WO2016176501A1 - Methods of local induction of t regulatory cells - Google Patents

Abstract

The instant disclosure provides methods of locally increasing the number T regulatory (Treg) cells, in particular Foxp3-expressing Treg cells, in the damaged epithelium of a subject by administering to the subject an agonist of the hedgehog signaling pathway. Also provided are methods of preventing a condition associated with damaged epithelium by prophylactically inducing Foxp3 -expressing Treg cells by administering a Hedgehog pathway agonist in a subject at risk of developing such a condition. Also provided are pharmaceutical compositions and kits comprising Hedgehog agonists formulated for use in the described methods.

Description

METHODS OF LOCAL INDUCTION OF T REGULATORY CELLS

CROSS-REFERENCE

This application claims the benefit of U.S. Provisional Patent Application No. 62/154,493, filed April 29, 2015, which application is incorporated herein by reference in its entirety. BACKGROUND

Immune system dysregulation is a major contributor to various diseases and generally underlies the etiology of autoimmune disease. The immune system consists of activating components that respond to an immunogen to induce an immune response and regulatory components that, when present and activated, function antagonistically to repress the immune response and inhibit inflammation.

While also serving many other functions, epithelial tissues generally function as an organism’s physical barrier to infection and are thus particularly important locations for immune regulation. Without a rapid and robust immune response to a pathogenic foreign antigen at the epithelial site of infection a pathogen may spread unchecked to other parts of the body. However, an overly frequent or inappropriately strong response to a non-pathogenic antigen can lead to unnecessary persistent inflammation in an epithelial tissue that, while in itself presents a significant impact on quality-of-life and serious pathology, may also promote more critical conditions such as cancer.

As an example, the gastrointestinal (GI) tract represents the main surface by which an organism encounters exogenous antigens, including both those antigens ingested as part of the organism’s diet as well as those present on commensal bacteria. Under normal conditions, however, these antigens do not trigger inflammation. The lack of inflammation in the GI tract of healthy subjects is not due to a lack of pathogenicity in commensal bacteria, as evidenced by the opportunistic infections of commensal bacteria that are frequently seen in the GI tract of immuno- compromised individuals. Thus, the immune response in the GI tract must be tightly regulated. When dysregulated, as seen in e.g., the overly exuberant immune response in individuals with inflammatory bowel disease, chronic intestinal inflammation may be a major contributor to GI disease and, long- term, can lead to colorectal cancer.

Immune dysregulation leading to autoimmune disease is not limited to diseases of the GI tract and are also seen in other epithelial tissues such as the skin (e.g., psoriasis) and non-epithelial tissues such as connective tissue (e.g., rheumatoid arthritis), the pancreas (e.g., type 1 diabetes) and the central nervous system (e.g., multiple sclerosis). Immune dysregulation can arise naturally, as seen in the aforementioned diseases, but can also be provoked, e.g., as seen in graft vs. host disease.

Relative to autoimmune diseases, immune cells and particularly the CD4+ T cell population contain both activated, pathogenic T cells as well as regulatory T (Treg) cells. CD25+ has been identified as a marker of a T cell subset that this largely Treg but nonetheless contains some pathogenic T cells. The transcription factor Foxp3, identified from the mouse mutant“scurfy” that suffers a severe autoimmune syndrome similar to human IPEX (immune dysregulation, polyendocrinopathy, enteropathy, X-linked) syndrome which also manifests from a Foxp3 mutation, has been identified as a higher fidelity marker of immune-repressive Treg cells.

Accordingly, Foxp3+ Treg cells are important for maintaining immune system balance, particularly where the immune system has been activated by the presence of an exogenous antigen. Therefore, particularly in subjects suffering of immune dysregulation, increasing the presence of Foxp3+ Treg cells or the expression of Foxp3 in immature T cells or the activity of Foxp3+ cells is an attractive strategy for controlling aberrant inflammation associated with autoimmune disease. In vitro expansion and adoptive transfer of Treg cells has been investigated for the treatment of certain autoimmune conditions as has the administration of superagonistic anti-CD28 antibodies which promote Treg cell proliferation. Both are largely systemic treatments, the former requiring significant effort, time and risk to collect, expand and administer the cultured Treg cells and the latter producing adverse“cytokine storms” in early clinical trials (see Marshall (2006) Science. 311(5768):1688- 1689). Moreover, auto-inflammatory conditions do not uniformly display a decrease in Treg cells or irregular Treg cell function. On the contrary, whether Treg cell numbers are reduced in Type 1 Diabetes remains a point of controversy and in the case of inflammatory bowel disease the numbers of Treg cells are actually increased (see e.g., Buckner (2010) Nat Rev Immunology.10(12):849-859). Such findings indicate that generically supplying more Treg cells systemically may not necessarily provide a therapeutic benefit in all autoimmune diseases.

Alternative methods of increasing Foxp3+ Treg cell numbers and function the effectively treat or prevent autoimmune diseases are desirable. In addition, targeted therapies where Foxp3+ Treg cells are increased or otherwise activated at the primary site of inflammation may allow for local immune suppression while preventing adverse effects due to systemic immune response inhibition of less specific therapies. SUMMARY

The instant disclosure provides, among other things, methods of locally increasing the number T regulatory (Treg) cells, in particular Foxp3-expressing Treg cells, in the damaged epithelium of a subject by administering to the subject an agonist of the hedgehog signaling pathway. Also provided are methods of preventing a condition associated with damaged epithelium by prophylactically inducing Foxp3-expressing Treg cells by administering a Hedgehog pathway agonist in a subject at risk of developing such a condition. Also provided are pharmaceutical compositions and kits comprising Hedgehog agonists formulated for use in the described methods. BRIEF DESCRIPTION OF THE FIGURES

The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity. Included in the drawings are the following figures. FIG. 1A-H: Decreased Hh pathway response exacerbates acute dextran sulfate sodium (DSS)-induced colitis. FIG. 1A: Overview of acute DSS-induced colitis experiments. T indicates days of tamoxifen treatment, arrowheads indicate the day of colon harvest, colored bars indicate the duration of DSS exposure and XL-139 treatment. FIG. 1B: Confocal image shows the stromal localization of Gli1-expressing cells using an antibody that detects nuclear expression of ß- _{galactosidase in a Gli1} ^LacZ/+ mouse. Epithelial cells are detected with an anti-Epcam antibody. FIG. 1C: Confocal image of a colon section from a tamoxifen-treated Gli1^CreER/+; R26^mTmG/+ mouse shows Gli1-expressing cells, as marked by expression of membrane-associated GFP, in the lamina propria closely juxtaposed to colon crypt epithelial cells (anti-Epcam antibody). FIG. 1D-1E: Gli1^CreER/+;Smo^fl/fl animals versus Gli1^CreER/+;Smo^fl/+ controls showed a greater loss of total body weight [(FIG. 1D) day 10, 83.8% vs. 97.9% original body weight, *p < 0.0001] and more severe colitis by histologic grading [(FIG.1E) 2.7 vs.0.9, *p = 0.0004; see FIG.1H]. FIG.1F-1G: XL-139- treated animals versus vehicle treated controls showed a greater loss of total body weight [(FIG.1F) day 10, 90.5% vs.112.1% original body weight, *p < 0.0001] and more severe colitis [(FIG.1G) day 10, 2.3 vs. 0.3 severity score, *p < 0.0001]. FIG. 1H: Representative H&E stained cross-sections of distal colons from acute-DSS colitis experiments showing varying levels of colitis severity, as discussed in the text (also see Methods).

FIG. 2A-2G: Increased Hh pathway response ameliorates acute DSS-induced colitis. FIG. 2A: Overview of experiments. Arrowheads indicate day of colon harvest. Colored bars indicate the duration of DSS exposure. Dots indicate the timing of either vehicle or SAG21k doses. FIG. 2B: Ptch1^+/- animals show less severe colitis than Ptch1^+/+ controls (average severity scores 1.8 vs. 3.4, *p = 0.0104). FIG. 2C: Survival is increased in Ptch1^+/- versus Ptch1^+/+ animals following a 7 day period of DSS injury (90.9 vs. 54.5 % survival, *p = 0.0449, Log-rank test). FIG. 2D: Microarray heat map shows induction of Hh pathway targets in SAG21k (n = 3) versus vehicle (n = 3) treated mice during DSS injury. Comparison of expression levels in the two treatment groups reveals the following t-test p-values: Hhip 0.003, Igf1 0.001, Gli1 8.3 x 10^-6, Ptch1 0.004, Myocd 0.027. FIG. 2E: SAG21k treated FVB mice display less severe colitis than vehicle treated FVB controls (average severity score 0.62 versus 4.75, *p < 0.0001). FIG.2F: C57BL/6 mice treated with SAG21k showed less severe colitis than vehicle treated controls by histologic grading at Day 7 (average severity score 1.9 vs. 3.1, *p = 0.0197). SAG21k or vehicle treatment was started on Day 4. FIG. 2G: Representative H&E stains of distal colon show less severe colitis in SAG21k treated mice (right panels) compared to vehicle treated mice (left panels), from the experiment in FIG.1E.

FIG. 3A-3B. Hh responsive cells are distinct from CD45⁺ hematopoetic cells. FIG. 3A: Confocal images of colon sections from tamoxifen treated Gli1^CreER/+;R26^{LSL-ZsGreen1/+} mice which were either uninjured (left two panels) or injured with DSS (5% DSS of 5 days, followed by 5 days of normal drinking water). No overlap was detected between CD45⁺ hematopoetic cells and Gli1⁺ cells, marked by fluorescent ZsGreen protein expression. FIG. 3B: FACS plots showing the identification and isolation of three distinct populations of cells from colons of

were given tamoxifen, then treated with DSS and/or pharmacologic agents as labeled (see Methods and FIG. 4A). These populations are Gli1⁺ stromal cells (ZsGreen⁺), hematopoetic cells (CD45⁺) and epithelial cells (Epcam⁺, CD45-, ZsGreen-; lower left corner of each plot). The plots show no overlap of GFP⁺ stromal cells with CD45⁺ hematopoetic cells.

FIG.4A-4G: The protective effect of Hh response in colitis is mediated in part by increased IL-10 expression. FIG. 4A: Overview of experiments. Tamoxifen treatment (T), colon harvest (arrowheads), duration of DSS exposure (blue bars) and vehicle or SAG21k doses (dots) are shown. FIG. 4B: FACS plots showing the isolation of Hh-responsive GFP⁺ marked cells (boxed, right, in each plot) from colons of Gli1^CreER/+;R26^mTmG/+ mice that were given tamoxifen, then treated with vehicle or SAG21k (as schematized in FIG. 4A, top diagram; see Methods). FIG. 4C: Microarray heat map shows induction of Hh pathway targets as well as IL-10 in FACS purified Gli1⁺ (GFP⁺) cells from SAG21k (n = 3) versus vehicle (n = 3) treated Gli1^CreER/+;R26^mTmG/+ mice. Comparison of expression levels in the two treatment groups yielded the following t-test p-values: Hhip 0.039, Igf1 0.088, Myocd 0.049, Gli1 0.058, Ptch1 0.049, IL-10 0.009. FIG. 4D: IL-10 mRNA expression was 6.3-fold higher in FACS-purified GFP⁺ cells from non-injured mice given SAG21k versus vehicle. FIG.4E-4F: IL-10 expression in FACS-purified cell populations from DSS injured mice given either vehicle or SAG21k is shown. ND indicates no detection after 40 cycles of amplification. FIG. 4G: The colitis-reducing effect of SAG21k was decreased in IL-10^-/- mice (1.3 unit change in mean severity score; p = 0.0101) compared to wild-type C57BL/6 mice (4.0 unit change; p < 0.0001). IL- 10^-/- mice which did not receive DSS displayed a low background level of colitis (mean severity score 1.0).

FIG.5A-5J: Foxp3⁺ Treg levels in the colon are increased by Hh response as well as colitis. FIG.5A: Overview of experiments. Arrowheads indicate day of colon harvest. Colored bars indicate duration of DSS. Dots indicate drug doses. FIG.5B: The percentage of Foxp3⁺ cells within the CD4⁺ population increases during DSS injury [n = 8 mice (Day 0), n = 4 (other timepoints)]. Mean % of Foxp3⁺/CD4⁺ cells was 9.9 on Day 0 versus 45.8 on Day 10 (p < 0.0001). FIG. 5C: Representative flow plots (gated on CD4⁺ cells) show greatly increased % of Foxp3⁺ cells at Day 10 versus Day 0 of DSS injury. FIG. 5D: The percentage of CD4⁺ Foxp3⁺ Treg cells increase dramatically after DSS injury. FIG. 5E: Mean % of Foxp3⁺/CD4⁺ cells sharply increases at one day following SAG21k treatment (9.9, Day 0 versus 21.3, Day 1; p = 0.0011). Afterwards, Foxp3⁺ cells remain elevated through day 10 [n = 8 mice (Day 0), n = 4 (other timepoints)]. FIG. 5F: Representative flow plots show increased Foxp3⁺ cells at Day 1 following SAG21k treatment compared to Day 0 baseline levels. FIG. 5G: After a 10 day DSS-injury protocol, mice treated with SAG21k had a decreased percentage of CD4⁺ Foxp3⁺ Treg cells versus vehicle controls. FIG. 5H-5J: When a short course of SAG21k or vehicle was given during early DSS injury (FIG. 5A, bottom schema), colitis severity was minimal at all time points and there were no significant differences in treatment groups (FIG. 5H). In this context, SAG21k increased the percentage of CD4⁺ Foxp3⁺ Tregs, both within the CD4⁺ population (FIG.5I) as well as the population of total colon cells (FIG.5J).

FIG. 6A-6J: Hh response reduces tumor burden in colitis-associated cancer. FIG. 6A: Overview of AOM-DSS tumor induction studies. Colored bars indicate duration of exposure to DSS and Hh modulators, A denotes azoxymethane, T indicates days of tamoxifen treatment and arrowheads indicate day of colon harvest. FIG.6B: Colons from Ptch1^+/+ (n = 7) and Ptch1^+/- mice (n = 7). Distal colons are oriented towards the top. FIG. 6C: Ptch1^+/- mice develop reduced overall volume of colon tumors compared to Ptch1^+/+ controls. Each data point represents the total tumor volume. FIG.6D: Ptch1^+/- mice develop fewer discrete colon tumor foci than Ptch1^+/+ controls. FIG. 6E: Colons from FVB mice given vismodegib (n = 6), vehicle (n = 7) or SAG21k (n = 7). Similar to XL-139, vismodegib causes a strong suppression of Hh response (see Fig. S2c). Distal colons are oriented towards the bottom. FIG. 6F: The vismodegib group shows dramatically increased tumor volumes as compared to vehicle (242.0 mm³ vs 25.1 mm³ respectively, p = 0.0004), whereas the SAG21k group displays decreased tumor volumes (4.2 mm³ vs 25.1 mm³ respectively, p = 0.0168). FIG. 5G: Fewer discrete tumor foci are present in the SAG21k versus vehicle group, whereas in the vismodegib group the tumors were too large to distinguish and count. FIG. 5H: Colons from Gli^CreER/+;Smo^fl/fl (n = 6) and Gli1^CreER/+;Smo^flox/+ (n = 6). Distal colons are oriented towards the bottom. i, Two weeks after completion of DSS injury, just prior to administration of tamoxifen (Week 4), minimal or no colitis was detected in either Gli^CreER/+;Smo^fl/fl or Gli1^CreER/+;Smo^flox/+ groups. There was no significant difference in mean colitis severity scores. FIG. 5J: Gli^CreER/+;Smo^fl/fl mice develop an increased overall volume of colon tumors as compared to Gli1^CreER/+;Smo^flox/+ mice (p = 0.0093).

FIG.7A-7C: Gli1 mutant effects on colitis. FIG.7A: Overview of acute DSS-induced colitis experiments. Blue bars indicate the duration of DSS exposure and arrowheads indicate the day of colon harvest. FIG. 7B: Weights of Gli1^+/+, Gli1^LacZ/+ and Gli1^LacZ/LacZ mice exposed to 5% DSS for five days. No statistically significant differences were noted among the three groups at any time point. FIG. 7C: Fourteen-day survival of Gli1^LacZ/+ and Gli1^LacZ/LacZ as compared to Gli1^+/+ mice (40.5%, 44.7%, vs.61.5% survival, respectively). Contrary to expectation, the decreased survival and its statistical significance were greater for Gli1^LacZ/+ heterozygotes as compared to Gli1^LacZ/LacZ homozygotes Gli1 (p = 0.0346 vs. p = 0.1276, respectively).

FIG. 8A-8D: Quantitation of Hh pathway response by qRT-PCR. FIG. 8A: Gli1 mRNA levels were reduced 4.5 fold in colons of Gli1^CreER/+;Smo^fl/fl (n = 3) versus Gli1^CreER/+;Smo^fl/+ (n = 3) mice after administration of tamoxifen (*p = 0.0136). FIG.8B: Gli1 mRNA levels in colons of FVB mice given vehicle or XL-139 (n = 3 for each group). XL-139 was given by oral gavage at 72 hour intervals, with dose number and time interval between the last dose and colon harvest as indicated. Gli1 mRNA levels were reduced 15.6 fold in colons of mice given XL-139 (2 doses, 24 hours) versus vehicle (*p = 0.0026). FIG. 8C: Gli1 mRNA levels in colons of FVB mice given vehicle or vismodegib (n = 3 for each group). Vismodegib (100 mg/kg) or vehicle was given by oral gavage every 12 hours x 6 doses. Colons were harvested 4 hours after the last dose. Gli1 mRNA levels were reduced 7.8 fold in colons of mice given vismodegib versus vehicle (*p = 0.0019). FIG.8D: Relative expression of Gli1 mRNA in colons of FVB mice with increasing doses of SAG21k. Values on the X-axis indicate the dose in mg/kg given by intraperitoneal injection every 12 hours.

FIG. 9A-9C: Expression of Hh pathway targets and Ihh by SAG21k in whole colon. FIG. 9A: Relative expression of the Hh pathway genes Gli1, Ptch1, Hhip and Ihh in the colons of FVB mice treated as indicated (n = 3 for each treatment condition). HPRT expression was used for normalization. In the non-injury groups, either vehicle (PBS) or SAG21k (0.5 mg/kg) was given every 12 hours x 6 doses by i.p. injection, and colons were harvested 4 hours after the last dose. In the DSS injury groups, 5% DSS was given on days 0-5 and colons were harvested on day 10. Vehicle or SAG21k were given by i.p. injection every 12 hours on days -2 through 10, with the last dose given 4 hours prior to colon harvest. FIG. 9B: The expression of IL-10 was increased 1.9-fold in colons of FVB mice that received SAG21k versus vehicle during DSS injury (*p = 0.0274). DSS and drug treatments were as performed in the previous panel. FIG. 9C: Increased levels of IL-10 protein were detected by Luminex Assay in SAG21k versus vehicle treated animals with DSS injury (*p = 0.0459).

FIG. 10A-10L: Localization of Hh responsive cells in the colon. FIG. 10A: An X-gal stain of a colon section from a Gli1^LacZ/+ mouse shows Gli1-expressing cells in the lamina propria, muscularis mucosa, and muscularis propria. FIG. 10B: A confocal image of a colon section from a Gli1^CreER/+;R26^mTmG/+ mouse which received tamoxifen is shown. Hh responsive cells, marked by GFP expression, are confined to the stromal compartment. FIG.10C-10G: Confocal images of colon sections from tamoxifen treated Gli1^CreER/+;R26^{LSL-ZsGreen1/+} mice which received no DSS treatment. No overlap was detected between Gli1⁺ cells (marked by fluorescent ZsGreen protein expression) and various subsets of hematopetic cells expressing CD11c, CD11b, F4/80 or CD206. FIG. 10h: A colon section from a Gli1^LacZ/+ mouse shows no overlap of endothelial cells (anti-CD31 antibody) with Gli1⁺ stromal cells (anti ß-galactosidase antibody; staining is localized to the nucleus). FIG.10I- 10L, Confocal images of colon sections from tamoxifen treated Gli1^CreER/+;R26^{LSL-ZsGreen1/+} mice with DSS colitis. Tamoxifen was given prior to the start of DSS (schema shown in middle diagram of FIG. 4A). During colitis, there was no evidence of overlap between the Gli1⁺ cells (ZsGreen- expressing) and hematopoetic subsets expressing CD11c or CD11b. DETAILED DESCRIPTION

The instant disclosure provides methods of locally increasing the number T regulatory (Treg) cells, in particular Foxp3-expressing Treg cells, in the damaged epithelium of a subject by administering to the subject an agonist of the hedgehog signaling pathway. Also provided are methods of preventing a condition associated with damaged epithelium by prophylactically inducing Foxp3-expressing Treg cells by administering a Hedgehog pathway agonist in a subject at risk of developing such a condition. Also provided are pharmaceutical compositions and kits comprising Hedgehog agonists formulated for use in the described methods. The practice of the present invention will employ, unless otherwise indicated, conventional methods of pharmacology, chemistry, biochemistry, recombinant DNA techniques and immunology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., Handbook of Experimental Immunology, Vols. I-IV (D.M. Weir and C.C. Blackwell eds., Blackwell Scientific Publications); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In Enzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.).

All publications, patents and patent applications cited herein, whether supra or infra, are hereby incorporated by reference in their entireties.

Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. It is understood that the present disclosure supercedes any disclosure of an incorporated publication to the extent there is a contradiction.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible.

The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention. Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed Definitions

In describing the present invention, the following terms will be employed, and are intended to be defined as indicated below.

It must be noted that, as used in this specification and the appended claims, the singular forms“a”,“an” and“the” include plural referents unless the content clearly dictates otherwise. Thus, for example, reference to“an agonist” includes a mixture of two or more such agonists, and the like. The terms “recipient”, “individual”, “subject”, “host”, and “patient”, are used interchangeably herein and refer to any mammalian subject for whom diagnosis, treatment, or therapy is desired, particularly humans. "Mammal" for purposes of treatment refers to any animal classified as a mammal, including humans, domestic and farm animals, and zoo, sports, or pet animals, such as dogs, horses, cats, cows, sheep, goats, pigs, camels, etc. In some embodiments, the mammal is human. In some cases, the methods of the invention find use in experimental animals, in veterinary application, and in the development of animal models, including, but not limited to, rodents including mice, rats, and hamsters; and primates.

The terms“specific binding,”“specifically binds,” and the like, refer to non-covalent or covalent preferential binding to a molecule relative to other molecules or moieties in a solution or reaction mixture (e.g., an antibody specifically binds to a particular polypeptide or epitope relative to other available polypeptides). In some embodiments, the affinity of one molecule for another molecule to which it specifically binds is characterized by a K_D (dissociation constant) of 10^-5 M or less (e.g., 10^-6 M or less, 10^-7 M or less, 10^-8 M or less, 10^-9 M or less, 10^-10 M or less, 10^-11 M or less, 10^-12 M or less, 10^-13 M or less, 10^-14 M or less, 10^-15 M or less, or 10^-16 M or less). "Affinity" refers to the strength of binding, increased binding affinity being correlated with a lower K_D.

The terms "treatment", "treating", "treat" and the like are used herein to generally refer to obtaining a desired pharmacologic and/or physiologic effect. The effect can be prophylactic in terms of completely or partially preventing a disease or symptom(s) thereof and/or may be therapeutic in terms of a partial or complete stabilization or cure for a disease and/or adverse effect attributable to the disease. For example, a preventative treatment, i.e. a prophylactic treatment, may include a treatment that effectively prevents an epithelial inflammatory condition or a treatment that effectively prevents or controls progression of an epithelial inflammatory condition. In some instances, the treatment may result in a treatment response, such as a complete response or a partial response. The term“treatment" encompasses any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease and/or symptom(s) from occurring in a subject who may be predisposed to the disease or symptom(s) but has not yet been diagnosed as having it; (b) inhibiting the disease and/or symptom(s), i.e., arresting development of a disease and/or the associated symptoms; or (c) relieving the disease and the associated symptom(s), i.e., causing regression of the disease and/or symptom(s). Those in need of treatment can include those already afflicted (e.g., those with epithelial damage and/or inflammation) as well as those in which prevention is desired (e.g., those with increased susceptibility to epithelial damage; those suspected of having epithelial damage, those with an increased risk of developing epithelial damage; those with increased environmental exposure to epithelial damaging agents, those suspected of having a genetic or behavioral predisposition to epithelial damage; those with epithelial damage, those having results from screening indicating an increased risk of epithelial damage or inflammation, those having tested positive for a epithelial damage or inflammation related condition, those having tested positive for one or more biomarkers of epithelial damage and/or an epithelial inflammation related condition, etc.).

A therapeutic treatment is one in which the subject is afflicted prior to administration and a prophylactic treatment is one in which the subject is not afflicted prior to administration. In some embodiments, the subject has an increased likelihood of becoming afflicted or is suspected of having an increased likelihood of becoming afflicted (e.g., relative to a standard, e.g., relative to the average individual, e.g., a subject may have a genetic predisposition to cancer and/or a family history indicating increased risk of cancer), in which case the treatment can be a prophylactic treatment. A“biological sample” encompasses a variety of sample types obtained from an individual and can be used in an assessment (e.g., a diagnostic or monitoring assay). The definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as

polynucleotides or polypeptides. The term“biological sample” encompasses a clinical sample, and also includes cells in culture, cell supernatants, cell lysates, serum, plasma, biological fluid, and tissue samples. Where appropriate, the term“biological sample” includes urine, saliva, cerebrospinal fluid, interstitial fluid, ocular fluid, synovial fluid, blood fractions such as plasma and serum, and the like. The term“biological sample” also includes solid tissue samples, tissue culture samples, and cellular samples.

The term“assessing” includes any form of measurement, and includes determining if an element is present or not. The terms“determining”,“measuring”,“evaluating”,“assessing” and “assaying” are used interchangeably and include quantitative and qualitative determinations.

Assessing may be relative or absolute.“Assessing the presence of” includes determining the amount of something present, and/or determining whether it is present or absent. As used herein, the terms “determining,”“measuring,” and“assessing,” and“assaying” are used interchangeably and include both quantitative and qualitative determinations. Before describing the present invention in detail, it is to be understood that this invention is not limited to particular formulations or process parameters as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments of the invention only, and is not intended to be limiting. METHODS AND COMPOSITIONS

Aspects of the disclosure include inducing T regulatory (Treg) cells through the administration of a Hedgehog (Hh) signaling pathway agonist to a subject having a condition associated with damaged epithelium or at risk of developing a condition associated with damaged epithelium. Methods of the instant disclosure include where the Treg cells are induced locally within and/or near the damaged epithelium of the subject to locally treat a condition associated with the damaged epithelium.

The terms“induction” and“induce” as used herein, particularly when referring to Treg cells, generally refers to increasing or enhancing the overall function of the cells that are induced, including where the overall function may be increased or enhanced by increasing the number of the subject cells or increasing the function of the subject cells, e.g., by increasing the number of Treg cells or increasing the function of Treg cells. Inducing an increase in the number or the function of a cell type need not be mutually exclusive and, in some cases, such inducing may result in an increase in both the number and the function of an induced cell type.

Local increases in cell number may manifest in various ways including e.g., an increase in proliferation of the particular cell type at the location, an increase in the differentiation of other cells into the particular cell type at the location, an increase in migration of the particular cell type (or cells fated to differentiate into the particular cell type) to the location. Local increases in the function of a particular cell type may manifest in various ways including e.g., a local increase in the expression level of a particular gene causing or correlated to the particular function in the subject cells, a local inhibition of one or more cellular functions or behaviors that interfere with or detract from the cellular function to be increased, etc.

The instant disclosure arises, at least in part, from the discovery that Treg cells can be locally induced, in subjects with epithelial damage or at risk thereof, by administering to the subject a Hh agonist. Specifically, without being bound by theory, Hh agonists were found to induce the expression of the cytokine, IL10, in stromal cells accompanying the epithelium, which expression subsequently induced the maintenance of Foxp3 expression in Treg cells in the epithelium. Specifically, Hh agonist was found to provide both an IL-10 dependent and IL-10 independent reduction in the severity of epithelial autoimmune disease models. Moreover, the effect of the Hh agonist, namely, the reduction in the severity of autoimmune disease, was found to not be due to activation of Hh pathway signaling in hematopoietic cell types.

Accordingly, the instant disclosure provides, in certain embodiments, methods of inducing Foxp3-expressing Treg cells, locally within damaged epithelium, by administering a Hh agonist, where the Hh agonist acts upon Hh responsive stromal cells and the Hh stimulated stromal cells then generate IL-10 which induces Treg cells. In certain embodiments, the instant disclosure also provides methods wherein Foxp3-expressing Treg cells are induced by a Hh agonist through an IL-10- independent mechanism. The mechanisms of Treg cell induction, whether IL-10 dependent or independent, are not necessarily mutually exclusive and, while certain methods may be solely IL-10 dependent or solely IL-10 independent, in many instances a method will involve both IL-10 dependent or independent induction of Treg cells.

As would be recognized, not all of the effect of administering the Hh agonist may be mediated by IL-10 or by induction of Treg cells. As such, in some embodiments, the effect of administering the Hh agonist may be mediated by an IL-10 Treg induction-independent pathway. As such, in some embodiments, the method may comprise administering to a subject having a condition characterized by a damaged epithelium or at risk thereof a Hedgehog (Hh) agonist in an amount effective to treat the damaged epithelium in the absence of a local increase the number of Foxp3- expressing Treg cells in the damaged epithelium. Stromal cells may, in certain cases, be referred to herein as“Hh-responsive cells” where the subject stromal cells react to an administered Hh agonist, generally but not exclusively to result in the release of a Treg cell altering cytokine from the Hh-responsive cell. Stromal cells of the subject disclosure will vary depending on e.g., the particular tissue to be treated including e.g., the particular epithelial tissue to be treated, and may include epithelial-associated stromal cells, including but not limited to e.g., intestinal stromal cells, skin stromal cells, and the like. In some instances, intestinal stromal cells may express one or more intestinal stromal cell markers including but not limited to e.g., collagen, vimentin, alpha-smooth muscle actin (ĮSMA), prostaglandin-E₂, CD90, and the like. In some instances, intestinal stromal cells may be identified, at least in part, based on the absence of one or more markers including the absence of one or more hematopoietic markers. Markers which may be used to identify stromal cells based on the absence of such markers may include but are not limited to e.g., CD45, CD31, CD11b, CD11c, F4/80, CD206, and the like. In some instances, stromal cells may be identified based on a combination markers including e.g., a combination of makers that are present and absent including but not limited to e.g., CD90+, ĮSMA+, CD45í and CD31í and/or any combination of the markers herein described.

Treg cells of the instant disclosure may likewise vary and may include but are not limited to CD4+ Treg cells. In some instances, Treg cells of the instant disclosure may include CD4+, CD25+ Treg cells. In some instances, Treg cells of the instant disclosure may include CD4+, CD25+, Foxp3+ Treg cells. In some instances, Tregs may be further characterized based on expression of Helios, an Ikaros family transcription factor, e.g., as described in Himmel et al. (2013) J Immunol. 190(5):2001-8; the disclosure of which is incorporated herein by reference.

The presence of immune cell surface markers (e.g., CD3, CD4, CD8, CD25, etc.) may be readily detected, on Treg cells and/or other relevant immune cell types, through the use of an antibody and subsequent detection of the bound antibody by a variety of means including e.g., immunofluorescence microscopy, flow cytometry, etc. The presence of internal (e.g., cytosolically expressed, nuclearly transported factors, etc.) markers (e.g., cytokine markers (e.g., interferon gamma (IFNȖ), tumor necrosis factor alpha (TNFĮ), IL-22, IL-17, IL-4, IL-13, IL-10, IL-2, etc.), proliferation markers (e.g., Ki67, etc.), Foxp3, Helios, etc.) may be detected by a variety of means including but not limited to e.g., detection of the expressed protein (e.g., through immunofluorescence microscopy) or the mRNA encoding the protein (e.g., through in situ hybridization, through quantitative PCR (qPCR), through quantitative sequencing, etc.). In some instances, the presence and/or functionality of Treg cells may be determined in vitro, e.g., through in vitro reactivity with activated (i.e., antigen-specific) T cells, etc. In some instances, analysis of immune cells may be performed by flow cytometry essentially as described by Bowcutt et al. (2015) J Immunol Methods. 421: 27–35; the disclosure of which is incorporated herein by reference in its entirety. Assessments may, in certain instances, include histological or cytological assessments, cytokine assessments (including e.g., an enzyme-linked immunosorbent assay (ELISA) assay, including e.g., ELISA for a single cytokine or a cytokine ELISA panel and the like).

Assessments

In addition to the administration of Hh agonists, described in more detail below, the methods of the instant disclosure also include, in certain instances, assessing Treg cells of the subject. Treg cells may be measured before treatment with a Hh agonist is initiated, e.g., to identify a subject that is in need of treatment to induce Treg cells. Treg cells may also be measured during treatment with a Hh agonist, e.g., to monitor therapy. Treg cells may also be measured following treatment with a Hh agonist, e.g., to evaluate the effectiveness of a completed course of treatment, to determine whether treatment should be stopped, etc. Treg cells may be assessed globally, e.g., by assessing Treg cells of the blood. Treg cells may also be assessed locally, e.g., by measuring Treg cells in a biological sample obtained from an affected area of the subject.

In certain instances, the effectiveness of a therapy including the administration of a Hh agonist as described herein may include monitoring the level of Treg cells during and following the treatment where, e.g., a decrease in Treg cells towards the end of therapy or following the therapy may be indicative of a reduction in the severity of the condition. In other instances, monitoring the effectiveness of a therapy including the administration of a Hh agonist as described herein may include monitoring the level of Treg cells near the beginning of therapy where a short-term increase in local Treg cells and/or local Foxp3 expression in Treg cells may be indicative of effective therapy.

Global and local Treg cell assessments of the instant disclosure may provide different information for evaluating various aspects of treatment. For example, global and local Treg cell assessments provide different information as to whether a subject should be treated with a Hh agonist, where global assessments may provide a readout of a subject’s overall level of immune suppression and local assessments may provide a readout of a subject’s level of immune suppression in an affected tissue. In some instances, although a subject has an abnormal local level of immune suppression (e.g., a level indicative of disease) within an affected tissue the subject may nonetheless have a global level of immune suppression that may be essentially normal or not indicative of disease. In other instances, a subject with an abnormal local level of immune suppression within an affected tissue may also have a global level of immune suppression that is abnormal. Abnormal levels of immune suppression may be abnormally high (i.e., elevated) or may be abnormally low (e.g., lowered), e.g., as compared to an appropriate healthy control. In certain cases, a subject may have an abnormally low level of immune suppression in an affected tissue including e.g., where the subject has an abnormally low number of Treg cells in the affected tissue and/or abnormally low Treg cell activity in the affected tissue. In certain cases, a subject may have an abnormally high level of immune suppression in an affected tissue including e.g., where the subject has an abnormally high number of Treg cells in the affected tissue and/or abnormally high Treg cell activity in the affected tissue. In certain cases, a subject may have an abnormally high level of global immune suppression including e.g., where the subject has an abnormally high number of Treg cells in a peripheral blood sample obtained from the subject and/or abnormally high Treg cell activity in a peripheral blood sample obtained from the subject. In certain cases, a subject may have an abnormally low level of global immune suppression including e.g., where the subject has an abnormally low number of Treg cells in a peripheral blood sample obtained from the subject and/or abnormally low Treg cell activity in a peripheral blood sample obtained from the subject. The level of immune suppression, either global or local, need not necessarily be abnormal and may, in some cases, be essentially normal. For example, when a subject is being treated prophylactically a subject may have a level of immune suppression (e.g., as measured by evaluating Treg cells of subject) that is essentially normal, including where the level of immune suppression is evaluated globally and/or locally.

In certain instances, a subject with epithelial damage may have an elevated level of immune suppression in the affected tissue; however, the elevated level may not be sufficient to suppress local inflammation in the affected tissue. For example, in some instances, a subject may have inflammatory bowel disease (IBD) characterized by an elevated level of local immune suppression (e.g., as measured by the number or activity of Treg cells locally in the affected tissue) insufficient to suppress inflammation in the affected area of the bowel, requiring further inducement of immune suppression in the bowel to treat the subject’s IBD. In some instances, a subject may have colitis characterized by an elevated level of local immune suppression (e.g., as measured by the number or activity of Treg cells locally in the affected tissue) insufficient to suppress inflammation in the affected area, requiring further inducement of immune suppression to treat the subject’s colitis. In some instances, a subject may have Crohn’s disease characterized by an elevated level of local immune suppression (e.g., as measured by the number or activity of Treg cells locally in the affected tissue) insufficient to suppress inflammation in the affected area, requiring further inducement of immune suppression to treat the subject’s Crohn’s disease.

In certain instances, a subject with epithelial damage may have a lowered level of immune suppression in the affected tissue resulting in chronic inflammation of the tissue. For example, in some instances, a subject may have psoriasis characterized by an increase in the conversion of Treg cells to proinflammatory T cells, resulting in a reduced number of Treg cells in the affected tissue (see e.g., Bovenschen et al. (2011) Invest Dermatol. 131(9):1853-60; the disclosure of which is incorporated herein by reference it its entirety). In some instances, a subject with epithelial damage may have lowered global levels of immune suppression contributing to chronic inflammation of an affected tissue, e.g., as observed in psoriasis (see e.g., Yan et al. (2010) Br J Dermatol. 163:48-56; the disclosure of which is incorporated herein by reference it its entirety).

Assessments of levels of immune suppression, whether global or local, may involve measuring the absolute levels of Treg cells or may involve measuring relative levels of immune cells including but not limited to e.g., the level of Treg cells relative to the total T cell population, the level of Treg cells relative to the total CD4+ T cell population, the level of CD25+ Treg cells relative to the level of CD25í Treg cells, the level of Foxp3+ Treg cells relative to the level of Foxp3í Treg cells, and the like. In some instances, a measurement of the relative levels of immunosuppressive cells may include measurement of a plurality of immune cell populations (e.g., Treg cells, CD4+ T cells, NK cells, CD8+ T cells, B cells, etc.) including but not limited to 2 or more immune cell populations, 3 or more immune cell populations, 4 or more immune cell populations, 5 or more immune cell populations, 6 or more immune cell populations, etc. Measurements of a plurality of immune cell populations of the instant disclosure will generally include measurement of at least one Treg cell population including but not limited to e.g., CD4+ Treg cells, CD4+CD25+ Treg cells, CD4+CD25+FOXP3+ Treg cells, and the like. Relative levels of different populations of immune cells may be assessed by any convenient method, including e.g., those described above, and may, in certain instances, be assessed by flow cytometry.

Assessments of immune suppression may be performed on any useful and relevant biological sample obtained from the affected tissue or an organ/tissue neighboring the affected tissue. For example, as described above, global assessments of immune cells, including assessments of immune suppression, may be performed on peripheral blood obtained from a subject.

In some instances, an assessment of local immune activity, including assessments of local immune suppression, may be performed using a biological sample obtained from an affected area of the subject. Useful biological samples include but are not limited to e.g., biopsy specimens of affected tissue but not limited to e.g., a skin biopsy or an intestinal biopsy (e.g., a colon biopsy, a small intestine biopsy, a rectal biopsy, etc.), etc. In certain instances, useful biological samples in a subject having IBD include but are not limited to e.g., a lamina propria mucosal biopsy (e.g., as described by Bowcutt et al. (2010) J Immunol Methods. 421: 27–35; the disclosure of which is incorporated herein by reference in its entirety), a mesenteric lymph node biopsy (Eberhardson et al. (2008) Eur J Gastroenterol Hepatol. 20(10):985-8, the disclosure of which is incorporated herein by reference in its entirety), and the like. In some instances, a useful sample of affected tissue in IBD is obtained during a colonoscopy. In other instances, e.g., where the subject has psoriasis useful samples may include but are not limited to a skin punch biopsy.

Subjects

Subjects of the instant disclosure to which a Hh agonist may be administered, as described herein, generally include subjects having, subjects suspected of having and subjects at risk of having damaged epithelium. Such subjects include but are not limited to e.g., subjects having or suspected of having or at risk of developing IBD (including e.g., colitis and Crohn’s disease) or subjects having or suspected of having or at risk of developing psoriasis. In instances where the subject is a subject having or suspected of having or at risk of developing IBD the affected are will generally be a portion of the colon and/or small intestine including but not limited to e.g., the rectum, the sigmoid colon, the descending colon, the transverse colon, the ascending colon, the cecum, the duodenum, the jejunum, the ileum, or a combination thereof. In instances where the subject is a subject having or suspected of having or at risk of developing Crohn’s disease the affected are will generally include the ileocecal region, however Crohn’s disease may in certain cases affect any region of the gastrointestinal (GI) tract. In instances where the subject is a subject having or suspected of having or at risk of developing colitis (e.g., ulcerative colitis) the affected are will generally include the rectum, the sigmoid colon, the descending colon, the transverse colon, the ascending colon, and/or the ileum.

Subjects suspected of having or at risk of having a damaged epithelium may include e.g., those subjects that are asymptomatic but have an elevated risk of any of the aforementioned conditions. An elevated risk may be due to a variety of factors including but not limited to a genetic predisposition to the condition, increased exposure to an agent known to increase risk of developing a condition, a previous diagnosis or treatment for the condition or a secondary condition associated the primary condition, an associated medical event, and the like. In one example, an associated medical event may include an impending or past transplant, e.g., a bone marrow transplant. For example, in some instances a subject having an elevated risk for an auto-inflammatory condition may e a subject having undergone a bone-marrow or stem cell transplant and may thus be at risk of developing graft versus host disease (GVHD).

Treatments of subjects at risk of developing GVHD may include the prophylactic administration of a Hh agonist to the subject before, during or after a bone marrow or stem cell transplant. In some instances, the transplant donor may be administered a Hh agonist prior to collection of the donor tissue as a part of a treatment to prevent GVHD in a subject receiving the donor tissue.

Subjects treated according to the methods of the instant disclosure may have altered levels of basal Hh pathway activity in the affected tissue. For example, in some instances, a subject treated with a Hh agonist, as described herein, is a subject having a decreased level of Hh activity as measured by one or more Hh pathway readouts including e.g., expression of Gli1, expression of Ptch1, expression of Hhip, and the like. Basal Hh activity, as assessed by the expression of one or more Hh pathway readouts, may be measured by any convenient method including but not limited to e.g., measuring the expression in a biological sample obtained from the subject, including where the measuring is qualitative (e.g., as measured by staining including e.g., in situ hybridization, immunofluorescence, etc.) or quantitative (e.g., as measured by qPCR, quantitative sequencing, etc.).

In some instances, subjects of the instant disclosure may include those subjects having had their basal Hh pathway activity artificially lowered, e.g., through receiving systemic treatment with one or more Hh antagonists. Subjects having received systemic treatment with one or more Hh antagonists and in need of local treatment with one or more Hh agonists according to the methods as described herein may in some instances display one or more symptoms of epithelial damage including but not limited to one or more symptoms of intestinal epithelial damage including but not limited to e.g., diarrhea, weight-loss, etc. In some instances, a subject receiving a Hh antagonist is a subject having cancer and being treated with a Hh antagonist for the cancer. In some instances, a subject receiving a Hh antagonist may include but is not limited to e.g., those subjects undergoing treatment for basal cell carcinoma (BCC) that includes receiving a Hh antagonist.

Administration

Aspects of the instant disclosure include administering a Hh agonist to a subject having a condition associated with epithelial damage to treat the subject for the condition. Hh agonists may also be administered to subjects at risk of developing a condition associated with damaged epithelium and, as such, the administering may be performed to prevent development of the condition or decrease the severity of the condition once developed.

Hh agonists useful in methods of the instant disclosure include agents that promote the Hh signaling pathway resulting in the signaling outcomes consistent with the presence of one or more Hh signaling ligands including but not limited to Hh, sonic hedgehog (Shh), indian hedgehog (Ihh), desert hedgehog (Dhh), and the like. All Hh ligands are synthesized as precursor proteins that undergo autocatalytic cleavage and concomitant cholesterol modification at the carboxy terminus and palmitoylation at the amino terminus, resulting in a secreted, dually-lipidated protein. Hh ligands are released from the cell surface through the combined actions of Dispatched and Scube2, and subsequently trafficked over multiple cells through interactions with the cell surface proteins LRP2 and the Glypican family of heparan sulfate proteoglycans (GPC1-6).

Hh proteins initiate signaling through binding to the canonical receptor Patched (PTCH1) and to the co-receptors GAS1, CDON and BOC. Hh binding to PTCH1 results in derepression of the GPCR-like protein Smoothened (SMO) that results in SMO accumulation in cilia and phosphorylation of its cytoplasmic tail. SMO mediates downstream signal transduction that includes dissociation of GLI proteins (the transcriptional effectors of the Hh pathway) from kinesin-family protein, Kif7, and the key intracellular Hh pathway regulator SUFU.

GLI proteins also traffic through cilia and in the absence of Hh signaling are sequestered by SUFU and Kif7, allowing for GLI phosphorylation by PKA, GSK3ȕ and CK1, and subsequent processing into transcriptional repressors (through cleavage of the carboxy-terminus) or targeting for degradation (mediated by the E3 ubiquitin ligase ȕ-TrCP). In response to activation of Hh signaling, GLI proteins are differentially phopshorylated and processed into transcriptional activators that induce expression of Hh target genes, many of which are components of the pathway (e.g. PTCH1 and GLI1). Feedback mechanisms include the induction of Hh pathway antagonists (PTCH1, PTCH2 and Hhip1) that interfere with Hh ligand function, and GLI protein degradation mediated by the E3 ubiquitin ligase adaptor protein, SPOP. For review see Beachy et al. (2010) Genes Dev. 24(18):2001–12; Eaton S (2008) Nat. Rev. Mol. Cell Biol.9(6):437–45; Hui et al. (2011) Annu. Rev. Cell Dev. Biol. 27: 513–37; Ingham et al. (2011) Nat. Rev. Genet. 12(6):393–406; Ng et al. (2011) Nat. Rev. Cancer 11(7):493–501; Wilson et al. (2010) Development 137(13):2079–94; Teglund et al. (2010) Biochim. Biophys. Acta 1805(2):181–208; Briscoe et al. (2013) Nat. Rev. Mol. Cell Biol. 14(7):416–29; Goetz et al. (2010) Nat. Rev. Genet. 11(5):331–44 and Falkenstein et al. (2014) Semin. Cell Dev. Biol. 33:73–80; the disclosures of which are incorporated herein by reference in their entireties.

Accordingly, methods of the instant disclosure that include treating a condition associated with damaged epithelium include treating the subject condition by activation of Hh signaling, e.g., through increasing or activating or stabilizing a Hh, e.g., by promoting Hh mRNA expression or promoting Hh protein expression, or by increasing or activating or stabilizing a gene or gene product that promotes Hh signaling or by inhibiting or repressing a gene or gene product that inhibits Hh signaling. Increasing Hh and/or activation of Hh signaling in a subject may be achieved by any convenient method including but not limited to, e.g., increasing of Hh expression (e.g., by altering the Hh genomic locus, by altering the locus of Hh repressive genes, through the use of interfering nucleic acids targeting Hh repressive components of the Hh pathway, etc.), activation of Hh pathway component function (e.g., through the use of small molecule Hh agonists and/or Hh pathway agonists, through the use of peptide or polypeptide Hh agonists and/or Hh pathway agonists, through the use of Hh and/or Hh pathway agonistic antibodies, etc.), through direct supplementation of Hh polypeptide or fragments thereof (e.g., including naturally occurring Hh peptide or synthetic Hh peptide or fragments thereof, etc.), through indirect supplementation of Hh polypeptide or fragments thereof (e.g., by providing nucleic acids that encode for Hh polypeptides, Hh-like polypeptides, or fragments thereof, etc.) and the like.

In some instances, an agent that promotes Hh signaling includes small molecule Hh agonists. Hh agonists useful as agents administered in the instantly disclosed methods, as described herein, include but are not limited to agents that directly affect Hh signaling through interaction with one or more members of the Hh signaling pathway including, e.g., Hh agonists that target SMO. Exemplary Hh agonists include but are not limited to, e.g., benzothiophene smoothened agonists (a family of biaryl substituted 1,4-diaminocyclohexanamides of 3-chlorobenzothiophene-2-carboxylic acids), SAG (Hh-Ag1.3) agonists (e.g., 3-chloro-N-[(1r,4r)-4-(methylamino)cyclohexyl]-N-[3-(pyridin-4- yl)benzyl]benzo[b]thiophene-2-carboxamide, including SAG21k; see, e.g., Bragina et al Neurosci. Lett.2010 482: 81–5, Heine et al, Sci Transl Med 2011 3 (105); Das et al Sci Transl Med 52013: 201ra120), oxysterols (see, e.g., Nachtergaele Nat Chem Biol. 2012 Jan 8;8(2):211-20, US20150118277 and US 20150140059) purmorphamine (Sinha Nature Chemical Biology 2, 29 - 30 (2006) , those agents and methods of derivation described in, e.g., Brunton et al. (2009) Bioorg Med Chem Lett. 19(15):4308–4311; Chen et al. (2002) PNAS. 99(22):14071-14076; Frank-Kamenetsky, et al. (2002) J Biol.1(2):10; Paladini et al. (2005) J Invest Dermatol.125(4):638-46; Nakamura et al. (2014) J Cell. Physiol. ePub; U.S. Patent Nos: 8,852,937; 7,479,539; 7,115,653; 6,683,192; 6,683,108; 6,639,051; 6,613,798, U.S. Patent Application Pub. Nos: 20130085096; 20120238500; 20120148549; 20100183560; 20080207740; 20080171328; 20070110698; 20050112125; 20050070578; 20050054568; 20050014796; 20030139457; 20030022819; 20020198236, and the like; the disclosures of which are incorporated by reference herein in their entirety.

Smoothened agonists may be synthetic non-peptidyl small molecule smoothened agonists. In some instances, a smoothened agonist may be a biaryl substituted 1,4-diaminocyclohexanamides of 3-chlorobenzothiophene-2-carboxylic acid or a derivative thereof. In some instances, a smoothened agonist useful in the method as described herein is SAG21K.

According to the methods as described herein an effective amount of a Hh agonist may be administered to a subject having a condition as described above in order to treat the subject for the condition. In some instances, an effective dose may be the human equivalent dose (HED) of a twice daily dose administered to a mouse ranging from less than 0.05 mg/kg to more than 5 mg/kg, including but not limited to 0.05 mg/kg to 5 mg/kg, 0.1 mg/kg to 5 mg/kg, 0.2 mg/kg to 5 mg/kg, 0.3 mg/kg to 5 mg/kg, 0.4 mg/kg to 5 mg/kg, 0.5 mg/kg to 5 mg/kg, 0.6 mg/kg to 5 mg/kg, 0.7 mg/kg to 5 mg/kg, 0.8 mg/kg to 5 mg/kg, 0.9 mg/kg to 5 mg/kg, 1 mg/kg to 5 mg/kg, 1.1 mg/kg to 5 mg/kg, 1.2 mg/kg to 5 mg/kg, 1.3 mg/kg to 5 mg/kg, 1.4 mg/kg to 5 mg/kg, 1.5 mg/kg to 5 mg/kg, 1.6 mg/kg to 5 mg/kg, 1.7 mg/kg to 5 mg/kg, 1.8 mg/kg to 5 mg/kg, 1.9 mg/kg to 5 mg/kg, 2 mg/kg to 5 mg/kg, 2.1 mg/kg to 5 mg/kg, 2.2 mg/kg to 5 mg/kg, 2.3 mg/kg to 5 mg/kg, 2.4 mg/kg to 5 mg/kg, 2.5 mg/kg to 5 mg/kg, 2.6 mg/kg to 5 mg/kg, 2.7 mg/kg to 5 mg/kg, 2.8 mg/kg to 5 mg/kg, 2.9 mg/kg to 5 mg/kg, 3 mg/kg to 5 mg/kg, 0.05 mg/kg to 3 mg/kg, 0.05 mg/kg to 2.9 mg/kg, 0.05 mg/kg to 2.8 mg/kg, 0.05 mg/kg to 2.7 mg/kg, 0.05 mg/kg to 2.6 mg/kg, 0.05 mg/kg to 2.5 mg/kg, 0.05 mg/kg to 2.4 mg/kg, 0.05 mg/kg to 2.3 mg/kg, 0.05 mg/kg to 2.2 mg/kg, 0.05 mg/kg to 2.1 mg/kg, 0.05 mg/kg to 2 mg/kg, 0.05 mg/kg to 1.9 mg/kg, 0.05 mg/kg to 1.8 mg/kg, 0.05 mg/kg to 1.7 mg/kg, 0.05 mg/kg to 1.6 mg/kg, 0.05 mg/kg to 1.5 mg/kg, 0.05 mg/kg to 1.4 mg/kg, 0.05 mg/kg to 1.3 mg/kg, 0.05 mg/kg to 1.2 mg/kg, 0.05 mg/kg to 1.1 mg/kg, 0.05 mg/kg to 1 mg/kg, 0.05 mg/kg to 0.9 mg/kg, 0.05 mg/kg to 0.8 mg/kg, 0.05 mg/kg to 0.7 mg/kg, 0.05 mg/kg to 0.6 mg/kg, 0.05 mg/kg to 0.5 mg/kg, 0.05 mg/kg to 0.4 mg/kg, 0.05 mg/kg to 0.3 mg/kg, 0.05 mg/kg to 0.2 mg/kg, 0.05 mg/kg to 0.1 mg/kg, 0.1 mg/kg to 1 mg/kg, 0.2 mg/kg to 0.9 mg/kg, 0.3 mg/kg to 0.8 mg/kg, 0.4 mg/kg to 0.7 mg/kg, a dose of 0.1 mg/kg, a dose of 0.2 mg/kg, a dose of 0.3 mg/kg, a dose of 0.4 mg/kg, a dose of 0.5 mg/kg, a dose of 0.6 mg/kg, a dose of 0.7 mg/kg, a dose of 0.8 mg/kg, a dose of 0.9 mg/kg, a dose of 1 mg/kg, etc. In some instances, the total amount contained in twice daily doses may be administered once daily. Conversion of an animal dose to human equivalent doses (HED) may, in some instances, be performed using the conversion table and/ or algorithm provided by the U.S. Department of Health and Human Services, Food and Drug Administration, Center for Drug Evaluation and Research (CDER) in, e.g., Guidance for Industry: Estimating the Maximum Safe Starting Dose in Initial Clinical Trials for Therapeutics in Adult Healthy Volunteers (2005) Food and Drug Administration, 5600 Fishers Lane, Rockville, MD 20857; (available at www(dot)fda(dot)gov/cder/guidance/index(dot)htm, the disclosure of which is incorporated herein by reference). Table 1: Conversion of Animal Doses to Human Equivalent Doses Based on Body Surface Area

^a ssumes g uman. For spec es not ste or or we g ts outs e t e stan ar ranges, HED can be calculated from the following formula:

HED = animal dose in mg/kg x (animal weight in kg/human weight in kg)0.33.

b This km value is provided for reference only since healthy children will rarely be volunteers for phase 1 trials.

c For example, cynomolgus, rhesus, and stumptail. In some instances, an effective amount of a Hh agonist administered to a human may be a daily dose ranging from 0.008 mg/kg to 0.8 mg/kg including but not limited to e.g., 0.008 mg/kg to 0.8 mg/kg, 0.01 mg/kg to 0.78 mg/kg, 0.012 mg/kg to 0.76 mg/kg, 0.014 mg/kg to 0.74 mg/kg, 0.016 mg/kg to 0.72 mg/kg, 0.018 mg/kg to 0.7 mg/kg, 0.02 mg/kg to 0.68 mg/kg, 0.022 mg/kg to 0.66 mg/kg, 0.024 mg/kg to 0.64 mg/kg, 0.026 mg/kg to 0.62 mg/kg, 0.028 mg/kg to 0.6 mg/kg, 0.03 mg/kg to 0.58 mg/kg, 0.032 mg/kg to 0.56 mg/kg, 0.034 mg/kg to 0.54 mg/kg, 0.036 mg/kg to 0.52 mg/kg, 0.038 mg/kg to 0.5 mg/kg, 0.04 mg/kg to 0.48 mg/kg, 0.042 mg/kg to 0.46 mg/kg, 0.044 mg/kg to 0.44 mg/kg, 0.046 mg/kg to 0.42 mg/kg, 0.048 mg/kg to 0.4 mg/kg, 0.05 mg/kg to 0.38 mg/kg, 0.052 mg/kg to 0.36 mg/kg, 0.054 mg/kg to 0.34 mg/kg, 0.056 mg/kg to 0.32 mg/kg, 0.058 mg/kg to 0.3 mg/kg, 0.06 mg/kg to 0.28 mg/kg, 0.062 mg/kg to 0.26 mg/kg, 0.064 mg/kg to 0.24 mg/kg, 0.066 mg/kg to 0.22 mg/kg, 0.068 mg/kg to 0.2 mg/kg, 0.07 mg/kg to 0.18 mg/kg, 0.072 mg/kg to 0.16 mg/kg, 0.074 mg/kg to 0.14 mg/kg, 0.076 mg/kg to 0.12 mg/kg, 0.078 mg/kg to 0.1 mg/kg, 0.01 mg/kg, 0.02 mg/kg, 0.03 mg/kg, 0.04 mg/kg, 0.05 mg/kg, 0.06 mg/kg, 0.07 mg/kg, 0.08 mg/kg, 0.09 mg/kg, 0.1 mg/kg, 0.11 mg/kg, 0.12 mg/kg, 0.13 mg/kg, 0.14 mg/kg, 0.15 mg/kg, 0.16 mg/kg, etc. An effective amount of a Hh agonist contained in a daily dose may be split and administered in multiple daily doses including but not limited to e.g., twice daily doses, three times per day, etc.

In some instances, an effective dose of a Hh agonist as described herein may be co- administered with one or more additional agents. Additional agents useful in such co-administration include agents that improve the overall effectiveness of the effective dose of the Hh agonist or decrease the dose of the Hh agonist necessary to achieve an effect essentially equal to administration of an effective dose of the Hh agonist without the additional agent. Non-limiting examples of additional agents that may be co-administered with a Hh agonist according to the methods described herein include but are not limited to e.g., those agents used in the treatment of subject conditions including but not limited to e.g., immunosuppressive agents, steroids, etc. and those additional agents described herein.

Treatments of subjects according to the instantly described methods may include combination treatments, e.g., where a subject is administered a Hh agonist in combination with one or more immunosuppressive therapies including but not limited to e.g., administration of an immunosuppressant, a steroid or a combination thereof.

In some instances, a subject with IBD is administered a Hh agonist as described herein in combination with one or more treatments for IBD including but not limited to e.g., one or more anti- inflammatory reagents (e.g., one or more aminosalicylates, one or more corticosteroids, etc.), one or more immune system repressors (e.g., azathioprine (Azasan, Imuran), mercaptopurine (Purinethol, Purixan), cyclosporine (Gengraf, Neoral, Sandimmune), Infliximab (Remicade), adalimumab (Humira), golimumab (Simponi), Methotrexate (Rheumatrex), natalizumab (Tysabri), vedolizumab (Entyvio), ustekinumab (Stelara), etc.) combinations thereof and the like. Treatments for IBD may further include additional agents such as but not limited to e.g., antibiotics, anti-diarrheal medications, pain relievers, iron supplements, vitamin B-12 supplements, calcium supplements, vitamin D supplements, combinations thereof and the like. In some instances, therapies for IBD may further include surgical treatments.

In some instances, a subject with psoriasis is administered a Hh agonist as described herein in combination with one or more treatments for psoriasis including but not limited to e.g., salicylic acid, steroid-based creams, calcipotriene, coal-tar ointments and shampoos, retinoids, methotrexate, cyclosporine, oral retinoids, etanercept (Enbrel), adalimumab (Humira), ustekinumab (Stelara), combinations thereof and the like. In some instances, treatments for psoriasis may further include light/photo therapy.

The terms "co-administration" and "in combination with" include the administration of two or more therapeutic agents either simultaneously, concurrently or sequentially within no specific time limits. In one embodiment, the agents are present in the cell or in the subject's body at the same time or exert their biological or therapeutic effect at the same time. In one embodiment, the therapeutic agents are in the same composition or unit dosage form. In other embodiments, the therapeutic agents are in separate compositions or unit dosage forms. In certain embodiments, a first agent can be administered prior to (e.g., minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks before), concomitantly with, or subsequent to (e.g., 5 minutes, 15 minutes, 30 minutes, 45 minutes, 1 hour, 2 hours, 4 hours, 6 hours, 12 hours, 24 hours, 48 hours, 72 hours, 96 hours, 1 week, 2 weeks, 3 weeks, 4 weeks, 5 weeks, 6 weeks, 8 weeks, or 12 weeks after) the administration of a second therapeutic agent.

The route of administration may be selected according to a variety of factors including, but not necessarily limited to, the condition to be treated, the formulation and/or device used, the patient to be treated, and the like. Routes of administration useful in the disclosed methods include but are not limited to oral and parenteral routes, such as intravenous (iv), intraperitoneal (ip), rectal, topical, ophthalmic, nasal, and transdermal. Pharmaceutical compositions formulated for particular routes of delivery are described in more detail elsewhere herein.

An effective amount of a subject compound will depend, at least, on the particular method of use, the subject being treated, the severity of the affliction, and the manner of administration of the therapeutic composition. A "therapeutically effective amount" of a composition is a quantity of a specified compound sufficient to achieve a desired effect in a subject being treated.

Therapeutically effective doses of a subject compound or pharmaceutical composition can be determined by one of skill in the art, with a goal of achieving local (e.g., tissue) concentrations that are at least as high as the IC50 of an applicable compound disclosed herein.

The specific dose level and frequency of dosage for any particular subject may be varied and will depend upon a variety of factors, including the activity of the subject compound, the metabolic stability and length of action of that compound, the age, body weight, general health, sex and diet of the subject, mode and time of administration, rate of excretion, drug combination, and severity of the condition of the host undergoing therapy.

Aspects of the instant disclosure include local administration of a Hh agonist to locally induce Treg cells in an affected tissue of the subject. Accordingly, in certain instances, a composition for use in the described methods may be specifically formulated according to the affected area of the subject. For example, where the affected area of the subject is the skin (e.g., as in a subject having psoriasis) a composition comprising a Hh agonist may be specifically formulated for topical delivery to the skin of the subject. In other instances, e.g., where the affected area of the subject is the GI tract of the subject, including but not limited to e.g., the colon or small intestine (e.g., as in IBD), a composition comprising a Hh agonist may be specifically formulated for enteric delivery to the GI tract, including e.g., specifically formulated for enteric delivery to the small intestine, enteric delivery to the colon of the subject, etc.

In some instances, a Hh agonist formulated for local delivery may be administered prophylactically to prevent the occurance of one or more symptoms associated with treatment for a condition that is not associated with epithelial damage and/or is not a condition described herein that may be treated by administration of a Hh agonist. For example, in some instances, a subject being treated a Hh antagonists may be prophylactically and locally administered a Hh agonist to prevent one or more side-effects of the Hh antagonists treatment. For example, in some instances, a subject receiving treatment with a systemic Hh antagonists may be administered a Hh agonist formulated for delivery to the GI tract (e.g., enteric coated) to prevent one or more side-effects of the Hh antagonist including but not limited to e.g., diarrhea, weight-loss, etc. In some instances, a subject receiving a bone marrow transplant or other stem cell treatment may be prophylactically and locally administered a Hh agonist to prevent one or more side-effects of the bone marrow transplant or other stem cell treatment, including but not limited to e.g., GVHD.

Pharmaceutical Compositions

Aspects of the instant disclosure include pharmaceutical compositions for performing one or more of the methods described herein where at a minimum such a pharmaceutical composition will include a Hh agonist appropriately formulated for administration as described herein.

A pharmaceutical composition comprising a subject compound may be administered to a patient alone, or in combination with other supplementary active agents. The pharmaceutical compositions may be manufactured using any of a variety of processes, including, without limitation, conventional mixing, dissolving, granulating, dragee-making, levigating, emulsifying, encapsulating, entrapping, and lyophilizing. The pharmaceutical composition can take any of a variety of forms including, without limitation, a sterile solution, suspension, emulsion, lyophilisate, tablet, pill, pellet, capsule, powder, syrup, elixir or any other dosage form suitable for administration.

A subject compound may be administered to the host using any convenient means capable of resulting in the desired reduction in disease condition or symptom. Thus, a subject compound can be incorporated into a variety of formulations for therapeutic administration. More particularly, a subject compound can be formulated into pharmaceutical compositions by combination with appropriate pharmaceutically acceptable carriers or diluents, and may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, etc.

Formulations for pharmaceutical compositions are well known in the art. For example, Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, Pa., 19th Edition, 1995, describes exemplary formulations (and components thereof) suitable for pharmaceutical delivery of disclosed compounds. Pharmaceutical compositions comprising at least one of the subject compounds can be formulated for use in human or veterinary medicine. Particular formulations of a disclosed pharmaceutical composition may depend, for example, on the mode of administration and/or on the location of the infection to be treated. In some embodiments, formulations include a pharmaceutically acceptable carrier in addition to at least one active ingredient, such as a subject compound. In other embodiments, other medicinal or pharmaceutical agents, for example, with similar, related or complementary effects on the affliction being treated can also be included as active ingredients in a pharmaceutical composition.

Pharmaceutically acceptable carriers useful for the disclosed methods and compositions are conventional in the art. The nature of a pharmaceutical carrier will depend on the particular mode of administration being employed. For example, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (e.g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically neutral carriers, pharmaceutical compositions to be administered can optionally contain minor amounts of non-toxic auxiliary substances (e.g., excipients), such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like; for example, sodium acetate or sorbitan monolaurate. Other non-limiting excipients include, nonionic solubilizers, such as cremophor, or proteins, such as human serum albumin or plasma preparations.

Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates and/or polyanhydrides; and (22) other non-toxic compatible substances employed in pharmaceutical formulations.

The disclosed pharmaceutical compositions may be formulated as a pharmaceutically acceptable salt of a disclosed compound. Pharmaceutically acceptable salts are non-toxic salts of a free base form of a compound that possesses the desired pharmacological activity of the free base. These salts may be derived from inorganic or organic acids. Non-limiting examples of suitable inorganic acids are hydrochloric acid, nitric acid, hydrobromic acid, sulfuric acid, hydroiodic acid, and phosphoric acid. Non-limiting examples of suitable organic acids are acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, malonic acid, succinic acid, malic acid, maleic acid, fumaric acid, tartaric acid, citric acid, benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, p-toluenesulfonic acid, methyl sulfonic acid, salicylic acid, formic acid, trichloroacetic acid, trifluoroacetic acid, gluconic acid, asparagic acid, aspartic acid, benzenesulfonic acid, p-toluenesulfonic acid, naphthalenesulfonic acid, and the like. Lists of other suitable pharmaceutically acceptable salts are found in Remington's Pharmaceutical Sciences, 17th Edition, Mack Publishing Company, Easton, Pa., 1985. A pharmaceutically acceptable salt may also serve to adjust the osmotic pressure of the composition.

A subject compound can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents. Such preparations can be used for oral administration.

A subject compound can be formulated into preparations for injection by dissolving, suspending or emulsifying them in an aqueous or nonaqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives. The preparation may also be emulsified or the active ingredient encapsulated in liposome vehicles. Formulations suitable for injection can be administered by an intravitreal, intraocular, intramuscular, subcutaneous, sublingual, or other route of administration, e.g., injection into the gum tissue or other oral tissue. Such formulations are also suitable for topical administration.

In some embodiments, a subject compound can be delivered by a continuous delivery system. The term "continuous delivery system" is used interchangeably herein with "controlled delivery system" and encompasses continuous (e.g., controlled) delivery devices (e.g., pumps) in combination with catheters, injection devices, and the like, a wide variety of which are known in the art.

Furthermore, a subject compound can be made into suppositories by mixing with a variety of bases such as emulsifying bases or water-soluble bases. A subject compound can be administered rectally via a suppository. The suppository can include vehicles such as cocoa butter, carbowaxes and polyethylene glycols, which melt at body temperature, yet are solidified at room temperature. In some instances, a suppository formulation may be specifically configured for local administration to the rectum epithelium of a subject. Formulations for local administration by suppository to a rectal epithelium may be configured to deliver an effective amount of the subject Hh agonist only to the rectal epithelium of a subject. For example, a composition may be configured to deliver an effective amount of the Hh agonist to a rectal epithelium and, upon subsequent diffusion, the amount of the Hh agonist present in surrounding and/or distant tissues essentially does not activate the Hh pathway sufficiently to produce any measureable or clinically significant effect.

The term "unit dosage form," as used herein, refers to physically discrete units suitable as unitary dosages for human and animal subjects, each unit containing a predetermined quantity of a subject compound calculated in an amount sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for a subject compound depend on the particular compound employed and the effect to be achieved, and the pharmacodynamics associated with each compound in the host.

The dosage form of a disclosed pharmaceutical composition will be determined by the mode of administration chosen. For example, in addition to injectable fluids, topical or oral dosage forms may be employed. Topical preparations may include eye drops, ointments, sprays and the like. In some instances, a topical preparation of a medicament useful in the methods described herein may include, e.g., an ointment preparation that includes one or more excipients including, e.g., mineral oil, paraffin, propylene carbonate, white petrolatum, white wax and the like, in addition to one or more additional active agents.

Oral formulations may be liquid (e.g., syrups, solutions or suspensions), or solid (e.g., powders, pills, tablets, or capsules). Methods of preparing such dosage forms are known, or will be apparent, to those skilled in the art.

In some instances, a formulation for local delivery within the GI tract will be formulated for oral delivery and include an enteric coating. Such enteric coatings will include one or more specific coatings that prevent release and absorption of the Hh agonist until the Hh agonist reaches the intestine. Useful enteric coatings, depending on the site of local delivery, will vary and may include e.g., those described in e.g., Hussan et al. (2012) IOSR Journal of Pharmacy.2(6):5-11; Caillard et al. (2016) Int J Pharm. 499(1-2):321-9; Macchi et al. (2015) Eur J Pharm Sci. 70:1-11; and U.S. Patent Nos.: 8846087; 7425342; 7217429; 6455052; 6420473; 6254889; 6139875; 5888550; 5882715; 5851579; 5837291; 5750104; 5723151; 4606771; 4547571; 4518433; 4462839; 4385078; 4377568; 4287221; the disclosures of which are incorporated herein by reference in their entirety.

In some instances, an enteric coated formulation may be specifically configured for local administration to the small intestine and/or colon epithelium of a subject. Formulations for local administration by enterically coated oral administration to a small intestine and/or colon epithelium may be configured to deliver an effective amount of the subject Hh agonist only to the small intestine and/or colon epithelium of a subject. For example, a composition may be configured to deliver an effective amount of the Hh agonist to a small intestine and/or colon epithelium and, upon subsequent diffusion, the amount of the Hh agonist present in surrounding and/or distant tissues essentially does not activate the Hh pathway sufficiently to produce any measureable or clinically significant effect.

Certain embodiments of the pharmaceutical compositions comprising a subject compound may be formulated in unit dosage form suitable for individual administration of precise dosages. The amount of active ingredient administered will depend on the subject being treated, the severity of the affliction, and the manner of administration, and is known to those skilled in the art. Within these bounds, the formulation to be administered will contain a quantity of the extracts or compounds disclosed herein in an amount effective to achieve the desired effect in the subject being treated.

Each therapeutic compound can independently be in any dosage form, such as those described herein, and can also be administered in various ways, as described herein. For example, the compounds may be formulated together, in a single dosage unit (that is, combined together in one form such as capsule, tablet, powder, or liquid, etc.) as a combination product. Alternatively, when not formulated together in a single dosage unit, an individual subject compound may be administered at the same time as another therapeutic compound or sequentially, in any order thereof. KITS

Also provided are kits for use in the subject methods. The subject kits include any combination of components and compositions for performing the subject methods. In some embodiments, a kit can include the following: a Hh agonist pharmaceutical composition with or without any additional agent as described herein, a pharmaceutical application device or delivery device; and any combination thereof.

In addition to the above components, the subject kits may further include (in certain embodiments) instructions for practicing the subject methods. These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, and the like. Yet another form of these instructions is a computer readable medium, e.g., diskette, compact disk (CD), flash drive, and the like, on which the information has been recorded. Yet another form of these instructions that may be present is a website address which may be used via the internet to access the information at a removed site. EXAMPLES

The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Celsius, and pressure is at or near atmospheric. Standard abbreviations may be used, e.g., room temperature (RT); base pairs (bp); kilobases (kb); picoliters (pl); seconds (s or sec); minutes (m or min); hours (h or hr); days (d); weeks (wk or wks); nanoliters (nl); microliters (ul); milliliters (ml); liters (L); nanograms (ng); micrograms (ug); milligrams (mg); grams ((g), in the context of mass); kilograms (kg); equivalents of the force of gravity ((g), in the context of centrifugation); nanomolar (nM); micromolar (uM), millimolar (mM); molar (M); amino acids (aa); kilobases (kb); base pairs (bp); nucleotides (nt); intramuscular (i.m.); intraperitoneal (i.p.); subcutaneous (s.c.); and the like. Example 1: Stromal Hedgehog pathway activation suppresses colitis and colitis-associated adenocarcinoma Materials and Methods

Mouse strains

FVB mice were obtained from Charles Rivers. The following strains were obtained from Jackson Labs: Wild type C57BL/6 (stock # 000664), IL-10^-/- C57BL/6 mice (stock # 002251), R26^{ZsGreen1/ZsGreen1} (stock # 007906), R26^mTmG/mTmG (stock # 07576), Smo^fl/fl (stock # 04526). Ptch^+/- mice were backcrossed over 10 generations to an FVB background. Other mouse stains used were: Gli1^CreER/CreER and Gli1^LacZ/LacZ. The mouse strains were intercrossed to produce the experimental cohorts. Mice were housed in a specified pathogen-free barrier facility at the Stanford School of Medicine. All experiments were conducted under Protocol 14586, approved by the Stanford Institutional Animal Care and Use Committee. For experiments in which tamoxifen-induced recombination was performed, mice were given 4 milligrams of tamoxifen (Sigma) per 30 grams of body weight on three consecutive days by oral gavage. Tamoxifen was formulated as a 40 mg/ml solution in corn oil. Marking of Gli1⁺ cells was accomplished by tamoxifen treatment of

mice to activate CreER and induce ZsGreen1 expression, or by tamoxifen treatment of Gli1^CreER/+;R26^mTmG/+ mice to activate CreER and induce a switch in expression of the mTmG bi-fluorescent reporter from mTomato to mGFP. DSS colitis studies

Solutions of DSS (MP Biomedicals; average molecular weight of 36,000 - 50,000) were made in sterile deionized water at the percent weight/volume concentrations indicated. DSS solutions were substituted for the regular drinking water at the indicated periods. All mice were between 9-16 weeks of age at the start of each DSS injury experiment.

SAG21k was formulated as a fine suspension in PBS at a concentration of 0.05 mg/ml. SAG21k was administered to mice by i.p. injection at a dose of 0.5 mg/kg, given every 12 hours. For vehicle controls, PBS was given on the same dosing schedule. Both SAG21k and vehicle were administered in a volume of 10 microliters per gram of mouse weight. The duration of the dosing is described in each figure. XL-139 was formulated in sterile de-ionized water at a concentration of 10 mg/ml and administered to mice by oral gavage every 72 hours at a dose of 100 mg/kg. Dosing volume for XL-139 or vehicle (sterile deionized water) was 10 microliters per gram of mouse weight.

Colitis severity scores were assessed in a blinded fashion by a single pathologist (E.S.S.) according to a previously described scoring system (see e.g., Geboes et al. (2000) Gut 47:404-409 (2000), the disclosure of which is incorporated herein by reference in its entirety). AOM-DSS studies

Azoxymethane (AOM; Sigma) was formulated in PBS at a concentration of 1 mg/ml. Mice received a single i.p. injection of AOM at a dose of 10 mg/kg at the start of each tumor induction study, as indicated.

Vismodegib was formulated in a 10 mg/ml suspension in MCT (0.5% methylcellulose, 0.2% Tween 80). Vismodegib was given by oral gavage every 12 hours at a dose of 100 mg/kg, during the timeframe indicated in FIG. 4A. SAG21k was formulated and administered as described in the section above. The duration of treatment is indicated in FIG. 4A. Vehicle treated animals received PBS injections twice daily as described above.

For tumor measurements, whole colons were dissected from sacrificed animals. The colons were flushed internally with 10 ml PBS with a blunt 20 gauge needle to removes feces. The colons were then cut open longitudinally and fixed in 4% paraformaldehyde/PBS (4% (wt/vol) PFA/PBS) overnight at 4° Celsius. To calculate the volume of each colon tumor focus, the maximal length, width and height measurements were obtained using digital electronic calipers. Volume was calculated as an ellipsoid: /6 x (L x W x H). The volume of each focus was summed together for the total tumor volume per colon per animal. Immunohistochemistry

Freshly dissected colons were flushed internally with PBS with a blunt 20 gauge needle as described above. The colons were then flushed with 4% PFA/PBS to promote accelerated fixation of tissue adjacent to the lumen. Sections from the distal third of the colon were fixed overnight in 4% PFA/PBS at 4° Celsius. A portion of the fixed colon was submitted for paraffin embedding, sectioning and H&E staining (Histotec) for histologic colitis severity assessment. For frozen sections, the fixed tissues were placed in 30% sucrose/PBS for 12-24 hours overnight at 4° Celsius. Afterwards the tissues were embedded into Optimal Cutting Temperature medium (OCT; Sakura Finetek).

Immunofluorescence staining was performed on 7 micron thick fixed-frozen colon samples. Permeabilization was performed with 0.5% Triton X-100/PBS for 15 minutes. Blocking was performed in 10% normal goat serum (NGS)/PBS for 30 minutes. Primary antibody incubations were performed in 5% NGS/PBS for either 2 hours at room temperature or overnight at 4° Celsius. Secondary antibody incubations were performed in 5% NGS/PBS. All washes were performed with 0.1% Tween 20/PBS (PBST). Slides were mounted with Prolong Gold with DAPI (Invitrogen).

Primary antibodies were as follows: chicken anti-beta galactosidase polyclonal (ab616, 1:1000, Abcam); rabbit anti-GFP polyclonal (1:1000; Novus); rat anti-mouse Epcam (clone G8.8, Developmental Studies Hydridoma Bank, University of Iowa; 1:400 of concentrated supernantant); Alexa Fluor 647 anti-mouse CD45 (clone 30F-11; 1:200; Biolegend); Alexa Fluor 647 anti-mouse CD11b (clone M1/70; 1:200; Biolegend); Alexa Fluor 647 anti-mouse CD11c (clone N418; 1:200; Biolegend); Alexa Fluor 647 anti-mouse F4/80 (clone BM8; 1:200; Biolegend); Alexa Fluor 647 anti-mouse CD206 (clone C068C2; 1:200; Biolegend) and rabbit anti-mouse CD31 polyclonal (ab28364; 1:100, Abcam). Secondary antibodies used for visualization were from Sigma or Jackson Immunoresearch. Confocal microscopy was performed on Zeiss LSM 700. Images were processed with ImageJ and Adobe Photoshop CS4 software.

X-gal stains on fresh frozen colon tissue sections (10 micron thickness) was performed as described previously (see e.g., Shin et al. (2011) Nature. FACS

Freshly dissected murine colons were gently flushed with cold calcium and magnesium-free PBS (CMF-PBS) using a blunt 20 Gauge needle to remove fecal material, then cut longitudinally, and then pulse vortexed several times in CMF-PBS to remove adherent debris. The tissue was then _{transferred to a tissue culture dish and sliced into 1-2 mm} ^{3 pieces with a razor blade. Tissue} fragments were subsequently washed in a 25 or 50 mL pipette by aspirating fragments in CMF-PBS up into the pipette and allowing them to settle by gravity. Tissue fragments were next digested in 10 mL of digestion buffer per colon at 37° Celsius in 5% CO₂ and 20% O₂, for 3-4 hours, pipetting every 15 minutes. Digestion buffer consisted of advanced Dulbecco's modified Eagle medium/F12 (Invitrogen, Carlsbad, CA), 1× Glutamax (Invitrogen), 120 ^g/mL penicillin, 100 ^g/mL streptomycin, 0.25 ^g/mL amphotericin-B, 10 mM Hepes, 10% heat-inactivated fetal calf serum, with 400 U/mL Collagenase type III (Worthington, Lakewood, NJ), and 100 U/mL DNase I (Worthington). The digestion was monitored under a fluorescence dissection microscope to ensure that the tissue was adequately dissociated into a single-cell suspension and that fluorescent cells, if present, were released. At this point, an equal volume of PBS + 10 mM EDTA was added for 10 minutes to help disaggregate remaining clusters of cells. The cell suspension was then filtered with a 40-^m nylon mesh filter (BD Biosciences), counted in a hemocytometer, and resuspended at ~1 × 10⁶ cells/mL in cold digestion media lacking collagenase and DNAse.

Cells in staining buffer were stained in the dark on ice for 20 minutes with titered fluorescently-conjugated antibodies. Fluorophores varied by experiment. Antibodies included the following: Epcam-allophycocyanin-cyanine 7 or Alexa 647 or Alexa 488 (clone G8.8), CD45- phycoerythrin (PE)-Cy5 or Pacific Blue (clone 30F-11), CD4-APC (clone RM4-5), Foxp3 (clone FJK-16s). Stainings were done with single-color controls, fluorescence-minus-one (FMO) controls, and fluorescently-labeled isotype controls stained at the same antibody concentration to ensure proper compensation and gating as well as specificity of antibody binding. Intracellular staining of Foxp3 was performed using the Foxp3 Fix/Perm Buffer Set (Biolegend). After staining, cells were washed in cold CMF-PBS, pelleted, and resuspended in cold digestion media lacking collagenase, but including DNAse I at 100U/mL.

After staining, flow cytometry was immediately performed with a 100 uM nozzle on a BD FACSAria II using FACSDiva software. Debris and doublets were excluded by sequential gating on forward scatter area vs side scatter area, followed by forward scatter width vs forward scatter height, followed by side scatter height vs side width area. Live cells were identified by exclusion of 4ƍ,6- diamidino-2-phenylindole (Molecular Probes, Grand Island, NY) using FMO controls. The compensation matrix was calculated with the FacsDiva software, and was then checked manually and adjusted as necessary using single color controls. Subpopulations within the live cell fraction were identified and gated using isotype controls. To ensure the highest possible sorting purity, cells of interest were sorted on“single-cell” purity mode into cold digestion media lacking collagenase and DNAse, and purity was then checked to ensure >95% purity. For some experiments, cells were sorted directly into Trizol-LS (Invitrogen) to maximize RNA quality. In those cases, a test sort into cold digestion media without DNAse or collagenase was performed before and after the sort into Trizol- LS to ensure that cells sorted into Trizol-LS were of sufficiently high purity. Microarrays Microarray analysis was performed by the Stanford Protein and Nucleic Acid (PAN) Facility using GeneChip Mouse Genome 4302.0 arrays (Affymetrix). For microarray experiments, RNA was reverse transcribed to cDNA with random hexamers and oligo-dT primers and T7 linkers were then added, followed by two rounds of (linear) T7-mediated amplification. RNA and cDNA quality was checked with a bioanalyzer. Microarray data were analyzed using R and Bioconductor. Raw data were normalized with the MAS5 algorithm using Custom Chip Definition Files that map to Entrez gene identifiers (Brainarray v. 19 at http(colon,blackslash,backslash) brainarray(dot)mbni(dot)med(dot)umich.edu(backslash)Brainarray(backslash)Database(backslash)Cu stomCDF(backslash)CDF_download(dot)asp). Differentially expressed genes were identified using the Student’s t-test. Quantitative RT-PCR

To perform quantitative RT-PCR on whole colon samples, freshly dissected colons were first flushed with PBS using a 20 gauge blunt needle. Material from the distal third of the colon was homogenized in TRIzol Reagent (Invitrogen) using a hand-held motorized tissue homogenizer. RNA was purified using the PureLink Mini Kit (Invitrogen). The SuperScript III First Strand Synthesis Supermix (Invitrogen) was used to prepare cDNA using random hexamers. Quantitative pPCR was performed with a Bio-Rad iCycler using the iQ SYBR Green Supermix (Bio-Rad).

To perform quantitative RT-PCR on cell populations isolated by FACS, the RNA was purified from Trizol-LS lysates using the PureLink Micro Kit (Invitrogen) and eluted in distilled deionized DEPC-treated RNAse-free water. For experiments where more than 10,000 cells were sorted per population, the RNA was reverse transcribed with random hexamers and oligo-dT primers and then cDNA was tested directly with quantitative PCR using Taqman assays (Invitrogen) on an ABI7900HT Thermocycler (Applied Biosystems, Carlsbad, CA) or designed primer pairs and Sybr green on a Bio-Rad iCycler. Samples were loaded in triplicate on all thermal cycler runs.

For experiments where less than 10,000 cells were sorted, the RNA was reverse-transcribed and preamplified (12-20 cycles) with gene-specific primers as described (see e.g., Rothenberg et al. (2012) Gastroenterology 142: 1195-1205, the disclosure of which is incorporated herein by reference in its entirety) using the Cells-Direct kit (Invitrogen). Briefly, 1.5 uL of RNA was added to a mixture of 5 uL of CellsDirect 2x buffer, 0.1 uL SuperaseIn, 1 uL of superscriptIII RT/platinum Taq enzyme mix, and 2.5uL of a mixture of pooled primer pairs (Taqman assays) with each assay at 0.2x. Reverse transcription was performed by incubating at 50 degrees for 30 minutes, followed by preamplification with cycles of 95 degrees for 2 minutes followed by 60 degrees for 4 minutes. The preamplified cDNA was then diluted 1:5 in water. Quantitative RT-PCR (40 cycles) was subsequently conducted on diluted preamplified cDNA using Taqman assays. If there was no detection of transcript, the result was verified by two additional RT-PCR experiments. Taqman assays used included:

Actb Mm00607939_s1; Gapdh Mm99999915_g1; Hprt1 Mm01545399_m1; Gli1 Mm00494645_m1 and Mm00494654_m1; Gli2 Mm01293116_m1; Ptch1 Mm01306905_m1; Hhip Mm00469580_m1; and IL10 Mm00439614_m1. Primers used with SYBR Green were: mouse Gli1 (forward: CCAAGCCAACTTTATGTCAGGG (SEQ ID NO: 1), reverse: AGCCCGCTTCTTTGTTAATTTGA (SEQ ID NO: 2)); mouse HPRT1 (forward: TCAGTCAACGGGGGACATAAA (SEQ ID NO: 3), reverse: GGGGCTGTACTGCTTAACCAG (SEQ ID NO: 4)); mouse Ptch1 (forward: GCTACGACTATGTCTCTCACATCAACT (SEQ ID NO: 5), reverse: GGCGACACTTTGATGAACCA (SEQ ID NO: 6)); mouse Hhip (forward: TGAAGATGCTCTCGTTTAAGCTG (SEQ ID NO: 7), reverse: CCACCACACAGGATCTCTCC (SEQ ID NO: 8)); Mouse IL-10: (forward: GCTCTTACTGACTGGCATGAG (SEQ ID NO: 9), reverse: CGCAGCTCTAGGAGCATGTG (SEQ ID NO: 10)); Mouse Ihh: (forward: GTTCACTGGTACCCTCAGATGCTCTA (SEQ ID NO: 11), reverse: GTTAGAGTCCCTTCAGCTTCCTGC (SEQ ID NO: 12)). Luminex Assay

Freshly dissected colons (distal third of the colon) were flushed with PBS as described above to remove feces. They were then homogenized in RIPA buffer (10 mM Tris [pH 8.0], 140 mM NaCl, 1 mm EDTA, 0.5 mM EGTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS) using a hand-held motorized homogenizer. The volume of RIPA buffer was >20-fold more than the volume of the sample. The RIPA buffer contained 1 tablet of complete Mini protease inhibitor cocktail (Roche) per 10 ml of buffer. The lysate was incubated at 4° Celsius for 30 minutes, followed by centrifugation at 21,000xg for 15 minutes at 4° Celsius. The clarified supernatant was analyzed by Luminex Assay at the Stanford Human Immune Monitoring Center. Statistical analyses

Graphing and statistical analyses were performed with GraphPad Prism 6 software. Standard error measurements are presented for all quantified data unless otherwise specified. Group comparisons were performed with a two-tailed Student’s t-test. Kaplan-Meier analyses were performed with the log-rank test. Results and Discussion

To investigate the role of Hh signaling in IBD, we first attempted to confirm that Gli1 inactivation increases the severity of acute DSS-induced colitis. We obtained less dramatic results, quite distinct from those previously reported (FIG. 7A-7C), possibly due to differences in housing, the genetic background, or the microbiota of the mice used in the two studies. Gli1 is a well- established target of Hh signaling but its loss causes only a partial impairment of Hh response, leaving open the possibility of a more striking effect with more severe impairment. To definitively ablate Hh signaling in the colon we combined Gli1^CreER, which expresses the tamoxifen-dependent CreER recombinase in a pattern that faithfully recapitulates stromal expression of Gli1^LacZ in the colon (FIG. 1B, FIG. 1C), with a conditional allele of the essential Hh transduction component Smoothened (Smo^fl). As Gli1 expression occurs in cells undergoing Hh response, tamoxifen treatment of Gli^CreER/+;Smo^fl/fl mice should ablate the capability for further response to Hh signals; this was confirmed by a 4.5 fold reduction in Gli1 transcript levels by quantitative RT-PCR (qRT-PCR) analysis of Gli^CreER/+;Smo^fl/fl as compared to Gli1^CreER/+;Smo^flox/+ control mice (FIG.8A). We found in these Smo-ablated mice that a light regimen of DSS exposure (2.5% for five days, with scarcely any effect on wild-type) sufficed to reliably induce weight loss (FIG.1D) as well as a significant increase in the mean colitis severity score (from 0.9 to 2.7; FIG. 1E), as determined histologically by a pathologist (E.S.S.) blinded to the genetic background and treatment regimen of the mice (FIG. 1H; see above). We found in addition that pharmacologic inhibition of Hh response using the small molecule Hh pathway antagonist, XL-139 (FIG.8B) also significantly accelerated weight loss (FIG. 1F) and increased the severity of colitis (from a score of 0.3 to 2.3; FIG. 1G). In summary, both genetic and pharmacologic manipulations that decisively ablate or block Hh response enhanced the development of colitis at levels of DSS exposure that scarcely produced any effect in mice with intact Hh response. The marked effect of selective Smo ablation by Gli1^CreER moreover shows that Gli1-expressing stromal cells are the critical site for the colitis-enhancing effect of lost response to the Hh signal.

As reduced Hh response exacerbates acute DSS colitis, we considered the possibility that genetic or pharmacological interventions that increase the level of Hh pathway activity might ameliorate colitis. To test this possibility, we first examined colitis severity in mice with a slight general elevation of Hh activity caused by heterozygous mutation of Ptch1 (FIG. 2A), which was backcrossed over 10 generations into an FVB background to permit comparison to FVB wild-type mice. We found that these Ptch1^+/- heterozygous mice developed significantly less severe DSS- induced colitis (severity score of 1.8 vs. 3.4; FIG. 2B) and showed decreased colitis-associated mortality (91% vs.55% survival; Fig.2c).

To further explore pathway activation, we tested the effect of a small molecule Smoothened agonist, SAG21k (see Lee et al. (2014) Proc Natl Acad Sci U S A 111:E3091-3100 and Brunton et al. (2009) Bioorganic & medicinal chemistry letters 19:4308-4311, the disclosures of which are incorporated herein by reference in their entireties), which generates a 2.8-fold maximal elevation of Gli1 transcript levels in the colon of uninjured FVB mice at a dose of 0.5 mg/kg twice per day (FIG. 8D). The relatively modest degree of Gli1 induction by SAG21k in uninjured colon as compared to vehicle likely is due to constitutive expression of Hh ligands in the epithelium, which generates a fairly high basal level of stromal Gli1 expression (FIG. 1B, FIG. 1C). Interestingly, this basal level of Hh pathway activity, as indicated by expression of Gli1 and additional Hh targets Ptch1 and Hhip, was significantly decreased by DSS-induced colitis (FIG. 9A: Vehicle-no injury vs. Vehicle-DSS). This reduction in Hh response may be due in part to the slightly reduced expression of Ihh, the major Hh ligand in adult colon, but could also be due to the colitis-induced disruption of tissue architecture, which includes a fluid infiltrate that might disrupt the normal close contact between ligand- expressing epithelial cells and Hh-responding stromal cells (FIG. 1C). In this setting of colitis- induced reduction of Hh pathway activity, SAG21k treatment induced a return of Hh pathway target expression to levels like those in uninjured mice treated with SAG21k (FIG.9A: SAG21k-no injury vs. SAG21k-DSS), thus resulting in a strong relative induction of Hh targets by SAG21k (e.g., a 16.0 fold change in Gli1, FIG.2D; FIG.9A).

Having established that SAG21k treatment causes a major and highly significant change in the level of Hh pathway activity in the setting of DSS-induced colitis, we examined the effects of SAG21k treatment on colitis severity when applied either before or after the initiation of DSS injury. First, either vehicle or SAG21k was given to mice beginning 5 days before exposure to a severe colitis-inducing regimen (5% DSS for five days; FIG.2A). In this setting, colitis severity was greatly reduced in the SAG21k group compared to the vehicle controls (severity score of 0.6 vs. 4.8; FIG. 2E, FIG.2G). Second, mice were given either vehicle or SAG21k starting four days after the start of DSS-treatment with a milder colitis-inducing regimen (2% DSS for seven days; FIG. 2A). SAG21k treated mice showed less severe colitis at Day 7 compared to vehicle treated controls (severity score of 1.9 vs.3.1; FIG.2F). Thus, increased Hh activity, achieved genetically or pharmacologically, has a strong protective effect in DSS-induced colitis. Furthermore, pharmacologic intervention to increase Hh activity can ameliorate colitis when applied either before or after the start of DSS-injury.

Although colitis is viewed primarily as an inflammatory disease, we found no evidence by immunofluorescence staining (FIG. 3A) or by FACS analysis (FIG. 3B) of pathway activity in hematopoietic cells of injured or uninjured colon, as indicated by absence of Gli1 co-expression with the general hematopoietic marker, CD45; this non-overlap of Gli1 expression with CD45 was confirmed by non-overlap with markers of subpopulations of hematopoietic cells (CD11b, CD11c, F4/80, or CD206, in FIG.10C-10L). Given this absence of Gli1 expression in hematopoietic cells of the colon, we focused directly on Gli1-expressing (Gli1⁺) colon stromal cells to identify factors that might mediate the protective effect of Hh response. To this end, we subjected FACS-isolated Gli1⁺ cells from the colons of SAG21k- and vehicle-treated mice (FIG. 4A, FIG. 4B) to microarray analysis, and noted the expected induction by SAG21k of Hh pathway targets, including Hhip, Igf1, Myocd, Gli1 and Ptch1 (FIG.4C). Notably, we also observed a 3-fold induction in IL-10 expression levels, confirmed as a 6.3-fold induction by qRT-PCR (FIG. 4D). In the setting of DSS-induced colitis (FIG. 4A), SAG21k induction of IL-10 was even more dramatic in Gli1⁺ colon stromal cells (FIG. 4E), and this induction was not observed in FACS-isolated hematopoietic or epithelial cell populations from the colons of DSS-exposed animals (FIG. 4F; FACS plots shown in bottom two panels of FIG.3B).

Our studies suggest that at least a portion of the protective effect of Hh pathway activation in DSS colitis might be mediated through induction of IL-10 expression. To determine whether IL-10 expression indeed mediates the protective effect of Hh stromal response, we exposed IL-10 mutant mice (IL-10^-/-) to DSS and treated with SAG21k. The IL-10^-/- strain, on a C57BL/6 background, is known to develop spontaneous colitis, which varies in severity depending on housing conditions: we indeed noted a low-grade colitis (average severity score, 1.0) without DSS exposure in our colony (FIG. 4G). These IL-10^-/- mice were subjected to a 5 day exposure to 5% DSS, which increased the average colitis severity score to the maximum level of 5.0 in vehicle-treated mice (FIG. 4G). This severity score was reduced to an average of 3.7 in the SAG21k treatment cohort (p = 0.01). The comparison vehicle-treated wild-type group, also C57BL/6, developed an average colitis severity score of 4.2 with DSS exposure, with a dramatic reduction to 0.2 upon SAG21k treatment (p < 0.0001). We conclude from these data that, although some SAG21k-induced reduction in colitis severity occurs in the absence of IL-10 function, a major portion of the SAG21k protective effect requires wild-type IL-10, consistent with transcriptional activation of IL-10 expression by Hh signaling as a protective mechanism.

IL-10 suppresses colitis by acting to maintain expression of the transcription factor Foxp3, a hallmark of regulatory T cell (Treg) identity and function. This suggests that Hh pathway activation by SAG21k might stimulate Foxp3 expression cells in the setting of colitis. However, as colitis itself causes an increase in colonic Tregs, we were concerned that the suppression of colitis by SAG21k treatment might confound any treatment-induced augmentation of Foxp3 expression. To address this issue we initially examined the effects of colitis and SAG21k on Foxp3⁺ Treg levels independently. We first examined the expression of Foxp3 during acute colitis and found that Foxp3 expression indeed increased in a large proportion of CD4⁺ T cells (FIG. 5A-5C), with a corresponding increase in the frequency of Foxp3⁺ CD4⁺ T cells within total cells of the colon (FIG.5D). We also found that Foxp3 expression in CD4⁺ T cells increased within one day of SAG21k treatment, and continued throughout our 10 day testing period (FIG. 5A, FIG. 5E, FIG. 5F). However, when SAG21k treatment was combined with a 10 day DSS injury protocol, the population of Tregs in the colon was significantly reduced (FIG. 5G). The SAG21k treatment effect of reducing colitis severity and the accompanying reduction in Tregs thus prevails over the Treg-inducing effect of SAG21k treatment in the absence of injury.

To determine if SAG21k could increase Treg cell levels in the setting of DSS injury independent of its effects on colitis severity, we examined the effects of SAG21k during the early phase of DSS injury prior to the onset of severe colitis and after only one day of SAG21k treatment. After 3 days of DSS exposure, mice were given either vehicle or SAG21k for one day (two doses), and Treg populations were analyzed at Day 4 (FIG. 5A, bottom schema). Mice given either vehicle or SAG21k did not display differences in histologic colitis severity from each other or from Day 3 control mice (FIG.5H). However, Foxp3 expression increased in a significant proportion of CD4⁺ T cells (FIG. 5I), with a corresponding increase in the frequency of Foxp3⁺ CD4⁺ T cells within total cells of the colon (Fig.5j). These results suggest that an early and rapid increase in Treg cells in the colon may be a mechanism by which SAG21k prevents onset or suppresses progression of colitis.

We have seen that Hh pathway manipulation affects colitis severity. We then explored the possibility that Hh pathway manipulation might affect the extent of colitis-associated colon cancer. For our studies we utilized an established colitis-dependent murine cancer model (AOM-DSS) in which systemic exposure to the carcinogen, azoxymethane is followed one week later by a week of exposure to DSS (see Tanaka et al. (2003) Cancer science 94: 965-973, the disclosure of which is incorporated herein by reference in its entirety). First, we observed that genetic elevation of Hh response in Ptch^+/- mice resulted in a reduced overall tumor burden as compared to Ptch1^+/+ littermate controls (FIG. 6A-6D). We then confirmed and extended these initial findings by pharmacologic manipulation of Hh response during the period of acute colitis in wild-type FVB mice (FIG. 6A). Pathway suppression using the small molecule Hh antagonist vismodegib resulted in significantly greater tumor burden, whereas pathway elevation using SAG21k resulted in decreased tumor burden (FIG. 6E, FIG. 6F). These results are consistent with our observations that Hh pathway activity decreases colitis severity, and further suggest that decreased severity of colitis is protective against formation of colon tumors in the AOM-DSS model.

Finally, we determined whether Hh pathway manipulation outside of the period of acute colitis can influence colon tumor growth. We found that reduction of Hh response by tamoxifen- induced genetic ablation of Smo in Gli^CreER/+;Smo^fl/fl mice, with tamoxifen administration initiated two weeks after the end of DSS treatment and after the resolution of acute colitis, resulted in greater overall tumor burden compared to Gli1^CreER/+;Smo^flox/+ controls (FIG.6A, FIG.6H-6J). These results suggest that Hh pathway response also reduces colon tumor growth, independent of its effects on colitis severity.

In summary, we have demonstrated that Hh pathway activity dramatically affects the severity of acute colitis in mice, with increased severity resulting from genetic or pharmacologic pathway suppression and decreased severity from genetic or pharmacologic pathway activation. The colitis- protective effect of pathway activation was disrupted by Gli1^CreER-directed ablation of Hh response, thus indicating that Gli1⁺ stromal cells, not epithelial or hematopoietic cells, are the direct cellular target of Hh signaling in the colon for this protective effect. As a possible mechanism mediating this effect, we identified the induction of expression in these Hh-responsive stromal cells of IL-10. We note that most of the protective effect of Hh pathway activity is lost upon mutation of IL-10, confirming that most of the colitis-protective effect of Hh pathway activity is conveyed by upregulation of IL-10. We also noted in our DSS model that Hh pathway activation by SAG21k treatment increased the relative number of Foxp3⁺ CD4⁺ Treg cells in the colon, both in a non-injured state as well as in the setting of early colitis.

Finally, we have demonstrated that genetic or pharmacologic Hh pathway manipulation can affect tumor burden in the AOM-DSS colon cancer model. In our experiments involving pharmacologic manipulation, we ascertained this cancer-protective effect during the period of DSS- induced acute colitis. However, we also noted that pathway inactivation by genetic ablation of Smoothened after the resolution of colitis and during the period of tumor growth resulted in increased tumor burden, suggesting that stromal Hh pathway activity may protect against tumor growth and development independently of an effect on colitis itself.

From a clinical perspective, our studies clearly highlight a potential risk for individuals with acute, chronic, or intermittent IBD who are receiving a Hh antagonist like vismodegib for a therapeutic purpose, such as treatment of locally advanced or metastatic basal cell carcinoma. In such cases, the antagonist may increase risk of IBD relapse or cause exacerbation of pre-existing disease. We note in particular in our studies that mild DSS exposure regimens that alone caused little pathology were associated with moderate to severe colitis in conjunction with genetic or pharmacologic Hh pathway blockade (FIG.1A-1H). Beyond exacerbation of pre-existing disease, it is possible that treatment with Hh antagonists may actually increase the risk of contracting IBD, as diarrhea and weight loss are consistent side effects in Hedgehog inhibitor trials.

The above example generally describes the applicability of Hh agonist for inducing Treg cells for treating, controlling and/or preventing damaged epithelium, where colitis is but one example of a condition associated damaged epithelium and SAG21K is but one example of a Hh agonist. EMBODIMENTS

1. In a first embodiment is provided a method of inducing Foxp3-expressing T regulatory (Treg) cells, comprising:

administering to a subject having a condition characterized by a damaged epithelium or at risk thereof a Hedgehog (Hh) agonist in an amount effective to locally increase the number of Foxp3-expressing Treg cells in the damaged epithelium.

2. The method according to embodiment 1, further comprising monitoring the induction in the subject by quantifying the number of Foxp3-expressing Treg cells, the level of Foxp3 expression in Treg cells, IL-10 expression or a combination thereof in a sample obtained from the damaged epithelium. 3. The method according to any of the preceding embodiments, further comprising identifying the subject as having a damaged epithelium associated with insufficient Foxp3-expressing Treg cells prior to the administering.

4. The method according to embodiment 3, wherein the identifying comprises quantifying the number of Foxp3-expressing Treg cells, the level of Foxp3 expression in Treg cells, IL-10 expression or a combination thereof in a sample obtained the subject.

5. The method according to any of the preceding embodiments, wherein the subject has an elevated level of Foxp3-expressing Treg cells in the damaged epithelium prior to the administering. 6. The method according any of the preceding embodiments, wherein the damaged epithelium is selected from the group consisting of: the rectum, the sigmoid colon, the descending colon, the transverse colon, the ascending colon, the cecum, the duodenum, the jejunum, and the ileum.

7. The method according to any of the preceding embodiments, wherein the amount of the Hh agonist is effective to induce IL-10 expression in a Hh-responsive cell.

8. The method according to embodiment 7, wherein the Hh-responsive cell is a stromal cell. 9. The method according to any of the preceding embodiments, wherein the method further comprises administering an immunosuppressant, a steroid or both.

10. The method according to any of the preceding embodiments, wherein the condition is selected from the group consisting of: acute colitis, Crohn’s disease, ulcerative colitis, graft versus host disease and psoriasis.

11. The method according to any of the preceding embodiments, wherein the Hh agonist is formulated: with an enteric coating, as a suppository, or for topical delivery.

12. The method according to any of the preceding embodiments, wherein the Hh agonist is administered intermittently.

13. The method according to embodiment 12, wherein the intermittent administration comprises a dosing interval ranging from two days to two weeks, a non-dosing interval ranging from two days to two weeks, or a combination thereof.

14. The method according to any of the preceding embodiments, wherein the subject is at risk of a condition characterized by a damaged epithelium and the administering is performed prophylactically to prevent the occurrence or reoccurrence of the condition.

15. The method according to embodiment 14, wherein the condition is graft versus host disease or colon cancer.

16. The method according to any of the preceding embodiments, wherein the Hh agonist is administered in a daily dose ranging from 0.008 mg/kg to 0.8 mg/kg.

17. The method according to any of the preceding embodiments, wherein the Hh agonist is a small molecule smoothened agonist. 18. The method according to embodiment 16, wherein the small molecule smoothened agonist is SAG21K.

19. In another embodiment is provided a pharmaceutical composition comprising:

a Hedgehog (Hh) agonist formulated for local administration to a damaged epithelium. 20. The pharmaceutical composition according to embodiment 19, wherein the Hh agonist is formulated with an enteric coating, or as a suppository.

The preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims.

Claims

CLAIMS That which is claimed is: 1. A method of inducing Foxp3-expressing T regulatory (Treg) cells, comprising:

administering to a subject having a condition characterized by a damaged epithelium or at risk thereof a Hedgehog (Hh) agonist in an amount effective to locally increase the number of Foxp3-expressing Treg cells in the damaged epithelium.

2. The method according to Claim 1, further comprising monitoring the induction in the subject by quantifying the number of Foxp3-expressing Treg cells, the level of Foxp3 expression in Treg cells, IL-10 expression or a combination thereof in a sample obtained from the damaged epithelium.

3. The method according to any of the preceding claims, further comprising identifying the subject as having a damaged epithelium associated with insufficient Foxp3-expressing Treg cells prior to the administering.

4. The method according to Claim 3, wherein the identifying comprises quantifying the number of Foxp3-expressing Treg cells, the level of Foxp3 expression in Treg cells, IL-10 expression or a combination thereof in a sample obtained the subject.

5. The method according to any of the preceding claims, wherein the subject has an elevated level of Foxp3-expressing Treg cells in the damaged epithelium prior to the administering.

6. The method according any of the preceding claims, wherein the damaged epithelium is selected from the group consisting of: the rectum, the sigmoid colon, the descending colon, the transverse colon, the ascending colon, the cecum, the duodenum, the jejunum, the ileum, and a combination thereof.

7. The method according to any one of the preceding claims, wherein the amount of the Hh agonist is effective to induce IL-10 expression in a Hh-responsive cell.

8. The method according to Claim 7, wherein the Hh-responsive cell is a stromal cell.

9. The method according to any one of the preceding claims, wherein the method further comprises administering an immunosuppressant, a steroid or both.

10. The method according to any one of the preceding claims, wherein the condition is selected from the group consisting of: acute colitis, Crohn’s disease, ulcerative colitis, graft versus host disease and psoriasis.

11. The method according to any one of the preceding claims, wherein the Hh agonist is formulated: with an enteric coating, as a suppository, or for topical delivery.

12. The method according to any one of the preceding claims, wherein the Hh agonist is administered intermittently.

13. The method according to Claim 12, wherein the intermittent administration comprises a dosing interval ranging from two days to two weeks, a non-dosing interval ranging from two days to two weeks, or a combination thereof.

14. The method according to any one of the preceding claims, wherein the subject is at risk of a condition characterized by a damaged epithelium and the administering is performed prophylactically to prevent the occurrence or reoccurrence of the condition.

15. The method according to Claim 14, wherein the condition is graft versus host disease or colon cancer.

16. The method according to any of the preceding claims, wherein the Hh agonist is administered in a daily dose ranging from 0.008 mg/kg to 0.8 mg/kg.

17. The method according to any of the preceding claims, wherein the Hh agonist is a small molecule smoothened agonist.

18. The method according to Claim 16, wherein the small molecule smoothened agonist is SAG21K.

19. A pharmaceutical composition comprising:

a Hedgehog (Hh) agonist formulated for local administration to a damaged epithelium.

20. The pharmaceutical composition according to Claim 19, wherein the Hh agonist is formulated with an enteric coating, or as a suppository.