteins include antibodies and aptamers for detecting proteins, and reagents necessary for detection in addition to molecules that bind to SYT7, MFSD4, and ETNK2 proteins. What is necessary is just composition.

Furthermore, in order to detect methylation of the promoter region of the MFSD4 gene, it may be configured to include a reagent necessary for a known methylation detection method.

In patients with gastric cancer liver metastasis, since SYT7 and ETNK2 are highly expressed, molecular target therapeutics can be selected by screening for compounds that suppress their expression. In addition, since the expression of MFSD4 is decreased, a molecular target therapeutic agent can be selected by screening a compound that increases the expression of MFSD4. A candidate for a molecular target therapeutic agent may be selected from a library composed of a low molecular compound, a natural product, or the like.

For example, a library compound is added to a culture solution of a cancer cell line or gastric cancer cell line established from gastric cancer liver metastasis and a cell line that highly expresses SYT7 and ETNK2, and cell culture is performed to express SYT7 and ETNK2 What is to be suppressed may be selected. Alternatively, a library compound may be added to a culture solution of a cell line with a low expression level of MFSD4, cell culture may be performed, and one that increases MFSD4 expression may be selected. Since the expression levels of SYT7, MFSD4, and ETNK2 can be quantified by measuring mRNA and protein as described above, a substance that suppresses expression with high sensitivity can be selected.

Further, the present inventor has found that when SYT7, MFSD4, and ETNK2 are depleted by siRNA, a change occurs in the cell migration ability. With respect to SYT7 and ETNK2, which have a correlation between increased expression and liver metastasis, it is possible to suppress liver metastasis by suppressing it with siRNA. Therefore, there is a possibility that siRNA of SYT7 and ETNK2 can be used as a therapeutic agent.

In the present invention, “SYT7 expression”, “MFSD4 expression”, and “ETNK2 expression” refer to gene and / or protein expression unless otherwise specified.

≪Analysis of genes specifically expressed in the liver recurrence group (1) ≫
Previously, advanced gastric cancer cases that had undergone gastrectomy at Nagoya University School of Medicine were divided into 4 groups: long-term recurrence group over 5 years, peritoneal dissemination recurrence group, liver metastasis recurrence group, and lymph node recurrence group. Focusing on the recurrence of liver metastasis, which accounts for about 25% of recurrent gastric cancer, and oral S-1 after gastrectomy is not effective in advanced gastric cancer. We decided to detect genes with different expression levels. Specifically, patients who underwent curative resection for stage III gastric cancer and who took S-1 as adjuvant therapy were divided into groups according to their course. The group was divided into four groups, a long-term recurrence group of 5 years or more, a peritoneal dissemination recurrence group, a liver metastasis recurrence group, and a lymph node recurrence group. Expression profiling by transcriptome analysis was performed on RNA obtained from gastric cancer primary tissue, gastric non-cancerous part, and liver metastatic lesions of 4 patients with liver metastasis recurrence group.

As the surgical sample, RNA was extracted using RNeasy kit (manufactured by QIAGEN). The extracted total RNA was subjected to sequence library adjustment according to a standard protocol using TruSeq RNA Sample Prep Kit (manufactured by Illumina).

Next, using a next-generation sequencer Hiseq (manufactured by illumina), paired-end sequencing was performed, and transcriptome analysis was performed. Data was acquired with a read base length of 100 bases / read, a reference acquisition number of reads of 100 million read pairs (200 million reads) / lane, and a reference acquisition data amount of 20 Gb / lane.

For analysis, use HiSeq software to perform mapping processing to the specified reference sequence, calculate the expression level for each gene based on the FPKM (Fragments per kilobase of exon per million mapped sequence reads) value, and create an inter-sample comparison table Was done.

The expression level of 57551 molecules in the non-cancerous part of the stomach, the primary gastric lesion, and the liver metastatic lesion in 4 cases in the liver metastasis recurrence group was comprehensively analyzed by transcriptome analysis. We extracted genes that showed a significant difference in gene expression between the non-cancerous part of the stomach and the primary gastric lesion, and no significant difference in expression between the primary stomach and liver metastases.

Table 1 shows the signals of non-cancerous stomach, primary gastric lesion, and liver metastatic lesion in the group in which recurrence of liver metastasis was observed. The intensity ratio (log 2 ratio) is calculated and summarized. SYT7 and MFSD4 were extracted as genes in which a significant difference was observed in the gene expression level between the non-cancerous part of the stomach and the primary gastric lesion, and no significant difference was observed in the expression between the primary gastric lesion and the liver metastatic lesion.

As shown in Table 1, it was observed that the expression of SYT7 (NCBI RefSeq ID accession number: NM_00125202065.1) was significantly increased in the liver metastasis recurrence group. SYT7 was found to be 21-fold or more upregulated in the primary gastric lesion compared to the non-cancerous part of the stomach. It was also observed that the expression of MFSD4 (NCBI RefSeq ID accession number: NM — 181644.4) was significantly reduced in the liver metastasis recurrence group. It was confirmed that the expression level of MFSD4 decreased to about 1/20 of the non-cancerous part of the stomach at the primary gastric lesion.

Furthermore, in both SYT7 and MFSD4, no significant difference was observed in the expression level between the liver metastatic lesion and the primary gastric lesion. The fact that there is no difference in the expression between the primary gastric lesion and the liver metastatic lesion suggests that the abnormal expression of these genes is a change that occurred before metastasis from the primary gastric lesion. Therefore, the gene expression of SYT7 and MFSD4 can be used as a marker for selecting a high-risk case of liver metastasis at the stage of endoscopic biopsy or cancer resection.

≪Analysis of genes specifically expressed in the liver recurrence group (2) ≫
Based on the transcriptome analysis of RNA obtained from the gastric cancer primary tissue of the patients divided into the 4 groups of long-term recurrence group, peritoneal dissemination recurrence group, liver metastasis recurrence group, and lymph node recurrence group over 5 years mentioned above Expression profiling was performed. The expression level of 57551 molecules was comprehensively analyzed for 4 cases of RNA in each group. Comparison was made between the 4 groups, and in the liver metastasis recurrence group, a molecule having a significant difference in the expression level compared to the other 3 groups was detected. As a result, it was revealed that 31 genes were significantly increased in the liver metastasis recurrence group. Among them, an analyzable gene whose expression in cancer tissue had not been reported so far and whose gene function was reported was selected.

As shown in Table 2, it can be seen that the expression level of the ETNK2 (NCBI RefSeq ID accession number: NM_001297760.1) gene is significantly enhanced in the liver metastasis recurrence group as compared to the long-term recurrence-free group. In cases where liver metastasis recurred, ETNK2 was found to be approximately 5.3 times as potent in expression as the relapse-free group. On the other hand, no significant enhancement of ETNK2 expression was observed in other metastatic forms of peritoneal dissemination and lymph node recurrence. Therefore, the ETNK2 gene expression level and protein expression level function as biomarkers for gastric cancer liver metastasis.

≪Expression level of SYT7, MFSD4, ETNK2 in clinical specimens≫
SYT7, MFSD4, and ETNK2 mRNA expression was analyzed by quantitative PCR using clinical specimens. Analyzed specimens included 9 cases that had already had liver metastasis at the time of gastrectomy and 12 cases that had no liver metastasis at the time of gastrectomy but had recurrence of liver metastases early within 2 years after surgery. A total of 78 specimens of 57 cases.

PCR primers used the following sequences, ABI STEPOnePlus Real-Time PCR System (manufactured by Applied Biosystems) was heated at 95 ° C for 10 minutes, and then amplified at 40 ° C for 40 cycles at 95 ° C for 5 seconds and 60 ° C for 60 seconds. And analyzed.

Primer sequence SYT7: Forward GCGCAGTGAGAAGAAGGCTA (SEQ ID NO: 1)
Reverse TCTGAGACGGAGGAACGTG (SEQ ID NO: 2)
MFSD4: Forward CAACATGCAGCTGGTAAGGA (SEQ ID NO: 3)
Reverse ACCCTGGAGACATGGAACAG (SEQ ID NO: 4)
ETNK2: Forward TGAAGAACGAGATCAACCCC (SEQ ID NO: 5)
Reverse GACAAAACACCACAGGGGAC (SEQ ID NO: 6)

1A shows the expression level of SYT7 mRNA, FIG. 1B shows the expression level of MFSD4 mRNA, and FIG. 1C shows the normalized value of ETNK2 mRNA expression level of GAPDH mRNA. Box-whisker plots (minimum value, 1st case) were observed in each group of cases in which liver metastasis was not observed at the time of gastrectomy. (Quarter point, median, third quarter point, maximum value).

Significant in patients with recurrent liver metastasis, ie, patients who had already had liver metastasis at the time of gastrectomy, or those who had liver metastasis at the early stage within 2 years after surgery In addition, an increase in the expression level of SYT7 and ETNK2 was observed, and a significant decrease in the expression level was observed in MFSD4.

Although there were variations among patients, the expression levels of SYT7 and ETNK2 in the group in which liver metastasis was observed were significantly higher than those in the group other than liver metastasis. In addition, the expression of MFSD4 was significantly higher in the group other than liver metastasis compared to the group in which recurrence of liver metastasis was observed.

Although the optimal cut-off value should be verified with multiple specimens, it is possible to predict the risk of gastric cancer with recurrent liver metastases by measuring the expression levels of SYT7, MFSD4, and ETNK2. For example, when SYT7 and ETNK2 expression is used as a marker of liver metastasis, as shown in FIGS. 1A and 1C, among the patient groups in which liver metastasis was not observed, simultaneous liver metastasis, liver metastasis within 2 years after surgery Since the number of patients exceeding the median value of any liver metastasis group is 25% or less, the risk of gastric cancer that recurs in the liver metastasis can be predicted based on the median value of cases in the liver metastasis group. The cut-off value can be predicted to vary depending on the measurement method of SYT7, MFSD4, and ETNK2, and the sample to be measured. Therefore, the cut-off value can be appropriately determined, and a patient group with a high risk of liver metastasis can be selected and followed. desirable.

The number of cases was increased and analysis was performed by the quantitative PCR method as described above. The expression level of each gene in the resected tissue of 200 cases of gastric cancer patients was analyzed. Stage II / III is divided into liver recurrence (-) and liver recurrence (+) according to the presence or absence of later liver metastasis, and stage IV is analyzed according to the presence or absence of liver metastasis, even if it has distant metastasis . The average value is shown on the left side of FIG. 2, and the plot is shown on the right side.

The expression level of SYT7 in gastric cancer tissues was confirmed in patients with liver metastases after staged curative resection (Stage II / III, liver recurrence (+)), among those with distant metastases (Stage IV liver metastasis ( +)) Was significantly higher. Conversely, in cases where there is no future or present liver metastasis, there is no difference in the expression level from normal gastric tissue, and it is considered that the presence and prediction of gastric cancer liver metastasis have high specificity. The expression level of MFSD4 in gastric cancer tissues was more highly suppressed in cases where liver metastasis or future liver metastasis recurrence was observed. The expression level of ETNK2 in gastric cancer tissues was significantly higher in cases with liver metastasis (Stage IV liver metastasis (+)), even among distant metastases. On the other hand, in other gastric cancer cases, there is no difference in the expression level from normal gastric tissue, and it is considered that the presence of gastric cancer liver metastasis has high specificity.

ROC curve analysis was performed on each mRNA expression level in the above 200 cases of gastric cancer patients. As shown in FIG. 3, the mRNA expression levels of SYT7, MFSD4, and ETNK2 in the primary gastric cancer lesion were all highly correlated with liver metastasis or liver metastasis within 2 years after surgery.

Using the cut-off values obtained by ROC curve analysis of each gene, 93 patients with stage II / III gastric cancer, that is, patients who were curatively excised but at a stage with high risk of recurrence The progress was examined. As shown in FIG. 4, in cases of SYT7 expression enhancement, MFSD4 expression suppression, and ETNK2 expression enhancement in gastric cancer primary lesions, liver metastasis recurs significantly after curative resection, and independence of gastric cancer liver metastasis is also found in multivariate analysis. It was a risk factor.

If the liver metastasis can be predicted using not only the gastrectomy tissue sample but also the blood sample, the diagnosis can be performed with the blood sample before and after the operation, which is very beneficial for the patient. Therefore, an analysis was performed to determine whether there was a change in the expression level of SYT7 using patient serum.

The amount of SYT7 in patient serum was measured using an ELISA kit (ELISA Kit for Synaptotagmin VII (SYT7), manufactured by Cloud-Clone). The subjects were 16 healthy patients, 10 stage I gastric cancer patients, 9 stage II gastric cancer patients, 10 stage III gastric cancer patients, and 39 stage IV gastric cancer patients. The results are shown in FIG.

As shown in FIG. 5, a gradual increase in serum SYT7 was observed according to the stage of gastric cancer. Therefore, the serum SYT7 value can be a diagnosis of the degree of progression of gastric cancer and a biomarker for predicting metastasis recurrence.

For other markers, it is considered that recurrence of liver metastases can be predicted by measuring the protein expression level using not only gastrectomy tissue but also a blood sample.

≪Correlation with expression of major cancer-related genes≫
Since SYT7, MFSD4, and ETNK2 were found to correlate with liver metastasis recurrence, we next examined the expression levels of these genes and major cancer-related genes, and analyzed which gene expression levels were correlated. Went. For analysis, 10 human gastric cancer cell lines, AGS (obtained from ATCC), MKN1 (obtained from RIKEN Cell Bank), MKN74 (obtained from RIKEN Cell Bank), N87 (obtained from ATCC), KATO-III (obtained from ATCC) ), MKN45 (obtained from RIKEN Cell Bank), NUGC2 (established at Nagoya University), NUGC3 (established at Nagoya University), NUGC4 (established at Nagoya University), SC-6-JCK (obtained from Tohoku University) and non-neoplastic gland The epithelial cell line FHs74 (obtained from ATCC) was used.

For the analysis, Human Epithelial to Mesenchymal Transition (EMT) RT2 Profile PCR Array Kit (manufactured by QIAGEN) was used to analyze the correlation of expression with 84 major cancer-related genes. The results are shown in FIG.

The expression level of SYT7 was significantly positively correlated with the expression of TGFB3, an epithelial-mesenchymal transition (EMT) -related molecule. On the contrary, an inverse correlation with CAV2 and RGS2 suppressed by EMT was observed.

The expression level of MFSD4 has a significant inverse correlation with the expression of BMP2, which is an EMT-related molecule that is deeply involved in cancer metastasis and progression, and conversely, it has a positive correlation with NUDT13 and OCLN, which are suppressed by EMT. Admitted.

ETNK2 expression level showed a significant positive correlation with AHNAK, ITGAV, FN1, MMP3, TGFB1, and EGFR. AHNAK and ITGAV are known as EMT promoters, FN1 and MMP3 are known as extracellular matrix proteins, and TGFB1 and EGFR are known as cell growth factors. These results indicate that the expression of SYT7, MFSD4, ETNK2 is coordinated with other major cancer-related genes.

≪Knockdown analysis using siRNA≫
It was analyzed whether recurrence of liver metastasis could be suppressed by regulating the expression of SYT7, MFSD4, and ETNK2 that was correlated with recurrence of liver metastasis. Using siRNA, it was analyzed whether changes occurred in the migration ability and invasion ability of gastric cancer cell lines.

Using MKN1, which is a gastric cancer cell line with high expression of SYT8 and SYT13, selective expression inhibition (knockdown) experiments of each gene were conducted to evaluate the migration ability of gastric cancer cells.

40 nM each of siRNA was introduced into MKN1 cells using Accel siRNA transfection methods (manufactured by Dharmacon), and after 72 hours of culturing in serum-free DMEM medium, the migration ability was evaluated. SYT7 siRNA, MFSD4 siRNA, ETNK2 siRNA, and control siRNA (Accel Green Non-targeting) were all obtained from Dharmacon.

After introduction of siRNA, the cells were cultured in a serum-free medium for 72 hours, and the cell migration ability was evaluated by a wound-healing assay. MKN1 cells to be 2 × 10 ^4, 12-well plates were seeded to form ibidi Culture insert method wound gap at a predetermined width (ibid Inc.), were cultured in serum-free medium. The insert was removed 24 hours after sowing, and the width was measured at intervals of 200 μm every 6 hours. The measurement was carried out using a microscope with a magnification of 40 times, and each well was measured at 10 locations to determine the average and standard deviation.

FIG. 7 shows changes over time in the microscopic image and the wound width. In FIG. 7, an asterisk (*) indicates that there is a significant difference compared to a control not subjected to siRNA introduction treatment. It was clarified that knockdown of SYT7 and ETNK2 significantly decreased the migration ability of gastric cancer cell line MKN1, and significantly increased by knockdown of MFSD4.

Next, the invasive ability of the cells by inhibiting MFSD4 expression was analyzed. The invasion ability of cells was evaluated by Matrigel invasion assay for cells cultured in a serum-free medium for 72 hours after introduction of siRNA. The assay was performed using BioCoat Matrigel inversion Chambers (BD Siosciences) according to the protocol. Specifically, siRNA-introduced MKN1 cells were seeded at 2.5 × 10 ⁴ per well, cultured for 24 hours in serum-free DMEM medium, and the cells on the bottom of the membrane were fixed. The number of cells was counted by observing under a microscope. Microscopic observation was performed at a magnification of 200 times, and the average and standard deviation of five randomly selected fields were obtained.

The microscopic image is shown on the left side of FIG. 8, and the number of cells having invasive ability is shown on the right side of FIG. When the expression of MFSD4 was inhibited, it was revealed that gastric cancer cells significantly suppressed invasive ability. In addition, * mark in the right graph of FIG. 8 shows that there was a significant difference between each sample.

These results suggest that SYT7, MFSD4, and ETNK2 are involved in the migration ability and invasive ability of gastric cancer cells, and that the inhibition of SYT7 and / or ETNK2 may suppress the recurrence of liver metastases. Therefore, siRMA of SYT7 and / or ETNK2 can function as an active ingredient of a pharmaceutical composition. Moreover, regarding MFSD4, it is considered that the recurrence of liver metastasis can be suppressed if its expression can be recovered.

≪Detection of DNA methylation abnormality≫
It has been reported that the decrease in gene expression in cancer cells is often caused by abnormal DNA methylation (Non-Patent Documents 5 and 6). DNA methylation is the addition of a methyl group to the C position of the CpG sequence of DNA. The CpG island present at the promoter site of the gene is methylated, resulting in gene inactivation resulting in a decrease in gene expression. It was analyzed whether the decrease in MFSD4 gene expression in the liver cancer metastasis recurrence group was due to DNA methylation.

FIG. 9A shows a CpG island in the promoter region of the MFSD4 gene. The sequence upstream of MFSD4 (NC — 000001.11. Reference GRCh38.p2) was analyzed. In the figure, the MFSD4 promoter region is indicated by a thin line. CpG sequences that can undergo methylation are shown as vertical lines on thin lines. CpG islands are portions that are gathered at a frequency that is far from the numerical value calculated with the normal probability. In the figure, a region indicated by a thick line is a region where 55% or more of GC is included in the array corresponding to the definition of the CpG island.

As a result of analyzing the promoter region of MFSD4, it was revealed that CpG islands exist over 1311 nucleotides. Next, 12 gastric cancer cell lines, AGS, GCIY (obtained from Riken Cell Bank), KATO-III, MKN1, MKN28 (obtained from JCRB cell bank), MKN45, MKN74, N87, NUGC2 by methylation-specific PCR method , NUGC3, NUGC4, SC-6-JCK and the non-neoplastic glandular epithelial cell line FHs74 were analyzed by methylation-specific PCR.

DNA was extracted from the cells, and bisulfite treatment was performed using EpiTect Bisulfite Kits (manufactured by QIAGEN) according to the protocol. The PCR primer used the following sequence and analyzed the sequence upstream of MFSD4. As shown in FIG. 9A, the PCR primer is set in the CpG island upstream from the transcription start site. As the polymerase, Platinum (registered trademark) Taq DNA Polymerase (manufactured by Invitrogen) was used, and after heating at 95 ° C. for 10 minutes by Veriti (registered trademark) Thermal Cycler (manufactured by Applied Biosystems), 95 ° C. for 5 seconds, 60 ° C. for 60 seconds. Amplification was performed under PCR conditions of 40 cycles and analyzed.

MFSD4, methylation detection primer Forward: CGGTTTTCGGTTGGTTTCG (SEQ ID NO: 7)
Reverse: CGCCCTCTACGACGGAATAAAAC (SEQ ID NO: 8)

Among 12 types of gastric cancer cell lines and non-tumor glandular epithelial cell lines FHs74, methylation of the promoter region of MFSD4 gene was observed in AGS, MKN28, NUGC3, and SC-6-JCK (FIG. 9 (B)). Assuming that the expression level of MFSD4 mRNA in the non-tumor glandular epithelial cell line FHs74 is 1.0, the expression levels of MFSD4 in AGS, MKN28, NUGC3, and SC-6-JCK are 0.65, 0.25, and 0.09, respectively. 0.06. In these gastric cancer cell lines in which methylation of the promoter region of MFSD4 gene was observed, the expression level of MFSD4 was highly suppressed as compared with non-neoplastic glandular epithelial cell line FHs74, and methylation of promoter region and suppression of gene expression were suppressed. And a correlation was observed.

In order to analyze the methylation of the promoter region in more detail, the primer was changed and the bisulfite sequencing method was used for the analysis. An outline of the position of the primer is shown in FIG. It is set further upstream than the position of the primer shown in FIG. The primer sequences used are as follows.

MFSD4, methylation detection primer Forward: AGTAGTTTTGTTTTTGTTGGGTAG (SEQ ID NO: 9)
Reverse: CCAAAAATCCACTTCAATCTCTAAA (SEQ ID NO: 10)

Eleven types of cells shown in FIG. 10 (B), gastric cancer cell lines AGS, MKN1, MKN74, N87, KATO-III, MKN45, NUGC2, NUGC3, NUGC4, SC-6-JCK and non-tumor glandular epithelial cell lines FHs74 As a result, DNA methylation was observed in 5 cell lines of AGS, N87, MKN45, NUGC3, SC-6-JCK (FIG. 10 (B) Box, Box upper stage; M = methylated, U = Indicates no methylation). In any of the cells, no abnormal copy number of the MFSD4 region was observed (Box lower row). On the other hand, DNA methylation was observed in 50% of gastric cancer cells.

Each cell was cultured for 96 hours in a medium supplemented with 10 μM 5-aza-dC (Sigma Aldrich), demethylated, and analyzed for the expression level of MFSD4. The black bar is the result for a normal cell, and the white bar is the result for a cell line that has been subjected to demethylation treatment with 5-aza-dC (FIG. 10 (B) graph). The cell line whose expression level was suppressed to a higher degree than the control FHs74 cell line was frequently accompanied by DNA methylation, and their expression recovered by demethylation treatment. From these results, it is clear that suppression of MFSD4 expression is based on DNA methylation as a main regulator.

Since analysis with a gastric cancer cell line is considered to occur in gastric cancer tissue, MFSD4 in which a decrease in the expression level is observed can be analyzed by analyzing the methylation of the MFSD4 promoter region in the gastric cancer tissue. You may be inspected for risk.

≪Detection of MFSD4 methylation in clinical specimen≫
If the presence or absence of methylation can be analyzed using a patient blood sample, it will be very advantageous in predicting recurrence of liver metastases. Therefore, MFSD4 expression level was analyzed using patient serum. DNA was extracted from patient sera, bisulfite-treated, and analyzed by quantitative methylation-specific PCR. In order to quantify methylation, the following primers were used.

Quantitative PCR primer: Forward: GTATTGTTTATTCGGTCGTAGGC (SEQ ID NO: 11)
Reverse: ATAACGCCAAACTAACGAACTCG (SEQ ID NO: 12)
probe: AAACCCCGCCCCTTAAAACCGA (SEQ ID NO: 13)

Quantitative primers and probes were combined with DNA extracted from patient serum and mixed, and PCR reaction was performed to specifically detect MFSD4 methylation. The PCR reaction was analyzed using ABI STEPOnePlus Real-Time PCR System (Applied Biosystems) at 95 ° C for 10 minutes, followed by amplification under 40 cycles of PCR conditions at 95 ° C for 5 seconds and 60 ° C for 60 seconds.

FIG. 11 shows the analysis results of 10 healthy patients, 6 stage I gastric cancer patients, 10 stage II / III gastric cancer patients, and 12 stage IV gastric cancer patients. Serum methylation of MFSD4 was not detected in healthy patients and stage I gastric cancer patients. On the other hand, in stage II / III gastric cancer patients, 2 out of 10 cases were detected (20%), and in stage IV gastric cancer patients, methylation was detected in serum samples in 5 out of 12 cases. Therefore. MFSD4 DNA methylation in serum can also function as a diagnostic biomarker of gastric cancer progression.

As described above, it is possible to accurately predict prognosis by analyzing mRNA expression of SYT7, MFSD4, and ETNK2 in gastric cancer tissues or blood samples. Moreover, it is also possible to detect by ELISA etc. using anti-SYT7 antibody, anti-ETNK2 antibody, and anti-MFSD4.

Moreover, in the case of MFSD4 in which gene expression is decreased in the liver metastasis recurrence group, DNA methylation of the promoter region may be analyzed. Generally, using a gene or protein whose expression level decreases as a marker may cause a problem in terms of accuracy, but it can be detected with high sensitivity by detecting DNA methylation.

According to the present invention, the expression level of SYT7, MFSD4, and ETNK2 in a sample obtained at the time of surgery can be used as a marker for predicting the risk of liver metastasis. As a result, the patient can be treated under a finer treatment policy. Furthermore, by conducting screening using the expression levels of SYT7, MFSD4, and ETNK2 as an index, it is possible to develop a drug that selectively acts on liver metastasis of gastric cancer. In particular, siRNA of SYT7 and ETNK2 can also function as a pharmaceutical composition.

Claims

A test method for predicting liver metastasis after gastrectomy for gastric cancer,
Determining the expression level of at least one of SYT7, MFSD4, and ETNK2 in patient serum collected from the subject and / or gastric cancer tissue in gastrectomy;
A test method characterized by determining that the risk of liver metastasis is high when at least one expression level of SYT7, MFSD4, and ETNK2 in a sample is significantly different from a predetermined value.
The inspection method according to claim 1,
A test method, wherein the expression level of SYT7, MFSD4, and ETNK2 measures the mRNA and / or protein expression level of SYT7, MFSD4, and ETNK2.
The inspection method according to claim 2,
A test method characterized in that the method for measuring the mRNA expression level of SYT7, MFSD4, and ETNK2 is based on quantitative PCR or a next-generation sequencer.
The inspection method according to claim 1,
A test method characterized in that the expression level of MFSD4 is determined by analyzing the DNA methylation state of the MFSD4 gene promoter region.
A test kit for diagnosing or predicting liver metastasis after gastrectomy for gastric cancer,
One or more of a primer for quantitative PCR for measuring the expression level of SYT7, MFSD4, or ETNK2, an anti-SYT7 antibody, an anti-MFSD4 antibody, an anti-ETNK2 antibody, or a methylation detection reagent for the MFSD4 gene promoter region A test kit comprising:
A method of screening a molecular targeted therapeutic for treating liver metastasis after gastrectomy for gastric cancer comprising:
A molecular targeted therapeutic drug screening method comprising screening a substance using at least one of suppression of SYT7, ETNK2 expression level, increase of MFSD4 expression level, or methylation of MFSD4 gene promoter region as an index.
A pharmaceutical composition for suppressing liver metastasis after gastrectomy, comprising at least one siRNA of SYT7 and ETNK2.