WO2016166329A1 - Flow cytometry-based assay to measure adhesion of upec to bladder epithelial cells - Google Patents
Flow cytometry-based assay to measure adhesion of upec to bladder epithelial cells Download PDFInfo
- Publication number
- WO2016166329A1 WO2016166329A1 PCT/EP2016/058420 EP2016058420W WO2016166329A1 WO 2016166329 A1 WO2016166329 A1 WO 2016166329A1 EP 2016058420 W EP2016058420 W EP 2016058420W WO 2016166329 A1 WO2016166329 A1 WO 2016166329A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- bladder epithelial
- epithelial cells
- upec
- bacteria
- cells
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/18—Testing for antimicrobial activity of a material
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/58—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances
- G01N33/582—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving labelled substances with fluorescent label
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
- G01N2333/24—Assays involving biological materials from specific organisms or of a specific nature from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
- G01N2333/245—Escherichia (G)
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
Definitions
- the present invention concerns a high-throughput flow cytometry-based assay to measure adhesion of UPEC to bladder epithelial cells and to screen for molecules having anti-adhesive and/or anti-internalizing capacity for the treatment of urinary tract infections.
- Urinary tract infections are considered to be the most common infectious diseases in humans, with approximately 150 million cases per year. UTI occur in otherwise healthy individuals and it is estimated that 50% of women and 5% of men will develop an UTI in their lifetime.
- UTI Ultrafiltration of the urethra by faecal bacteria, and spreading up in the urinary tract to the bladder as well as to the kidneys. Because women have a shorter urethra than men, they are more prone to UTI. UTI are classified into disease categories according to the site of infection: cystitis (bladder), pyelonephritis (kidney) or bacteriuria (urine). The most common symptoms of cystitis are painful and frequent urination or urge to urinate (or both), while symptoms pyelonephritis include (in addition to the symptoms of cystitis) : fever, flank pain and nausea. Pyelonephritis can also lead to irreversible kidney damage and death.
- UPEC uropathogenic Escherichia coli
- UPEC uropathogenic Escherichia coli
- Their ability to cause symptomatic UTI is associated with expression of a broad spectrum of virulence factors, with adhesive molecules being the most important determinants of pathogenicity.
- These adhesins can contribute to virulence via different mechanisms: triggering host and bacterial cell signalling pathways, facilitating the delivery of bacterial products to host tissues or promoting bacterial attachment and invasion into host tissues.
- UPEC can indeed invade bladder epithelial cells, providing the bacteria a protected niche where they can persist for long times, unperturbed by host defences and protected from antibiotic treatments. Thus UPEC can persist within the urinary tract and may serve as a reservoir for recurrent infections and serious complications.
- antibiotic treatment is generally effective for the eradication of the infecting strain, there are many concerns about increases in antibiotic resistance, alteration of the normal gut flora and failure to prevent recurrent infections.
- the inventors have thus developed a fast and robust high-throughput assay to monitor UPEC adhesion to human bladder epithelial cells using flow cytometry.
- the UPEC strains are transformed with a plasmid encoding the green fluorescent protein (GFP) and are thus constitutively fluorescent.
- GFP green fluorescent protein
- using transformed UPEC allows testing their adhesion in presence of non-sterile body fluids (e.g. urine from volunteers).
- this assay is very fast (it can generate robust data in as little as 3 min per condition tested).
- robotization in 96-well plates makes this assay very valuable for screening purposes.
- this technology is applicable to the measurement of the anti-adhesion properties of candidate molecules, as well as to large scale screening for identifying new molecules.
- the invention thus relates to a method of assaying adhesion and/or internalization of uropathogenic Escherichia coli (UPEC) bacteria (in)to T24 (ATCC ® HTB-4TM) bladder epithelial cells which comprises:
- the invention further relates to a method of screening a candidate molecule for its anti-adhesive and/or anti-internalizing capacity, said method comprising:
- a2) contacting UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein with a candidate molecule, washing the contacted UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, and inoculating and incubating a 100% confluent culture of T24 bladder epithelial cells with said contacted UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell; or a3) contacting a 100% confluent culture of T24 bladder epithelial cells with a candidate molecule, washing the contacted confluent culture of T24 bladder epithelial cells, and inoculating and incubating the confluent culture of T24 bladder epithelial cells with UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell; and
- the invention relates to a method of assaying adhesion of uropathogenic Escherichia coli (UPEC) bacteria to bladder epithelial cells which can advantageously be implemented for the screening of anti-adhesive molecules, as an alternative to antibiotics, for the treatment of urinary tract infections (UTI).
- UPEC uropathogenic Escherichia coli
- T24 cells ATCC ® HTB-4TM
- cell lines can derive after a number of passages.
- T24 cells that have been maintained in culture for more than 2 months should preferably not be used as the consequence of cell aging is an increase in sensitivity to UPEC adhesion and a higher rate of detachment.
- a 100% confluent culture of T24 bladder epithelial cells is provided which is afterwards inoculated and incubated with UPEC bacteria.
- the number of T24 bladder epithelial cells, and thus, their confluency at the moment of infection with UPEC bacteria is a key parameter for this assay.
- Incubating T24 bladder epithelial cells with some UPEC strains can induce cell cytotoxicity characterized by cell rounding and cell loss upon washes. Dense cell monolayers seem more resistant to UPEC adhesion, resulting in more consistent bacterial adhesion.
- the term "confluent" herein described refers to a ratio of an area occupied by cells to the entire culture surface (e.g.
- T24 bladder epithelial cells 100% confluent when used in the methods of the invention, which means that the entire culture surface is covered by the cells, and no more room is left for the cells to grow as a monolayer.
- An optimal T24 bladder epithelial cell number ranges from 2 x10 4 to 5x10 4 cells/well, in a 96-well plate format.
- Any UPEC bacteria may be used in the frame of the method of the invention.
- MOI multiplicity of infection
- Cytotoxicity is, for instance, correlated with the production of Cytotoxic Necrotizing Factor 1 (CNF1 ) (Flatau, 1997).
- CNF1 Cytotoxic Necrotizing Factor 1
- the fluorescent UPEC strains tested by the inventors were derived from clinical isolates and genetically characterized by PCR for the presence of genes encoding virulence factors genes, including cnfl (see Table 1 ).
- the cytotoxicity observed with the CNF1 -expressing strain assayed by the inventors (G50 strain) was successfully minimized in the assay of the invention.
- the UPEC bacteria used in the frame of the methods of the invention can express virulence factors.
- the UPEC bacteria express one or more of the afa/draBC, sfa, foe, fimH, papG2, papG3, papA, papC, papE, and cnfl virulence factors, in particular at least the enf 1 virulence factor.
- the UPEC bacteria are beforehand transformed with a plasmid encoding a fluorescent reporter protein.
- high-throughput means the quantification of a high number of cells in a short period of time. Each well contains up to 5x10 4 cells and less than one minute per well is required in the assay.
- a "fluorescent reporter protein” as used herein means a reporter protein that is detectable based on fluorescence wherein the fluorescence is emitted by the reporter protein directly. Examples of fluorescent proteins are GFP and EGFP whose presence in/on cells can be readily detected by flow cytometry.
- the plasmid encoding a fluorescent reporter protein typically further comprises an antibiotic resistance gene. Accordingly, the UPEC bacteria transformed with said plasmid encoding a fluorescent reporter protein and antibiotic resistance protein can be assayed in non-sterile body fluids. Indeed treatment of the non-sterile body fluids with the antibiotic to which the transformed UPEC bacteria are resistant makes it possible to eliminate other pathogens likely present in the non-sterile body fluids and that could otherwise interfere with the assay.
- the plasmid encoding a fluorescent reporter protein is the so-called plN25 (pBBR-GFP-cam r ) which map is shown on Figure 5 and sequence is as follows (SEQ ID NO:1 ):
- any prokaryotic expression plasmid allowing the expression of a fluorescent protein conferring resistance to an antibiotic can be used in theory in the frame of the methods according to the invention.
- the antibiotic resistance gene of the plasmid is selected so as to confer resistance to an antibiotic which is scarcely used or not used in clinics to avoid potential interference of resistant bacteria that may be present in biological fluids (e.g. urine).
- the UPEC bacteria can be cultivated in any appropriate culture medium, such as a Luria-Bertani broth (LB typical composition: peptone 140 10 g/L, yeast extract 5g/L, sodium chloride 5 g/L).
- LB typical composition: peptone 140 10 g/L, yeast extract 5g/L, sodium chloride 5 g/L.
- inoculating and incubating the 100% confluent culture of T24 bladder epithelial cells with UPEC bacteria is performed at 37 ⁇ 1 °C, in 5% C0 2 , for 2.5 to 4 hours, preferably for about 3 hours. Incubating for shorter period of time lowers the efficiency of UPEC adhesion to T24 bladder epithelial cells. In another embodiment, inoculation and incubation are performed at 4 ⁇ 1 °C.
- the candidate molecule is either simultaneously contacted with the UPEC bacteria and T24 bladder epithelial cells (step a1 ), or preincubated with the T24 bladder epithelial cells (step a2), or preincubated with the UPEC bacteria (step a3).
- the way the method of screening is carried out may be adapted depending on the known or assumed mechanism of action of the candidate molecules to be assayed (i.e. if the candidate molecule acts on a target on/in the UPEC or on a target on/in the T24 bladder epithelial cells).
- UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein are contacted with the candidate molecule by adding the candidate molecule in a culture of the UPEC bacteria and incubating the UPEC bacteria and candidate molecule under conditions sufficient to allow the candidate molecule to interact with the UPEC bacteria.
- These conditions can be for instance culturing at 37 ⁇ 1 °C, for 2 to 24h, such as for 2 to 4h, or for 12 to 14h, preferably for 16 to 18h.
- culturing is performed with agitation (e.g. 200 rpm).
- UPEC bacteria preincubated with the candidate molecule are then washed before being inoculated and incubated into a 100% confluent culture of T24 bladder epithelial cells at a MOI of 100 to 500 bacteria/ bladder epithelial cell.
- this step of incubation is typically performed at 37 ⁇ 1 °C, in 5% C0 2 , for 2.5 to 4 hours, preferably for about 3 hours.
- the candidate molecule When the candidate molecule is preincubated with the T24 bladder epithelial cells, the candidate molecule is added into the 100% confluent culture of bladder epithelial cells and incubated with the cells under conditions sufficient to allow the candidate molecule to interact with the T24 bladder epithelial cells. These conditions can be for instance culturing at 37 ⁇ 1 °C, for 2 to 24h, such as for 2 to 4h, or for 12 to 14h, preferably for 16 to 18h.
- the T24 bladder epithelial cells preincubated with the candidate molecule are then washed before being inoculated and incubated with the UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein at a MOI of 100 to 500 bacteria/ bladder epithelial cell. As mentioned above, this step of incubation is typically performed at 37 ⁇ 1 °C, in 5% C0 2 , for 2.5 to 4 hours, preferably for about 3 hours.
- the candidate molecule When the candidate molecule is simultaneously contacted with the UPEC bacteria and T24 bladder epithelial cells, this is typically performed by inoculating and incubating the 100% confluent culture of T24 bladder epithelial cells with (i) UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell and with (ii) the candidate molecule. Incubation is typically performed at 37 ⁇ 1 °C, in 5% C0 2 , for 2.5 to 4 hours, preferably for about 3 hours.
- MOI multiplicity of infection
- the culture of T24 bladder epithelial cells is washed to remove non adherent UPEC bacteria (and candidate molecule if present).
- the 100% confluent culture of bladder epithelial cells with UPEC bacteria inoculated and incubated with UPEC bacteria is washed once with PBS.
- a single wash with PBS is generally sufficient to remove most unbound UPEC. Washing more than once results in cell loss, that is proportional to the number of washes. Furthermore subsequent analysis using flow cytometry allows the exclusion of free fluorescent bacteria.
- the methods of the invention then comprise the step of detaching and resuspending homogeneously the T24 bladder epithelial cells to obtain a suspension of T24 bladder epithelial cells.
- the washed T24 bladder epithelial cells are then detached from their culture support is typically by aspiring the medium and adding trypsin-EDTA until the cells start to detach (or get rounded) which usually takes a few minutes (e.g. 1 -5 min).
- PBS is then added and the suspension is homogenized by pipetting up and down 2 to 4 times, preferably 3 times.
- T24 bladder epithelial cells must be sufficiently homogenized to avoid cell aggregates, but the homogenization treatment must not be too harsh in order to avoid affecting cell viability.
- the subsequent flow cytometry analysis requires cells suspensions in which cells are individualized, because cells clumps are excluded from the analysis through gating on single cells.
- the suspension of T24 bladder epithelial cells is then analyzed by high-throughput flow cytometry to measure the intensity of fluorescence emitted by the fluorescent reporter protein among the single cells present in the cell suspension.
- a gating on single cells is performed on the FSC-A/FSC-H dot plot (plot displaying forward-scattered light - Area vs forward-scattered light - height) by selecting cells present on the diagonal of the dot plot.
- Fluorescence emission is preferably read at the wavelength of maximum fluorescence emission of the fluorescent reporter protein.
- the control can be a predetermined single value or range of values, or a measure of intensity of fluorescence in a "negative control", i.e. a 100% confluent culture of T24 bladder epithelial cells which has been incubated typically at 37 ⁇ 1 °C, in 5% C0 2 , for 2.5 to 4 hours, preferably for about 3 hours, without any UPEC bacteria, and which was then submitted to washed, detached and resuspended homogeneously and analysed by high- throughput flow cytometry. Determining the anti-adhesive and/or anti-internalizing capacity of the candidate molecule based on the measured intensity of fluorescence is also usually carried out by comparing the measured intensity of fluorescence to a control.
- the control can be a predetermined single value or range of values, or a measure of intensity of fluorescence in
- a "negative control” i.e. a 100% confluent culture of T24 bladder epithelial cells which has been incubated typically at 37 ⁇ 1 °C, in 5% C0 2 , for 2.5 to 4 hours, preferably for about 3 hours, without any UPEC bacteria, and which was then submitted to washed, detached and resuspended homogeneously and analysed by high-throughput flow cytometry, and/or
- a "positive control” i.e. a 100% confluent culture of T24 bladder epithelial cells which has been incubated typically at 37 ⁇ 1 °C, in 5% C0 2 , for 2.5 to 4 hours, preferably for about 3 hours, with UPEC bacteria but without any candidate molecule, and which was then submitted to washed, detached and resuspended homogeneously and analysed by high-throughput flow cytometry
- a candidate molecule is identified as a molecule having anti-adhesive and/or anti-internalizing capacity if the intensity of fluorescence measured is decreased for instance by at least 10%, 20%, 30%, 40%, 50% or more, compared with a positive control and/or if the intensity of fluorescence is statistically significantly different from the intensity of fluorescence of the negative control.
- a statistical significant difference is assayed by calculating the p value using 2 independent sample t-test.
- the method of screening of the invention is implemented with a cranberry extract or a molecule isolated from cranberry extract.
- the methods of the inventions are robust and very fast: generating data using fluorescence microscopy was estimated to require 5 hours for only one condition (tested in triplicate), while the assay according to the instant disclosure requires only 3 min/condition.
- using a 96 well-plates and a microplate reader allow to test up to 30 different molecules or conditions with 1 h30 in an automated fashion, ie without requiring the presence of a technical staff during the acquisition of the data. These parameters fulfil the requirement for screening purposes, or for regular measurement of batch-to-batch efficiency of commercialized anti-adhesion molecules.
- the invention will be further illustrated in view of the following figures and examples.
- Figure 1 Detection of UPEC adhesion on epithelial bladder cells using flow cytometry.
- MFI Median fluorescent intensity
- FIG. 2 Adhesion efficiency of different E. coli strains. MFI of T24 cells incubated with different E. coli strains with an MOI of 100. The histogram shows mean values for at least 3 independent replicates ( ⁇ SD). The black line indicates the basal autofluorescence of T24 cells, measured on non-infected (Nl) cells.
- Figure 3 Flow-cytometry based assay can quantify the inhibition of UPEC adhesion.
- MFI Median fluorescent intensity
- Histogram showing the level of intensity of non-fluorescent UPEC, untreated fluorescent UPEC and cranberry-treated fluorescent UPEC.
- Figure 5 plN25 plasmid map.
- Histogram showing the percentage of GFP-positive T24 cells infected with G50-GFP at an MOI of 500 upon increasing the number of post-infection PBS washes after infection.
- the histogram shows mean values for at least 3 independent replicates ( ⁇ SD).
- the black line indicates the basal autofluorescence of T24 cells, measured on non- infected (Nl) cells.
- Figure 7 Influence of the cell monolayers density on resistance to G50- induced detachment.
- Histogram showing the percentage of GFP-positive T24 cells infected with G50-GFP at an MOI of 500 upon using different cell numbers in 96-well plates.
- the histogram shows mean values for at least 3 independent replicates ( ⁇ SD).
- the black line indicates the basal autofluorescence of T24 cells, measured on non-infected (Nl) cells.
- Figure 8 Influence of the incubation time on the efficiency of UPEC interaction with bladder cells.
- MFI Median fluorescent intensity
- UPEC Fluorescent uropathogenic Escherichia coli
- T24 Human urinary bladder epithelial (T24) cells (ATCC HTB-4), frozen stocks in fetal bovine serum (FBS) supplemented with 10 % dimethyl sulfoxide (DMSO), kept in liquid nitrogen;
- FBS fetal bovine serum
- DMSO dimethyl sulfoxide
- - LB media dissolve 20 g of a commercial LB preparation (+ 13g of agar for plates) in 800ml of purified water and sterilize by autoclaving at 121 °C for 15 min;
- a multichannel aspiration device can be used to aspirate the different buffers during the assay;
- Flow cytometer equipped with a 488nm laser, a microplate sampler and a precision syringe pump (allowing volumetric pipetting and sample mixing) for absolute counting of cells.
- T24 cells are routinely cultured in 75 cm2 plastic culture flasks at 37°C with 5% C02. Approximately 24h before the adhesion assay, detach the cells from the flasks by trypsinization, add propidium iodide to the cell suspension (final concentration 1 ⁇ g/ml), determine the concentration of live cells using a flow cytometer (cells stained with PI are considered to be dead) and seed 5x10 4 live cells per well in a 96-well culture plate with flat bottom. Prepare at least 3 wells per condition tested. On the day of the assay, T24 cells should be at 100 % confluency.
- the fluorescent strains of uropathogenic E. coli are maintained in LB plates containing chloramphenicol (15 ⁇ g/ml).
- chloramphenicol 15 ⁇ g/ml
- To prepare the bacterial cultures inoculate 2 ml of LB supplemented with chloramphenicol (15 ⁇ g/ml) with a colony of fluorescent UPEC in a sterile glass tube with loose cap. Eventually add the anti-adhesion molecule to be tested. Incubate at 37°C with agitation (200 rpm) for 16-18h.
- Infection of T24 cells by UPEC Prepare a 1 /20 th dilution of the overnight bacterial cultures in 2 ml of LB supplemented with chloramphenicol (15 ⁇ g/ml) and (if appropriate) with the anti-adhesion molecule to be tested. Incubate at 37°C with agitation (200 rpm) until the OD reaches 0,5 to 1 (approximately 2h).
- the gating strategy for analysis should be: 1 ) gating around cells on a FSC-A/SSC-A dot plot (to exclude cell debris and bacteria) and 2) further gating around single cells on a FSC-A/FSC-H dot plot (to exclude cell doublets that would give false positives). Fluorescence of single cells are then analysed in the light path corresponding to the fluorescence of the UPEC strain.
- the efficiency of UPEC adhesion to T24 cells is expressed as the MFI (Median
- Table 1 Characteristics of E. coli strains used in this study. Strains were genotyped by PCR for genes encoding adhesins ⁇ afa/draBC for Dr Adhesin family, sfa and foe for S/F1 C pili, fimH for Type 1 pili, papG2, papG3, papa, papC, and papE for P pili) and for the toxin- encoding gene cnfl.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Immunology (AREA)
- Wood Science & Technology (AREA)
- Hematology (AREA)
- Biotechnology (AREA)
- Urology & Nephrology (AREA)
- Microbiology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Biochemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Cell Biology (AREA)
- Toxicology (AREA)
- Biophysics (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention concerns a high-throughput flow cytometry-based assay to measure adhesion of UPEC to bladder epithelial cells and to screen for molecules having anti-adhesive and/or anti-internalizing capacity for the treatment of urinary tract infections.
Description
FLOW CYTOMETRY-BASED ASSAY TO MEASURE ADHESION OF UPEC TO
BLADDER EPITHELIAL CELLS
The present invention concerns a high-throughput flow cytometry-based assay to measure adhesion of UPEC to bladder epithelial cells and to screen for molecules having anti-adhesive and/or anti-internalizing capacity for the treatment of urinary tract infections.
Urinary tract infections (UTI) are considered to be the most common infectious diseases in humans, with approximately 150 million cases per year. UTI occur in otherwise healthy individuals and it is estimated that 50% of women and 5% of men will develop an UTI in their lifetime.
Most UTI are due to colonization of the urethra by faecal bacteria, and spreading up in the urinary tract to the bladder as well as to the kidneys. Because women have a shorter urethra than men, they are more prone to UTI. UTI are classified into disease categories according to the site of infection: cystitis (bladder), pyelonephritis (kidney) or bacteriuria (urine). The most common symptoms of cystitis are painful and frequent urination or urge to urinate (or both), while symptoms pyelonephritis include (in addition to the symptoms of cystitis) : fever, flank pain and nausea. Pyelonephritis can also lead to irreversible kidney damage and death.
Strains of uropathogenic Escherichia coli (UPEC) are the causative agent in the vast majority of UTI. Their ability to cause symptomatic UTI is associated with expression of a broad spectrum of virulence factors, with adhesive molecules being the most important determinants of pathogenicity. These adhesins can contribute to virulence via different mechanisms: triggering host and bacterial cell signalling pathways, facilitating the delivery of bacterial products to host tissues or promoting bacterial attachment and invasion into host tissues. UPEC can indeed invade bladder epithelial cells, providing the bacteria a protected niche where they can persist for long times, unperturbed by host defences and protected from antibiotic treatments. Thus UPEC can persist within the urinary tract and may serve as a reservoir for recurrent infections and serious complications.
Although antibiotic treatment is generally effective for the eradication of the infecting strain, there are many concerns about increases in antibiotic resistance, alteration of the normal gut flora and failure to prevent recurrent infections.
There is thus an urge for developing alternative strategies for UTI, either preventive or curative. Because of the high frequency of such infections in the World, such new therapeutics represent a high economical potential. Adhesion of UPEC to host cells being a limiting step for their pathogenicity, many scientists and industrials are already
searching for molecules inhibiting bacterial adhesion. Among others, cranberry extracts showed efficiency in preventing UTI in susceptible population. Many other molecules will probably come soon, and these candidates will have to prove their efficiency in inhibiting UPEC adhesion.
A rapid and convenient method for quantifying UPEC adhesion to bladder epithelial cells is lacking.
Previous methods consisted in quantifying bacteria attached to bladder cells either by counting bacterial colonies (after spreading serial dilutions of the cell lysates on agar plates) or counting fluorescent bacteria on individual cells (using a fluorescence microscope). These techniques were extremely time consuming, fastidious and impossible to robotize.
A flow-cytometry based assay has already been described for the measurement of UPEC adhesion to T24 cells (Rafsanjany et al., 2013 J. Ethnopharmacology ;145 :591- 597, Kimble et al., 2014 J. Nat. Prod. 77, 1 102-1 1 10). However, in this case, bacteria were labelled using chemical coupling to a fluorophore (fluorescein isothiocyanate). This step is not only fastidious, because it requires extemporaneous labelling before each assay, but can also lead to batch-to-batch variations in fluorescence intensity. Adhesion efficiency might also be altered because this treatment might alter the biophysical properties of bacterial surface proteins. In some studies, the co-incubation of bacteria and cells was performed in suspension (Kimble et al., 2014 J. Nat. Prod. 77, 1 102-1 1 10) or a centrifugation step was used to enhance the contact of bacteria with the cells from 5637 cell line monolayer (Scharenberg et al., 201 1 Assay Drud Dev. Technol. 9, 455-464); both of these may induce non-specific binding. The flow cytometry assay was carried out on 24-well plates, which is not compatible with high-throughput analysis. Four washes were performed before the assay ((Scharenberg et al., 201 1 Assay Drud Dev. Technol. 9, 455- 464). Washing more than once results in cell loss, that is proportional to the number of washes.
The inventors have thus developed a fast and robust high-throughput assay to monitor UPEC adhesion to human bladder epithelial cells using flow cytometry. In this assay, the UPEC strains are transformed with a plasmid encoding the green fluorescent protein (GFP) and are thus constitutively fluorescent. Moreover, because this plasmid also confers chloramphenicol resistance, using transformed UPEC allows testing their adhesion in presence of non-sterile body fluids (e.g. urine from volunteers). Compared to previously used methods, this assay is very fast (it can generate robust data in as little as 3 min per condition tested). Moreover, robotization in 96-well plates makes this assay very valuable for screening purposes. Thus this technology is applicable to the measurement
of the anti-adhesion properties of candidate molecules, as well as to large scale screening for identifying new molecules.
SUMMARY OF THE INVENTION
The invention thus relates to a method of assaying adhesion and/or internalization of uropathogenic Escherichia coli (UPEC) bacteria (in)to T24 (ATCC® HTB-4™) bladder epithelial cells which comprises:
a) Inoculating and incubating a 100% confluent culture of T24 bladder epithelial cells with UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell;
b) Washing the inoculated and incubated 100% confluent culture of T24 bladder epithelial cells;
c) Detaching and resuspending homogeneously the T24 bladder epithelial cells to obtain a suspension of T24 bladder epithelial cells;
d) Analysing by high-throughput flow cytometry the suspension of T24 bladder epithelial cells and measuring the intensity of fluorescence emitted by the fluorescent reporter protein among the single cells present in the suspension of T24 bladder epithelial cells;
e) Determining the efficiency of UPEC bacteria adhesion and/or internalization (in)to T24 bladder epithelial cells based on the measured intensity of fluorescence.
The invention further relates to a method of screening a candidate molecule for its anti-adhesive and/or anti-internalizing capacity, said method comprising:
a1 ) Inoculating and incubating a 100% confluent culture of T24 bladder epithelial cells with (i) UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria bladder epithelial cell and with (ii) a candidate molecule; or
a2) contacting UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein with a candidate molecule, washing the contacted UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, and inoculating and incubating a 100% confluent culture of T24 bladder epithelial cells with said contacted UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell; or
a3) contacting a 100% confluent culture of T24 bladder epithelial cells with a candidate molecule, washing the contacted confluent culture of T24 bladder epithelial cells, and inoculating and incubating the confluent culture of T24 bladder epithelial cells with UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell; and
b) Washing the inoculated and incubated 100% confluent culture of T24 bladder epithelial cells;
c) Detaching and resuspending homogeneously the T24 bladder epithelial cells to obtain a suspension of T24 bladder epithelial cells;
d) Analysing by high-throughput flow cytometry the suspension of T24 bladder epithelial cells and measuring the intensity of fluorescence emitted by the fluorescent reporter protein within the single cells present in the suspension of T24 bladder epithelial cells;
e) Determining the anti-adhesive and/or anti-internalizing capacity of the candidate molecule based on the measured intensity of fluorescence.
DETAILED DESCRIPTION
The invention relates to a method of assaying adhesion of uropathogenic Escherichia coli (UPEC) bacteria to bladder epithelial cells which can advantageously be implemented for the screening of anti-adhesive molecules, as an alternative to antibiotics, for the treatment of urinary tract infections (UTI).
The methods of the invention are carried out using the T24 cells (ATCC® HTB-4™) as the bladder epithelial cells. As known to the skilled person, cell lines can derive after a number of passages. In this assay, T24 cells that have been maintained in culture for more than 2 months should preferably not be used as the consequence of cell aging is an increase in sensitivity to UPEC adhesion and a higher rate of detachment.
In the methods of the invention, a 100% confluent culture of T24 bladder epithelial cells is provided which is afterwards inoculated and incubated with UPEC bacteria. The number of T24 bladder epithelial cells, and thus, their confluency at the moment of infection with UPEC bacteria is a key parameter for this assay. Incubating T24 bladder epithelial cells with some UPEC strains can induce cell cytotoxicity characterized by cell rounding and cell loss upon washes. Dense cell monolayers seem more resistant to UPEC adhesion, resulting in more consistent bacterial adhesion.
The term "confluent" herein described refers to a ratio of an area occupied by cells to the entire culture surface (e.g. the surface of a flask, of a dish, or of a well in a multi- well plate). For example, a state in which 90% of the area of the culture support is occupied by cells is referred to as "90% confluent". The culture of T24 bladder epithelial cells is 100% confluent when used in the methods of the invention, which means that the entire culture surface is covered by the cells, and no more room is left for the cells to grow as a monolayer.
An optimal T24 bladder epithelial cell number ranges from 2 x104 to 5x104 cells/well, in a 96-well plate format.
Any UPEC bacteria may be used in the frame of the method of the invention.
It is an advantage of the invention that, due to the optimization of the T24 bladder epithelial cell density (confluency) and of the ratio between UPEC and T24 bladder epithelial cells at the time of inoculation (multiplicity of infection (MOI)), even the more cytotoxic UPEC can be assayed without occurrence of significant bladder epithelial cell loss. The inventors observed that MOI is another parameter that influences UPEC- induced cytotoxicity, the cell loss being proportional to the MOI. The MOI giving satisfactory results in this assay ranged from 100 to 500, preferably from 100 to 250.
Cytotoxicity is, for instance, correlated with the production of Cytotoxic Necrotizing Factor 1 (CNF1 ) (Flatau, 1997). The fluorescent UPEC strains tested by the inventors were derived from clinical isolates and genetically characterized by PCR for the presence of genes encoding virulence factors genes, including cnfl (see Table 1 ). The cytotoxicity observed with the CNF1 -expressing strain assayed by the inventors (G50 strain) was successfully minimized in the assay of the invention.
Accordingly, the UPEC bacteria used in the frame of the methods of the invention can express virulence factors. In an embodiment the UPEC bacteria express one or more of the afa/draBC, sfa, foe, fimH, papG2, papG3, papA, papC, papE, and cnfl virulence factors, in particular at least the enf 1 virulence factor. For assaying UPEC bacteria adhesion to the bladder epithelial cell by high- throughput flow cytometry, the UPEC bacteria are beforehand transformed with a plasmid encoding a fluorescent reporter protein.
The term "high-throughput" as intended herein means the quantification of a high number of cells in a short period of time. Each well contains up to 5x104 cells and less than one minute per well is required in the assay.
A "fluorescent reporter protein" as used herein means a reporter protein that is detectable based on fluorescence wherein the fluorescence is emitted by the reporter protein directly. Examples of fluorescent proteins are GFP and EGFP whose presence in/on cells can be readily detected by flow cytometry.
The plasmid encoding a fluorescent reporter protein typically further comprises an antibiotic resistance gene. Accordingly, the UPEC bacteria transformed with said plasmid encoding a fluorescent reporter protein and antibiotic resistance protein can be assayed in non-sterile body fluids. Indeed treatment of the non-sterile body fluids with the antibiotic to which the transformed UPEC bacteria are resistant makes it possible to eliminate other pathogens likely present in the non-sterile body fluids and that could otherwise interfere with the assay.
In an embodiment, the plasmid encoding a fluorescent reporter protein is the so- called plN25 (pBBR-GFP-camr) which map is shown on Figure 5 and sequence is as follows (SEQ ID NO:1 ):
ctagagcggccgccaccgcggtggagctccaattcgccctatagtgagtcgtattacgcgcgctca ctggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgca gcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacag ttgcgcagcctgaatggcgaatggaaattgtaagcgttaatattttgttaaaattcgcgttaaatt tttgttaaatcagctcattttttaaccaataggccgactgcgatgagtggcagggcggggcgtaat ttttttaaggcagttattggtgcccttaaacgcctggtgctacgcctgaataagtgataataagcg gatgaatggcagaaattcgaaagcaaattcgacccggtcgtcggttcagggcagggtcgttaaata gccgcttatgtctattgctggtttaccggtttattgactaccggaagcagtgtgaccgtgtgcttc tcaaatgcctgaggccagtttgctcaggctctccccgtggaggtaataattgacgatatgatcatt tattctgcctcccagagcctgataaaaacggtgaatccgttagcgaggtgccgccggcttccattc aggtcgaggtggcccggctccatgcaccgcgacgcaacgcggggaggcagacaaggtatagggcgg cgaggcggctacagccgatagtctggaacagcgcacttacgggttgctgcgcaacccaagtgctac cggcgcggcagcgtgacccgtgtcggcggctccaacggctcgccatcgtccagaaaacacggctca tcgggcatcggcaggcgctgctgcccgcgccgttcccattcctccgtttcggtcaaggctggcagg tctggttccatgcccggaatgccgggctggctgggcggctcctcgccggggccggtcggtagttgc tgctcgcccggatacagggtcgggatgcggcgcaggtcgccatgccccaacagcgattcgtcctgg tcgtcgtgatcaaccaccacggcggcactgaacaccgacaggcgcaactggtcgcggggctggccc cacgccacgcggtcattgaccacgtaggccgacacggtgccggggccgttgagcttcacgacggag atccagcgctcggccaccaagtccttgactgcgtattggaccgtccgcaaagaacgtccgatgagc ttggaaagtgtcttctggctgaccaccacggcgttctggtggcccatctgcgccacgaggtgatgc agcagcattgccgccgtgggtttcctcgcaataagcccggcccacgcctcatgcgctttgcgttcc gtttgcacccagtgaccgggcttgttcttggcttgaatgccgatttctctggactgcgtggccatg cttatctccatgcggtagggtgccgcacggttgcggcaccatgcgcaatcagctgcaacttttcgg cagcgcgacaacaattatgcgttgcgtaaaagtggcagtcaattacagattttctttaacctacgc aatgagctattgcggggggtgccgcaatgagctgttgcgtaccccccttttttaagttgttgattt ttaagtctttcgcatttcgccctatatctagttctttggtgcccaaagaagggcacccctgcgggg ttcccccacgccttcggcgcggctccccctccggcaaaaagtggcccctccggggcttgttgatcg actgcgcggccttcggccttgcccaaggtggcgctgcccccttggaacccccgcactcgccgccgt gaggctcggggggcaggcgggcgggcttcgccttcgactgcccccactcgcataggcttgggtcgt tccaggcgcgtcaaggccaagccgctgcgcggtcgctgcgcgagccttgacccgccttccacttgg tgtccaaccggcaagcgaagcgcgcaggccgcaggccggaggcttttccccagagaaaattaaaaa aattgatggggcaaggccgcaggccgcgcagttggagccggtgggtatgtggtcgaaggctgggta gccggtgggcaatccctgtggtcaagctcgtgggcaggcgcagcctgtccatcagcttgtccagca
gggttgtccacgggccgagcgaagcgagccagccggtggccgctcgcggccatcgtccacatatcc acgggctggcaagggagcgcagcgaccgcgcagggcgaagcccggagagcaagcccgtagggcgaa taaatacctgtgacggaagatcacttcgcagaataaataaatcctggtgtccctgttgataccggg aagccctgggccaacttttggcgaaaatgagacgttgatcggcacgtaagaggttccaactttcac cataatgaaataagatcactaccgggcgtattttttgagttatcgagattttcaggagctaaggaa gctaaaatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaa cattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacg gcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcc cgcctgatgaatgctcatccggaattccgtatggcaatgaaagacggtgagctggtgatatgggat agtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaa taccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaac ctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagt ttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggc aaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgt gatggcttccatgtcggcagaatgcttaatgaattacaacagtttttatgcatgcgcccaatacgc aaaccgcctctccccgcgcgttggccgattcattaactagtagcccgcctaatgagcgggcttttt tttggtaccgggccccccctcgaggtcgacggtatcgataagcttgatatcgaattcctgcaggag ctgttgacaattaatcatcggctcgtataatgtgtggaattgtgagcggataacaatttcacacag gaagatctcatatgagtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattag atggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaa aacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcacta ctttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttca agagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactaca agacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattg attttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtat acatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaag atggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttt taccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagacc acatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaat agt.
Any prokaryotic expression plasmid allowing the expression of a fluorescent protein conferring resistance to an antibiotic can be used in theory in the frame of the methods according to the invention. Preferably, the antibiotic resistance gene of the plasmid is selected so as to confer resistance to an antibiotic which is scarcely used or not used in clinics to avoid potential interference of resistant bacteria that may be present in biological fluids (e.g. urine).
The UPEC bacteria can be cultivated in any appropriate culture medium, such as a Luria-Bertani broth (LB typical composition: peptone 140 10 g/L, yeast extract 5g/L, sodium chloride 5 g/L).
Both in the method of assaying adhesion and internalization of UPEC bacteria to T24 bladder epithelial cells and in the method of screening according to the invention, inoculating and incubating the 100% confluent culture of T24 bladder epithelial cells with UPEC bacteria is performed at 37±1 °C, in 5% C02, for 2.5 to 4 hours, preferably for about 3 hours. Incubating for shorter period of time lowers the efficiency of UPEC adhesion to T24 bladder epithelial cells.
In another embodiment, inoculation and incubation are performed at 4±1 °C. Incubation at 4°C decreases the mean fluorescence intensity (MFI) of infected cells, and adhesion, only, of UPEC bacteria to T24 bladder epithelial cells is then measured. In the frame of the screening method of the invention, the candidate molecule is either simultaneously contacted with the UPEC bacteria and T24 bladder epithelial cells (step a1 ), or preincubated with the T24 bladder epithelial cells (step a2), or preincubated with the UPEC bacteria (step a3). The way the method of screening is carried out may be adapted depending on the known or assumed mechanism of action of the candidate molecules to be assayed (i.e. if the candidate molecule acts on a target on/in the UPEC or on a target on/in the T24 bladder epithelial cells).
For instance when the candidate molecule is preincubated with the T24 bladder epithelial cells, UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein are contacted with the candidate molecule by adding the candidate molecule in a culture of the UPEC bacteria and incubating the UPEC bacteria and candidate molecule under conditions sufficient to allow the candidate molecule to interact with the UPEC bacteria. These conditions can be for instance culturing at 37±1 °C, for 2 to 24h, such as for 2 to 4h, or for 12 to 14h, preferably for 16 to 18h. In an embodiment culturing is performed with agitation (e.g. 200 rpm). UPEC bacteria preincubated with the candidate molecule are then washed before being inoculated and incubated into a 100% confluent culture of T24 bladder epithelial cells at a MOI of 100 to 500 bacteria/ bladder epithelial cell. As mentioned above, this step of incubation is typically performed at 37±1 °C, in 5% C02, for 2.5 to 4 hours, preferably for about 3 hours.
When the candidate molecule is preincubated with the T24 bladder epithelial cells, the candidate molecule is added into the 100% confluent culture of bladder epithelial cells and incubated with the cells under conditions sufficient to allow the candidate molecule to interact with the T24 bladder epithelial cells. These conditions can be for instance culturing at 37±1 °C, for 2 to 24h, such as for 2 to 4h, or for 12 to 14h, preferably for 16 to 18h. The T24 bladder epithelial cells preincubated with the candidate molecule are then washed before being inoculated and incubated with the UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein at a MOI of 100 to 500 bacteria/ bladder epithelial cell. As mentioned above, this step of incubation is typically performed at 37±1 °C, in 5% C02, for 2.5 to 4 hours, preferably for about 3 hours.
When the candidate molecule is simultaneously contacted with the UPEC bacteria and T24 bladder epithelial cells, this is typically performed by inoculating and incubating the 100% confluent culture of T24 bladder epithelial cells with (i) UPEC bacteria
transformed with a plasmid encoding a fluorescent reporter protein at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell and with (ii) the candidate molecule. Incubation is typically performed at 37±1 °C, in 5% C02, for 2.5 to 4 hours, preferably for about 3 hours.
After incubation of the T24 bladder epithelial cells with the UPEC bacteria, and candidate molecule if present, the culture of T24 bladder epithelial cells is washed to remove non adherent UPEC bacteria (and candidate molecule if present).
In an embodiment, the 100% confluent culture of bladder epithelial cells with UPEC bacteria inoculated and incubated with UPEC bacteria is washed once with PBS. A single wash with PBS is generally sufficient to remove most unbound UPEC. Washing more than once results in cell loss, that is proportional to the number of washes. Furthermore subsequent analysis using flow cytometry allows the exclusion of free fluorescent bacteria.
The methods of the invention then comprise the step of detaching and resuspending homogeneously the T24 bladder epithelial cells to obtain a suspension of T24 bladder epithelial cells. The washed T24 bladder epithelial cells are then detached from their culture support is typically by aspiring the medium and adding trypsin-EDTA until the cells start to detach (or get rounded) which usually takes a few minutes (e.g. 1 -5 min). PBS is then added and the suspension is homogenized by pipetting up and down 2 to 4 times, preferably 3 times. T24 bladder epithelial cells must be sufficiently homogenized to avoid cell aggregates, but the homogenization treatment must not be too harsh in order to avoid affecting cell viability. In the methods of the invention, the subsequent flow cytometry analysis requires cells suspensions in which cells are individualized, because cells clumps are excluded from the analysis through gating on single cells.
The suspension of T24 bladder epithelial cells is then analyzed by high-throughput flow cytometry to measure the intensity of fluorescence emitted by the fluorescent reporter protein among the single cells present in the cell suspension.
In order to limit fluorescence analysis to the individualised cells, a gating on single cells is performed on the FSC-A/FSC-H dot plot (plot displaying forward-scattered light - Area vs forward-scattered light - height) by selecting cells present on the diagonal of the dot plot.
Furthermore free fluorescent bacteria are excluded from flow cytometry by gating on the FSC-A SSC-A (side-scattered light - area) dot plot.
Fluorescence emission is preferably read at the wavelength of maximum fluorescence emission of the fluorescent reporter protein. For instance, the wavelength of maximum fluorescence emission of wild-type GFP or EGFP is 509 nm. Determining the efficiency of UPEC bacteria adhesion and internalization (in)to T24 bladder epithelial cells based on the measured intensity of fluorescence is usually carried out by comparing the measured intensity of fluorescence to a control.
The control can be a predetermined single value or range of values, or a measure of intensity of fluorescence in a "negative control", i.e. a 100% confluent culture of T24 bladder epithelial cells which has been incubated typically at 37±1 °C, in 5% C02, for 2.5 to 4 hours, preferably for about 3 hours, without any UPEC bacteria, and which was then submitted to washed, detached and resuspended homogeneously and analysed by high- throughput flow cytometry. Determining the anti-adhesive and/or anti-internalizing capacity of the candidate molecule based on the measured intensity of fluorescence is also usually carried out by comparing the measured intensity of fluorescence to a control.
The control can be a predetermined single value or range of values, or a measure of intensity of fluorescence in
- a "negative control", i.e. a 100% confluent culture of T24 bladder epithelial cells which has been incubated typically at 37±1 °C, in 5% C02, for 2.5 to 4 hours, preferably for about 3 hours, without any UPEC bacteria, and which was then submitted to washed, detached and resuspended homogeneously and analysed by high-throughput flow cytometry, and/or
- a "positive control" , i.e. a 100% confluent culture of T24 bladder epithelial cells which has been incubated typically at 37±1 °C, in 5% C02, for 2.5 to 4 hours, preferably for about 3 hours, with UPEC bacteria but without any candidate molecule, and which was then submitted to washed, detached and resuspended homogeneously and analysed by high-throughput flow cytometry
Based on the comparison of the measures of intensity of fluorescence, a candidate molecule is identified as a molecule having anti-adhesive and/or anti-internalizing capacity if the intensity of fluorescence measured is decreased for instance by at least 10%, 20%, 30%, 40%, 50% or more, compared with a positive control and/or if the intensity of fluorescence is statistically significantly different from the intensity of fluorescence of the negative control. In an embodiment, a statistical significant difference is assayed by calculating the p value using 2 independent sample t-test.
In an embodiment, the method of screening of the invention is implemented with a cranberry extract or a molecule isolated from cranberry extract. Compared to previously used methods, the methods of the inventions are robust and very fast: generating data using fluorescence microscopy was estimated to require 5 hours for only one condition (tested in triplicate), while the assay according to the instant disclosure requires only 3 min/condition. Moreover, using a 96 well-plates and a microplate reader allow to test up to 30 different molecules or conditions with 1 h30 in an automated fashion, ie without requiring the presence of a technical staff during the acquisition of the data. These parameters fulfil the requirement for screening purposes, or for regular measurement of batch-to-batch efficiency of commercialized anti-adhesion molecules. The invention will be further illustrated in view of the following figures and examples.
FIGURES
Figure 1 : Detection of UPEC adhesion on epithelial bladder cells using flow cytometry.
A) Histogram showing the level of intensity of T24 cells incubated or not with a fluorescent UPEC with an MOI of 500. The gating strategy to distinguish fluorescent vs non fluorescent cells is show, and the % of fluorescent infected cells is indicated.
B) Median fluorescent intensity (MFI) values of T24 cells incubated or not with the fluorescent UPEC with an MOI of 500. The histogram shows mean values for at least 3 independent replicates (±SD).
Figure 2: Adhesion efficiency of different E. coli strains. MFI of T24 cells incubated with different E. coli strains with an MOI of 100. The histogram shows mean values for at least 3 independent replicates (±SD). The black line indicates the basal autofluorescence of T24 cells, measured on non-infected (Nl) cells.
Figure 3: Flow-cytometry based assay can quantify the inhibition of UPEC adhesion.
A) Histogram showing the level of intensity of T24 cells incubated with cranberry- treated or untreated fluorescent UPEC or not incubated with bacteria, with an MOI of 500.
B) Median fluorescent intensity (MFI) of T24 cells incubated with untreated or cranberry-treated fluorescent UPEC with an MOI of 500. The histogram shows mean values for at least 3 independent replicates (±SD).
Figure 4: Fluorescence intensity of UPEC measured by flow cytometry.
Histogram showing the level of intensity of non-fluorescent UPEC, untreated fluorescent UPEC and cranberry-treated fluorescent UPEC.
Figure 5: plN25 plasmid map.
Figure 6: Influence of the number of washes on cell losses.
Histogram showing the percentage of GFP-positive T24 cells infected with G50-GFP at an MOI of 500 upon increasing the number of post-infection PBS washes after infection. The histogram shows mean values for at least 3 independent replicates (±SD). The black line indicates the basal autofluorescence of T24 cells, measured on non- infected (Nl) cells.
Figure 7: Influence of the cell monolayers density on resistance to G50- induced detachment.
Histogram showing the percentage of GFP-positive T24 cells infected with G50-GFP at an MOI of 500 upon using different cell numbers in 96-well plates. The histogram shows mean values for at least 3 independent replicates (±SD). The black line indicates the basal autofluorescence of T24 cells, measured on non-infected (Nl) cells.
Figure 8: Influence of the incubation time on the efficiency of UPEC interaction with bladder cells.
Median fluorescent intensity (MFI) of T24 cells infected with G50-GFP at an MOI of 500 after different incubation times. The histogram shows mean values for at least 3 independent replicates (±SD). The black line indicates the basal autofluorescence of T24 cells, measured on non-infected (Nl) cells.
EXAMPLE MATERIALS
- Fluorescent uropathogenic Escherichia coli (UPEC) strains (transformed with a pBBR- GFP-carrT plasmid, herein called PIN25), frozen glycerol stocks in Luria Broth (LB) containing 15% glycerol, kept at -80 °C;
- Human urinary bladder epithelial (T24) cells (ATCC HTB-4), frozen stocks in fetal bovine serum (FBS) supplemented with 10 % dimethyl sulfoxide (DMSO), kept in liquid nitrogen;
- LB media : dissolve 20 g of a commercial LB preparation (+ 13g of agar for plates) in 800ml of purified water and sterilize by autoclaving at 121 °C for 15 min;
- Chloramphenicol solution, 15 mg/ml in ethanol, kept at -20°C;
- Pyrogen free-FBS, heat inactivated (56 °C for 30 min in a water bath), kept at -20°C; - Cell culture media : McCoy supplemented with 2mM L-Glutamine and 10% FBS, kept at 4°C;
- Phosphate Buffered Saline (PBS), without calcium and magnesium, kept at room temperature;
- Sterile trypsin-EDTA solution, 0,05% trypsin - 0,02% EDTA in PBS, kept at 4°C;
- Sterile PBS + FBS, 10% FBS + 1 mM EDTA in PBS, kept at 4°C;
- Propidium iodide (PI), 1 mg/ml stock solution in water, kept at 4°C protected from light;
- Sterile 15ml tubes with loose caps;
- 96 well plates with flat bottom (cell culture quality);
- 96 well plates with V-shaped bottom;
- Multichannel pipettes (10-100 μΙ and 100-1000 μΙ) and corresponding sterile filtered tips; - Microscope with transmission light (to visualize the cells);
- C02 incubator;
- Table-top micro-centrifuge;
- Spectrophotometer (to read the optical density at 600 nm);
- Vacuum pump coupled to a flexible rubber tube (long enough to be conveniently used in the interior of the laminar hood). A multichannel aspiration device can be used to aspirate the different buffers during the assay;
- Flow cytometer, equipped with a 488nm laser, a microplate sampler and a precision syringe pump (allowing volumetric pipetting and sample mixing) for absolute counting of cells.
METHODS
Culture of T24 cells and preparation of bacterial inoculums
T24 cells are routinely cultured in 75 cm2 plastic culture flasks at 37°C with 5% C02. Approximately 24h before the adhesion assay, detach the cells from the flasks by trypsinization, add propidium iodide to the cell suspension (final concentration 1 μg/ml), determine the concentration of live cells using a flow cytometer (cells stained with PI are considered to be dead) and seed 5x104 live cells per well in a 96-well culture plate with flat bottom. Prepare at least 3 wells per condition tested. On the day of the assay, T24 cells should be at 100 % confluency.
The fluorescent strains of uropathogenic E. coli are maintained in LB plates containing chloramphenicol (15 μg/ml). To prepare the bacterial cultures, inoculate 2 ml of LB supplemented with chloramphenicol (15 μg/ml) with a colony of fluorescent UPEC in a sterile glass tube with loose cap. Eventually add the anti-adhesion molecule to be tested. Incubate at 37°C with agitation (200 rpm) for 16-18h.
Infection of T24 cells by UPEC
Prepare a 1 /20th dilution of the overnight bacterial cultures in 2 ml of LB supplemented with chloramphenicol (15 μg/ml) and (if appropriate) with the anti-adhesion molecule to be tested. Incubate at 37°C with agitation (200 rpm) until the OD reaches 0,5 to 1 (approximately 2h).
Wash the bacteria twice with sterile PBS by centrifugation (2500 g at room temperature for 3 min). Resuspend the pellet in 1 ml of PBS and measure the optical density (OD) at 600 nm of this bacterial suspension using a spectrophotometer. Calculate the corresponding concentration of bacteria (for E. coli, an OD of 1 corresponds 8x108 bacteria/ml) and the volume needed to prepare the bacterial inoculums in cell culture media, given that the MOI (multiplicity of infection) applied to T24 cells should be 100 bacteria/cell, that each well contains 5x104 cells and that 200 μΙ will be applied to cells.
Wash the T24 cells by aspirating the cell culture media and replacing gently by 100 μΙ of PBS. After aspiration of PBS, apply 200 μΙ of the bacterial inoculums to the corresponding wells and incubate for 3h at 37°C in a 5 % C02 atm.
In an assay designed to test a candidate anti-adhesion molecule, a negative control
(cells not incubated with the fluorescent bacteria) and a positive control (cells incubated with untreated UPEC) are included.
Analysis of UPEC adhesion using flow cytometry
Aspirate the infection medium and gently wash the cells with 100 μΙ of PBS. Aspirate all the PBS and add rapidly (so that the cell do not dry out) 25 μΙ of trypsin-EDTA. As soon as the cells start to detach (cells get rounded), add 100 μΙ of PBS + FBS, homogenize the cell suspension by pipetting up & down three times and transfer the cells into a V-shaped 96 well plate without changing the tips.
Analyse rapidly the cells with the flow cytometer. The gating strategy for analysis should be: 1 ) gating around cells on a FSC-A/SSC-A dot plot (to exclude cell debris and bacteria) and 2) further gating around single cells on a FSC-A/FSC-H dot plot (to exclude cell doublets that would give false positives). Fluorescence of single cells are then analysed in the light path corresponding to the fluorescence of the UPEC strain.
The efficiency of UPEC adhesion to T24 cells is expressed as the MFI (Median
Fluorescence Intensity) of cells, calculated as the mean value for at least 3 replicates. A molecule can be considered to have a significant anti-adhesion effect on UPEC when statistical tests (p value calculated using 2 independent sample t-test) show that the corresponding MFI is different from the positive control MFI (obtained with the untreated bacteria) with p<0.05.
RESULTS
First, to verify whether flow cytometry was sensitive enough to detect bacterial adhesion to cells, we incubated T24 cells with a fluorescent UPEC and analysed their fluorescence. Incubating T24 cells with UPEC increased their fluorescence level, with around 87% of cells being fluorescent compared to non-infected cells (Figure 1 A). The level of fluorescence of cells can also be measured using their median fluorescence intensity (MFI) value, the MFI of non-infected cells corresponding to their baseline autofluorescence. Incubation of T24 cells with the fluorescent UPEC also strongly increased their MFI (Figure 1 B).
In parallel to the experiment described above, we performed adhesion assays on T24 cells grown on coverslips and visualized cells using fluorescence microscopy. Using this method, we quantified the number of fluorescent bacteria attached to each T24 cell and found 25 bacteria/cell (± 10,4, n=50), which is consistent with values from the literature (Gupta et al., 2007 J Urol.; 177(6): 2357-2360; Howell et al., 2010 BMC Infect Dis.; 10:94). These data thus show that flow cytometry is sensitive enough to detect an increase of fluorescence due to the adhesion of 25 bacteria on a T24 cell.
We then tested different bacterial strains in our adhesion assay. We used a panel of E. coli strains representing different types of UTI (cystitis, pyelonephritis or asymptomatic colonization) and a non-adherent laboratory strain as a negative control. All strains were transformed with the same fluorescence-encoding plasmid and were characterized by PCR for the presence of several virulence genes, including genes encoding adhesins (Table 1 ).
Table 1 : Characteristics of E. coli strains used in this study. Strains were genotyped by PCR for genes encoding adhesins {afa/draBC for Dr Adhesin family, sfa and foe for S/F1 C pili, fimH for Type 1 pili, papG2, papG3, papa, papC, and papE for P pili) and for the toxin- encoding gene cnfl.
In our assay, the UPEC strains G50, G09 and CFT073 increased very significantly the MFI of T24 cells, while G38 did only mildly and DH5a not at all (Figure 2). This suggests that only P-type pili UPEC strains attach strongly to uroepithelial cells. Thus, our assay can also quantify the efficiency of adhesion of different UPEC strains to T24 cells.
We then optimized different parameters of the assay using strain G50-GFP. Using an MOI of 500 (which induces an acute cytopathic effect in T24 cells), the proportion of fluorescent T24 cells decreased progressively with successive post-infection washes (Figure 6), confirming that infected cells were lost upon washes. Because flow cytometry analysis allows the exclusion of unbound bacteria, we decided to proceed with a single PBS wash for all subsequent experiments. Using an MOI of 500, a single wash and different T24 cell numbers, we saw that dense cell monolayers are more resistant to G50- induced detachment (Figure 7). Using an MOI of 500, a single wash and a cell density of 5x104 cells/well, we saw that incubating T24 cells with G50-GFP for shorter than 3 hours decreased the infection-induced cytopathic effect, but also decreased the efficiency of UPEC interaction with bladder cells (Figure 8).
Finally, in order to confirm that the increase of T24 cells' MFI was due to the adhesion of fluorescent UPEC, we added a molecule with known anti-adhesion properties in our assays. We used cranberry extracts (Reference M090774, Noveal, France), known to contain proanthocyanidins (PAC) and to inhibit adhesion of UPEC onto T24 cells. The MFI measured using UPEC pre-treated with cranberry extracts were significantly lower (p<0,05) than with non-treated bacteria (Figure 3).
As a control experiment, we also analysed the bacteria using flow cytometry and observed that this treatment did not affect the fluorescence intensity of the bacteria themselves (Figure 4).
Altogether, these data show that the increase of MFI observed incubation of T24 cells with fluorescent UPEC is due to adhesion of bacteria to the cells and that the lower MFI of cells upon treatment with cranberry is due to an inhibition of UPEC adhesion.
Claims
1 . A method of assaying adhesion and/or internalization of uropathogenic Escherichia coli (UPEC) bacteria (in)to T24 (ATCC® HTB-4™) bladder epithelial cells which comprises:
a) Inoculating and incubating a 100% confluent culture of T24 bladder epithelial cells with UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell;
b) Washing the inoculated and incubated 100% confluent culture of T24 bladder epithelial cells;
c) Detaching and resuspending homogeneously the T24 bladder epithelial cells to obtain a suspension of T24 bladder epithelial cells;
d) Analysing by flow cytometry the suspension of T24 bladder epithelial cells and measuring the intensity of fluorescence emitted by the fluorescent reporter protein among the single cells present in the suspension of T24 bladder epithelial cells;
e) Determining the efficiency of UPEC bacteria adhesion and/or internalization (in)to T24 bladder epithelial cells based on the measured intensity of fluorescence.
2. A method of screening a candidate molecule for its anti-adhesive and/or anti- internalizing capacity, said method comprising:
a1 ) Inoculating and incubating a 100% confluent culture of T24 bladder epithelial cells with (i) UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria bladder epithelial cell and with (ii) a candidate molecule; or
a2) contacting UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein with a candidate molecule, washing the contacted UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, and inoculating and incubating a 100% confluent culture of T24 bladder epithelial cells with said contacted UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell; or
a3) contacting a 100% confluent culture of T24 bladder epithelial cells with a candidate molecule, washing the contacted confluent culture of T24 bladder
epithelial cells, and inoculating and incubating the confluent culture of T24 bladder epithelial cells with UPEC bacteria transformed with a plasmid encoding a fluorescent reporter protein, at a multiplicity of infection (MOI) of 100 to 500 bacteria/ bladder epithelial cell; and
b) Washing the inoculated and incubated 100% confluent culture of T24 bladder epithelial cells;
c) Detaching and resuspending homogeneously the T24 bladder epithelial cells to obtain a suspension of T24 bladder epithelial cells;
d) Analysing by flow cytometry the suspension of T24 bladder epithelial cells and measuring the intensity of fluorescence emitted by the fluorescent reporter protein within the single cells present in the suspension of T24 bladder epithelial cells;
e) Determining the anti-adhesive and/or anti-internalizing capacity of the candidate molecule based on the measured intensity of fluorescence.
3. The method according to claim 1 or 2, wherein step e) is carried out by comparing the measured intensity of fluorescence to a control.
4. The method according to any one of claims 1 to 3, wherein the plasmid encoding a fluorescent reporter protein is pBBR-GFP-camr.
5. The method according to any one of claims 1 -4, wherein the UPEC bacteria express one or more of the virulence factors afa/draBC, sfa, foe, fimH, papG2, papG3, papA, papC, papE, and enf 1 .
6. The method according to any one of claims 1 -5, wherein inoculating and incubating the 100% confluent culture of T24 bladder epithelial cells with UPEC bacteria is performed at 37±1 °C, in 5% C02, for 2.5 to 4 hours.
7. The method according to any one of claims 1 -6, wherein the 100% confluent culture of T24 bladder epithelial cells with UPEC bacteria inoculated and incubated with UPEC bacteria is washed once with PBS.
8. The method according to any one of claims 2-7, wherein the candidate molecule is a cranberry extract or a molecule isolated from cranberry extract.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP15305584 | 2015-04-17 | ||
| EP15305584.3 | 2015-04-17 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016166329A1 true WO2016166329A1 (en) | 2016-10-20 |
Family
ID=52991664
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/EP2016/058420 Ceased WO2016166329A1 (en) | 2015-04-17 | 2016-04-15 | Flow cytometry-based assay to measure adhesion of upec to bladder epithelial cells |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2016166329A1 (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2017501146A (en) * | 2013-12-18 | 2017-01-12 | チエシ ファルマスティスィ エス.ピー.エー. | Isochromene derivatives as phosphoinositide 3-kinase inhibitors |
-
2016
- 2016-04-15 WO PCT/EP2016/058420 patent/WO2016166329A1/en not_active Ceased
Non-Patent Citations (12)
| Title |
|---|
| A. P. TITTEL ET AL: "Kidney Dendritic Cells Induce Innate Immunity against Bacterial Pyelonephritis", JOURNAL OF THE AMERICAN SOCIETY OF NEPHROLOGY., vol. 22, no. 8, 1 August 2011 (2011-08-01), US, pages 1435 - 1441, XP055221111, ISSN: 1046-6673, DOI: 10.1681/ASN.2010101072 * |
| GUPTA ET AL., J UROL., vol. 177, no. 6, 2007, pages 2357 - 2360 |
| GUR CHAMUTAL ET AL: "Natural Killer Cell-Mediated Host Defense against UropathogenicE. coliIs Counteracted by Bacterial HemolysinA-Dependent Killing of NK Cells", CELL HOST & MICROBE, vol. 14, no. 6, 2013, pages 664 - 674, XP028800898, ISSN: 1931-3128, DOI: 10.1016/J.CHOM.2013.11.004 * |
| HOWELL ET AL., BMC INFECT DIS., vol. 10, 2010, pages 94 |
| KIMBLE ET AL., J. NAT. PROD, vol. 77, 2014, pages 1102 - 1110 |
| KIMBLE ET AL., J. NAT. PROD., vol. 77, 2014, pages 1102 - 1110 |
| LINDSEY L KIMBLE ET AL: "Development of a Fluorometric Microplate Antiadhesion Assay Using Uropathogenic Escherichia coli and Human Uroepithelial Cells", JOURNAL OF NATURAL PRODUCTS, 22 April 2014 (2014-04-22), pages 1102 - 1110, XP055221203, Retrieved from the Internet <URL:http://pubs.acs.org/doi/pdf/10.1021/np400781y> [retrieved on 20151015] * |
| MEIKE SCHARENBERG ET AL: "A Flow Cytometry-Based Assay for Screening FimH Antagonists", ASSAY AND DRUG DEVELOPMENT TECHNOLOGIES, vol. 9, no. 5, 1 October 2011 (2011-10-01), pages 455 - 464, XP055132522, ISSN: 1540-658X, DOI: 10.1089/adt.2010.0357 * |
| NASLI RAFSANJANY ET AL: "Antiadhesion as a functional concept for protection against uropathogenic Escherichia coli: In vitro studies with traditionally used plants with antiadhesive activity against uropathognic Escherichia coli", JOURNAL OF ETHNOPHARMACOLOGY, vol. 145, no. 2, 1 January 2013 (2013-01-01), IE, pages 591 - 597, XP055220305, ISSN: 0378-8741, DOI: 10.1016/j.jep.2012.11.035 * |
| RAFSANJANY ET AL., J. ETHNOPHARMACOLOGY, vol. 145, 2013, pages 591 - 597 |
| ROCHA MARCELE N ET AL: "An alternative in vitro drug screening test usingLeishmania amazonensistransfected with red fluorescent protein", DIAGNOSTIC MICROBIOLOGY AND INFECTIOUS DISEASES, ELSEVIER SCIENCE PUBLISHING CO., AMSTERDAM, NL, vol. 75, no. 3, 10 January 2013 (2013-01-10), pages 282 - 291, XP028976703, ISSN: 0732-8893, DOI: 10.1016/J.DIAGMICROBIO.2012.11.018 * |
| SCHARENBERG ET AL., ASSAY DRUD DEV. TECHNOL., vol. 9, 2011, pages 455 - 464 |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2017501146A (en) * | 2013-12-18 | 2017-01-12 | チエシ ファルマスティスィ エス.ピー.エー. | Isochromene derivatives as phosphoinositide 3-kinase inhibitors |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Di Azevedo et al. | An overview on the molecular diagnosis of animal leptospirosis | |
| Corvec et al. | Epidemiology and new developments in the diagnosis of prosthetic joint infection | |
| McAuliffe et al. | Systematic application of multiplex PCR enhances the detection of bacteria, parasites, and viruses in stool samples | |
| Ritzmann et al. | Prevalence of Mycoplasma suis in slaughter pigs, with correlation of PCR results to hematological findings | |
| D'hondt et al. | Applications of flow cytometry in plant pathology for genome size determination, detection and physiological status | |
| US20200299748A1 (en) | Method for determining the concentration of intact microorganisms in a sample | |
| CN108048584A (en) | The brucellar probe of RAA Fluorometric assays and kit | |
| Samuel et al. | Laboratory maintenance of Coxiella burnetii | |
| CN102363815A (en) | Reagent for detecting salmonellae by using cross primer nucleic acid isothermal amplification technology, amplification method and detection method for salmonellae | |
| Larrosa et al. | Evaluation of Pseudomonas aeruginosa (PAO1) adhesion to human alveolar epithelial cells A549 using SYTO 9 dye | |
| Chandrakanth et al. | Molecular approaches for detection of pebrine disease in sericulture | |
| Goyal et al. | A comparison of Ziehl-Neelsen staining and fluorescent microscopy for diagnosis of pulmonary tuberculosis | |
| CN101768625A (en) | Pathogen detection method | |
| CN105506070A (en) | Specific probe and method thereof for rapid and sensitive quantification of staphylococcus aureus | |
| McFeters et al. | Rapid direct methods for enumeration of specific, active bacteria in water and biofilms | |
| WO2016166329A1 (en) | Flow cytometry-based assay to measure adhesion of upec to bladder epithelial cells | |
| CN104032023B (en) | A kind of molecular beacon probe of rapid detection non-tuberculous mycobacteria and detection method | |
| Fontana et al. | Use of flow cytometry for rapid and accurate enumeration of live pathogenic Leptospira strains | |
| Çelebi et al. | A comparative study of detecting Chlamydophila psittaci in pet birds using isolation in embryonated egg and polymerase chain reaction | |
| JP2016536592A (en) | Bacteria diagnosis | |
| Pattanayak et al. | Salmonella Infections with Biofilms in Developed and Developing Nations | |
| CN107121375A (en) | A kind of flow cytomery method of tetracyclin resistance bacterium in drinking water | |
| JP4235718B2 (en) | E. coli detection method and E. coli detection phage | |
| Begum et al. | Diagnosis of Bacterial Vaginosis by Acridine Orange Staining and its Comparison to Conventional Methods and Association of Gardnerella vaginalis with Bacterial Vaginosis. | |
| JP2003506029A (en) | Internal certification test method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16719322 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16719322 Country of ref document: EP Kind code of ref document: A1 |
