WO2016180725A1 - Diagnosis of dementia with lewy bodies - Google Patents
Diagnosis of dementia with lewy bodies Download PDFInfo
- Publication number
- WO2016180725A1 WO2016180725A1 PCT/EP2016/060176 EP2016060176W WO2016180725A1 WO 2016180725 A1 WO2016180725 A1 WO 2016180725A1 EP 2016060176 W EP2016060176 W EP 2016060176W WO 2016180725 A1 WO2016180725 A1 WO 2016180725A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- dementia
- lewy bodies
- genetic variation
- short genetic
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Definitions
- the present invention relates to the field of medicine, and particularly to neurodegenerative disorders. It specifically relates to markers for the diagnosis of dementia with Lewy bodies.
- Lewy body diseases comprise a group of disorders characterized by the presence of proteinaceous neuronal inclusions called Lewy bodies (LB).
- Lewy body diseases include Parkinson's disease (PD) and dementia with Lewy bodies (DLB), and the latter can be characterized by Lewy body pathology alone in its pure form (pure dementia with Lewy body, pDLB), or by the mixture of Lewy bodies and concomitant Alzheimer's disease pathology that constitutes a common variant of dementia with Lewy bodies (cDLB) (Braak and Braak, "Diagnostic criteria for neuropathological assessment of
- AD Alzheimer's disease
- DLB DLB was thought to be an infrequent disorder, but over the last years intense investigation has revealed that it accounts for 10-15% of autopsied cases.
- Main DLB symptoms include fluctuating cognitive impairment, recurrent visual hallucinations and Parkinsonism, but
- AD and DLB patients may differ in terms of response to medication and prognosis, it is important to improve accuracy in diagnosing DLB.
- DLB patients exhibit a slower decline of recognition memory but have more psychiatric symptoms than patients with AD, where this kind of symptomathology is observed at later disease stages.
- AD psychiatric symptoms
- the presence of visual hallucinations in early-stage dementia has been shown to be most specific for DLB. It is noteworthy to mention that although a high specificity (ranging from 90 to 99% in different studies) of clinical diagnosis is achieved, its sensitivity remains relatively low (18-83%). Accordingly, the first
- the main cause of low diagnostic sensitivity for DLB comes from the elevated percentage of cases that show, in addition to LB, related pathology AD characteristic changes in the brain.
- the third DLB consortium proposed a model to place AD-related pathology into the context of LB pathology.
- a recent report confirmed that the misdiagnosis of DLB increases with increasing AD associated pathology, but even so, only around 52% of patients had received the correct diagnosis of DLB at low AD-pathology stages.
- AD treatment consists of using cholinesterase inhibitors to improve the effectiveness of acetylcholine either by increasing the levels in the brain or by strengthening the way nerve cells to respond to it.
- neuroleptic drugs are used to diminish psychotic symptoms normally present during the disease course.
- the use of neuroleptics may cause adverse reaction in about 50% of DLB patients, sometimes causing irreversible damages and even death. Therefore, administering neuroleptic drugs to patients suffering from DLB should be avoided.
- SPECT SPECT are available, but their sensitivity is not very high and they are very expensive for a routine clinical use. An early unequivocal diagnosis of DLB would avoid the severe adverse effects suffered by administration of neuroleptics to patients suffering from DLB and provide a therapeutic margin to reduce or stop the disease progression.
- Patent EP2539461 discloses that specific variations in Butyrylcholinesterase (BChE) gene are related to DLB. This discovery allows for the diagnosis of patients suffering from DLB by determining the genotype of particular variations in BChE gene in a blood sample. While being a substancial improvement for this field, the disclosed diagnosis may not identify all DLB patients. Recent results have, indeed, shown that this method identifies only around 10% of DLB patients, so that there is still a substantial proportion of DLB patients that are not diagnosed. The treatment of DLB is symptomatic and is based on a limited number of clinical trials and extension of results from trials in AD.
- BChE Butyrylcholinesterase
- the present inventors have found that variations in the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 according to GRCh38.p2 (Genome Reference
- SEQ ID NO: 1 Consortium Human Build 38 patch release 2 from NCBI (SEQ ID NO: 1 ) are related to the presence of DLB in a subject. The detection of variations in this gene provides for a reliable and early diagnosis of DLB to be used in the common clinical practice. According to HapMap data release 28, SEQ ID NO: 1 is located from position 175.989.261 to position 176.003.107.
- the invention provides an in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 (SEQ ID NO: 1 ).
- Another aspect provides for the use of at least one variation in SEQ ID NO: 1 for the in vitro diagnosis of dementia with Lewy bodies.
- the present diagnostic method allows to identify DLB patients with specificity above 95%. Further, around 30-40% of all DLB cases are identified.
- the present diagnosis method may identify patients with DLB that cannot be found by using the diagnosis method which is based on determining variations in BChE gene (EP2539461 ). However, use of the present biomarker in combination with the biomarker disclosed in EP2539461 would identify between 40-60% of all DLB patients.
- the invention also contemplates an in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 1 and additionally detecting at least one other marker known as being indicative of dementia with Lewy bodies. Also contemplated is the use of at least one variation in SEQ ID NO: 1 for the in vitro diagnosis of dementia with Lewy bodies in combination with at least one other marker known as being indicative of dementia with Lewy bodies.
- the variations in SEQ ID NO: 1 identify a molecular subgroup of DLB patients with particular physiopathological characteristics, namely, patients that have diminished b-syn expression levels in the cortex and pure LB pathology without concominant AD.
- This molecular subgroup is herein named as patients suffering from "pure dementia with Lewy bodies” (pDLB) and has been defined previously in Beyer et al (supra), which document is herein incorporated by reference.
- the present invention thus provides for the early, diferential diagnosis of patients suffering from pDLB, distinguishing them from patients showing concominant AD, and also distinguishing them from patients suffering from another synucleinopathy such as PD. These patients are impossible to be identified pre-mortem within the known clinical practice.
- the sensitivity and specificity for the particular subgroup of patients with pDLB is very high, above 95%. It is noted that the drastic and specific b-syn decrease detected in this subgroup could be implicated in disease development by modulating alpha- synuclein properties, and is thus an interesting therapeutic target that may lead to the development of a new treatment for DLB. If such a new treatment becomes available, accurate identification of this particular subgroup of patients will be of great importance to the medical community in terms of recommending the most effective treatment regime. Also, importantly, identification of patients having pure LB pathology without concominant AD will avoid that these patients are subjected to non-effective or even harmful medical regimes.
- the clinician may exclude therapy with neuroleptics, which is the most adequate treatment for psychotic symptoms in AD but often cause severe adverse reactions in DLB patients. Therefore, by applying the method of the invention, patients will benefit not only from the possibility of receiving an effective treatment, but also because they will be exempted from being subjected to non-effective or potentially harmful treatments.
- Another aspect of the invention thus provides a method of deciding or recommending to initiate a medical regime for the treatment of dementia with Lewy bodies in a subject, which method comprises diagnosing dementia with Lewy bodies or determining whether the subject is suspicious of suffering dementia with Lewy bodies according to the method of the first aspect of the invention, wherein a) if the subject is diagnosed of suffering from dementia with Lewy bodies, or of being suspicious of suffering from DLB, then the initiation of the medical regimen is recommended, and b) if the subject is diagnosed of not suffering from dementia with Lewy bodies, the follow-up is performed optionally in consideration of the result of an examination of the patient by a physician.
- the present method has the advantage that the most appropriate medical regime will be recommended to the patient, for instance, a medical regime that is effective of the treatment of pure DLB, without concomitant Alzheimer's disease pathology and with lack, or substantial decrease, of beta-synuclein expression in the brain.
- a medical regime for the treatment of AD in particular, narcoleptic drugs, may be ruled out for the patient being diagnosed of pDLB.
- the invention is also directed to the use of means for detecting one or more variations in SEQ ID NO: 1 in a biological sample from a subject for the in vitro diagnosis of dementia with Lewy bodies. Said means may be included in a kit for the diagnosis of DLB.
- FIG. 2 Fragment containing rs14721 1 109 (underlined). In bold are the regions for annealing of primers 1 E_int1_2U and 1 E_int1_2L used for fragment amplification.
- FIG. 3 Fragment containing rs70991565 (underlined). In bold are the regions for annealing of primers 1 E_int1_3U and 1 E_int1_3L used for fragment amplification.
- FIG. 4 Fragment containing rs1 13812814 and rs1 1951438 (underlined). In bold are the regions for annealing of primers SNCBmet2U and SNCBproml L.
- FIG. 5 Scheme of the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 (SEQ ID NO: 1 ) including EIF4E1 B exons 1 -4 and SNCB exons 1 and 2, indicating polymorphisms polyC, rs5873545, rs14721 1 109, rs70991565, rs1 13812814 and rs1 1951438.
- FIG. 6 Distribution of the genetic biomarker in pDLB, cDLB, PDND, PDD, AD and controls. 67% of pDLB cases presented one of the seven genotype combinations.
- the present invention is directed to the early, diferential diagnosis of DLB by detecting variations in SEQ ID NO: 1 .
- This nucleotide sequence, defined by SEQ ID NO: 1 coincides with the 5' regulatory region of SNCB gene.
- the invention also contemplates a method for diagnosis DLB which comprises detecting variations in the 5' regulatory region of SNCB gene.
- the 5' regulatory region of SNCB gene is the 5' regulatory region of human SNCB gene.
- regulatory region of SNCB gene it is understood a segment of the human genome which is capable of increasing or decreasing the expression of SNCB.
- Human SNCB (beta-synuclein gene, herein also called b-syn, NCBI Gene ID: NG_012131 .1 , updated 04-MAY-2014) is located in chromosome 5 (NCBI Reference Sequence GRCh38.p2: NC_000005.10, updated 12-MAR-2015, SEQ ID NO: 1 ).
- the 5' regulatory region of SNCB defined by SEQ ID NO: 1 includes EIF4E1 B exons 1 -4 and SNCB exons 1 and 2.
- the human EIF4E1 B gene (NCBI Gene ID: 253314, updated on 4-Apr-2015) is located upstream the SNCB gene transcription start.
- variation in a nuleotide sequence means any variability (or polymorphism) in said nucleotide sequence.
- variations can include a single nucleotide polymorphism, a deletion, an insertion, a substitution or a duplication of one or more nucleotides, and a chemical modification on a nucleotide (e.g. methylation).
- Said variations usually imply only one or a few nucleotides of the genetic sequence and are thus herein termed in general as “short genetic variations”.
- variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 (i) the short genetic variation defined by rs5873545, (iii) the short genetic variation defined by rs14721 1 109, (iv) the short genetic variation defined by rs70991565, (v) the short genetic variation defined by rs1 13812814, and (vi) the short genetic variation defined by rs1 1951438, this is indicative of the presence of DLB in the subject.
- polyC poly-citosine sequence starting at position 13,198 of SEQ ID NO: 1 that forms part of the present biomarker has not been previously described.
- This poly-citosine sequence is herein also referred as "polyC” and is located in intron 3 of EIF4E1 B gene, i.e. starting at position 176.642.852 of human chromosome 5.
- the present inventors have observed for the first time variations on the length of this sequence and their relation to DLB. In particular, it was found that longer polyC sequences (at least 17 bp, in particular from 17 to 25 bp, more particularly from 17 to 22 bp, more particularly 17, 18, 19, 20 or 21 ) are indicative of DLB in the subject (see example 1 ).
- rs5873545 is a TCCCCG deletion/insertion variation (-/TCCCCG) found within the polyC sequence (see figure 1 ).
- the TCCCCG sequence is identified as SEQ ID NO: 10.
- rs14721 1 109 is a TTTG deletion/insertion variation (-/TTTG) found in EIF4E1 B intron 1 .
- TTTG sequence is identified as SEQ ID NO: 1 1 .
- rs70991565 is a T deletion/insertion variation (- FT) also found in EIF4E1 B intron 1 .
- rs1 13812814 is a single nucleotide variation (G/A) found within exon 1 of SNCB.
- rs1 1951438 is a single nucleotide variation (G/A) also found within exon 1 of SNCB. All sequences described in the present application are given in the 5' - 3' direction.
- detecting the variation in this description it is meant to detect, by any means, whether a particular genetic variation is present in the genome of the subject being tested.
- the in vitro method for the diagnosis of dementia with Lewy bodies may comprise detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 14 ( Figure 1 A), which corresponds to nucleotides
- the polyC and rs5873545 are located within SEQ ID NO: 14. In one embodiment of the method of the invention, if at least one variation selected from a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 and the short genetic variation defined by rs5873545 is detected this is indicative of the presence of DLB in the subject.
- the in vitro method for the diagnosis of dementia with Lewy bodies may also comprise detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 15, which corresponds to nucleotides 383 to 3787 of SEQ ID NO: 1 (see figures 2 and 4).
- the SNPs rs14721 1 109, rs 1 13812814 and rs1 1951438 are located within SEQ ID NO: 15. In one embodiment of the method of the invention, if at least one variation selected from rs14721 1 109 and rs 1 13812814 is detected this is indicative of the presence of DLB in the subject.
- the in vitro method for the diagnosis of dementia with Lewy bodies may also comprise detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 16, which corresponds to nucleotides 4868 to 5167 of SEQ ID NO: 1 (figure 3).
- the SNPs rs70991565 is located within SEQ ID NO: 16. In one embodiment of the method of the invention, if at least variation rs70991565 is detected this is indicative of the presence of DLB in the subject.
- the method of the invention further comprises determining variation rs1 1951438.
- at least two of the above variations (i)-(vi) are detected.
- at least three, at least four, at least five or the six variations above are detected.
- At least the polyC and/or rs5873545 and at least one additional variation selected from rs14721 1 109, rs70991565, and rs1 13812814 are detected.
- at least the variable polyC is detected.
- at least one further variation selected from rs14721 1 109, rs70991565, and rs1 13812814 are detected.
- the variations (i)-(v) as defined above are detected.
- the method further comprises detecting the short genetic variation defined by rs1 1951438 to be indicative of DLB.
- determining the genotype it is meant identifying the nucleotide(s) for a given variation.
- the specific genotypes that provide a diagnosis of DLB are shown in table 9. Accordingly, one embodiment provides a method for the in vitro diagnosis of DLB according to the the invention, wherein the following genotype:
- the polyC comprises from 17 to 22 cytosines in at least one of the alleles or, alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545, (ii) at least one of the alleles shows the deletion of four contiguous nucleotides TTTG for s14721 1 109, (iii) both alleles show the deletion of a tyrosine residue T for rs70991565, and (iv) both alleles contain guanine for rs1 13812814; or, alternatively, this other genotype:
- the polyC comprises from 17 to 22 cytosines in at least one of the alleles or, alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545, (vi) at least one of the alleles shows the deletion of four contiguous nucleotides TTTG for s14721 1 109, (vii) both alleles show the deletion of a tyrosine residue for rs70991565, (viii) one allele contains guanine and the other allele contains adenine for rs1 13812814, and (ix) both alleles contain guanine for rs1 1951438; is indicative of the presence of dementia with Lewy bodies in the subject.
- genotype that is indicative of dementia with Lewy bodies is genotype 1 , 2, 3, 4, 5 or 6 disclosed in table 9. In another particular embodiment, the genotype is 1 , 2 or 3 disclosed in table 9.
- genotype combinations have been found to be strongly associated with diminished b-syn expression levels in the cortex (see figure 6), and identify a subgroup of DLB patients characterized mainly by pure LB pathology without concominant AD.
- the subgroup of patients showing these characteristics have been previously defined as having "pure dementia with Lewy bodies" (pDLB).
- pDLB pure dementia with Lewy bodies
- the present invention provides a method as defined in the first aspect wherein the above genotypes identify a subgroup of patients that suffer from pDLB.
- the present invention thus provides for the early, diferential diagnosis of patients suffering from pDLB, distinguishing them from patients showing concominant AD, and also distinguishing them from patients suffering from another synucleinopathy such as PD.
- the present method includes determining the genotype of the indicated variations in the 5' regulatory region of SNCB as defined above, but also determining polymorphisms in linkage disequilibrium with said variations which would give the same information.
- "linkage disequilibrium" is the non-random association of alleles at two or more loci, not necessarily on the same chromosome.
- the analysis of DLB would be as follows: a patient with suspected onset of dementia and/or with a non-definitive clinical-familial evaluation would be diagnosed by a genetic test detecting the variations described above. If DLB specific genotypes are determined, no additional tests or trial will be needed to diagnose correctly DLB. Furthermore, since the present diagnosis may identify patients with pDLB (which express very low b-syn in the brain), a specific therapy which is effective for the treatment of this subgroup of patients may be recommended, while medical regimes that are indicated for AD, such as neuroleptics, may be excluded.
- the present diagnostic method may be carried out in any biological sample obtained from the patient.
- the method of the invention is applicable to any cell type of the body.
- the biological sample is selected from blood, plasma, saliva, urine, semen, cerebrospinal fluid and derivatives thereof.
- the direct application of genotyping represents an important reduction of economic costs in the daily clinical practice.
- Another aspect of the invention refers to a method for the diagnosis of DLB according to the first aspect that additionally comprises determining at least one other marker known as being indicative of dementia with Lewy bodies. Some embodiments of this aspect detect at least one of the above mentioned variations, in particular two, three, four, five or the six variations in addition to the at least one other marker known as being indicative of dementia with Lewy bodies. In some embodiments, at least the variable polyC is detected.
- the following variations are detected: (i) a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545, the variable polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by
- rs70991565 (iv) the short genetic variation defined by rs1 13812814 and, optionally, (v) the short genetic variation defined by rs1 1951438 in addition to the at least one other marker known as being indicative of dementia with
- any of the genotypes disclosed in table 9 is detected in addition to the other marker.
- the other marker to be detected is one of the polymorphic sites in BChE gene disclosed in EP2539461 .
- the other marker is the polymorphic site at position 68974 in BChE gene as defined by NCBI Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 12, which corresponds to SEQ ID NO: 28 of EP2539461 ).
- other variations in BChE gene are detected selected from the group consisting of the polymorphic sites at position 3687, 4206, 4443 and the poly-thymine region at positions 4780 to 4786 in NCBI Accession Number NG_009031 (i.e. positions 3687, 4206, 4443 and 4780-4786 respectively in SEQ ID NO: 13, which corresponds to SEQ ID NO: 1 of EP2539461 ).
- any technique may be used to detect the variations defined in the present invention.
- any genotyping technique may be used to determine the genotype for the variations defined above.
- the determination of the genotype is carried out by one of the techniques selected from the group consisting of primer-specific PCR followed by detection or sequencing, primer-specific PCR multiplex followed by detection or
- PCR polymerase chain reaction
- the PCR is the most widely used method for the in vitro amplification of nucleic acids.
- the PCR can be a real-time PCR, wherein the detection by labeled probes of the presence of the target genotypes is almost instantaneous to the amplification.
- the amplification of the target polymorphisms can be performed by primer- specific PCR multiplex with following detection by polyacrylamide
- ASPE Allele Specific Primer Extension
- detection may be carried out by DNA biochips/microarrays made with oligonucleotides deposited by any mechanism, with oligonucleotides synthesized in situ by photolithography or any other mechanism.
- microarray-based method that allow multiplex SNP genotyping in total human genomic DNA without the need for target amplification or complexity reduction can also be used for the genotyping of the variations.
- This direct SNP genotyping methodology requires no enzymes and relies on the high sensitivity of the gold nanoparticle probes. Specificity is derived from two sequential oligonucleotide hybridizations to the target by allele-specific surface-immobilized capture probes and gene-specific oligonucleotide- functionalized gold nanoparticle probes.
- the assay format is simple, rapid and robust pointing to its suitability for multiplex SNP profiling at the 'point of care'.
- DASH dynamic allele-specific hybridization
- the core reaction principal of DASH is real-time (dynamic) tracking of allele-specific differences in the process of DNA denaturation.
- an oligonucleotide probe is first hybridized to the target DNA, a necessary component of essentially all genotyping methods.
- the target DNA comprises one strand of a PCR product immobilized onto a solid surface, and a single probe is used that is
- a further aspect of the invention provides for the use of means for detecting variations in the nucleotide sequence which is located from position
- the means are for detecting the variations as defined above.
- the means are for determining the genotype for said variations.
- said means are for the in vitro diagnosis (identification) of pDLB.
- said means for detecting or determining the genotype of the variations comprise primers for amplification of sequence fragments containing the above variations, for example, those primers disclosed in the examples below.
- the means comprise at least one pair of primers selected from SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 and SEQ ID NO: 8 and SEQ ID NO: 9.
- the means comprise primers defined by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7.
- the means comprise primers defined by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
- the means comprise DNA hybridization probes for at least one of the above variations.
- the means comprise a microarray containing at least one DNA hybridization probe for at least one of the above variations.
- the means comprise a microarray containing DNA hybridization probes for all of the above variations.
- the above means form part of a kit.
- Said kit may comprise, in addition to the means for determining the genotype of the above variations, instructions for using said means.
- the kit provided by the present invention can be used in a routine clinical practice to diagnose DLB, in particular to identify patients suffering from pDLB, thus differentiating said patients from other patients that suffer from AD.
- the kit of the invention may be indicated for point-of-care utilization. With the kit of the invention the clinicians will be able to apply more individualized and risk-adapted treatment strategies to patients suffering from DLB.
- the above means included or not in a kit, may also be employed to detect the above variations for deciding or recommending to initiate a medical regime for the treatment of DLB in a patient.
- the present invention also provides the use of the variations in the 5' regulatory region of SNCB gene for the in vitro diagnosis of DLB.
- use is provided of at least one of the following variations: (i) a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , (ii) the short genetic variation defined by rs5873545, (iii) the short genetic variation defined by rs14721 1 109, (iv) the short genetic variation defined by rs70991565, (v) the short genetic variation defined by rs1 13812814, and (vi) the short genetic variation defined by rs1 1951438 for the in vitro diagnosis of DLB.
- Certain embodiments provide use of at least two, at least three, at least four at least five or the six variations.
- at least the variable polyC is used.
- the invention also provides at least one variation in SEQ ID NO: 14, or alternatively, at least one variation in SEQ ID NO: 15, or alternatively at least one variation in SEQ ID NO: 16, wherein SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 are comprised within SEQ ID NO: 1 , for use an in vitro diagnosis biomarker of dementia with Lewy bodies.
- the at least one variation in SEQ ID NO 14 is selected from: a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , and the short genetic variation defined by rs5873545;
- the at least one variation in SEQ ID NO 15 is selected from: the short genetic variation defined by rs14721 1 109, and the short genetic variation defined by rs1 13812814;
- the at least one variation in SEQ ID NO 16 is the short genetic variation defined by rs70991565.
- use of the following variations is provided: (i) a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545 and the variable polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by rs70991565, (iv) the short genetic variation defined by rs1 13812814 and, optionally, (v) the short genetic variation defined by rs1 1951438.
- use of any of the specific genotypes disclosed in table 9 is provided for the in vitro diagnosis of DLB.
- use of said variations or genotypes allows for identification a subgroup of patients that suffer from pDLB.
- the invention also contemplates use of at least one of the above variations, in particular two, three, four, five or the six variations in combination with at least one other marker known as being indicative of dementia with Lewy bodies.
- at least the variable polyC is used in combination with the other DLB marker.
- the other marker is one of the polymorphic sites in BChE gene disclosed in EP2539461 .
- the other marker is the polymorphic site at position 68974 in BChE gene as defined by NCBI Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 12, which corresponds to SEQ ID NO: 28 of EP2539461 ).
- the invention also provides, in another aspect, a method of deciding or recommending to initiate a medical regime for the treatment of DLB in a subject by detecting at least one variation in the 5' regulatory region of SNCB defined by SEQ ID NO: 1 .
- the variations providing the diagnosis of DLB are at least one, or at least two, or at least three, or at least four, or at least five or at least six of the variations as defined above. Also provided is the method of deciding or recommending to initiate a medical regime for the treatment of DLB in a subject which
- SEQ ID NO: 14 comprises detecting at least one variation in SEQ ID NO: 14, or alternatively, at least one variation in SEQ ID NO: 15, or alternatively at least one variation in SEQ ID NO: 16, wherein SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 are comprised within SEQ ID NO: 1 .
- the at least one variation in SEQ ID NO 14 is selected from: a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , and the short genetic variation defined by rs5873545;
- the at least one variation in SEQ ID NO 15 is selected from: the short genetic variation defined by rs14721 1 109, and the short genetic variation defined by rs1 13812814;
- the at least one variation in SEQ ID NO 16 is the short genetic variation defined by rs70991565.
- the following variations provide the diagnosis of DLB: (i) a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545 and the variable polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by rs70991565, (iv) the short genetic variation defined by rs1 13812814 and, optionally, (v) the short genetic variation defined by rs1 1951438.
- a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545 and the variable polyC together with the short genetic variation defined by rs5873545 (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by rs70991565, (iv) the short genetic variation defined by rs1 13812814 and, optionally, (
- determination of any of the genotypes disclosed in table 9 provides for the diagnosis of DLB.
- the method of deciding or recommending to initiate a medical regime for the treatment (a) if the subject is diagnosed of suffering from dementia with Lewy bodies, or of being suspicious of suffering from DLB, then the initiation of the medical regimen is recommended, while (b) if the subject is diagnosed of not suffering from dementia with Lewy bodies, the follow-up is performed optionally in
- the DLB is pDLB.
- this patient may be recommended to follow a medical regime for treatment of pDLB, in particular, a medical regime that is appropriate for patients that have decreased b-syn expression in the brain.
- the clinician may preferably recommend that this patient showing pDLB shall not follow a treatment designed for AD, in particular, treatment with
- narcoleptics shall not be recommended.
- PDND Parkinson disease without dementia
- PDD Parkinson disease with dementia
- Samples from these patients were obtained post mortem and classified according to their clinical history into patients with AD (without Lewy bodies), pDLB, cDLB and PD.
- PD patients were sometimes studied as two separate groups, PD patients without dementia (PDND) and PD patients showing dementia (PDD).
- Control samples were obtained from subjects that did not suffer any of the above conditions, in particular control subjects did not show any neurological symptomatology or movement disorder.
- a variable length polyC sequence in combination with the presence or absence of a hexa-nucleotide insertion was detected up-stream to the transcription start of the SNCB gene, within intron 3 of human EIF4E1 B in Chromosome 5.
- the polyC sequence starts at position 13198 of SEQ ID NO: 1 (which is the sequence for the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5). If present, the hexa-nucleotide insertion rs5873545 interrupts the polyC-sequence three citosines before ending ( Figure 1 ).
- the insertion preceding polyC stretch varied in length comprising between 10 and 12 cytosines.
- the polyC sequence was between 14 and 16 nucleotides in length.
- the polyC sequence was characterized by an increased variability and was constituted by up to 18 cytosines. Overall, 18 different genotypes were found. Genotype frequencies of the polyC polymorphism for each group of patients are shown in Table 2. Most frequent genotypes were polyC1 1 .15 with a frequency of 30.1 %, polyC1 1 .1 1 with a frequency of 21 .5% and polyC1 1 .16 with a frequency of 1 1 .8%.
- genotypes Due to the wide genotype variability we grouped the genotypes into two groups, short polyC-allele containing genotypes (polyC10.1 1 , 1 1 .1 1 , 1 1 .12, 10.15, 10.16, 1 1 .14, 1 1 .15, 1 1 .16, 12.14, 12.16, 12.17, 15.15, 15.16 and 16.16) and long polyC-allele containing genotypes (polyC16.17, 17.17, 17.18 and 18.18).
- Genotype frequencies of the insertion for AD patients, DLB patients and PD patients are summarized in the Table 4 below.
- the most frequent genotype was the heterozygote form (IW) with a frequency of 52.2%
- the least frequent genotype was the wild type homozygote (WW) with a frequency of 18.9%.
- WW wild type homozygote
- PCR products were diluted 1 :10 with formamide, mixed with Rox350 (Applied Biosystems) as size ladder and heat denatured.
- rs147211109 tetra-nucleotide repeat (GTTT) 7 with the possible deletion of one or more (GTTT)
- the wild type allele contained 7 repeats of the tetra-nucleotide GTTT, allele A presented deletion of one GTTT, and allele X deletion of three GTTT.
- Table 5 represents genotype frequencies in the different disease groups and controls, where genotypes are given as BB and allele-A carriers, A+: Table 5. Genotype frequencies for rs14721 1 109
- a significant accumulation of A-allele containing genotypes (AB and AA) was observed in DLB. In contrast, no significant accumulation of any genotype was observed for AD and PD.
- E_int1_3L used for fragment amplification are shown in figure 3.
- Three alleles were identified for rs70991565.
- the wild type allele (B-allele) contained 13 thymines (underlined in Figure 3) , allele A presented 12 thymines, and allele X 1 1 thymines.
- Allele B was represented by a PCR product of 139 bp of length, allele A by a fragment of 138 and allele X of 137 bp of length.
- the X-allele was present in AD and controls, but absent in synucleinopathies.
- Table 6 represents genotype frequencies in the different disease groups and controls, where genotypes are given as XA, AA and B- allele carriers (B+). Table 6. Genotype frequencies for rs70991565
- the PCR reaction contained 66% of DMSO to achieve needed specificity and a 36-cycle program included 45 seconds of denaturation at 95°C, 40 seconds of annealing at 60°C and 1 minute of extension at 72°C.
- the presence of the 551 bp PCR-product was checked by agarose-gel electrophoresis and initially, the SNPs were detected by cycle sequencing (see above) with the BigDye Terminator version (BDv) 1 .1 Cycle Sequencing Kit (Applied Biosystems) using primer SNCBproml L. 3.2 Restriction enzyme digestion
- the 551 bp fragment was digested with BseRI (NewEngland Biolabs) to determine rs1 13812814 alleles and with Ecil to determine rs1 1951438 alleles.
- rs113812814 Whereas two fragments of 244 and 307 bp were observed in the case of the T-allele, the full-length PCR fragment with no enzyme digestion indicated the presence of the C-allele. All three fragments (244, 307 and 551 bp) were present in the case of the CT genotype.
- the C allele was represented by the undigested 551 -bp fragment and the T allele by two fragments of 204 and 351 bp, respectively. In the case of the CT genotype, three fragments (204, 351 and 551 bp) were observed.
- 3.3 rs113812814 Genotype distribution in disease The distribution of the three genotypes of this SNP in the control group were: CC 6.2%, CT 65.7% and TT 28.1 %, being the C-allele the most frequent. Whereas genotype distribution did not differ significantly between AD, PD and controls an important overrepresentation of CC-genotype carriers was detected in the group of DLB patients (Table 7).
- the distribution of the three genotypes of this SNP in the control group were: CC 46.9%, CT 50% and TT 3.1 %, being the C-allele the most frequent .
- L allele containing at least 17 consecutive cytosines
- S allele containing less than 17 consecutive cytosines
- genotypes 1 -3 provide the best diagnosis information, followed by genotypes 4-6.
- CLAUSES 1 An in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in the nucleotide sequence which is located from position
- the poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 comprises from 17 to 22 cytosines in at least one of the alleles or
- At least one of the alleles contains an insert TCCCCG for rs5873545,
- both alleles show the deletion of a tyrosine residue T for rs70991565, and (iv) both alleles contain guanine for rs1 13812814; or, alternatively, this other genotype:
- the poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 comprises from 17 to 22 cytosines in at least one of the alleles or
- At least one of the alleles contains an insert TCCCCG for rs5873545,
- At least one of the alleles shows the deletion of four contiguous nucleotidesTTTG for s14721 1 109,
- both alleles show the deletion of a tyrosine residue for rs70991565
- one allele contains guanine and the other allele contains adenine for rs1 13812814
- both alleles contain guanine for rs1 1951438. is indicative of the presence of dementia with Lewy bodies in the subject. 6.
- the method according to any of the claims 1 -5 that additionally comprises determining at least one other marker known as being indicative of dementia with Lewy bodies.
- the means comprise at least one pair of primers selected from SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and SEQ ID NO: 8 and SEQ ID NO: 9.
- a method of deciding or recommending to initiate a medical regime for the treatment of dementia with Lewy bodies in a subject comprises diagnosing dementia with Lewy bodies or determining whether the subject is suspicious of suffering dementia with Lewy bodies by the method as defined in any of the claims 1 -6, wherein a) if the subject is diagnosed of suffering from dementia with Lewy bodies, or of being suspicious of suffering from DLB, then the initiation of the medical regimen is recommended, and b) if the subject is diagnosed of not suffering from dementia with Lewy bodies, the follow-up is performed optionally in consideration of the result of an examination of the patient by a physician.
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 14, or alternatively at least one variation in SEQ ID NO: 15, or alternatively at least one variation in SEQ ID NO: 16, wherein SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 are comprised within position 175.989.261 to position 176.003.107 in Homo sapiens chromosome 5 according to HapMap data release 28 (SEQ ID NO: 1). The invention also provides means for detecting the above variations and a method for recommending to initiate a medical regime for the treatment of DLB in a subject based on detecting the above variations. In particular, the provided method is for the in vitro diagnosis of pure dementia with Lewy bodies.
Description
Diagnosis of dementia with Lewy bodies
The present invention relates to the field of medicine, and particularly to neurodegenerative disorders. It specifically relates to markers for the diagnosis of dementia with Lewy bodies.
BACKGROUND ART
Lewy body diseases comprise a group of disorders characterized by the presence of proteinaceous neuronal inclusions called Lewy bodies (LB). Lewy body diseases include Parkinson's disease (PD) and dementia with Lewy bodies (DLB), and the latter can be characterized by Lewy body pathology alone in its pure form (pure dementia with Lewy body, pDLB), or by the mixture of Lewy bodies and concomitant Alzheimer's disease pathology that constitutes a common variant of dementia with Lewy bodies (cDLB) (Braak and Braak, "Diagnostic criteria for neuropathological assessment of
Alzheimer's disease", Neurobiol Aging 1997, vol. 18, p. 85). Whereas PD is the most common progressive movement disorder in the elderly, DLB is the second most frequent cause of dementia after Alzheimer disease (AD). While widespread distribution of LB in virtually every brain area is a typical feature of DLB, the substancia nigra is the most affected in PD.
When first described, DLB was thought to be an infrequent disorder, but over the last years intense investigation has revealed that it accounts for 10-15% of autopsied cases. Main DLB symptoms include fluctuating cognitive impairment, recurrent visual hallucinations and Parkinsonism, but
nevertheless, many AD overlapping symptoms lead to a frequent
misdiagnosis of DLB. Since AD and DLB patients may differ in terms of response to medication and prognosis, it is important to improve accuracy in diagnosing DLB.
To achieve a better clinical distinction between DLB and AD, various longitudinal and comparative studies have been carried out during the last years. Patients with only Lewy body (LB) pathology show relatively less severe impairments but more pronounced deterioration of executive function and attention than patients with only AD or mixed AD/LB pathology.
Moreover, DLB patients exhibit a slower decline of recognition memory but
have more psychiatric symptoms than patients with AD, where this kind of symptomathology is observed at later disease stages. Finally, the presence of visual hallucinations in early-stage dementia has been shown to be most specific for DLB. It is noteworthy to mention that although a high specificity (ranging from 90 to 99% in different studies) of clinical diagnosis is achieved, its sensitivity remains relatively low (18-83%). Accordingly, the first
consensus guidelines established in 1996 for the clinical diagnosis of probable and possible DLB have been revised to improve the sensitivity for DLB diagnosis, but nevertheless, many AD overlapping symptoms lead to a frequent misdiagnosis of DLB between 40-80% of the cases.
The main cause of low diagnostic sensitivity for DLB comes from the elevated percentage of cases that show, in addition to LB, related pathology AD characteristic changes in the brain. To assess this type of combined pathology, the third DLB consortium proposed a model to place AD-related pathology into the context of LB pathology. The higher the stage of AD-type pathology the lower is the sensitivity to achieve a correct diagnosis of DLB. Accordingly, a recent report confirmed that the misdiagnosis of DLB increases with increasing AD associated pathology, but even so, only around 52% of patients had received the correct diagnosis of DLB at low AD-pathology stages.
At the moment AD treatment consists of using cholinesterase inhibitors to improve the effectiveness of acetylcholine either by increasing the levels in the brain or by strengthening the way nerve cells to respond to it. Moreover, neuroleptic drugs are used to diminish psychotic symptoms normally present during the disease course. On the contrary, for treating DLB the use of neuroleptics may cause adverse reaction in about 50% of DLB patients, sometimes causing irreversible damages and even death. Therefore, administering neuroleptic drugs to patients suffering from DLB should be avoided.
It follows from the above that the ability to diferentially diagnose between AD and DLB would be a major advantage not only for the individual patient being treated, but also with respect to the economic strain upon the public health systems. Naturally, it would be convenient to be able to perform said
diferential diagnosis pre-mortem and preferably early enough for the recommendable treatment to be effective.
The usual practice for pre-mortem diagnosis of DLB is based on clinical evaluation of symptoms and traits, following the guidelines established by the Consortium on DLB International Workshop (I.G. McKeith, "Consensus guidelines for the clinical and pathologic diagnosis of dementia with Lewy bodies (DLB): report of the Consortium on DLB International Workshop", J. Alzheimer's Dis. 2006, vol. 9, pp. 417-23), but as explained above, it leads to a substancial rate of misdiagnosis of DLB. Image methods like positron tomography (PET) and single photon emission computer tomography
(SPECT) are available, but their sensitivity is not very high and they are very expensive for a routine clinical use. An early unequivocal diagnosis of DLB would avoid the severe adverse effects suffered by administration of neuroleptics to patients suffering from DLB and provide a therapeutic margin to reduce or stop the disease progression.
There have been some attempts in trying to find genetic markers to precisely identify DLB. In this sense, some proteins and genes studied in order to find a relationship with DLB are alpha-7 nicotinic acetylcholine receptor subunit, osteopontin, nitric oxide synthase, ubiquitin carboxy-terminal hydrolase L1 gene or BDNF gene. Many of them have been studied in brain samples at an experimental level but they are not useful in real clinical diagnosis because of the difficulties to obtain a patient brain biopsy.
Patent EP2539461 discloses that specific variations in Butyrylcholinesterase (BChE) gene are related to DLB. This discovery allows for the diagnosis of patients suffering from DLB by determining the genotype of particular variations in BChE gene in a blood sample. While being a substancial improvement for this field, the disclosed diagnosis may not identify all DLB patients. Recent results have, indeed, shown that this method identifies only around 10% of DLB patients, so that there is still a substantial proportion of DLB patients that are not diagnosed. The treatment of DLB is symptomatic and is based on a limited number of clinical trials and extension of results from trials in AD. Recently, a different molecular subgroup of DLB patients has been identified that show pure LB
pathology, a short disease duration and no concomitant AD pathology (Beyer et al, Brain 2010, vol 133, p. 3724). This molecular subgroup is also characterised by the lack or drastically diminished beta-synuclein (b-syn) expression in the brain. Since the drastic and specific b-synuclein decrease detected in this subgroup could be implicated in disease development by modulating alpha-synuclein properties, this discovery provides an interesting therapeutic target that may lead to the development of a new treatment for DLB. However, early diagnosis of this particular subgroup is not available, since b-syn expression may only be determined by analysing brain samples post-mortem.
Therefore, there is still a need to provide means for an early and accurate identification of patients suffering from DLB to be used in the common clinical practice.
SUMMARY OF THE INVENTION
The present inventors have found that variations in the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 according to GRCh38.p2 (Genome Reference
Consortium Human Build 38 patch release 2 from NCBI) (SEQ ID NO: 1 ) are related to the presence of DLB in a subject. The detection of variations in this gene provides for a reliable and early diagnosis of DLB to be used in the common clinical practice. According to HapMap data release 28, SEQ ID NO: 1 is located from position 175.989.261 to position 176.003.107.
Thus, in a first aspect, the invention provides an in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 (SEQ ID NO: 1 ).
Another aspect provides for the use of at least one variation in SEQ ID NO: 1 for the in vitro diagnosis of dementia with Lewy bodies.
The present diagnostic method allows to identify DLB patients with specificity above 95%. Further, around 30-40% of all DLB cases are identified. The
present diagnosis method may identify patients with DLB that cannot be found by using the diagnosis method which is based on determining variations in BChE gene (EP2539461 ). However, use of the present biomarker in combination with the biomarker disclosed in EP2539461 would identify between 40-60% of all DLB patients.
Thus, the invention also contemplates an in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 1 and additionally detecting at least one other marker known as being indicative of dementia with Lewy bodies. Also contemplated is the use of at least one variation in SEQ ID NO: 1 for the in vitro diagnosis of dementia with Lewy bodies in combination with at least one other marker known as being indicative of dementia with Lewy bodies.
Advantageously, the variations in SEQ ID NO: 1 identify a molecular subgroup of DLB patients with particular physiopathological characteristics, namely, patients that have diminished b-syn expression levels in the cortex and pure LB pathology without concominant AD. This molecular subgroup is herein named as patients suffering from "pure dementia with Lewy bodies" (pDLB) and has been defined previously in Beyer et al (supra), which document is herein incorporated by reference. The present invention thus provides for the early, diferential diagnosis of patients suffering from pDLB, distinguishing them from patients showing concominant AD, and also distinguishing them from patients suffering from another synucleinopathy such as PD. These patients are impossible to be identified pre-mortem within the known clinical practice. The sensitivity and specificity for the particular subgroup of patients with pDLB is very high, above 95%. It is noted that the drastic and specific b-syn decrease detected in this subgroup could be implicated in disease development by modulating alpha- synuclein properties, and is thus an interesting therapeutic target that may lead to the development of a new treatment for DLB. If such a new treatment becomes available, accurate identification of this particular subgroup of patients will be of great importance to the medical community in terms of recommending the most effective treatment regime. Also, importantly, identification of patients having pure LB pathology without concominant AD
will avoid that these patients are subjected to non-effective or even harmful medical regimes. In particular, by use of the present diagnosis method the clinician may exclude therapy with neuroleptics, which is the most adequate treatment for psychotic symptoms in AD but often cause severe adverse reactions in DLB patients. Therefore, by applying the method of the invention, patients will benefit not only from the possibility of receiving an effective treatment, but also because they will be exempted from being subjected to non-effective or potentially harmful treatments. Another aspect of the invention thus provides a method of deciding or recommending to initiate a medical regime for the treatment of dementia with Lewy bodies in a subject, which method comprises diagnosing dementia with Lewy bodies or determining whether the subject is suspicious of suffering dementia with Lewy bodies according to the method of the first aspect of the invention, wherein a) if the subject is diagnosed of suffering from dementia with Lewy bodies, or of being suspicious of suffering from DLB, then the initiation of the medical regimen is recommended, and b) if the subject is diagnosed of not suffering from dementia with Lewy bodies, the follow-up is performed optionally in consideration of the result of an examination of the patient by a physician.
The present method has the advantage that the most appropriate medical regime will be recommended to the patient, for instance, a medical regime that is effective of the treatment of pure DLB, without concomitant Alzheimer's disease pathology and with lack, or substantial decrease, of beta-synuclein expression in the brain. Another important advantage is that a medical regime for the treatment of AD, in particular, narcoleptic drugs, may be ruled out for the patient being diagnosed of pDLB. The invention is also directed to the use of means for detecting one or more variations in SEQ ID NO: 1 in a biological sample from a subject for the in vitro diagnosis of dementia with Lewy bodies. Said means may be included in a kit for the diagnosis of DLB. BRIEF DESCRIPTION OF THE DRAWINGS
FIG. 1 . (A) Fragment containing polyC stretch (underlined). At†, insertion of TCCCCG (rs5873545) may occur. In bold are the regions for annealing of primers EIFex3/4-U and EIFex3/4-L used for fragment amplification. PolyC stretch (underlined). At†, insertion of TCCCCG (rs5873545) may occur. (B) Short polyC strech in presence of the 6-nucleotide insertion (insertion underlined). (C) Long polyC strech without the 6-nucleotide insertion.
FIG. 2. Fragment containing rs14721 1 109 (underlined). In bold are the regions for annealing of primers 1 E_int1_2U and 1 E_int1_2L used for fragment amplification.
FIG. 3. Fragment containing rs70991565 (underlined). In bold are the regions for annealing of primers 1 E_int1_3U and 1 E_int1_3L used for fragment amplification.
FIG. 4. Fragment containing rs1 13812814 and rs1 1951438 (underlined). In bold are the regions for annealing of primers SNCBmet2U and SNCBproml L.
FIG. 5. Scheme of the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 (SEQ ID NO: 1 ) including EIF4E1 B exons 1 -4 and SNCB exons 1 and 2, indicating polymorphisms polyC, rs5873545, rs14721 1 109, rs70991565, rs1 13812814 and rs1 1951438. FIG. 6. Distribution of the genetic biomarker in pDLB, cDLB, PDND, PDD, AD and controls. 67% of pDLB cases presented one of the seven genotype combinations.
DETAILED DESCRIPTION OF THE INVENTION
The present invention is directed to the early, diferential diagnosis of DLB by detecting variations in SEQ ID NO: 1 . This nucleotide sequence, defined by SEQ ID NO: 1 , coincides with the 5' regulatory region of SNCB gene. The invention also contemplates a method for diagnosis DLB which comprises detecting variations in the 5' regulatory region of SNCB gene. Preferrably, the 5' regulatory region of SNCB gene is the 5' regulatory region of human SNCB gene. By "regulatory region of SNCB gene" it is understood a segment of the
human genome which is capable of increasing or decreasing the expression of SNCB.
Human SNCB (beta-synuclein gene, herein also called b-syn, NCBI Gene ID: NG_012131 .1 , updated 04-MAY-2014) is located in chromosome 5 (NCBI Reference Sequence GRCh38.p2: NC_000005.10, updated 12-MAR-2015, SEQ ID NO: 1 ). The 5' regulatory region of SNCB defined by SEQ ID NO: 1 includes EIF4E1 B exons 1 -4 and SNCB exons 1 and 2. The human EIF4E1 B gene (NCBI Gene ID: 253314, updated on 4-Apr-2015) is located upstream the SNCB gene transcription start.
In the sense of this description, "variation in a nuleotide sequence" means any variability (or polymorphism) in said nucleotide sequence. Examples of variations can include a single nucleotide polymorphism, a deletion, an insertion, a substitution or a duplication of one or more nucleotides, and a chemical modification on a nucleotide (e.g. methylation). Said variations usually imply only one or a few nucleotides of the genetic sequence and are thus herein termed in general as "short genetic variations". In particular, if at least one of the following variations is detected: (i) a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , (ii) the short genetic variation defined by rs5873545, (iii) the short genetic variation defined by rs14721 1 109, (iv) the short genetic variation defined by rs70991565, (v) the short genetic variation defined by rs1 13812814, and (vi) the short genetic variation defined by rs1 1951438, this is indicative of the presence of DLB in the subject.
The poly-citosine sequence starting at position 13,198 of SEQ ID NO: 1 that forms part of the present biomarker has not been previously described. This poly-citosine sequence is herein also referred as "polyC" and is located in intron 3 of EIF4E1 B gene, i.e. starting at position 176.642.852 of human chromosome 5. The present inventors have observed for the first time variations on the length of this sequence and their relation to DLB. In particular, it was found that longer polyC sequences (at least 17 bp, in particular from 17 to 25 bp, more particularly from 17 to 22 bp, more particularly 17, 18, 19, 20 or 21 ) are indicative of DLB in the subject (see example 1 ).
The other variations defined above have been previously described and may be found in open databases, such as dbSNP from NCBI. However, their relation to DLB is disclosed here for the first time. These short genetic variations are identified by a reference number ("rs") which enables their unequivocal identification. A map of the genetic variations that form part of the biomarker of the invention is provided in figure 5. rs5873545 is a TCCCCG deletion/insertion variation (-/TCCCCG) found within the polyC sequence (see figure 1 ). The TCCCCG sequence is identified as SEQ ID NO: 10. rs14721 1 109 is a TTTG deletion/insertion variation (-/TTTG) found in EIF4E1 B intron 1 . The TTTG sequence is identified as SEQ ID NO: 1 1 . rs70991565 is a T deletion/insertion variation (- FT) also found in EIF4E1 B intron 1 . rs1 13812814 is a single nucleotide variation (G/A) found within exon 1 of SNCB. rs1 1951438 is a single nucleotide variation (G/A) also found within exon 1 of SNCB. All sequences described in the present application are given in the 5' - 3' direction.
By "detecting the variation" in this description it is meant to detect, by any means, whether a particular genetic variation is present in the genome of the subject being tested.
The in vitro method for the diagnosis of dementia with Lewy bodies may comprise detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 14 (Figure 1 A), which corresponds to nucleotides
12908 to 13807 of SEQ ID NO: 1 . The polyC and rs5873545 are located within SEQ ID NO: 14. In one embodiment of the method of the invention, if at least one variation selected from a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 and the short genetic variation defined by rs5873545 is detected this is indicative of the presence of DLB in the subject.
The in vitro method for the diagnosis of dementia with Lewy bodies may also comprise detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 15, which corresponds to nucleotides 383 to 3787 of SEQ ID NO: 1 (see figures 2 and 4). The SNPs rs14721 1 109, rs 1 13812814 and rs1 1951438 are located within SEQ ID NO: 15. In one embodiment of the method of the invention, if at least one variation selected from rs14721 1 109
and rs 1 13812814 is detected this is indicative of the presence of DLB in the subject.
The in vitro method for the diagnosis of dementia with Lewy bodies may also comprise detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 16, which corresponds to nucleotides 4868 to 5167 of SEQ ID NO: 1 (figure 3). The SNPs rs70991565 is located within SEQ ID NO: 16. In one embodiment of the method of the invention, if at least variation rs70991565 is detected this is indicative of the presence of DLB in the subject.
In another embodiment, the method of the invention further comprises determining variation rs1 1951438. In some embodiments of the present method, at least two of the above variations (i)-(vi) are detected. In other embodiments, at least three, at least four, at least five or the six variations above are detected. In other
embodiments, at least the polyC and/or rs5873545 and at least one additional variation selected from rs14721 1 109, rs70991565, and rs1 13812814 are detected. In another embodiment, at least the variable polyC is detected. In other embodiments, in addition to the polyC, at least one further variation selected from rs14721 1 109, rs70991565, and rs1 13812814 are detected. In a further embodiment, the variations (i)-(v) as defined above are detected. In a further embodiment, if the following variations are detected: (i) a variation selected from the group consisting of: the polyC, the short genetic variation defined by rs5873545, and the polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by rs70991565, and (iv) the short genetic variation defined by rs1 13812814; they are indicative of the presence of dementia with Lewy bodies in the subject. In another further embodiment, the method further comprises detecting the short genetic variation defined by rs1 1951438 to be indicative of DLB. Some specific genotype combinations for the variations defined above have been found to identify patients that suffer from DLB with particularly high sensitivity and specificity. By "determining the genotype" in this description it
is meant identifying the nucleotide(s) for a given variation. The specific genotypes that provide a diagnosis of DLB are shown in table 9. Accordingly, one embodiment provides a method for the in vitro diagnosis of DLB according to the the invention, wherein the following genotype:
(i) the polyC comprises from 17 to 22 cytosines in at least one of the alleles or, alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545, (ii) at least one of the alleles shows the deletion of four contiguous nucleotides TTTG for s14721 1 109, (iii) both alleles show the deletion of a tyrosine residue T for rs70991565, and (iv) both alleles contain guanine for rs1 13812814; or, alternatively, this other genotype:
(v) the polyC comprises from 17 to 22 cytosines in at least one of the alleles or, alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545, (vi) at least one of the alleles shows the deletion of four contiguous nucleotides TTTG for s14721 1 109, (vii) both alleles show the deletion of a tyrosine residue for rs70991565, (viii) one allele contains guanine and the other allele contains adenine for rs1 13812814, and (ix) both alleles contain guanine for rs1 1951438; is indicative of the presence of dementia with Lewy bodies in the subject.
In one particular embodiment the genotype that is indicative of dementia with Lewy bodies is genotype 1 , 2, 3, 4, 5 or 6 disclosed in table 9. In another particular embodiment, the genotype is 1 , 2 or 3 disclosed in table 9.
Moreover, the above genotype combinations have been found to be strongly associated with diminished b-syn expression levels in the cortex (see figure 6), and identify a subgroup of DLB patients characterized mainly by pure LB pathology without concominant AD. As mentioned above, the subgroup of patients showing these characteristics have been previously defined as having "pure dementia with Lewy bodies" (pDLB). This term as used herein defines a subgroup of DLB patients without concomitant AD pathology and decreased b-syn expression in the brain. Therefore, in particular
embodiments the present invention provides a method as defined in the first aspect wherein the above genotypes identify a subgroup of patients that suffer from pDLB. As mentioned above, the present invention thus provides for the early, diferential diagnosis of patients suffering from pDLB,
distinguishing them from patients showing concominant AD, and also distinguishing them from patients suffering from another synucleinopathy such as PD. According to the invention, the present method includes determining the genotype of the indicated variations in the 5' regulatory region of SNCB as defined above, but also determining polymorphisms in linkage disequilibrium with said variations which would give the same information. In population genetics, "linkage disequilibrium" is the non-random association of alleles at two or more loci, not necessarily on the same chromosome.
In accordance with the diagnostic method of the present invention, the analysis of DLB would be as follows: a patient with suspected onset of dementia and/or with a non-definitive clinical-familial evaluation would be diagnosed by a genetic test detecting the variations described above. If DLB specific genotypes are determined, no additional tests or trial will be needed to diagnose correctly DLB. Furthermore, since the present diagnosis may identify patients with pDLB (which express very low b-syn in the brain), a specific therapy which is effective for the treatment of this subgroup of patients may be recommended, while medical regimes that are indicated for AD, such as neuroleptics, may be excluded.
Advantageously, the present diagnostic method may be carried out in any biological sample obtained from the patient. Being a genetic test, the method of the invention is applicable to any cell type of the body. Thus, there is no need to provide a brain sample and may be performed pre-mortem to provide an early diagnosis of the disease. In particular embodiments the biological sample is selected from blood, plasma, saliva, urine, semen, cerebrospinal fluid and derivatives thereof. Also, the direct application of genotyping represents an important reduction of economic costs in the daily clinical practice.
Another aspect of the invention refers to a method for the diagnosis of DLB according to the first aspect that additionally comprises determining at least one other marker known as being indicative of dementia with Lewy bodies. Some embodiments of this aspect detect at least one of the above mentioned variations, in particular two, three, four, five or the six variations in addition to
the at least one other marker known as being indicative of dementia with Lewy bodies. In some embodiments, at least the variable polyC is detected. In other embodiments of this aspect the following variations are detected: (i) a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545, the variable polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by
rs70991565, (iv) the short genetic variation defined by rs1 13812814 and, optionally, (v) the short genetic variation defined by rs1 1951438 in addition to the at least one other marker known as being indicative of dementia with
Lewy bodies. In other particular embodiments, any of the genotypes disclosed in table 9 is detected in addition to the other marker.
In particular embodiments, the other marker to be detected is one of the polymorphic sites in BChE gene disclosed in EP2539461 . In another particular embodiment, the other marker is the polymorphic site at position 68974 in BChE gene as defined by NCBI Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 12, which corresponds to SEQ ID NO: 28 of EP2539461 ). In other particular embodiments, in addition to the polymorphic site at position 68974 in BChE gene, other variations in BChE gene are detected selected from the group consisting of the polymorphic sites at position 3687, 4206, 4443 and the poly-thymine region at positions 4780 to 4786 in NCBI Accession Number NG_009031 (i.e. positions 3687, 4206, 4443 and 4780-4786 respectively in SEQ ID NO: 13, which corresponds to SEQ ID NO: 1 of EP2539461 ).
Any technique may be used to detect the variations defined in the present invention. In particular, any genotyping technique may be used to determine the genotype for the variations defined above. In one embodiment, the determination of the genotype is carried out by one of the techniques selected from the group consisting of primer-specific PCR followed by detection or sequencing, primer-specific PCR multiplex followed by detection or
sequencing, multiplex allele specific primer extension, an DNA hybridization microarray-based method, dynamic allele-specific hybridization, and DNA fragmentation followed by amplification and sequencing. In a particular embodiment, it is carried out by primer-specific PCR followed by detection.
The polymerase chain reaction (PCR) is the most widely used method for the in vitro amplification of nucleic acids. The PCR can be a real-time PCR, wherein the detection by labeled probes of the presence of the target genotypes is almost instantaneous to the amplification.
The amplification of the target polymorphisms can be performed by primer- specific PCR multiplex with following detection by polyacrylamide
electrophoresis or by analysis with a genetic analyzer. Alternatively, various PCR reactions can be performed followed by agarose gel electrophoresis or by sequencing.
Determination of the genotype can be performed by Allele Specific Primer Extension (ASPE). This is a sequence specific enzymatic reaction technology that can be used to assay multiple SNPs in a single tube. The ASPE method involves two phases, an enzymatic reaction that determines the target genotype followed by a capture on solid microsphere surface for detection. Taking advantage of the solution phase kinetics, this technique allows sequence labeled microspheres to be used for detecting new templates. This is done with the help of an appropriate capture sequence attached to the allele specific oligonucleotide.
Optionally, detection may be carried out by DNA biochips/microarrays made with oligonucleotides deposited by any mechanism, with oligonucleotides synthesized in situ by photolithography or any other mechanism. A
microarray-based method that allow multiplex SNP genotyping in total human genomic DNA without the need for target amplification or complexity reduction can also be used for the genotyping of the variations. This direct SNP genotyping methodology requires no enzymes and relies on the high sensitivity of the gold nanoparticle probes. Specificity is derived from two sequential oligonucleotide hybridizations to the target by allele-specific surface-immobilized capture probes and gene-specific oligonucleotide- functionalized gold nanoparticle probes. The assay format is simple, rapid and robust pointing to its suitability for multiplex SNP profiling at the 'point of care'.
Furthermore, determination of the genotype can be performed by dynamic allele-specific hybridization (DASH), which represents the basis for
throughput SNP genotyping in some laboratories. The core reaction principal of DASH is real-time (dynamic) tracking of allele-specific differences in the process of DNA denaturation. To achieve this, an oligonucleotide probe is first hybridized to the target DNA, a necessary component of essentially all genotyping methods. The target DNA comprises one strand of a PCR product immobilized onto a solid surface, and a single probe is used that is
complementary to one of the target alleles. This assay concept was shown to be very precise (>99.9% accurate). A further aspect of the invention provides for the use of means for detecting variations in the nucleotide sequence which is located from position
176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 in a biological sample from a subject for the in vitro diagnosis of DLB. In particular embodiments the means are for detecting the variations as defined above. In other particular embodiments, the means are for determining the genotype for said variations. In other particular embodiments said means are for the in vitro diagnosis (identification) of pDLB.
In particular embodiments said means for detecting or determining the genotype of the variations comprise primers for amplification of sequence fragments containing the above variations, for example, those primers disclosed in the examples below. Thus in one embodiment, the means comprise at least one pair of primers selected from SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7 and SEQ ID NO: 8 and SEQ ID NO: 9. In another embodiment the means comprise primers defined by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7. In another embodiment the means comprise primers defined by SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8 and SEQ ID NO: 9.
In other embodiments the means comprise DNA hybridization probes for at least one of the above variations. In particular embodiments the means comprise a microarray containing at least one DNA hybridization probe for at least one of the above variations. In other particular embodiments the means comprise a microarray containing DNA hybridization probes for all of the above variations.
In further embodiments the above means form part of a kit. Said kit may comprise, in addition to the means for determining the genotype of the above variations, instructions for using said means. The kit provided by the present invention can be used in a routine clinical practice to diagnose DLB, in particular to identify patients suffering from pDLB, thus differentiating said patients from other patients that suffer from AD. The kit of the invention may be indicated for point-of-care utilization. With the kit of the invention the clinicians will be able to apply more individualized and risk-adapted treatment strategies to patients suffering from DLB.
As will be evident for the skilled person, the above means, included or not in a kit, may also be employed to detect the above variations for deciding or recommending to initiate a medical regime for the treatment of DLB in a patient.
The present invention also provides the use of the variations in the 5' regulatory region of SNCB gene for the in vitro diagnosis of DLB. In some embodiments, use is provided of at least one of the following variations: (i) a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , (ii) the short genetic variation defined by rs5873545, (iii) the short genetic variation defined by rs14721 1 109, (iv) the short genetic variation defined by rs70991565, (v) the short genetic variation defined by rs1 13812814, and (vi) the short genetic variation defined by rs1 1951438 for the in vitro diagnosis of DLB. Certain embodiments provide use of at least two, at least three, at least four at least five or the six variations. In particular embodiments, at least the variable polyC is used.
The invention also provides at least one variation in SEQ ID NO: 14, or alternatively, at least one variation in SEQ ID NO: 15, or alternatively at least one variation in SEQ ID NO: 16, wherein SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 are comprised within SEQ ID NO: 1 , for use an in vitro diagnosis biomarker of dementia with Lewy bodies. In particular, the at least one variation in SEQ ID NO 14 is selected from: a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , and the short genetic variation defined by rs5873545; the at least one variation in SEQ ID NO 15 is selected from: the short genetic variation defined by rs14721 1 109, and the
short genetic variation defined by rs1 13812814; and the at least one variation in SEQ ID NO 16 is the short genetic variation defined by rs70991565.
In other particular embodiments, use of the following variations is provided: (i) a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545 and the variable polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by rs70991565, (iv) the short genetic variation defined by rs1 13812814 and, optionally, (v) the short genetic variation defined by rs1 1951438. In particular embodiments, use of any of the specific genotypes disclosed in table 9 is provided for the in vitro diagnosis of DLB. Advantageously, use of said variations or genotypes allows for identification a subgroup of patients that suffer from pDLB.
The invention also contemplates use of at least one of the above variations, in particular two, three, four, five or the six variations in combination with at least one other marker known as being indicative of dementia with Lewy bodies. In some embodiments, at least the variable polyC is used in combination with the other DLB marker. In other embodiments use of the following variations: (i) a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545, the variable polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by rs70991565, (iv) the short genetic variation defined by rs1 13812814 and, optionally, (v) the short genetic variation defined by rs1 1951438 is provided for diagnosing of DLB in combination with at least one other marker known as being indicative of dementia with Lewy bodies. In particular embodiments, use of any of the genotypes disclosed in table 9 is provided in combination the other marker for diagnosing DLB. In particular embodiments, the other marker is one of the polymorphic sites in BChE gene disclosed in EP2539461 . In another particular embodiment, the other marker is the polymorphic site at position 68974 in BChE gene as defined by NCBI Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 12, which corresponds to SEQ ID NO: 28 of EP2539461 ).
The invention also provides, in another aspect, a method of deciding or
recommending to initiate a medical regime for the treatment of DLB in a subject by detecting at least one variation in the 5' regulatory region of SNCB defined by SEQ ID NO: 1 . In some embodiments of this aspect, the variations providing the diagnosis of DLB are at least one, or at least two, or at least three, or at least four, or at least five or at least six of the variations as defined above. Also provided is the method of deciding or recommending to initiate a medical regime for the treatment of DLB in a subject which
comprises detecting at least one variation in SEQ ID NO: 14, or alternatively, at least one variation in SEQ ID NO: 15, or alternatively at least one variation in SEQ ID NO: 16, wherein SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 are comprised within SEQ ID NO: 1 . In particular, the at least one variation in SEQ ID NO 14 is selected from: a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , and the short genetic variation defined by rs5873545; the at least one variation in SEQ ID NO 15 is selected from: the short genetic variation defined by rs14721 1 109, and the short genetic variation defined by rs1 13812814; and the at least one variation in SEQ ID NO 16 is the short genetic variation defined by rs70991565.
In particular embodiments of the method of deciding or recommending to initiate a medical regime for the treatment of DLB in a subject the following variations provide the diagnosis of DLB: (i) a variation selected from the group consisting of: the variable polyC, the short genetic variation defined by rs5873545 and the variable polyC together with the short genetic variation defined by rs5873545, (ii) the short genetic variation defined by rs14721 1 109, (iii) the short genetic variation defined by rs70991565, (iv) the short genetic variation defined by rs1 13812814 and, optionally, (v) the short genetic variation defined by rs1 1951438. In other particular embodiments,
determination of any of the genotypes disclosed in table 9 provides for the diagnosis of DLB. In the embodiments for the method of deciding or recommending to initiate a medical regime for the treatment: (a) if the subject is diagnosed of suffering from dementia with Lewy bodies, or of being suspicious of suffering from DLB, then the initiation of the medical regimen is recommended, while (b) if the subject is diagnosed of not suffering from dementia with Lewy bodies, the follow-up is performed optionally in
consideration of the result of an examination of the patient by a physician. In certain embodiments, the DLB is pDLB. When the patient is diagnosed with pDLB, this patient may be recommended to follow a medical regime for
treatment of pDLB, in particular, a medical regime that is appropriate for patients that have decreased b-syn expression in the brain. At the same time, the clinician may preferably recommend that this patient showing pDLB shall not follow a treatment designed for AD, in particular, treatment with
narcoleptics shall not be recommended.
Throughout the description and claims the word "comprise" and variations of the word, are not intended to exclude other technical features, additives, components, or steps. Additional objects, advantages and features of the invention will become apparent to those skilled in the art upon examination of the description or may be learned by practice of the invention. The following examples and drawings are provided by way of illustration, and they are not intended to be limiting of the present invention. Reference signs related to drawings and placed in parentheses in a claim, are solely for attempting to increase the intelligibility of the claim, and shall not be construed as limiting the scope of the claim. Furthermore, the present invention covers all possible combinations of particular and preferred embodiments described herein.
EXAMPLES
The characteristics of the patients included in the present study are shown in table 1 .
Table 1 . Characteristics of patients included in the study
PDND: Parkinson disease without dementia
PDD: Parkinson disease with dementia
Samples from these patients were obtained post mortem and classified according to their clinical history into patients with AD (without Lewy bodies), pDLB, cDLB and PD. PD patients were sometimes studied as two separate
groups, PD patients without dementia (PDND) and PD patients showing dementia (PDD). Control samples were obtained from subjects that did not suffer any of the above conditions, in particular control subjects did not show any neurological symptomatology or movement disorder.
1. PolyC + insertion rs5873545
1.1 PCR and sequencing Initially, a region containing exons 3 and 4 as well as the entire intron 3 of EIF4E1 B gene (NCBI Gene ID: 253314, updated on 4-Apr-2015) was amplified in 15 μΙ reactions using a 34-cycle standard PCR programme with an annealing temperature of 60°C. Primers that yielded an 865 base pair (bp) PCR product were: EIFex3/4-U (AGTGTCTCTGCTTCTGCCAT, SEQ ID NO: 2) and EIFex3/4-L (TGTTTG ACCCACAGTCTCTG , SEQ ID NO: 3). The presence and size of PCR products was checked on 1 .2% agarose gels for subsequent sequencing analysis.
PCR products were purified with 1 -step Exostar treatment following
manufacturer's instructions. First, all sequence reactions were performed using the BigDye Terminator version (BDv) 1 .1 Cycle Sequencing Kit (Applied Biosystems, Boston, USA) and run in an ABI PRISM 3100 system (Applied Biosystems). To improve both readability and reliability of the polyC sequence, an initial mix containing DNA, 1 x sequencing buffer, 3.2 pmol of the correspondent primer and 1 x SequenceR Enhancer Solution A
(LifeTechnologies) was denatured during 5 min at 95°C and stored on ice for 5 min. Finally, 3 μΙ of BDv3.1 were added and the cycle sequencing program comprising an initial denaturalization at 96°C for 2 minutes and 40 cycles of 96°C for 10 seconds and 60°C for 3 minutes, was initialized immediately.
1.2 Characterization of the polyC sequence
A variable length polyC sequence in combination with the presence or absence of a hexa-nucleotide insertion (rs5873545) was detected up-stream to the transcription start of the SNCB gene, within intron 3 of human EIF4E1 B in Chromosome 5. The polyC sequence starts at position 13198 of SEQ ID NO: 1 (which is the sequence for the nucleotide sequence which is located
from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5). If present, the hexa-nucleotide insertion rs5873545 interrupts the polyC-sequence three citosines before ending (Figure 1 ). The insertion preceding polyC stretch varied in length comprising between 10 and 12 cytosines. In the absence of the insertion TCCCCG, the polyC sequence was between 14 and 16 nucleotides in length. In the case of Lewy body diseases, the polyC sequence was characterized by an increased variability and was constituted by up to 18 cytosines. Overall, 18 different genotypes were found. Genotype frequencies of the polyC polymorphism for each group of patients are shown in Table 2. Most frequent genotypes were polyC1 1 .15 with a frequency of 30.1 %, polyC1 1 .1 1 with a frequency of 21 .5% and polyC1 1 .16 with a frequency of 1 1 .8%. Due to the wide genotype variability we grouped the genotypes into two groups, short polyC-allele containing genotypes (polyC10.1 1 , 1 1 .1 1 , 1 1 .12, 10.15, 10.16, 1 1 .14, 1 1 .15, 1 1 .16, 12.14, 12.16, 12.17, 15.15, 15.16 and 16.16) and long polyC-allele containing genotypes (polyC16.17, 17.17, 17.18 and 18.18).
1.3 PolyC genotype distribution in DLB, PD and AD patients in
comparison with controls
Genotype frequencies of the polyC polymorphism for each group of patients are reported in the Table 2 below. After a Bonferroni correction we observed that all the groups of samples were in Hardy-Weinberg equilibrium except AD samples (p=0.0054). The genotype distribution of polyC polymorphism in DLB patients were significantly different from that observed in controls, due to an accumulation of genotypes constituted by the longest alleles.
Table 2. Genotype frequencies of the polyC polymorphism for each group of patients p chi
N short long p Fisher's square OR
AD 24 23 1 1 .0 0.33
DLB 24 18 6 0.022 0.012 5.8 (1 .1 1 -22.8)
PD 23 20 3 0.233 0.08
controls 22 22 0
1.4 PolyC genotype distribution in pure DLB (pDLB), common DLB (cDLB), PDND, PDD and AD patients in comparison with controls
Since two forms, pure and common DLB, can be distinguished
neuropathologically and PD patients may present or no dementia, the polyC genotype analysis was carried out for six groups as well. Genotype frequencies of the polyC polymorphism considering subdivisions of DLB (pDLB and cDLB) and PD (PDND and PDD) are reported in the Table 3 below. The genotype distribution of the polyC polymorphism in pDLB patients was significantly different from that observed in controls (Fisher exact test: p=0.019), due to an even more pronounced accumulation of the polyC genotypes constituted by the longest alleles than in the previous analysis. The genotype distribution was not statistically different in the other groups (Table 3).
Table 3. Genotype frequencies of the polyC polymorphism considering subdivisions of DLB (pDLB and cDLB) and PD (PDND and PDD)
Canonical correspondence analysis diagram for the distribution of polyC genotypes in AD, pDLB, cDLB, PDND, PDD and the control group showed that the pDLB group was clearly distanced from the other groups and, as indicated by the previous results, it was related with polyC genotypes constituted by the longest alleles (results not shown). A trend of accumulation towards genotypes constituted by smallest polyC alleles was observed in AD patients. PolyC genotype distribution in cDLB and PDD patients was similar to controls.
1.5 Presence or absence of the insertion TCCCCG (rs5873545)
Genotype frequencies of the insertion for AD patients, DLB patients and PD patients are summarized in the Table 4 below. In the control group, the most frequent genotype was the heterozygote form (IW) with a frequency of 52.2%, and the least frequent genotype was the wild type homozygote (WW) with a frequency of 18.9%. Although a trend of overrepresentation of the WW genotype was observed in the DLB group, the genotype distribution of the presence of the insertion was statistically not different between groups. When divided into further subgroups, no significant differences were found in the frequencies of the insertion polymorphism.
Table 4. Genotype frequencies of the insertion for AD patients, DLB patients and PD patients
2. Deletions rs147211109 and rs70991565 (EIF4E1 B_intron1) 2.1 PCR and fragment length analysis
The detection of the deletions was carried out by di-plex PCR assays. Two primer pairs, 1 E_int1_2U: TCT TCA TAG GTC TGC CTG GT (SEQ ID NO: 4) and 1 E_int1_2L: ACT TGA GAC CAG GAG TTC GA (SEQ ID NO: 5) to amplify a fragment containing rs14721 1 109, and 1 E_int1_3U: ACT GGC TCA
CAC AAT TCC TGA (SEQ ID NO: 6) and 1 E_int1_3L: AAT CCT TTG AAC CCA GGA GG (SEQ ID NO: 7) to amplify a fragment containing rs70991565, were used in the same 15 ul reaction with the Multiplex PCR Kit (Qiagen). A short-step 30-cycle programme with annealing temperature of 58°C was carried out. To allow the analysis of PCR products on a genetic analyzer (ABI
PRISM 3100 system, Applied Biosystems), the forward primers had been 5' modified with the fluorochromes HEX and FAM, respectively. PCR products
were diluted 1 :10 with formamide, mixed with Rox350 (Applied Biosystems) as size ladder and heat denatured.
2.2 rs147211109: tetra-nucleotide repeat (GTTT)7with the possible deletion of one or more (GTTT)
The fragment of EIF4E1 B gene containing rs14721 1 109 variation and primers 1 E_int1_2U and 1 E_int1_2L employed for its amplification are shown in figure 2.
Three alleles were identified for rs14721 1 109. The wild type allele (B-allele) contained 7 repeats of the tetra-nucleotide GTTT, allele A presented deletion of one GTTT, and allele X deletion of three GTTT. Allele B was represented by a PCR product of 240 bp of length, allele A by a fragment of 236 and allele X of 228 bp of length. Since the frequency of the X-allele was very low (n=1 in each AD, DLB and PD), it was not included in the data analysis. Table 5 represents genotype frequencies in the different disease groups and controls, where genotypes are given as BB and allele-A carriers, A+: Table 5. Genotype frequencies for rs14721 1 109
A significant accumulation of A-allele containing genotypes (AB and AA) was observed in DLB. In contrast, no significant accumulation of any genotype was observed for AD and PD.
2.3 rs70991565: polyT sequence of variable length
The fragment containing rs70991565 and primers 1 E_int1_3U and
1 E_int1_3L used for fragment amplification are shown in figure 3.
Three alleles were identified for rs70991565. The wild type allele (B-allele) contained 13 thymines (underlined in Figure 3) , allele A presented 12 thymines, and allele X 1 1 thymines. Allele B was represented by a PCR product of 139 bp of length, allele A by a fragment of 138 and allele X of 137 bp of length. The X-allele was present in AD and controls, but absent in synucleinopathies. Table 6 represents genotype frequencies in the different disease groups and controls, where genotypes are given as XA, AA and B- allele carriers (B+). Table 6. Genotype frequencies for rs70991565
Similar to rs14721 1 109, significant changes were detected in the DLB group where the AA genotype was significantly accumulated. No significant accumulation of any genotype was observed for AD and PD when compared to controls.
3. SNPs rs113812814 and rs11951438 (SNCB_exon1) 3.1 PCR and sequencing
Mononucleotide substitutions at rs1 13812814 and rs1 1951438 located within exon 1 of the SNCB gene were detected by the amplification of a DNA fragment with primers SNCBmet2U - 5' TAC GCG AGT CTT ACG GCC GG 3' (SEQ ID NO: 8) and SNCBproml L - 5' ACC GGA GCA TAC TCA CAT ACT C 3' (SEQ ID NO: 9). The fragment containing rs1 13812814 and rs1 1951438, and primers used for fragment amplification are shown in figure 4.
The PCR reaction contained 66% of DMSO to achieve needed specificity and a 36-cycle program included 45 seconds of denaturation at 95°C, 40 seconds of annealing at 60°C and 1 minute of extension at 72°C. The presence of the 551 bp PCR-product was checked by agarose-gel electrophoresis and initially, the SNPs were detected by cycle sequencing (see above) with the BigDye Terminator version (BDv) 1 .1 Cycle Sequencing Kit (Applied Biosystems) using primer SNCBproml L. 3.2 Restriction enzyme digestion
To analyse allele frequencies of both SNPs, the 551 bp fragment was digested with BseRI (NewEngland Biolabs) to determine rs1 13812814 alleles and with Ecil to determine rs1 1951438 alleles. rs113812814: Whereas two fragments of 244 and 307 bp were observed in the case of the T-allele, the full-length PCR fragment with no enzyme digestion indicated the presence of the C-allele. All three fragments (244, 307 and 551 bp) were present in the case of the CT genotype. rs11951438: The C allele was represented by the undigested 551 -bp fragment and the T allele by two fragments of 204 and 351 bp, respectively. In the case of the CT genotype, three fragments (204, 351 and 551 bp) were observed.
3.3 rs113812814: Genotype distribution in disease The distribution of the three genotypes of this SNP in the control group were: CC 6.2%, CT 65.7% and TT 28.1 %, being the C-allele the most frequent. Whereas genotype distribution did not differ significantly between AD, PD and controls an important overrepresentation of CC-genotype carriers was detected in the group of DLB patients (Table 7).
Table 7. Genotype frequencies for rs1 13812814.
N CC T+ p Fisher's p chi square OR
AD 25 4 21 0.388 0.234
DLB 47 17 30 <0.0001 <0.0001 19.6 (3.5-144.4)
PD 24 6 19 0.120 0.056
controls 32 2 30
3.4 rs11951438: Genotype distribution in disease
The distribution of the three genotypes of this SNP in the control group were: CC 46.9%, CT 50% and TT 3.1 %, being the C-allele the most frequent .
Although no significant differences could be observed in genotype distribution of the different groups, a marked tendency of CC genotype accumulation was observed in the pDLB subgroup (CC 66% and CT 33%) (table 8). Table 8. Genotype frequencies for rs1 1951438.
4. Genotype combinations of six polymorphisms located within the SNCB regulatory region
Since the analysis of the different polymorphisms revealed the accumulation of certain genotypes in DLB, none of them provided sensitivity and specificity high enough to serve as a diagnostic biomarker.
Therefore, further analyses were carried out taking into account different combinations of the genotypes from the six polymorphisms studied, all of them localized in the 5' regulatory region of SNCB: polyC and rs5873545 at - 12.3 kb of the SNCB transcription start, rs14721 1 109 at -5.5 kb, rs70991565 at -4 kb, and SNPs rs1 13812814 and rs1 1951438 within exon 1 of SNCB (Figure 5).
A total of 36 different genotype combinations was detected (results not shown) and 7 of these were found to be strongly associated with diminished SNCB expression levels in the cortex that had been observed earlier, specifically in DLB brains characterized mainly by pure LB pathology. Table 9 shows said 7 genotypes.
Table 9. Genotypes providing diferential diagnosis of pDLB
1 For PolyC, L: allele containing at least 17 consecutive cytosines; S: allele containing less than 17 consecutive cytosines
2 For rs5873545, I: allele containing insertion of TCCCCG, W: wild type allele (no insertion)
3 For rs14721 1 109, A: wild type containing 7x(TTTG); B: allele containing 6x(TTTG)
4 For rs70991565, A: wild type containing 13xT; B: allele containing 12xT
In consequence, 67% of pDLB cases presented one of the seven genotype combinations (Figure 6). A reduced number of DLB brains presenting concomitant AD pathology also showed diminished SNCB levels in the cortex and, accordingly, 25% of cDLB cases also carried one of the seven genotype combinations of the SNCB regulatory region. Also in one of the PDD cases one of the SNCB-reduction associated genotype combinations was detected (Figure 6). Although all above 7 genotypes provide a reliable diagnosis of pDLB, genotypes 1 -3 provide the best diagnosis information, followed by genotypes 4-6.
REFERENCES CITED IN THE APPLICATION
Braak and Braak, "Diagnostic criteria for neuropathological assessment of
Alzheimer's disease", Neurobiol Aging 1997, vol. 18, p. 85.
1. G. McKeith, "Consensus guidelines for the clinical and pathologic diagnosis of dementia with Lewy bodies (DLB): report of the Consortium on DLB International Workshop", J. Alzheimer's Dis. 2006, vol. 9, pp. 417-23
EP2539461
Beyer et al, "The decrease of b-synuclein in cortical brain areas defines a molecular subgroup of dementia with Lewy bodies". Brain 2010, vol 133, p. 3724
CLAUSES 1 . An in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in the nucleotide sequence which is located from position
176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 (SEQ ID NO: 1 ).
2. The method according to claim 1 , wherein if at least one of the following variations is detected:
(i) a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 ,
(ii) the short genetic variation defined by rs5873545,
(iii) the short genetic variation defined by rs14721 1 109,
(iv) the short genetic variation defined by rs70991565,
(v) the short genetic variation defined by rs1 13812814, and
(vi) the short genetic variation defined by rs1 1951438, this is indicative of the presence of dementia with Lewy bodies in the subject.
3. The method according to any of the claims 1 -2, wherein if the following variations are detected:
(i) a variation selected from the group consisting of: a variable poly-cytosine
sequence starting at position 13,198 of SEQ ID NO: 1 , a short genetic variation defined by rs5873545, and a poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 together with a short genetic variation defined by rs5873545,
(ii) the short genetic variation defined by rs14721 1 109,
(iii) the short genetic variation defined by rs70991565, and
(iv) the short genetic variation defined by rs1 13812814, they are indicative of the presence of dementia with Lewy bodies in the subject.
4. The method according to claim 3, which further comprises detecting the short genetic variation defined by rs1 1951438. 5. The method according to any of the claims 1 -4, wherein the following genotype:
(i) the poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 comprises from 17 to 22 cytosines in at least one of the alleles or,
alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545,
(ii) at least one of the alleles shows the deletion of four contiguous
nucleotides TTTG for s14721 1 109,
(iii) both alleles show the deletion of a tyrosine residue T for rs70991565, and (iv) both alleles contain guanine for rs1 13812814; or, alternatively, this other genotype:
(v) the poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 comprises from 17 to 22 cytosines in at least one of the alleles or,
alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545,
(vi) at least one of the alleles shows the deletion of four contiguous nucleotidesTTTG for s14721 1 109,
(vii) both alleles show the deletion of a tyrosine residue for rs70991565, (viii) one allele contains guanine and the other allele contains adenine for rs1 13812814, and
(ix) both alleles contain guanine for rs1 1951438. is indicative of the presence of dementia with Lewy bodies in the subject. 6. The method according to any of the claims 1 -5 that additionally comprises determining at least one other marker known as being indicative of dementia with Lewy bodies.
7. The method according to claim 6, wherein the other marker is the polymorphic site at position 68974 in BChE gene as defined by NCBI
Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 12).
8. Use of means for detecting one or more variations as defined in any of the claims 1 -5 in a biological sample from a subject for the in vitro diagnosis of dementia with Lewy bodies.
9. The use according to claim 8, wherein the means comprise at least one pair of primers selected from SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and SEQ ID NO: 8 and SEQ ID NO: 9.
10. The use according to any of the claims 8-9, wherein the means form part of a kit. 1 1 . Use of at least one variation in the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 (SEQ ID NO: 1 ) for the in vitro diagnosis of dementia with Lewy bodies. 12. Use of at least one of the following variations in the nucleotide sequence which is located from position 176.629.654 to position 176.643.500 in Homo sapiens chromosome 5 (SEQ ID NO: 1 ):
(i) a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 ,
(ii) the short genetic variation defined by rs5873545,
(iii) the short genetic variation defined by rs14721 1 109,
(iv) the short genetic variation defined by rs70991565,
(v) the short genetic variation defined by rs1 13812814, and
(vi) the short genetic variation defined by rs1 1951438; for the in vitro diagnosis of dementia with Lewy bodies.
13. Use according to any of the claims 1 1 -12 in combination with at least one other marker known as being indicative of dementia with Lewy bodies. 14. A method of deciding or recommending to initiate a medical regime for the treatment of dementia with Lewy bodies in a subject, which method comprises diagnosing dementia with Lewy bodies or determining whether the subject is suspicious of suffering dementia with Lewy bodies by the method as defined in any of the claims 1 -6, wherein a) if the subject is diagnosed of suffering from dementia with Lewy bodies, or of being suspicious of suffering from DLB, then the initiation of the medical regimen is recommended, and b) if the subject is diagnosed of not suffering from dementia with Lewy bodies, the follow-up is performed optionally in consideration of the result of an examination of the patient by a physician.
15. The method of in vitro diagnosis of dementia with Lewy bodies according to any of the claims 1 -6, or the use of means for in vitro diagnosis of dementia with Lewy bodies according to any of the claims 8-10, or the use for in vitro diagnosis of dementia with Lewy bodies according to any of the claims 1 1 -12, or the method of deciding or recommending to initiate a medical regime for the treatment of dementia with Lewy bodies according to claim14, wherein the dementia with Lewy bodies is pure dementia with Lewy bodies.
Claims
1 . An in vitro method for the diagnosis of dementia with Lewy bodies comprising detecting, in a biological sample from a subject, at least one variation in SEQ ID NO: 14, or alternatively at least one variation in SEQ ID NO: 15, or alternatively at least one variation in SEQ ID NO: 16, wherein SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 are comprised within position 175.989.261 to position 176.003.107 in Homo sapiens chromosome 5 according to HapMap data release 28 (SEQ ID NO: 1 ).
2. The method according to claim 1 , wherein if at least one of the following variations in SEQ ID NO 14 is detected: a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , or
the short genetic variation defined by rs5873545, this is indicative of the presence of dementia with Lewy bodies in the subject.
3. The method according to claim 1 , wherein if at least one of the following variations in SEQ ID NO 15 is detected: the short genetic variation defined by rs14721 1 109, or
the short genetic variation defined by rs1 13812814. this is indicative of the presence of dementia with Lewy bodies in the subject.
4. The method according to claim 1 , wherein if at least the following variation in SEQ ID NO 16 is detected: the short genetic variation defined by rs70991565. this is indicative of the presence of dementia with Lewy bodies in the subject.
5. The method according to claim 2, which further comprises detecting at least one of the following variations:
the short genetic variation defined by rs14721 1 109,
the short genetic variation defined by rs70991565, or
the short genetic variation defined by rs1 13812814.
6. The method according to any of the claims 1 -5, wherein if the following variations are detected:
(i) a variation selected from the group consisting of: a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , a short genetic variation defined by rs5873545, and a poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 together with a short genetic variation defined by rs5873545,
(ii) the short genetic variation defined by rs14721 1 109,
(iii) the short genetic variation defined by rs70991565, and
(iv) the short genetic variation defined by rs1 13812814, they are indicative of the presence of dementia with Lewy bodies in the subject.
7. The method according to any of the claims 1 -6, which further comprises detecting the short genetic variation defined by rs1 1951438.
8. The method according to any of the claims 1 -7, wherein the following genotype:
(i) the poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 comprises from 17 to 22 cytosines in at least one of the alleles or,
alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545,
(ii) at least one of the alleles shows the deletion of four contiguous
nucleotides TTTG for s14721 1 109,
(iii) both alleles show the deletion of a tyrosine residue T for rs70991565, and
(iv) both alleles contain guanine for rs1 13812814; or, alternatively, this other genotype:
(v) the poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1
comprises from 17 to 22 cytosines in at least one of the alleles or,
alternatively, at least one of the alleles contains an insert TCCCCG for rs5873545,
(vi) at least one of the alleles shows the deletion of four contiguous nucleotidesTTTG for s14721 1 109,
(vii) both alleles show the deletion of a tyrosine residue for rs70991565,
(viii) one allele contains guanine and the other allele contains adenine for rs1 13812814, and
(ix) both alleles contain guanine for rs1 1951438. is indicative of the presence of dementia with Lewy bodies in the subject.
9. The method according to any of the claims 1 -8 that additionally comprises determining at least one other marker known as being indicative of dementia with Lewy bodies.
10. The method according to claim 9, wherein the other marker is the polymorphic site at position 68974 in BChE gene as defined by NCBI
Accession Number NG_009031 (i.e. position 934 in SEQ ID NO: 12).
1 1 . Use of means selected from primers for amplification of sequence fragments and hybridization probes for detecting one or more variations as defined in any of the claims 1 -7 in a biological sample from a subject for the in vitro diagnosis of dementia with Lewy bodies.
12. The use according to claim 1 1 , wherein the means comprise at least one pair of primers selected from SEQ ID NO: 2 and SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5, SEQ ID NO: 6 and SEQ ID NO: 7, and SEQ ID NO: 8 and SEQ ID NO: 9.
13. The use according to any of the claims 1 1 -12, wherein the means form part of a kit.
14. At least one variation in SEQ ID NO: 14, or alternatively, at least one variation in SEQ ID NO: 15, or alternatively at least one variation in SEQ ID
NO: 16, wherein SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 are comprised within position 175.989.261 to position 176.003.107 in Homo
sapiens chromosome 5 according to HapMap data release 28 (SEQ ID NO: 1 ), for use as an in vitro diagnosis biomarker of dementia with Lewy bodies.
15. Use according to claim 14, wherein the at least one variation in SEQ ID NO 14 is selected from: a variable poly-cytosine sequence starting at position 13,198 of SEQ ID NO: 1 , and
the short genetic variation defined by rs5873545.
16. Use according to claim 14, wherein the at least one variation in SEQ ID NO 15 is selected from: the short genetic variation defined by rs14721 1 109, and
the short genetic variation defined by rs1 13812814.
17. Use according to claim 14, wherein wherein the at least one variation in SEQ ID NO 16 is the short genetic variation defined by rs70991565.
18. Use according to any of the claims 14-17 in combination with at least one other marker known as being indicative of dementia with Lewy bodies.
19. A method of deciding or recommending to initiate a medical regime for the treatment of dementia with Lewy bodies in a subject, which method comprises diagnosing dementia with Lewy bodies or determining whether the subject is suspicious of suffering dementia with Lewy bodies by the method as defined in any of the claims 1 -10, wherein a) if the subject is diagnosed of suffering from dementia with Lewy bodies, or of being suspicious of suffering from DLB, then the initiation of the medical regimen is recommended, and b) if the subject is diagnosed of not suffering from dementia with Lewy bodies, the follow-up is performed optionally in consideration of the result of an examination of the patient by a physician.
20. The method of in vitro diagnosis of dementia with Lewy bodies according
to any of the claims 1 -10, or the use of means for in vitro diagnosis of dementia with Lewy bodies according to any of the claims 1 1 -13, or the use for in vitro diagnosis of dementia with Lewy bodies according to claim 14-18, or the method of deciding or recommending to initiate a medical regime for the treatment of dementia with Lewy bodies according to claim 19, wherein the dementia with Lewy bodies is pure dementia with Lewy bodies.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP15382240 | 2015-05-08 | ||
| EP15382240.8 | 2015-05-08 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016180725A1 true WO2016180725A1 (en) | 2016-11-17 |
Family
ID=53180690
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2016/060176 Ceased WO2016180725A1 (en) | 2015-05-08 | 2016-05-06 | Diagnosis of dementia with lewy bodies |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2016180725A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020016437A1 (en) | 2018-07-19 | 2020-01-23 | Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol | In vitro method for the diagnosis of synucleinopathies |
| KR20230085582A (en) * | 2021-12-07 | 2023-06-14 | 주식회사 엔젠바이오 | Single nucleotide polymorphic markers for the diagnosis of dementia with Lewy bodies |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008220174A (en) * | 2007-03-08 | 2008-09-25 | Tokyoto Igaku Kenkyu Kiko | Transformed cells and transgenic non-human animals that co-express mutant β-synuclein and α-synuclein |
| EP2539461A1 (en) | 2010-02-24 | 2013-01-02 | Universitat Autònoma De Barcelona | Genetic marker for the diagnosis of dementia with lewy bodies |
-
2016
- 2016-05-06 WO PCT/EP2016/060176 patent/WO2016180725A1/en not_active Ceased
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2008220174A (en) * | 2007-03-08 | 2008-09-25 | Tokyoto Igaku Kenkyu Kiko | Transformed cells and transgenic non-human animals that co-express mutant β-synuclein and α-synuclein |
| EP2539461A1 (en) | 2010-02-24 | 2013-01-02 | Universitat Autònoma De Barcelona | Genetic marker for the diagnosis of dementia with lewy bodies |
Non-Patent Citations (8)
| Title |
|---|
| BEYER ET AL., BRAIN, vol. 133, 2010, pages 3724 |
| BEYER ET AL.: "The decrease of b-synuclein in cortical brain areas defines a molecular subgroup of dementia with Lewy bodies", BRAIN, vol. 133, 2010, pages 3724, XP055222665, DOI: doi:10.1093/brain/awq275 |
| BRAAK; BRAAK: "Diagnostic criteria for neuropathological assessment of Alzheimer's disease", NEUROBIOL AGING, vol. 18, 1997, pages 85 |
| GRIT TASCHENBERGER ET AL: "[beta]-synuclein aggregates and induces neurodegeneration in dopaminergic neurons", ANNALS OF NEUROLOGY., vol. 74, no. 1, 6 July 2013 (2013-07-06), BOSTON, US, pages 109 - 118, XP055222852, ISSN: 0364-5134, DOI: 10.1002/ana.23905 * |
| H. OHTAKE ET AL: "Beta-Synuclein gene alterations in dementia with Lewy bodies", NEUROLOGY, vol. 63, no. 5, 14 September 2004 (2004-09-14), US, pages 805 - 811, XP055222581, ISSN: 0028-3878, DOI: 10.1212/01.WNL.0000139870.14385.3C * |
| I.G. MCKEITH: "Consensus guidelines for the clinical and pathologic diagnosis of dementia with Lewy bodies (DLB): report of the Consortium on DLB International Workshop", J. ALZHEIMER'S DIS., vol. 9, 2006, pages 417 - 23 |
| K. BEYER ET AL: "The decrease of beta-synuclein in cortical brain areas defines a molecular subgroup of dementia with Lewy bodies", BRAIN., vol. 133, no. 12, 19 October 2010 (2010-10-19), GB, pages 3724 - 3733, XP055222665, ISSN: 0006-8950, DOI: 10.1093/brain/awq275 * |
| NISHIOKA K ET AL: "Association of alpha-, beta-, and gamma-Synuclein With Diffuse Lewy Body Disease", ARCHIVES OF NEUROLOGY, vol. 67, no. 8, August 2010 (2010-08-01), pages 970 - 975, XP009186834 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2020016437A1 (en) | 2018-07-19 | 2020-01-23 | Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol | In vitro method for the diagnosis of synucleinopathies |
| US12065701B2 (en) | 2018-07-19 | 2024-08-20 | Fundació Institut D'investigació En Ciències De La Salut Germans Trias I Pujol | In vitro method for the diagnosis of synucleinopathies |
| EP4589015A2 (en) | 2018-07-19 | 2025-07-23 | Fundació Institut d'Investigació en Ciències de la Salut Germans Trias i Pujol | In vitro method for the diagnosis of synucleinopathies |
| KR20230085582A (en) * | 2021-12-07 | 2023-06-14 | 주식회사 엔젠바이오 | Single nucleotide polymorphic markers for the diagnosis of dementia with Lewy bodies |
| KR102737915B1 (en) | 2021-12-07 | 2024-12-04 | 주식회사 엔젠바이오 | Single nucleotide polymorphic markers for the diagnosis of dementia with Lewy bodies |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2539461B1 (en) | Genetic marker for the diagnosis of dementia with lewy bodies | |
| KR102158716B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of ARHGAP32 gene | |
| US12612661B2 (en) | Compositions and methods for assessing the efficacy of inhibitors of neurotransmitter transporters | |
| WO2016180725A1 (en) | Diagnosis of dementia with lewy bodies | |
| KR102158673B1 (en) | A method for providing information for seasonality or circadian preference in bipolar disorder using single nucleotide polymorphisms | |
| EP2471949B1 (en) | Method for the identification by molecular techniques of genetic variants that encode no D antigen (D-) and altered C antigen (C+W) | |
| WO2008010082A2 (en) | Diagnostic method for fibromyalgia (fms) or chronic fatigue syndrome (cfs) | |
| US20140249047A1 (en) | Genetic marker for the diagnosis of dementia with lewy bodies | |
| JP6342627B2 (en) | A novel pathogenic gene for amyotrophic lateral sclerosis | |
| US20050255498A1 (en) | APOC1 genetic markers associated with age of onset of Alzheimer's Disease | |
| KR101167945B1 (en) | Polynucleotides derived from ATG16L1 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same | |
| KR102158719B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of LOC102724084 gene | |
| KR102158723B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of SPCS3 gene | |
| KR102158725B1 (en) | SNP marker for diagnosis of intracranial aneurysm comprising SNP of MINK1 gene | |
| KR101167942B1 (en) | Polynucleotides derived from ALG12 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same | |
| AU2002244949B2 (en) | Genomic DNAS participating in rheumatoid arthritis, method of diagnosing the same, method of judging onset riks thereof and diagnostic kit for detecting the same | |
| KR101167940B1 (en) | Polynucleotides derived from FMN2 gene comprising single nucleotide polymorphisms, microarrays and diagnostic kits comprising the same, and analytic methods for autism spectrum disorders using the same | |
| HK40083504A (en) | Compositions and methods for assessing the efficacy of inhibitors of neurotransmitter transporters | |
| KR20110088690A (en) | Polynucleotides containing a single base polymorphism derived from TICAM1 gene, microarray and diagnostic kit comprising the same, and autism spectrum disorder analysis method using the same | |
| JP2012249554A (en) | Snp marker for diagnosing immune-mediated epilepsy and method for using the same, and inspection kit for immune-mediated epilepsy | |
| WO2009036513A1 (en) | Diagnostic and therapeutic protocols | |
| Berlin | Genetics/transcriptomics |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16722621 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16722621 Country of ref document: EP Kind code of ref document: A1 |






