WO2016179034A2 - Methods and compositions for stimulating immune response using potent immunostimulatory rna motifs - Google Patents
Methods and compositions for stimulating immune response using potent immunostimulatory rna motifs Download PDFInfo
- Publication number
- WO2016179034A2 WO2016179034A2 PCT/US2016/030242 US2016030242W WO2016179034A2 WO 2016179034 A2 WO2016179034 A2 WO 2016179034A2 US 2016030242 W US2016030242 W US 2016030242W WO 2016179034 A2 WO2016179034 A2 WO 2016179034A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- subject
- rna
- dvg
- motif
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/117—Nucleic acids having immunomodulatory properties, e.g. containing CpG-motifs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07H—SUGARS; DERIVATIVES THEREOF; NUCLEOSIDES; NUCLEOTIDES; NUCLEIC ACIDS
- C07H21/00—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids
- C07H21/02—Compounds containing two or more mononucleotide units having separate phosphate or polyphosphate groups linked by saccharide radicals of nucleoside groups, e.g. nucleic acids with ribosyl as saccharide radical
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/53—DNA (RNA) vaccination
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
- A61K2039/55511—Organic adjuvants
- A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/17—Immunomodulatory nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/18011—Paramyxoviridae
- C12N2760/18811—Sendai virus
- C12N2760/18821—Viruses as such, e.g. new isolates, mutants or their genomic sequences
Definitions
- the presently disclosed subject matter relates, in certain embodiments, to immunostimulatory RNA motifs as well as methods for initiating or enhancing immune responses.
- these RNA motifs can be used as immunostimulatory agents to enhance host immune responses, as antivirals, as vaccine adjuvants, and/or as antitumor agents.
- the immune system plays an important role in defense against specific microorganisms, for example viruses, specific fungi and bacteria, as well as in recognizing and inhibiting and/or eradicating tumor cells.
- Vaccinations are a long-known method of activating the immune system.
- Vaccination and immunization is the introduction of a non-virulent agent into a subject, in which the agent elicits the subject's immune system to mount an immunological response.
- vaccine antigens are killed or attenuated forms of the microbes which cause the disease.
- the presence of non-essential components and antigens in these killed or attenuated vaccines has encouraged considerable efforts to refine vaccine components including developing well-defined synthetic antigens using chemical and recombinant techniques.
- the refinement and simplification of vaccines has led to a concomitant loss in potency.
- Low-molecular weight synthetic antigens though devoid of potentially harmful contaminants, are often not sufficiently immunogenic by themselves and do not produce an adequate immune response.
- the immunogenicity of an antigen can be increased by administering it in a mixture with substances called adjuvants.
- adjuvants increase the response against the antigen either by directly acting on the immunological system or by modifying the pharmacokinetic characteristics of the antigen, resulting in an increased interaction time between the antigen and the immune system. Additionally, the addition of an adjuvant can permit the use of a smaller dose of antigen to stimulate a similar immune response, thereby reducing the production cost of a vaccine.
- Aluminum salts have been useful for some vaccines like hepatitis B, diphtheria, tetanus, and toxoid; however, they are not useful for others like rabies, MMR, and typhoid.
- Aluminum salts fail to induce cell-mediated immunity, result in the induction of granulomas at the injection site and vary in effectiveness between batches of alum preparations.
- RNA motifs that effectively trigger this pathway are disclosed herein, which can, in certain embodiments, be used to generate synthetic RLR ligands for strong induction of antiviral responses in the context of vaccination or antiviral therapies.
- dsRNA double strand RNA
- HCV Hepatitis C virus
- SeV iDVGs belong to the copy-back type of RNA DVGs and are produced when the viral polymerase is released fiom the template strand during replication and copies back the nascent strand (28). iDVGs are unable to replicate in the absence of helper virus as they lack essential replication machinery, and are not transcribed into proteins as they are flanked by the antigenomic promoter (29-32).
- a copy-back iDVG of 546 nucleotides (DVG- 546) predominant in laboratory stocks of SeV strain Cantell (SeV C) has been characterized to be a strong trigger of RLRs signaling (12, 23, 26, 33).
- RNA motif (DVG 70 -1 14) that is capable of eliciting an immune response.
- this motif can be harnessed to increase the immunostimulatory potential of otherwise inert R As and represents a novel immunostimulatory enhancer that can be used in the development of vaccine adjuvants and anti viral s.
- the instant disclosure provides methods for stimulating an immune response in a subject including administering to the subject, e.g., a mammalian subject or a non-mammalian subject, e.g., a human, bird, or fish, at least one antigen in conjunction with an RNA motif capable of inducing an antigen specific immune response in the subject.
- a mammalian subject or a non-mammalian subject e.g., a human, bird, or fish.
- the present disclosure provides methods of activating an antigen presenting cell, for example a dendritic cell, including contacting the cell with an antigen and an RNA motif capable of inducing an antigen specific immune response.
- an antigen presenting cell for example a dendritic cell
- the antigen presenting cell is isolated from a subject and activated ex vivo. The activated cell can then be introduced, or reintroduced, into the subject.
- the instant disclosure provides methods for stimulating an immune response in a subject including administering to the subject an antibody conjugated to at least one RNA motif capable of inducing an antigen specific immune response in the subject.
- the disclosure provides methods for stimulating an immune response in a subject to an immunostimulatory-inert virus including administering to the subject a portion of the inert virus's genome in which at least one RNA motif capable of inducing an antigen specific immune response in the subject is cloned into the genome.
- the RNA motif comprises the nucleotide sequence of SEQ ID NO: l , or modified variants thereof having immunostimuiatory activity. In certain embodiments, the RNA motif comprises the nucleotide sequence of SEQ ID NO:2. In certain embodiments, the RNA motif comprises the nucleotide sequence of SEQ ID NO:5. In certain embodiments, the antigen is, for example, a virus, bacterial, fungal, parasite, nucleotide, or peptide antigen.
- the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO:l having immunostimuiatory activity and a pharmaceutically acceptable carrier.
- the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO: l having immunostimuiatory activity, one or more adjuvant, and a pharmaceutically acceptable carrier.
- the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO:l having immunostimuiatory activity, one or more antigens, and a pharmaceutically acceptable carrier.
- the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO: I, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO: l having immunostimuiatory activity, conjugated to one or more adjuvant, and a pharmaceutically acceptable carrier.
- the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23 or a modified variant of SEQ ID NO:l having immunostimuiatory activity, conjugated to, combined with, or encapsulated by one or more nanoparticle, and a pharmaceutically acceptable carrier.
- the nanoparticle can be liposome.
- the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO: l having immunostimulatory activity, inserted into one or more nucleotide sequence, and a pharmaceutically acceptable carrier.
- the nucleotide sequence can be an mRNA sequence.
- the present disclosure provides an isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO: l , SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO:l having immunostimulatory activity.
- FIG. 1A - Figure IB DVGs promote protection from infection with an unrelated virus.
- Figure IB Expression of antiviral genes examined by RT-qPCR. Results are expressed as the mean ⁇ the standard error of the mean of three independent experiments.
- FIG. 2A Figure 2D. Accumulation of positive (+)DVG strands associates with strong expression of IFNB1 during infection.
- Figure 2A Representation of genomic and copy-back DVG RNAs produced during SeV infection.
- Figure 2B 1FNB1 mRNA expression and ratio of (+)/(-)DVG RNA copy numbers determined by RT-qPCR from A549 cells infected with SeV-HD at a moi of 1.5 TCIDso/cell. Experiments were independently repeated at least three times. Each assay was performed in triplicates. A representative graph is shown.
- FIG. 2C Representative staining of (+)DVG (green), (+)SeV genome or mRNA (red), IRF3 (purple) and nuclei (DAPI, blue) on LLC-MK2 cells 6h after SeV HD infection or mock controls. Image magnification: 100X.
- Figure 3A - Figure 3D Production of DVG(+) during DVG replication closely matches induction of IFNBl .
- Figure 3A Scheme of PCR amplification strategy utilized to detect and differentiate (+) and (-) strands of DVG-546. DVG reverse transcription was performed with the indicated primers for the (+) or (-) sense DVGs. RT-qPCR of each sense- specific RT product was performed with a combination of the DVG 1 and DVG J primers to produce identical PCR products at equivalent efficiencies.
- Figure 3D IFNB1 mRNA expression and ratio of (+)/(-) DVG RNA determined by RT-qPCR from LLC- 2 cells infected with SeV-HD at a moi of 1.5 TCIDso/cell. All experiments shown in Figure3B- Figure 3D were independently repeated for three times and each assay was performed in triplicate. A representative data set is shown. Data are expressed as copy numbers relative to the housekeeping genes GAPDH.
- FIG. 4A - Figure 4G Identification of a candidate motif essential for type I IFN induction by DVG RNA.
- Figure 4A Representation of deletion DVG mutants. Length of the deletion (dashed line) and total final length of each molecule are indicated. DVG mutant with deletion of both complementary sequences (gray) is indicated as DVG-1S (internal sequence).
- FIG. 5A - Figure 5B Quality control of ivtDVG R As.
- Figure 5A Electrophoretic analysis of ivtDVGs was performed on an Agilents's 2100 Bioanalyzer.
- Figure 5B Endotoxin test for ivtDVGs used in the study.
- Figure 5C Expression of IFNB1 mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15pmol gel-purified DVG- ivtDVG. The experiment was independently repeated three times and each assay was performed in triplicate. A representative qPCR is shown. RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH.
- FIG. 6A - Figure 6C ivtDVGs with intact stimulatory motif stimulate IFN responses in both mouse and human cells and is sustained for up to 24 h post transfection.
- Figure 6A Expression of Ifnb mRNA by RT-qPCR of TC-1 cells transfected for 6 h with 4.15 pmol of the indicated ivtDVGs.
- Figure 6B Expression of IFNB 1 mRNA by RT-qPCR of A549 cells transfected for 6 h with 4.15 pmol of the indicated ivtDVGs. Each RT-qPCR assay was performed in triplicates. Data correspond to the average of all experiments (total n>3/group).
- RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH for LL-CMK2 cells and Rpsl 1 for TC-1 cells.
- Figure 6C Expression of IFNB1 and IFIT1 mRNA at 4, 8, 12, and 24 h post transfection of LL-CMK2 with 4.15 pmol of the indicated ivtDVG RNA. One representative experiment out of three is shown. Data are expressed as copy numbers relative to the housekeeping genes GAPDH.
- FIG. 7A - Figure 7D Quality control of ivtDVG RNAs.
- Figure 7A Electrophoretic analysis of ivtDVGs was performed on an Agilent 2100 Bioanalyzer.
- Figure 7B Endotoxin levels on ivtDVGs used in the study measured by Limulus assay.
- Figure 7C Expression of 1FNB1 mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15pmol gel-purified ivtDVG. The experiment was independently repeated three times and each assay was performed in triplicate. A representative qPCR is shown. RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH.
- FIG. 8A Eletrophoretic analysis for DVG-268 ivtDVGs on an Agilents's 2100 Bioanalyzer.
- Figure 8B Eletrophoretic analysis for DVG-546 ivtDVGs on an Agilents's 2100 Bioanalyzer.
- Figure 8C Folding prediction for DVG-546 motif deletion (DVG-546 A70- I I- > ) and the parental DVG-546. Motif DVG 70- n4 is indicated with an oval.
- FIG. 8D Expression of IFNBl mRNA by RT-qPCR in LLC-MK2 cells transfected for 6 h with 4.15 pmol of the indicated ivtDVG.
- Figure 8E Folding prediction for DVG-546 motifl + and the parental DVG- 546. Motif DVGTO-I i4 is indicated with an oval. Mutated motif DVG 70- i i4 in DVG-546 motifl+ is indicated with an oval.
- Figure 8F Expression of IFNBl mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15pmol of ivtDVG illustrated in ( Figure 8E). All transfection experiments were independently repeated at least three times.
- FIG. 9A Figure 9D.
- Recombinant SeV iDVGs with an intact DVG70-U4 motif preserve their stimulatory activity in the context of infection.
- Figure 9A Schematic of the recombinant SeV DVG generation system. BSR-T7 cells were infected with partially inactivated SeV 52 and transfected with a plasmid encoding either DVG-324 or DVG-354. Cells and supernatants were collected 48 h later and inoculated into 10-day-old embryonated chicken eggs. SeV containing rDVGs was collected from the allantoic fluid.
- T7 pro T7 promoter sequence
- Riboz. ribozyme
- T7 term T7 polymerase terminator sequence.
- FIG. 11A - Figure 11B DVG 70 -114 motif transfers strong immunostimulatory activity to inert RNA molecules.
- Figure 11 A Folding predictions of HCV X-region (SEQ ID NO: 17), X-region_DVG 7 o- i i 4 (SEQ ID NO: 18) and X-region_DVG 5 - 5 i, Motif DVG 70 -i 14 (SEQ ID NO: 19) is ballooned in the middle figure and motif DVG 5 . 51 is ballooned in figure on the right.
- Figure 11B Expression of IFNB l and IFIT1 mRNA measured by RT-qPCR of LLC- MK2 cells transfected for 6 h with 4.
- FIG. 12A EMSA of 6 pmol HCV poly U/UC, X-region and DVG-268 in the presence of ATP and increasing doses (0-20pmol) of full length RIG-I. Product was resolved on a 2% agarose gel.
- FIG. 13A - Figure 13E DVG7 0 -1 14 motif strongly stimulates RLR signaling.
- Figure 13 A Expression of Ifnb mRNA determined by RT-qPCR from WT, Mavs ' , and Ddx58 ' ' (RIG-T A ) MEFs transfected for 6 h with 4.15pmol DVG- ivtDVG variants.
- Figure 13B Expression of IFNB1 mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with DVG-derived ivtDVGs untreated or treated with alkaline phosphatase (AP).
- AP alkaline phosphatase
- FIG. 13C Expression of IFNB1 mRNA by RT-qPCR of LLC-M 2 cells transfected for 6 h with 4.15pmol DVG-268 ivtDVGs not treated (NT) or treated with RNase A, RNase VI , RNase A/Vl , or mock transfected.
- Figure 13D and Figure 13E EMSA of DVG-268 and DVG-268 ⁇ 70- ⁇ 14 RNA to increasing doses of RIG-I deltaCARD in the absence ( Figure 13D) or presence (Figure 13E) of 1 ⁇ ATP. All experiments in Figure 13A - Figure 13E were independently repeated at least three times. Each RT-qPCR assay was performed in triplicates.
- RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH and/or ACTB (for LL-CMK2 cells) and Rpsll for MEFs.
- FIG. 15B Expression of the antiviral gene Mxl in whole lung homogenates collected 6 hpi.
- Figure 15C RNA in situ hybridization on lungs extracted 6h after inoculation of DVG-324NC. Green dots represent DVG-324NC bound by labeled probes.
- FIG. 17 SEQ ID NO:2.
- An exemplary modifying mutation DVG 7 o-H otifl + (47nt, from 5' to 3', additional nucleotides underlined).
- Figure 18 SEQ ID NO:3.
- FIG. 19 SEQ ID NO:4. An exemplar)' mutation that significantly reduces the motif activity: DVG70-1 14 C97G (45nt, from 5 '-3', mutated nucleotide is underlined).
- Figure 21 Primers used in mutagenesis.
- Figure 22 Primers used in quantitative PCR assays.
- FIG. 25 DVG-268 induced strong protection to infectious challenge with single immunization. Flu HA specific IgG, IgGl and lgG2b antibodies in the blood were measured by ELISA. *** ⁇ 0.0001 and *** ⁇ 0.001 by One way-ANOVA with Bonferroni pos- hoc test. Ns-non-significant.
- FIG. 26 DVG-268 induced strong protection to infectious challenge with single immunization. Expression of Flu NP mRNA in whole lung homogenate was analyzed by RT-qPCR as an indication of virus load in the lung. Data are shown as mRNA copy number relative to house keeping gene Rpsl l and Gapdh. *** ⁇ 0.001 by One way-ANOVA with Bonferroni pos-hoc test.
- FIG. 28 Motif 70-114 induced strong protection to infectious challenge with single immunization. Expression of IAV NP mRNA in whole lung homogenate was analyzed by RT-qPCR. Data are shown as mRNA copy number relative to house keeping gene Rpsl 1 and Gapdh. *** ⁇ 0.001 by One way-ANOVA with Bonferroni pos-hoc test.
- Figure 29 DVG-derived RNA is stable at 4°C and 37°C. RNA pico 6000 assay on Agilent 2100 Bioanalyzer.
- FIG. 30 DVG-derived RNA is stable at 37°C for at least 24 hours. RNA pico 6000 assay on Agilent 2100 Bioanalyzer.
- FIG. 31 DVG-324 inserted into MERS DNA vaccine enhanced immunostimulatory activity. MERS specific IFN-gamma ELISpot in C57BL/6.
- FIG. 32 DVG70-114 motif alone conserve strong immunostimulatory activity in the presence of a 5' end overhang.
- 3'-overhang DVG70-1 14 motif (SEQ ID NO: 22).
- 5' and 3'-overhang DVG70-1 14 motif (SEQ ID NO: 23).
- Blunt DVG70-1 14 motif alone (SEQ ID NO: 1).
- Mock Untreated control.
- the present disclosure is based, at least in part, on the discovery of an RNA motif (DVG 70 -H4) that is capable of eliciting a strong immune response.
- the RNA motif, DVG 70 - 1 14, facilitates recognition of viral RNA by R1G-I like receptors (RLRs) and/or Toll-like receptors (TLRs) and promotes the onset of the antiviral response.
- this RNA motif can be modified for stronger immunostimulatory activity and can be engineered into immunologically inert or weak RNA to enhance the RNA immunostimulatory potential.
- the motif can be stabilized by modifying its sequence or using chemical molecules.
- RNA motif DVG 7 0-1 14 or modified motif forms can be used as immunostimulants in vivo and used as adjuvants along with vaccines, antigens, and other substances to enhance host immune responses.
- DVG 70 .1 14 or its modified motif forms represent novel PAMP enhancer motifs.
- the DVG 70 -1 14 motif has been shown to confer strong immunostimulatory activity to inert RNA molecules (e.g., non-immunostimulatory virus molecules, non-viral RNA molecules, and the like).
- inert RNA molecules e.g., non-immunostimulatory virus molecules, non-viral RNA molecules, and the like.
- the immunostimulatory activity can be conferred upon an inert RNA molecule by cloning the motif, or modified forms of the motif, into the sequence of a naturally-occurring immunologically inert RNA molecule.
- the immunostimulatory activity of these motifs can be transferred to a naturally-occurring inert RNA molecule by cloning the motifs into the X-region of the hepatitis C virus (HCV) (a non- immunostimulatory small RNA derived from the HCV viral genome).
- HCV hepatitis C virus
- the immunostimulatory activity can be conferred upon any RNA molecule that contains or is modified to contain 5' triphosphates or phosphate analogs by cloning the motif into the sequence of the RNA molecule.
- these motifs can also be attached to antibodies allowing for targeted delivery of the motifs allowing for localized immunostimulation.
- these motifs can be attached to an antibody directed to an antigen found on a specific tumor cell.
- these motifs enhance the host's immune response to the tumor cells.
- these motifs can be also targeted to antigen presenting cells, such as dendritic cells and macrophages, to trigger their maturation and activity.
- these motifs are targeted to a specific organ to generate a localized inflammatory response, for example, but not limited to the lung, liver, kidney, heart, penis, uterus, eye, brain, intestine, skin, joints, or bone.
- these motifs can be conjugated with antigens and/or natural or synthetic nanoparticles, for example, but not limited to, liposomes, virus like particles, polymers, etc, for the development of novel vaccines.
- these motifs act as an immune-potentiator.
- motifs can be also conjugated to (or combined with) adjuvants to modify or improve their activity.
- the motifs can be combined or conjugated with alum to promote the generation of a Thl -biased immune response.
- the combination of these motifs with adjuvant emulsions for example, but not limited to MF59.
- these motifs can be encapsulated with natural or synthetic nanoparticles, for example, but not limited to, liposomes, virus like particles, polymers, etc. for the development of novel vaccines.
- the positive (+)RNA strands of SeV copy-back DVGs are associated with strong stimulation of the antiviral response.
- the (+)RNA strands or their derivatives of SeV can also be used, in certain embodiments, as immunostimulants in vivo.
- a "subject" or a “patient” is a human or non- human animal.
- the animal subject is preferably a human
- the compounds and compositions of the invention have application in veterinary medicine as well, e.g., for the treatment of domesticated species such as canine, feline, murine, and various other pets; farm animal species such as bovine, equine, ovine, caprine, porcine, etc.; and wild animals, e.g., in the wild or in a zoological garden, such as non-human primates.
- Adjuvant means any substance that increases the humoral or cellular immune response to an antigen. Adjuvants are generally used to accomplish two objectives: they slow the release of antigens from the injection site, and they stimulate the immune system.
- Antibody refers to an immunoglobulin molecule that can bind to a specific antigen as the result of an immune response to that antigen.
- Immunoglobulins are serum proteins composed of "light” and “heavy” polypeptide chains having "constant” and “variable” regions and are divided into classes (e.g., IgA, IgD, IgE, IgG, and IgM) based on the composition of the constant regions.
- Antigen refers to any substance that stimulates an immune response.
- the term includes killed, inactivated, attenuated, or modified live bacteria, viruses, fungi or parasites or parasite eggs, etc.
- the term antigen also includes polynucleotides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, or lipids, or fragments thereof, individually or in any combination thereof.
- the term antigen also includes antibodies, such as anti-idiotype antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope).
- RNA motif as used herein includes, but is not limited to, the isolated R A molecule DVG 7 O-I M (SEQ ID NO: l ) or modified variants (e.g., SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:23) that signal for the activation of transcription factors that trigger the expression of antiviral and/or pro-inflammatory molecules.
- Modified variants include mutant DVG 70- n4 forms that results in enhancement of DVG 70 .11 signaling.
- these modified variants are generated by the substitution, deletion, or addition of a nucleotide(s).
- a modified motif form can include an additional A-U base pair in the long stem region of DVG 70 -u4 creating a 47 nucleotide stabilized variant (e.g. SEQ ID NO:2).
- a modified motif form can include additional nucleotides can be added either to the 5 ' or the 5' and 3' end of the DVG 70- i l4 (e.g., SEQ ID NO: 23).
- Immune response in a subject refers to the development of a humoral immune response, a cellular immune response, or a humoral and a cellular immune response to an antigen. Immune responses can usually be determined using standard immunoassays and neutralization assays, which are known in the art.
- Cellular immune response or “cell mediated immune response” is one mediated by T-lymphocytes or other white blood cells or both, and includes the production of cytokines, chemokines and similar molecules produced by activated T-cells, white blood cells, or both.
- Human immune response refers to one that is mediated by antibodies.
- immunogenicly protective amount or "immunologically effective amount” or "effective amount to produce an immune response" of an antigen is an amount effective to induce an immunogenic response in the recipient.
- the immunogenic response can be sufficient for diagnostic purposes or other testing, or can be adequate to prevent signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a disease agent. Either humoral immunity or cell-mediated immunity or both can be induced.
- the immunogenic response of an animal to an immunogenic composition can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain, whereas the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature number, overall physical condition, and overall health and performance of the subject.
- the immune response can comprise, without limitation, induction of cellular and/or humoral immunity.
- immunogenic means evoking an immune or antigenic response.
- an immunogenic composition would be any composition that induces an immune response.
- Immunoser molecule refers to a molecule that generates an immune response.
- Treatment refers to obtaining a desired pharmacologic and/or physiologic effect.
- the effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease.
- Treatment covers any treatment of a disease in a subject or patient and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.
- Therapeutically effective amount refers to an amount of an antigen or vaccine that would induce an immune response in a subject receiving the antigen or vaccine which is adequate to prevent or reduce signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a pathogen, such as a virus or a bacterium.
- Humoral immunity or cell-mediated immunity or both humoral and cell-mediated immunity can be induced.
- the immunogenic response of a subject to a vaccine can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain.
- the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature, overall physical condition, and overall health of the subject.
- the amount of a vaccine that is therapeutically effective can vary depending on the particular adjuvant used, the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art.
- “Pharmaceutical composition” and “pharmaceutical formulation,” as used herein, refer to a composition which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a patient to which the formulation would be administered.
- “Pharmaceutically acceptable,” as used herein, e.g., with respect to a “pharmaceutically acceptable carrier,” refers to the property of being nontoxic to a subject.
- a pharmaceutically acceptable ingredient in a pharmaceutical fonnulation can be an ingredient other than an active ingredient that is nontoxic.
- a pharmaceutically acceptable carrier can include a buffer, excipient, stabilizer, and/or preservative.
- Lipids refers to any of a group of organic compounds, including the fats, oils, waxes, sterols, and triglycerides, which are insoluble in water but soluble in nonpolar organic solvents, are oily to the touch, and together with carbohydrates and proteins constitute the principal structural material of living cells.
- Liposome refers to a microscopic spherical particle formed by a lipid bilayer enclosing an aqueous compartment, used medicinally to carry a drug, antigen, vaccine, enzyme, or another substance to targeted cells in the body.
- Vaccine refers to a composition that includes an antigen, as defined herein. Administration of the vaccine to a subject results in an immune response, generally against one or more specific diseases.
- the amount of a vaccine that is therapeutically effective can vary depending on the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art.
- a vaccine can comprise a live attenuated virus in a suitable pharmaceutically, or physiologically acceptable carrier, such as isotonic saline or isotonic salts solution.
- suitable pharmaceutically, or physiologically acceptable carrier such as isotonic saline or isotonic salts solution.
- the appropriate carrier will be evident to those skilled in the art and will depend in large part upon the route of administration.
- vaccines composed of polynucleotide molecules desirably contain optional polynucleotide facilitating agents or "co- agents", such as a local anesthetic, a peptide, a lipid including cationic lipids, a liposome or lipidic particle, a polycation such as polylysine, a branched, three-dimensional polycation such as a dendrimer, a carbohydrate, a cationic amphiphile, a detergent, a benzylammonium surfactant, or another compound that facilitates polynucleotide transfer to cells.
- polynucleotide facilitating agents or co- agents such as a local anesthetic, a peptide, a lipid including cationic lipids, a liposome or lipidic particle, a polycation such as polylysine, a branched, three-dimensional polycation such as a dendrimer, a carbohydrate, a cati
- Carcer includes, for example, skin cancers (melanoma and squamous cell carcinoma), pancreatic cancer, kidney cancer, e.g., renal cell carcinoma (RCC), urogenital cancer, e.g., urothelial carcinomas in urinary bladder, kidney, pelvic and ureter, melanoma, prostate carcinoma, lung carcinomas (non-small cell carcinoma, small cell carcinoma, neuroendocrine carcinoma and carcinoid tumor), breast carcinomas (ductal carcinoma, lobular carcinoma and mixed ductal and lobular carcinoma), thyroid carcinomas (papillary thyroid carcinoma, follicular carcinoma and medullary carcinoma), brain cancers (meningioma, astrocytoma, glioblastoma, cerebellum tumors, medullob!astoma, ependymoma), ovarian carcinomas (serous, mucinous and endometrioid types), cervical cancers (squamous cell carcinoma in situ
- a "tumor” includes any tumor resulting or associated with from any of the above cancers.
- RNA motifs are used as adjuvants or immunostimulatory agents to activate antigen presenting cells, such as dendritic cells, or structural cells, such as fibroblasts and muscle, to trigger cytokine expression and enhance host immune responses to an antigen.
- the RNA motifs described herein have increased immunostimulatory activity as compared to DVG particles or DVG-derived RNA molecules containing larger portions of the DVG sequence.
- the motifs described herein can trigger an innate immune response in any cell. This is a major advantage of triggering the RLRs (e.g., RIG-I and MDA5) over Toll-like receptors (TLRs), as RLRs are expressed in all cells, while TLRs are mostly restricted to antigen presenting cells.
- RLRs e.g., RIG-I and MDA5
- TLRs Toll-like receptors
- the stem region of motif DVG70-1 14 provides stability to the motif structure and can be modified to enhance stability by, for example, engineering additional base pairs, or replacing weak interactions (A:T) with stronger ones (C:G). Residues at the tip or bulk of the molecules could also be modified to enhance stability and binding to innate immune receptors. In addition, alterations in or to the sequence of the motif that maintain its structure can be introduce to maximize immune stimulation. Immunostimulatory activity can be measured by the methods described herein (e.g., in the Examples), and methods known in the art.
- the RNA motif is DVG70-1 H- In certain embodiments, the RNA motif is a modified variant of DVG 70 -H4- In certain embodiments, the modified RNA motifs can contain nucleotide substitutions, deletions, inversions and insertions of the DVG70- 1 14 motif, but still retain immunostimulatory activity. In certain embodiments, the modified RNA motif includes a DVG 70- i H with an elongated long stem region, but which still retain immunostimulatory activity. In certain embodiments, the modified RNA motif includes an additional A-U pair assertion into the DVG 7 o-i u long stem region (e.g., SEQ ID NO:2). In certain embodiments, the modified RNA motif includes a C-G insertion. In certain embodiments, the modified RNA motif includes a point mutation that maintains or enhances activity (e.g., SEQ ID NO:5).
- the modified RNA motif can also be stabilized by adding an overhang (i.e., additional nucleotide residues) to either the 5 ' or 5' and 3 ' end of the DVG70-1 14 motif.
- an overhang i.e., additional nucleotide residues
- either the 5' or 3' overhang are complementary.
- at least a portion of the 5' and 3 ' overhang extend the stem portion of the DVG70- 1 14 motif.
- at least a portion of the 5 ' and 3 ' overhang is complementary.
- the additional nucleotides can be from the parent DVG-268 sequence (e.g. ,SEQ ID NO: 22).
- the additional nucleotides are not from the parent DVG-268 sequence (e.g. ,SEQ ID NO: 24). In certain embodiments, the additional nucleotides of one overhang can be from the parent DVG-268 sequence while the additional nucleotides of the other overhang are not (e.g. ,SEQ ID NO: 23).
- 5 to 1 5 nucleotides can be added to the 5 ' end of the DVG70- 1 14 motif.
- 5 to 1 0, 1 0 to 1 5, or 10 to 20 nucleotides can be added to the 5' end of the DVG70-1 1 4 motif.
- 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 1 5, 1 6, 17, 1 8, 1 9, or 20 nucleotides can be added to the 5' end of the DVG70- 1 14 motif.
- 5 nucleotides can be added to the 5 ' end of the DVG70- 1 14 motif (e.g., SEQ ID NO:24).
- 5 to 1 5 nucleotides can be added to the 3' end of the DVG70- 1 14 motif. In certain embodiments, 5 to 1 0, 10 to 1 5, or 10 to 20 nucleotides can be added to the 3 ' end of the DVG70- 1 14 motif. In certain embodiments, 5, 6, 7, 8, 9, 10, 1 1 , 12, 1 3, 14, 15, 1 6, 1 7, 1 8, 1 9, or 20 nucleotides can be added to the 3 ' end of the DVG70- 1 14 motif. In certain embodiment, 1 5 nucleotides can be added to the 3 ' end of the of the DVG70- 1 14 motif.
- 5 nucleotides can be added to the 5 ' end and 1 5 nucleotides can be added to the 3' end of the DVG70-1 14 motif (SEQ ID NO:23).
- the 5' and 3' overhang has 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or 15 complementary pairs.
- the 5' and 3 ' overhang has about 2 to about 5 complementary pairs.
- the 5' and 3' overhang has about 3 complementary pairs (e.g., SEQ ID NO:23).
- the modified RNA motif can also be stabilized by chemical modifications. In certain embodiments, the modified RNA motif can also be modulated in a negative way with point mutations.
- the motif can be in vitro transcribed or made synthetically and used as an RLR ligand in vitro or in vivo.
- DVG-268 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU U106G UCCCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU
- DVG-268 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU A89U UCCCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU
- DVG-268 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU C97G UCCCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU
- RNA motifs into a subject or cell can be either direct, in which case the subject or cell is directly exposed to the naked nucleic acid, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then introduced or reintroduced into the patient.
- RNA motifs of the present disclosure can be directly administered in vivo, e.g., combined with an antigen or vaccine to form an adjuvant composition.
- the RNA motif (or motifs) e.g., SEQ ID NO:l ; SEQ ID NO:2; SEQ ID NO:5), or a modified variant of SEQ ID NO:l having irnmunostimulatory activity, can be administered in vivo.
- the RNA motif is conjugated to additional nucleotides to impart its irnmunostimulatory activity.
- the modified RNA motif can have additional nucleotides at the 5' or 5' and 3' end of the DVG70-1 14 motif as described above (e.g., SEQ ID NO: 23).
- the DVG70-1 14 motif can be conjugated to a natural or synthetic nanoparticles, for example, but not limited to, liposomes, virus like particles, polymers to impart its irnmunostimulatory activity.
- Administered in vivo can be accomplished by any of numerous methods known in the art, e.g., by direct injection of naked RNA.
- the RNA motif can be injected, aerosolized, electroporated in the skin or muscle, or used intranasally, etc.
- the RNA motif can also be administered by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide.
- the nucleic acid-ligand complexes can also be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
- the RNA motifs can also be stabilized with cationic molecules, e.g., Poly-L Lysine, or attached to nanoparticles for delivery.
- the nanoparticles can also contain one or more antigen.
- the RNA motifs can be conjugated with antigen for delivery.
- the RNA motif can be conjugated to parasite eggs, proteins, etc.
- the RNA motifs can also be delivered along with the antigen and an additional immunological adjuvant.
- motifs can be also conjugated to or combined with adjuvants to modify or improve their activity.
- Immunological adjuvants include, but are not limited to: aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate, aluminum sulfate, etc.; oil-in- water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components) (e.g., mineral oil), such as for example MF59 (International Publication No.
- WO 90/14837 containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts of MTP-PE (see below), although not required) formulated into submicron particles using a microfluidizer such as Model 110Y micro fluidizer (Microfluidics, Newton, Mass.), SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121 , and thr-MDP either microfiuidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and RibiTM adjuvant system (RAS), (Ribi Immunochem, Hamilton, Mont.) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL) (e.g.
- MPL monophosphorylipid A
- saponin adjuvants such as Quil A, or QS21 (e.g., StimulonTM (Cambridge Bioscience, Worcester, Mass.)) may be used or particle generated therefrom such as ISCOMs (immunostimulating complexes); Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IF A); cytokines, such as interleukins (IL- 1 , IL-2, etc.), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; detoxified mutants of a bacterial ADP-ribosylating toxin such as a cholera toxin (CT) (either in a wild-type or mutant form, e.g., wherein the glutamic acid at amino acid position 29 is replaced by another amino acid, preferably a histidine, in accordance with International Patent Application No.
- CFA Complete Freunds Adjuvant
- IF A Incomplete Freunds Adjuvant
- cytokines such
- PCT/US99/22520 a pertussis toxin (PT), killed Bordetella, or an E. coli heat-labile toxin (LT), particularly LT-K63 (where lysine is substituted for the wild-type amino acid at position 63) LT-R72 (where arginine is substituted for the wild-type amino acid at position 72), CT-S 109 (where serine is substituted for the wild-type amino acid at position 109), and PT-K9/G129 (where lysine is substituted for the wild-type amino acid at position 9 and glycine substituted at position 129) (see, e.g., International Publication Nos.
- RNA motifs can be combined or conjugated with alum to promote the generation of an immune response (e.g. a Thl -biased immune response). In certain embodiments the combination of these motifs with adjuvant emulsions, for example, but not limited to MF59.
- the these motifs can be combined with MF59 to promote the generation of an immune response (e.g. a Thl -biased immune response).
- the motif is conjugated with MF59 to promote the generation of an immune response (e.g. a Thl -biased immune response).
- the ratio of RNA motif to adjuvant can range from about 1 ⁇ g motif : about 100 ⁇ adjuvant formulation. In certain embodiments, the ratio of RNA motif to adjuvant formulation can range from about 1 ⁇ g motif : about 95 ⁇ adjuvant formulation; about 1 ⁇ g motif : about 90 ⁇ adjuvant formulation; about 1 ⁇ g motif : about 85 ⁇ adjuvant formulation; about 1 g motif : about 80 ⁇ adjuvant formulation; about 1 ⁇ g motif : about 75 ⁇ adjuvant formulation; about 1 ⁇ g motif : about 70 ⁇ adjuvant formulation; about 1 ⁇ g motif : about 65 ⁇ adjuvant formulation; about 1 ⁇ g motif : about 60 ⁇ adjuvant formulation; about 1 ⁇ motif : about 55 ⁇ adjuvant formulation; about 1 ⁇ 3 ⁇ 4 motif : about 50 ⁇ ] adjuvant formulation; about 1 ⁇ g motif : about 45 ⁇ adjuvant formulation; about 1 ⁇ g motif : about 45 ⁇ adjuvant formulation;
- the ratio of RNA motif to adjuvant formulation can be about 10-50 pmols of the motif : about 40 ⁇ adjuvant formulation. In certain embodiments, the ratio of RNA motif to adjuvant formulation can be about 10 pmols motif : about 40 ⁇ !
- the RNA motifs can also be constructed as part of an appropriate vector (viral or otherwise).
- vector means the vehicle by which a nucleic acid sequence can be introduced into a cell.
- Vectors include plasmids, phages, viruses, etc.
- a "therapeutic vector”, as used herein, refers to a vector which is acceptable for administration to an animal, and particularly to a human.
- Vectors typically comprise the DNA of a transmissible agent, into which foreign nucleic acid molecule is inserted.
- a common way to insert one nucleic acid molecule into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites.
- restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites.
- the foreign nucleic acid molecule is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
- Suitable vectors include viruses, such as adenoviruses, adeno-associated virus (AAV), lentiviral vectors, vaccinia, herpesviruses, paramyxoviruses, Sendai Virus, RNA-based viruses, Newcastle disease virus, baculoviruses, orthomyxovirus, RNA-based viruses, retroviruses, parvovirus, lentivirus, bacteriophages, cosmids, plasmids, fungal vectors, and other recombination vehicles typically used in the art.
- viruses such as adenoviruses, adeno-associated virus (AAV), lentiviral vectors, vaccinia, herpesviruses, paramyxoviruses, Sendai Virus, RNA-based viruses, Newcastle disease virus, baculoviruses, orthomyxovirus, RNA-based viruses, retroviruses, parvovirus, lentivirus, bacteriophages, cosmids,
- RNAs of the present disclosure are described in, for example, but not by way of limitation, Clegg, C. H. et al Proc Natl Acad Sci U S A 109, 17585-17590, (2012); Thim, H. L. et al. Vaccine M, 4828-4834, (2012); Alving, C. R., et al. Curr Opin Immunol 24, 310-315, (2012); Baldwin, S. L. et al T Immunol 188, 2189- 2197 (2012); Nordly, P. et al. J Control Release 150, 307-317, (201 1 ); Schneider-Ohrum, K. et al.
- the RNA motifs of the disclosed subject matter can be administered parenterally, e.g., subcutaneously or intramuscularly, aerosolized, electroporated in the skin or muscle, or used intranasally, etc., or delivered by any other suitable route for delivery of RNA alone or in combination with a vaccine
- the compositions of the disclosed subject matter can be administered topically onto the skin or to the mucosa of a subject (see, e.g., Pavot, V., Vaccine 2012 Jan 5;30(2): 142-54 and Bal, SM J. Control Release 2010 Dec 20;148(3);266-82).
- the RNA motifs of the presently disclosed subject matter can be administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens.
- the RNA motif (or motifs) can be provided together with or conjugated to the antigen.
- the RNA motif (or motifs) can be can be conjugated to or encapsulated in a natural or synthetic nanoparticle, for example, but not limited to, liposomes, virus like particles, polymers to impart its immunostimulatory activity.
- the RNA motif (or motifs) ⁇ e.g., SEQ ID NO: 1 ; SEQ ID NO:2; SEQ ID NO:5), or a modified variant of SEQ ID NO:l having immunostimulatory activity, can be administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens.
- the RNA motif is conjugated to additional nucleotides and administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens.
- the modified RNA motif can have additional nucleotides at the 5' or 5' and 3' end of the DVG70-1 14 motif as described above ⁇ e.g., SEQ ID NO: 23).
- the antigen can be any of a wide variety of substances capable of producing a desired immune response in a subject.
- the antigens used with these adjuvant compositions can be one or more of viruses (inactivated, attenuated, and modified live), bacteria, fungi, parasites, parasite eggs, nucleotides, polynucleotides, peptides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, carbohydrates, fatty acids, teichioc acid, peptidoglycans, lipids, or glycolipids, individually or in any combination thereof.
- the antigens used with the adjuvants of the disclosed subject matter can also include immunogenic fragments of nucleotides, polynucleotides, peptides, polypeptides, that can be isolated from the organisms referred to herein. In certain embodiments, they can also be in the form of DNA vaccines.
- Live, modified-live, and attenuated viral strains are those that either do not cause disease in a subject have been isolated in non-virulent form or have been attenuated using methods well known in the art, including serial passage in a suitable cell line or exposure to ultraviolet light or a chemical mutagen.
- Inactivated or killed viral strains are those which have been inactivated by methods known to those skilled in the art, including treatment with formalin, betapropriolactone (BPL), binary ethyleneimine (BEI), sterilizing radiation, heat, or other such methods.
- two or more antigens can be combined to produce a polyvalent composition that can protect a subject against a wide variety of diseases caused by the pathogens. While conventional adjuvants are often limited in the variety of antigens with which they can be effectively used (either monovalently or polyvalently), the adjuvants described herein can be used effectively with a wide range of antigens, both monovalently and polyvalently. Thus, in certain embodiments, the antigens described herein can be combined in a single composition comprising the adjuvants described herein.
- pathogenic viruses that can be used as antigens in the compositions and methods of the present subject matter include hepatitis (A, B, or C), herpes virus (e.g., VZV, HSV-l , HAV-6, HSV-il, and CMV, Epstein Barr virus), adenovirus, influenza virus, flavi viruses, echovirus, rhinovirus, coxsackie virus, cornovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, molluscum virus, poliovirus, rabies virus, JC virus and arboviral encephalitis virus.
- herpes virus e.g., VZV, HSV-l , HAV-6, HSV-il, and CMV, Epstein Barr virus
- adenovirus e.g., influenza virus, flavi viruses, echovirus, rhinovirus,
- pathogenic bacteria that can be used as antigens in the compositions and methods of the present subject matter include chlamydia, rickettsial bacteria, mycobacteria, staphylococci, streptococci, pneumonococci, meningococci and conococci, klebsiella, proteus, serratia, pseudomonas, legionella, diphtheria, salmonella, bacilli, cholera, tetanus, botulism, anthrax, plague, leptospirosis, and Lymes disease bacteria.
- pathogenic fungi that can be used as antigens in the compositions and methods of the present subject matter include Candida (albicans, krusei, glabrata, tropicalis, etc.), Cryptococcus neoformans, Aspergillus (fumigatus, niger, etc.), Genus Mucorales (Mucor, Absidia, Rhizophus), Sporothrix schenkii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis and Histoplasma capsulatum.
- Candida albicans, krusei, glabrata, tropicalis, etc.
- Cryptococcus neoformans Aspergillus (fumigatus, niger, etc.)
- Genus Mucorales Macor, Absidia, Rhizophus
- Sporothrix schenkii Blastomyces dermatitidis
- Paracoccidioides brasiliensis Coccidioides im
- pathogenic parasites that can be used as antigens in the compositions and methods of the present subject matter include Entamoeba histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba sp., Giardia lambia, Cryptosporidium sp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondi, Nippostrongylus brasiliensis, and Schistosomiasis.
- Tumor antigens can also be used in the adjuvant compositions of the present subject matter.
- Many strategies for vaccination against tumors have been devised (see Rosenberg, S., 2000, Development of Cancer Vaccines, ASCO Educational Book Spring: 60- 62; Logothetis, C, 2000, ASCO Educational Book Spring: 300-302; Khayat, D. 2000, ASCO Educational Book Spring: 414-428; Foon, K. 2000, ASCO Educational Book Spring: 730-738; see also Restifo, N. and Sznol, M., Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita, V. et al.
- a vaccine is prepared using autologous or allogeneic tumor cells. These cellular vaccines have been shown to be most effective when the tumor cells are transduced to express GM-CSF. GM-CSF has been shown to be a potent activator of antigen presentation for tumor vaccination (Dranoff et al. (1993) Proc. Natl. Acad. Sci U.S.A. 90 (80: 3539-43).
- tumor specific antigens are differentiation antigens expressed in the tumors and in the cell from which the tumor arose, for example melanocyte antigens gp 100, MAGE antigens, Trp-2. More importantly, many of these antigens can be shown to be the targets of tumor specific T cells found in the host.
- the tumor antigen can also include the protein telomerase, which is required for the synthesis of telomeres of chromosomes and which is expressed in more than 85% of human cancers and in only a limited number of somatic tissues (Kim, N et al. (3994) Science 266, 201 1-2013). (These somatic tissues can be protected from immune attack by various means).
- Tumor antigen can also be "neo-antigens" expressed in cancer cells because of somatic mutations that alter protein sequence or create fusion proteins between two unrelated sequences (i.e. bcr-abl in the Philadelphia chromosome), or idiotype from B cell tumors.
- tumor vaccines can include the proteins from viruses implicated in human cancers such a Human Papilloma Viruses (HPV), Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV).
- HPV Human Papilloma Viruses
- HBV and HCV Hepatitis Viruses
- KHSV Kaposi's Herpes Sarcoma Virus
- HSP heat shock proteins
- RNA motifs and vaccination methods of the present disclosure can also be used in conjunction with anti-cancer therapies (e.g., chemotherapy), to augment cancerous cell death by creating a more immunogenic environment in a subject afflicted with cancer.
- anti-cancer therapies e.g., chemotherapy
- Such combination therapy enhances cancer cell death and promotes a robust immune response capable of killing any residual cancer cells that have escaped treatment.
- anti-cancer therapies include radiation, surgery, and hormone deprivation (Kwon, E. et al (1999) Proc. Natl. Acad. Sci U.S.A. 96 (26): 15074-9).
- Angiogenesis inhibitors can also be used. Inhibition of angiogenesis leads to tumor cell death, which can feed tumor antigen into host antigen presentation pathways.
- cancer cells e.g., tumor cells isolated from a subject can be exposed to the adjuvants of the present subject matter and used to treat dendritic cells ex vivo.
- the mature ex vivo treated dendritic cells are then re-introduced into the patient and promote a robust immune response directed against the cancer cells.
- RNA motifs to confer immunostimuiatory activity to inert nucleotide molecules
- the RNA motifs of the presently disclosed subject matter can be cloned into the genome of a non-immunostimulatory virus (i.e., inert virus) to confer immunostimuiatory activity against the inert virus.
- the RNA motif is cloned onto the 5' end of a viral gene, the 3' end of a viral gene, and/or within the viral gene, yet will still retain immunostimuiatory activity.
- the viral genome can be either RNA or DNA.
- the RNA stem-loop structure is maintained and/or stabilized.
- the RNA motif DVG 7 o-n4 is cloned into the X-region from hepatitis C virus (HCV).
- the RNA motif (or motifs) e.g., SEQ ID NO: l ; SEQ ID NO:2; SEQ ID NO:5, SEQ ID NO:23
- the viral genome of hepatitis A, B, or C
- herpes virus e.g., VZV, HSV-1 , HAV-6, HSV-II, and CMV, Epstein Barr virus
- adenovirus influenza virus, flaviviruses, echovirus, rhinovirus, coxsackie virus, cornovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, molluscum virus, poliovirus,
- the UNA motif (or motifs) is cloned into pathogenic bacteria, fungi, parasites, or tumor antigens, yet still retains immunostimulatory activity.
- Exemplary bacteria, fungi, parasites, and tumor antigens are listed above with respect to the delivery of the RNA motifs along with antigens.
- the RNA motif (or motifs) is cloned into a polynucleotide, yet still retains immunostimulatory activity.
- the polynucleotide can be cDNA, genomic DNA, RNA, mRNA, RNAi, siRNAs, shRNAs, miRNA, etc.
- the polynucleotide can be mRNA.
- RNA motifs of the presently disclosed subject matter can be conjugated or linked to an antibody to confer targeted immunostimulatory activity at the location of antibody specific antigen.
- antibodies include, but are not limited to monoclonal antibodies, subject ' s species specific antibodies, mammalian antibodies, human antibodies, humanized antibodies, camelid antibodies, chimeric antibodies, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the present disclosure).
- the antibodies can be of any isotype/class (e.g., IgG, IgE, IgM, IgD, IgA and IgY), or subclass (e.g., IgGl , IgG2, IgG3, IgG4, IgAl and IgA2).
- the RNA motifs are conjugated or linked to an antigen binding fragment.
- the linkage can be covalent bonds, or non-covalent interactions such as through electrostatic forces.
- Various linkers known in the art, can be employed in order to form the immunoconjugate.
- the immunoconjugate can be provided in the form of a fusion protein that may be expressed from a polynucleotide encoding the immunoconjugate.
- a "fusion protein” refers to proteins created through the joining of two or more genes or gene fragments which originally coded for separate proteins (including peptides and polypeptides). Translation of the fusion gene results in a single protein with functional properties derived from each of the original proteins.
- the RNA motifs of the present disclosure can be formulated as pharmaceutical compositions or pharmaceutical formulations by admixture with a pharmaceutically acceptable carrier or excipient.
- the pharmaceutical formulations can include one or more RNA motifs and a physiologically acceptable diluent or carrier.
- the pharmaceutical composition can further include an antigen, drug, adjuvant, or tumor chemotherapy.
- the pharmaceutical formulation can be a solid dosage form.
- the solid dosage form can be a tablet or capsule.
- the pharmaceutical formulation can be a liquid formulation.
- the liquid formulation can be an oral solution or oral suspension.
- the pharmaceutical formulation can be a transdermal drug delivery system, e.g., a patch, cream, gel, and/or microemulsion.
- the pharmaceutical formulation can include liposomes, nanoparticles, and/or other carriers.
- the pharmaceutical formulation can include an adjuvant or enhancer, e.g., an enzyme inhibitor.
- the pharmaceutical formulation can be a direct infusion. In certain embodiments, the pharmaceutical formulation can be an implantable device.
- compositions of the disclosure are prepared in the form of, for example, liquids, powders, aerosols, tablets, capsules, enteric coated tablets or capsules, or suppositories.
- compositions of the present disclosure suitable for inoculation or for parenteral or oral administration, comprise attenuated or inactivated forms of mammalian viruses, for example, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
- the composition can further comprise auxiliary agents or excipients, as known in the art.
- a virus vaccine composition of the present disclosure can comprise from about 10 2 -10 9 plaque forming units (PFU)/ml, or any range or value therein, where the virus is attenuated.
- a vaccine composition comprising an inactivated virus can comprise an amount of virus corresponding to about 0.1 to 200 micrograms of an antigenic protein/ml or combinations thereof, or any range or value therein.
- preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and/or emulsions, which can contain auxiliary agents or excipients known in the art.
- non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
- Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption.
- Liquid dosage forms for oral administration can generally comprise a liposome solution containing the liquid dosage form.
- Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water.
- inert diluents commonly used in the art, such as purified water.
- such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents. See, e.g., Berkow, infra, Goodman, infra, Avery's, infra, Osol, infra and Katzung, infra, which are incorporated in their entirety herein by reference.
- a vaccine composition of the present disclosure used for administration to an individual, can further comprise salts, preservatives, chemical stabilizers, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition.
- stabilizers, adjuvants, and preservatives are optimized to determine the best formulation for efficacy in the target human or animal.
- Suitable exemplary preservatives include chlorobutanol potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.
- Suitable stabilizing ingredients which can be used include, for example, casamino acids, sucrose, gelatin, phenol red, N-Z amine, monopotassium diphosphate, lactose, lactalbumin hydrolysate, and dried milk.
- the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the mammal being immunized. Examples of adjuvants are discussed above. Additional examples of materials suitable for use in vaccine compositions are provided in Osol, A., ed., Remington's Pharmaceutical Sciences, Mack Publishing Co, Easton, Pa. (1980), pp. 1324-1341, which reference is incorporated in its entirety herein by reference.
- heterogeneity in the vaccine can be provided by mixing different modified viruses of the disclosed subject matter, such as 2-50 modified viruses or any range or value therein.
- a pharmaceutical composition according to the present disclosure can further or additionally comprise at least one viral chemotherapeutic compound, including, but not limited to, gamma globulin, amantadine, ribavirin, guanidine, hydroxybenzimidazole, interferon-alpha, interferon-beta, interferon-gamma, thiosemicarbarzones, methisazone, rifampin, ribavirin, a pyrimidine analog, a purine analog, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, a protease inhibitor, or ganciclovir (neuraminidase inhibiting drugs oseltamivir, zanamivir). See, e.g., Katzung, infra, and the references cited therein on pages 798-800 and 680-681 , respectively, which references are herein entirely incorporated by reference
- a pharmaceutical composition according to the present disclosure can further or additionally comprise an aptamer to target a specific cell as provided in Bunka D. and Stockley P., "Aptamer come of age - at last,” Nature Reviews Microbiology and Majumder P, et al., “From bench side research towards patented molecules with therapeutic applications,” Expert Opin Ther Pat. 2009 Nov; 19(1 1 ): 1603- 13, references which are herein entirely incorporated by reference.
- the vaccine can also contain variable but small quantities of endotoxin, free fomialdehyde, and preservative, which have been found safe and not contributing to the reactogenicity of the vaccines for humans.
- the administration of a vaccine composition of the disclosure can be for either ''prophylactic" or "therapeutic" purposes.
- the compositions are provided before any symptom of infection becomes manifest.
- the prophylactic administration of the composition serves to prevent or attenuate any subsequent infection.
- the vaccine is provided upon the detection of a symptom of actual infection.
- the therapeutic administration of the compound(s) serves to attenuate any actual infection. See, e.g, Berkow, infra, Goodman, infra, Avery, infra and atzung, infra, which are entirely incorporated herein by reference.
- an attenuated or inactivated vaccine composition of the present disclosure can thus be provided either before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
- a vaccine or composition of the present disclosure is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient that enhances at least one primary or secondary humoral or cellular immune response against at least one strain of an infectious virus.
- the "protection" provided need not be absolute, i.e., the viral infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population or set of patients. Protection can be limited to mitigating the severity or rapidity of symptom onset of infection or disease.
- an "effective amount" of a vaccine composition is one that is sufficient to achieve a desired biological effect. It is understood that the effective dosage can be determined by a medical practitioner based on a number of variables including the age, sex, health, and weight of the recipient, kind of concurrent treatment , if any, frequency of treatment, and the nature of the desired outcome. In certain embodiments, the ranges of effective doses provided below are not intended to limit the disclosed subject matter, but are provided as representative preferred dose ranges. However, in certain embodiments, the most preferred dosage will be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation.
- the dosage of an attenuated virus vaccine for a mammalian (e.g., human) adult can be from about 10 3 -10 7 plaque forming units (PFU)/kg, or any range or value therein.
- the dose of inactivated vaccine can range from about 1 to 50 micrograms of an antigenic protein.
- the dosage should be a safe and effective amount as determined by conventional methods, using existing vaccines as a starting point.
- the dosage of immunoreactive protein in each dose of virus or modified virus vaccine can be standardized to contain a suitable amount, e.g., 1 -50 micrograms or any range or value therein, or an amount recommended by the U.S. Public Health Service (PHS).
- a suitable amount e.g. 1 -50 micrograms or any range or value therein, or an amount recommended by the U.S. Public Health Service (PHS).
- PHS U.S. Public Health Service
- Each 0.5-ml dose of vaccine preferably contains approximately 1 -50 billion virus particles, and preferably 10 billion particles.
- a method of immunizing includes both methods of protecting an individual from pathogen challenge, as well as methods for treating an individual suffering from pathogen infection. Accordingly, the present disclosure can be used as a vaccine for prophylactic protection and/or in a therapeutic manner; that is, as a reagent for immunotherapeutic methods and preparations.
- Example 1 DVGs promote protection to infection with an unrelated virus.
- SeV iDVGs induce a broad antiviral state that could protect against unrelated viral infections
- mouse cells were infected either with SeV C containing high levels of copy-back iDVGs (SeV HD) or with SeV C depleted of iDVGs (SeV LD) or left untreated (N/T) and re-infected 6 h later with the unrelated IAV.
- Cells pre-infected with SeV HD were significantly more resistant to IAV replication than were cells pre-infected with SeV LD (Fig. 1A) and induced higher antiviral gene expression levels (Fig. IB).
- RNA-fluorescent in situ hybridization in combination with immunofluorescence staining (IFA) showed that IRF3 translocation to the nucleus occurs predominantly in cells showing a strong DVG signal (Figs. 2C and 2D).
- IFA immunofluorescence staining
- Example 2 Identification of a candidate motif essential for type I IFN induction by (+)DVG RNA
- DVG-546 alterations in the internal (non-complementary) region of DVG-546 drastically affect its stimulatory ability (26). Specifically, a DVG-mutant retaining the 5 '' end of the internal sequence (DVG-324) promoted enhanced expression of type 1 IFNs upon transfection, while a mutant missing the 5' end of the interna! sequence (DVG- 354) significantly lost its stimulatory capacity (26). These data suggest that a specific region towards the 5' end of the internal sequence plays an essential role in maximizing the stimulatory potential of DVG RNA. Additional mutants further confirmed this prediction. One mutant that retained a shorter 5 f internal sequence (DVG-268; Fig.
- DVG(ivtDVG) RNAs were purified from gels, tested for purity and endotoxin content, and transfected into cells at equal molarity (see Fig. 7A to 7D).
- DVG70-1 14 spans the 3' end of the 5 ' complementary sequence and the 5' end of the internal sequence, consistent with a partial requirement for sequences of the complementary and internal regions of the DVG RNA. This analysis identified DVG 7 0-1 14 as a candidate motif that provides strong immuno stimulatory activity to SeV iDVG RNA.
- Example 3 DVG o-n is necessary for the strong stimulatory activity of SeV DVG RNA
- DVG70-1 14 was necessary for the strong stimulatory ability of SeV DVG RNA. Removal of DVG 70 .1 14 did not significantly affect other secondary structures of these molecules (Figs. 4E and 8C). Quality controls can be found in Fig. 8A and 8B. Removal of DVG 7 o-i i 4 nearly abolished the stimulatory activity of DVG-268, and cells transfected with ivtDVG- 268 ⁇ 7 ⁇ 4 expressed significantly lower levels of IFNB1 and IFITI mRNA compared to cells transfected with ivtDVG-268 (Fig. 4F).
- SeV stocks including recombinant defective viral particles were generated containing the DVG70-1 14 motif (rDVG-324) or lacking this motif (rDVG-354) as shown in Fig. 4A and 9A (26).
- rDVG-324 DVG70-1 14 motif
- rDVG-354 DVG70-1 14 motif
- LL-CM 2 cells were infected with virus rDVG-324 or rDVG-354 at an MOl of 5 TCID50/cell and analyzed at 6 h postinfection by RT-qPCR for the expression of IFN- ⁇ , IFITI , and SeV NP mRNA.
- the relative copy number ofDVGR A was quantified by RT-qPCR with the DVGcomp primers (see Table 2).
- X-region_DVG70-1 14 R a AGTCTTGGACTTATCCATATGACAAACTTGATCTGCAGAGAGGCCA
- DVG 7 o-n 4 promotes antiviral immunity in the presence of a virus-encoded antagonist
- cells were infected with SeV LD 24 h before transfection with either DVG-268 or DVG-268 A 70-i H -
- viral protein mRNA including NP and P V
- Fig. 9C viral protein mRNA
- Fig. 9D NT [nontransfected]
- Fig. 9D NT [nontransfected]
- Example 5 The 3' complementary end of iDVG RNA is not required for maximal IFN induction
- DVG-324NC As expected, the potent stimulatory activity of DVG-324NC depended on the DVG 70-1 14 motif as a DVG-324NCA7 O - H 4 mutant significantly lost stimulatory potential (Fig. I OC, 10D, and 10F).
- DVG5-51 an auxiliary secondary motif located more proximal to the 5'- triphosphate end of RNA in relation to DVG 70 .1 14 was next removed (Fig. IOC - blue circle and 10E). This motif is also preserved in all DVG mutants shown in Fig. 4.
- DVG 7 o-n 4 enhances the immunostimulatory activity of DVG RNA and functions independently of the 3'end complementary sequence or additional proximal secondary structures.
- Example 7 DVG70-114 motif confers strong immunostimulatory activity to inert RNA molecules
- DVG 7 o-n4 hepatitis C virus
- HCV hepatitis C virus
- Fig. 1 1 A RNA stem-loop structures present in both the DVG 70- u4 motif and the X-region
- X-regionJDVG o-n4 X-region based mutant that includes DVG70- 1 14
- X-region_DVG 7 o-i i4 also demonstrated an equivalent ability to stimulate antiviral gene expression when compared with HCV polyU/UC (13) (Fig.1 IB) .
- auxiliary DVG 5 _5 t motif (Fig. IOC and 10F).
- DVG 5- 51 motif is not required for immunostimulatory activity of DVG RNA.
- DVG 5-5 i is of a similar size as DVG 70 -n4 and causes equivalent disruption of the X region folding (Fig. 1 1 A).
- Introduction of the DVG5.51 motif did not alter the stimulatory activity of the X-region (Fig. 1 IB) demonstrating that DVG 7 o-n 4 has exceptional and transferrable immunostimulatory potential.
- DVG RNA The activity of DVG RNA was compared with that of other known RIG-I ligands. As shown in Fig. S5A, DVG-derived RNA binds to RIG-1 with an affinity equivalent to that of poly(U/UC) and RNA containing DVG 7 o-n 4 stimulates levels of antiviral expression equivalent to that of poly(U/UC) or the viral RNA synthetic analog poly(I ⁇ C) (see Fig. S5B and C).
- Example 8 The DVGTO-I H motif promotes binding of the RNA to RIG-I [001591] To establish whether the strong stimulatory activity of DVG-268 and DVG-324NC were mediated by RIG-I, these constructs were transfected into mouse embryo fibroblast lacking the essential RLR signaling molecule MAVS or lacking the RIG-I sensor. Similar to other DVG constructs (26), Ifnbl mRNA expression was completely dependent on MAVS and RIG-I activity for both mutants (Fig. 13A), while control polyI:C showed only MAVS, but not RIG-I dependency. In addition, Ifhbl stimulation was largely dependent on the presence of uncapped 5 '-triphosphates (Fig. 13B) and on RNA secondary structures (Fig. 13C).
- electrophoretic mobility shift assay (EMSA) was performed on DVG-RNA exposed to purified RIG-I proteins that lacked the signaling (CARD) domain. Binding was tested in both the absence or presence of ATP, which promotes RIG-I polymerization upon association to RNA.
- RIG-I deltaCARD was used previously in characterizing specific RNA binding signatures and demonstrated equivalent RNA binding affinity as their full-length parental protein (10, 36). RNAs containing the DVG 7 o-n 4 motif were more profoundly displaced in the gels than RNAs lacking this motif both in the absence and presence of ATP (Fig. 13D and 13E).
- Example 9 DVG70-1 14 has iramunostimulatory activity in vivo
- SeV iDVG-derived RNAs are natural RLR ligands that potentiate host antiviral innate immune responses (12, 26).
- the inventor has discovered an RNA secondary structure (DVG 7 o. f i 4 ) that significantly enhances the activity of inert RNA and provides outstanding immunostimulatory activity.
- the DVGvo-i u stem-loop motif shares little sequence homology with the standard viral genome, as it forms in the copy-back iDVG's "junction region" where the polymerase starts extending (or copying back) the nascent strand after been released from the template strand (12, 43, 44). Similar stem-loop structures are found in other copy-back DVGs generated during infection with SeV strains Cantell and 52 (data not shown), suggesting that this structure is broadly present during SeV infection.
- DVG-324NC (DVG-324 lacking the 3 '-complementary sequence) induced IFN expression equal to DVG-324 and this activity depended on an intact DVG 7 o- i i4-
- This result contradicts a previous study that shows a requirement for both 5' and 3' complementary sequences for the maintenance of SeV DVGs immunostimulatory functions (35).
- the disparity likely results from an unexpected impact of truncations of the complementary region on the structure of the DVG 70 - 1 14 motif leading to a misinterpretation of the need for the complementary region.
- DVG 7 o_n 4 facilitates the binding of the iDVG to RIG-I explaining its strong ability to trigger the antiviral response.
- DVG 7 o-i i4 in enhancing binding of MDA5 to DVG RNA observed, supporting previous findings of a role for MDA5 in the early detection of SeV iDVGs (34).
- a molecular motif has been identified that facilitates the activation of the antiviral immune response by enhancing the binding of RNAs to the intracellular viral sensor protein RIG-I.
- this motif can be harnessed to maximize the immunostimulatory activity of uncapped 5'triphosphate-containing RNAs and thus it represents a novel immunostimulatory enhancer that can be used in the development of vaccine adjuvants or antivirals.
- LLC-M 2 cells (Rhesus monkey kidney epithelial cells, ATCC, #DR-L2785), A549 cells (human type II alveolar cells, ATCC, #CCL185), and wild type, Ddx58 'L (RIG-I*) and Mavs '1' MEFs (mouse embryo fibroblast, kindly provided by Drs. J. agan and J. Chen) were cultured in DMEM supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 2 mL L-Glutamine, and 50 mg ml gentamicin or penicillin and streptomycin (all from Invitrogen). All cell lines were treated with mycoplasma removal agent (MP Biomedicals) before use. SeV Cantell HD (SeV-HD; high DVG particle content) was prepared in embryonated hen eggs as described previously (25). Plasmids and constructs
- a plasmid expressing DVG-546 flanked at the 3' end by the Spel-T7 promoter sequence and at the 5' end by the hepatitis delta virus ribozyme and the T7 polymerase terminator sequence was prepared as described previously (26).
- restriction enzyme sites were introduced into the construct using the QuickChange II XL site- directed mutagenesis kit (Agilent Technologies).
- DVG-268 was generated by the introduction of 6 nucleotides to generate a Kpnl site at position 163 of the DVG-546 sequence.
- a second Kpnl site at position 448 of the wild type DVG internal sequence allowed the deletion of 228 nucleotide-long fragment of the DVG.
- DVG-324 and DVG-354 were generated as previously described (26).
- DVG-324NC was generated by introduction of a second Kpnl site at position 330 of the DVG-324 sequence allowing the deletion of a 100 nucleotide-long fragment between positions 230 and 330 of the DVG-324 sequence.
- Motif DVG70.1 t 4 and DVGs-51 deletions single nucleotide swaps (T106G, A89U, C97G), and nucleotides additions (motifl +) were generated by site-directed mutagenesis (QuikChange XL II, Agilent Technologies).
- primers introduced T/G mutations at position 89,97 or 106 of the DVG-268 sequence.
- MotifH includes an A insertion after position 78, and a T insertion after position 104 of the DVG-324NC sequence. Sequences for all mutagenesis primers are shown in Figure 21. Poly U/UC and X-region plasmids were kindly provided by Dr. M. Gale (University of Washington).
- DNA sequences bearing PolyU/UC or X-region were amplified by PCR (X- region for 5 ? - T A ATACG ACTC ACTAT AGGTGGCTCC ATCTTAGCCCTA-3 ' , X-region rev 5'- ACTTGATCTGCAGAGAGGCCAGTATCA-3 ' ; HCV polyU/UC for 5'- TAATACGACTCACTATAGGCCATCCTGTTTTTTTCCC- 3'; HCV polyU/UC rev 5'- A A AGGA AAG A A A AGG A AAA A A AG AGG-3 ' ) using a high fidelity polymerase (Invitrogen).
- X-region mutants bearing DVG motifs were constructed by adding DVG motifs at the 3' end of molecule by PCR using the primers shown in Figure 22.
- the resulting PCR products were gel-purified (QIAGEN) and subjected to in vitro transcription as described below. ivtDVG preparation
- DVG-expressing plasmids were linearized and in vitro transcribed using the Ffi A crrmt T7 kit (Ambion) in the presence of RNase inhibitor (Fermentas). RNA products were treated with DNase followed by LiCl precipitation. OD260/280 ratios of all ivtDVG were between 2.00 and 2.25 and OD260/230 between 2.20-2.60. The integrity of ivtDVG was analyzed in an Agilent Bioanalyzer 2100.
- Endotoxin level of all ivtDVG used in this study was tested by the Biomedical Research Core Facility, University of Pennsylvania and was reported to be below 1.2EU/100 g for all ivtDVG RNA preparations and ⁇ 0.36EU/100 ⁇ g for all HCV polyU/UC and X-region mutant ivtRNA preparations.
- all ivtDVGs were gel-purified on 5% Urea-TBE gel and transfected into LLC-M 2 cells at the same molarity (4.15 pmol). Purified ivtDVGs had essentially identical activity than the non-purified ivtDVGs used to gather most of the data.
- Purified PCR products were used for in vitro transcription of PolyU/UC or X-region RNA using the MEGAscript T7 kit (Ambion) in the presence of RNase inhibitor (Fermentas).
- Alkaline Phosphatase AP, Thermo Scientific
- AP Alkaline Phosphatase
- RNase VI RNase VI
- RNAs were heated at 65°C for 5 min, cooled down to room temperature for 5 min, and then chilled on ice to promote proper folding of the molecules before transfection into cells. 4.15 pmols of the structured RNAs were transfected into cells (2.5 * 10 5 ) using Lipofectamine 2000 (invitrogen). As controls, cells were transfected with equally molarity of High Molecular Weight (HMW) Poly I:C (InvivoGen).
- HMW High Molecular Weight
- RNA folding was predicted using RNAfold server from the Vienna RNA package v.2.1.8 (rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi. University of Vienna) (46).
- MFE minimum free energy
- partition functions fold algorithms partition functions fold algorithms
- RT-qPCR was performed as previously described (24). Briefly, 1 ⁇ g of RNA was reverse transcribed using High Capacity RNA-to-cDNA kit (Applied Biosystems). qPCRs were performed using SYBR Green PCR Master Mix (Applied Biosystems) in a Viia7 Applied Biosystems Lightcycler. Primers used can be found in Figure 22.
- Probes complementary to the positive sense (+) of the SeV genome were designed against the full-length genome (from position 1 to 1 1630) excluding the 5' end that encompasses the DVG sequence.
- a pool of 32 oligos targeting the (+) SeV genome was designed by Dr. Arjun Raj as previously described (47). These probes recognize (+) viral genome as well as all viral-encoded mRNAs.
- For probes identifying DVGs a pool of 15 single-stranded 20 nucleotides-long oligos specific for the 3' end of the (+) SeV genome (from position 14965 tol 5416) which covers the DVG sequences was designed using same methods.
- RNA-FISH FISH was performed according to published protocols with minor modifications (48). Briefly, 2.5* 10 5 LL-CMK2 cells were transfected with 4.15 pmol of ivtDVG RNA using Lipofectamine 2000. At different times after transfection the cells were washed with phosphate buffer saline (PBS), followed by fixation with 4% formaldehyde for 10 min at room temperature (RT). Fixed cells were then permeabilized with 70% ethanol for 1 h at RT.
- PBS phosphate buffer saline
- RT room temperature
- Permeabilized cells were incubated with anti-human IRF3 antibody (Santa Cruz, 1 : 100 dilution) followed by Alexa Fluor 594-labeled goat anti-rabbit IgG (Invitrogen, 1 :500 dilution) diluted in 1% bovine albumin in presence of 40U/ml RNase inhibitor (Invitrogen). Stained cells were incubated in 4% formaldehyde for 10 min prior to FISH and then washed with PBS and equilibrated in wash buffer containing 10% formamide and 2X saline sodium citrate (SSC).
- SSC wash buffer containing 10% formamide and 2X saline sodium citrate
- FISH FISH was performed by hybridizing fixed cells with 10 nM of probes diluted in hybridization buffer consisting of 10% formamide, 2X SSC, and 10% dextran sulfate (w/v). Hybridyzation was performed overnight in a humidified chamber at 37°C. Imaging acquisition was performed on Nikon E600 Epifluorescent microscope equipped with a 100X, 1.4 numerical aperture (NA) oil-immersion objective (Zeiss) and a Zeiss AxiCam Rm camera.
- NA numerical aperture
- Imaging quantification was performed using Volocity Quantitation module (Perkin-Elmer) (49). Exposure time, gain, and offset were held constant for all images. The fluorescent signal from the nuclei of cells was selected by drawing a region of interest (ROI) around each nucleus. The fluorescent signals of the (+)DVG was determined by drawing an ROI around the entire cell and following the same procedure as described above. The average ROI intensity of IRF3 and (+)DVG signals in mock infected cells was measured and used as reference to set threshold for defining nuclear IRF3 and (+)DVG positive cells.
- ROI region of interest
- Nuclear IRF3 positive cells among (+)DVG positive populations were identified by performing "intersect module” while the nuclear IRF3 positive cells among (+)DVG negative populations were identified by the performing "exclude touching” module.
- at least 250 cells were quantified in each experimental group through three independent experiments.
- RIG- deltaCARD and MDA5_deltaCARD protein were kindly provided by Dr. Sun Hur (Harvard, Boston, MA) and were prepared as described elsewhere (36).
- EMSA was performed by incubating ivtRNA with ⁇ -g or indicated amount RIG-1 deltaCARD or MDAS deltaCARD protein in buffer A (20 mM HEPES (pH 7.5), 150 mM NaCl, 1.5 mM MgC12, and 2 mM dithiothreitol [DTT]) for 15 min at 37°C, and the complex was analyzed on 4-12% Bis-Tris NativePAGE (Bio-Rad). Gels were stained with SYBR Gold (Life Technologies), and fluorescent gel images were recorded and analyzed using a Gel Doc XR+ imaging system (Bio-Rad).
- MF59 is an Adjuvant produced by Norvartis that is licensed for vaccines used in humans in Europe and others parts of the world, approved by the FDA for use in the USA in influenza vaccines for the elderly. It is an emulsion and presumably facilitates the delivery of the antigen to the target cells. It also has a mild immunostimulatory potential.
- Samples for immunization were formulated with (in ratio of) 1 ⁇ g DVG, 40 ⁇ MF59, 0.6 ⁇ g IAV Cal/09 HA protein as antigen per mouse / dose.
- DVG-268 was used. Briefly, 1 pg DVG-268 was diluted in water, heated at 65 degree for 5 min and put on ice for 2 min to restore correct folding of the RNA. Then 40 ⁇ of MF59 and 0.6 ⁇ g of IAV Cal/09 HA protein were mixed into the samples to get the complete formulation. Samples were kept in 4 degree before i.m.
- mice Six-weeks old B129 mice were injected intramuscularly in the flank with ⁇ g DVG-derived RNA alone or diluted in PBS mixed with MF59, (Adda VAX; InvivoGen) or MF59 alone. As vehicle control, the same volume of PBS was injected in the opposite flank. Flank muscle was collected 24 hours after injection. Total RNA was extracted from tissue homogenate with TRIzol (Invitrogen). Expression of various antiviral genes mRNA in tissue homogenate was analyzed by RT-qPCR. Fig. 23 demonstrated that MF59 and DVGs together synergize in their adjuvant capacity. Fig. 24 demonstrated the innate immune response is mice was synergistically stimulated.
- Example 11 DVG-derived RNA induced strong protection to infection challenge
- mice were challenged with Flu Cal/09 D225G intranasally (2X104 TCID50/mice) and weighted in the following three consecutive davs nost infection.
- Whole lungs were collected 3 days post infection.
- Total RNA was extracted from the whole lung homogenate with TRIzol (Invitrogen), Expression of Flu NP mRNA in whole lung homogenate was analyzed by RT-qPCR as an indication of virus load in the lung and presented in Fig. 26.
- DVG-268 also acted synergistically with MF59 to create the enhanced immune response.
- Example 12 Motif 70-114 induced strong protection to infection challenge
- mice were challenged with Flu Cal/09 D225G intranasally (2X104 TCID50/mice) and weighted in the following three consecutive days post infection.
- Whole lungs were collected 3 days post infection.
- Total RNA was extracted from whole lung homogenate with TRIzol (Invitrogen). Expression of Flu NP mRNA in whole lung homogenate was analyzed by RT-qPCR. Data are shown as mRNA copy number relative to house keeping gene Rpsl l and Gapdh. DVG70-1 14 motif also acted synergistically with MF59 to create the enhanced immune response.
- Example 13 DVG-derived RNA is stable at room temperature
- DVG-268 is stable at 4°C and 37°C (Fig. 29), and continue to remain stable for at least 25 hours at room temperature (Fig. 30).
- DVG-268 (3 ng/ ⁇ ) was diluted in water and analyzed for at the indicated times using the RNA pico 6000 assay on Agilent 2100 Bioanalyzer.
- Example 14 DVG-derived RNA can be inserted into a delivery vector/DNA vaccine to enhance the vaccine immunostimulatory activity
- DVG-324 was genetically engineered into a MERS DNA vaccine.
- a description of the MERS vaccine backbone can be found in Science Trans Med 301 , 301ra312 (2015).
- the DNA vector encoding for the MERS S protein and DVG-324 was diluted in water and delivered via in vivo electroporation into the tibialis anterior muscle immunizations as indicated in Fig. 31.
- DVG-324 increased the immunostimulatory activity of the MERS vaccine (Fig. 31 ).
- the MERS specific IFNganima response was assessed on week three by ELlSpot assays using six peptide pools encompassing the entire MERS S protein.
- Example 15 DVG70-114 motif alone conserve strong immunostimulatory activity in the presence of a 5' overhang
- Motif DVG70-1 14 was modified by including 3' and/or 5' additional overhang nucleotides to test the minimal requirements for potent immunostimulatory activity.
- Recombinant DVG70-1 14 was synthetized with various combination of 3 " and 5' overhangs. In particular, a range of 5-15 nucleotide additional overhangs on both 5' and 3' prime of DVG70-1 14 motif were tested.
- LLC-MK2 cells were transfected with 250 ng of control or treated RNAs and analyzed 6h after transfection by RT-qPCR. Gene expression is shown as a copy number relative to the gene GAPDH. Error bars indicate the standard deviation of triplicate measurements in a representative experiment (**p ⁇ 0.01, ***p ⁇ 0.001 , ****p ⁇ 0.0001) by one way ANOVA with Bonferroni adjustment performed on PRISM. All treatments were run in triplicate.
- 3 '-overhang consisted of an additional 10 nucleotide overhang sequence at 3' prime of DVG70-1 14 motif (SEQ ID NO.: 22).
- 5' and 3'-overhang consisted of additional 5 nucleotides and 15 nucleotides at the 5' prime and 3' prime of DVG70-1 14 motif (SEQ ID NO.: 23), respectively.
- Blunt consisted of DVG70-1 14 motif alone (SEQ ID NO.: 1 ). Mock was the untreated control..
- Virus Res 109 125-132.
- Double- stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J Virol 80:5059-5064.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The presently disclosed subject matter relates to methods and compositions relating to immunostimulatory RNA motifs that act as adjuvants and/or immunostimulatory agents to enhance host immune responses.
Description
METHODS AND COMPOSITIONS FOR STIMULATING IMMUNE RESPONSE USING POTENT IMMUNOSTIMULATORY RNA MOTIFS
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR
DEVELOPMENT
[001] This invention was made with government support under NIH Grant Numbers R01-A1083284 awarded by the National Institutes of Health. The government has certain rights in the invention.
FIELD OF THE INVENTION
[002] The presently disclosed subject matter relates, in certain embodiments, to immunostimulatory RNA motifs as well as methods for initiating or enhancing immune responses. In certain embodiments, these RNA motifs can be used as immunostimulatory agents to enhance host immune responses, as antivirals, as vaccine adjuvants, and/or as antitumor agents.
BACKGROUND
[003] The immune system plays an important role in defense against specific microorganisms, for example viruses, specific fungi and bacteria, as well as in recognizing and inhibiting and/or eradicating tumor cells. Vaccinations are a long-known method of activating the immune system. Vaccination and immunization is the introduction of a non-virulent agent into a subject, in which the agent elicits the subject's immune system to mount an immunological response. Often, vaccine antigens are killed or attenuated forms of the microbes which cause the disease. The presence of non-essential components and antigens in these killed or attenuated vaccines has encouraged considerable efforts to refine vaccine components including developing well-defined synthetic antigens using chemical and recombinant techniques. The refinement and simplification of vaccines, however, has led to a concomitant loss in potency. Low-molecular weight synthetic antigens, though devoid of potentially harmful contaminants, are often not sufficiently immunogenic by themselves and do not produce an adequate immune response.
[004] The immunogenicity of an antigen can be increased by administering it in a mixture with substances called adjuvants. Adjuvants increase the response against the antigen
either by directly acting on the immunological system or by modifying the pharmacokinetic characteristics of the antigen, resulting in an increased interaction time between the antigen and the immune system. Additionally, the addition of an adjuvant can permit the use of a smaller dose of antigen to stimulate a similar immune response, thereby reducing the production cost of a vaccine.
[005] Currently the most widely adjuvants used in humans are Aluminum salts. Aluminum salts have been useful for some vaccines like hepatitis B, diphtheria, tetanus, and toxoid; however, they are not useful for others like rabies, MMR, and typhoid. In addition, Aluminum salts fail to induce cell-mediated immunity, result in the induction of granulomas at the injection site and vary in effectiveness between batches of alum preparations.
[006] Detection of specific viral pathogen-associated molecular patterns (PAMPs) by host pathogen recognition receptors (PRRs) is the first event in the defense against virus infection (1 -3). During infection with RNA viruses, the RIG-I-like receptors (RLRs) RIG-I (retinoic acid-inducible gene I) and MDA5 (melanoma differentiation-associated protein 5) bind viral PAMPs present in the infected cell and initiate a signaling cascade mediated by the mitochondrial antiviral signaling molecule (MAVS), which culminates in the production of type I IFNs and other antiviral genes (4-6). This primary host response to infection is essential to control virus replication and to initiate protective antiviral immunity (7). RNA motifs that effectively trigger this pathway are disclosed herein, which can, in certain embodiments, be used to generate synthetic RLR ligands for strong induction of antiviral responses in the context of vaccination or antiviral therapies.
[007] 5'-di- or -triphosphates associated with double strand RNA (dsRNA) or with single strand RNA, with or without poly U/UC ssRNA stretches, trigger RIG-I stimulation (1 , 3, 8- 10). These structures are present in influenza A virus (IAV) (8, 1 1), Sendai virus (SeV) (12), Hepatitis C virus (HCV) (13-15), and reovirus (16, 17). MDA5 ligands are much less characterized and are presumed to be complex secondary RNA structures (18, 19).
[008] During infection with viruses that are adapted to the host, viral-encoded proteins interfere with RLR activity allowing the virus to reach high titers prior to the onset of the antiviral response (20-22). The delay in detection of viral structures that are normally present in the viral genomes during natural infections indicates that additional factors are required for the effective triggering of antiviral responses in vivo. During infection with SeV, potent stimuli for the initiation of the antiviral response is provided by immunostimulatory defective viral aenomes fiDVGs) generated during virus replication at high titers (23-25). SeV iDVGs trigger
RLR signaling and initiate strong antiviral immunity both in vitro and during natural infections in vivo (26, 27). SeV iDVGs belong to the copy-back type of RNA DVGs and are produced when the viral polymerase is released fiom the template strand during replication and copies back the nascent strand (28). iDVGs are unable to replicate in the absence of helper virus as they lack essential replication machinery, and are not transcribed into proteins as they are flanked by the antigenomic promoter (29-32). A copy-back iDVG of 546 nucleotides (DVG- 546) predominant in laboratory stocks of SeV strain Cantell (SeV C) has been characterized to be a strong trigger of RLRs signaling (12, 23, 26, 33). Although this activity largely depends on 5 'triphosphates and the presence of dsRNA structures, prior to the instant disclosure, it was unclear whether additional RNA motifs optimize the immunostimulatory potential DVG-546 contributing to its efficient recognition even in the presence of virus-encoded antagonists of the antiviral response (25, 34).
SUMMARY
[009] The present disclosure is based, in part, on an RNA motif (DVG70-1 14) that is capable of eliciting an immune response. For example, but not by way of limitation, this motif can be harnessed to increase the immunostimulatory potential of otherwise inert R As and represents a novel immunostimulatory enhancer that can be used in the development of vaccine adjuvants and anti viral s.
[0010] In certain embodiments, the instant disclosure provides methods for stimulating an immune response in a subject including administering to the subject, e.g., a mammalian subject or a non-mammalian subject, e.g., a human, bird, or fish, at least one antigen in conjunction with an RNA motif capable of inducing an antigen specific immune response in the subject.
[0011] In certain embodiments, the present disclosure provides methods of activating an antigen presenting cell, for example a dendritic cell, including contacting the cell with an antigen and an RNA motif capable of inducing an antigen specific immune response. In certain embodiments, the antigen presenting cell is isolated from a subject and activated ex vivo. The activated cell can then be introduced, or reintroduced, into the subject.
[0012] In certain embodiments, the instant disclosure provides methods for stimulating an immune response in a subject including administering to the subject an antibody conjugated to at least one RNA motif capable of inducing an antigen specific immune response in the subject.
[0013] In certain embodiments, the disclosure provides methods for stimulating an immune response in a subject to an immunostimulatory-inert virus including administering to
the subject a portion of the inert virus's genome in which at least one RNA motif capable of inducing an antigen specific immune response in the subject is cloned into the genome.
[0014] In certain embodiments, the RNA motif comprises the nucleotide sequence of SEQ ID NO: l , or modified variants thereof having immunostimuiatory activity. In certain embodiments, the RNA motif comprises the nucleotide sequence of SEQ ID NO:2. In certain embodiments, the RNA motif comprises the nucleotide sequence of SEQ ID NO:5. In certain embodiments, the antigen is, for example, a virus, bacterial, fungal, parasite, nucleotide, or peptide antigen.
[0015] In certain embodiments, the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO:l having immunostimuiatory activity and a pharmaceutically acceptable carrier.
[0016] In certain embodiments, the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO: l having immunostimuiatory activity, one or more adjuvant, and a pharmaceutically acceptable carrier.
[0017] In certain embodiments, the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO:l having immunostimuiatory activity, one or more antigens, and a pharmaceutically acceptable carrier.
[0018] In certain embodiments, the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO: I, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO: l having immunostimuiatory activity, conjugated to one or more adjuvant, and a pharmaceutically acceptable carrier.
[0019] In certain embodiments, the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23 or a modified variant of SEQ ID NO:l having immunostimuiatory activity, conjugated to, combined with, or encapsulated by one or more nanoparticle, and a pharmaceutically acceptable carrier. In certain embodiments, the nanoparticle can be liposome.
[0020] In certain embodiments, the present disclosure also provides pharmaceutical compositions comprising an RNA motif comprising the nucleotide sequence of SEQ ID NO:l,
SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO: l having immunostimulatory activity, inserted into one or more nucleotide sequence, and a pharmaceutically acceptable carrier. In certain embodiments, the nucleotide sequence can be an mRNA sequence.
[0021] In certain embodiments, the present disclosure provides an isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO: l , SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO: 23, or a modified variant of SEQ ID NO:l having immunostimulatory activity.
BRIEF DESCRIPTION OF THE FIGURES
[0022] Figure 1A - Figure IB. DVGs promote protection from infection with an unrelated virus. (Figure 1A) Mouse embryo fibroblasts (MEFs) were infected with SeV HD or SeV LD (MOI = 1.5 TCID50/cell) or left untreated (N/T) and challenged 6 h later with influenza virus (IAV) (MOI of 1.5). Cells were harvested 12 h after a challenge, and the expression of IAV NP mRNA was examined by qRT-PCR. The data are the percentage of IAV NP mRNA relative to that of N/T cells. (Figure IB) Expression of antiviral genes examined by RT-qPCR. Results are expressed as the mean ± the standard error of the mean of three independent experiments.
[0023] Figure 2A - Figure 2D. Accumulation of positive (+)DVG strands associates with strong expression of IFNB1 during infection. (Figure 2A) Representation of genomic and copy-back DVG RNAs produced during SeV infection. (Figure 2B) 1FNB1 mRNA expression and ratio of (+)/(-)DVG RNA copy numbers determined by RT-qPCR from A549 cells infected with SeV-HD at a moi of 1.5 TCIDso/cell. Experiments were independently repeated at least three times. Each assay was performed in triplicates. A representative graph is shown. (Figure 2C) Representative staining of (+)DVG (green), (+)SeV genome or mRNA (red), IRF3 (purple) and nuclei (DAPI, blue) on LLC-MK2 cells 6h after SeV HD infection or mock controls. Image magnification: 100X. (Figure 2D) Quantification of IRF3 nuclear translocation within total, DVG-containing cells, and DVG negative cells. Results are expressed as mean± SEM from three independent experiments. ***p<0.001 by one-way ANOVA with Bonferroni post hoc test. Data are expressed as copy numbers relative to the housekeeping gene GAPDH. ns = non-significant.
[0024] Figure 3A - Figure 3D. Production of DVG(+) during DVG replication closely matches induction of IFNBl . (Figure 3A) Scheme of PCR amplification strategy utilized to detect and differentiate (+) and (-) strands of DVG-546. DVG reverse transcription was
performed with the indicated primers for the (+) or (-) sense DVGs. RT-qPCR of each sense- specific RT product was performed with a combination of the DVG 1 and DVG J primers to produce identical PCR products at equivalent efficiencies. While the DVG1 primer will serve to reverse transcribe the (+) sense of both DVG-546 and the SeV HD genome, the DVG J primer spans the junction site between the inverse trailer and the internal DVG sequence, which is unique to the DVG-546 sequence and is not present in the SeV HD genome. (Figure 3B) (+)DVG and (-)DVG qPCR efficiency test from TC-1 mouse lung epithelial cells infected with SeV HD at a moi of 1 .5 TCID5o/cell. Total R A (l pg) isolated 12 h after infection was reverse transcribed for either (+)DVG or (-)DVG. Ten-fold serial dilutions were analyzed for RT-qPCR and cycle threshold (Ct) values for each dilution were graphed relative to the logio(pg) of initial RNA. The linear region of the standard curve is shown, and was used to determine the R" value and PCR efficiency, which was calculated as I 0"l lope - 1. (Figure 3C) Copy numbers of (+)DVGs and (-) DVGs over the course of an A549 infection with SeV HD at a moi of 1 .5 TCID50/cell. (Figure 3D) IFNB1 mRNA expression and ratio of (+)/(-) DVG RNA determined by RT-qPCR from LLC- 2 cells infected with SeV-HD at a moi of 1.5 TCIDso/cell. All experiments shown in Figure3B-Figure 3D were independently repeated for three times and each assay was performed in triplicate. A representative data set is shown. Data are expressed as copy numbers relative to the housekeeping genes GAPDH.
[0025] Figure 4A - Figure 4G. Identification of a candidate motif essential for type I IFN induction by DVG RNA. (Figure 4A) Representation of deletion DVG mutants. Length of the deletion (dashed line) and total final length of each molecule are indicated. DVG mutant with deletion of both complementary sequences (gray) is indicated as DVG-1S (internal sequence). (Figure 4B) Expression of IFNB1 and IFIT1 mRNA measured by RT-qPCR from LLC-M 2 cells transfected for 6 h with 4.15pmol ivtDVGs. Data correspond to the mean ± SEM of all experiments (total n=5-l 1 /group). *p<0.05, **p<0.01. ***p<0.001, ****p<0.0001 by one-way ANOVA with Bonferroni post hoc test. Data are expressed as copy numbers relative to the housekeeping gene GAPDH. (Figure 4C) Folding prediction of highly stimulatory and poorly stimulatory DVG mutants using RNA fold Vienna software. A temperature option equal to 37°C was chosen to determine structured based on minimal free energy. Candidate motif (DVGvo-m) is circled. (Figure 4D) Relative position of the candidate stimulatory DVG70- 1 1 4 motif and its sequence in the genome of DVG-546. AU content of DVG70.1 1 4 compared with DVG-546 and full-length genome is indicated in the adjacent table. (Figure 4E) Folding predictions for DVG-268 and its derived mutants. Structures of intact
DVG-268 and DVG7o-i i 4 motif deletion (Δ70-Π4) are shown. Position of DVG70-i i 4 is highlighted. Point mutations within the DVG70.1 14 motif are indicated in the grey square. (Figure 4F) LLC-MK2 cells were transfected with 4.15 pmol of the indicated ivtDVG, IFNB1 and IFIT1 mRNA expression was analyzed by RT-qPCR at and 6 h post-transfection. (Figure 4G) Murine TC-1 cells were transfected with 4.15 pmol of DVG-268 or DVG-268 Δ-70-1 14, and IFN-beta protein and mRNA levels were measured by ELISA and RT-qPCR, respectively. Data correspond to the mean± SEM of all experiments (total n=3/group). *p<0.05, **p<0.01, ***p<0.001 , ****p<0.0001 by one-way ANOVA with Bonferroni post hoc test. Data are expressed as copy numbers relative to the housekeeping gene GAPDH. ns = non-significant.
[0026] Figure 5A - Figure 5B. Quality control of ivtDVG R As. (Figure 5A) Electrophoretic analysis of ivtDVGs was performed on an Agilents's 2100 Bioanalyzer. (Figure 5B). Endotoxin test for ivtDVGs used in the study. (Figure 5C) Expression of IFNB1 mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15pmol gel-purified DVG- ivtDVG. The experiment was independently repeated three times and each assay was performed in triplicate. A representative qPCR is shown. RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH.
[0027] Figure 6A - Figure 6C. ivtDVGs with intact stimulatory motif stimulate IFN responses in both mouse and human cells and is sustained for up to 24 h post transfection. (Figure 6A) Expression of Ifnb mRNA by RT-qPCR of TC-1 cells transfected for 6 h with 4.15 pmol of the indicated ivtDVGs. (Figure 6B) Expression of IFNB 1 mRNA by RT-qPCR of A549 cells transfected for 6 h with 4.15 pmol of the indicated ivtDVGs. Each RT-qPCR assay was performed in triplicates. Data correspond to the average of all experiments (total n>3/group). *<0.05, **p<0.001 , ***p<0.001 , ****p<0.0001 by one-way ANOVA with Bonferroni post hoc test. RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH for LL-CMK2 cells and Rpsl 1 for TC-1 cells. (Figure 6C) Expression of IFNB1 and IFIT1 mRNA at 4, 8, 12, and 24 h post transfection of LL-CMK2 with 4.15 pmol of the indicated ivtDVG RNA. One representative experiment out of three is shown. Data are expressed as copy numbers relative to the housekeeping genes GAPDH.
[0028] Figure 7A - Figure 7D. Quality control of ivtDVG RNAs. (Figure 7A) Electrophoretic analysis of ivtDVGs was performed on an Agilent 2100 Bioanalyzer. (Figure 7B). Endotoxin levels on ivtDVGs used in the study measured by Limulus assay. (Figure 7C) Expression of 1FNB1 mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15pmol gel-purified ivtDVG. The experiment was independently repeated three times and
each assay was performed in triplicate. A representative qPCR is shown. RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH. (Figure 7D) The amount of ivtDVGs present upon each transfection was quantified 6 h post transfection by RT- qPCR using a common set of primers directed to the 5'-complementary end of the DVGs (DVG Comp). Two representative transfections in LL-CMK2 cells are shown (EXPs 1 and 2). Data are expressed as copy numbers relative to the housekeeping genes GAPDH.
[0029J Figure 8A - Figure 8F. Verification of motif DVG70-n4 activity in ivtDVG-546. (Figure 8A) Eletrophoretic analysis for DVG-268 ivtDVGs on an Agilents's 2100 Bioanalyzer. (Figure 8B) Eletrophoretic analysis for DVG-546 ivtDVGs on an Agilents's 2100 Bioanalyzer. (Figure 8C) Folding prediction for DVG-546 motif deletion (DVG-546 A70-I I->) and the parental DVG-546. Motif DVG70-n4 is indicated with an oval. (Figure 8D) Expression of IFNBl mRNA by RT-qPCR in LLC-MK2 cells transfected for 6 h with 4.15 pmol of the indicated ivtDVG. (Figure 8E) Folding prediction for DVG-546 motifl + and the parental DVG- 546. Motif DVGTO-I i4 is indicated with an oval. Mutated motif DVG70-i i4 in DVG-546 motifl+ is indicated with an oval. (Figure 8F) Expression of IFNBl mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15pmol of ivtDVG illustrated in (Figure 8E). All transfection experiments were independently repeated at least three times. Data correspond to the meant SEM of all experiments (total n=3-5/group). **p<0.01, ***p<0.001 , ****p<0.0001 by one-way ANOVA with Bonferroni post hoc test. Data are expressed as copy numbers relative to the housekeeping gene GAPDH.
[0030] Figure 9A - Figure 9D. Recombinant SeV iDVGs with an intact DVG70-U4 motif preserve their stimulatory activity in the context of infection. (Figure 9A) Schematic of the recombinant SeV DVG generation system. BSR-T7 cells were infected with partially inactivated SeV 52 and transfected with a plasmid encoding either DVG-324 or DVG-354. Cells and supernatants were collected 48 h later and inoculated into 10-day-old embryonated chicken eggs. SeV containing rDVGs was collected from the allantoic fluid. T7 pro, T7 promoter sequence; Riboz., ribozyme; T7 term, T7 polymerase terminator sequence. (Figure 9B) LL-CMK2 cells were infected with virus rDVG-324 or rDVG-354 at an MOI of 5 TClD50/cell and analyzed at 6 h postinfection by RT-qPCR for the expression of IFN-βΙ , IFIT1, and SeV NP mRNA. The data are the average of three independent experiments. *, P<0.05; **, PO.01 ; ***, PO.001 ; ****, PO.0001 ; ns, nonsignificant (one-wayANOVA with Bonferroni' s post hoc test and two-tailed t test in DVG RNA quantification). Data are expressed as the copy number relative to that of the housekeeping gene for GAPDH. (Figure
9C and Figure 9D) LL-CMK2 cells were infected with SeV LD at an MOI of 1.5 TCID50/cell and transfected 24 later with 4.15 pmol of DVG-268 or DVG-268A7o-u4 RNA or left untreated (NT). Expression of SeV NP and SeV (P/V) (Figure 9C) and antiviral genes (Figure 9D) was measured at 6 h post transfection. The data are the average of three independent experiments. *, PO.05; **, P<0.01 ; ***, P<0.001 ; * ***, PO.0001 ; ns, nonsignificant (one-way ANOVA with Bonferroni's post hoc test). Data are expressed as the copy number relative to that of the housekeeping gene for GAPDH.
[0031] Figure 10A - Figure 10H. 3'- 5' complementarity and additional secondary structures are not necessary for IFN induction by DVG-derived RNA. (Figure 10A)
Illustration of DVG-324 and the related 3 ' complementary sequence deletion mutant (DVG- 324NC). The relative position of immunostimulatory motif DVG7O-I H is highlighted in a grey square. Length of the deletion (dashed line is indicated. (Figure 10B) Expression of IFNBl and IFIT 1 mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15pmol DVG-324, DVG-324NC or DVG-546. (Figure IOC) Folding prediction for DVG-324NC lacking the 70- 1 14 motif (DVG-324NCA7O-I I4), the parental DVG-324NC, and DVG-324NCA5-5 i . Motif DVG70-1 14 and Motif DVG5-51 are indicated. (Figure 10D) Expression of IFNBl mRNA by RT-qPCR in LLC-MK2 cells transfected for 6 h with 4.15pmol of the indicated ivtDVG. (Figure 10E) Illustration of DVG5.51 stem-loop motif and its relative position on the DVG- 324NC construct. (Figure 10F) Expression of IFNBl mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15 pmol of the indicated ivtDVG. (Figure 10G) Folding predictions of DVG-324NC motif] + compared to DVG-324NC. (Figure 10H) Expression of IFNBl mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with 4.15 pmol of ivtDVG illustrated in (Figure 10F). All transfection experiments were independently repeated for at least three times. Data correspond to the mean± SEM of all experiments (total n=3-5/group). *p<0.05, **p<0.01 , ***p<0.001 , ****p<0.0001 by one-way ANOVA with Bonferroni post hoc test. Data are expressed as copy numbers relative to the housekeeping gene GAPDH. ns = non-significant
[0032] Figure 11A - Figure 11B. DVG70-114 motif transfers strong immunostimulatory activity to inert RNA molecules. (Figure 11 A) Folding predictions of HCV X-region (SEQ ID NO: 17), X-region_DVG7o- i i 4 (SEQ ID NO: 18) and X-region_DVG5-5i, Motif DVG70-i 14 (SEQ ID NO: 19) is ballooned in the middle figure and motif DVG5.51 is ballooned in figure on the right. (Figure 11B) Expression of IFNB l and IFIT1 mRNA measured by RT-qPCR of LLC- MK2 cells transfected for 6 h with 4. 1 5 pmol gel purified X-region, X-region_DVG7o-u4 and
X-region_DVG5-5 i ivtDVGs. Data correspond to the mean± SEM of all experiments (total n~3- 5/group). *p<0.05, **p<0.01 by one-way ANOVA with Bonferroni post hoc test. Data are expressed as copy numbers relative to the housekeeping genes GAPDH. ns - non-significant. Figure 12. DVG derived ivtR As induced equivalent level of antiviral responses compared to known viral RIG-I ligands. (Figure 12A) EMSA of 6 pmol HCV poly U/UC, X-region and DVG-268 in the presence of ATP and increasing doses (0-20pmol) of full length RIG-I. Product was resolved on a 2% agarose gel. (Figure 12B and Figure 12C) Expression of 1FNB 1 and IFIT1 mRNA measured by RT-qPCR from LLC-M 2 cells transfected for 6 h with 4.15 pmol ivtDVGs or equivalent amounts of HCV poly U/UC, X-region or poly I:C (HMW). Data correspond to the mean± SEM of all experiments (total n=3/group). *p<0.05, **p<0.01 , ***p<0.001, ****p<0.0001 by one-way ANOVA with Bonferroni post hoc test. Data are expressed as copy numbers relative to the housekeeping gene GAPDH.
[0033] Figure 13A - Figure 13E. DVG70-1 14 motif strongly stimulates RLR signaling. (Figure 13 A). Expression of Ifnb mRNA determined by RT-qPCR from WT, Mavs' , and Ddx58' ' (RIG-TA) MEFs transfected for 6 h with 4.15pmol DVG- ivtDVG variants. (Figure 13B) Expression of IFNB1 mRNA by RT-qPCR of LLC-MK2 cells transfected for 6 h with DVG-derived ivtDVGs untreated or treated with alkaline phosphatase (AP). (Figure 13C) Expression of IFNB1 mRNA by RT-qPCR of LLC-M 2 cells transfected for 6 h with 4.15pmol DVG-268 ivtDVGs not treated (NT) or treated with RNase A, RNase VI , RNase A/Vl , or mock transfected. (Figure 13D and Figure 13E) EMSA of DVG-268 and DVG-268 Δ70-Ι 14 RNA to increasing doses of RIG-I deltaCARD in the absence (Figure 13D) or presence (Figure 13E) of 1 μΜ ATP. All experiments in Figure 13A - Figure 13E were independently repeated at least three times. Each RT-qPCR assay was performed in triplicates. Data correspond to the average of all experiments (total n>3/group). **p<0.001. ***p<0.001, ****p<0.0001 by two-way ANOVA (Figure 13A) or one-way ANOVA (Figure 13B and Figure 13C) with Bonferroni post hoc test. RT-qPCR data are expressed as copy numbers relative to the housekeeping genes GAPDH and/or ACTB (for LL-CMK2 cells) and Rpsll for MEFs.
1003 j Figure 14. DVG70-1 u improves the binding of DVGs to MDA5. EMSA of DVG- 268 and DVG-268A7O-I I4 RNA in the presence of increasing doses of MDA5 delta CARD. |0035] Figure 15A- Figure 15C. DVG70-n4 immunostimulatory activity in vivo. (Figure 15A) Procedure for testing the activity of DVG70-1 14 in vivo. C57BL6 mice were treated intranasally (i.n.) with 30ul of PBS (mock) or 4μ of polyI:C, DVG-324NC or DVG-
324NC 70-1 34. (Figure 15B) Expression of the antiviral gene Mxl in whole lung homogenates collected 6 hpi. (Figure 15C) RNA in situ hybridization on lungs extracted 6h after inoculation of DVG-324NC. Green dots represent DVG-324NC bound by labeled probes.
[00361 Figure 16. SEQ ID NO:l. DVG70- 1 ,4 Motif (45nt).
[0037] Figure 17. SEQ ID NO:2. An exemplary modifying mutation: DVG7o-H otifl + (47nt, from 5' to 3', additional nucleotides underlined).
[0038] Figure 18. SEQ ID NO:3. An exemplary mutation that significantly reduces the motif activity: DVG7o-n4 U106G (45nt, from 5'-3', mutated nucleotide is underlined).
[0039] Figure 19. SEQ ID NO:4. An exemplar)' mutation that significantly reduces the motif activity: DVG70-1 14 C97G (45nt, from 5 '-3', mutated nucleotide is underlined).
[0040] Figure 20. SEQ ID O:5. An exemplary modifying mutation: DVG70-i i4 A89U
(45nt, from 5'-3\ mutated nucleotide is underlined).
[0041] Figure 21. Primers used in mutagenesis.
[0042] Figure 22. Primers used in quantitative PCR assays.
[0043] Figure 23. Expression of various antiviral genes mRNA in tissue homogenate by RT-qPCR. Data are shown as mRNA copy number relative to house keeping gene Rpsl l and Gapdh. ***<0.001 by Two way-ANOVA with Bonferroni pos-hoc test. ns=non-significant. n=5.
[0044] Figure 24. DVG and MF59 complexes synergistically stimulate the innate immune response. Confocal microscopy of combination adjuvant consisting of DDO and MF59 showing the presence of multilamellar vesicle structures containing dye labeled DDO MRNA. Scalebar = 20 micrometers.
[0045] Figure 25. DVG-268 induced strong protection to infectious challenge with single immunization. Flu HA specific IgG, IgGl and lgG2b antibodies in the blood were measured by ELISA. ***<0.0001 and ***<0.001 by One way-ANOVA with Bonferroni pos- hoc test. Ns-non-significant.
[0046] Figure 26. DVG-268 induced strong protection to infectious challenge with single immunization. Expression of Flu NP mRNA in whole lung homogenate was analyzed by RT-qPCR as an indication of virus load in the lung. Data are shown as mRNA copy number relative to house keeping gene Rpsl l and Gapdh. ***<0.001 by One way-ANOVA with Bonferroni pos-hoc test.
|0047] Figure 27. Motif 70-114 (along with 5' and 3' overhang) induced strong protection to infectious challenge with single immunization. Level of IAV HA specific
IgG, IgGl and IgG2b antibodies in the serum were measured by ELISA. ***<0.0001 and
***<0.001 by One way-ANOVA with Bonferroni pos-hoc test. Ns^non-significant.
[0048] Figure 28. Motif 70-114 induced strong protection to infectious challenge with single immunization. Expression of IAV NP mRNA in whole lung homogenate was analyzed by RT-qPCR. Data are shown as mRNA copy number relative to house keeping gene Rpsl 1 and Gapdh. ***<0.001 by One way-ANOVA with Bonferroni pos-hoc test.
10049] Figure 29. DVG-derived RNA is stable at 4°C and 37°C. RNA pico 6000 assay on Agilent 2100 Bioanalyzer.
[0050] Figure 30. DVG-derived RNA is stable at 37°C for at least 24 hours. RNA pico 6000 assay on Agilent 2100 Bioanalyzer.
[0051] Figure 31. DVG-324 inserted into MERS DNA vaccine enhanced immunostimulatory activity. MERS specific IFN-gamma ELISpot in C57BL/6.
[0052] Figure 32. DVG70-114 motif alone conserve strong immunostimulatory activity in the presence of a 5' end overhang. 3'-overhang: DVG70-1 14 motif (SEQ ID NO: 22). 5' and 3'-overhang: DVG70-1 14 motif (SEQ ID NO: 23). Blunt: DVG70-1 14 motif alone (SEQ ID NO: 1). DVG-268:DDO. Mock: Untreated control.
[0053] Figure 33. Potent immunostimulatory activity of DVG-268 in vivo requires type I IFN signaling. Blood serum was collected 2 weeks post immunization. Level of IAV HA specific IgG, IgGl and lgG2b antibody in blood serum was measured by ELISA assay. ***<0.0001 , **<0.001 and *<0.05 by One way-ANOVA with Bonferroni pos-hoc test. ns=non-signi fi cant
DETAILED DESCRIPTION
[0054] The present disclosure is based, at least in part, on the discovery of an RNA motif (DVG70-H4) that is capable of eliciting a strong immune response. In certain embodiments, the RNA motif, DVG70- 1 14, facilitates recognition of viral RNA by R1G-I like receptors (RLRs) and/or Toll-like receptors (TLRs) and promotes the onset of the antiviral response. In certain embodiments, this RNA motif can be modified for stronger immunostimulatory activity and can be engineered into immunologically inert or weak RNA to enhance the RNA immunostimulatory potential. For example, the motif can be stabilized by modifying its sequence or using chemical molecules. In certain embodiments, the RNA motif DVG70-1 14 or modified motif forms can be used as immunostimulants in vivo and used as adjuvants along with vaccines, antigens, and other substances to enhance host immune responses. Thus, in
certain embodiments, DVG70.1 14 or its modified motif forms represent novel PAMP enhancer motifs.
[0055] As described herein, the DVG70-1 14 motif has been shown to confer strong immunostimulatory activity to inert RNA molecules (e.g., non-immunostimulatory virus molecules, non-viral RNA molecules, and the like). In certain embodiments, the immunostimulatory activity can be conferred upon an inert RNA molecule by cloning the motif, or modified forms of the motif, into the sequence of a naturally-occurring immunologically inert RNA molecule. For example, but not by way of limitation, the immunostimulatory activity of these motifs can be transferred to a naturally-occurring inert RNA molecule by cloning the motifs into the X-region of the hepatitis C virus (HCV) (a non- immunostimulatory small RNA derived from the HCV viral genome).
[0056] In certain embodiments, the immunostimulatory activity can be conferred upon any RNA molecule that contains or is modified to contain 5' triphosphates or phosphate analogs by cloning the motif into the sequence of the RNA molecule.
[0057] In certain embodiments, these motifs can also be attached to antibodies allowing for targeted delivery of the motifs allowing for localized immunostimulation. For example, but not by way of limitation, these motifs can be attached to an antibody directed to an antigen found on a specific tumor cell. As such, in certain embodiments these motifs enhance the host's immune response to the tumor cells. In certain embodiments, these motifs can be also targeted to antigen presenting cells, such as dendritic cells and macrophages, to trigger their maturation and activity. In certain embodiments these motifs are targeted to a specific organ to generate a localized inflammatory response, for example, but not limited to the lung, liver, kidney, heart, penis, uterus, eye, brain, intestine, skin, joints, or bone.
[0058] In certain embodiments these motifs can be conjugated with antigens and/or natural or synthetic nanoparticles, for example, but not limited to, liposomes, virus like particles, polymers, etc, for the development of novel vaccines. In certain embodiments, these motifs act as an immune-potentiator. In certain embodiments, motifs can be also conjugated to (or combined with) adjuvants to modify or improve their activity. For example, the motifs can be combined or conjugated with alum to promote the generation of a Thl -biased immune response. In certain embodiments the combination of these motifs with adjuvant emulsions, for example, but not limited to MF59.
[0059] In certain embodiments these motifs can be encapsulated with natural or synthetic nanoparticles, for example, but not limited to, liposomes, virus like particles, polymers, etc. for the development of novel vaccines.
[0060] in certain embodiments, the positive (+)RNA strands of SeV copy-back DVGs are associated with strong stimulation of the antiviral response. In certain embodiments, an increased ratio of (+)/(-)DVG strands positively correlated with the induction of IFNB1 expressing in vitro, and the accumulation of (+)RNA strands of SeV is positively associated with the induction of antiviral responses in cells infected with SeV. As such, the (+)RNA strands or their derivatives of SeV can also be used, in certain embodiments, as immunostimulants in vivo.
Definitions
[0061] According to the present disclosure, a "subject" or a "patient" is a human or non- human animal. Although the animal subject is preferably a human, the compounds and compositions of the invention have application in veterinary medicine as well, e.g., for the treatment of domesticated species such as canine, feline, murine, and various other pets; farm animal species such as bovine, equine, ovine, caprine, porcine, etc.; and wild animals, e.g., in the wild or in a zoological garden, such as non-human primates.
[0062] "Adjuvant" means any substance that increases the humoral or cellular immune response to an antigen. Adjuvants are generally used to accomplish two objectives: they slow the release of antigens from the injection site, and they stimulate the immune system.
[0063] "Antibody" refers to an immunoglobulin molecule that can bind to a specific antigen as the result of an immune response to that antigen. Immunoglobulins are serum proteins composed of "light" and "heavy" polypeptide chains having "constant" and "variable" regions and are divided into classes (e.g., IgA, IgD, IgE, IgG, and IgM) based on the composition of the constant regions.
[0064] "Antigen" or "immunogen" refers to any substance that stimulates an immune response. The term includes killed, inactivated, attenuated, or modified live bacteria, viruses, fungi or parasites or parasite eggs, etc. The term antigen also includes polynucleotides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, or lipids, or fragments thereof, individually or in any combination thereof. The term antigen also includes antibodies, such as anti-idiotype
antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope).
[0065] "RNA motif as used herein includes, but is not limited to, the isolated R A molecule DVG7O-I M (SEQ ID NO: l ) or modified variants (e.g., SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:23) that signal for the activation of transcription factors that trigger the expression of antiviral and/or pro-inflammatory molecules.
|0066] "Modified variants", "'modified RNA motif forms", or "modified motif forms" include mutant DVG70-n4 forms that results in enhancement of DVG70.11 signaling. In certain embodiments, these modified variants are generated by the substitution, deletion, or addition of a nucleotide(s). For example, a modified motif form can include an additional A-U base pair in the long stem region of DVG70-u4 creating a 47 nucleotide stabilized variant (e.g. SEQ ID NO:2). As another example, a modified motif form can include additional nucleotides can be added either to the 5 ' or the 5' and 3' end of the DVG70-i l4 (e.g., SEQ ID NO: 23).
[0067] "Immune response" in a subject refers to the development of a humoral immune response, a cellular immune response, or a humoral and a cellular immune response to an antigen. Immune responses can usually be determined using standard immunoassays and neutralization assays, which are known in the art.
[0068] "Cellular immune response" or "cell mediated immune response" is one mediated by T-lymphocytes or other white blood cells or both, and includes the production of cytokines, chemokines and similar molecules produced by activated T-cells, white blood cells, or both.
[0069] "Humoral immune response" refers to one that is mediated by antibodies.
[0070] "Immunologically protective amount" or "immunologically effective amount" or "effective amount to produce an immune response" of an antigen is an amount effective to induce an immunogenic response in the recipient. The immunogenic response can be sufficient for diagnostic purposes or other testing, or can be adequate to prevent signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a disease agent. Either humoral immunity or cell-mediated immunity or both can be induced. The immunogenic response of an animal to an immunogenic composition can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain, whereas the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature number, overall physical condition, and
overall health and performance of the subject. The immune response can comprise, without limitation, induction of cellular and/or humoral immunity.
10071] "immunogenic" means evoking an immune or antigenic response. Thus an immunogenic composition would be any composition that induces an immune response.
[0072] "Immunostimulatory molecule" refers to a molecule that generates an immune response.
[0073] "Treatment," "treating," and the like refer to obtaining a desired pharmacologic and/or physiologic effect. The effect may be prophylactic in terms of completely or partially preventing a disease or symptom thereof and/or may be therapeutic in terms of a partial or complete cure for a disease and/or adverse effect attributable to the disease. "Treatment," as used herein, covers any treatment of a disease in a subject or patient and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it; (b) inhibiting the disease, i.e., arresting its development; and (c) relieving the disease, i.e., causing regression of the disease.
[0074] "Therapeutically effective amount" refers to an amount of an antigen or vaccine that would induce an immune response in a subject receiving the antigen or vaccine which is adequate to prevent or reduce signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a pathogen, such as a virus or a bacterium. Humoral immunity or cell-mediated immunity or both humoral and cell-mediated immunity can be induced. The immunogenic response of a subject to a vaccine can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain. The protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature, overall physical condition, and overall health of the subject. The amount of a vaccine that is therapeutically effective can vary depending on the particular adjuvant used, the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art.
[0075] "Pharmaceutical composition" and "pharmaceutical formulation," as used herein, refer to a composition which is in such form as to permit the biological activity of an active ingredient contained therein to be effective, and which contains no additional components which are unacceptably toxic to a patient to which the formulation would be administered.
[0076] "Pharmaceutically acceptable," as used herein, e.g., with respect to a "pharmaceutically acceptable carrier," refers to the property of being nontoxic to a subject. A
pharmaceutically acceptable ingredient in a pharmaceutical fonnulation can be an ingredient other than an active ingredient that is nontoxic. A pharmaceutically acceptable carrier can include a buffer, excipient, stabilizer, and/or preservative.
[0077] "Lipids" refers to any of a group of organic compounds, including the fats, oils, waxes, sterols, and triglycerides, which are insoluble in water but soluble in nonpolar organic solvents, are oily to the touch, and together with carbohydrates and proteins constitute the principal structural material of living cells.
|0078} "Liposome" refers to a microscopic spherical particle formed by a lipid bilayer enclosing an aqueous compartment, used medicinally to carry a drug, antigen, vaccine, enzyme, or another substance to targeted cells in the body.
[0079] "Vaccine" refers to a composition that includes an antigen, as defined herein. Administration of the vaccine to a subject results in an immune response, generally against one or more specific diseases. The amount of a vaccine that is therapeutically effective can vary depending on the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art. A vaccine can comprise a live attenuated virus in a suitable pharmaceutically, or physiologically acceptable carrier, such as isotonic saline or isotonic salts solution. The appropriate carrier will be evident to those skilled in the art and will depend in large part upon the route of administration. Alternatively, vaccines composed of polynucleotide molecules desirably contain optional polynucleotide facilitating agents or "co- agents", such as a local anesthetic, a peptide, a lipid including cationic lipids, a liposome or lipidic particle, a polycation such as polylysine, a branched, three-dimensional polycation such as a dendrimer, a carbohydrate, a cationic amphiphile, a detergent, a benzylammonium surfactant, or another compound that facilitates polynucleotide transfer to cells. Non-exclusive examples of such facilitating agents or co-agents useful in this disclosure are described in U.S. Pat. Nos. 5,593,972; 5,703,055; 5,739,3 18; 5,837,533; International Patent Application No. WO96/10038, published Apr. 4, 1996; and International Patent Application No W094/16737, published Aug. 8, 1994, which are each incorporated herein by reference.
{0080] "Cancer" includes, for example, skin cancers (melanoma and squamous cell carcinoma), pancreatic cancer, kidney cancer, e.g., renal cell carcinoma (RCC), urogenital cancer, e.g., urothelial carcinomas in urinary bladder, kidney, pelvic and ureter, melanoma, prostate carcinoma, lung carcinomas (non-small cell carcinoma, small cell carcinoma, neuroendocrine carcinoma and carcinoid tumor), breast carcinomas (ductal carcinoma, lobular carcinoma and mixed ductal and lobular carcinoma), thyroid carcinomas (papillary thyroid
carcinoma, follicular carcinoma and medullary carcinoma), brain cancers (meningioma, astrocytoma, glioblastoma, cerebellum tumors, medullob!astoma, ependymoma), ovarian carcinomas (serous, mucinous and endometrioid types), cervical cancers (squamous cell carcinoma in situ, invasive squamous cell carcinoma and endocervical adenocarcinoma), uterine endometrial carcinoma (endometrioid, serous and mucinous types), primary peritoneal carcinoma, mesothelioma (pleura and peritoneum), eye cancer (retinoblastoma), muscle (rhapdosarcoma and leiomyosarcoma), lymphomas, esophageal cancer (adenocarcinoma and squamous cell carcinoma), gastric cancers (gastric adenocarcinoma and gastrointestinal stroma tumor), liver cancers (hepatocellular carcinoma and bile duct cancer), small intestinal tumors (small intestinal stromal tumor and carcinoid tumor) colon cancer (adenocarcinoma of the colon, colon high grade dysplasia and colon carcinoid tumor), testicular cancer, and adrenal carcinoma.
[0081] A "tumor" includes any tumor resulting or associated with from any of the above cancers.
RNA motifs
|0082] The presently disclosed subject matter provides, in certain embodiments, for immunostimulatory RNA motifs. In certain embodiments, the RNA motifs are used as adjuvants or immunostimulatory agents to activate antigen presenting cells, such as dendritic cells, or structural cells, such as fibroblasts and muscle, to trigger cytokine expression and enhance host immune responses to an antigen. In certain embodiments, the RNA motifs described herein have increased immunostimulatory activity as compared to DVG particles or DVG-derived RNA molecules containing larger portions of the DVG sequence. For example, but not by way of limitation, the motifs described herein can trigger an innate immune response in any cell. This is a major advantage of triggering the RLRs (e.g., RIG-I and MDA5) over Toll-like receptors (TLRs), as RLRs are expressed in all cells, while TLRs are mostly restricted to antigen presenting cells.
[0083] The stem region of motif DVG70-1 14 (nucleotides 75-82 and 100-109 of DVG- 268) provides stability to the motif structure and can be modified to enhance stability by, for example, engineering additional base pairs, or replacing weak interactions (A:T) with stronger ones (C:G). Residues at the tip or bulk of the molecules could also be modified to enhance stability and binding to innate immune receptors. In addition, alterations in or to the sequence of the motif that maintain its structure can be introduce to maximize immune stimulation.
Immunostimulatory activity can be measured by the methods described herein (e.g., in the Examples), and methods known in the art.
[0084] In certain embodiments, the RNA motif is DVG70-1 H- In certain embodiments, the RNA motif is a modified variant of DVG70-H4- In certain embodiments, the modified RNA motifs can contain nucleotide substitutions, deletions, inversions and insertions of the DVG70- 1 14 motif, but still retain immunostimulatory activity. In certain embodiments, the modified RNA motif includes a DVG70-i H with an elongated long stem region, but which still retain immunostimulatory activity. In certain embodiments, the modified RNA motif includes an additional A-U pair assertion into the DVG7o-i u long stem region (e.g., SEQ ID NO:2). In certain embodiments, the modified RNA motif includes a C-G insertion. In certain embodiments, the modified RNA motif includes a point mutation that maintains or enhances activity (e.g., SEQ ID NO:5).
(0085] In certain embodiments, the modified RNA motif can also be stabilized by adding an overhang (i.e., additional nucleotide residues) to either the 5 ' or 5' and 3 ' end of the DVG70-1 14 motif. In certain embodiments, either the 5' or 3' overhang are complementary. In certain embodiments, at least a portion of the 5' and 3 ' overhang extend the stem portion of the DVG70- 1 14 motif. In certain embodiments, at least a portion of the 5 ' and 3 ' overhang is complementary. In certain embodiments, the additional nucleotides can be from the parent DVG-268 sequence (e.g. ,SEQ ID NO: 22). In certain embodiments, the additional nucleotides are not from the parent DVG-268 sequence (e.g. ,SEQ ID NO: 24). In certain embodiments, the additional nucleotides of one overhang can be from the parent DVG-268 sequence while the additional nucleotides of the other overhang are not (e.g. ,SEQ ID NO: 23).
[0086] In certain embodiments, 5 to 1 5 nucleotides can be added to the 5 ' end of the DVG70- 1 14 motif. In certain embodiments, 5 to 1 0, 1 0 to 1 5, or 10 to 20 nucleotides can be added to the 5' end of the DVG70-1 1 4 motif. In certain embodiments, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 1 5, 1 6, 17, 1 8, 1 9, or 20 nucleotides can be added to the 5' end of the DVG70- 1 14 motif. In certain embodiment, 5 nucleotides can be added to the 5 ' end of the DVG70- 1 14 motif (e.g., SEQ ID NO:24). In certain embodiments, 5 to 1 5 nucleotides can be added to the 3' end of the DVG70- 1 14 motif. In certain embodiments, 5 to 1 0, 10 to 1 5, or 10 to 20 nucleotides can be added to the 3 ' end of the DVG70- 1 14 motif. In certain embodiments, 5, 6, 7, 8, 9, 10, 1 1 , 12, 1 3, 14, 15, 1 6, 1 7, 1 8, 1 9, or 20 nucleotides can be added to the 3 ' end of the DVG70- 1 14 motif. In certain embodiment, 1 5 nucleotides can be added to the 3 ' end of the of the DVG70- 1 14 motif. In certain embodiment, 5 nucleotides can be added to the 5 ' end and 1 5
nucleotides can be added to the 3' end of the DVG70-1 14 motif (SEQ ID NO:23). In certain embodiments, the 5' and 3' overhang has 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, or 15 complementary pairs. In certain embodiments, the 5' and 3 ' overhang has about 2 to about 5 complementary pairs. In certain embodiments, the 5' and 3' overhang has about 3 complementary pairs (e.g., SEQ ID NO:23).
[0087] In certain embodiments, the modified RNA motif can also be stabilized by chemical modifications. In certain embodiments, the modified RNA motif can also be modulated in a negative way with point mutations.
[0088] In certain embodiments, the motif can be in vitro transcribed or made synthetically and used as an RLR ligand in vitro or in vivo.
TABLE 1 Table of Sequences. Shading denotes the RNA motif, and underlining denotes base modifications.
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU NO:7 UCUUGUCUUC UUGUAAGUUU UUCUUGCUAU UGUCAUAUGG
AUAAGUCCAA G^U UCUU
DVG-546 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU
UCAAUUAGGA AUAGUUUCAU UAUCAUCCCG UGAGAUCAGG AACCUGAGGG UUAUCACAAA AACUUUAUUA GACAGGUUUG AGGAUAUUAU ACAUAGUAUA ACGUAUAGAU UCCUCACCAA AGAAAUAAAG AUCUUGAUGA AGAUUUUAGG GGCAGUCAAG AUGUUCGGGG CCAGGCAAAA UGAAUACACG ACCGUGAUUG AUGAUGGAUC ACUGGGUGAU AUCGAGCCAU AUGACAGCUC GUAAUAAUUA GUCCCUAUCG UGCAGAACGA UCGAAGCUCC GCGGUACCUG GAAGUCUUGG ACUUAUCCAU AUGACAAUAG UAAGAAAAAC UUACAAGAAG ACAAGAAAAU UUAAUAGGAU ACAUAUCUCU UAAACUCUUG UCUGGU
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU
NO:8 UCUUGUCUUC UUGUAAGUUU UUCUUGCUAU UGUCAUAUGG
AUAAGUCCAA GACUAUCUUU AUCUAUGUCC ACAA AU UGG
DVG-324 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU
UCAAUUAGGA AUAGUUUCAU UAUCAUCCCG UGAGAUCAGG AACCUGAGGG UUAUCACAAA GGUACCUGGA AGUCUUGGAC UUAUCCAUAU GACAAUAGUA AGAAAAACUU ACAAGAAGAC AAGAAAAUUU AAUAGGAUAC AUAUCUCUUA AACUCUUGUC UGGU
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU
N0:9 UCUUGUCUUC UUGUAAGUUU U UCU UGCUAU UGUCAUAUGG
AUAAGUCCAA GACUAUCUUU AUCUAUGUCC ACAAGAU UGG
DVG-268 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU
UCCCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU AGUAAGAAAA ACUUACAAGA AGACAAGAAA AUUUAAUAGG AUACAUAUCU CUUAAACUCU UGUCUGGU
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU NO: 10 UCUUGUCUUC UUGUAAGUUU UUCUUGCUAU UGUCAUAUGG
AUAAGUCCAA GACUAUGGUA CCUGGAAGUC UUGGACUUAU
DVG-200 CCAUAUGACA AUAGUAAGAA AAACUUACAA GAAGACAAGA
AAAUUUAAUA GGAUACAUAU CUCUUAAACU CUUGUCUGGU
SEQ ID CCUUUAUCUA UGUCCACAAG AUUGGUAACU GGGUCAUUCC NO: 1 1 CUGACCAGAA GUUUGAAGCA AGACUUCAAU UAGGAAUAGU
UUCAUUAUCA UCCCGUGAGA UCAGGAACCU GAGGGUUAUC
DVG-IS ACAAAAACUU UAUUAGACAG GUUUGAGGAU AUUAUACAUA
GUAUAACGUA UAGAUUCCUC ACCAAAGAAA UAAAGAUUUU GAUGAAGAUU UUAGGGGCAG UCAAGAUGUU CGGGGCCAGG CAAAAUGAAU ACACGACCGU GAUUGAUGAU GGAUCACUGG GUGAUAUCGA GCCAUAUGAC AGCUCGUAAU AAUUAGUCCC UAUCGUGCAG AACGAUCGAA GCUCCGCGGU ACC
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU NO: 12 UCUUGUCUUC UUGUAAGUUU U UCUUGCUAU UGUCAUAUGG
AUA GUCCA^
DVG-268 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU U106G UCCCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU
AGUAAGAAAA ACUUACAAGA AGACAAGAAA AUUUAAUAGG AUACAUAUCU CUUAAACUCU UGUCUGGU
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU NO: 13 UCUUGUCUUC UUGUAAGUUU UUCUUGCUAU UGUCAUAUGG
AUAAGUCCUA GACUAUCUUU AUCUAUGUCC ACAAGAUUGG
DVG-268 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU A89U UCCCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU
AGUAAGAAAA ACUUACAAGA AGACAAGAAA AUUUAAUAGG AUACAUAUCU CUUAAACUCU UGUCUGGU
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU NO: 14 UCUUGUCUUC UUGUAAGUUU UUCUUGCUAU UGUCAUAUGG
AUA^GUCCAA
DVG-268 UAACUGGGUC AUUCCCUGAC CAGAAGUUUG AAGCAAGACU C97G UCCCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU
AGUAAGAAAA ACUUACAAGA AGACAAGAAA AUUUAAUAGG AUACAUAUCU CUUAAACUCU UGUCUGGU
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU NO: 15 UCUUGUCUUC UUGUAAGUUU UUCUUGCUAG AUUGGUAACU
GGGUCAUUCC CUGACCAGAA GUUUGAAGCA AGACUUCAAU
DVG- UAGGAAUAGU UUCAUUAUCA UCCCGUGAGA UCAGGAACCU
546Δ70-3 14 GAGGGUUAUC ACAAAAACUU UAUUAGACAG GUUUGAGGAU
AUUAUACAUA GUAUAACGUA UAGAUUCCUC ACCAAAGAAA UAAAGAUCUU GAUGAAGAUU UUAGGGGCAG UCAAGAUGUU CGGGGCCAGG CAAAAUGAAU ACACGACCGU GAUUGAUGAU GGAUCACUGG GUGAUAUCGA GCCAUAUGAC AGCUCGUAAU AAUUAGUCCC UAUCGUGCAG AACGAUCGAA GCUCCGCGGU ACCUGGAAGU CUUGGACUUA UCCAUAUGAC AAUAGUAAGA AAAACUUACA AGAAGACAAG AAAAUUUAAU AGGAUACAUA UCUCUUAAAC UCUUGUCUGG U
SEQ ID ACCAGACAAG AGUUUAAGAG AUAUGUAUCC UUUUAAAUUU NO: 16 UCUUGUCUUC UUGUAAGUUU UUCUUGCUAU UGUCAUAUAG
GAUAAGUCCA AGACUAUCUU UAUCUUAUGU CCACAAGAUU
DVG- GGUAACUGGG UCAUUCCCUG ACCAGAAGUU UGAAGCAAGA
546motif 1 + CUUCAAUUAG GAAUAGUUUC AUUAUCAUCC CGUGAGAUCA
GGAACCUGAG GGUUAUCACA AAAACUUUAU UAGACAGGUU UGAGGAUAUU AUACAUAGUA UAACGUAUAG AUUCCUCACC AAAGAAAUAA AGAUCUUGAU GAAGAUUUUA GGGGCAGUCA AGAUGUUCGG GGCCAGGCAA AAUGAAUACA CGACCGUGAU UGAUGAUGGA UCACUGGGUG AUAUCGAGCC AUAUGACAGC UCGUAAUAAU UAGUCCCUAU CGUGCAGAAC GAUCGAAGCU CCGCGGUACC UGGAAGUCUU GGACUUAUCC AUAUGACAAU AGUAAGAAAA ACUUACAAGA AGACAAGAAA AUUUAAUAGG AUACAUAUCU CUUAAACUCU UGUCUGGU
[0089] In certain embodiments, delivery of RNA motifs into a subject or cell (e.g., dendritic cell) can be either direct, in which case the subject or cell is directly exposed to the naked nucleic acid, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then introduced or reintroduced into the patient.
[0090] The RNA motifs of the present disclosure can be directly administered in vivo, e.g., combined with an antigen or vaccine to form an adjuvant composition. In certain embodiments, the RNA motif (or motifs) (e.g., SEQ ID NO:l ; SEQ ID NO:2; SEQ ID NO:5), or a modified variant of SEQ ID NO:l having irnmunostimulatory activity, can be administered in vivo. In certain embodiments, the RNA motif is conjugated to additional nucleotides to impart its irnmunostimulatory activity. For example, the modified RNA motif can have additional nucleotides at the 5' or 5' and 3' end of the DVG70-1 14 motif as described above (e.g., SEQ ID NO: 23). In certain embodiments, the DVG70-1 14 motif can be conjugated to a natural or synthetic nanoparticles, for example, but not limited to, liposomes, virus like particles, polymers to impart its irnmunostimulatory activity.
[0091] Administered in vivo can be accomplished by any of numerous methods known in the art, e.g., by direct injection of naked RNA. For example, the RNA motif can be injected, aerosolized, electroporated in the skin or muscle, or used intranasally, etc. The RNA motif can also be administered by use of microparticle bombardment (e.g., a gene gun; Biolistic, Dupont), or coating with lipids, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide. The nucleic acid-ligand complexes can also be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. The RNA motifs can also be stabilized with cationic molecules, e.g., Poly-L Lysine, or attached to nanoparticles for delivery. In certain embodiments, the nanoparticles can also contain one or more antigen. In certain embodiments, the RNA motifs can be conjugated with antigen for delivery. For example, the RNA motif can be conjugated to parasite eggs, proteins, etc. The RNA motifs can also be delivered along with the antigen and an additional immunological adjuvant.
[0092] In certain embodiments, motifs can be also conjugated to or combined with adjuvants to modify or improve their activity. Immunological adjuvants include, but are not limited to: aluminum salts (alum), such as aluminum hydroxide, aluminum phosphate,
aluminum sulfate, etc.; oil-in- water emulsion formulations (with or without other specific immunostimulating agents such as muramyl peptides (see below) or bacterial cell wall components) (e.g., mineral oil), such as for example MF59 (International Publication No. WO 90/14837), containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts of MTP-PE (see below), although not required) formulated into submicron particles using a microfluidizer such as Model 110Y micro fluidizer (Microfluidics, Newton, Mass.), SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121 , and thr-MDP either microfiuidized into a submicron emulsion or vortexed to generate a larger particle size emulsion, and Ribi™ adjuvant system (RAS), (Ribi Immunochem, Hamilton, Mont.) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL) (e.g. 3-O-deacylated monophosphoryl lipid A; RIBI ImmunoChem Research, Inc., Hamilton, Mont.), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL+CWS (Detox™) (for a further discussion of suitable submicron oil-in-water emulsions for use herein, see e.g., Patent No. 6,086,91); saponin adjuvants, such as Quil A, or QS21 (e.g., Stimulon™ (Cambridge Bioscience, Worcester, Mass.)) may be used or particle generated therefrom such as ISCOMs (immunostimulating complexes); Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IF A); cytokines, such as interleukins (IL- 1 , IL-2, etc.), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc.; detoxified mutants of a bacterial ADP-ribosylating toxin such as a cholera toxin (CT) (either in a wild-type or mutant form, e.g., wherein the glutamic acid at amino acid position 29 is replaced by another amino acid, preferably a histidine, in accordance with International Patent Application No. PCT/US99/22520), a pertussis toxin (PT), killed Bordetella, or an E. coli heat-labile toxin (LT), particularly LT-K63 (where lysine is substituted for the wild-type amino acid at position 63) LT-R72 (where arginine is substituted for the wild-type amino acid at position 72), CT-S 109 (where serine is substituted for the wild-type amino acid at position 109), and PT-K9/G129 (where lysine is substituted for the wild-type amino acid at position 9 and glycine substituted at position 129) (see, e.g., International Publication Nos. WO93/13202 and W092/19265); CpG oligonucleotides and other immunostimulating sequences (ISSs); Amphigen, Avridine, LI 21 /squalene, D-lactide-polylactide/glycoside, pluronic plyois, muramyl dipeptide; and other substances that act as immunostimulating agents to enhance the effectiveness of the composition. For example, the RNA motifs can be combined or conjugated with alum to promote the generation of an immune response (e.g. a Thl -biased immune response). In certain
embodiments the combination of these motifs with adjuvant emulsions, for example, but not limited to MF59. In certain embodiments, the these motifs can be combined with MF59 to promote the generation of an immune response (e.g. a Thl -biased immune response). In certain embodiments, the motif is conjugated with MF59 to promote the generation of an immune response (e.g. a Thl -biased immune response).
[0093] In certain embodiments, the ratio of RNA motif to adjuvant can range from about 1 μg motif : about 100 μΐ adjuvant formulation. In certain embodiments, the ratio of RNA motif to adjuvant formulation can range from about 1 μg motif : about 95 μΐ adjuvant formulation; about 1 μg motif : about 90 μΐ adjuvant formulation; about 1 μg motif : about 85 μΐ adjuvant formulation; about 1 g motif : about 80 μΐ adjuvant formulation; about 1 μg motif : about 75 μΐ adjuvant formulation; about 1 μg motif : about 70 μΐ adjuvant formulation; about 1 μg motif : about 65 μΐ adjuvant formulation; about 1 μg motif : about 60 μΐ adjuvant formulation; about 1 μ motif : about 55 μΐ adjuvant formulation; about 1 μ¾ motif : about 50 μ] adjuvant formulation; about 1 μg motif : about 45 μΐ adjuvant formulation; about 1 μg motif : about 40 μΐ adjuvant formulation; about 1 μg motif : about 35 μΐ adjuvant formulation; about 1 μg motif : about 30 μΐ adjuvant formulation; about 1 μg motif : about 25 μΐ adjuvant formulation; about 1 μg motif : about 20 μΐ adjuvant formulation; about 1 μ motif : about 15 μΐ adjuvant formulation; or about 1 μg motif : about 10 μΐ adjuvant formulation. In certain embodiments, the ratio of RNA motif to adjuvant formulation can be about 1 μg motif : about 40 μΐ adjuvant formulation.
[0094] In certain embodiments, the ratio of RNA motif to adjuvant formulation can be about 10-50 pmols of the motif : about 40 μΐ adjuvant formulation. In certain embodiments, the ratio of RNA motif to adjuvant formulation can be about 10 pmols motif : about 40 μ! adjuvant formulation; about 12.5 pmols motif : about 40 μΐ adjuvant formulation; about 15 pmols motif : about 40 μϊ adjuvant formulation; about 17.5 pmols moti : about 40 μΐ adjuvant formulation; about 20 pmols motif : about 40 μΐ adjuvant formulation; about 22.5 pmols motif : about 40 μΐ adjuvant formulation; about 25 pmols motif : about 40 μΐ adjuvant formulation; about 27.5 pmols motif : about 40 μΐ adjuvant formulation; about 30 pmols motif : about 40 μΐ adjuvant formulation; about 32.5 pmo!s motif : about 40 μΐ adjuvant formulation; about 35 pmols moti : about 40 μΐ adjuvant formulation; about 37.5 pmols motif : about 40 μΐ adjuvant formulation; about 40 pmols motif : about 40 μΐ adjuvant formulation; about 42.5 pmols motif : about 40 μΐ adjuvant formulation; about 45 pmols motif : about 40 μΐ adjuvant formulation;
about 47.5 pmols motif : about 40 μΐ adjuvant formulation; or about 50 pmols motif : about 40 μΐ adjuvant formulation.
(00951 In certain embodiments, the RNA motifs can also be constructed as part of an appropriate vector (viral or otherwise). The term "vector" means the vehicle by which a nucleic acid sequence can be introduced into a cell. Vectors include plasmids, phages, viruses, etc. A "therapeutic vector", as used herein, refers to a vector which is acceptable for administration to an animal, and particularly to a human.
[0096] Vectors typically comprise the DNA of a transmissible agent, into which foreign nucleic acid molecule is inserted. A common way to insert one nucleic acid molecule into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites. Generally, the foreign nucleic acid molecule is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
[0097] Suitable vectors include viruses, such as adenoviruses, adeno-associated virus (AAV), lentiviral vectors, vaccinia, herpesviruses, paramyxoviruses, Sendai Virus, RNA-based viruses, Newcastle disease virus, baculoviruses, orthomyxovirus, RNA-based viruses, retroviruses, parvovirus, lentivirus, bacteriophages, cosmids, plasmids, fungal vectors, and other recombination vehicles typically used in the art.
[0098] Methods that can be used to deliver the RNAs of the present disclosure are described in, for example, but not by way of limitation, Clegg, C. H. et al Proc Natl Acad Sci U S A 109, 17585-17590, (2012); Thim, H. L. et al. Vaccine M, 4828-4834, (2012); Alving, C. R., et al. Curr Opin Immunol 24, 310-315, (2012); Baldwin, S. L. et al T Immunol 188, 2189- 2197 (2012); Nordly, P. et al. J Control Release 150, 307-317, (201 1 ); Schneider-Ohrum, K. et al. Vaccine 29, 9081-9092, (2011); Caskey, M. et al. J Exp Med 208, 2357-2366, 201 1); Petsch, B. et al. Pr Nat Biotechnol 30, 1210-1216, (2012), the contents of which are expressly incorporated herein by reference).
[0099] In certain embodiments, the RNA motifs of the disclosed subject matter (either naked RNA or RNA linked to a delivery vehicle as described above), can be administered parenterally, e.g., subcutaneously or intramuscularly, aerosolized, electroporated in the skin or muscle, or used intranasally, etc., or delivered by any other suitable route for delivery of RNA alone or in combination with a vaccine, in another embodiment, the compositions of the disclosed subject matter can be administered topically onto the skin or to the mucosa of a
subject (see, e.g., Pavot, V., Vaccine 2012 Jan 5;30(2): 142-54 and Bal, SM J. Control Release 2010 Dec 20;148(3);266-82).
Delivery of the RNA motifs with antigens
[00100] As described herein, as an adjuvant, the RNA motifs of the presently disclosed subject matter can be administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens. In certain embodiments, the RNA motif (or motifs) can be provided together with or conjugated to the antigen. In certain embodiments, the RNA motif (or motifs) can be can be conjugated to or encapsulated in a natural or synthetic nanoparticle, for example, but not limited to, liposomes, virus like particles, polymers to impart its immunostimulatory activity.
[00101] In certain embodiments, the RNA motif (or motifs) {e.g., SEQ ID NO: 1 ; SEQ ID NO:2; SEQ ID NO:5), or a modified variant of SEQ ID NO:l having immunostimulatory activity, can be administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens. In certain embodiments, the RNA motif is conjugated to additional nucleotides and administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens. For example, the modified RNA motif can have additional nucleotides at the 5' or 5' and 3' end of the DVG70-1 14 motif as described above {e.g., SEQ ID NO: 23).
J00102] In certain embodiments, the antigen can be any of a wide variety of substances capable of producing a desired immune response in a subject. The antigens used with these adjuvant compositions can be one or more of viruses (inactivated, attenuated, and modified live), bacteria, fungi, parasites, parasite eggs, nucleotides, polynucleotides, peptides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, carbohydrates, fatty acids, teichioc acid, peptidoglycans, lipids, or glycolipids, individually or in any combination thereof. In certain embodiments, the antigens used with the adjuvants of the disclosed subject matter can also include immunogenic fragments of nucleotides, polynucleotides, peptides, polypeptides, that can be isolated from the organisms referred to herein. In certain embodiments, they can also be in the form of DNA vaccines.
[00103] Live, modified-live, and attenuated viral strains are those that either do not cause disease in a subject have been isolated in non-virulent form or have been attenuated using methods well known in the art, including serial passage in a suitable cell line or exposure to
ultraviolet light or a chemical mutagen. Inactivated or killed viral strains are those which have been inactivated by methods known to those skilled in the art, including treatment with formalin, betapropriolactone (BPL), binary ethyleneimine (BEI), sterilizing radiation, heat, or other such methods.
J00104J In certain embodiments, two or more antigens can be combined to produce a polyvalent composition that can protect a subject against a wide variety of diseases caused by the pathogens. While conventional adjuvants are often limited in the variety of antigens with which they can be effectively used (either monovalently or polyvalently), the adjuvants described herein can be used effectively with a wide range of antigens, both monovalently and polyvalently. Thus, in certain embodiments, the antigens described herein can be combined in a single composition comprising the adjuvants described herein.
[00105] Some examples of pathogenic viruses that can be used as antigens in the compositions and methods of the present subject matter include hepatitis (A, B, or C), herpes virus (e.g., VZV, HSV-l , HAV-6, HSV-il, and CMV, Epstein Barr virus), adenovirus, influenza virus, flavi viruses, echovirus, rhinovirus, coxsackie virus, cornovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, molluscum virus, poliovirus, rabies virus, JC virus and arboviral encephalitis virus.
[00106J Some examples of pathogenic bacteria that can be used as antigens in the compositions and methods of the present subject matter include chlamydia, rickettsial bacteria, mycobacteria, staphylococci, streptococci, pneumonococci, meningococci and conococci, klebsiella, proteus, serratia, pseudomonas, legionella, diphtheria, salmonella, bacilli, cholera, tetanus, botulism, anthrax, plague, leptospirosis, and Lymes disease bacteria.
[00107] Some examples of pathogenic fungi that can be used as antigens in the compositions and methods of the present subject matter include Candida (albicans, krusei, glabrata, tropicalis, etc.), Cryptococcus neoformans, Aspergillus (fumigatus, niger, etc.), Genus Mucorales (Mucor, Absidia, Rhizophus), Sporothrix schenkii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis and Histoplasma capsulatum.
[00108] Some examples of pathogenic parasites that can be used as antigens in the compositions and methods of the present subject matter include Entamoeba histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba sp., Giardia lambia, Cryptosporidium sp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma
cruzi, Leishmania donovani, Toxoplasma gondi, Nippostrongylus brasiliensis, and Schistosomiasis.
[00109] Tumor antigens can also be used in the adjuvant compositions of the present subject matter. Many strategies for vaccination against tumors have been devised (see Rosenberg, S., 2000, Development of Cancer Vaccines, ASCO Educational Book Spring: 60- 62; Logothetis, C, 2000, ASCO Educational Book Spring: 300-302; Khayat, D. 2000, ASCO Educational Book Spring: 414-428; Foon, K. 2000, ASCO Educational Book Spring: 730-738; see also Restifo, N. and Sznol, M., Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita, V. et al. (eds.), 1 97, Cancer: Principles and Practice of Oncology, Fifth Edition). In certain of these strategies, a vaccine is prepared using autologous or allogeneic tumor cells. These cellular vaccines have been shown to be most effective when the tumor cells are transduced to express GM-CSF. GM-CSF has been shown to be a potent activator of antigen presentation for tumor vaccination (Dranoff et al. (1993) Proc. Natl. Acad. Sci U.S.A. 90 (80: 3539-43).
[00110] The study of gene expression and large scale gene expression patterns in various tumors has led to the definition of so called tumor specific antigens (Rosenberg, S A (1999) Immunity 10: 281 -7). In many cases, these tumor specific antigens are differentiation antigens expressed in the tumors and in the cell from which the tumor arose, for example melanocyte antigens gp 100, MAGE antigens, Trp-2. More importantly, many of these antigens can be shown to be the targets of tumor specific T cells found in the host. The tumor antigen can also include the protein telomerase, which is required for the synthesis of telomeres of chromosomes and which is expressed in more than 85% of human cancers and in only a limited number of somatic tissues (Kim, N et al. (3994) Science 266, 201 1-2013). (These somatic tissues can be protected from immune attack by various means). Tumor antigen can also be "neo-antigens" expressed in cancer cells because of somatic mutations that alter protein sequence or create fusion proteins between two unrelated sequences (i.e. bcr-abl in the Philadelphia chromosome), or idiotype from B cell tumors. Other tumor vaccines can include the proteins from viruses implicated in human cancers such a Human Papilloma Viruses (HPV), Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV).
[00111] Another form of tumor specific antigen which can be used in conjunction with the compositions and methods of the presently disclosed subject matter is purified heat shock proteins (HSP) isolated from the tumor tissue itself. These heat shock proteins contain fragments of proteins from the tumor cells and these HSPs are highly efficient at delivery to
antigen presenting cells for eliciting tumor immunity (Suot, R & Srivastava, P (1995) Science 269: 1585-1588; Tamura, Y. et al. (1997) Science 278: 1 17-120.
[00112] The RNA motifs and vaccination methods of the present disclosure can also be used in conjunction with anti-cancer therapies (e.g., chemotherapy), to augment cancerous cell death by creating a more immunogenic environment in a subject afflicted with cancer. Such combination therapy enhances cancer cell death and promotes a robust immune response capable of killing any residual cancer cells that have escaped treatment. (Lake et al. New Engl J of Med 354, 2503 (2006)). Other non-limiting examples of anti-cancer therapies that can be used with the compositions of the present disclosure include radiation, surgery, and hormone deprivation (Kwon, E. et al (1999) Proc. Natl. Acad. Sci U.S.A. 96 (26): 15074-9). Angiogenesis inhibitors can also be used. Inhibition of angiogenesis leads to tumor cell death, which can feed tumor antigen into host antigen presentation pathways.
[00113] In certain embodiments, cancer cells (e.g., tumor cells) isolated from a subject can be exposed to the adjuvants of the present subject matter and used to treat dendritic cells ex vivo. The mature ex vivo treated dendritic cells are then re-introduced into the patient and promote a robust immune response directed against the cancer cells.
Delivery of the RNA motifs to confer immunostimuiatory activity to inert nucleotide molecules
|00114] As described herein, the RNA motifs of the presently disclosed subject matter can be cloned into the genome of a non-immunostimulatory virus (i.e., inert virus) to confer immunostimuiatory activity against the inert virus. In certain embodiments, the RNA motif is cloned onto the 5' end of a viral gene, the 3' end of a viral gene, and/or within the viral gene, yet will still retain immunostimuiatory activity. The viral genome can be either RNA or DNA. In certain of such embodiments, the RNA stem-loop structure is maintained and/or stabilized.
[00115] In certain embodiments, the RNA motif DVG7o-n4 is cloned into the X-region from hepatitis C virus (HCV). In certain embodiments, the RNA motif (or motifs) (e.g., SEQ ID NO: l ; SEQ ID NO:2; SEQ ID NO:5, SEQ ID NO:23) is cloned into the viral genome of hepatitis (A, B, or C), herpes virus (e.g., VZV, HSV-1 , HAV-6, HSV-II, and CMV, Epstein Barr virus), adenovirus, influenza virus, flaviviruses, echovirus, rhinovirus, coxsackie virus, cornovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, molluscum virus,
poliovirus, rabies virus, JC virus or arboviral encephalitis virus, yet still retains immunostimulatory activity.
100116] In certain embodiments, the UNA motif (or motifs) is cloned into pathogenic bacteria, fungi, parasites, or tumor antigens, yet still retains immunostimulatory activity. Exemplary bacteria, fungi, parasites, and tumor antigens are listed above with respect to the delivery of the RNA motifs along with antigens.
[00117] In certain embodiments, the RNA motif (or motifs) is cloned into a polynucleotide, yet still retains immunostimulatory activity. In certain embodiments, the polynucleotide can be cDNA, genomic DNA, RNA, mRNA, RNAi, siRNAs, shRNAs, miRNA, etc. In certain embodiments, the polynucleotide can be mRNA.
Delivery of the RNA motifs via attachment to antibodies
[00118] As described herein, the RNA motifs of the presently disclosed subject matter can be conjugated or linked to an antibody to confer targeted immunostimulatory activity at the location of antibody specific antigen. Such antibodies include, but are not limited to monoclonal antibodies, subject's species specific antibodies, mammalian antibodies, human antibodies, humanized antibodies, camelid antibodies, chimeric antibodies, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the present disclosure). The antibodies can be of any isotype/class (e.g., IgG, IgE, IgM, IgD, IgA and IgY), or subclass (e.g., IgGl , IgG2, IgG3, IgG4, IgAl and IgA2). In another embodiment, the RNA motifs are conjugated or linked to an antigen binding fragment.
[00119] The linkage can be covalent bonds, or non-covalent interactions such as through electrostatic forces. Various linkers, known in the art, can be employed in order to form the immunoconjugate. Additionally, the immunoconjugate can be provided in the form of a fusion protein that may be expressed from a polynucleotide encoding the immunoconjugate. A "fusion protein" refers to proteins created through the joining of two or more genes or gene fragments which originally coded for separate proteins (including peptides and polypeptides). Translation of the fusion gene results in a single protein with functional properties derived from each of the original proteins.
Pharmaceutical compositions and administration
[00120] In certain embodiments, the RNA motifs of the present disclosure can be formulated as pharmaceutical compositions or pharmaceutical formulations by admixture with a pharmaceutically acceptable carrier or excipient. In certain embodiments, the pharmaceutical formulations can include one or more RNA motifs and a physiologically acceptable diluent or carrier. In certain embodiments, the pharmaceutical composition can further include an antigen, drug, adjuvant, or tumor chemotherapy.
[00121] In certain embodiments, the pharmaceutical formulation can be a solid dosage form. In certain embodiments, the solid dosage form can be a tablet or capsule.
[00122] In certain embodiments, the pharmaceutical formulation can be a liquid formulation. In certain embodiments, the liquid formulation can be an oral solution or oral suspension.
[00123] In certain embodiments, the pharmaceutical formulation can be a transdermal drug delivery system, e.g., a patch, cream, gel, and/or microemulsion.
[00124] In certain embodiments, the pharmaceutical formulation can include liposomes, nanoparticles, and/or other carriers. In certain embodiments, the pharmaceutical formulation can include an adjuvant or enhancer, e.g., an enzyme inhibitor.
[00125] In certain embodiments, the pharmaceutical formulation can be a direct infusion. In certain embodiments, the pharmaceutical formulation can be an implantable device.
[00126] Many methods can be used to introduce the vaccine formulations described herein, these include but are not limited to oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intra-pulmonary, rectal, vaginal and intranasal routes. All such routes are suitable for administration of these compositions, and can be selected depending on the patient and condition treated if there is a condition present, and similar factors by an attending physician. In certain embodiments, it is preferable to introduce a vaccine formulation via the natural route of infection of the pathogen for which the vaccine is designed. According to the desired route for administration, the compositions of the disclosure are prepared in the form of, for example, liquids, powders, aerosols, tablets, capsules, enteric coated tablets or capsules, or suppositories.
[00127] Selection of the appropriate dosage for the priming compositions of the present disclosure can be based upon the physical condition of the mammal, most especially including the general health and weight of the immunized mammal. Such selection and upward or downward adjustment of the effective dose is within the skill of the art.
|00128] Pharmaceutical compositions of the present disclosure, suitable for inoculation or for parenteral or oral administration, comprise attenuated or inactivated forms of mammalian viruses, for example, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions, and emulsions. The composition can further comprise auxiliary agents or excipients, as known in the art. See, e.g, Berkow et al, eds., The Merck Manual, 15th edition, Merck and Co., Rahway, N.J. (1987); Goodman et al., eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th edition, Pergamon Press, Inc., Elmsford, N.Y. (1990); Avery's Drug Treatment: Principles and Practice of Clinical Pharmacology and Therapeutics, 3rd edition, ADIS Press, LTD., Williams and Wilkins, Baltimore, Md. (1987); Osol, A., ed., Remington's Pharmaceutical Sciences, Mack Publishing Co, Easton, Pa. pp. 1324-1341 (1980); Katzung, ed. Basic and Clinical Pharmacology, Fifth Edition, Appleton and Lange, Norwalk, Conn. (1992), which references and references cited therein, are entirely incorporated herein by reference as they show the state of the art.
100129] For example, a virus vaccine composition of the present disclosure can comprise from about 102-109 plaque forming units (PFU)/ml, or any range or value therein, where the virus is attenuated. In certain embodiments, a vaccine composition comprising an inactivated virus can comprise an amount of virus corresponding to about 0.1 to 200 micrograms of an antigenic protein/ml or combinations thereof, or any range or value therein.
[00130] In certain embodiments, preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and/or emulsions, which can contain auxiliary agents or excipients known in the art. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration can generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water. Besides the inert diluents, such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents. See, e.g., Berkow, infra, Goodman, infra, Avery's, infra, Osol, infra and Katzung, infra, which are incorporated in their entirety herein by reference.
|00131] In certain embodiments, a vaccine composition of the present disclosure, used for administration to an individual, can further comprise salts, preservatives, chemical stabilizers, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the
composition. Typically, stabilizers, adjuvants, and preservatives are optimized to determine the best formulation for efficacy in the target human or animal. Suitable exemplary preservatives include chlorobutanol potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable stabilizing ingredients which can be used include, for example, casamino acids, sucrose, gelatin, phenol red, N-Z amine, monopotassium diphosphate, lactose, lactalbumin hydrolysate, and dried milk. Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the mammal being immunized. Examples of adjuvants are discussed above. Additional examples of materials suitable for use in vaccine compositions are provided in Osol, A., ed., Remington's Pharmaceutical Sciences, Mack Publishing Co, Easton, Pa. (1980), pp. 1324-1341, which reference is incorporated in its entirety herein by reference.
[00132] In certain embodiments, heterogeneity in the vaccine can be provided by mixing different modified viruses of the disclosed subject matter, such as 2-50 modified viruses or any range or value therein.
(00133] In certain embodiments, a pharmaceutical composition according to the present disclosure can further or additionally comprise at least one viral chemotherapeutic compound, including, but not limited to, gamma globulin, amantadine, ribavirin, guanidine, hydroxybenzimidazole, interferon-alpha, interferon-beta, interferon-gamma, thiosemicarbarzones, methisazone, rifampin, ribavirin, a pyrimidine analog, a purine analog, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, a protease inhibitor, or ganciclovir (neuraminidase inhibiting drugs oseltamivir, zanamivir). See, e.g., Katzung, infra, and the references cited therein on pages 798-800 and 680-681 , respectively, which references are herein entirely incorporated by reference.
[00134] In certain embodiments, a pharmaceutical composition according to the present disclosure can further or additionally comprise an aptamer to target a specific cell as provided in Bunka D. and Stockley P., "Aptamer come of age - at last," Nature Reviews Microbiology and Majumder P, et al., "From bench side research towards patented molecules with therapeutic applications," Expert Opin Ther Pat. 2009 Nov; 19(1 1 ): 1603- 13, references which are herein entirely incorporated by reference.
[00135] In certain embodiments, the vaccine can also contain variable but small quantities of endotoxin, free fomialdehyde, and preservative, which have been found safe and not contributing to the reactogenicity of the vaccines for humans.
[00136] In certain embodiments, the administration of a vaccine composition of the disclosure can be for either ''prophylactic" or "therapeutic" purposes. When provided prophylactically, the compositions are provided before any symptom of infection becomes manifest. In certain embodiments, the prophylactic administration of the composition serves to prevent or attenuate any subsequent infection. When provided therapeutically, the vaccine is provided upon the detection of a symptom of actual infection. The therapeutic administration of the compound(s) serves to attenuate any actual infection. See, e.g, Berkow, infra, Goodman, infra, Avery, infra and atzung, infra, which are entirely incorporated herein by reference.
[00137] In certain embodiments, an attenuated or inactivated vaccine composition of the present disclosure can thus be provided either before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
[00138] in certain embodiments, a vaccine or composition of the present disclosure is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient that enhances at least one primary or secondary humoral or cellular immune response against at least one strain of an infectious virus.
[00139] In certain embodiments, the "protection" provided need not be absolute, i.e., the viral infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population or set of patients. Protection can be limited to mitigating the severity or rapidity of symptom onset of infection or disease.
[00140] In certain embodiments, according to the present disclosure, an "effective amount" of a vaccine composition is one that is sufficient to achieve a desired biological effect. It is understood that the effective dosage can be determined by a medical practitioner based on a number of variables including the age, sex, health, and weight of the recipient, kind of concurrent treatment , if any, frequency of treatment, and the nature of the desired outcome. In certain embodiments, the ranges of effective doses provided below are not intended to limit the disclosed subject matter, but are provided as representative preferred dose ranges. However, in certain embodiments, the most preferred dosage will be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation. See, e.g., Betkow et al., eds., The Merck Manual, 16th edition, Merck and Co., Rahway, N.J., 1 92; Goodman et al., eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th edition, Pergamon Press, Inc., Elmsford, N.Y., (1990); Avery's Drug Treatment: Principles and Practice of Clinical Pharmacology and Therapeutics, 3rd edition, ADIS Press, LTD., Williams and Wilkins, Baltimore, Md. (1987), Ebadi, Pharmacology, Little, Brown and Co., Boston,
Mass. (1985); and atzung, infra, which references and references cited therein, are entirely incorporated herein by reference.
[00141] In certain embodiments, the dosage of an attenuated virus vaccine for a mammalian (e.g., human) adult can be from about 103-107 plaque forming units (PFU)/kg, or any range or value therein. In certain embodiments, the dose of inactivated vaccine can range from about 1 to 50 micrograms of an antigenic protein. However, the dosage should be a safe and effective amount as determined by conventional methods, using existing vaccines as a starting point.
[00142] In certain embodiments, the dosage of immunoreactive protein in each dose of virus or modified virus vaccine can be standardized to contain a suitable amount, e.g., 1 -50 micrograms or any range or value therein, or an amount recommended by the U.S. Public Health Service (PHS). Each 0.5-ml dose of vaccine preferably contains approximately 1 -50 billion virus particles, and preferably 10 billion particles.
[00143] While this disclosure generally discusses immunization in the context of prophylactic methods of protection, the term "immunizing" is meant to refer to both prophylactic and/or therapeutic methods. Thus, in certain embodiments, a method of immunizing includes both methods of protecting an individual from pathogen challenge, as well as methods for treating an individual suffering from pathogen infection. Accordingly, the present disclosure can be used as a vaccine for prophylactic protection and/or in a therapeutic manner; that is, as a reagent for immunotherapeutic methods and preparations.
EXAMPLES
[00144] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the presently disclosed subject matter, including, but not limited to the use of RNA molecule DVG70-1 1 or modified variants thereof to induce or enhance immunostimulatory responses in a subject. The following examples are not intended to limit the scope of the presently disclosed subject matter. It is understood that various other embodiments may be practiced, given the general description provided above.
Example 1: DVGs promote protection to infection with an unrelated virus.
[00145] To examine whether SeV iDVGs induce a broad antiviral state that could protect against unrelated viral infections, mouse cells were infected either with SeV C containing high
levels of copy-back iDVGs (SeV HD) or with SeV C depleted of iDVGs (SeV LD) or left untreated (N/T) and re-infected 6 h later with the unrelated IAV. Cells pre-infected with SeV HD were significantly more resistant to IAV replication than were cells pre-infected with SeV LD (Fig. 1A) and induced higher antiviral gene expression levels (Fig. IB). These data indicate that SeV iDVGs stimulate a strong antiviral state that can protect against infection with unrelated viruses.
[00146] Because copy-back DVGs maintain the promoter elements necessary for replication, both positive and negative DVG RNA strands are present in infected cells (Fig. 2A). To narrow down the search for molecular motifs that confer strong stimulatory activity to iDVGs, it was first assessed whether a specific strand of iDVG preferentially activates the host antiviral response during infection. The number of (+) and (-) RNA strands of a predominant iDVGs (DVG-546) present during infection with SeV strain Cantell (denoted "high DVG": HD) (12, 35) was quantified and correlated to amounts with IFNB1 mRNA expression. The description and validation of this assay are shown in Fig. 3A and 3B. Although copy numbers of (-)DVG strands were consistently higher than those of (+)DVG strands throughout the infection (Fig. 3C), an increased ratio of (+)/(-)DVG strands positively correlated with the induction of IFNB1 expression in infected humans A549 cells (Fig. 2B). The strong correlation between (+)DVG RNA and type I IFN expression was recapitulated in LLC-MK2 cells, a cell line highly permissive to SeV replication (Fig. 3D). Confirming the strong ability of (+)DVG RNA to stimulate the antiviral response, RNA-fluorescent in situ hybridization (RNA-FISH) in combination with immunofluorescence staining (IFA) showed that IRF3 translocation to the nucleus occurs predominantly in cells showing a strong DVG signal (Figs. 2C and 2D). Thus, accumulation of (+) copy-back DVG is positively associated with the induction of antiviral responses in cells infected with SeV.
Example 2: Identification of a candidate motif essential for type I IFN induction by (+)DVG RNA
[00147) It was previously reported that alterations in the internal (non-complementary) region of DVG-546 drastically affect its stimulatory ability (26). Specifically, a DVG-mutant retaining the 5'' end of the internal sequence (DVG-324) promoted enhanced expression of type 1 IFNs upon transfection, while a mutant missing the 5' end of the interna! sequence (DVG- 354) significantly lost its stimulatory capacity (26). These data suggest that a specific region
towards the 5' end of the internal sequence plays an essential role in maximizing the stimulatory potential of DVG RNA. Additional mutants further confirmed this prediction. One mutant that retained a shorter 5f internal sequence (DVG-268; Fig. 4A-C) also showed potent immuno stimulatory activity while mutants lacking either the complete internal sequence (DVG-200) or both complementary sequences (DVG IS, Fig. 4A-C) showed reduced ability to stimulate antiviral genes upon transfection. For all the studies reported here, ivtDVGs were tested for purity, endotoxin content, and activity after gel purification as shown in Fig. 5 (see also Fig. 6 and 7). This differential activity of mutant DVG proteins was sustained over a 24-h time course, ruling out the possibility of different kinetics of IFN induction by the different mutant proteins (see Fig. 6C). For all of these studies, in vitro-transcribed DVG(ivtDVG) RNAs were purified from gels, tested for purity and endotoxin content, and transfected into cells at equal molarity (see Fig. 7A to 7D).
[00148] To identify the specific sequence and/or secondary RNA structure responsible for the strong stimulatory activity of iDVGs, the folding of mutants with either strong or weak ability to induce type I IFN expression was modeled in silico. Based on the modeling, structures present only in strong inducers as candidates to maximize the DVG stimulatory ability was identified (Fig. 4C). For in silico folding predictions, the 3' complementary sequence of the constructs was excluded since long complementarities strongly interfere with predictions based on minimal free energy resulting in predicted structures that significantly deviate from the natural folding of the molecule. In these conditions, a candidate stem loop domain formed by nucleotides 70-1 14 (DVG70-1 14) was identified that was only observed in DVG mutants showing strong stimulatory ability (Fig. 4D). This region is enriched in A/U nucleotides when compared to the positive sense SeV genome or the full length DVG-546 (Fig. 4D). DVG70-1 14 spans the 3' end of the 5' complementary sequence and the 5' end of the internal sequence, consistent with a partial requirement for sequences of the complementary and internal regions of the DVG RNA. This analysis identified DVG70-1 14 as a candidate motif that provides strong immuno stimulatory activity to SeV iDVG RNA.
Example 3: DVG o-n is necessary for the strong stimulatory activity of SeV DVG RNA
[00149] To determine whether DVG70-1 14 is necessary for the strong stimulatory ability of SeV DVG RNA, the DVG70-1 14 motif was removed from DVG-268 or the parental DVG-546. Removal of DVG70.1 14 did not significantly affect other secondary structures of these molecules (Figs. 4E and 8C). Quality controls can be found in Fig. 8A and 8B. Removal of DVG7o-i i 4
nearly abolished the stimulatory activity of DVG-268, and cells transfected with ivtDVG- 268Λ7Ο·Π4 expressed significantly lower levels of IFNB1 and IFITI mRNA compared to cells transfected with ivtDVG-268 (Fig. 4F). This difference was recapitulated in murine cells and sustained at the RNA and protein levels over a 24-h time course (Fig. 4G). Significantly reduced activity was also observed in ivtDVG-546A70-H4 (Fig- 8C and 8D) demonstrating that DVG70.1 14 significantly augments the stimulatory activity of SeV iDVG RNA.
[00150] To further confirm the stimulatory role of DVG70-1 H, point mutations were introduced into this motif. A nucleotide swap within the stem region of DVG70-1 14 (U106G) disrupted the complementarity structure of DVG70-1 14 motif (Fig. 4E) resulting in reduced stimulatory activity of DVG-268 (Fig. 4F) and suggesting that the potent stimulatory activity of SeV iDVGs depends on the integrity of the DVG70-1 14 motif. To address if specific non- complementary structures within DVG70-1 14 are necessary for stimulation, single nucleotide swaps were introduced at the most distal loops of the DVG70-i motif (A89U and C97G) while preserving the overall predicted structure of the motif (Fig. 4E). Interestingly, the C97G mutation, but not the A89U mutation (SEQ ID NO:5) decreased the stimulatory activity compared to the parental DVG-268 (Fig. 4F), indicating that both structure and sequence influence the stimulatory activity of DVG7o-i 14.
Example 4; DVG70-114 promotes strong antiviral responses during SeV infection,
overcoming viral antagonism.
(00151] To test whether DVG70-1 14 is involved in the stimulation of antiviral immunity during infection, SeV stocks including recombinant defective viral particles were generated containing the DVG70-1 14 motif (rDVG-324) or lacking this motif (rDVG-354) as shown in Fig. 4A and 9A (26). As shown in Fig. 9B, LL-CM 2 cells were infected with virus rDVG-324 or rDVG-354 at an MOl of 5 TCID50/cell and analyzed at 6 h postinfection by RT-qPCR for the expression of IFN-βΙ , IFITI , and SeV NP mRNA. The relative copy number ofDVGR Awas quantified by RT-qPCR with the DVGcomp primers (see Table 2).
TABLE 2 Primers used in mutagenesis and mutant verification
Primers Forward/reverse primers (5' to 3')
Δ70- Π GTTCTTGTAAGTTTTTCTTGCTAGATTGGTAACTGGGTCATTCCC /
GGGAATGACCCAGTTACCAATCTAGCAAGAAAAACTTACAAGAAC
Δ5-51 CGACTCACTATAGGGACCATGTAAGTTTTTCTTGCTATTGTC/
GACAATAGCAAGAAAAACTTACATGGTCCCTATAGTGAGTCG
T106G GTCCAAGACTATCTTTATCTAGGTCCACAAGATTGGTAACTG /
GTCCAAGACTATCTTTATCTAGGTCCACAAGATTGGTAACTG
T106G A77C GTTTTTCTTGCTATTGTCATCTGGATAAGTCCAAGACTATC /
GATAGTCTTGGACTTATCCAGATGACAATAGCAAGAAAAAC
GCTATTGTCATATGGATAAGTCCTAGACTATCTTTATCTATGTCCAC
A89T /
GTGGACATAGATAAAGATAGTCTAGGACTTATCCATATGACAATAG C
C97G GGATAAGTCCAAGACTATGTTTATCTATGTCCACAAGATTGG /
CCAATCTTGTGGACATAGATAAACATAGTCTTGGACTTATCC
GCTATTGTCATATAGGATAAGTCCAAGACTATCTTTATCTTATGTCC
Motif] + AC /
GTGGACATAAGATAAAGATAGTCTTGGACTTATCCTATATGACAAT AGC
CTATTGTCATAGGATAAGTCCAAGACTATCTTTATCTTGTCCACAAG
otifi- /
CTTGTGGACAAGATAAAGATAGTCTTGGACTTATCCTATGACAATA G
HCV X-region TAATACGACTCACTATAGGTGGCTCCATCTTAGCCCTA/
ACTTGATCTGCAGAGAGGCCAGTATCA
HCV PolyU UC TAATACGACTCACTATAGGCCATCCTGTTTTTTTCCC/
AAAGGAAAGAAAAGGAAAAAAAGAGG
TTGTGGACATAGATAAAGAT
X-region_DVG70-1 14 Ra AGTCTTGGACTTATCCATATGACAAACTTGATCTGCAGAGAGGCCA
GTATCA
X-regionJDVG5-51 R' GAAGACAAGAAAATTTAAAAGGATACATATCTCTTAAACTCTTGTC
ACTTGATCTGCAGAGAGGCCAGTATCA
DVG-324 GGTGAGGAATCTATACGTTATAC/
CCTCAGGTTCCTGATCTC
DVG-354 GGTGAGGAATCTATACGTTATAC/
CCTCAGGTTCCTGATCTC
DVG Comp ACCAGACAAGAGTTTAAGAGATATG/
AGCAAGAAAAACTTACAAGAAGACA a. Only the reverse primer sequence is provided here. Use HCV X-region Forward primer for pairing the
mutagenesis.
[00152] Infection with rDVG-324 stimulated significantly higher levels of IFN-β Ι and IFlTl mRNA expression in LLC- K2 cells than did infection with rDVG-354, while the viral protein and DVG RNA expression levels were equivalent (Fig. 9C). These data show that DVG70-n4 functions to enhance the antiviral response during infection, demonstrating its biological relevance.
[00153] To further evaluate whether DVG7o-n4 promotes antiviral immunity in the presence of a virus-encoded antagonist, cells were infected with SeV LD 24 h before transfection with
either DVG-268 or DVG-268A70-i H- By the time of DVG RNA transfection, viral protein mRNA, including NP and P V, had accumulated to high levels in the cells (Fig. 9C) and no antiviral gene expression was detected (Fig. 9D, NT [nontransfected]). Agreeing with their predicted stimulatory potential, transfection of DVG-268 resulted in the strong expression of antiviral genes while DVG-268A7O~I I4 maintained its reduced stimulatory potential under these conditions (Fig. 9D). These data further demonstrate that DVG7o-n4 has strong immunostimulatory activity even in the presence of potent viral antagonists of detection.
Example 5: The 3' complementary end of iDVG RNA is not required for maximal IFN induction
[00154] Contrary to previous implications, the data strongly suggest that complementarity along the 5' and 3' ends of copy-back DVGs is not a requirement for strong stimulatory activity. To directly test if the 3 '-complementary sequence is essential, the complete 3' -complementary sequence (94nt) from DVG-324 (Fig. 10A; DVG-324NC; SEQ ID NO:6) was deleted. Upon transfection, DVG-324NC induced the same level of expression of antiviral genes as the parental DVG-324, and both mutants showed higher potency than DVG-546 (Fig. 10B). As expected, the potent stimulatory activity of DVG-324NC depended on the DVG 70-1 14 motif as a DVG-324NCA7O-H4 mutant significantly lost stimulatory potential (Fig. I OC, 10D, and 10F). (00155] To control for the role of additional secondary structures in the stimulatory activity of DVG-324NC, an auxiliary secondary motif (DVG5-51 ) located more proximal to the 5'- triphosphate end of RNA in relation to DVG70.1 14 was next removed (Fig. IOC - blue circle and 10E). This motif is also preserved in all DVG mutants shown in Fig. 4. Deletion of DVG5-5i in DVG-324NC did not affect the integrity of DVG70-1 14 or the overall structure of the DVG (Fig. I OC) and did not impact the stimulatory activity of DVG-324NC (Fig. 10F). Overall, these data demonstrated that DVG7o-n4 enhances the immunostimulatory activity of DVG RNA and functions independently of the 3'end complementary sequence or additional proximal secondary structures.
Example 6: Stabilization of DVGro-m enhances its stimulatory potential
[00156] It was next evaluated whether modifying the DVG70-1 14 motif could further optimize the stimulatory activity of DVG-derived RNAs. To do this, an additional A-U base pair was introduced into the DVG7o-n4 long stem region of the DVG-324NC background. This
insertion stabilized the stem structure as it increased its minimal free energy from -9.8kcal/mol to -10.89 kcal/mol (Fig. 30G; DVG-324NCmotin+). Cells transfected with DVG-324NCmolin+ RNA expressed two-fold higher levels of IFNBl and IFITl mRNA than cells transfected with unmodified DVG-324NC (Fig. 10H and data not shown) demonstrating that stabilization of DVG7o-i !4 motif improves its immunostimulatory potential. The stimulatory enhancement potential of stabilizing DVG7o-i 1 was further validated in DVG-546 (Fig. 8E and 8F).
Example 7: DVG70-114 motif confers strong immunostimulatory activity to inert RNA molecules
[00157] To assess if the immunostimulatory activity of DVG7o-n4 could be transferred to inert 5'triphosphate-containing RNA molecules, the DVG7o-i i4 motif was cloned into the X- region from hepatitis C virus (HCV), a well -described non-immuno stimulatory small RNA derived from the virus genome (13). The cloning strategy preserved the RNA stem-loop structures present in both the DVG70-u4 motif and the X-region (Fig. 1 1 A). Remarkably, transfection of the ivtRNA X-regionJDVG o-n4 (X-region based mutant that includes DVG70- 1 14) lead to pronounce induction of IFNBl and IFITl mRNA compared to the X-region alone (Fig. 1 IB). X-region_DVG7o-i i4 also demonstrated an equivalent ability to stimulate antiviral gene expression when compared with HCV polyU/UC (13) (Fig.1 IB). To rule out the possibility that the potent activity of X-region_DVG7o-i i4 resulted from adding an additional stem loop structure, independently of the sequence of the motif, the inventor also cloned into the X-region the auxiliary DVG5_5 t motif (Fig. IOC and 10F). As mentioned previously, DVG5- 51 motif is not required for immunostimulatory activity of DVG RNA. DVG5-5 i is of a similar size as DVG70-n4 and causes equivalent disruption of the X region folding (Fig. 1 1 A). Introduction of the DVG5.51 motif did not alter the stimulatory activity of the X-region (Fig. 1 IB) demonstrating that DVG7o-n4 has exceptional and transferrable immunostimulatory potential.
[00158] The activity of DVG RNA was compared with that of other known RIG-I ligands. As shown in Fig. S5A, DVG-derived RNA binds to RIG-1 with an affinity equivalent to that of poly(U/UC) and RNA containing DVG7o-n4 stimulates levels of antiviral expression equivalent to that of poly(U/UC) or the viral RNA synthetic analog poly(I · C) (see Fig. S5B and C).
Example 8: The DVGTO-I H motif promotes binding of the RNA to RIG-I
[001591 To establish whether the strong stimulatory activity of DVG-268 and DVG-324NC were mediated by RIG-I, these constructs were transfected into mouse embryo fibroblast lacking the essential RLR signaling molecule MAVS or lacking the RIG-I sensor. Similar to other DVG constructs (26), Ifnbl mRNA expression was completely dependent on MAVS and RIG-I activity for both mutants (Fig. 13A), while control polyI:C showed only MAVS, but not RIG-I dependency. In addition, Ifhbl stimulation was largely dependent on the presence of uncapped 5 '-triphosphates (Fig. 13B) and on RNA secondary structures (Fig. 13C). To determine if the DVG70-1 1 motif augmented the binding of DVG RNA to RIG-I, electrophoretic mobility shift assay (EMSA) was performed on DVG-RNA exposed to purified RIG-I proteins that lacked the signaling (CARD) domain. Binding was tested in both the absence or presence of ATP, which promotes RIG-I polymerization upon association to RNA. RIG-I deltaCARD was used previously in characterizing specific RNA binding signatures and demonstrated equivalent RNA binding affinity as their full-length parental protein (10, 36). RNAs containing the DVG7o-n 4 motif were more profoundly displaced in the gels than RNAs lacking this motif both in the absence and presence of ATP (Fig. 13D and 13E). These data indicate a stronger capacity of RNA containing the DVG70-M4 motif to promote RIG-I binding and polymerization, essential events in RLR signaling (37-39). In addition, a slight enhancement in the binding capacity of RNAs containing the DVGTO-I H motif to MDA5 deltaCARD was observed (Fig. 14), supporting previous reports of a supplementary role for MDA5 in the sensing of DVGs (34). Together, these results demonstrate that DVG7o-n4 facilitates the binding of RNAs to RLRs and is critical for effective triggering of RIG-1 signaling in response to SeV DVGs.
Example 9: DVG70-1 14 has iramunostimulatory activity in vivo
(00160) C57BL6 mice were treated intranasally (i.n.) with 30ul of PBS (mock) or 4 ig of polyhC, DVG-324NC or DVG-324NCA70-i i4. See Fig. 15. Expression of the antiviral gene Mxl in whole lung homogenates collected 6 hpi and RNA in situ hybridization on lungs extracted 6h after inoculation of DVG-324NC indicates that nasal delivery of the DVG7o-i i4 motif in vivo results in the delivery of the motif to the lungs. This indicates that the RNA motif is stable within the subject and that nasal administration is appropriate. Importantly, it demonstrates that RNAs containing this motif are active in triggering antiviral immunity when administered this way.
DISCUSSION
[00161 ] SeV iDVG-derived RNAs are natural RLR ligands that potentiate host antiviral innate immune responses (12, 26). The inventor has discovered an RNA secondary structure (DVG7o.f i4) that significantly enhances the activity of inert RNA and provides outstanding immunostimulatory activity.
[00162] DVG70-1 14 folds into a stable stem-loop motif in the positive sense strand of the SeV DVGs. Folding predictions of the negative sense of the molecule failed to predict the formation of a similar structure (not shown) corresponding with the observed strong correlation between the enhanced relative accumulation of (+)DVG in infected cells and type I IFN expression. These observations demonstrate that in addition to the conventional 5' -triphosphate motif, sequences and/or structures present only in the (+) sense of the molecule maximize its immunostimulatory potential.
[00163] The DVGvo-i u stem-loop motif shares little sequence homology with the standard viral genome, as it forms in the copy-back iDVG's "junction region" where the polymerase starts extending (or copying back) the nascent strand after been released from the template strand (12, 43, 44). Similar stem-loop structures are found in other copy-back DVGs generated during infection with SeV strains Cantell and 52 (data not shown), suggesting that this structure is broadly present during SeV infection.
(00164] Without being bound by theory, the immunostimulatory activity of DVG7o- n4 appears to depend on both its structure and sequence. Point mutation analyses demonstrated tolerance to nucleotide swaps at the most distal tip of the motif (A89U) while nucleotide stringency was shown in mutation at the bulge (C97G) and some areas of the stem (U106G). In addition, the data demonstrated that the 3' -complementary sequence is not required for the iDVG stimulatory activity. DVG-324NC (DVG-324 lacking the 3 '-complementary sequence) induced IFN expression equal to DVG-324 and this activity depended on an intact DVG7o- i i4- This result contradicts a previous study that shows a requirement for both 5' and 3' complementary sequences for the maintenance of SeV DVGs immunostimulatory functions (35). The disparity likely results from an unexpected impact of truncations of the complementary region on the structure of the DVG70- 1 14 motif leading to a misinterpretation of the need for the complementary region.
[00165] Remarkably, the insertion of DVG70-n4 but not of DVG5.51 into the inherently inert X-region of HCV conferred strong immunostimulatory activity to this molecule, comparable to
that of the well-characterized polyU/UC region. These data demonstrate that DVG7o-n4 retains its stimulatory potential even outside of the context of iDVGs. Previous studies demonstrated that 5 '-triphosphates were necessary for non-self recognition of SeV iDVG by RIG-I (24). Here it is shown that 5 '-triphosphates are not sufficient and that optimal recognition occurs only in the presence of DVG70-i i4, as mutants DVG-IS and DVG-200 maintain their 5 'triphosphate but do not stimulate RLR signaling. Here it is reported that DVG7o_n4 facilitates the binding of the iDVG to RIG-I explaining its strong ability to trigger the antiviral response. In addition, a role for DVG7o-i i4 in enhancing binding of MDA5 to DVG RNA observed, supporting previous findings of a role for MDA5 in the early detection of SeV iDVGs (34).
[00166] The role of DVGs in promoting strong antiviral responses during infection with a number of viruses has been documented since the 1970s, (23) and most recently it was shown that DVGs occurring naturally in the lung during SeV infection drive the antiviral response in vivo (24). Facilitated binding to RLR by DVG7o-i i4, together with the faster accumulation of DVGs over the standard virus genome in infected cells (24), likely explain the ability of DVGs to overcome viral antagonism of the immune response.
[00167] In summary, a molecular motif has been identified that facilitates the activation of the antiviral immune response by enhancing the binding of RNAs to the intracellular viral sensor protein RIG-I. Importantly, this motif can be harnessed to maximize the immunostimulatory activity of uncapped 5'triphosphate-containing RNAs and thus it represents a novel immunostimulatory enhancer that can be used in the development of vaccine adjuvants or antivirals.
MATERIALS AND METHODS
Cell lines and viruses
[00168] LLC-M 2 cells (Rhesus monkey kidney epithelial cells, ATCC, #DR-L2785), A549 cells (human type II alveolar cells, ATCC, #CCL185), and wild type, Ddx58'L (RIG-I*) and Mavs'1' MEFs (mouse embryo fibroblast, kindly provided by Drs. J. agan and J. Chen) were cultured in DMEM supplemented with 10% fetal bovine serum, 1 mM sodium pyruvate, 2 mL L-Glutamine, and 50 mg ml gentamicin or penicillin and streptomycin (all from Invitrogen). All cell lines were treated with mycoplasma removal agent (MP Biomedicals) before use. SeV Cantell HD (SeV-HD; high DVG particle content) was prepared in embryonated hen eggs as described previously (25).
Plasmids and constructs
[00169] A plasmid expressing DVG-546 flanked at the 3' end by the Spel-T7 promoter sequence and at the 5' end by the hepatitis delta virus ribozyme and the T7 polymerase terminator sequence was prepared as described previously (26). To generate DVG mutants, restriction enzyme sites were introduced into the construct using the QuickChange II XL site- directed mutagenesis kit (Agilent Technologies). Specifically, DVG-268 was generated by the introduction of 6 nucleotides to generate a Kpnl site at position 163 of the DVG-546 sequence. A second Kpnl site at position 448 of the wild type DVG internal sequence allowed the deletion of 228 nucleotide-long fragment of the DVG. DVG-324 and DVG-354 were generated as previously described (26). DVG-324NC was generated by introduction of a second Kpnl site at position 330 of the DVG-324 sequence allowing the deletion of a 100 nucleotide-long fragment between positions 230 and 330 of the DVG-324 sequence. Motif DVG70.1 t 4 and DVGs-51 deletions, single nucleotide swaps (T106G, A89U, C97G), and nucleotides additions (motifl +) were generated by site-directed mutagenesis (QuikChange XL II, Agilent Technologies). For nucleotide swaps, primers introduced T/G mutations at position 89,97 or 106 of the DVG-268 sequence. MotifH includes an A insertion after position 78, and a T insertion after position 104 of the DVG-324NC sequence. Sequences for all mutagenesis primers are shown in Figure 21. Poly U/UC and X-region plasmids were kindly provided by Dr. M. Gale (University of Washington).
HCV PA P preparation and manipulation
[00170] DNA sequences bearing PolyU/UC or X-region were amplified by PCR (X- region for 5?- T A ATACG ACTC ACTAT AGGTGGCTCC ATCTTAGCCCTA-3 ' , X-region rev 5'- ACTTGATCTGCAGAGAGGCCAGTATCA-3 ' ; HCV polyU/UC for 5'- TAATACGACTCACTATAGGCCATCCTGTTTTTTTCCC- 3'; HCV polyU/UC rev 5'- A A AGGA AAG A A A AGG A AAA A A AG AGG-3 ' ) using a high fidelity polymerase (Invitrogen). X-region mutants bearing DVG motifs were constructed by adding DVG motifs at the 3' end of molecule by PCR using the primers shown in Figure 22. The resulting PCR products were gel-purified (QIAGEN) and subjected to in vitro transcription as described below. ivtDVG preparation
|00171] DVG-expressing plasmids were linearized and in vitro transcribed using the Ffi A crrmt T7 kit (Ambion) in the presence of RNase inhibitor (Fermentas). RNA products
were treated with DNase followed by LiCl precipitation. OD260/280 ratios of all ivtDVG were between 2.00 and 2.25 and OD260/230 between 2.20-2.60. The integrity of ivtDVG was analyzed in an Agilent Bioanalyzer 2100. Endotoxin level of all ivtDVG used in this study was tested by the Biomedical Research Core Facility, University of Pennsylvania and was reported to be below 1.2EU/100 g for all ivtDVG RNA preparations and < 0.36EU/100 μg for all HCV polyU/UC and X-region mutant ivtRNA preparations. As an additional control all ivtDVGs were gel-purified on 5% Urea-TBE gel and transfected into LLC-M 2 cells at the same molarity (4.15 pmol). Purified ivtDVGs had essentially identical activity than the non-purified ivtDVGs used to gather most of the data. Purified PCR products were used for in vitro transcription of PolyU/UC or X-region RNA using the MEGAscript T7 kit (Ambion) in the presence of RNase inhibitor (Fermentas).
RNA treatments and transfection
[00172] To remove 5 '-triphosphates, 1 μg of ivtDVG was incubated with 10 U of Alkaline Phosphatase (AP, Thermo Scientific) for 60 min at 37 C. To cleave single stranded RNA, 1 μg of RNA was incubated with 1 ng of RNase A (Ambion) for 15 min at room temperature. To cleave double stranded RNA, RNA was incubated with 0.1 U of RNase VI (Ambion) for 15 min at room temperature. After treatments, RNA was purified using TRIzol or precipitatioiVinactivation buffer according to the manufacturer's specifications. AP and RNase dual treatment was accomplished by incubating AP treated ivtDVG with RNases following same protocol mentioned above. Prior to transfection, RNAs were heated at 65°C for 5 min, cooled down to room temperature for 5 min, and then chilled on ice to promote proper folding of the molecules before transfection into cells. 4.15 pmols of the structured RNAs were transfected into cells (2.5 * 105) using Lipofectamine 2000 (invitrogen). As controls, cells were transfected with equally molarity of High Molecular Weight (HMW) Poly I:C (InvivoGen).
Secondary structure in silico prediction
[00173] DVG RNA folding was predicted using RNAfold server from the Vienna RNA package v.2.1.8 (rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi. University of Vienna) (46). For analysis default parameters were applied for minimum free energy (MFE) and partition functions fold algorithms (Turner model, 2004). The optimal secondary structure with minimum free energy of the thermodynamic ensemble is shown for each DVG RNA prediction.
Quantitative RT-PCR (RT-qPCR)
100174] RT-qPCR was performed as previously described (24). Briefly, 1 μg of RNA was reverse transcribed using High Capacity RNA-to-cDNA kit (Applied Biosystems). qPCRs were performed using SYBR Green PCR Master Mix (Applied Biosystems) in a Viia7 Applied Biosystems Lightcycler. Primers used can be found in Figure 22.
RNA fluorescent in situ hybridization (FISH) and immunofluorescence assay
(IFA)
[00175] Probes complementary to the positive sense (+) of the SeV genome were designed against the full-length genome (from position 1 to 1 1630) excluding the 5' end that encompasses the DVG sequence. A pool of 32 oligos targeting the (+) SeV genome was designed by Dr. Arjun Raj as previously described (47). These probes recognize (+) viral genome as well as all viral-encoded mRNAs. For probes identifying DVGs, a pool of 15 single-stranded 20 nucleotides-long oligos specific for the 3' end of the (+) SeV genome (from position 14965 tol 5416) which covers the DVG sequences was designed using same methods. These probes will bind to DVGs, viral L protein mRNA, and (+) SeV genome. In both pools, oligos were complementary to a different region of the target RNA, with no less than two bases separating any two oligonucleotides. SeV genome probes were labeled with Quasar 570 and DVG probes were labeled with Quasar 670 (Biosearch Technologies). Since L protein mRNA and (+) SeV genome are recognized by both set of probes, pixels containing both colors were considered a representation of SeV genome/protein. Pixels only stained with Quasar 670 (pseudocolored green) represent (+) DVGs. For FISH, cells were plated onto plain glass coverslips (Fisher Scientific) at a density of 1 x 106 cells/well and grown overnight at 37°C. RNA-FISH was performed according to published protocols with minor modifications (48). Briefly, 2.5* 105 LL-CMK2 cells were transfected with 4.15 pmol of ivtDVG RNA using Lipofectamine 2000. At different times after transfection the cells were washed with phosphate buffer saline (PBS), followed by fixation with 4% formaldehyde for 10 min at room temperature (RT). Fixed cells were then permeabilized with 70% ethanol for 1 h at RT. Permeabilized cells were incubated with anti-human IRF3 antibody (Santa Cruz, 1 : 100 dilution) followed by Alexa Fluor 594-labeled goat anti-rabbit IgG (Invitrogen, 1 :500 dilution) diluted in 1% bovine albumin in presence of 40U/ml RNase inhibitor (Invitrogen). Stained cells were incubated in 4% formaldehyde for 10 min prior to FISH and then washed with PBS and equilibrated in wash buffer containing 10% formamide and 2X saline sodium citrate
(SSC). FISH was performed by hybridizing fixed cells with 10 nM of probes diluted in hybridization buffer consisting of 10% formamide, 2X SSC, and 10% dextran sulfate (w/v). Hybridyzation was performed overnight in a humidified chamber at 37°C. Imaging acquisition was performed on Nikon E600 Epifluorescent microscope equipped with a 100X, 1.4 numerical aperture (NA) oil-immersion objective (Zeiss) and a Zeiss AxiCam Rm camera.
FISH-IFA image quantification
[00176] Imaging quantification was performed using Volocity Quantitation module (Perkin-Elmer) (49). Exposure time, gain, and offset were held constant for all images. The fluorescent signal from the nuclei of cells was selected by drawing a region of interest (ROI) around each nucleus. The fluorescent signals of the (+)DVG was determined by drawing an ROI around the entire cell and following the same procedure as described above. The average ROI intensity of IRF3 and (+)DVG signals in mock infected cells was measured and used as reference to set threshold for defining nuclear IRF3 and (+)DVG positive cells. Nuclear IRF3 positive cells among (+)DVG positive populations were identified by performing "intersect module" while the nuclear IRF3 positive cells among (+)DVG negative populations were identified by the performing "exclude touching" module. For the analysis, at least 250 cells were quantified in each experimental group through three independent experiments.
Eleetrophoretic Mobility Shift Assay (EMSA)
[00177] RIG- deltaCARD and MDA5_deltaCARD protein (RIG-I or MDA5 without the two N-terminal CARDs) were kindly provided by Dr. Sun Hur (Harvard, Boston, MA) and were prepared as described elsewhere (36). EMSA was performed by incubating ivtRNA with Ι -g or indicated amount RIG-1 deltaCARD or MDAS deltaCARD protein in buffer A (20 mM HEPES (pH 7.5), 150 mM NaCl, 1.5 mM MgC12, and 2 mM dithiothreitol [DTT]) for 15 min at 37°C, and the complex was analyzed on 4-12% Bis-Tris NativePAGE (Bio-Rad). Gels were stained with SYBR Gold (Life Technologies), and fluorescent gel images were recorded and analyzed using a Gel Doc XR+ imaging system (Bio-Rad).
Statistical Analysis
[00178] Statistical analyses were performed using GraphPad Prism version 5.0. GraphPad Software, San Diego, CA, USA. www.graphpad.com. A statistically significant difference was defined as a P value of <0.05 by either One-way ANOVA or Student's / test with or without post hoc test as indicated in each figure based on specific data set.
Example 10: DVG-derived RNA acts synergistically with FS9 to enhance inimunostimulatory activity
[00179] MF59 is an Adjuvant produced by Norvartis that is licensed for vaccines used in humans in Europe and others parts of the world, approved by the FDA for use in the USA in influenza vaccines for the elderly. It is an emulsion and presumably facilitates the delivery of the antigen to the target cells. It also has a mild immunostimulatory potential.
[00180] Samples for immunization were formulated with (in ratio of) 1 μg DVG, 40 μΐ MF59, 0.6 μg IAV Cal/09 HA protein as antigen per mouse / dose. In this experiment we used DVG-268 was used. Briefly, 1 pg DVG-268 was diluted in water, heated at 65 degree for 5 min and put on ice for 2 min to restore correct folding of the RNA. Then 40 μΐ of MF59 and 0.6 μg of IAV Cal/09 HA protein were mixed into the samples to get the complete formulation. Samples were kept in 4 degree before i.m.
[001811 Six-weeks old B129 mice were injected intramuscularly in the flank with ^g DVG-derived RNA alone or diluted in PBS mixed with MF59, (Adda VAX; InvivoGen) or MF59 alone. As vehicle control, the same volume of PBS was injected in the opposite flank. Flank muscle was collected 24 hours after injection. Total RNA was extracted from tissue homogenate with TRIzol (Invitrogen). Expression of various antiviral genes mRNA in tissue homogenate was analyzed by RT-qPCR. Fig. 23 demonstrated that MF59 and DVGs together synergize in their adjuvant capacity. Fig. 24 demonstrated the innate immune response is mice was synergistically stimulated.
Example 11: DVG-derived RNA induced strong protection to infection challenge
[00182] In Fig. 25 six-weeks old B129 mice (n=5) were immunized intramuscularly with 1 g DVG-268 RNA diluted in water mixed with 40 μΐ MF59 (InvivoGen), Flu Cal/09 D225G HA protein (HA=2.5 pg; BEI Resource). Blood serum was collected 3 weeks post immunization. Flu HA specific IgG, IgGl and IgG2b antibodies in the blood were measured by ELISA. DVG-268 induced strong protection to infectious challenge when used in a single immunization together with an influenza HA protein vaccine. DVG-268 also acted synergistically with MF59 to create the enhanced immune response.
[00183] Twenty-seven days post immunization, mice were challenged with Flu Cal/09 D225G intranasally (2X104 TCID50/mice) and weighted in the following three consecutive davs nost infection. Whole lungs were collected 3 days post infection. Total RNA was
extracted from the whole lung homogenate with TRIzol (Invitrogen), Expression of Flu NP mRNA in whole lung homogenate was analyzed by RT-qPCR as an indication of virus load in the lung and presented in Fig. 26. DVG-268 also acted synergistically with MF59 to create the enhanced immune response.
Example 12: Motif 70-114 induced strong protection to infection challenge
(00184] In Fig. 27 six-weeks old B129 mice (n-5) were immunized intramuscularly with 1 μ¾ modified DVG7o-i i4 5' and 3' overhang motif (Motif; DVG70-1 14 (RNA structure shown; SEQ ID NO. 23) diluted in water and mixed with 40 μΐ MF59 (InvivoGen) and Flu Cal/09 D225G HA protein (HA=2.5 g; BEI Resource). Blood serum was collected 3 weeks post immunization. Level of Flu HA specific IgG, IgGl and IgG2b antibodies in the serum were measured by EL1SA. DVG70-i H 5' and 3' overhang motif also acted synergistically with MF59 to create the enhanced immune response.
[00185] In Fig. 28 twenty-seven days post immunization, mice were challenged with Flu Cal/09 D225G intranasally (2X104 TCID50/mice) and weighted in the following three consecutive days post infection. Whole lungs were collected 3 days post infection. Total RNA was extracted from whole lung homogenate with TRIzol (Invitrogen). Expression of Flu NP mRNA in whole lung homogenate was analyzed by RT-qPCR. Data are shown as mRNA copy number relative to house keeping gene Rpsl l and Gapdh. DVG70-1 14 motif also acted synergistically with MF59 to create the enhanced immune response.
Example 13: DVG-derived RNA is stable at room temperature
[00186] DVG-268 is stable at 4°C and 37°C (Fig. 29), and continue to remain stable for at least 25 hours at room temperature (Fig. 30). DVG-268 (3 ng/μΐ) was diluted in water and analyzed for at the indicated times using the RNA pico 6000 assay on Agilent 2100 Bioanalyzer.
Example 14: DVG-derived RNA can be inserted into a delivery vector/DNA vaccine to enhance the vaccine immunostimulatory activity
[00187] For this study, DVG-324 was genetically engineered into a MERS DNA vaccine. A description of the MERS vaccine backbone can be found in Science Trans Med 301 , 301ra312 (2015). The DNA vector encoding for the MERS S protein and DVG-324 was
diluted in water and delivered via in vivo electroporation into the tibialis anterior muscle immunizations as indicated in Fig. 31.
(00188] DVG-324 increased the immunostimulatory activity of the MERS vaccine (Fig. 31 ). The MERS specific IFNganima response was assessed on week three by ELlSpot assays using six peptide pools encompassing the entire MERS S protein.
Example 15: DVG70-114 motif alone conserve strong immunostimulatory activity in the presence of a 5' overhang
[00189] For this study, Motif DVG70-1 14 was modified by including 3' and/or 5' additional overhang nucleotides to test the minimal requirements for potent immunostimulatory activity. Recombinant DVG70-1 14 was synthetized with various combination of 3" and 5' overhangs. In particular, a range of 5-15 nucleotide additional overhangs on both 5' and 3' prime of DVG70-1 14 motif were tested.
[00190] LLC-MK2 cells were transfected with 250 ng of control or treated RNAs and analyzed 6h after transfection by RT-qPCR. Gene expression is shown as a copy number relative to the gene GAPDH. Error bars indicate the standard deviation of triplicate measurements in a representative experiment (**p<0.01, ***p<0.001 , ****p<0.0001) by one way ANOVA with Bonferroni adjustment performed on PRISM. All treatments were run in triplicate.
[00191] 3 '-overhang consisted of an additional 10 nucleotide overhang sequence at 3' prime of DVG70-1 14 motif (SEQ ID NO.: 22). 5' and 3'-overhang consisted of additional 5 nucleotides and 15 nucleotides at the 5' prime and 3' prime of DVG70-1 14 motif (SEQ ID NO.: 23), respectively. Blunt consisted of DVG70-1 14 motif alone (SEQ ID NO.: 1 ). Mock was the untreated control..
[00192] The data indicate an overhang at the 5' end was required for maximized IFN stimulation (Fig. 32). These mutant RNAs were then transfected into cells and innate immune responses were characterized using qPCR. Consistent with the previous experiment, the molecule with the motif placed at the 3' end failed to trigger an immune response. In addition, the blunt motif, lacking both a 5' and 3' overhangs, also failed to trigger an immune response. However, the mutant RNA with the motif flanked by overhangs at both the 3' and 5' successfully elicited an immune response comparable to the parent DVG-268 molecule.
Example 16: Potent immunostimulatory activity of DDO in vivo requires type I IFN signaling
[00193] Six-weeks old WT and IFNb receptor knockout (IFNrKO) mice were immunized intramuscularly with DVG-derived RNA (DVG-268) diluted in water mixing with 40μ1 MF59 (MF; InvivoGen) and 0.625μg IAV Cal/09 D225G HA protein (HA; BEI Resource). Blood serum was collected 2 weeks post immunization. Level of IAV HA specific IgG, IgGl and IgG2b antibody in blood serum was measured by ELISA assay. ***<0.0001, **<0.001 and *<0.05 by One way-ANOVA with Bonferroni pos-hoc test, ns-non- significant
[00194] Result show IFN dependency of DVG-268 working as an adjuvant in vivo (Fig. 33).
[00195] Various publications, patents and patent application are cited herein, the contents of which are hereby incorporated by reference in their entireties.
REFERENCES
1. Dixit E, Kagan JC. 2013. Intracellular pathogen detection by RIG-I-like receptors. Advances in immunology 117:99-125.
2. Kumar H, Kawai T, Akira S. 201 1. Pathogen recognition by the innate immune system. International reviews of immunology 30: 16-34.
3. Yoo JS, Kato H, Fujita T. 2014. Sensing viral invasion by RIG-I like receptors. Current opinion in microbiology 20: 131 - 138.
4. Seth RB, Sun L, Ea CK, Chen ZJ. 2005. Identification and characterization of MAVS, a mitochondrial antiviral signaling protein that activates NF-kappaB and IRF 3. Cell 122:669-682.
5. Kawai T, Takahashi K, Sato S, Coban C, Kumar H, Kato H, Ishii KJ, Takeuchi O, Akira S. 2005. IPS-1, an adaptor triggering RIG-i- and Mda5-mediated type I interferon induction. Nat Immunol 6:981-988.
Xu LG, Wang YY, Han KJ, Li LY, Zhai Z, Shu HB. 2005. VISA is an adapter protein required for virus- triggered IFN-beta signaling. Mol Cell 19:727-740.
Samuel CE. 2001 . Antiviral actions of interferons. Clinical microbiology reviews
14:778-809,.
Schlec M, Roth A, Hornung V, Hagmann CA, Wimmenauer V, Barchet W, Coch C, Janke M, Mihailovic A, Wardle G, Juranek S, Kato H, Kawai T, Poeck H, Fitzgerald KA, Takeuchi O, Akira S, Tuschl T, Latz E, Lud ig J, Hartmann G.
2009. Recognition of 5' triphosphate by RIG-I helicase requires short blunt double- stranded RNA as contained in panhandle of negative-strand virus. Immunity 31 :25-34. Yoneyama M, Onomoto , Jogi M, Akaboshi T, Fujita T. 2015. Viral RNA detection by RIG-I-like receptors. Curr Opin Immunol 32C:48-53.
Anchisi Sp, Guerra J, Garcin D. 2015. RIG-I ATPase Activity and Discrimination of Self-RNA versus Non-Self-RNA. mBio 6 (2) pii: el 2349-14.
Nallagatia SR, Hwang J, Toroney R, Zheng X, Cameron CE, Bevilacqua PC. 2007. 5'-triphosphate-dependent activation of PKR by RNAs with short stem-loops. Science 318: 1455- 1458.
Strahle L, Garcin D, Kolakofsky D. 2006. Sendai virus defective-interfering genomes and the activation of interferon-beta. Virology 351 : 101 -1 1 1 .
Saito T, Owen DM, Jiang F, Marcotrigiano J, Gale M, Jr. 2008. Innate immunity induced by composition-dependent RIG-I recognition of hepatitis C virus RNA. Nature 454:523-527.
Schnell G, Loo YM, Marcotrigiano J, Gale M, Jr. 2012. Uridine composition of the poly-U/UC tract of HCV RNA defines non-self recognition by RIG-I. PLoS pathogens 8:el 002839.
Uzri D, Gehrke L. 2009. Nucleotide sequences and modifications that determine RIG- I/RNA binding and signaling activities. J Virol 83:4174-4184.
Witteveldt J, Blundell R, Maarleveld JJ, McFadden N, Evans DJ, Simmonds P. 2013. The influence of viral RNA secondary structure on interactions with innate host cell defences. Nucleic Acids Research 42 (5) : 3314-29.
Goubau D, Schlee M, Deddouche S, Pruijssers AJ, Zillinger T, Goldeck M, Schuberth C, Van der Veen AG, Fujimura T, Rehwinkel J, Iskarpatyoti JA, Barchet W, Ludwig J, Dermody TS, Hartmann G, Reis e Sousa C. 2014. Antiviral immunity via RlG-I-mediated recognition of RNA bearing 5 '-diphosphates. Nature 514:372-375.
Pichlmair A, Schulz O, Tan C-P, Rehwinkel J, Kato H, Takeuchi O, Akira S, Way M, Schiavo G, Reis e Sousa C. 2009. Activation of MDA5 Requires Higher-Order RNA Structures Generated during Virus Infection. Journal of virology 83:10761-10769. Kato H, Takeuchi O, Sato S, Yoneyama M, Yamamoto M, Matsui K, Uematsu S, Jung A, Kawai T, Ishii KJ, Yamaguchi O, Otsu K, Tsujimura T, Koh CS, Reis e Sousa C, Matsuura Y, Fujita T, Akira S. 2006. Differential roles of MDA5 and RIG- I helicases in the recognition of RNA viruses. Nature 441:101-105.
Moltedo B, Lopez CB, Pazos M, Becker MI, Hermesh T, Moran TM. 2009. Cutting edge: stealth influenza virus replication precedes the initiation of adaptive immunity. J Immunol 183:3569-3573.
Zhao L, Jha BK, Wu A, Elliott R, Ziebuhr J, Gorbalenya AE, Silverman RH, Weiss SR. 2012. Antagonism of the interferon-induced OAS-RNase L pathway by murine coronavirus ns2 protein is required for virus replication and liver pathology. Cell Host Microbe 11:607-616.
Hermesh T, Moltedo B, Lopez CB, Moran TM. 2010. Buying time-the immune system determinants of the incubation period to respiratory viruses. Viruses 2:2541- 2558.
Lopez CB. 2014. Defective viral genomes: critical danger signals of viral infections. Journal of virology 88:8720-8723.
Tapia K, Kim WK, Sun Y, Mercado-Lopez X, Dunay E, Wise M, Adu M, Lopez CB. 2013. Defective viral genomes arising in vivo provide critical danger signals for the triggering of lung antiviral immunity. PLoS Pathog 9:el 003703.
Yount JS, Kraus TA, Horvath CM, Moran TM, Lopez CB. 2006. A novel role for viral-defective interfering particles in enhancing dendritic cell maturation. J Immunol 177:4503-4513.
Mercado-Lopez X, Cotter CR, Kim WK, Sun Y, Munoz L, Tapia K, Lopez CB.
2013. Highly immunostimulatory RNA derived from a Sendai virus defective viral genome. Vaccine 31:5713-5721.
Tapia K, Kim WK, Sun Y, Mercado-Lopez X, Dunay E, Wise M, Adu M, Lopez CB. 2013. Defective viral genomes arising in vivo provide critical danger signals for the triggering of lung antiviral immunity. PLoS pathogens 9:el 003703.
Re GG, Gupta KC, Kingsbury DW. 1983. Genomic and copy-back 3' termini in Sendai virus defective interfering RNA species. Journal of virology 45:659-664.
Calain P, Curran J, Kolakofsky D, Roux L. 1 92. Molecular cloning of natural paramyxovirus copy-back defective interfering RNAs and their expression from DNA. Virology 191 :62-71.
Engelhorn M, Strieker R, Roux L. 1993. Molecular cloning and characterization of a Sendai virus internal deletion defective RNA. J Gen Virol 74 ( Pt 1):137-141.
Kolakofsky D. 1976. Isolation and characterization of Sendai virus DI-RNAs. Cell 8:547-555.
Salinas Y, Roux L. 2005. Replication and packaging properties of short
Paramyxovirus defective RNAs. Virus Res 109: 125-132.
Strahle L, Marq JB, Brini A, Hausmann S, Kolakofsky D, Garcin D. 2007.
Activation of the beta interferon promoter by unnatural Sendai virus infection requires RIG-1 and is inhibited by viral C proteins. J Virol 81: 12227-12237.
Yount JS, Gitlin L, Moran TM, Lopez CB. 2008. MDA5 Participates in the
Detection of Paramyxovirus Infection and Is Essential for the Early Activation of Dendritic Cells in Response to Sendai Virus Defective Interfering Particles. J Immunol 180:4910-4918.
Patel JR, Jain A, Chou YY, Baum A, Ha T, Garcia-Sastre A. 2013. ATPase-driven oligomerization of RIG-I on RNA allows optimal activation of type-I interferon. EMBO Rep 14:780-787.
Wu B, Peisley A, Tetrault D, Li Z, Egelnian EH, Magor KE, Walz T, Penczek PA,
Hur S. 2014. Molecular Imprinting as a Signal- Activation Mechanism of the Viral RNA Sensor RIG-I. Molecular Cell 55:51 1-523.
Peisley A, Lin C, Wu B, Orme-Johnson M, Liu M, Walz T, Hur S. 201 1.
Cooperative assembly and dynamic disassembly of MDA5 filaments for viral dsRNA recognition. Proc Natl Acad Sci U S A 108:21010-2101 .
Peisley A, Wu B, Yao H, Walz T, Hur S. 2013. RIG-I forms signaling-competent filaments in an ATP-dependent, ubiquitin-independent manner. Mol Cell 51:573-583. Wu B, Peisley A, Richards C, Yao H, Zeng X, Lin C, Chu F, Walz T, Hur S. 2013. Structural basis for dsRNA recognition, filament formation, and antiviral signal activation by MDA5. Cell 152:276-289.
Pichlmair A, Schulz O, Tan CP, Naslund TI, Liljestrom P, Weber F, Reis e Sousa
C. 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5'- phosphates. Science 314:997-1001.
Weber F, Wagner V, Rasmussen SB, Hartmann R, Paludan SR. 2006. Double- stranded RNA is produced by positive-strand RNA viruses and DNA viruses but not in detectable amounts by negative-strand RNA viruses. J Virol 80:5059-5064.
Schonborn J, Oberstrass J, Breyel E, Tittgen J, Schumacher J, Lukacs . 1991. Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude nucleic acid extracts. Nucleic Acids Res 19:2993-3000.
Shioda T, Ivvasaki , Shibuta H. 1986. Determination of the complete nucleotide sequence of the Sendai virus genome RNA and the predicted amino acid sequences of the F, HN and L proteins. Nucleic Acids Res 14: 1545-1563.
Plattet P, Strahle L, le Mercier P, Hausmann Sp, Garcin D, olakofsky D. 2007. Sendai virus RNA polymerase scanning for mRNA start sites at gene junctions.
Virology 362:41 1-420.
Gosai SJ, Foley SW, Wang D, Silverman IM, Selamoglu N, Nelson AD, Beilstein MA, Daldal F, Deal RB, Gregory BD. 2015. Global Analysis of the RNA-Protein Interaction and RNA Secondary Structure Landscapes of the Arabidopsis Nucleus. Mol Cell 57:376-388.
Deutsch V, Brun G. 1 83. Nongenetic complementation in VSV: asymmetric contribution of the L proteins of each parent in the rescue of group I ts mutants.
Virology 124:366-379.
Raj A, van den Bogaard P, Rifkin SA, van Oudenaarden A, Tyagi S. 2008. Imaging individual mRNA molecules using multiple singly labeled probes. Nat Meth 5:877-879.
Zavada J, Zavadova Z, Russ G, Polakova K, Rajcani J, Stencl J, Loksa J. 1983. Human cell surface proteins selectively assembled into vesicular stomatitis virus virions. Virology 127:345-360.
Peiuso RW, Moyer SA. 1983. initiation and replication of vesicular stomatitis virus genome RNA in a cell-free system. Proceedings of the National Academy of Sciences of the United States of America 80:3198-3202.
Claims
1. A method for stimulating an immune response in a subject comprising administering to the subject at least one antigen in conjunction with an RNA motif capable of inducing an antigen specific immune response in the subject.
2. The method of claim 1 , wherein the at least one antigen is selected from the group consisting of virus, bacterial, fungal, parasite, nucleotide, and peptide antigens.
3. The method of claim 1, wherein the RNA motif comprises the nucleotide sequence of SEQ ID NO:l .
4. The method of claim 1 , wherein the RNA motif comprises a nucleotide sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:23.
5. The method of claim 1 , wherein the RNA motif comprises a modified variant of SEQ ID NO: 3 having immunostimulatory activity.
6. The method of claim 1, wherein the subject has a tumor.
7. The method of claim 1 , wherein the subject is a human.
8. The method of claim 1 , wherein the subject is a non-human mammal.
9. The method of claim 1 , wherein the subject is a non-mammal.
10. The method of claim 9, wherein the non-mammal is a fish.
1 1. The method of claim 1 , further comprising an adjuvant.
12. The method of claim 1 1 , wherein the adjuvant is MF59.
13. A method of activating an antigen presenting cell comprising contacting the cell with an antigen and an RNA motif capable of inducing an antigen specific immune response in the subject.
14. The method of claim 13, wherein the antigen presenting cell is isolated from a subject and activated ex vivo.
15. The method of claim 14, wherein the activated cell is reintroduced into the subject.
16. The method of claim 13, wherein the antigen presenting cell is a dendritic cell .
17. The method of claim 13, wherein the RNA motif comprises the nucleotide sequence of SEQ ID NO:l .
18. The method of claim 13, wherein the RNA motif comprises the nucleotide sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:23.
19. The method of claim 13, wherein the RNA motif comprises a modified variant of SEQ ID NO:l having immunostimulatory activity.
20. The method of claims 13, 14, or 15, wherein the at least one antigen is selected from the group consisting of virus, bacterial, fungal, parasite, nucleotide, and peptide antigens.
21. A method for stimulating an immune response in a subject comprising administering to the subject an antibody conjugated with at least one RNA motif capable of inducing an antigen specific immune response in the subject.
22. The method of claim 21 , wherein the antibody is a monoclonal antibody.
23. The method of claim 21 , wherein the antibody is human.
24. The method of claim 21 , wherein the antibody is humanized.
25. The method of claim 21 , wherein the RNA motif comprises the nucleotide sequence of SEQ ID NO:l .
26. The method of claim 21 , wherein the RNA motif comprises a nucleotide sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:23.
27. The method of claim 21, wherein the RNA motif comprises a modified variant of SEQ ID NO: 1 having immunostimulatory activity.
28. The method of claim 21 , wherein the subject has a tumor.
29. The method of claim 21 , wherein the subject is a human.
30. The method of claim 21 , wherein the subject is a non-human mammal.
31. The method of claim 21 , wherein the subject is a non-mammal.
32. The method of claim 31 , wherein the non-mammal is a fish.
33. A method for stimulating an immune response in a subject to an immunostimulatory inert virus comprising administering to the subject a nucleotide sequence of the inert virus genome wherein at least one RNA motif capable of inducing an antigen specific immune response in the subject is cloned into the inert viral nucleotide sequence.
34. The method of claim 33, wherein the RNA motif comprises the nucleotide sequence of SEQ ID NO: l .
35. The method of claim 33, wherein the RNA motif comprises a nucleotide sequence of SEQ ID NO:2, SEQ ID NO.5, or SEQ ID NO:23.
36. The method of claim 33, wherein the RNA motif comprises a modified variant of SEQ ID NO: 1 having immunostimulatory activity.
37. The method of claim 33, wherein the subject is a human.
38. The method of claim 33, wherein the subject is a non-human mammal.
39. The method of claim 33, wherein the subject is a non-mammal.
40. The method of claim 39, wherein the non-mammal is a fish.
41. A method for stimulating an immune response in a subject to an immunostimulatory inert polynucleotide comprising administering to the subject an immunostimulatory inert polynucleotide wherein at least one RNA motif capable of inducing an antigen specific immune response in the subject is cloned into the an immunostimulatory inert polynucleotide sequence.
42. The method of claim 41, wherein the polynucletide is cDNA, genomic DNA, RNA, mRNA, RNAi, siRNAs, shRNAs, or miRNA.
The method of claim 42, wherein the polynucleotide is mRNA.
44. The method of claim 41, wherein the RNA motif comprises the nucleotide sequence of SEQ ID NO:l .
45. The method of claim 41 , wherein the RNA motif comprises a nucleotide sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:23.
46. The method of claim 41, wherein the RNA motif comprises a modified variant of SEQ ID NO:l having immunostimulatory activity.
47. The method of claim 41 , wherein the subject is a human.
48. The method of claim 41 , wherein the subject is a non-human mammal.
49. The method of claim 41 , wherein the subject is a non-mammal.
50. The method of claim 49, wherein the non-mammal is a fish.
51. A method for stimulating an immune response in a subject comprising administering to the subject an adjuvant conjugated with at least one RNA motif capable of inducing an antigen specific immune response in the subject.
52. The method of claim 51 , wherein the adjuvant is MF59.
53. The method of claim 51 , wherein the adjuvant is Alum.
54. The method of claim 51 , wherein the RNA motif comprises the nucleotide sequence of SEQ ID NO:l .
55. The method of claim 51, wherein the RNA motif comprises a nucleotide sequence of SEQ ID NO:2, SEQ ID NO:5, or SEQ ID NO:23.
56. The method of claim 51, wherein the RNA motif comprises a modified variant of SEQ ID NO:l having immunostimulatory activity.
57. The method of claim 51 , wherein the subject is a human.
58. The method of claim 51 , wherein the subject is a non-human mammal.
59. The method of claim 51 , wherein the subject is a non-mammal.
60. The method of claim 59, wherein the non-mammal is a fish.
61. A pharmaceutical composition comprising an isolated RNA motif comprising the nucleotide sequence of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:23, or a modified variant of SEQ ID NO: l having immunostimulatory activity and a pharmaceutically acceptable carrier.
62. The pharmaceutical composition of claim 61 , further comprising an adjuvant.
63. A pharmaceutical composition comprising an isolated RNA motif comprising the nucleotide sequence of SEQ ID NO: l , SEQ ID NO:2, SEQ ID NO:5, SEQ ID NO:23, or a modified variant of SEQ ID NO: l having immunostimulatory activity, one or more antigens, and a pharmaceutically acceptable carrier.
64. The pharmaceutical composition of claim 63, further comprising an adjuvant.
65. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO: 1.
66. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO:2.
67. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO:5.
68. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO.23.
69. An isolated RNA molecule comprising the nucleotide sequence of a modified variant of SEQ ID NO: 1 having immunostimulatory activity.
70. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO: 1, wherein 5 - 15 nucleotides are added to the 5' end of SEQ ID NO: 1.
71. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO: 1 , wherein 5 - 15 nucleotides are added to the 5' end and 5 - 15 nucleotides are added to the 3' end of SEQ ID NO: 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/571,096 US10624964B2 (en) | 2015-05-01 | 2016-04-29 | Methods and compositions for stimulating immune response using potent immunostimulatory RNA motifs |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201562155740P | 2015-05-01 | 2015-05-01 | |
| US62/155,740 | 2015-05-01 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2016179034A2 true WO2016179034A2 (en) | 2016-11-10 |
| WO2016179034A3 WO2016179034A3 (en) | 2016-12-15 |
Family
ID=57217853
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2016/030242 Ceased WO2016179034A2 (en) | 2015-05-01 | 2016-04-29 | Methods and compositions for stimulating immune response using potent immunostimulatory rna motifs |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US10624964B2 (en) |
| WO (1) | WO2016179034A2 (en) |
Cited By (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018172426A1 (en) * | 2017-03-24 | 2018-09-27 | Biontech Rna Pharmaceuticals Gmbh | Methods and compositions for stimulating immune response |
| WO2018213464A3 (en) * | 2017-05-16 | 2018-12-27 | Children's Medical Center Corporation | Inhibiting the fungal cell-surface phosphate transporter pho84 |
| WO2019204179A1 (en) * | 2018-04-20 | 2019-10-24 | Merck Sharp & Dohme Corp. | Novel substituted rig-i agonists: compositions and methods thereof |
| US10736957B2 (en) * | 2017-12-19 | 2020-08-11 | President And Fellows Of Harvard College | Enhanced immunogenicity of mRNA with co-encoded adjuvant sequences |
| WO2021097347A1 (en) * | 2019-11-15 | 2021-05-20 | Infectious Disease Research Institute | Rig-i agonist and adjuvant formulation for tumor treatment |
| US20210252131A1 (en) * | 2016-06-24 | 2021-08-19 | Institut Pasteur | Compositions and methods comprising measles virus defective interfering particles for the prevention of infectious diseases |
| US20220202846A1 (en) * | 2019-01-10 | 2022-06-30 | Osaka University | Immunostimulating composition |
| WO2022165313A1 (en) | 2021-02-01 | 2022-08-04 | Regenxbio Inc. | Gene therapy for neuronal ceroid lipofuscinoses |
| EP3746088B1 (en) * | 2018-02-02 | 2024-07-10 | University of Washington | Compositions and methods for inducing tripartite motif-containing protein 16 (trim16) signaling |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101842679B1 (en) * | 2015-10-15 | 2018-03-28 | 한국과학기술원 | Rna oligonucleotide and enhancer of immune system comprising the same |
| US10973908B1 (en) | 2020-05-14 | 2021-04-13 | David Gordon Bermudes | Expression of SARS-CoV-2 spike protein receptor binding domain in attenuated salmonella as a vaccine |
| US12537071B1 (en) | 2020-07-22 | 2026-01-27 | David Gordon Bermudes | Bacteria having boolean control pathways expressing therapeutic proteins including immunotherapeutic cytotoxins |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US855654A (en) * | 1906-06-30 | 1907-06-04 | Paul Herpolsheimer | Valve-gear. |
| US5703055A (en) | 1989-03-21 | 1997-12-30 | Wisconsin Alumni Research Foundation | Generation of antibodies through lipid mediated DNA delivery |
| CA2017507C (en) | 1989-05-25 | 1996-11-12 | Gary Van Nest | Adjuvant formulation comprising a submicron oil droplet emulsion |
| IL101715A (en) | 1991-05-02 | 2005-06-19 | Amgen Inc | Recombinant dna-derived cholera toxin subunit analogs |
| IT1253009B (en) | 1991-12-31 | 1995-07-10 | Sclavo Ricerca S R L | DETOXIFIED IMMUNOGENIC MUTANTS OF COLERIC TOXIN AND TOXIN LT, THEIR PREPARATION AND USE FOR THE PREPARATION OF VACCINES |
| US5593972A (en) | 1993-01-26 | 1997-01-14 | The Wistar Institute | Genetic immunization |
| HU219767B (en) | 1993-01-26 | 2001-07-30 | Leslie R. Coney | Compositions and methods for delivery of genetic material into cells |
| US5739118A (en) | 1994-04-01 | 1998-04-14 | Apollon, Inc. | Compositions and methods for delivery of genetic material |
| US5837533A (en) | 1994-09-28 | 1998-11-17 | American Home Products Corporation | Complexes comprising a nucleic acid bound to a cationic polyamine having an endosome disruption agent |
| WO2006138435A2 (en) * | 2005-06-16 | 2006-12-28 | Mount Sinai School Of Medicine | Methods for enhancing immune responses |
| US8496941B2 (en) | 2009-06-03 | 2013-07-30 | National Institute Of Advanced Industrial Science And Technology | Vectors for generating pluripotent stem cells and methods of producing pluripotent stem cells using the same |
| KR20130108295A (en) * | 2010-08-13 | 2013-10-02 | 베일러 리서치 인스티튜트 | Novel vaccine adjuvants based on targeting adjuvants to antibodies directly to antigen-presenting cells |
| WO2014151265A1 (en) * | 2013-03-15 | 2014-09-25 | The Trustees Of The University Of Pennsylvania | Methods and compositions for stimulating immune response |
-
2016
- 2016-04-29 WO PCT/US2016/030242 patent/WO2016179034A2/en not_active Ceased
- 2016-04-29 US US15/571,096 patent/US10624964B2/en active Active
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US12533404B2 (en) * | 2016-06-24 | 2026-01-27 | Institut Pasteur | Compositions and methods comprising measles virus defective interfering particles for the prevention of infectious diseases |
| US20210252131A1 (en) * | 2016-06-24 | 2021-08-19 | Institut Pasteur | Compositions and methods comprising measles virus defective interfering particles for the prevention of infectious diseases |
| WO2018172426A1 (en) * | 2017-03-24 | 2018-09-27 | Biontech Rna Pharmaceuticals Gmbh | Methods and compositions for stimulating immune response |
| US12168051B2 (en) | 2017-03-24 | 2024-12-17 | BioNTech SE | Methods and compositions for stimulating immune response |
| EP4241786A3 (en) * | 2017-03-24 | 2023-12-27 | BioNTech SE | Methods and compositions for stimulating immune response |
| US11471522B2 (en) | 2017-03-24 | 2022-10-18 | BioNTech SE | Methods and compositions for stimulating immune response |
| WO2018213464A3 (en) * | 2017-05-16 | 2018-12-27 | Children's Medical Center Corporation | Inhibiting the fungal cell-surface phosphate transporter pho84 |
| US10736957B2 (en) * | 2017-12-19 | 2020-08-11 | President And Fellows Of Harvard College | Enhanced immunogenicity of mRNA with co-encoded adjuvant sequences |
| EP3746088B1 (en) * | 2018-02-02 | 2024-07-10 | University of Washington | Compositions and methods for inducing tripartite motif-containing protein 16 (trim16) signaling |
| US11542505B1 (en) | 2018-04-20 | 2023-01-03 | Merck Sharp & Dohme Llc | Substituted RIG-I agonists: compositions and methods thereof |
| WO2019204179A1 (en) * | 2018-04-20 | 2019-10-24 | Merck Sharp & Dohme Corp. | Novel substituted rig-i agonists: compositions and methods thereof |
| EP3909588A4 (en) * | 2019-01-10 | 2023-01-04 | Osaka University | IMMUNOSTIMULATING COMPOSITION |
| US20220202846A1 (en) * | 2019-01-10 | 2022-06-30 | Osaka University | Immunostimulating composition |
| WO2021097347A1 (en) * | 2019-11-15 | 2021-05-20 | Infectious Disease Research Institute | Rig-i agonist and adjuvant formulation for tumor treatment |
| WO2022165313A1 (en) | 2021-02-01 | 2022-08-04 | Regenxbio Inc. | Gene therapy for neuronal ceroid lipofuscinoses |
Also Published As
| Publication number | Publication date |
|---|---|
| US10624964B2 (en) | 2020-04-21 |
| US20180169222A1 (en) | 2018-06-21 |
| WO2016179034A3 (en) | 2016-12-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10624964B2 (en) | Methods and compositions for stimulating immune response using potent immunostimulatory RNA motifs | |
| US12240873B2 (en) | Respiratory syncytial virus (RSV) vaccine | |
| Ross et al. | Single dose combination nanovaccine provides protection against influenza A virus in young and aged mice | |
| CA2975816A1 (en) | Prime-boost regimens involving administration of at least one mrna construct | |
| BR112020013974A2 (en) | FORMULATION FOR RNA ADMINISTRATION | |
| US10653769B2 (en) | iDNA vaccines and methods for using the same | |
| JP2016520534A (en) | Influenza nucleoprotein vaccine | |
| US20240115693A1 (en) | Sars-cov-2 antigen nanoparticles and uses there of | |
| US12514919B2 (en) | Influenza vaccine composition based on novel nucleic acid | |
| Lu et al. | Enhanced protective immune response of foot-and-mouth disease vaccine through DNA-loaded virus-like particles | |
| JP2013545733A (en) | Recombinant envelope protein of human immunodeficiency virus (HIV) and vaccine containing the same | |
| WO2014151265A1 (en) | Methods and compositions for stimulating immune response | |
| EP3035960B1 (en) | Respiratory syncytial virus (rsv) vaccine | |
| AU2011269729A1 (en) | Constrained immunogenic compositions and uses therefor | |
| US20220323569A1 (en) | Plant-produced vlps and ric vaccines | |
| AU2019200943B2 (en) | Vaccine against Bovine Viral Diarrhea Virus | |
| US20240158763A1 (en) | Optimal production of sars-cov-2 virus-like particles (vlps) produced in mammalian cells | |
| Genova | HA-ppy immunity: unveiling the power of hyaluronan as an adjuvant in SARS-CoV-2 vaccination | |
| WO2023211281A1 (en) | Antiviral vaccine composition | |
| JP2025506695A (en) | mRNA vaccine | |
| Kamble | GENERATION OF VIRUS-LIKE PARTICLES (VLPs) OF AVIAN INFECTIOUS BRONCHITIS VIRUS AND ITS IMMUNOLOGICAL ASSESSMENT | |
| NZ750583B2 (en) | Vaccine against bovine viral diarrhea virus | |
| HK1260012A1 (en) | Compositions and methods for modified dendrimer nanoparticle vaccine delivery |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16789857 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15571096 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16789857 Country of ref document: EP Kind code of ref document: A2 |

