WO2014151265A1 - Methods and compositions for stimulating immune response - Google Patents

Methods and compositions for stimulating immune response Download PDF

Info

Publication number
WO2014151265A1
WO2014151265A1 PCT/US2014/025318 US2014025318W WO2014151265A1 WO 2014151265 A1 WO2014151265 A1 WO 2014151265A1 US 2014025318 W US2014025318 W US 2014025318W WO 2014151265 A1 WO2014151265 A1 WO 2014151265A1
Authority
WO
WIPO (PCT)
Prior art keywords
dvg
rna molecule
seq
rna
derived
Prior art date
Application number
PCT/US2014/025318
Other languages
French (fr)
Inventor
Carolina B. Lopez
Xiomara MERCADO-LOPEZ
Original Assignee
The Trustees Of The University Of Pennsylvania
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by The Trustees Of The University Of Pennsylvania filed Critical The Trustees Of The University Of Pennsylvania
Publication of WO2014151265A1 publication Critical patent/WO2014151265A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/39—Medicinal preparations containing antigens or antibodies characterised by the immunostimulating additives, e.g. chemical adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/12—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/461—Cellular immunotherapy characterised by the cell type used
    • A61K39/4615—Dendritic cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/462—Cellular immunotherapy characterized by the effect or the function of the cells
    • A61K39/4622—Antigen presenting cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/46—Cellular immunotherapy
    • A61K39/464—Cellular immunotherapy characterised by the antigen targeted or presented
    • A61K39/464838—Viral antigens
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/525—Virus
    • A61K2039/5252—Virus inactivated (killed)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
    • A61K2039/552—Veterinary vaccine
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/555—Medicinal preparations containing antigens or antibodies characterised by a specific combination antigen/adjuvant
    • A61K2039/55511—Organic adjuvants
    • A61K2039/55561—CpG containing adjuvants; Oligonucleotide containing adjuvants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/31—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterized by the route of administration
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K2239/00—Indexing codes associated with cellular immunotherapy of group A61K39/46
    • A61K2239/38—Indexing codes associated with cellular immunotherapy of group A61K39/46 characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/16011—Orthomyxoviridae
    • C12N2760/16111—Influenzavirus A, i.e. influenza A virus
    • C12N2760/16134—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18511—Pneumovirus, e.g. human respiratory syncytial virus
    • C12N2760/18534—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
    • C12N2760/00011—Details
    • C12N2760/18011—Paramyxoviridae
    • C12N2760/18811—Sendai virus
    • C12N2760/18834—Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein

Definitions

  • the immune system plays an important role in defense against specific microorganisms, for example viruses, specific fungi and bacteria, as well as in recognizing and repelling malignant (degenerate) cells (tumor cells).
  • Immune responses have been characterized as either humoral, in which antibodies specific for antigens are produced by differentiated B lymphocytes known as plasma cells, or cell mediated, in which various types of T lymphocytes act to eliminate antigens by a number of mechanisms.
  • CD4+ helper T cells that are capable of recognizing specific antigens can respond by releasing soluble mediators such as cytokines to recruit additional cells of the immune system to participate in an immune response.
  • CD8+ cytotoxic T cells that are also capable of specific antigen recognition can respond by binding to and destroying or damaging an antigen bearing cell (i.e., dendritic cells) or particle.
  • Vaccinations are a long-known method of activating the immune system.
  • Vaccination and immunization is the introduction of a non-virulent agent into a subject, in which the agent elicits the subject's immune system to mount an immunological response.
  • vaccine antigens are killed or attenuated forms of the microbes which cause the disease.
  • the presence of non-essential components and antigens in these killed or attenuated vaccines has encouraged considerable efforts to refine vaccine components including developing well-defined synthetic antigens using chemical and recombinant techniques.
  • the refinement and simplification of vaccines has led to a concomitant loss in potency.
  • Low-molecular weight synthetic antigens though devoid of potentially harmful contaminants, are often not sufficiently immunogenic by themselves and do not produce an adequate immune response.
  • the immunogenicity of an antigen can be increased by administering it in a mixture with substances called adjuvants.
  • adjuvants increase the response against the antigen either by directly acting on the immunological system or by modifying the phannacokinetic characteristics of the antigen, resulting in an increased interaction time between the antigen and the immune system. Additionally, the addition of an adjuvant can permit the use of a smaller dose of antigen to stimulate a similar immune response, thereby reducing the production cost of a vaccine.
  • a number of compounds exhibiting varying degrees of adjuvant activity have been described. These include saponins complexed to membrane protein antigens (immune stimulating complexes), pluronic polymers with mineral oil, killed Mycobacteria in mineral oil, Freund's complete adjuvant, bacterial products, such as muramyl dipeptide (MDP) and lipopolysaccharide (LPS), as well as lipid A, and liposomes.
  • MDP muramyl dipeptide
  • LPS lipopolysaccharide
  • adjuvants such as Sponin, Quil A, and the water-in-oil adjuvant, Freund's with killed tubercle bacilli (Freund's complete) or without bacilli (Freund's incomplete), have had limited use in humans due to their toxic effects; and, concerns have been raised due to adverse effects in the host (e.g., production of sterile abscesses, organ damage, carcinogenicity, or allergenic responses).
  • Aluminum salts have been useful for some vaccines like hepatitis B, diphtheria, tetanus, and toxoid; however, they are not useful for others like rabies, MMR, and typhoid.
  • Aluminum salts fail to induce cell-mediated immunity, result in the induction of granulomas at the injection site and vary in effectiveness between batches of alum preparations.
  • RNA molecules that mimic viral-derived oligonucleotides as potential adjuvants.
  • Poly I:C a synthetic double- stranded RNA polymer, has been identified as an inducer of cytokine production in in vitro and in vivo studies (Magee M E & GriffithMJ, lifeScience II, 11 : 1081- 1086,1972; ManettiYR et al., Eur. J. Immunol.
  • DC dendritic cell
  • APC antigen presenting cell
  • DVGs defective interfering virus particles derived from the mouse paramyxovirus Sendai (SeV) that contain complementary ends (known as copy-back genomes) were shown to have potent immunostimulatory properties (see Yount et al., 2006; Yount et al., 2008; U.S. Patent Application Publication No. 2009/0304738, the contents of which are expressly incorporated herein by reference).
  • SeV particles containing DVGs promote the expression of high levels of IFN- ⁇ , IL-12, IL-6 and other cytokines from infected cells, as well as the complete maturation of mouse and human dendritic cells (DCs), a necessary property of an effective adjuvant molecule (Yount et al., 2006; Yount et al., 2008).
  • DCs mouse and human dendritic cells
  • the present disclosure is based, at least in part, on the identification of immunostimulatory RNAs derived from a defective viral genome (DVG) that act as adjuvants or immunostimulatory agents to enhance host immune responses.
  • DVG defective viral genome
  • the disclosure provides methods for stimulating an immune response in a subject including administering to the subject, e.g., a mammalian subject or a non-mammalian subject, e.g., a human, bird, or fish, at least one antigen in conjunction with defective viral genome-derived RNA molecule capable of inducing an antigen specific immune response in the subject.
  • the present disclosure provides methods of activating a dendritic cell including contacting the cell with an antigen and a defective viral genome-derived RNA molecule capable of inducing an antigen specific immune response.
  • the dendritic cell is isolated from a subject and activated ex vivo. The activated cell can then be introduced, or reintroduced, into the subject.
  • the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO: l, or variants thereof having immunostimulatory activity. In another embodiment, the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:2, or variants thereof having immunostimulatory activity. In another embodiment, the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:3, or variants thereof having immunostimulatory activity. In another embodiment, the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:4, or variants thereof having immunostimulatory activity. In another embodiment, the antigen is, for example, a virus, bacterial, fungal, parasite, nucleotide, or peptide antigen.
  • the defective viral genome-derived RNA molecule comprises a structure as described by Figure 12. In certain embodiments, the defective viral genome-derived RNA molecule comprises at least 1, 2, 3, 4, 5 or more, or any combination thereof, of the RNA motifs described by Figure 12.
  • compositions comprising a defective viral genome-derived RNA molecule comprising the nucleotide sequence of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or variants thereof having immunostimulatory activity, one or more antigens, and a pharmaceutically acceptable carrier.
  • the disclosure provides an isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO:l , SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
  • Figure 1 Activation of human DCs upon SeV Cantell HD infection induces strong CD4 + T cell response.
  • E Expression of viral proteins (Np) mRNA and Il-12p40 was determined from a sample of the cells 2 hpi by RTqPCR.
  • F Anti-influenza virus IgG in the sera of mice 14 days after immunization.
  • G Number of influenza virus specific IFNy-producing CD8 + T cells in splenocytes from immunized mice. Error bars indicate the standard deviation of triplicate measurements in a representative experiment, ns: non significant. *p ⁇ 0.05, **p ⁇ 0.01, ***p ⁇ 0.001, ****p ⁇ 0.0001 (Unpaired t student test).
  • FIG. 2 Recombinant SeV copy back DVG preserves strong stimulatory activity.
  • BHK-21 cells expressing the T7 polymerase (BSR-T7) were infected with partially inactivate SeV 52 and transfected with the plasmid encoding DVG-546. Cells and supernatant were removed 48 h later and inoculated into 10-day embryonated hen eggs.
  • B LLCMK2 cells were infected at a moi of 5 with three consecutive passages (PI-P3) of allantoid fluid from eggs containing control SeV Cantell LD alone or in the presence of rDPs. The presence of DVG-546 in the infected cells was confirmed 15 h after infection by RT-PCR.
  • DVG for SeV Cantell was used as a positive control (+).
  • D LLMCK2 cells infected with SeV Cantell LD or rDP (P3) were analyzed by RTqPCR for the expression of the viral protein Np mRNA or (E) for ⁇ / ⁇ . Data are expressed as copy numbers relative to the housekeeping genes ⁇ -tubulin and rpsll.
  • Figure 3 Naked DVG-derived RNA preserves immunostimulatory activity.
  • A Representation of deletion mutants of the DVG genome. Deletions (hatched) were performed in the internal sequence (black) without compromising the DVG complementary ends (grey).
  • B The electrophoretic analysis for each in vitro transcribed RNA was performed in an Agilent's 2100 Bioanalyzer.
  • C LLCMK2 cells were transfected with mDVG-546, capped mDVG-546 (DVG CAP), mDVG- 546 treated with calf intestinal phosphatase (DVG-CIP) or the different mutants and 6 h post-transfection cells were harvested and total cellular RNA was extracted to determine expression of ⁇ ⁇ mRNA by RTqPCR. Data are expressed as copy numbers relative to the housekeeping genes Actb and Tubalb. Statistical outliers were removed based on the Grubb's test. *p ⁇ 0.05 (Unpaired t student test).
  • RIGIKO and MAVSKO MEFs were transfected with 500ng of in vitro transcribed RNA or mock-treated. Total RNA was extracted 8h later and expression of 1 ⁇ mRNA was determined by RTqPCR. Data are expressed as copy numbers relative to the housekeeping genes Actb and Tubalb. *p ⁇ 0.05, ****p ⁇ 0.0001 (Unpaired t student test).
  • FIG. 5 DVG-derived naked RNA shows immunostimulatory activity in mice.
  • Mice were injected subcutaneously in the footpad with 50ug of DVG-derived RNAs, Poly I:C or PBS. After 36 hrs, footpad tissue was harvested and RNA was extracted for cytokine expression analysis by RTqPCR for ⁇ - ⁇ mRNA (A) or 11-12 mRNA (B).
  • Figure 6 SEQ ID NO:l.
  • Figure 7 SEQ ID NO:2.
  • Figure 8 SEQ ID NO:3.
  • Figure 9 SEQ ID NO:4. An exemplary DVG-derived RNA molecule having a length of 268 nucleotides.
  • Figure 10 LLCMK2 cells were transfected with 500ng of each of the in vitro transcribed RNAs. IFNbeta production was determined by RTqPCR. Data show average of three independent experiments.
  • FIG. 11A-E Mice were injected subcutaneously in the footpad with 50 ⁇ of DVG-324 or poly I:C (high molecular weight).
  • B Analysis of cytokine expression in mice footpads collected at 6 h post infection. The experiment was independently repeated two times. Each assay was performed in triplicates.
  • CDl lc + CDl lb + cells were further gated for expression of CD 103 and B220 to quantify CD1 lc + CDl lb + CD103 " DCs and CD1 lb lo CDl lc'°B220 + plasmacytoid DCs. Data show a representative plot for poly I:C treatment and two representative plots for DVG-324 treatment.
  • E Antibodies in the sera of Balb/c mice three weeks after immunization with a single i.m. dose of 180 ⁇ g of inactivated respiratory syncytial virus (inRSV) in the presence of 50 ⁇ g poly I:C, 50 ⁇ g DVG-324, or PBS. Sera pre- immunization (pre-bleed: PB) was also analyzed. Anti-RSV antibodies were determined by ELISA.
  • inRSV inactivated respiratory syncytial virus
  • Figure 12 Shows RNA motifs of DVGs with strong and weak activity. The DVGs that exhibited strong activity shared a common motif (arrow).
  • the present disclosure is based, at least in part, on the discovery of immunostimulatory RNAs derived from a defective viral genome (DVG) that act as adjuvants or immunostimulatory agents to enhance host immune responses.
  • DVG defective viral genome
  • the inventors have cloned the genome of a mouse paramyxovirus Sendai (SeV) DVG, and generated short, optimized DVG-derived RNA molecules from the SeV that retain or improve the stimulatory properties of full DVGs. These DVG- derived RNA molecules can be used as immunostimulants in vivo.
  • SeV-derived DVGs preserve strong immuno stimulatory activity while in the context of a viral infection, as well as when used as naked RNA. As described herein, these short SeV DVG-derived RNAs have been shown to induce high levels of IFN- ⁇ expression in vitro and trigger fast expression of proinflammatory cytokines and mobilization of dendritic cells when injected in the footpad tissue or skin of mice.
  • these short SeV DVG-derived RNAs have been shown to promote the development of adaptive immunity against a model vaccine, inactivated respiratory syncytial virus, when the SeV DVG-derived RNAs were administered with the vaccine to mice.
  • these oligonucleotides are potent adjuvants for vaccination.
  • the present subject matter provides methods and compositions for use in stimulating an immune response in a subject, comprising administering a DVG- derived RNA, as described herein, to the subject, in conjunction with one or more antigens, e.g., antigens contained in vaccines, to enhance or promote an antigen specific immune response.
  • the present subject matter also provides methods and compositions for the activation of an antigen presenting cell, e.g. , a dendritic cell, where the cell is contacted with a DVG-derived RNA as described herein, and introduced, or reintroduced, into a subject.
  • an antigen presenting cell e.g. , a dendritic cell
  • the DVG-derived RNA molecules of the disclosed subject matter can be used as anti-tumoral agents, e.g., to inhibit, treat, or prevent tumor growth or cancer in a subject.
  • the DVG-derived RNA molecules can be used as an immunostimulant to generate local inflammation surrounding a tumor, e.g., through systemic administration, administration to the tumor itself, or via topical administration, such as for tumors of the skin (e.g., melanoma).
  • the DVG-derived RNA molecules of the disclosed subject matter can be used as anti-skin ailment agents, to inhibit treat or prevent skin ailments in a subject.
  • a skin ailment includes any skin disease or disorder that can be treated or prevented by an inflammatory response.
  • the DVG-derived RNA molecules can be used as an immunostimulant to generate local inflammation surrounding a skin ailment, e.g., through systemic administration, administration to the skin ailment itself, or via topical administration, such as for warts.
  • the DVG-derived RNA can be delivered to the subject or to a cell by any means known in the art for delivery of nucleic acids, including, for example, using a vector, liposome, nanoparticle, or by direct injection of the naked RNA.
  • the DVG-derived RNA molecules of the disclosed subject matter can be used as viral analogues for in vitro experiments (e.g, as an alternative to poly IC).
  • Adjuvant means any substance that increases the humoral or cellular immune response to an antigen. Adjuvants are generally used to accomplish two objectives: they slow the release of antigens from the injection site, and they stimulate the immune system.
  • Antibody refers to an immunoglobulin molecule that can bind to a specific antigen as the result of an immune response to that antigen.
  • Immunoglobulins are serum proteins composed of "light” and “heavy” polypeptide chains having "constant” and “variable” regions and are divided into classes (e.g., IgA, IgD, IgE, IgG, and IgM) based on the composition of the constant regions.
  • Antigen refers to any substance that stimulates an immune response.
  • the term includes killed, inactivated, attenuated, or modified live bacteria, viruses, fungi or parasites or parasite eggs, etc.
  • the term antigen also includes polynucleotides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, or lipids, or fragments thereof, individually or in any combination thereof.
  • the term antigen also includes antibodies, such as anti-idiotype antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope).
  • Cellular immune response or “cell mediated immune response” is one mediated by T-lymphocytes or other white blood cells or both, and includes the production of cytokines, chemokines and similar molecules produced by activated T- cells, white blood cells, or both.
  • DVGs defective interfering viral genomes
  • DIVGs defective interfering viral genomes
  • DIVGs are generated as byproducts during viral replication when the viral polymerase loses processivity at high virus titers [3, 4].
  • DVGs are truncated versions of the parental viral genome and lack essential replication machinery for replication; however, they retain the signals necessary for the stimulation of RIG-I like receptors (RLR) signaling.
  • RLRs bind to RNA oligonucleotides that are derived from viral genomes and signal for the activation of transcription factors that trigger the expression of antiviral and pro-inflammatory molecules [1, 2].
  • Defective interfering particles are wide-spread in many DNA and RNA viruses in bacteria, plants and animals.
  • DVG-derived RNA includes an isolated RNA molecule that signals for the activation of transcription factors that trigger the expression of antiviral and/or pro-inflammatory molecules.
  • An RNA derived from a defective viral genome acts as an adjuvant or immunostimulatory agent to enhance host immune responses to an antigen.
  • these DVG-derived RNA molecules are mutants that are generated or prepared from a defective viral genome.
  • an isolated RNA molecule includes an isolated RNA molecule that at least one nucleotide shorter than the full length defective viral genome.
  • Dose refers to a vaccine or immunogenic composition given to a subject.
  • a “first dose” or “priming vaccine” refers to the dose of such a composition given on Day 0.
  • a “second dose” or a “third dose” or an “annual dose” refers to an amount of such composition given subsequent to the first dose, which can or can not be the same vaccine or immunogenic composition as the first dose.
  • Human immune response refers to one that is mediated by antibodies.
  • Immune response in a subject refers to the development of a humoral immune response, a cellular immune response, or a humoral and a cellular immune response to an antigen. Immune responses can usually be determined using standard immunoassays and neutralization assays, which are known in the art.
  • Immunologically protective amount or “immunologically effective amount” or “effective amount to produce an immune response” of an antigen is an amount effective to induce an immunogenic response in the recipient.
  • the immunogenic response can be sufficient for diagnostic purposes or other testing, or can be adequate to prevent signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a disease agent. Either humoral immunity or cell-mediated immunity or both can be induced.
  • the immunogenic response of an animal to an immunogenic composition can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain, whereas the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature number, overall physical condition, and overall health and performance of the subject.
  • the immune response can comprise, without limitation, induction of cellular and/or humoral immunity.
  • Immunogenic means evoking an immune or antigenic response.
  • an immunogenic composition would be any composition that induces an immune response.
  • Immunoser molecule refers to a molecule that generates an immune response.
  • Lipids refers to any of a group of organic compounds, including the fats, oils, waxes, sterols, and triglycerides, which are insoluble in water but soluble in nonpolar organic solvents, are oily to the touch, and together with carbohydrates and proteins constitute the principal structural material of living cells.
  • Liposome refers to a microscopic spherical particle formed by a lipid bilayer enclosing an aqueous compartment, used medicinally to carry a drug, antigen, vaccine, enzyme, or another substance to targeted cells in the body
  • Parenteral administration refers to the introduction of a substance, such as a vaccine, into a subject's body through or by way of a route that does not include the digestive tract.
  • Parenteral administration includes subcutaneous, intramuscular, transcutaneous, intradermal, intraperitoneal, intraocular, and intravenous administration.
  • “Pharmaceutically acceptable” refers to substances, which are within the scope of sound medical judgment, suitable for use in contact with the tissues of subjects without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit-to-risk ratio, and effective for their intended use.
  • Subject refers to any animal for which the administration of an adjuvant composition is desired. It includes mammals and non-mammals, including humans, livestock, companion animals, laboratory test animals, captive wild animals, aves (including in ova), reptiles, and fish.
  • this term includes but is not limited to humans, monkeys, swine, cattle, sheep, goats, equines, mice, rats, guinea pigs, hamsters, rabbits, felines, canines, chickens, turkeys, ducks, other poultry, frogs, fish, and lizards.
  • “Therapeutically effective amount” refers to an amount of an antigen or vaccine that would induce an immune response in a subject receiving the antigen or vaccine which is adequate to prevent or reduce signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a pathogen, such as a virus or a bacterium.
  • Humoral immunity or cell-mediated immunity or both humoral and cell-mediated immunity can be induced.
  • the immunogenic response of a subject to a vaccine can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain.
  • the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature, overall physical condition, and overall health of the subject.
  • the amount of a vaccine that is therapeutically effective can vary depending on the particular adjuvant used, the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art.
  • Vaccine refers to a composition that includes an antigen, as defined herein. Administration of the vaccine to a subject results in an immune response, generally against one or more specific diseases.
  • the amount of a vaccine that is therapeutically effective can vary depending on the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art.
  • a vaccine can comprise a live attenuated virus in a suitable pharmaceutically, or physiologically acceptable carrier, such as isotonic saline or isotonic salts solution.
  • suitable pharmaceutically, or physiologically acceptable carrier such as isotonic saline or isotonic salts solution.
  • the appropriate carrier will be evident to those skilled in the art and will depend in large part upon the route of administration.
  • vaccines composed of polynucleotide molecules desirably contain optional polynucleotide facilitating agents or "co-agents", such as a local anesthetic, a peptide, a lipid including cationic lipids, a liposome or lipidic particle, a polycation such as polylysine, a branched, three-dimensional polycation such as a dendrimer, a carbohydrate, a cationic amphiphile, a detergent, a benzylammonium surfactant, or another compound that facilitates polynucleotide transfer to cells.
  • polynucleotide facilitating agents or co-agents such as a local anesthetic, a peptide, a lipid including cationic lipids, a liposome or lipidic particle, a polycation such as polylysine, a branched, three-dimensional polycation such as a dendrimer, a carbohydrate,
  • “Cancer” includes, for example, skin cancers (melanoma and squamous cell carcinoma), pancreatic cancer, kidney cancer, e.g., renal cell carcinoma (RCC), urogenital cancer, e.g., urothelial carcinomas in urinary bladder, kidney, pelvic and ureter, melanoma, prostate carcinoma, lung carcinomas (non-small cell carcinoma, small cell carcinoma, neuroendocrine carcinoma and carcinoid tumor), breast carcinomas (ductal carcinoma, lobular carcinoma and mixed ductal and lobular carcinoma), thyroid carcinomas (papillary thyroid carcinoma, follicular carcinoma and medullary carcinoma), brain cancers (meningioma, astrocytoma, glioblastoma, cerebellum tumors, medulloblastoma, ependymoma), ovarian carcinomas (serous, mucinous and endometrioid types), cervical cancers (squamous cell carcinoma in situ, invasive squa
  • a "tumor” includes any tumor resulting or associated with from any of the above cancers.
  • DVG-derived isolated RNA molecules are used as adjuvants or immunostimulatory agents to activate dendritic cells, trigger cytokine expression and enhance host immune responses to an antigen.
  • the DVG-derived RNA molecules described herein have increased immunostimulatory activity as compared to DVG particles.
  • the DVG-derived RNA molecules of the presently disclosed subject matter can be derived from the paramyxovirus Sendai (SeV), or from any other virus that produces a defective viral genome.
  • viruses can include but are not limited to human parainfluenza virus, respiratory syncytial virus, measles, Newcastle Disease virus, and human matapneumo virus.
  • a DVG-derived RNA molecule has a structure wherein the ends are complementary to each other, forming a loop structure when annealed. In one embodiment, the DVG-derived RNA molecule contains both complementary ends. In another embodiment, the DVG-derived RNA molecule contains one of the complementary ends. In yet another embodiment, DVG-derived RNA molecule contains neither of the complementary ends.
  • a DVG-derived RNA molecule comprises one or more of the structures described by Figure 12. In certain embodiments, a DVG- derived RNA molecule comprises at least 1 , 2, 3, 4, 5 or more, or any combination thereof, of the RNA moti s described by Figure 12.
  • these DVG-derived RNA molecules are truncated mutants that are isolated from the defective viral genome.
  • the DVG-derived RNA molecules have a length of about 100-600 or more nucleotides.
  • the DVG-derived RNA molecules can be about 100, 125, 150, 175, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 425, 450, 475, 500, 525, 550 or more nucleotides in length.
  • the DVG-derived RNA molecule is 546 nucleotides or less in length.
  • the DVG-derived RNA molecule is about 268 or about 324 or about 396 or about 546 nucleotides in length. In one embodiment the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO: l ( Figure 6). In another embodiment, the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO:2 ( Figure 7). In another embodiment, the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO:3 ( Figure 8). In another embodiment, the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO:4 ( Figure 9).
  • the disclosed subject matter further provides for the use of DVG- derived RNA molecules, and fragments thereof, that are variants of the nucleotide sequence shown in SEQ ID NOs.T-4 ( Figures 6-9), but still retain immunostimulatory activity.
  • the variants can contain nucleotide substitutions, deletions, inversions and insertions (including truncated variants).
  • variants typically have a substantial identity with a nucleic acid molecules of SEQ ID NOS:l-4.
  • Variants can be identified using methods well known in the art.
  • variants comprise a nucleotide sequence that is typically at least about 70-75%, more typically at least about 80-85%, and most typically at least about 90-95% or more homologous to the nucleotide sequence shown in SEQ ID NOS: l-4 or a fragment of this sequence, and retain immunostimulatory activity.
  • the variants comprise one or more of the structures described by Figure 12.
  • the variants comprise at least 1, 2, 3, 4, 5 or more, or any combination thereof, of the RNA motifs described by Figure 12. Immunostimulatory activity can be measured by the methods described herein (e.g., in the Examples), any method known in the art.
  • nucleic acid into a subject or dendritic cell be either direct, in which case the subject or cell is directly exposed to the naked nucleic acid, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then introduced or reintroduced into the patient.
  • RNA molecules of the present disclosure can be directly administered in vivo, e.g., combined with an antigen or vaccine to form an adjuvant composition. This can be accomplished by any of numerous methods known in the art, e.g., by direct injection of naked RNA.
  • the RNA can be injected, aerosolized, electroporated in the skin or muscle, or used intranasally, etc.
  • the RNA can also be administered by use of microparticle bombardment ⁇ e.g., a gene gun; Biolistic, Dupont), or coating with lipids, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide.
  • the nucleic acid- ligand complexes can also be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation.
  • the RNA can also be stabilized with cationic molecules, e.g., Poly-L Lysine, or attached to nanoparticles for delivery.
  • the nanoparticles can also contain one or more antigen.
  • the RNA can be conjugated with antigen for delivery.
  • the RNA can be conjugated to parasite eggs, proteins, etc.
  • RNA can also be constructing as part of an appropriate vector (viral or otherwise).
  • vector means the vehicle by which a nucleic acid sequence can be introduced into a cell.
  • Vectors include plasmids, phages, viruses, etc.
  • a "therapeutic vector” as used herein refers to a vector which is acceptable for administration to an animal, and particularly to a human.
  • Vectors typically comprise the DNA of a transmissible agent, into which foreign nucleic acid molecule is inserted.
  • a common way to insert one nucleic acid molecule into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites.
  • restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites.
  • the foreign nucleic acid molecule is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
  • Suitable vectors include viruses, such as adenoviruses, adeno- associated virus (AAV), lentiviral vectors, vaccinia, herpesviruses, paramyxoviruses, Sendai Virus, RNA-based viruses, Newcastle disease virus, baculoviruses, orthomyxovirus, RNA-based viruses, retroviruses, parvovirus, lentivirus, bacteriophages, cosmids, plasmids, fungal vectors, and other recombination vehicles typically used in the art.
  • viruses such as adenoviruses, adeno- associated virus (AAV), lentiviral vectors, vaccinia, herpesviruses, paramyxoviruses, Sendai Virus, RNA-based viruses, Newcastle disease virus, baculoviruses, orthomyxovirus, RNA-based viruses, retroviruses, parvovirus, lentivirus, bacteriophages, cosmids,
  • RNAs of the present disclosure Methods that can be used to deliver the RNAs of the present disclosure are described in, for example, Clegg, C. H. et al. Proc Natl Acad Sci U S A 109, 17585-17590, (2012); Thim, H. L. et al. Vaccine 30, 4828-4834, (2012); Alving, C. R., et al. Curr Opin Immunol 24, 310-315, (2012); Baldwin, S. L. et al. T Immunol 188, 2189-2197 (2012); Nordly, P. et al. J Control Release 150, 307-317, (2011); Schneider-Ohrum, K. et al. Vaccine 29, 9081-9092, (2011); Caskey, M. et al. J Exp Med 208, 2357-2366, 2011); Petsch, B. et al. Pr Nat Biotechnol 30, 1210-1216, (2012), the contents of which are expressly incorporated herein by reference).
  • the RNA of the disclosed subject matter can be administered parenterally, e.g., subcutaneously or intramuscularly, aerosolized, electroporated in the skin or muscle, or used intranasally, etc., or delivered by any other suitable route for delivery of RNA alone or in combination with a vaccine.
  • the compositions of the disclosed subject matter can be administered topically onto the skin or to the mucosa of a subject (see, e.g., Pavot, V., Vaccine 2012 Jan 5;30(2): 142-54 and Bal, SM J. Control Release 2010 Dec 20; 148(3):266-82).
  • RNA molecules of the presently disclosed subject matter can be administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens.
  • the antigen can be any of a wide variety of substances capable of producing a desired immune response in a subject.
  • the antigens used with these adjuvant compositions can be one or more of viruses (inactivated, attenuated, and modified live), bacteria, fungi, parasites, parasite eggs, nucleotides, polynucleotides, peptides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, carbohydrates, fatty acids, teichioc acid, peptidoglycans, lipids, or glycolipids, individually or in any combination thereof.
  • antigens used with the adjuvants of the disclosed subject matter also include immunogenic fragments of nucleotides, polynucleotides, peptides, polypeptides, that can be isolated from the organisms referred to herein. They could also be in the form of DNA vaccines.
  • Live, modified-live, and attenuated viral strains that do not cause disease in a subject have been isolated in non-virulent form or have been attenuated using methods well known in the art, including serial passage in a suitable cell line or exposure to ultraviolet light or a chemical mutagen.
  • Inactivated or killed viral strains are those which have been inactivated by methods known to those skilled in the art, including treatment with formalin, betapropriolactone (BPL), binary ethyl eneimine (BEI), sterilizing radiation, heat, or other such methods.
  • Two or more antigens can be combined to produce a polyvalent composition that can protect a subject against a wide variety of diseases caused by the pathogens. While conventional adjuvants are often limited in the variety of antigens with which they can be effectively used (either monovalently or polyvalently), the adjuvants described herein can be used effectively with a wide range of antigens, both monovalently and polyvalently. Thus, the antigens described herein can be combined in a single composition comprising the adjuvants described herein.
  • pathogenic viruses that can be used as antigens in the compositions and methods of the present subject matter include hepatitis (A, B, or C), herpes virus (e.g., VZV, HSV-1 , HAV-6, HSV-II, and CMV, Epstein Barr virus), adenovirus, influenza virus, flaviviruses, echovirus, rhinovirus, coxsackie virus, cornovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, molluscum virus, poliovirus, rabies virus, JC virus and arboviral encephalitis virus.
  • herpes virus e.g., VZV, HSV-1 , HAV-6, HSV-II, and CMV, Epstein Barr virus
  • adenovirus e.g., influenza virus, flaviviruses, echovirus
  • pathogenic bacteria that can be used as antigens in the compositions and methods of the present subject matter include chlamydia, rickettsial bacteria, mycobacteria, staphylococci, streptococci, pneumonococci, meningococci and conococci, klebsiella, proteus, serratia, pseudomonas, legionella, diphtheria, salmonella, bacilli, cholera, tetanus, botulism, anthrax, plague, leptospirosis, and Lymes disease bacteria.
  • pathogenic fungi that can be used as antigens in the compositions and methods of the present subject matter include Candida (albicans, krusei, glabrata, tropicalis, etc.), Cryptococcus neoformans, Aspergillus (fumigatus, niger, etc.), Genus Mucorales (Mucor, Absidia, Rhizophus), Sporothrix schenkii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis and Histoplasma capsulatum.
  • Candida albicans, krusei, glabrata, tropicalis, etc.
  • Cryptococcus neoformans Aspergillus (fumigatus, niger, etc.)
  • Genus Mucorales Macor, Absidia, Rhizophus
  • Sporothrix schenkii Blastomyces dermatitidis
  • Paracoccidioides brasiliensis Coccidioides im
  • pathogenic parasites that can be used as antigens in the compositions and methods of the present subject matter include Entamoeba histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba sp., Giardia lambia, Cryptosporidium sp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondi, Nippostrongylus brasiliensis, and Schistosomiasis.
  • Tumor antigens can be used in the adjuvant compositions of the present subject matter.
  • Many strategies for vaccination against tumors have been devised (see Rosenberg, S., 2000, Development of Cancer Vaccines, ASCO Educational Book Spring: 60-62; Logothetis, C, 2000, ASCO Educational Book Spring: 300-302; Khayat, D. 2000, ASCO Educational Book Spring: 414-428; Foon, K. 2000, ASCO Educational Book Spring: 730-738; see also Restifo, N. and Sznol, M., Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita, V. et al. (eds.), 1997, Cancer: Principles and Practice of Oncology, Fifth Edition).
  • a vaccine is prepared using autologous or allogeneic tumor cells. These cellular vaccines have been shown to be most effective when the tumor cells are transduced to express GM-CSF. GM-CSF has been shown to be a potent activator of antigen presentation for tumor vaccination (Dranoff et al. (1993) Proc. Natl. Acad. Sci U.S.A. 90 (80: 3539-43).
  • tumor specific antigens are differentiation antigens expressed in the tumors and in the cell from which the tumor arose, for example melanocyte antigens gp 100, MAGE antigens, Trp-2. More importantly, many of these antigens can be shown to be the targets of tumor specific T cells found in the host.
  • the tumor antigen can also include the protein telomerase, which is required for the synthesis of telomeres of chromosomes and which is expressed in more than 85% of human cancers and in only a limited number of somatic tissues (Kim, N et al. (1994) Science 266, 201 1-2013). (These somatic tissues can be protected from immune attack by various means).
  • Tumor antigen can also be "neo-antigens" expressed in cancer cells because of somatic mutations that alter protein sequence or create fusion proteins between two unrelated sequences (i.e. bcr-abl in the Philadelphia chromosome), or idiotype from B cell tumors.
  • tumor vaccines can include the proteins from viruses implicated in human cancers such a Human Papilloma Viruses (HPV), Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV).
  • HPV Human Papilloma Viruses
  • HBV and HCV Hepatitis Viruses
  • KHSV Kaposi's Herpes Sarcoma Virus
  • HSP heat shock proteins
  • RNA molecules and vaccination methods of the present disclosure can also be used in conjunction with anti-cancer therapies (e.g., chemotherapy), to augment cancerous cell death by creating a more immunogenic environment in a subject afflicted with cancer.
  • anti-cancer therapies e.g., chemotherapy
  • Such combination therapy enhances cancer cell death and promotes a robust immune response capable of killing any residual cancer cells that have escaped treatment.
  • Other anti-cancer therapies that can be used with the compositions of the present disclosure include radiation, surgery, and hormone deprivation (Kwon, E. et al. (1999) Proc. Natl. Acad. Sci U.S.A. 96 (26): 15074-9).
  • Angiogenesis inhibitors can also be used. Inhibition of angiogenesis leads to tumor cell death, which can feed tumor antigen into host antigen presentation pathways.
  • cancer cells e.g., tumor cells isolated from a subject can be exposed to the adjuvants of the present subject matter and used to treat dendritic cells ex vivo.
  • the mature ex vivo treated dendritic cells are then reintroduced into the patient and promote a robust immune response directed against the cancer cells.
  • compositions of the disclosure are prepared in the form of, for example, liquids, powders, aerosols, tablets, capsules, enteric coated tablets or capsules, or suppositories.
  • Selection of the appropriate dosage for the priming compositions of the present disclosure can be based upon the physical condition of the mammal, most especially including the general health and weight of the immunized mammal. Such selection and upward or downward adjustment of the effective dose is within the skill of the art.
  • compositions of the present disclosure suitable for inoculation or for parenteral or oral administration, comprise attenuated or inactivated forms of mammalian viruses, for example, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
  • the composition can further comprise auxiliary agents or excipients, as known in the art. See, e.g, Berkow et al., eds,, The Merck Manual, 15th edition, Merck and Co., Rahway, N.J. (1987); Goodman et al., eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th edition, Pergamon Press, Inc., Elmsford, N.Y.
  • a virus vaccine composition of the present disclosure can comprise from about 10 2 -10 9 plaque forming units (PFU)/ml, or any range or value therein, where the virus is attenuated.
  • a vaccine composition comprising an inactivated virus can comprise an amount of virus corresponding to about 0.1 to 200 micrograms of an antigenic protein/ml or combinations thereof, or any range or value therein.
  • Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and/or emulsions, which can contain auxiliary agents or excipients known in the art.
  • non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
  • Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption.
  • Liquid dosage forms for oral administration can generally comprise a liposome solution containing the liquid dosage form.
  • Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water.
  • inert diluents commonly used in the art, such as purified water.
  • such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents. See, e.g., Berkow, infra, Goodman, infra, Avery's, infra, Osol, infra and Katzung, infra, which are incorporated in their entirety herein by reference.
  • a vaccine composition of the present disclosure used for administration to an individual, can further comprise salts, preservatives, chemical stabilizers, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition.
  • stabilizers, adjuvants, and preservatives are optimized to determine the best formulation for efficacy in the target human or animal.
  • Suitable exemplary preservatives include chlorobutanol potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol.
  • Suitable stabilizing ingredients which can be used include, for example, casamino acids, sucrose, gelatin, phenol red, N-Z amine, monopotassium diphosphate, lactose, lactalbumin hydrolysate, and dried milk.
  • the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the mammal being immunized.
  • Such adjuvants include, among others, MPL.
  • Heterogeneity in the vaccine can be provided by mixing different modified viruses of the disclosed subject matter, such as 2-50 modified viruses or any range or value therein.
  • a pharmaceutical composition according to the present disclosure can further or additionally comprise at least one viral chemotherapeutic compound, including, but not limited to, gamma globulin, amantadine, ribavirin, guanidine, hydroxybenzimidazole, interferon-alpha, interferon-beta, interferon-gamma, thiosemicarbarzones, methisazone, rifampin, ribavirin, a pyrimidine analog, a purine analog, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, a protease inhibitor, or ganciclovir (neuraminidase inhibiting drugs oseltamivir, zanamivir). See, e.g., Katzung, infra, and the references cited therein on pages 798-800 and 680-681 , respectively, which references are herein entirely incorporated by reference.
  • a pharmaceutical composition according to the present disclosure can further or additionally comprise an aptamer to target a specific cell as provided in Bunka D. and Stockley P., "Aptamer come of age - at last,” Nature Reviews Microbiology and Majumder P, et al., “From bench side research towards patented molecules with therapeutic applications,” Expert Opin Ther Pat. 2009 Nov;19(l 1): 1603-13, references which are herein entirely incorporated by reference.
  • the vaccine can also contain variable but small quantities of endotoxin, free formaldehyde, and preservative, which have been found safe and not contributing to the reactogenicity of the vaccines for humans.
  • a vaccine composition of the disclosure can be for either "prophylactic” or "therapeutic” purposes.
  • the compositions are provided before any symptom of infection becomes manifest.
  • the prophylactic administration of the composition serves to prevent or attenuate any subsequent infection.
  • the vaccine is provided upon the detection of a symptom of actual infection.
  • the therapeutic administration of the compound(s) serves to attenuate any actual infection. See, e.g, Berkow, infra, Goodman, infra, Avery, infra and Katzung, infra, which are entirely incorporated herein by reference.
  • An attenuated or inactivated vaccine composition of the present disclosure can thus be provided either before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
  • a composition is said to be "pharmacologically acceptable” if its administration can be tolerated by a recipient patient. Such an agent is said to be administered in a “therapeutically effective amount” if the amount administered is physiologically significant.
  • a vaccine or composition of the present disclosure is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient that enhances at least one primary or secondary humoral or cellular immune response against at least one strain of an infectious virus.
  • the "protection” provided need not be absolute, i.e., the viral infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population or set of patients. Protection can be limited to mitigating the severity or rapidity of symptom onset of infection or disease.
  • an "effective amount" of a vaccine composition is one that is sufficient to achieve a desired biological effect. It is understood that the effective dosage can be determined by a medical practitioner based on a number of variables including the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the desired outcome.
  • the ranges of effective doses provided below are not intended to limit the disclosed subject matter, but are provided as representative preferred dose ranges. However, the most preferred dosage will be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation.
  • the dosage of an attenuated virus vaccine for a mammalian (e.g., human) adult can be from about 10 -10 plaque forming units (PFU)/kg, or any range or value therein.
  • the dose of inactivated vaccine can range from about 1 to 50 micrograms of an antigenic protein.
  • the dosage should be a safe and effective amount as determined by conventional methods, using existing vaccines as a starting point.
  • the dosage of immunoreactive protein in each dose of virus or modified virus vaccine can be standardized to contain a suitable amount, e.g., 1-50 micrograms or any range or value therein, or an amount recommended by the U.S. Public Health Service (PHS).
  • a suitable amount e.g. 1-50 micrograms or any range or value therein, or an amount recommended by the U.S. Public Health Service (PHS).
  • PHS U.S. Public Health Service
  • Each 0.5-ml dose of vaccine preferably contains approximately 1-50 billion virus particles, and preferably 10 billion particles.
  • a method of immunizing includes both methods of protecting an individual from pathogen challenge, as well as methods for treating an individual suffering from pathogen infection. Accordingly, the present disclosure can be used as a vaccine for prophylactic protection and/or in a therapeutic manner; that is, as a reagent for immunotherapeutic methods and preparations.
  • DVGs Defective viral genomes
  • DC dendritic cell
  • RAG-I retinoic acid-inducible gene 1
  • SeV DVG-derived RNAs induce high levels of Interferon- ⁇ (IFN- ⁇ ) expression in vitro and trigger fast expression of pro-inflammatory cytokines and mobilization of dendritic cells when injected in the footpad tissue of mice.
  • IFN- ⁇ Interferon- ⁇
  • the harnessing SeV DVGs as immunostimulatory molecules was performed and shorter optimized synthetic DVG- derived RNA molecules were generated that retain the stimulatory properties of full DVGs and that can be used as immunostimulants in vivo, as described herein.
  • Rhesus monkey kidney epithelial cells LLCMK2 (ATCC, #CCL7),
  • Baby hamster kidney-21 (BHK-21) cells expressing the T7 RNA polymerase (BSR- T7), RIGIKO MEFs, and MAVSKO MEFs were cultured in DMEM supplemented with 10% fetal bovine serum, ImM sodium pyruvate, 2mL L-Glutamine, and 50mg/ml gentamicin.
  • C57BL/6 mice were obtained from Taconic Farms, Inc. SeV strains Cantell and 52, and IAV strains A/New Caledonia/20/99 and X-31 were grown in 10 days hen embryonated eggs (SPAFAS; Charles River Laboratories) for 40h at 37°C [15].
  • SeV strain Cantell (C) depleted of DVGs-containing particles (LD) was generated after 2 passages of SeV Cantell highly diluted in 10-day chicken embryonated eggs as previously described [5], Allantoic fluid was snap frozen in ethanol-dry ice bath and stored at -80°C. Purified IAV was prepared by passing pelleted virus through a 40% sucrose cushion using sterile conditions. DVG detection PCR
  • the temperature cycle parameters used for the PCR were: 95°C for lOmin and 33 cycles of 95°C for 45 sec, 55°C for 30 sec and 72°C for 90 sec followed by a 4°C hold.
  • MDDC Human monocvte-derived dendritic cell
  • Human MDDCs were prepared as previously described [16]. Briefly, PBMC were isolated by Ficoll density gradient centrifugation (Histopaque, Sigma Aldrich) from buffy coats of healthy human donors. CD14 + cells were purified using anti-human CD 14 antibody-labeled magnetic beads and iron-based Midimacs LS columns (Miltenyi Biotec). After elution from the columns, cells (1 x 10 6 cells/well) were cultured for 5-6 days in RPMI medium containing 10% FBS, 100 U/ml penicillin, 100 ⁇ g/ml streptomycin, 500 U/1 human GM-CSF, and 1 ,000 U/ml human IL-4. Isolation of human naive CD4 + T cells
  • Naive CD4 + T cells were directly separated via negative selection from the PBMC using a cocktail of biotin-conjugated anti-CD8, -CD14, -CD16, -CD19, - CD36, -CD45RO, -CD56, -CD 123, -TCRy/ ⁇ , and -Glycophorin A antibodies (Miltenyi Biotec). Cells were further isolated to remove HLA-DR + cells using anti- HLA-DR microbeads (Miltenyi Biotec). Isolations were performed with iron-based Midimacs LS columns (Miltenyi Biotec).
  • BMDC Murine bone marrow-derived dendritic cell
  • BMDCs were prepared according to a standard protocol ensuring the production of immature DCs [17]. Briefly, bone marrow was obtained from mice femurs and tibias. Red blood cells were lysed with red blood cell lysing buffer (Sigma) and cells expressing CD4, CD8, B220, or MHC class II molecules were depleted by magnetic bead separation using a cocktail of anti-mouse CD4, CD8, CD45R/B220, and I-A/I-E antibodies (BD Biosciences).
  • the purified precursor cells were plated at a density of 7 x 10 5 cells/well in 24 well plates and cultured with RPMI containing 1% normal mouse serum, 25 unit/ml GM-CSF (PeproTech), 2mM L- glutamine, ImM NaPy, and 50 ⁇ g/ml gentamycin. The cells were used after 4 days of culture.
  • Human MDDCs were infected with SeV Cantell HD and Sev Cantell LD for 6 h.
  • the activated MDDCs were incubated with human naive CD4 + T cells in a 1 :5 ratio for 5 days.
  • Supernatant from this culture was collected for ELISA.
  • Human IFNy in the supernatant was measures by ELISA (eBiosciences) following manufacturer's instructions.
  • SeV Cantell (C) was grown at a dilution of 1 in 1000 in 10 days embryonated eggs for 40 h. Allantoid fluid from 100 eggs was pooled and concentrated by highspeed centrifugation. Pellets were suspended 0.5 ml of PBS/2 mM EDTA and incubated overnight at 4°C. A 5-45% sucrose (Fisher) gradient was prepared using the Gradient Master 107 gradient maker (BioComp). The virus suspension was added to the sucrose gradient and centrifuged at 4°C for 1.5 h at 28,000 rpm. The pellet, described to contain viral aggregates, was visible as were the bands representing high and low molecular density particles.
  • the fraction containing low-density viral particles were collected, pelleted and suspended in PBS/2 mM EDTA prior to their application to a second 5-45% sucrose gradient. Gradients were centrifuged at 4°C for 1.5 h at 28,000 rpm; bands containing low density viral particles pooled and suspended in PBS/2 mM EDTA prior to concentration by centrifugation at 4°C for 2 h at 21,000 rpm. Pellets were suspended in PBS, snap frozen and stored at -80°C. Content of DI particles was determined by calculating the ratio of infectious over noninfectious particles as previously described [5], and confirmed by DVG PCR.
  • Influenza virus UV inactivation IAV was fully inactivated fully inactivated by exposing 1/10 virus dilution to UV light for 10 min. UV light was positioned 6 inches over the virus solution. Virus solution was maintained at 4stirring throughout UV exposure. Complete inactivation was confirmed by establishing the virus inability to replicate in permissive cells. Partial inactivation of SeV 52 (LD) was achieved by exposing the diluted virus to UV light for 45 sec. In these conditions the virus vas not able to replicate productively, but viral proteins were expressed.
  • LD Partial inactivation of SeV 52
  • BMDCs were treated with 2.5 g of fully UV-inactivated IAV for 24 h previous infection with partially inactivated SeV-52 in the presence or absence of 125 HA Units of purified DI particles.
  • BMDCs were analyzed 2 h after SeV infection for gene expression by RTqPCR. 5 x 10 5 treated BMDCs were injected i.p. into mice. Immunized mice were bled 14 days post infection and sera was analyzed for the presence of anti-influenza virus total IgG by ELISA on plates coated with purified IAV. Mice were sacrificed at day 21 after immunization and CD8 + T cells were isolated from splenocytes using positive selection by magnetic beads (Miltenyi).
  • T cells were co-cultured in an ELISPOT plate coated with anti-IFNy at a 1 :1 ratio with irradiated splenocytes isolated from naive mice and infected with IAV strain X-31 (H3N2). Plates were incubated for 24h before performing IFNy ELISA. Quantitative PCR
  • RNA-to-cDNA kit Applied Biosystems
  • the cDNA was then diluted 1 :40 in water and qPCR assay were performed using SYBR Green PCR Master Mix (Applied Biosystems) in triplicate using the corresponding primers on Viia7 Applied Biosystems Lightcycler. Normalization was conducted based on levels of mouse Tuba lb and Rpsll or human Actb and human Tubal b.
  • mice rw& i6 / r-5'TGCCTTTGTGCACTGGTATG3', rev- 5 'CTGGAGCAGTTTGACGACAC3 ' ; mouse Rpsll: for-
  • a 591 nt long product containing the sequence of the T7 promoter followed by the 546-nucleotide long copy back DVG from SeV Cantell, and flanked by the restriction enzymes Spel and Sapl at the 3' an 5' ends was synthetically synthesized (DNA 2.0) and clone into the pSL1 180 vector (Amersham Pharmacia Biotech) containing the sequences for the hepatitis delta virus ribozyme and the T7 polymerase terminator.
  • restriction enzyme sites were introduced in the pSLl 180DVG-546 using the QuikChange II XL site-directed mutagenesis kit (Stratagene) following manufacturer instructions.
  • a unique Bglll site was created by one base substitution to generate the mutant pSLl 180mDVG-546 (mDVG-546). This construct was used as template for the generation of all other mutants.
  • DVG-396 To generate DVG-396 a BamHI restriction site was inserted at position 445 of the DVG sequence followed by digestion with Bglll and BamHI and ligation to delete 156-bp fragment from the DVG internal sequence (DVG nt 290-445).
  • DVG-324 was generated by the introduction of a Kpnl site in the mDVG-546 sequence.
  • a second Kpnl site at position 453 of the wild type DVG internal sequence allowed the deletion of 228 nt fragment between positions 226 and 453 of the DVG sequence.
  • BSR-T7 cells were infected with partially inactivated SeV strain 52 at a multiplicity of infection (MOI) of 66.
  • Virus inactivation was performed by exposing the diluted virus to U.V. light (254 nm model MRL-58, UVP Upland, CA) at for 53 sec at a distance of 9 inches from the light source. Cells were incubated at 37°C one hour before transfection of 3 ⁇ g of plasmid encoding DVG. Transfection was performed with XtremeGENE transfection reagent (Roche) according to manufacturer instructions.
  • DMEM Dulbecco's modified Eagle medium
  • Bovine serum albumin 2% NaC0 3
  • trypsin Worthington
  • penicillin-streptomycin Invitrogen
  • 7% C0 2 7% C0 2 at 37°C.
  • Cells and supernatant were harvested after 48 h and 200 ⁇ of the suspension were inoculated in the allantoic cavity of 10-day embryonated hen eggs (B & E Eggs, Silver Springs, PA). After 40 hours allantoic fluid was harvest and 200 ⁇ of undiluted fluid were inoculate in 10-day embryonated eggs for virus growth and egg inoculation was repeated for three consecutive passages.
  • DVG-expressing plasmids were linearized and used as templates for in vitro transcription using the MEGAscript T7 kit (Ambion) following supplier instructions. 20 U of RNase inhibitor (Fermentas) were added to the reaction. Capped
  • RNA was synthesized using Cap Analog (m7G(5')ppp(5')G) (Ambion). All RNA reaction products were subjected to DNase treatment followed by LiCl precipitation. Integrity of the in vitro transcribed RNA was analyzed in an Agilent Bioanalyzer 2100 (Agilent Technologies). RNA dephosphorylation was carried out using FastAP thermosensitive alkaline phosphatase (Fermentas) according to manufacturer's instructions.
  • Cap Analog m7G(5')ppp(5')G
  • LiCl precipitation Integrity of the in vitro transcribed RNA was analyzed in an Agilent Bioanalyzer 2100 (Agilent Technologies). RNA dephosphorylation was carried out using FastAP thermosensitive alkaline phosphatase (Fermentas) according to manufacturer's instructions.
  • Mouse embryo fibroblasts (MEFs) were seeded in six well plates at 80- 85% confluence and 500ng of in vitro transcribe DVG RNA were transfected using Lipofectamine 2000 (Invitrogen) according to manufacturer instructions. LLCMK2 cells transfections were performed in 24 well plates and 250ng of in vitro transcribe DVG RNA were added.
  • mice footpad infection C57BL/6 mice of 12-16 weeks of age were injected subcutaneously in both footpads with 50ug of in vitro transcribe RNA. After 36 hrs post injection mice were euthanized and the footpad tissue was harvest for RNA extraction. Trizol (Invitrogen) was used to extract RNA from homogenized footpad tissue for cytokine expression analysis. RNA injection was performed under anesthesia.
  • SeV DVGs particles enhance the ability of human and mouse DCs to activate adaptive immunity.
  • SeV Cantell HD Stocks of SeV strain Cantell with a high content of particles bearing copy-back DVGs (SeV Cantell HD) were shown to efficiently induce the maturation of mouse and human DCs [6].
  • SeV Cantell HD enhanced the ability of DCs to activate human T cells
  • human monocyte-derived DCs MDDCs
  • SeV Cantell HD or SeV Cantell depleted of DVG-containing particles LD
  • the presence of DVGs in the different SeV stocks was controlled by PCR in infected mouse bone marrow- derived DCs ( Figure 1A).
  • BMDCs Bone marrow-derived DCs
  • IAV UV-inactivated influenza virus
  • H1N1 UV-inactivated influenza virus
  • Partial inactivation of SeV Cantell LD rendered the virus unable to productively replicate, but capable of expressing virus proteins.
  • pDPs enhanced the expression of 11-12 mRNA by the SeV infected DCs, despite equivalent expression of SeV Np mRNA ( Figure IE).
  • pDPs alone trigger 11-12 mRNA expression despite only residual expression of SeV Np mRNA ( Figure IE) confirming their inability to be transcribed and replicated in the absence of a helper virus.
  • Mice immunized i.p. with BMDCs were sacrificed 21 days after immunization for analysis of the anti-IAV immune response.
  • mice immunized with BMDCs treated with pDPs showed enhanced production of IgG antibodies against IA V ( Figure 1 F) and higher frequency of anti-IAV specific IFNy-producing CD8 + T cells (Figure 1G) than control mice, independent of the presence of co-infecting virus.
  • Copy-back DVGs cannot be transcribed due to properties of their promoters, therefore their stimulatory activity is likely provided only by elements of their genome.
  • rDP reverse genetics system for the modification and rescue of DI particles containing recombinant DVGs
  • This plasmid was transfected into cells expressing the T7 polymerase and infected with partially inactivated SeV strain 52 that provided the necessary proteins for virus replication and packaging after T7 transcription. SeV 52 does not produce highly immunostimulatory copy-bask DVGs [5], therefore all stimulatory activity is provided by the recombinant DVG.
  • rDP particles were amplified in embryonated hen eggs ( Figure 2A). Copy-back rDVGs were detectable by RTqPCR in virus stocks obtained after one passage in eggs ( Figure 2B) and were enriched in subsequent passages as determined by the ratio between infectious (I) and total hemagglutinating viral particles (HA) in the allantoid fluid (I/HA) ( Figure 2C).
  • rDP particles maintained their ability to inhibit the replication of the helper virus, as determined by the reduced expression of the SeV protein NP in cells infected with rDP-containing allantoid fluid compared with cells infected with control Sev Cantell LD ( Figure 2D). In addition, they maintained a strong ability to induce the expression of type I IFNs in infected cells (Figure 2E),
  • DVG-546 A restriction enzyme site was introduced in DVG-546 to generate a modified DVG 546 (mDVG-546) that would serve as the backbone for further modifications (Figure 2F). Modifications of DVG-546 were performed taking into account the "rule of six" that states than a length of an exact multiple of six nucleotides needs to be preserved to maintain optimal replication of paramyxovirus genomes [9]. mrDP particles preserved their strong stimulatory ability and induced ifn- ⁇ mRNA levels that were comparable with those induced by SeV Cantell (Figure 2G), demonstrating that the modified recombinant genome retained the immuno stimulatory activity of the parental SeV DVG. Naked DVG RNA maintains potent immunostimulatory activity in vitro
  • the shorter DVG-324 shows enhanced immunostimulatory activity when transfected into cells in vitro as measured by the expression of type I IFNs, interferon stimulated genes and proinflammatory cytokines such as 11-12 and II- lb.
  • DVG-354 failed to induce significant levels of ifn- ⁇ in transfected cells. These mutants have approximately the same size suggesting that SeV DVG recognition by viral RNA sensors is sequence dependent.
  • mice footpads were injected with the different DVG mutant RNAs.
  • the synthetic viral analog poly I:C was used.
  • Expression of pro-inflammatory cytokines and DC activation was determined 36 h later from footpad tissue and the draining popliteal lymph node.
  • Il-IB and 11-12 mRNA were expressed at high levels at the site of infection.
  • the pattern of cytokines expressed by poly I:C and DVG-396 was different, suggesting distinct mechanisms for immuno stimulation (Figure 5A).
  • the shorter DVG-324 shows enhanced immunostimulatory activity when transfected into cells in vitro as measured by the expression of type I IFNs, interferon stimulated genes and of proinflammatory cytokines such as 11-12 and II- lb.
  • higher numbers of DCs were found in the popliteal lymph node of mice injected with DVG RNA than poly I:C ( Figure 5B), confirming the potent immunostimulatory ability of DVG RNA in vivo.
  • injection with DVG- 324 RNA resulted in higher relative copy numbers of Il- ⁇ and 11-12 mRNA than the parental DVG RNA or DVG-396, confirming that sequence composition and structure are involved in effective immunostimulatory activity.
  • RNA oligonucleotides represent novel adjuvant candidates.
  • RNA stability Despite concerns related to RNA stability, several studies have demonstrated the successful use of naked RNA as therapy (Caskey M., et. al. "Synthetic double-stranded RNA induces innate immune responses similar to a live viral vaccine in humans," J Exp Med. 201 1 Nov 21 ; 208(12): 2357-66; Stahl-Hennig C, et al. "Synthetic double-stranded RNAs are adjuvants for the induction of T helper 1 and humoral immune responses to human papillomavirus in rhesus macaques," PLoS Pathog. 2009 Apr; 5(4).
  • the synthetic viral RNA analog poly I:C has entered clinical trials as an anti-tumoral (Rosenfeld MR, et al. A multi-institution phase II study of poly-ICLC and radiotherapy with concurrent and adjuvant temozolomide in adults with newly diagnosed glioblastoma. Neuro Oncol. 2010 Oct; 12(10): 1071-7). Importantly, poly I:C has been shown to be safe in humans (Caskey M., et. al. Synthetic double-stranded RNA induces innate immune responses similar to a live viral vaccine in humans. J Exp Med. 201 1 Nov 21 ; 208(12): 2357-66), demonstrating the feasibility of using naked RNA as adjuvants. SeV DI particles stimulate the development of adaptive immune responses in mice and show enhanced ability to activate human DCs, supporting their potential as adjuvants.
  • SeV DVG-derived synthetic RNA of high immunostimulatory capacity was generated in vitro and in vivo that has several advantages over poly I:C.
  • the commercial vaccine quality version of poly I:C is a mixed of molecules of multiple sizes and is poorly standardized, showing variable activity batch to batch.
  • the immunostimulatory DVG RNA was generated from a plasmid leading to the reliable generation of identical immunostimulatory molecules.
  • the molecular characteristics responsible for the immunostimulatory ability of DVG-derived RNA are characterized in detail, leading to product optimization and modification, while it is impossible to do so for the variable mixture of poly I:C polymers.
  • DVG-derived RNA is shorter, and therefore cheaper to produce than poly I:C, a relevant consideration for the production of adjuvants.
  • RNA oligonucleotides derived from one of the most potent known natural viral RLR agonists, the SeV DVG have immuno stimulatory activity and represent novel alternatives as potent adjuvants for vaccination.
  • the present example demonstrates that DVG-324 maintains strong stimulatory activity once injected as naked RNA into mouse skin. Compared to the only other RNA immunostimulant available, poly I:C, DVG-324 showed enhanced induction of IL- ⁇ ⁇ , a desired property in an effective adjuvant. In addition, DVG-324 induced more efficient migration of dendritic cells from the skin to the draining lymph nodes, supporting it as exhibiting a stronger ability to stimulate the immune system. Additionally, the present example demonstrates that DVG-324 promotes the development of adaptive immunity against a model vaccine, inactivated respiratory syncytial virus and enhanced the breadth of antibodies.
  • mice were injected subcutaneously in the footpad with 50 ⁇ g of DVG-
  • Footpad tissue was harvested after 6 or 36 h and RNA was extracted for the analysis of cytokine expression.
  • CDl lc+CDl lb+ cells were further gated for expression of CD103 and B220 to quantify CD1 lc+CDl lb+CD103- DCs and CD1 lbloCDl lcloB220+ plasmacytoid DCs.
  • Figure 1 1D shows a representative plot for poly I:C treatment and two representative plots for DVG-324 treatment.
  • inRSV inactivated respiratory syncytial virus
  • a 268 nucleotide DVG was prepared (SEQ ID NO:4 and Figure 9). LLCMK2 cells were transfected with 500 ng of each of the in vitro transcribed RNAs (i.e., DVG-268, DVG-324 and DVG-546). IFNbeta production was determined by RTqPCR. Data show average of three independent experiments.
  • DVGs were identified by their molecular weight and were classified as strong or weak stimulators based on their ability to induce ifnb expression upon transfection (i.e., as in vitro transcribed R A).
  • Figure 12 shows the predicted folding structure of highly stimulatory (strong) and poorly stimulatory (weak) DVG mutants using the Vienna RNAfold software. Motifs conserved in the different molecules are ballooned and color-coded. The number of nucleotides from the 5' end of the molecule included in the modeling is indicated. Longer stretches could not be appropriately modeled due to the presence of long complementary ends that interfere with the folding prediction.
  • Candidate immunostimulatory motif common to strong stimulatory DVGs is indicated with an arrow.

Abstract

The present disclosure is directed to compositions and methods relating to immunostimulatory RNAs derived from defective viral genomes (DVGs) that act as adjuvants and/or immunostimulatory agents to enhance host immune responses.

Description

METHODS AND COMPOSITIONS FOR STIMULATING IMMUNE
RESPONSE
CROSS-REFERENCE TO RELATED APPLICATIONS
The present application claims priority to U.S. Provisional Application Serial No. 61/794,829 filed March 15, 2014, which is incorporated by reference in its entirety,
STATEMENT REGARDING FEDERALLY-SPONSORED RESEARCH
This invention is made with government support under AI083284 awarded by the National Institute of Health. The government has certain rights in the invention.
BACKGROUND
The immune system plays an important role in defense against specific microorganisms, for example viruses, specific fungi and bacteria, as well as in recognizing and repelling malignant (degenerate) cells (tumor cells). Immune responses have been characterized as either humoral, in which antibodies specific for antigens are produced by differentiated B lymphocytes known as plasma cells, or cell mediated, in which various types of T lymphocytes act to eliminate antigens by a number of mechanisms. For example, CD4+ helper T cells that are capable of recognizing specific antigens can respond by releasing soluble mediators such as cytokines to recruit additional cells of the immune system to participate in an immune response. CD8+ cytotoxic T cells that are also capable of specific antigen recognition can respond by binding to and destroying or damaging an antigen bearing cell (i.e., dendritic cells) or particle.
Vaccinations are a long-known method of activating the immune system. Vaccination and immunization is the introduction of a non-virulent agent into a subject, in which the agent elicits the subject's immune system to mount an immunological response. Often, vaccine antigens are killed or attenuated forms of the microbes which cause the disease. The presence of non-essential components and antigens in these killed or attenuated vaccines has encouraged considerable efforts to refine vaccine components including developing well-defined synthetic antigens using chemical and recombinant techniques. The refinement and simplification of vaccines, however, has led to a concomitant loss in potency. Low-molecular weight synthetic antigens, though devoid of potentially harmful contaminants, are often not sufficiently immunogenic by themselves and do not produce an adequate immune response.
The immunogenicity of an antigen can be increased by administering it in a mixture with substances called adjuvants. Adjuvants increase the response against the antigen either by directly acting on the immunological system or by modifying the phannacokinetic characteristics of the antigen, resulting in an increased interaction time between the antigen and the immune system. Additionally, the addition of an adjuvant can permit the use of a smaller dose of antigen to stimulate a similar immune response, thereby reducing the production cost of a vaccine.
A number of compounds exhibiting varying degrees of adjuvant activity have been described. These include saponins complexed to membrane protein antigens (immune stimulating complexes), pluronic polymers with mineral oil, killed Mycobacteria in mineral oil, Freund's complete adjuvant, bacterial products, such as muramyl dipeptide (MDP) and lipopolysaccharide (LPS), as well as lipid A, and liposomes. Other adjuvants, such as Sponin, Quil A, and the water-in-oil adjuvant, Freund's with killed tubercle bacilli (Freund's complete) or without bacilli (Freund's incomplete), have had limited use in humans due to their toxic effects; and, concerns have been raised due to adverse effects in the host (e.g., production of sterile abscesses, organ damage, carcinogenicity, or allergenic responses).
Currently the most widely adjuvants used in humans are Aluminum salts. Aluminum salts have been useful for some vaccines like hepatitis B, diphtheria, tetanus, and toxoid; however, they are not useful for others like rabies, MMR, and typhoid. In addition, Aluminum salts fail to induce cell-mediated immunity, result in the induction of granulomas at the injection site and vary in effectiveness between batches of alum preparations.
Advances in the understanding of innate immune molecular mechanisms responsible for the initiation of the immune response have revealed novel pathways that could be harnessed for adjuvant development. In particular, research has been focused on the identification of RNA molecules that mimic viral-derived oligonucleotides as potential adjuvants. For example, Poly I:C, a synthetic double- stranded RNA polymer, has been identified as an inducer of cytokine production in in vitro and in vivo studies (Magee M E & GriffithMJ, lifeScience II, 11 : 1081- 1086,1972; ManettiYR et al., Eur. J. Immunol. 25:2656-2660, 1995), and has been known to induce dendritic cell (DC) maturation, the most popular antigen presenting cell (APC) in mammals. The matured DC is then capable of inducing immune response effectively (Rous R et al, International Immunol 16:767-773, 2004). Additionally, defective interfering virus particles (DVGs) derived from the mouse paramyxovirus Sendai (SeV) that contain complementary ends (known as copy-back genomes) were shown to have potent immunostimulatory properties (see Yount et al., 2006; Yount et al., 2008; U.S. Patent Application Publication No. 2009/0304738, the contents of which are expressly incorporated herein by reference). SeV particles containing DVGs promote the expression of high levels of IFN-β, IL-12, IL-6 and other cytokines from infected cells, as well as the complete maturation of mouse and human dendritic cells (DCs), a necessary property of an effective adjuvant molecule (Yount et al., 2006; Yount et al., 2008). These types of adjuvants, however, sometimes are not strong enough to induce a desired strength immune response. Additionally, these adjuvants can be poorly standardized.
Therefore, there is a continual need for new and improved adjuvant systems to better facilitate the development of a next generation of synthetic vaccines. Additionally, the discovery and development of effective adjuvant systems is essential for improving the efficacy and safety of existing and future vaccines.
SUMMARY
The present disclosure is based, at least in part, on the identification of immunostimulatory RNAs derived from a defective viral genome (DVG) that act as adjuvants or immunostimulatory agents to enhance host immune responses. Accordingly, in one aspect, the disclosure provides methods for stimulating an immune response in a subject including administering to the subject, e.g., a mammalian subject or a non-mammalian subject, e.g., a human, bird, or fish, at least one antigen in conjunction with defective viral genome-derived RNA molecule capable of inducing an antigen specific immune response in the subject.
In another aspect, the present disclosure provides methods of activating a dendritic cell including contacting the cell with an antigen and a defective viral genome-derived RNA molecule capable of inducing an antigen specific immune response. In one embodiment, the dendritic cell is isolated from a subject and activated ex vivo. The activated cell can then be introduced, or reintroduced, into the subject.
In one embodiment, the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO: l, or variants thereof having immunostimulatory activity. In another embodiment, the defective viral genome- derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:2, or variants thereof having immunostimulatory activity. In another embodiment, the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:3, or variants thereof having immunostimulatory activity. In another embodiment, the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:4, or variants thereof having immunostimulatory activity. In another embodiment, the antigen is, for example, a virus, bacterial, fungal, parasite, nucleotide, or peptide antigen.
In another embodiment, the defective viral genome-derived RNA molecule comprises a structure as described by Figure 12. In certain embodiments, the defective viral genome-derived RNA molecule comprises at least 1, 2, 3, 4, 5 or more, or any combination thereof, of the RNA motifs described by Figure 12.
The present disclosure also provides pharmaceutical compositions comprising a defective viral genome-derived RNA molecule comprising the nucleotide sequence of SEQ ID NO: l, SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4 or variants thereof having immunostimulatory activity, one or more antigens, and a pharmaceutically acceptable carrier.
In another aspect, the disclosure provides an isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO:l , SEQ ID NO:2, SEQ ID NO:3, or SEQ ID NO:4.
BRIEF DESCRIPTION OF THE FIGURES
Figure 1: Activation of human DCs upon SeV Cantell HD infection induces strong CD4+ T cell response. (A) BMDCs were mock-infected or infected with an MOI= 1.5 TCID50/cell of SeV Cantell HD or Sev Cantell LD. Infected cells were harvested 6 h post-infection and total RNA was analyzed by PCR to detect copy- back DVGs and standard viral genomic RNA (gSeV). (B) Human MDDCs were infected with SeV Cantell HD or Sev Cantell LD (MOI=1.5 TCID50/cell). After 6hrs, total RNA was extracted and analyzed by RTqPCR for the expression of viral protein mRNA and cytokines. (C) Activated MDDCs were co-cultured with human allogeneic naive CD4+ T cells (DCs: T cells =1 :5). After 5 days, the supernatant was collected and IFNy was quantified by ELISA. Phytohaemaglutinin (PHA) was used for CD4+ T cell activation as a positive control. (D) Representation of the procedure for DC immunization. BMDCs pretreated for 24 h with UV-inactivated IAV were infected with partially inactivated Sev Cantell LD alone (MOI = 1.5 TCIDso/cell), together with 125 HA Units of pDPs, or pDPs alone. (E) Expression of viral proteins (Np) mRNA and Il-12p40 was determined from a sample of the cells 2 hpi by RTqPCR. (F) Anti-influenza virus IgG in the sera of mice 14 days after immunization. (G) Number of influenza virus specific IFNy-producing CD8+ T cells in splenocytes from immunized mice. Error bars indicate the standard deviation of triplicate measurements in a representative experiment, ns: non significant. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 (Unpaired t student test).
Figure 2: Recombinant SeV copy back DVG preserves strong stimulatory activity. (A) BHK-21 cells expressing the T7 polymerase (BSR-T7) were infected with partially inactivate SeV 52 and transfected with the plasmid encoding DVG-546. Cells and supernatant were removed 48 h later and inoculated into 10-day embryonated hen eggs. (B) LLCMK2 cells were infected at a moi of 5 with three consecutive passages (PI-P3) of allantoid fluid from eggs containing control SeV Cantell LD alone or in the presence of rDPs. The presence of DVG-546 in the infected cells was confirmed 15 h after infection by RT-PCR. DVG for SeV Cantell was used as a positive control (+). (C) Passages PI-P3 of allantoid fluid from eggs containing control SeV 52 alone or in the presence of rDPs were analyzed for their content of DI particles by determining the ratio of infectious particles over total hemagglutinating particles (HA) (n=5-8). Each symbol represents an individual egg (****p<0.0001 (oneway ANOVA) (D) LLMCK2 cells infected with SeV Cantell LD or rDP (P3) were analyzed by RTqPCR for the expression of the viral protein Np mRNA or (E) for Ι/ηβ. Data are expressed as copy numbers relative to the housekeeping genes β-tubulin and rpsll. (F) A restriction site for Bglll (diamond) was introduce in the DVG internal sequence to generate a modified DVG to be used as backbone to further modifications. CS: complementary sequence. (G) Ι/ηβΠ mRNA expression in LLCMK2 cell infected with SeV C, rDPs, or modified rDP (mrDP) Data are expressed as copy numbers relative to the housekeeping genes Actb and Tubalb. **p<0.01, ****p<0.0001 (Unpaired t student test).
Figure 3: Naked DVG-derived RNA preserves immunostimulatory activity. (A) Representation of deletion mutants of the DVG genome. Deletions (hatched) were performed in the internal sequence (black) without compromising the DVG complementary ends (grey). (B) The electrophoretic analysis for each in vitro transcribed RNA was performed in an Agilent's 2100 Bioanalyzer. (C) LLCMK2 cells were transfected with mDVG-546, capped mDVG-546 (DVG CAP), mDVG- 546 treated with calf intestinal phosphatase (DVG-CIP) or the different mutants and 6 h post-transfection cells were harvested and total cellular RNA was extracted to determine expression of Ι ηβ mRNA by RTqPCR. Data are expressed as copy numbers relative to the housekeeping genes Actb and Tubalb. Statistical outliers were removed based on the Grubb's test. *p<0.05 (Unpaired t student test).
Figure 4: DVG-derived naked RNA trigger RLR signaling. WT,
RIGIKO and MAVSKO MEFs were transfected with 500ng of in vitro transcribed RNA or mock-treated. Total RNA was extracted 8h later and expression of 1 ηβ mRNA was determined by RTqPCR. Data are expressed as copy numbers relative to the housekeeping genes Actb and Tubalb. *p<0.05, ****p<0.0001 (Unpaired t student test).
Figure 5: DVG-derived naked RNA shows immunostimulatory activity in mice. Mice were injected subcutaneously in the footpad with 50ug of DVG-derived RNAs, Poly I:C or PBS. After 36 hrs, footpad tissue was harvested and RNA was extracted for cytokine expression analysis by RTqPCR for ΙΙ-β mRNA (A) or 11-12 mRNA (B).
Figure 6: SEQ ID NO:l. An exemplary DVG-derived RNA molecule having a length of 546 nucleotides.
Figure 7: SEQ ID NO:2. An exemplary DVG-derived RNA molecule having a length of 396 nucleotides.
Figure 8: SEQ ID NO:3. An exemplary DVG-derived RNA molecule having a length of 324 nucleotides.
Figure 9: SEQ ID NO:4. An exemplary DVG-derived RNA molecule having a length of 268 nucleotides. Figure 10: LLCMK2 cells were transfected with 500ng of each of the in vitro transcribed RNAs. IFNbeta production was determined by RTqPCR. Data show average of three independent experiments.
Figure 11A-E: Mice were injected subcutaneously in the footpad with 50 μ of DVG-324 or poly I:C (high molecular weight). (A) Footpad tissue was harvested after 36 h and RNA was extracted for the analysis of cytokine expression. The experiment was independently repeated three times. Each assay was performed in triplicates. Data shown is a compilation of all experiments. Each symbol represents an individual animal (total n = 8-11). * is p<0.05, ** is pO.01 , **** is pO.0001 by one- way ANOVA with Bonferroni post-test. (B) Analysis of cytokine expression in mice footpads collected at 6 h post infection. The experiment was independently repeated two times. Each assay was performed in triplicates. Data shown is a compilation of all experiments (n = 4/group). Data are expressed as copy numbers relative to the housekeeping gene rpsll. (C-D) Single cell suspensions from draining popliteal lymph nodes were analyzed by flow cytometry. (C) Percentage of CDl lc+CDl lb+ cells from the live cell gate is shown.** is p<0.01 by one-way ANOVA with Bonferroni post-test (n = 2 for PBS and 5 for poly I:C and DVG 324). (D) CDl lc+CDl lb+ cells were further gated for expression of CD 103 and B220 to quantify CD1 lc+CDl lb+CD103" DCs and CD1 lbloCDl lc'°B220+ plasmacytoid DCs. Data show a representative plot for poly I:C treatment and two representative plots for DVG-324 treatment. (E) Antibodies in the sera of Balb/c mice three weeks after immunization with a single i.m. dose of 180 μg of inactivated respiratory syncytial virus (inRSV) in the presence of 50 μg poly I:C, 50 μg DVG-324, or PBS. Sera pre- immunization (pre-bleed: PB) was also analyzed. Anti-RSV antibodies were determined by ELISA.
Figure 12: Shows RNA motifs of DVGs with strong and weak activity. The DVGs that exhibited strong activity shared a common motif (arrow).
DETAILED DESCRIPTION
The present disclosure is based, at least in part, on the discovery of immunostimulatory RNAs derived from a defective viral genome (DVG) that act as adjuvants or immunostimulatory agents to enhance host immune responses. In particular, the inventors have cloned the genome of a mouse paramyxovirus Sendai (SeV) DVG, and generated short, optimized DVG-derived RNA molecules from the SeV that retain or improve the stimulatory properties of full DVGs. These DVG- derived RNA molecules can be used as immunostimulants in vivo.
The SeV-derived DVGs preserve strong immuno stimulatory activity while in the context of a viral infection, as well as when used as naked RNA. As described herein, these short SeV DVG-derived RNAs have been shown to induce high levels of IFN-β expression in vitro and trigger fast expression of proinflammatory cytokines and mobilization of dendritic cells when injected in the footpad tissue or skin of mice.
Additionally, as described herein, these short SeV DVG-derived RNAs have been shown to promote the development of adaptive immunity against a model vaccine, inactivated respiratory syncytial virus, when the SeV DVG-derived RNAs were administered with the vaccine to mice.
Accordingly, these oligonucleotides are potent adjuvants for vaccination. The present subject matter provides methods and compositions for use in stimulating an immune response in a subject, comprising administering a DVG- derived RNA, as described herein, to the subject, in conjunction with one or more antigens, e.g., antigens contained in vaccines, to enhance or promote an antigen specific immune response.
The present subject matter also provides methods and compositions for the activation of an antigen presenting cell, e.g. , a dendritic cell, where the cell is contacted with a DVG-derived RNA as described herein, and introduced, or reintroduced, into a subject.
In another embodiment, the DVG-derived RNA molecules of the disclosed subject matter can be used as anti-tumoral agents, e.g., to inhibit, treat, or prevent tumor growth or cancer in a subject. In one embodiment, the DVG-derived RNA molecules can be used as an immunostimulant to generate local inflammation surrounding a tumor, e.g., through systemic administration, administration to the tumor itself, or via topical administration, such as for tumors of the skin (e.g., melanoma).
In a further embodiment, the DVG-derived RNA molecules of the disclosed subject matter can be used as anti-skin ailment agents, to inhibit treat or prevent skin ailments in a subject. A skin ailment includes any skin disease or disorder that can be treated or prevented by an inflammatory response. In one embodiment, the DVG-derived RNA molecules can be used as an immunostimulant to generate local inflammation surrounding a skin ailment, e.g., through systemic administration, administration to the skin ailment itself, or via topical administration, such as for warts.
The DVG-derived RNA can be delivered to the subject or to a cell by any means known in the art for delivery of nucleic acids, including, for example, using a vector, liposome, nanoparticle, or by direct injection of the naked RNA.
In another embodiment, the DVG-derived RNA molecules of the disclosed subject matter can be used as viral analogues for in vitro experiments (e.g, as an alternative to poly IC).
Definitions
"Adjuvant" means any substance that increases the humoral or cellular immune response to an antigen. Adjuvants are generally used to accomplish two objectives: they slow the release of antigens from the injection site, and they stimulate the immune system.
"Antibody" refers to an immunoglobulin molecule that can bind to a specific antigen as the result of an immune response to that antigen. Immunoglobulins are serum proteins composed of "light" and "heavy" polypeptide chains having "constant" and "variable" regions and are divided into classes (e.g., IgA, IgD, IgE, IgG, and IgM) based on the composition of the constant regions.
"Antigen" or "immunogen" refers to any substance that stimulates an immune response. The term includes killed, inactivated, attenuated, or modified live bacteria, viruses, fungi or parasites or parasite eggs, etc. The term antigen also includes polynucleotides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, or lipids, or fragments thereof, individually or in any combination thereof. The term antigen also includes antibodies, such as anti-idiotype antibodies or fragments thereof, and to synthetic peptide mimotopes that can mimic an antigen or antigenic determinant (epitope).
"Cellular immune response" or "cell mediated immune response" is one mediated by T-lymphocytes or other white blood cells or both, and includes the production of cytokines, chemokines and similar molecules produced by activated T- cells, white blood cells, or both.
"Defective viral genomes", "DVGs", defective interfering viral genomes", or "DIVGs" are generated as byproducts during viral replication when the viral polymerase loses processivity at high virus titers [3, 4]. DVGs are truncated versions of the parental viral genome and lack essential replication machinery for replication; however, they retain the signals necessary for the stimulation of RIG-I like receptors (RLR) signaling. RLRs bind to RNA oligonucleotides that are derived from viral genomes and signal for the activation of transcription factors that trigger the expression of antiviral and pro-inflammatory molecules [1, 2]. Defective interfering particles are wide-spread in many DNA and RNA viruses in bacteria, plants and animals.
"DVG-derived RNA" includes an isolated RNA molecule that signals for the activation of transcription factors that trigger the expression of antiviral and/or pro-inflammatory molecules. An RNA derived from a defective viral genome (DVG) acts as an adjuvant or immunostimulatory agent to enhance host immune responses to an antigen. In one embodiment, these DVG-derived RNA molecules are mutants that are generated or prepared from a defective viral genome. For example, an isolated RNA molecule includes an isolated RNA molecule that at least one nucleotide shorter than the full length defective viral genome.
"Dose" refers to a vaccine or immunogenic composition given to a subject. A "first dose" or "priming vaccine" refers to the dose of such a composition given on Day 0. A "second dose" or a "third dose" or an "annual dose" refers to an amount of such composition given subsequent to the first dose, which can or can not be the same vaccine or immunogenic composition as the first dose.
"Humoral immune response" refers to one that is mediated by antibodies.
"Immune response" in a subject refers to the development of a humoral immune response, a cellular immune response, or a humoral and a cellular immune response to an antigen. Immune responses can usually be determined using standard immunoassays and neutralization assays, which are known in the art.
"Immunologically protective amount" or "immunologically effective amount" or "effective amount to produce an immune response" of an antigen is an amount effective to induce an immunogenic response in the recipient. The immunogenic response can be sufficient for diagnostic purposes or other testing, or can be adequate to prevent signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a disease agent. Either humoral immunity or cell-mediated immunity or both can be induced. The immunogenic response of an animal to an immunogenic composition can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain, whereas the protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature number, overall physical condition, and overall health and performance of the subject. The immune response can comprise, without limitation, induction of cellular and/or humoral immunity.
"Immunogenic" means evoking an immune or antigenic response. Thus an immunogenic composition would be any composition that induces an immune response.
"Immunostimulatory molecule" refers to a molecule that generates an immune response.
"Lipids" refers to any of a group of organic compounds, including the fats, oils, waxes, sterols, and triglycerides, which are insoluble in water but soluble in nonpolar organic solvents, are oily to the touch, and together with carbohydrates and proteins constitute the principal structural material of living cells.
"Liposome" refers to a microscopic spherical particle formed by a lipid bilayer enclosing an aqueous compartment, used medicinally to carry a drug, antigen, vaccine, enzyme, or another substance to targeted cells in the body
"Parenteral administration" refers to the introduction of a substance, such as a vaccine, into a subject's body through or by way of a route that does not include the digestive tract. Parenteral administration includes subcutaneous, intramuscular, transcutaneous, intradermal, intraperitoneal, intraocular, and intravenous administration.
"Pharmaceutically acceptable" refers to substances, which are within the scope of sound medical judgment, suitable for use in contact with the tissues of subjects without undue toxicity, irritation, allergic response, and the like, commensurate with a reasonable benefit-to-risk ratio, and effective for their intended use. "Subject" refers to any animal for which the administration of an adjuvant composition is desired. It includes mammals and non-mammals, including humans, livestock, companion animals, laboratory test animals, captive wild animals, aves (including in ova), reptiles, and fish. Thus, this term includes but is not limited to humans, monkeys, swine, cattle, sheep, goats, equines, mice, rats, guinea pigs, hamsters, rabbits, felines, canines, chickens, turkeys, ducks, other poultry, frogs, fish, and lizards.
"Therapeutically effective amount" refers to an amount of an antigen or vaccine that would induce an immune response in a subject receiving the antigen or vaccine which is adequate to prevent or reduce signs or symptoms of disease, including adverse health effects or complications thereof, caused by infection with a pathogen, such as a virus or a bacterium. Humoral immunity or cell-mediated immunity or both humoral and cell-mediated immunity can be induced. The immunogenic response of a subject to a vaccine can be evaluated, e.g., indirectly through measurement of antibody titers, lymphocyte proliferation assays, or directly through monitoring signs and symptoms after challenge with wild type strain. The protective immunity conferred by a vaccine can be evaluated by measuring, e.g., reduction in clinical signs such as mortality, morbidity, temperature, overall physical condition, and overall health of the subject. The amount of a vaccine that is therapeutically effective can vary depending on the particular adjuvant used, the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art.
"Vaccine" refers to a composition that includes an antigen, as defined herein. Administration of the vaccine to a subject results in an immune response, generally against one or more specific diseases. The amount of a vaccine that is therapeutically effective can vary depending on the particular antigen used, or the condition of the subject, and can be determined by one skilled in the art. A vaccine can comprise a live attenuated virus in a suitable pharmaceutically, or physiologically acceptable carrier, such as isotonic saline or isotonic salts solution. The appropriate carrier will be evident to those skilled in the art and will depend in large part upon the route of administration. Alternatively, vaccines composed of polynucleotide molecules desirably contain optional polynucleotide facilitating agents or "co-agents", such as a local anesthetic, a peptide, a lipid including cationic lipids, a liposome or lipidic particle, a polycation such as polylysine, a branched, three-dimensional polycation such as a dendrimer, a carbohydrate, a cationic amphiphile, a detergent, a benzylammonium surfactant, or another compound that facilitates polynucleotide transfer to cells. Non-exclusive examples of such facilitating agents or co-agents useful in this disclosure are described in U.S. Pat. Nos. 5,593,972; 5,703,055; 5,739,118; 5,837,533; International Patent Application No. WO96/10038, published Apr. 4, 1996; and International Patent Application No W094/16737, published Aug. 8, 1994, which are each incorporated herein by reference.
"Cancer" includes, for example, skin cancers (melanoma and squamous cell carcinoma), pancreatic cancer, kidney cancer, e.g., renal cell carcinoma (RCC), urogenital cancer, e.g., urothelial carcinomas in urinary bladder, kidney, pelvic and ureter, melanoma, prostate carcinoma, lung carcinomas (non-small cell carcinoma, small cell carcinoma, neuroendocrine carcinoma and carcinoid tumor), breast carcinomas (ductal carcinoma, lobular carcinoma and mixed ductal and lobular carcinoma), thyroid carcinomas (papillary thyroid carcinoma, follicular carcinoma and medullary carcinoma), brain cancers (meningioma, astrocytoma, glioblastoma, cerebellum tumors, medulloblastoma, ependymoma), ovarian carcinomas (serous, mucinous and endometrioid types), cervical cancers (squamous cell carcinoma in situ, invasive squamous cell carcinoma and endocervical adenocarcinoma), uterine endometrial carcinoma (endometrioid, serous and mucinous types), primary peritoneal carcinoma, mesothelioma (pleura and peritoneum), eye cancer (retinoblastoma), muscle (rhapdosarcoma and leiomyosarcoma), lymphomas, esophageal cancer (adenocarcinoma and squamous cell carcinoma), gastric cancers (gastric adenocarcinoma and gastrointestinal stroma tumor), liver cancers (hepatocellular carcinoma and bile duct cancer), small intestinal tumors (small intestinal stromal tumor and carcinoid tumor) colon cancer (adenocarcinoma of the colon, colon high grade dysplasia and colon carcinoid tumor), testicular cancer, and adrenal carcinoma.
A "tumor" includes any tumor resulting or associated with from any of the above cancers.
DVG-Derived RNA Molecules The presently disclosed subject matter provides for immunostimulatory
DVG-derived isolated RNA molecules. In one embodiment, the DVG-derived RNA molecules are used as adjuvants or immunostimulatory agents to activate dendritic cells, trigger cytokine expression and enhance host immune responses to an antigen. In one embodiment, the DVG-derived RNA molecules described herein have increased immunostimulatory activity as compared to DVG particles.
The DVG-derived RNA molecules of the presently disclosed subject matter can be derived from the paramyxovirus Sendai (SeV), or from any other virus that produces a defective viral genome. For example, other viruses can include but are not limited to human parainfluenza virus, respiratory syncytial virus, measles, Newcastle Disease virus, and human matapneumo virus.
In one embodiment, a DVG-derived RNA molecule has a structure wherein the ends are complementary to each other, forming a loop structure when annealed. In one embodiment, the DVG-derived RNA molecule contains both complementary ends. In another embodiment, the DVG-derived RNA molecule contains one of the complementary ends. In yet another embodiment, DVG-derived RNA molecule contains neither of the complementary ends.
In one embodiment, a DVG-derived RNA molecule comprises one or more of the structures described by Figure 12. In certain embodiments, a DVG- derived RNA molecule comprises at least 1 , 2, 3, 4, 5 or more, or any combination thereof, of the RNA moti s described by Figure 12.
In one embodiment, these DVG-derived RNA molecules are truncated mutants that are isolated from the defective viral genome. In another embodiment, the DVG-derived RNA molecules have a length of about 100-600 or more nucleotides. For example, the DVG-derived RNA molecules can be about 100, 125, 150, 175, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 425, 450, 475, 500, 525, 550 or more nucleotides in length. In one embodiment, the DVG-derived RNA molecule is 546 nucleotides or less in length. In one embodiment, the DVG-derived RNA molecule is about 268 or about 324 or about 396 or about 546 nucleotides in length. In one embodiment the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO: l (Figure 6). In another embodiment, the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO:2 (Figure 7). In another embodiment, the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO:3 (Figure 8). In another embodiment, the DVG-derived RNA molecule has the nucleotide sequence of SEQ ID NO:4 (Figure 9). The disclosed subject matter further provides for the use of DVG- derived RNA molecules, and fragments thereof, that are variants of the nucleotide sequence shown in SEQ ID NOs.T-4 (Figures 6-9), but still retain immunostimulatory activity. The variants can contain nucleotide substitutions, deletions, inversions and insertions (including truncated variants). Typically, variants have a substantial identity with a nucleic acid molecules of SEQ ID NOS:l-4. Variants can be identified using methods well known in the art. These variants comprise a nucleotide sequence that is typically at least about 70-75%, more typically at least about 80-85%, and most typically at least about 90-95% or more homologous to the nucleotide sequence shown in SEQ ID NOS: l-4 or a fragment of this sequence, and retain immunostimulatory activity. In certain embodiments the variants comprise one or more of the structures described by Figure 12. In certain embodiments, the variants comprise at least 1, 2, 3, 4, 5 or more, or any combination thereof, of the RNA motifs described by Figure 12. Immunostimulatory activity can be measured by the methods described herein (e.g., in the Examples), any method known in the art.
Delivery of the DVG-Derived RNA Molecules
Delivery of nucleic acid into a subject or dendritic cell be either direct, in which case the subject or cell is directly exposed to the naked nucleic acid, or indirect, in which case, cells are first transformed with the nucleic acids in vitro, then introduced or reintroduced into the patient.
The RNA molecules of the present disclosure can be directly administered in vivo, e.g., combined with an antigen or vaccine to form an adjuvant composition. This can be accomplished by any of numerous methods known in the art, e.g., by direct injection of naked RNA. For example, the RNA can be injected, aerosolized, electroporated in the skin or muscle, or used intranasally, etc. The RNA can also be administered by use of microparticle bombardment {e.g., a gene gun; Biolistic, Dupont), or coating with lipids, encapsulation in liposomes, microparticles, or microcapsules, or by administering them in linkage to a peptide. The nucleic acid- ligand complexes can also be formed in which the ligand comprises a fusogenic viral peptide to disrupt endosomes, allowing the nucleic acid to avoid lysosomal degradation. The RNA can also be stabilized with cationic molecules, e.g., Poly-L Lysine, or attached to nanoparticles for delivery. In one embodiment, the nanoparticles can also contain one or more antigen. In another embodiment, the RNA can be conjugated with antigen for delivery. For example, the RNA can be conjugated to parasite eggs, proteins, etc.
The RNA can also be constructing as part of an appropriate vector (viral or otherwise). The terms "vector" means the vehicle by which a nucleic acid sequence can be introduced into a cell. Vectors include plasmids, phages, viruses, etc. A "therapeutic vector" as used herein refers to a vector which is acceptable for administration to an animal, and particularly to a human.
Vectors typically comprise the DNA of a transmissible agent, into which foreign nucleic acid molecule is inserted. A common way to insert one nucleic acid molecule into another segment of DNA involves the use of enzymes called restriction enzymes that cleave DNA at specific sites (specific groups of nucleotides) called restriction sites. Generally, the foreign nucleic acid molecule is inserted at one or more restriction sites of the vector DNA, and then is carried by the vector into a host cell along with the transmissible vector DNA.
Suitable vectors include viruses, such as adenoviruses, adeno- associated virus (AAV), lentiviral vectors, vaccinia, herpesviruses, paramyxoviruses, Sendai Virus, RNA-based viruses, Newcastle disease virus, baculoviruses, orthomyxovirus, RNA-based viruses, retroviruses, parvovirus, lentivirus, bacteriophages, cosmids, plasmids, fungal vectors, and other recombination vehicles typically used in the art.
Methods that can be used to deliver the RNAs of the present disclosure are described in, for example, Clegg, C. H. et al. Proc Natl Acad Sci U S A 109, 17585-17590, (2012); Thim, H. L. et al. Vaccine 30, 4828-4834, (2012); Alving, C. R., et al. Curr Opin Immunol 24, 310-315, (2012); Baldwin, S. L. et al. T Immunol 188, 2189-2197 (2012); Nordly, P. et al. J Control Release 150, 307-317, (2011); Schneider-Ohrum, K. et al. Vaccine 29, 9081-9092, (2011); Caskey, M. et al. J Exp Med 208, 2357-2366, 2011); Petsch, B. et al. Pr Nat Biotechnol 30, 1210-1216, (2012), the contents of which are expressly incorporated herein by reference).
In one embodiment, the RNA of the disclosed subject matter (either naked RNA or RNA linked to a delivery vehicle as described above), can be administered parenterally, e.g., subcutaneously or intramuscularly, aerosolized, electroporated in the skin or muscle, or used intranasally, etc., or delivered by any other suitable route for delivery of RNA alone or in combination with a vaccine. In another embodiment, the compositions of the disclosed subject matter can be administered topically onto the skin or to the mucosa of a subject (see, e.g., Pavot, V., Vaccine 2012 Jan 5;30(2): 142-54 and Bal, SM J. Control Release 2010 Dec 20; 148(3):266-82).
Antigens
As described herein, as an adjuvant, the RNA molecules of the presently disclosed subject matter can be administered in combination with vaccines, to stimulate the immune response to pathogens, toxins, and self-antigens.
The antigen can be any of a wide variety of substances capable of producing a desired immune response in a subject. The antigens used with these adjuvant compositions can be one or more of viruses (inactivated, attenuated, and modified live), bacteria, fungi, parasites, parasite eggs, nucleotides, polynucleotides, peptides, polypeptides, recombinant proteins, synthetic peptides, protein extract, cells (including tumor cells), tissues, polysaccharides, carbohydrates, fatty acids, teichioc acid, peptidoglycans, lipids, or glycolipids, individually or in any combination thereof. The antigens used with the adjuvants of the disclosed subject matter also include immunogenic fragments of nucleotides, polynucleotides, peptides, polypeptides, that can be isolated from the organisms referred to herein. They could also be in the form of DNA vaccines.
Live, modified-live, and attenuated viral strains that do not cause disease in a subject have been isolated in non-virulent form or have been attenuated using methods well known in the art, including serial passage in a suitable cell line or exposure to ultraviolet light or a chemical mutagen. Inactivated or killed viral strains are those which have been inactivated by methods known to those skilled in the art, including treatment with formalin, betapropriolactone (BPL), binary ethyl eneimine (BEI), sterilizing radiation, heat, or other such methods.
Two or more antigens can be combined to produce a polyvalent composition that can protect a subject against a wide variety of diseases caused by the pathogens. While conventional adjuvants are often limited in the variety of antigens with which they can be effectively used (either monovalently or polyvalently), the adjuvants described herein can be used effectively with a wide range of antigens, both monovalently and polyvalently. Thus, the antigens described herein can be combined in a single composition comprising the adjuvants described herein. Some examples of pathogenic viruses that can be used as antigens in the compositions and methods of the present subject matter include hepatitis (A, B, or C), herpes virus (e.g., VZV, HSV-1 , HAV-6, HSV-II, and CMV, Epstein Barr virus), adenovirus, influenza virus, flaviviruses, echovirus, rhinovirus, coxsackie virus, cornovirus, respiratory syncytial virus, mumps virus, rotavirus, measles virus, rubella virus, parvovirus, vaccinia virus, HTLV virus, dengue virus, papillomavirus, molluscum virus, poliovirus, rabies virus, JC virus and arboviral encephalitis virus.
Some examples of pathogenic bacteria that can be used as antigens in the compositions and methods of the present subject matter include chlamydia, rickettsial bacteria, mycobacteria, staphylococci, streptococci, pneumonococci, meningococci and conococci, klebsiella, proteus, serratia, pseudomonas, legionella, diphtheria, salmonella, bacilli, cholera, tetanus, botulism, anthrax, plague, leptospirosis, and Lymes disease bacteria.
Some examples of pathogenic fungi that can be used as antigens in the compositions and methods of the present subject matter include Candida (albicans, krusei, glabrata, tropicalis, etc.), Cryptococcus neoformans, Aspergillus (fumigatus, niger, etc.), Genus Mucorales (Mucor, Absidia, Rhizophus), Sporothrix schenkii, Blastomyces dermatitidis, Paracoccidioides brasiliensis, Coccidioides immitis and Histoplasma capsulatum.
Some examples of pathogenic parasites that can be used as antigens in the compositions and methods of the present subject matter include Entamoeba histolytica, Balantidium coli, Naegleria fowleri, Acanthamoeba sp., Giardia lambia, Cryptosporidium sp., Pneumocystis carinii, Plasmodium vivax, Babesia microti, Trypanosoma brucei, Trypanosoma cruzi, Leishmania donovani, Toxoplasma gondi, Nippostrongylus brasiliensis, and Schistosomiasis.
Tumor antigens can be used in the adjuvant compositions of the present subject matter. Many strategies for vaccination against tumors have been devised (see Rosenberg, S., 2000, Development of Cancer Vaccines, ASCO Educational Book Spring: 60-62; Logothetis, C, 2000, ASCO Educational Book Spring: 300-302; Khayat, D. 2000, ASCO Educational Book Spring: 414-428; Foon, K. 2000, ASCO Educational Book Spring: 730-738; see also Restifo, N. and Sznol, M., Cancer Vaccines, Ch. 61, pp. 3023-3043 in DeVita, V. et al. (eds.), 1997, Cancer: Principles and Practice of Oncology, Fifth Edition). In one of these strategies, a vaccine is prepared using autologous or allogeneic tumor cells. These cellular vaccines have been shown to be most effective when the tumor cells are transduced to express GM-CSF. GM-CSF has been shown to be a potent activator of antigen presentation for tumor vaccination (Dranoff et al. (1993) Proc. Natl. Acad. Sci U.S.A. 90 (80: 3539-43).
The study of gene expression and large scale gene expression patterns in various tumors has led to the definition of so called tumor specific antigens (Rosenberg, S A (1999) Immunity 10: 281-7). In many cases, these tumor specific antigens are differentiation antigens expressed in the tumors and in the cell from which the tumor arose, for example melanocyte antigens gp 100, MAGE antigens, Trp-2. More importantly, many of these antigens can be shown to be the targets of tumor specific T cells found in the host. The tumor antigen can also include the protein telomerase, which is required for the synthesis of telomeres of chromosomes and which is expressed in more than 85% of human cancers and in only a limited number of somatic tissues (Kim, N et al. (1994) Science 266, 201 1-2013). (These somatic tissues can be protected from immune attack by various means). Tumor antigen can also be "neo-antigens" expressed in cancer cells because of somatic mutations that alter protein sequence or create fusion proteins between two unrelated sequences (i.e. bcr-abl in the Philadelphia chromosome), or idiotype from B cell tumors. Other tumor vaccines can include the proteins from viruses implicated in human cancers such a Human Papilloma Viruses (HPV), Hepatitis Viruses (HBV and HCV) and Kaposi's Herpes Sarcoma Virus (KHSV).
Another form of tumor specific antigen which can be used in conjunction with the compositions and methods of the presently disclosed subject matter is purified heat shock proteins (HSP) isolated from the tumor tissue itself. These heat shock proteins contain fragments of proteins from the tumor cells and these HSPs are highly efficient at delivery to antigen presenting cells for eliciting tumor immunity (Suot, R & Srivastava, P (1995) Science 269: 1585-1588; Tamura, Y. et al. (1997) Science 278: 117-120.
The RNA molecules and vaccination methods of the present disclosure can also be used in conjunction with anti-cancer therapies (e.g., chemotherapy), to augment cancerous cell death by creating a more immunogenic environment in a subject afflicted with cancer. Such combination therapy enhances cancer cell death and promotes a robust immune response capable of killing any residual cancer cells that have escaped treatment. (Lake et al. New Engl J of Med 354, 2503 (2006)). Other anti-cancer therapies that can be used with the compositions of the present disclosure include radiation, surgery, and hormone deprivation (Kwon, E. et al. (1999) Proc. Natl. Acad. Sci U.S.A. 96 (26): 15074-9). Angiogenesis inhibitors can also be used. Inhibition of angiogenesis leads to tumor cell death, which can feed tumor antigen into host antigen presentation pathways.
In one embodiment, cancer cells (e.g., tumor cells) isolated from a subject can be exposed to the adjuvants of the present subject matter and used to treat dendritic cells ex vivo. The mature ex vivo treated dendritic cells are then reintroduced into the patient and promote a robust immune response directed against the cancer cells.
Pharmaceutical Compositions and Administration
Many methods can be used to introduce the vaccine formulations described herein, these include but are not limited to oral, topical, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intra-pulmonary, rectal, vaginal and intranasal routes. All such routes are suitable for administration of these compositions, and can be selected depending on the patient and condition treated if there is a condition present, and similar factors by an attending physician. It is preferable to introduce a vaccine formulation via the natural route of infection of the pathogen for which the vaccine is designed. According to the desired route for administration, the compositions of the disclosure are prepared in the form of, for example, liquids, powders, aerosols, tablets, capsules, enteric coated tablets or capsules, or suppositories.
Selection of the appropriate dosage for the priming compositions of the present disclosure can be based upon the physical condition of the mammal, most especially including the general health and weight of the immunized mammal. Such selection and upward or downward adjustment of the effective dose is within the skill of the art.
Pharmaceutical compositions of the present disclosure, suitable for inoculation or for parenteral or oral administration, comprise attenuated or inactivated forms of mammalian viruses, for example, optionally further comprising sterile aqueous or non-aqueous solutions, suspensions, and emulsions. The composition can further comprise auxiliary agents or excipients, as known in the art. See, e.g, Berkow et al., eds,, The Merck Manual, 15th edition, Merck and Co., Rahway, N.J. (1987); Goodman et al., eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th edition, Pergamon Press, Inc., Elmsford, N.Y. (1990); Avery's Drug Treatment: Principles and Practice of Clinical Pharmacology and Therapeutics, 3rd edition, ADIS Press, LTD., Williams and Wilkins, Baltimore, Md. (1987); Osol, A., ed., Remington's Pharmaceutical Sciences, Mack Publishing Co, Easton, Pa. pp. 1324-1341 (1980); Katzung, ed. Basic and Clinical Pharmacology, Fifth Edition, Appleton and Lange, Norwalk, Conn. (1992), which references and references cited therein, are entirely incorporated herein by reference as they show the state of the art.
For example, a virus vaccine composition of the present disclosure can comprise from about 102-109 plaque forming units (PFU)/ml, or any range or value therein, where the virus is attenuated. A vaccine composition comprising an inactivated virus can comprise an amount of virus corresponding to about 0.1 to 200 micrograms of an antigenic protein/ml or combinations thereof, or any range or value therein.
Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and/or emulsions, which can contain auxiliary agents or excipients known in the art. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Carriers or occlusive dressings can be used to increase skin permeability and enhance antigen absorption. Liquid dosage forms for oral administration can generally comprise a liposome solution containing the liquid dosage form. Suitable forms for suspending liposomes include emulsions, suspensions, solutions, syrups, and elixirs containing inert diluents commonly used in the art, such as purified water. Besides the inert diluents, such compositions can also include adjuvants, wetting agents, emulsifying and suspending agents, or sweetening, flavoring, or perfuming agents. See, e.g., Berkow, infra, Goodman, infra, Avery's, infra, Osol, infra and Katzung, infra, which are incorporated in their entirety herein by reference.
A vaccine composition of the present disclosure, used for administration to an individual, can further comprise salts, preservatives, chemical stabilizers, buffers, adjuvants, or other substances which are desirable for improving the efficacy of the composition. Typically, stabilizers, adjuvants, and preservatives are optimized to determine the best formulation for efficacy in the target human or animal. Suitable exemplary preservatives include chlorobutanol potassium sorbate, sorbic acid, sulfur dioxide, propyl gallate, the parabens, ethyl vanillin, glycerin, phenol, and parachlorophenol. Suitable stabilizing ingredients which can be used include, for example, casamino acids, sucrose, gelatin, phenol red, N-Z amine, monopotassium diphosphate, lactose, lactalbumin hydrolysate, and dried milk. Normally, the adjuvant and the composition are mixed prior to presentation to the immune system, or presented separately, but into the same site of the mammal being immunized. Such adjuvants include, among others, MPL. (3-O-deacylated monophosphoryl lipid A; RIBI ImmunoChem Research, Inc., Hamilton, Mont.), mineral oil and water, aluminum hydroxide, Amphigen, Avridine, L121/squalene, D- lactide-polylactide/glycoside, pluronic plyois, muramyl dipeptide, killed Bordetella, saponins, such as Quil A or Stimulon QS-21 (Aquila Biopharmaceuticals, Inc., Framingham, Mass.) and cholera toxin (either in a wild-type or mutant form, e.g., wherein the glutamic acid at amino acid position 29 is replaced by another amino acid, preferably a histidine, in accordance with International Patent Application No. PCT/US99/22520, incorporated herein by reference). Additional examples of materials suitable for use in vaccine compositions are provided in Osol, A., ed., Remington's Pharmaceutical Sciences, Mack Publishing Co, Easton, Pa. (1980), pp. 1324-1341, which reference is incorporated in its entirety herein by reference.
Heterogeneity in the vaccine can be provided by mixing different modified viruses of the disclosed subject matter, such as 2-50 modified viruses or any range or value therein.
A pharmaceutical composition according to the present disclosure can further or additionally comprise at least one viral chemotherapeutic compound, including, but not limited to, gamma globulin, amantadine, ribavirin, guanidine, hydroxybenzimidazole, interferon-alpha, interferon-beta, interferon-gamma, thiosemicarbarzones, methisazone, rifampin, ribavirin, a pyrimidine analog, a purine analog, foscarnet, phosphonoacetic acid, acyclovir, dideoxynucleosides, a protease inhibitor, or ganciclovir (neuraminidase inhibiting drugs oseltamivir, zanamivir). See, e.g., Katzung, infra, and the references cited therein on pages 798-800 and 680-681 , respectively, which references are herein entirely incorporated by reference.
A pharmaceutical composition according to the present disclosure can further or additionally comprise an aptamer to target a specific cell as provided in Bunka D. and Stockley P., "Aptamer come of age - at last," Nature Reviews Microbiology and Majumder P, et al., "From bench side research towards patented molecules with therapeutic applications," Expert Opin Ther Pat. 2009 Nov;19(l 1): 1603-13, references which are herein entirely incorporated by reference.
The vaccine can also contain variable but small quantities of endotoxin, free formaldehyde, and preservative, which have been found safe and not contributing to the reactogenicity of the vaccines for humans.
The administration of a vaccine composition of the disclosure can be for either "prophylactic" or "therapeutic" purposes. When provided prophylactically, the compositions are provided before any symptom of infection becomes manifest. The prophylactic administration of the composition serves to prevent or attenuate any subsequent infection. When provided therapeutically, the vaccine is provided upon the detection of a symptom of actual infection. The therapeutic administration of the compound(s) serves to attenuate any actual infection. See, e.g, Berkow, infra, Goodman, infra, Avery, infra and Katzung, infra, which are entirely incorporated herein by reference.
An attenuated or inactivated vaccine composition of the present disclosure can thus be provided either before the onset of infection (so as to prevent or attenuate an anticipated infection) or after the initiation of an actual infection.
A composition is said to be "pharmacologically acceptable" if its administration can be tolerated by a recipient patient. Such an agent is said to be administered in a "therapeutically effective amount" if the amount administered is physiologically significant. A vaccine or composition of the present disclosure is physiologically significant if its presence results in a detectable change in the physiology of a recipient patient that enhances at least one primary or secondary humoral or cellular immune response against at least one strain of an infectious virus.
The "protection" provided need not be absolute, i.e., the viral infection need not be totally prevented or eradicated, if there is a statistically significant improvement compared with a control population or set of patients. Protection can be limited to mitigating the severity or rapidity of symptom onset of infection or disease.
According to the present disclosure, an "effective amount" of a vaccine composition is one that is sufficient to achieve a desired biological effect. It is understood that the effective dosage can be determined by a medical practitioner based on a number of variables including the age, sex, health, and weight of the recipient, kind of concurrent treatment, if any, frequency of treatment, and the nature of the desired outcome. The ranges of effective doses provided below are not intended to limit the disclosed subject matter, but are provided as representative preferred dose ranges. However, the most preferred dosage will be tailored to the individual subject, as is understood and determinable by one of skill in the art, without undue experimentation. See, e.g., Betkow et al., eds., The Merck Manual, 16th edition, Merck and Co., Rahway, N.J., 1992; Goodman et al., eds., Goodman and Gilman's The Pharmacological Basis of Therapeutics, 8th edition, Pergamon Press, Inc., Elmsford, N.Y., (1990); Avery's Drug Treatment: Principles and Practice of Clinical Pharmacology and Therapeutics, 3rd edition, ADIS Press, LTD., Williams and Wilkins, Baltimore, Md. (1987), Ebadi, Pharmacology, Little, Brown and Co., Boston, Mass. (1985); and atzung, infra, which references and references cited therein, are entirely incorporated herein by reference.
The dosage of an attenuated virus vaccine for a mammalian (e.g., human) adult can be from about 10 -10 plaque forming units (PFU)/kg, or any range or value therein. The dose of inactivated vaccine can range from about 1 to 50 micrograms of an antigenic protein. However, the dosage should be a safe and effective amount as determined by conventional methods, using existing vaccines as a starting point.
The dosage of immunoreactive protein in each dose of virus or modified virus vaccine can be standardized to contain a suitable amount, e.g., 1-50 micrograms or any range or value therein, or an amount recommended by the U.S. Public Health Service (PHS). Each 0.5-ml dose of vaccine preferably contains approximately 1-50 billion virus particles, and preferably 10 billion particles.
While this disclosure generally discusses immunization in the context of prophylactic methods of protection, the term "immunizing" is meant to refer to both prophylactic and/or therapeutic methods. Thus, a method of immunizing includes both methods of protecting an individual from pathogen challenge, as well as methods for treating an individual suffering from pathogen infection. Accordingly, the present disclosure can be used as a vaccine for prophylactic protection and/or in a therapeutic manner; that is, as a reagent for immunotherapeutic methods and preparations.
The following Example is offered to more fully illustrate the present disclosure, but is not to be construed as limiting the scope thereof.
EXAMPLES EXAMPLE 1: HIGHLY IMMUNOSTIMULATORY RNA DERIVED FROM A
SENDAI VIRUS DEFECTIVE INTERFERING VIRAL GENOME
Defective viral genomes (DVGs) are generated during RNA virus replication. DVGs bearing complementary ends are strong inducers of dendritic cell (DC) maturation and of the expression of antiviral and pro-inflammatory cytokines by triggering signaling of members of the retinoic acid-inducible gene 1 (RIG-I) family of cellular pattern recognition receptors. DCs stimulated in the presence of these types of DVGs have enhanced ability to activate human T cells and can induce protective immunity in mice. Shorter Sendai virus (SeV)-derived DVGs were generated that preserve strong immunostimulatory activity while in the context of a viral infection, as well as when used as naked RNA. These short SeV DVG-derived RNAs induce high levels of Interferon-β (IFN-β) expression in vitro and trigger fast expression of pro-inflammatory cytokines and mobilization of dendritic cells when injected in the footpad tissue of mice. The harnessing SeV DVGs as immunostimulatory molecules was performed and shorter optimized synthetic DVG- derived RNA molecules were generated that retain the stimulatory properties of full DVGs and that can be used as immunostimulants in vivo, as described herein.
EXPERIMENTAL METHODS
Cell lines, mice, and viruses
Rhesus monkey kidney epithelial cells LLCMK2 (ATCC, #CCL7),
Baby hamster kidney-21 (BHK-21) cells expressing the T7 RNA polymerase (BSR- T7), RIGIKO MEFs, and MAVSKO MEFs were cultured in DMEM supplemented with 10% fetal bovine serum, ImM sodium pyruvate, 2mL L-Glutamine, and 50mg/ml gentamicin. C57BL/6 mice were obtained from Taconic Farms, Inc. SeV strains Cantell and 52, and IAV strains A/New Caledonia/20/99 and X-31 were grown in 10 days hen embryonated eggs (SPAFAS; Charles River Laboratories) for 40h at 37°C [15]. SeV strain Cantell (C) depleted of DVGs-containing particles (LD) was generated after 2 passages of SeV Cantell highly diluted in 10-day chicken embryonated eggs as previously described [5], Allantoic fluid was snap frozen in ethanol-dry ice bath and stored at -80°C. Purified IAV was prepared by passing pelleted virus through a 40% sucrose cushion using sterile conditions. DVG detection PCR
RNA was isolated using TRIzol according to the manufacturer's specifications. 2 μg of RNA was reversed transcribed using Transcriptor First Strand cDNA Synthesis Kit (Roche) and the primer 5'GGTGAGGAATCTATACGTTATAC3': cDNA was amplified using Platinum Taq polymerase (Invitrogen) and the primers: for- 5 ' GGTGAGGAATCTAT ACGTTATAC3 ' and rev-
5 'ACCAGACAAGAGTTTAAGAGATATGTATT3 ' . The temperature cycle parameters used for the PCR were: 95°C for lOmin and 33 cycles of 95°C for 45 sec, 55°C for 30 sec and 72°C for 90 sec followed by a 4°C hold.
Human monocvte-derived dendritic cell (MDDC) preparation
Human MDDCs were prepared as previously described [16]. Briefly, PBMC were isolated by Ficoll density gradient centrifugation (Histopaque, Sigma Aldrich) from buffy coats of healthy human donors. CD14+ cells were purified using anti-human CD 14 antibody-labeled magnetic beads and iron-based Midimacs LS columns (Miltenyi Biotec). After elution from the columns, cells (1 x 106 cells/well) were cultured for 5-6 days in RPMI medium containing 10% FBS, 100 U/ml penicillin, 100 μg/ml streptomycin, 500 U/1 human GM-CSF, and 1 ,000 U/ml human IL-4. Isolation of human naive CD4+ T cells
Naive CD4+ T cells were directly separated via negative selection from the PBMC using a cocktail of biotin-conjugated anti-CD8, -CD14, -CD16, -CD19, - CD36, -CD45RO, -CD56, -CD 123, -TCRy/δ, and -Glycophorin A antibodies (Miltenyi Biotec). Cells were further isolated to remove HLA-DR+ cells using anti- HLA-DR microbeads (Miltenyi Biotec). Isolations were performed with iron-based Midimacs LS columns (Miltenyi Biotec).
Murine bone marrow-derived dendritic cell (BMDC) preparation
BMDCs were prepared according to a standard protocol ensuring the production of immature DCs [17]. Briefly, bone marrow was obtained from mice femurs and tibias. Red blood cells were lysed with red blood cell lysing buffer (Sigma) and cells expressing CD4, CD8, B220, or MHC class II molecules were depleted by magnetic bead separation using a cocktail of anti-mouse CD4, CD8, CD45R/B220, and I-A/I-E antibodies (BD Biosciences). The purified precursor cells were plated at a density of 7 x 105 cells/well in 24 well plates and cultured with RPMI containing 1% normal mouse serum, 25 unit/ml GM-CSF (PeproTech), 2mM L- glutamine, ImM NaPy, and 50 μg/ml gentamycin. The cells were used after 4 days of culture.
Human allogeneic co-culture
Human MDDCs were infected with SeV Cantell HD and Sev Cantell LD for 6 h. The activated MDDCs were incubated with human naive CD4+ T cells in a 1 :5 ratio for 5 days. Supernatant from this culture was collected for ELISA. Human IFNy in the supernatant was measures by ELISA (eBiosciences) following manufacturer's instructions.
SeV DI particle purification
DI particle purification was performed as previously described [5]. In short, SeV Cantell (C) was grown at a dilution of 1 in 1000 in 10 days embryonated eggs for 40 h. Allantoid fluid from 100 eggs was pooled and concentrated by highspeed centrifugation. Pellets were suspended 0.5 ml of PBS/2 mM EDTA and incubated overnight at 4°C. A 5-45% sucrose (Fisher) gradient was prepared using the Gradient Master 107 gradient maker (BioComp). The virus suspension was added to the sucrose gradient and centrifuged at 4°C for 1.5 h at 28,000 rpm. The pellet, described to contain viral aggregates, was visible as were the bands representing high and low molecular density particles. The fraction containing low-density viral particles were collected, pelleted and suspended in PBS/2 mM EDTA prior to their application to a second 5-45% sucrose gradient. Gradients were centrifuged at 4°C for 1.5 h at 28,000 rpm; bands containing low density viral particles pooled and suspended in PBS/2 mM EDTA prior to concentration by centrifugation at 4°C for 2 h at 21,000 rpm. Pellets were suspended in PBS, snap frozen and stored at -80°C. Content of DI particles was determined by calculating the ratio of infectious over noninfectious particles as previously described [5], and confirmed by DVG PCR. Influenza virus UV inactivation IAV was fully inactivated fully inactivated by exposing 1/10 virus dilution to UV light for 10 min. UV light was positioned 6 inches over the virus solution. Virus solution was maintained at 4stirring throughout UV exposure. Complete inactivation was confirmed by establishing the virus inability to replicate in permissive cells. Partial inactivation of SeV 52 (LD) was achieved by exposing the diluted virus to UV light for 45 sec. In these conditions the virus vas not able to replicate productively, but viral proteins were expressed.
Immunizations, antibody measurement, and ELISPOT
BMDCs were treated with 2.5 g of fully UV-inactivated IAV for 24 h previous infection with partially inactivated SeV-52 in the presence or absence of 125 HA Units of purified DI particles. BMDCs were analyzed 2 h after SeV infection for gene expression by RTqPCR. 5 x 105 treated BMDCs were injected i.p. into mice. Immunized mice were bled 14 days post infection and sera was analyzed for the presence of anti-influenza virus total IgG by ELISA on plates coated with purified IAV. Mice were sacrificed at day 21 after immunization and CD8+ T cells were isolated from splenocytes using positive selection by magnetic beads (Miltenyi). T cells were co-cultured in an ELISPOT plate coated with anti-IFNy at a 1 :1 ratio with irradiated splenocytes isolated from naive mice and infected with IAV strain X-31 (H3N2). Plates were incubated for 24h before performing IFNy ELISA. Quantitative PCR
For RTqPCR 0.5-2.0 μg of RNA were reverse transcribed using High Capacity RNA-to-cDNA kit (Applied Biosystems). The cDNA was then diluted 1 :40 in water and qPCR assay were performed using SYBR Green PCR Master Mix (Applied Biosystems) in triplicate using the corresponding primers on Viia7 Applied Biosystems Lightcycler. Normalization was conducted based on levels of mouse Tuba lb and Rpsll or human Actb and human Tubal b. The following primer sequences were used: mouse rw& i6: / r-5'TGCCTTTGTGCACTGGTATG3', rev- 5 'CTGGAGCAGTTTGACGACAC3 ' ; mouse Rpsll: for-
5 ' CGTGACGAAGATGAAGATGC3 ' , rev-5 ' GCAC ATTGAATCGC AC AGTC3 ' ; mouse i «- ?.-/or-5'AGATGTCCTCAACTGCTCTC3', rev-
5 'AGATTCACTACC AGTCCCAG3 ' ; SeV Np for- 5 ' TGCCCTGGAAGATGAGTTAG3 ' , re v-5 ' GC CTGTTGGTTTGTGGT A AG3 ' ; human Tubalb: for-5'ACCTGTCACCCCGACTCA3', rev-
5 ' ATTGCCC ATCTGGAC ACCT3 ' ; human Actb: or-5AGAGCTACG AGCTGCCTGAC3 ' , rev-5 ' CGTGGATGCCACAGGACT3 '; human Ι/ηβ: for- 5 ' GTC AG AGTC GA A ATC CTAAG3', rev-5 'AC AGCATCTGCTGGTTGAAG3 ' .
Plasmids and constructs
A 591 nt long product containing the sequence of the T7 promoter followed by the 546-nucleotide long copy back DVG from SeV Cantell, and flanked by the restriction enzymes Spel and Sapl at the 3' an 5' ends was synthetically synthesized (DNA 2.0) and clone into the pSL1 180 vector (Amersham Pharmacia Biotech) containing the sequences for the hepatitis delta virus ribozyme and the T7 polymerase terminator.
In order to optimize the transcription of the DVG, 3 G residues were introduced downstream of the T7 promoter by site-directed mutagenesis (Stratagene, CA) using the oligonucleotides
5'CCACTAGTTAATACGACTCACTATAGGGACCAGACAAGAGTTTAAGAG- 3' and 5 'CTCTTAAACTCTTGTCTGGTCCCTATAGTGAGTCGTATTAACTAGTGG-3 '. To generate DVG mutants, restriction enzyme sites were introduced in the pSLl 180DVG-546 using the QuikChange II XL site-directed mutagenesis kit (Stratagene) following manufacturer instructions. A unique Bglll site was created by one base substitution to generate the mutant pSLl 180mDVG-546 (mDVG-546). This construct was used as template for the generation of all other mutants. To generate DVG-396 a BamHI restriction site was inserted at position 445 of the DVG sequence followed by digestion with Bglll and BamHI and ligation to delete 156-bp fragment from the DVG internal sequence (DVG nt 290-445). DVG-324 was generated by the introduction of a Kpnl site in the mDVG-546 sequence. A second Kpnl site at position 453 of the wild type DVG internal sequence allowed the deletion of 228 nt fragment between positions 226 and 453 of the DVG sequence. Rescue of recombinant virus
BSR-T7 cells were infected with partially inactivated SeV strain 52 at a multiplicity of infection (MOI) of 66. Virus inactivation was performed by exposing the diluted virus to U.V. light (254 nm model MRL-58, UVP Upland, CA) at for 53 sec at a distance of 9 inches from the light source. Cells were incubated at 37°C one hour before transfection of 3μg of plasmid encoding DVG. Transfection was performed with XtremeGENE transfection reagent (Roche) according to manufacturer instructions. Cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 1% bovine serum albumin, 2% NaC03, O^g/mL trypsin (Worthington) and 0.1% penicillin-streptomycin (Invitrogen) and incubated in 7% C02 at 37°C. Cells and supernatant were harvested after 48 h and 200μί of the suspension were inoculated in the allantoic cavity of 10-day embryonated hen eggs (B & E Eggs, Silver Springs, PA). After 40 hours allantoic fluid was harvest and 200μΕ of undiluted fluid were inoculate in 10-day embryonated eggs for virus growth and egg inoculation was repeated for three consecutive passages.
In vitro transcription
DVG-expressing plasmids were linearized and used as templates for in vitro transcription using the MEGAscript T7 kit (Ambion) following supplier instructions. 20 U of RNase inhibitor (Fermentas) were added to the reaction. Capped
RNA was synthesized using Cap Analog (m7G(5')ppp(5')G) (Ambion). All RNA reaction products were subjected to DNase treatment followed by LiCl precipitation. Integrity of the in vitro transcribed RNA was analyzed in an Agilent Bioanalyzer 2100 (Agilent Technologies). RNA dephosphorylation was carried out using FastAP thermosensitive alkaline phosphatase (Fermentas) according to manufacturer's instructions.
Transfections of ivt RNA
Mouse embryo fibroblasts (MEFs) were seeded in six well plates at 80- 85% confluence and 500ng of in vitro transcribe DVG RNA were transfected using Lipofectamine 2000 (Invitrogen) according to manufacturer instructions. LLCMK2 cells transfections were performed in 24 well plates and 250ng of in vitro transcribe DVG RNA were added.
Mice footpad infection C57BL/6 mice of 12-16 weeks of age were injected subcutaneously in both footpads with 50ug of in vitro transcribe RNA. After 36 hrs post injection mice were euthanized and the footpad tissue was harvest for RNA extraction. Trizol (Invitrogen) was used to extract RNA from homogenized footpad tissue for cytokine expression analysis. RNA injection was performed under anesthesia.
Statistical analysis
Statistical analyses were performed as indicated in each figure. GraphPad Prism version 5.00, GraphPad Software, San Diego California USA, www.graphpad.com, was used in most analyses. RESULTS
SeV DVGs particles enhance the ability of human and mouse DCs to activate adaptive immunity.
Stocks of SeV strain Cantell with a high content of particles bearing copy-back DVGs (SeV Cantell HD) were shown to efficiently induce the maturation of mouse and human DCs [6]. To test if SeV Cantell HD enhanced the ability of DCs to activate human T cells, human monocyte-derived DCs (MDDCs) were infected with SeV Cantell HD or SeV Cantell depleted of DVG-containing particles (LD) and placed in allogeneic co-cultures with purified human T cells. The presence of DVGs in the different SeV stocks was controlled by PCR in infected mouse bone marrow- derived DCs (Figure 1A). MDDCs infected with SeV Cantell HD expressed mRNA for the cytokines Ι/ηβ, 11-6, and Tnfa but those infected with SeV Cantell LD did not expressed these cytokines, despite similar degrees of expression of mRNA for the viral protein Np (Figure IB). IFNy was produced at high levels when CD4+ T cells were co-cultured with MDDCs infected with SeV Cantell HD, but not with SeV Cantell LD (Figure 1C). These results demonstrate that viral particles containing DVGs can be used to enhance DC-mediated activation of human T cells.
To evaluate whether DCs exposed to SeV DVGs show enhanced ability to trigger specific immunity in vivo, purified SeV defective particles containing DVGs (pDPs) were tested as immunostimulants on a model of DC immunization in mice. Bone marrow-derived DCs (BMDCs) were treated with UV-inactivated influenza virus (IAV) A/New Caledonia/20/99 (H1N1) as the antigen and these cells were exposed to either partially inactivated SeV Cantell LD alone, pDPs alone, or partially inactivated SeV Cantell LD plus pDPs (Figure ID). Partial inactivation of SeV Cantell LD rendered the virus unable to productively replicate, but capable of expressing virus proteins. In these conditions pDPs enhanced the expression of 11-12 mRNA by the SeV infected DCs, despite equivalent expression of SeV Np mRNA (Figure IE). Notably, pDPs alone trigger 11-12 mRNA expression despite only residual expression of SeV Np mRNA (Figure IE) confirming their inability to be transcribed and replicated in the absence of a helper virus. Mice immunized i.p. with BMDCs were sacrificed 21 days after immunization for analysis of the anti-IAV immune response. Remarkably, mice immunized with BMDCs treated with pDPs showed enhanced production of IgG antibodies against IA V (Figure 1 F) and higher frequency of anti-IAV specific IFNy-producing CD8+ T cells (Figure 1G) than control mice, independent of the presence of co-infecting virus. These results demonstrate that SeV DVGs can act as potent natural adjuvants for the induction of adaptive immunity in mice and humans.
Generation of a recombinant SeV DP with strong immunostimulatory activity
Copy-back DVGs cannot be transcribed due to properties of their promoters, therefore their stimulatory activity is likely provided only by elements of their genome. To evaluate whether a recombinant DVGs retained their ability to induce cytokine production, a highly efficient reverse genetics system for the modification and rescue of DI particles containing recombinant DVGs (rDP) was established. For this system, a copy-back DVG of 546 nucleotides (DVG-546) that was previously identified to be strongly immunostimulatory and the predominant DVG in laboratory stocks of SeV strain Cantell [8] was cloned under the control of the T7 polymerase promoter. This plasmid was transfected into cells expressing the T7 polymerase and infected with partially inactivated SeV strain 52 that provided the necessary proteins for virus replication and packaging after T7 transcription. SeV 52 does not produce highly immunostimulatory copy-bask DVGs [5], therefore all stimulatory activity is provided by the recombinant DVG. rDP particles were amplified in embryonated hen eggs (Figure 2A). Copy-back rDVGs were detectable by RTqPCR in virus stocks obtained after one passage in eggs (Figure 2B) and were enriched in subsequent passages as determined by the ratio between infectious (I) and total hemagglutinating viral particles (HA) in the allantoid fluid (I/HA) (Figure 2C). rDP particles maintained their ability to inhibit the replication of the helper virus, as determined by the reduced expression of the SeV protein NP in cells infected with rDP-containing allantoid fluid compared with cells infected with control Sev Cantell LD (Figure 2D). In addition, they maintained a strong ability to induce the expression of type I IFNs in infected cells (Figure 2E),
A restriction enzyme site was introduced in DVG-546 to generate a modified DVG 546 (mDVG-546) that would serve as the backbone for further modifications (Figure 2F). Modifications of DVG-546 were performed taking into account the "rule of six" that states than a length of an exact multiple of six nucleotides needs to be preserved to maintain optimal replication of paramyxovirus genomes [9]. mrDP particles preserved their strong stimulatory ability and induced ifn-β mRNA levels that were comparable with those induced by SeV Cantell (Figure 2G), demonstrating that the modified recombinant genome retained the immuno stimulatory activity of the parental SeV DVG. Naked DVG RNA maintains potent immunostimulatory activity in vitro
The use of infectious particles during vaccination raises a number of safety concerns. Therefore, the modified DVGs were evaluated to determine if they retained their immunostimulatory activity in the form of naked RNA. To do this, an in vitro transcribed (ivt)RNA was generated from a series of mutant DVGs generated from the mDVG-546 backbone (Figure 3A). Integrity of the itvRNA was confirmed by automated electrophoresis (Figure 3B). LLCMK2 cells transfected with the ivtRNAs were analyzed for ifn-β expression 6 h after transfection. As observed during infections, cells transfected with DVG-396 and DVG-324 RNA expressed higher relative copy numbers of ifn-β than the parental DVG RNA (Figure 3C). In general, the shorter DVG-324 shows enhanced immunostimulatory activity when transfected into cells in vitro as measured by the expression of type I IFNs, interferon stimulated genes and proinflammatory cytokines such as 11-12 and II- lb. Remarkably, DVG-354 failed to induce significant levels of ifn-β in transfected cells. These mutants have approximately the same size suggesting that SeV DVG recognition by viral RNA sensors is sequence dependent.
It has been established that a 5'-PPP motif on viral RNA is required for efficient recognition by intracellular viral sensors [10-14]. Adding a 5 'cap to DVG- 546 or treatment with calf intestinal phosphatase (CIP) significantly reduced the ability of this RNA to trigger ifn-β expression suggesting that RIG-I is a primary PAMP for the recognition of DVG-546 RNA. In addition, transfection of DVG-546 RNA into mouse embryo fibroblasts lacking RIG-I or the essential RLR signaling molecule MAVS demonstrated that naked DVG-derived RNA signals through this pathway (Figure 4). DVG-396 is less dependent on RIG-I and likely engages the related molecule MDA5 that also signals through MAVS.
DVG-derived naked RNA shows immunostimulatory activity in mice
Expression of pro-inflammatory cytokines, local inflammation, and DC activation and migration to the draining lymph nodes are hallmarks of adjuvant activity in vivo. To determine the immunostimulatory potential of DVG-derived RNA in vivo, mice footpads were injected with the different DVG mutant RNAs. As control the synthetic viral analog poly I:C was used. Expression of pro-inflammatory cytokines and DC activation was determined 36 h later from footpad tissue and the draining popliteal lymph node. Il-IB and 11-12 mRNA were expressed at high levels at the site of infection. Interestingly, the pattern of cytokines expressed by poly I:C and DVG-396 was different, suggesting distinct mechanisms for immuno stimulation (Figure 5A). In general, the shorter DVG-324 shows enhanced immunostimulatory activity when transfected into cells in vitro as measured by the expression of type I IFNs, interferon stimulated genes and of proinflammatory cytokines such as 11-12 and II- lb. Higher numbers of DCs were found in the popliteal lymph node of mice injected with DVG RNA than poly I:C (Figure 5B), confirming the potent immunostimulatory ability of DVG RNA in vivo. Additionally, injection with DVG- 324 RNA resulted in higher relative copy numbers of Il-β and 11-12 mRNA than the parental DVG RNA or DVG-396, confirming that sequence composition and structure are involved in effective immunostimulatory activity.
DISCUSSION
Viral-derived RNA oligonucleotides represent novel adjuvant candidates. Despite concerns related to RNA stability, several studies have demonstrated the successful use of naked RNA as therapy (Caskey M., et. al. "Synthetic double-stranded RNA induces innate immune responses similar to a live viral vaccine in humans," J Exp Med. 201 1 Nov 21 ; 208(12): 2357-66; Stahl-Hennig C, et al. "Synthetic double-stranded RNAs are adjuvants for the induction of T helper 1 and humoral immune responses to human papillomavirus in rhesus macaques," PLoS Pathog. 2009 Apr; 5(4). In addition, the synthetic viral RNA analog poly I:C has entered clinical trials as an anti-tumoral (Rosenfeld MR, et al. A multi-institution phase II study of poly-ICLC and radiotherapy with concurrent and adjuvant temozolomide in adults with newly diagnosed glioblastoma. Neuro Oncol. 2010 Oct; 12(10): 1071-7). Importantly, poly I:C has been shown to be safe in humans (Caskey M., et. al. Synthetic double-stranded RNA induces innate immune responses similar to a live viral vaccine in humans. J Exp Med. 201 1 Nov 21 ; 208(12): 2357-66), demonstrating the feasibility of using naked RNA as adjuvants. SeV DI particles stimulate the development of adaptive immune responses in mice and show enhanced ability to activate human DCs, supporting their potential as adjuvants.
An optimized SeV DVG-derived synthetic RNA of high immunostimulatory capacity was generated in vitro and in vivo that has several advantages over poly I:C. First, the commercial vaccine quality version of poly I:C is a mixed of molecules of multiple sizes and is poorly standardized, showing variable activity batch to batch. The immunostimulatory DVG RNA was generated from a plasmid leading to the reliable generation of identical immunostimulatory molecules. Second, the molecular characteristics responsible for the immunostimulatory ability of DVG-derived RNA are characterized in detail, leading to product optimization and modification, while it is impossible to do so for the variable mixture of poly I:C polymers. Third, DVG-derived RNA is shorter, and therefore cheaper to produce than poly I:C, a relevant consideration for the production of adjuvants.
By comparing DVG mutants of similar lengths, a region in the SeV DVG was identified that is essential for its activity. This sequence restriction was observed in the context of infectious viruses, as well as in transfected naked RNA, suggesting that in addition to the 5'PPP motif the sequence composition is relevant for effective RLR stimulation by natural viral agonists.
Interestingly, different inflammatory profiles were observed in vivo upon injection of poly I:C and DVG-derived RNA suggesting that these molecules engage at least partially different signaling pathways in mice. Poly I:C adjuvanticity relies mostly on TLR recognition in vivo (Lan T, et al. "Design of synthetic oligoribonucleotide-based agonists of Toll-like receptor 3 and their immune response profiles in vitro and in vivo," Org Biomol Chem. 2013 Feb 14;1 1(6): 1049-58; T Kawai and S Akira, " The role of pattern-recognition receptors in innate immunity: update on Toll-like receptors," Nature Immunology 1 1, 373-384) while DVGs stimulate mostly through RLRs (Baum A, Sachidanandam R, Garcia-Sastre A. "Preference of RIG-I for short viral RNA molecules in infected cells revealed by next-generation sequencing," Proc Natl Acad Sci U S A. 2010 Sep 14; 107(37): 16303-8; . Yount JS, Gitlin L, Moran TM, Lopez CB. MDA5 participates in the detection of paramyxovirus infection and is essential for the early activation of dendritic cells in response to Sendai Virus defective interfering particles. J Immunol. 2008 Apr 1 ; 180(7): 4910-8.). Notably, DVG-derived RNA induce higher expression of IL-Ιβ and result in a different profile of cytokine production compared to poly I:C. Therefore, RNA oligonucleotides derived from one of the most potent known natural viral RLR agonists, the SeV DVG, have immuno stimulatory activity and represent novel alternatives as potent adjuvants for vaccination.
EXAMPLE 2: DVG-DERIVED NAKED RNA SHOWS STRONG LOCALIZED PRO-INFLAMMATORY ACTIVITY IN MICE
The present example demonstrates that DVG-324 maintains strong stimulatory activity once injected as naked RNA into mouse skin. Compared to the only other RNA immunostimulant available, poly I:C, DVG-324 showed enhanced induction of IL-Ι β, a desired property in an effective adjuvant. In addition, DVG-324 induced more efficient migration of dendritic cells from the skin to the draining lymph nodes, supporting it as exhibiting a stronger ability to stimulate the immune system. Additionally, the present example demonstrates that DVG-324 promotes the development of adaptive immunity against a model vaccine, inactivated respiratory syncytial virus and enhanced the breadth of antibodies.
Mice were injected subcutaneously in the footpad with 50 μg of DVG-
324 or poly I:C (high molecular weight). Footpad tissue was harvested after 6 or 36 h and RNA was extracted for the analysis of cytokine expression.
For the analysis of tissue collected after 36 h, as described by the results shown in Figure 1 1 A, the experiment was independently repeated three times, and each assay was performed in triplicates. (Data shown is a compilation of all experiments, Total n = 8-11). As shown in Figure 1 1 A, DVG-324 increased cytokine expression compared to PBS control. For the analysis of tissue collected after 6 h, as described by the results shown in Figure 1 IB, the experiment was independently repeated two times. Each assay was performed in triplicates. Data shown is a compilation of all experiments (n = 4/group). Data are expressed as copy numbers relative to the housekeeping gene rpsll. As shown in Figure 1 IB, DVG-324 increased cytokine expression compared to PBS control.
Single cell suspensions from draining popliteal lymph nodes of the injected mice were analyzed by flow cytometry to characterize dendritic cells (DCs). Percentage of CDl lc+CDl lb+ cells from the live cell gate is shown. DVG-324 increased the percentage of CDl lc+CDl lb+ cells compared to Poly IC and control (Figure 1 1C, ** is pO.01 by one-way ANOVA with Bonferroni post-test (n = 2 for PBS and 5 for poly I:C and DVG 324)). CDl lc+CDl lb+ cells were further gated for expression of CD103 and B220 to quantify CD1 lc+CDl lb+CD103- DCs and CD1 lbloCDl lcloB220+ plasmacytoid DCs. Figure 1 1D shows a representative plot for poly I:C treatment and two representative plots for DVG-324 treatment.
Antibodies in the sera of Balb/c mice three weeks after immunization with a single i.m. dose of 180 μg of inactivated respiratory syncytial virus (inRSV) in the presence of 50 μg poly I:C, 50 μg DVG-324, or PBS. Sera pre-immunization (pre- bleed: PB) was also analyzed. Anti-RSV antibodies were measured using ELISA. As shown by Figure HE, combining DVG-324 with inRSV increased the production of antibodies compared to control or immunization with inRSV alone.
EXAMPLE 3: DVG-268 IS A POTENT IMM UNOSTl Mil LA TOR DVG RNA
A 268 nucleotide DVG was prepared (SEQ ID NO:4 and Figure 9). LLCMK2 cells were transfected with 500 ng of each of the in vitro transcribed RNAs (i.e., DVG-268, DVG-324 and DVG-546). IFNbeta production was determined by RTqPCR. Data show average of three independent experiments.
The immunostimulatory RNAs were tested in vitro and DVG-268 demonstrated a stronger ability to promote type I IFN production that DVG-324 and DVG-546 (Figure 10).
EXAMPLE 4: RNA MOTIFS CHARACTERIZED BY STRONG DVG
ACTIVITY Mutants DVGs were identified by their molecular weight and were classified as strong or weak stimulators based on their ability to induce ifnb expression upon transfection (i.e., as in vitro transcribed R A). Figure 12 shows the predicted folding structure of highly stimulatory (strong) and poorly stimulatory (weak) DVG mutants using the Vienna RNAfold software. Motifs conserved in the different molecules are ballooned and color-coded. The number of nucleotides from the 5' end of the molecule included in the modeling is indicated. Longer stretches could not be appropriately modeled due to the presence of long complementary ends that interfere with the folding prediction. Candidate immunostimulatory motif common to strong stimulatory DVGs is indicated with an arrow.
REFERENCES
[I] Xiao T. Innate immune recognition of nucleic acids. Immunol Res 2009; 43:98- 108.
[2] Kumar H, Kawai T, Akira S. Pathogen recognition by the innate immune system. Int Rev Immunol 201 1 ; 30: 16-34.
[3] Huang AS, Baltimore D. Defective viral particles and viral disease processes. Nature 1970; 226:325-327.
[4] Lazzarini RA, Keene JD, Schubert M. The origins of defective interfering particles of the negative- strand RNA viruses. Cell 1981 ; 26:145-154.
[5] Yount JS, Kraus TA, Horvath CM et al. A novel role for viral-defective interfering particles in enhancing dendritic cell maturation. J Immunol 2006;
177:4503-4513.
[6] Yount JS, Gitlin L, Moran TM, Lopez CB. MDA5 Participates in the Detection of Paramyxovirus Infection and Is Essential for the Early Activation of Dendritic Cells in Response to Sendai Virus Defective Interfering Particles. J Immunol 2008;
180:4910-4918.
[7] Baum A, Sachidanandam R, Garcia-Sastre A. Preference of RIG-I for short viral
RNA molecules in infected cells revealed by next-generation sequencing. Proc Natl
Acad Sci U S A 2010; 107: 16303-16308.
[8] Strahle L, Garcin D, Kolakofsky D. Sendai virus defective-interfering genomes and the activation of interferon-beta. Virology 2006; 351 : 101 - 1 1 1.
[9] Calain P, Roux L. The rule of six, a basic feature for efficient replication of Sendai virus defective interfering RNA. J Virol 1993; 67:4822-4830.
[10] Takahasi K, Yoneyama M, Nishihori T et al. Nonself RNA-sensing mechanism of RIG-I helicase and activation of antiviral immune responses. Mol Cell 2008;
29:428-440.
[I I] Lu C, Xu H, Ranjith-Kumar CT et al. The structural basis of 5' triphosphate double-stranded RNA recognition by RIG-I C-terminal domain. Structure 2010;
18: 1032-1043.
[12] Uzri D, Gehrke L. Nucleotide sequences and modifications that determine RIG- I/RNA binding and signaling activities. J Virol 2009; 83:4174-4184.
[13] Pichlmair A, Schulz O, Tan CP et al. RIG-I-mediated antiviral responses to single-stranded RNA bearing 5 '-phosphates. Science 2006; 314:997-1001. [14] Hornung V, Ellegast J, Kim S et al. 5 -Triphosphate RNA is the ligand for RIG-I. Science 2006; 314:994-997.
[15] Lopez CB, Yount JS, Hermesh T, Moran TM. Sendai virus infection induces efficient adaptive immunity independently of type I interferons. J Virol 2006;
80:4538-4545.
[16] Cotter CR, Nguyen ML, Yount JS et al. The virion host shut-off (vhs) protein blocks a TLR-independent pathway of herpes simplex virus type 1 recognition in human and mouse dendritic cells. PLoS One 2010; 5:e8684.
[17] Lopez CB, Fernandez-Sesma A, Schulman JL, Moran TM. Myeloid dendritic cells stimulate both Thl and Th2 immune responses depending on the nature of the antigen. J Interferon Cytokine Res 2001 ; 21 :763-773.
Various publications, patents, patent application, and GenBank Accession Nos. are cited herein, the contents of which are hereby incorporated by reference in their entireties.

Claims

1. A method for stimulating an immune response in a subject comprising administering to the subject at least one antigen in conjunction with a defective viral genome-derived RNA molecule capable of inducing an antigen specific immune response in the subject.
2. The method of claim 1, wherein the at least one antigen is selected from the group consisting of virus, bacterial, fungal, parasite, nucleotide, and peptide antigens.
3. The method of claim 1, wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO: l , or variants thereof having immunostimulatory activity.
4. The method of claim 1 , wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:2, or variants thereof having immunostimulatory activity.
5. The method of claim 1 , wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:3, or variants thereof having immunostimulatory activity.
6. The method of claim 1 , wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:4, or variants thereof having immunostimulatory activity.
7. The method of claim 1 , wherein the defective viral genome-derived RNA molecule comprises a structure as depicted in Figure 12.
8. The method of claim 1, wherein the defective viral genome-derived RNA molecule comprises at least one RNA motif as depicted in Figure 12.
9. The method of claim 1, wherein the subject has a tumor.
10. The method of claim 1 , wherein the subject is a human.
11. The method of claim 1, wherein the subject is a non-human mammal.
12. The method of claim 1, wherein the subject is a non-mammal.
13. The method of claim 12, wherein the non-mammal is a fish.
14. A method of activating an antigen presenting cell comprising contacting the cell with an antigen and a defective viral genome-derived RNA molecule capable of inducing an antigen specific immune response in the subject.
15. The method of claim 14, wherein the antigen presenting cell is isolated from a subject and activated ex vivo.
16. The method of claim 15, wherein the activated cell is reintroduced into the subject.
17. The method of claim 14, wherein the antigen presenting cell is a dendritic cell.
18. The method of claim 14, wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO: l, or variants thereof having immunostimulatory activity.
19. The method of claim 14, wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:2, or variants thereof having immunostimulatory activity.
20. The method of claim 14, wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:3, or variants thereof having immunostimulatory activity.
21. The method of claim 14, wherein the defective viral genome-derived RNA molecule comprises the nucleotide sequence of SEQ ID NO:4, or variants thereof having immunostimulatory activity.
22. The method of claim 14, wherein the defective viral genome-derived RNA molecule comprises a structure as depicted in Figure 12.
23. The method of claim 14, wherein the defective viral genome-derived RNA molecule comprises at least one RNA motif as depicted in Figure 12.
24. The method of claim 14, 15 or 16, wherein the at least one antigen is selected from the group consisting of virus, bacterial, fungal, parasite, nucleotide, and peptide antigens.
25. A pharmaceutical composition comprising an isolated defective viral genome- derived RNA molecule comprising the nucleotide sequence of SEQ ID NO: 1 , SEQ ID
NO:2, SEQ ID NO:3, or SEQ ID NO:4 or variants thereof having immunostimulatory activity, one or more antigens, and a pharmaceutically acceptable carrier.
26. A pharmaceutical composition comprising an isolated defective viral genome- derived RNA molecule comprising a structure as depicted in Figure 12, one or more antigens, and a pharmaceutically acceptable carrier.
27. A pharmaceutical composition comprising an isolated defective viral genome- derived RNA molecule comprising at least one RNA motif as depicted in Figure 12, one or more antigens, and a pharmaceutically acceptable carrier.
28. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO: l .
29. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO:2.
30. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO:3.
31. An isolated RNA molecule comprising the nucleotide sequence of SEQ ID NO:4.
32. An isolated RNA molecule comprising a structure as depicted in Figure 12.
33. An isolated RNA molecule comprising at least one RNA motif as depicted in Figure 12.
34. An isolated RNA molecule derived from a defective viral genome, wherein the RNA molecule has immunostimulatory activity.
PCT/US2014/025318 2013-03-15 2014-03-13 Methods and compositions for stimulating immune response WO2014151265A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201361794829P 2013-03-15 2013-03-15
US61/794,829 2013-03-15

Publications (1)

Publication Number Publication Date
WO2014151265A1 true WO2014151265A1 (en) 2014-09-25

Family

ID=51580919

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2014/025318 WO2014151265A1 (en) 2013-03-15 2014-03-13 Methods and compositions for stimulating immune response

Country Status (1)

Country Link
WO (1) WO2014151265A1 (en)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016179034A3 (en) * 2015-05-01 2016-12-15 The Trustees Of The University Of Pennsylvania Methods and compositions for stimulating immune response using potent immunostimulatory rna motifs
WO2022165313A1 (en) 2021-02-01 2022-08-04 Regenxbio Inc. Gene therapy for neuronal ceroid lipofuscinoses

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090304738A1 (en) * 2005-06-16 2009-12-10 Moran Thomas M Methods for Enhancing Immune Responses
WO2010123083A1 (en) * 2009-04-23 2010-10-28 国立大学法人北海道大学 Polypeptide derived from mouse hepatitis virus and/or polypeptide derived from sendai virus, test kit for infection by mouse hepatitis virus and/or sendai virus using the polypeptide, and method for detecting infection by mouse hepatitis virus and/or sendai virus

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20090304738A1 (en) * 2005-06-16 2009-12-10 Moran Thomas M Methods for Enhancing Immune Responses
WO2010123083A1 (en) * 2009-04-23 2010-10-28 国立大学法人北海道大学 Polypeptide derived from mouse hepatitis virus and/or polypeptide derived from sendai virus, test kit for infection by mouse hepatitis virus and/or sendai virus using the polypeptide, and method for detecting infection by mouse hepatitis virus and/or sendai virus

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016179034A3 (en) * 2015-05-01 2016-12-15 The Trustees Of The University Of Pennsylvania Methods and compositions for stimulating immune response using potent immunostimulatory rna motifs
US10624964B2 (en) 2015-05-01 2020-04-21 The Trustees Of The University Of Pennsylvania Methods and compositions for stimulating immune response using potent immunostimulatory RNA motifs
WO2022165313A1 (en) 2021-02-01 2022-08-04 Regenxbio Inc. Gene therapy for neuronal ceroid lipofuscinoses

Similar Documents

Publication Publication Date Title
US10329329B2 (en) Fusion proteins for promoting an immune response, nucleic acids encoding same, and methods of making and use thereof
US10624964B2 (en) Methods and compositions for stimulating immune response using potent immunostimulatory RNA motifs
RU2723328C2 (en) Vaccine against respiratory syncytial virus (rsv)
KR101255016B1 (en) Synergistic attenuation of vesicular stomatitis virus, vectors thereof and immunogenic compositions thereof
US20110305664A1 (en) Novel vaccines against multiple subtypes of influenza virus
ES2877160T3 (en) Formulation for RNA administration
JP2021505648A (en) Dika vaccine and immunogenic composition, and how to use them
CN113684219A (en) mRNA or mRNA composition, preparation method and application thereof
US20190292545A1 (en) 5&#39;-triphosphate oligoribonucleotides
US20090304738A1 (en) Methods for Enhancing Immune Responses
BR112020013974A2 (en) FORMULATION FOR RNA ADMINISTRATION
CN104968782A (en) Vaccine prepared utilizing human parainfluenza virus type 2 vector
CN103687942A (en) Virus-like particles and process for preparing same
CN117750974A (en) Viral vaccine
CN105143251A (en) Influenza nucleoprotein vaccines
Shi et al. The expression of membrane protein augments the specific responses induced by SARS-CoV nucleocapsid DNA immunization
WO2014151265A1 (en) Methods and compositions for stimulating immune response
MX2010012587A (en) Expression vector encoding alphavirus replicase and the use thereof as immunological adjuvant.
CN113573731A (en) Immunopotentiating adjuvant capable of being administered in combination with oil emulsion and foot and mouth disease vaccine composition comprising the same
AU2022322270A1 (en) Vaccine construct and uses thereof
Nouri-Shirazi et al. TLR3 and TLR7/8 agonists improve immunization outcome in nicotine exposed mice through different mechanisms
KR102211077B1 (en) A pseudo type rabies virus vaccine using virus-like particles
Lu et al. Enhanced protective immune response of foot-and-mouth disease vaccine through DNA-loaded virus-like particles
Neeli et al. Comparison of DNA vaccines with AS03 as an adjuvant and an mRNA vaccine against SARS-CoV-2
KR102654379B1 (en) Influenza vaccine composition based on novel nucleic acid

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 14770247

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 14770247

Country of ref document: EP

Kind code of ref document: A1