WO2016156537A1

WO2016156537A1 - Method for optimizing the assembly and production of hetero-multimeric protein complexes

Info

Publication number: WO2016156537A1
Application number: PCT/EP2016/057147
Authority: WO
Inventors: Giovanni Magistrelli; Pauline MALINGE; Yves Poitevin; Nicolas Fischer
Original assignee: Novimmune Sa
Priority date: 2015-03-31
Filing date: 2016-03-31
Publication date: 2016-10-06
Also published as: JP2018509922A; EP3277821B1; EP3277821A1; CN108040485A; JP6740244B2; US10113193B2; US20190226001A1; AU2016239683A1; AU2016239683B2; CA2981204C; ES2752054T3; CA2981204A1; DK3277821T3; US20160289727A1; PT3277821T; JP2020096641A

Abstract

Methods are provided to improve the expression of protein complexes by tuning the expression levels of each component required for the assembly of the complex. These methods are effective in limiting the expression of the dominant chain and, thus, equilibrating their relative abundance. The methods provided herein lead to a significant increase in productivity and final bispecific yields both in transient expression systems as well as in stably transfected mammalian cells.

Description

METHOD FOR OPTIMIZING THE ASSEMBLY AND PRODUCTION OF HETERO-MULTIMERIC PROTEIN COMPLEXES

RELATED APPLICATION

[0001] This application claims the benefit of U.S. Provisional Application No.

62/141,009, filed March 31, 2015, the contents of each of which are incorporated herein by reference in their entireties.

FIELD OF THE INVENTION

[0002] Methods are provided to improve the expression of protein complexes by tuning the expression levels of each component required for the assembly of the complex. These methods are effective in limiting the expression of the dominant chain and, thus, equilibrating their relative abundance. The methods provided herein lead to a significant increase in productivity and final bispecific yields both in transient expression systems as well as in stably transfected mammalian cells.

BACKGROUND OF THE INVENTION

[0003] Recombinant expression in bacterial, yeast, insect, plant or mammalian cells is fundamental for the production of proteins that are used for research as well as therapeutic applications. Recently, the yield of recombinant protein expression in Chinese Hamster Ovary (CHO) cells has been significantly enhanced by optimizing multiple parameters such as culture medium composition, fermentation parameters, as well as optimization of the constructs that are used to drive the expression of the gene encoding the recombinant protein of interest.

[0004] Some proteins are composed of several polypeptides that can associate in complexes that can be covalently or non-covalently linked. Antibodies are an example of such a class of proteins as they are composed of four polypeptides (i.e. two heavy chains and two light chains) that are linked by disulfide bonds. Due to their commercial and therapeutic importance, the expression of antibodies in CHO cells has been the subject of intense efforts of optimization, aiming at maximizing the expression of the two chains that compose the antibody. However, major differences can be observed as the levels of expression can vary up to 200-fold between antibodies.

[0005] Previous optimization approaches aimed at increasing the expression levels of polypeptides in order to achieve higher production yields. In the case of protein complexes composed of multiple polypeptides, unbalanced expression can limit assembly of the desired molecule, promote production of unwanted products and limit the overall production yield. Accordingly, there exists a need for methods for improving expression of protein complexes.

SUMMARY OF THE INVENTION

[0006] The methods of the disclosure improve the expression of protein complexes by tuning the expression levels of each component required for the assembly of the complex. In contrast to previously described approaches, reducing the expression of one or several polypeptides in the protein complex enhances the assembly and yield of the protein complex. The method is particularly suited to optimize the expression and yield of bispecific antibodies that often rely on the co-expression of multiple polypeptides. The unbalanced expression (too high or too low) of one of the components can lead to a significant decrease of the desired final product and an increase in the production of unwanted side-products. This limitation can impact both IgG-like bispecific formats as well as formats based on antibody fragments.

[0007] The method is in particular applicable for the optimization of the expression of bispecific antibodies named κλ-bodies (Fischer et al., Exploiting light chains for the scalable generation and platform purification of native human bispecific IgG. Nat. Comms, 6: 61 13 (2015)). This technology produces a fully-human bispecific antibody (BsAb), composed of a common heavy chain and two different light chains (one kappa and one lambda) (see e.g., WO 2012/023053). A proprietary tricistronic vector including these three chains is introduced in mammalian cells to produce the bispecific antibodies (κλ-bodies) that contain one κ and one λ chains in addition to the two monospecific antibodies IgGK and IgG .

[0008] In principle, if the two light chains are express at the same rate and assemble in a similar manner, the ratio for the three molecules should be 25% IgGK, 25% IgG and 50% ¾ϋκλ. However, an unbalanced expression level of the two chains is sometimes observed, leading a decrease in bispecific yield. One solution could be to increase the expression of the less expressed chain to restore the balance. However, this approach has been unsuccessful (as shown in the working examples provided herein).

[0009] In contrast, the methods of the disclosure are effective in limiting the expression of the dominant chain and, thus, equilibrating their relative abundance. The methods disclosed herein lead to a significant increase in productivity and final bispecific yields both in transient expression systems as well as in stably transfected CHO cells. Thus, the reduction of the expression of one or several polypeptides can lead to an overall increase in productivity. While the examples provided herein use κλ-bodies, the methods disclosed herein are applicable to other bispecific antibody formats and any other protein complex composed of several different polypeptides.

[00010] In some embodiments, the disclosure provides methods to increase the production yield of a protein complex composed of several polypeptides by decreasing the expression rate of one or several of the polypeptides. In some embodiments, the reduction in expression of one of the polypeptides is achieved by modification of transcription rate, translation rate, or mRNA stability. In some embodiments, the reduction in expression rate of one of the polypeptides is achieved by the modifying the mRNA secondary structure. In some embodiments, the reduction in expression of one of the polypeptides is achieved by modifying transcription rate, modifying translation rate, modifying mRNA stability, modifying mRNA secondary structure or by a combination of any of these factors.

[00011] In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate. In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by altering the codon composition of that polypeptide. In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate and altering the codon composition of that polypeptide.

[00012] In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate. In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by altering the codon composition of that polypeptide via the replacement of certain codons with codons that are less frequently used in the host cell that is used for expression of the protein complex. In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate, and altering the codon composition of that polypeptide via the replacement of certain codons with codons that are less frequently used in the host cell that is used for expression of the protein complex.

[00013] In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate. In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by altering the codon composition of that polypeptide via the replacement of certain codons with codons that are less frequently used in a mammalian host cell used for expression of the protein complex. In some embodiments, the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate and altering the codon composition of that polypeptide via the replacement of certain codons with codons that are less frequently used in a mammalian host cell used for expression of the protein complex.

[00014] In some embodiments, the protein complex is a multispecific antibody. In some embodiments, the protein complex is a bispecific antibody. In some embodiments, the bispecific antibody is a composed of two different light chains and a common heavy chain.

[00015] In some embodiments, the bispecific antibody includes a human lambda light chain and a human kappa light chain.

[00016] In some embodiments, the bispecific antibody includes a first and the second antigen-binding regions each comprise at least one complementarity determining region (CDR). In some embodiments, the first and the second antigen-binding regions each comprise at least two CDRs. In some embodiments, the first and the second antigen-binding regions each comprise each comprise three CDRs. In some embodiments, the CDRs are from an immunoglobulin heavy chain. In some embodiments, the heavy chain is a human heavy chain. In some embodiments, the CDRs are from a lambda light chain. In some embodiments, the CDRs are from a kappa light chain.

[00017] In some embodiments, the first antigen-binding region comprises a first immunoglobulin heavy chain variable domain, and the second antigen-binding region comprises a second immunoglobulin heavy chain variable domain.

[00018] In some embodiments, the first and the second immunoglobulin heavy chain variable domains independently comprise a human CDR, a mouse CDR, a rat CDR, a rabbit CDR, a monkey CDR, an ape CDR, a synthetic CDR, and/or a humanized CDR. In some embodiments, the CDR is human and is somatically mutated. [00019] In some embodiments, the bispecific antibodies comprise a human framework region (FR). In some embodiments, the human FR is a somatically mutated human FR.

[00020] In some embodiments, the bispecific antibodies are obtained by screening a phage library comprising antibody variable regions for reactivity toward an antigen of interest.

[00021] In some embodiments, the first and/or the second antigen-binding regions of the bispecific antibodies are obtained by immunizing a non-human animal such as a mouse, a rat, a rabbit, a monkey, or an ape with an antigen of interest and identifying an antibody variable region nucleic acid sequence encoding variable region specific for the antigen of interest.

[00022] In some embodiments, the bispecific antibody is a fully human bispecific antibody and has an affinity for each epitope, independently, in the micromolar, nanomolar, or picomolar range.

[00023] In some embodiments, the bispecific antibody is non-immunogenic or substantially non-immunogenic in a human. In some embodiments, the bispecific antibody lacks a non-native human T-cell epitope. In some embodiments, the modification of the

CHI region is non-immunogenic or substantially non-immunogenic in a human.

[00024] In some embodiments, the antigen-binding protein comprises a heavy chain, wherein the heavy chain is non-immunogenic or substantially non-immunogenic in a human.

[00025] In some embodiments, the heavy chain has an amino acid sequence that does not contain a non-native T-cell epitope. In some embodiments, the heavy chain comprises an amino acid sequence whose proteolysis cannot form an amino acid sequence of about 9 amino acids that is immunogenic in a human. In a specific embodiment, the human is a human being treated with the antigen-binding protein. In some embodiments, the heavy chain comprises an amino acid sequence whose proteolysis cannot form an amino acid sequence of about 13 to about 17 amino acids that is immunogenic in a human. In a specific embodiment, the human is a human being treated with the antigen-binding protein.

[00026] In some embodiments, more than one protein complex is co-expressed. In some embodiments, more than one antibody is co-expressed. BRIEF DESCRIPTION OF THE FIGURES

[00027] Figure 1 is an illustration depicting the mutations introduced in the lambda light chain to modulate its expression. VLCL2, wild type sequence; VLCL2_0, optimized sequence; VLCL2_1, VLCL2_2, VLCL2_3, sequences with increased levels of deoptimization.

[00028] Figure 2 is a graph indicating the concentration of IgG 1 antibodies obtained in the supernatant of producing Peak cells measured using the OCTET technology.

[00029] Figure 3 A is a graph of HIC profile of total purified IgG.

[00030] Figure 3B is a graph showing the different percentage of monospecific kappa antibody, monospecific lambda antibody, and bispecific IgG for the different constructs and that were derived from the HIC profiles.

[00031] Figure 4 is an isoelectric focusing polyacrylamide gel showing the expression of monoclonal and bispecific antibodies after affinity purification with CaptureSelect IgG Fc XL resin.

[00032] Figure 5 is a series of graphs indicating the total IgG productivity for different constructs from several CHO cells pools.

[00033] Figure 6A is gel-like image representation of an Agilent protein 80 chip run monitoring the sizes of the heavy and light chains from purified IgG in reducing and denaturing conditions.

[00034] Figure 6B is a graph showing the ratio of total kappa and lambda light chains for several CHO pools for each construct.

[00035] Figure 7 is a series of graphs showing the distribution in % for mono Kappa, mono Lambda and bispecific antibodies expressed by several CHO cell pools.

[00036] Figure 8 is a graph depicting the results of an ELISA showing the specific binding of each arm of the bispecific antibody against two targets (hCD19 and hCD47) as well as an irrelevant control protein (hIL6R).

DETAILED DESCRIPTION

[00037] Recombinant expression in bacterial, yeast, insect, plant or mammalian cells is fundamental for the production of proteins that are used for research as well as therapeutic applications. Recently, the yield of recombinant protein expression in Chinese Hamster Ovary cells has been significantly enhanced by optimizing multiple parameters such as culture medium composition, fermentation parameters, as well as optimization of the constructs that are used to drive the expression of the gene encoding the recombinant protein of interest. These include the improvements at transcriptional and translational levels as well as mRNA secondary structures and stability. Another important element is the optimization of codon usages so that it matches the expression host and avoid limitation due to low abundance tRNAs. The optimization process also can also include the removal of sequence repeats, killer motifs and splice sites and stable RNA secondary structures are avoided. The codon usage and GC content can be simultaneously adapted for the expression in CHO cells or other host cells. The aim of such modifications is to maximize translation and stability of RNA so that translation and thus expression of the desired polypeptide is maximal.

[00038] Some proteins are composed of several polypeptides that can associate in complexes that can be covalently or non-covalently linked. Antibodies are an example of such a class of proteins as they are composed of four polypeptides (i.e. two heavy chains and two light chains) that are linked by disulfide bonds. Antibodies carry a unique specificity for a target antigen that is driven by the Fab portion while they can engage with the immune via their Fc portion. A number of currently used biological therapeutics for cancer are monoclonal antibodies directed against antigens that are over expressed by targeted cancer cells. When such antibodies bind to the tumor cells, several processes can be triggered such as antibody-dependent cellular toxicity (ADCC), antibody-dependent cellular phagocytosis or complement-dependent cytotoxicity (CDC). Due to their commercial and therapeutic importance, the expression of antibodies in CHO cells has been the subject of intense efforts of optimization, aiming at maximizing the expression of the two chains that compose the antibody. However, major differences can be observed as the levels of expression can vary up to 200-fold between antibodies. The expression level is determined by a several factors including the level of light chain synthesis and heavy and light chain compatibility for assembly. It appears that high expression of light chain is beneficial for the overall secretion rates of whole antibody (Strutzenberger et al., Changes during subclone development and ageing of human antibody-producing recombinant CHO cells, J. Biotechnol, vol. 69(2-3): 215-16 (1999)). Indeed, reduction of light chain expression leads to accumulation of heavy chain in the endoplasmic reticulum and limits productivity.

[00039] Targeting or neutralizing a single protein with a monoclonal antibody is not always sufficient to achieve efficacy and this limits the therapeutic use of monoclonal antibodies. It is increasingly clear that in a number of diseases the neutralization of one component of a biological system is not sufficient provide a beneficial effect. Thus multispecific antibodies capable of engaging more than one antigen, e.g., bispecific antibodies, have been developed. A large number of bispecific antibody formats have been described and two bispecific antibodies have been approved so far while many others are currently in clinical trials (Kontermann RE, Brinkmann U., Bispecific antibodies, Drug Discover Today, (2015), available at dx.doi.org/10.1016/j.drudis.2015.02.2008). In many cases the bispecific antibody is composed of more than two polypeptides. The correct assembly can be based on random pairing of the chains, leading to a mixture of molecules from which the bispecific antibody can be purified. Alternatively, the interface of the chains can be engineered so that the desired pairing can be preferably obtained. In any case, the co- expression of multiple chains implies a higher complexity and the relative expression rates and thus abundance of the chains composing the bispecific molecule can potentially have a major impact on overall yield and efficiency in assembly.

[00040] Previous optimization approaches aimed at increasing the expression levels of polypeptides in order to achieve higher production yields. In the case of protein complexes composed of multiple polypeptides, unbalanced expression can limit assembly of the desired molecule, promote production of unwanted products and limit the overall production yield.

[00041] The methods of the disclosure improve the expression of protein complexes by tuning the expression levels of each component required for the assembly of the complex. The methods of the disclosure are effective in limiting the expression of the dominant chain and, thus, equilibrating their relative abundance. The methods disclosed herein lead to a significant increase in productivity and final bispecific yields both in transient expression systems as well as in stably transfected CHO cells. Thus, the reduction of the expression of one or several polypeptides can lead to an overall increase in productivity.

[00042] Table 1 is a table depicting the constructs generated with different sequence optimization and deoptimization levels. Table 1.

Deoptimization level

[00043] The sequences used are shown below in Tables 1.1, 1.2, and 1.3.

Table 1.1. VHCH WT (SEQ ID NO: 1) and VHCH OPT (SEQ ID NO: 2) sequences

1 ATGGAATGGAGCTGGGTCTTTCTCTTCTTCCTGTCAGTAACTACAGGTGT

1 ATGGAATGGTCCTGGGTGTTCCTGTTCTTCCTGTCCGTGACCACCGGCGT

51 CCACTCCGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTG

51 CCACTCCGAGGTGCAGCTGCTGGAATCTGGCGGCGGACTGGTCCAGCCTG

101 GGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGC

101 GAGGCTCCCTGAGACTGTCTTGCGCCGCCTCCGGCTTCACCTTCTCCAGC

151 TATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGT

151 TACGCCATGTCCTGGGTGCGACAGGCCCCTGGCAAGGGACTGGAATGGGT

201 CTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGA

201 GTCCGCCATCTCCGGCTCCGGCGGCTCTACCTACTACGCCGACTCCGTGA

251 AGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTG

251 AGGGCCGGTTCACCATCTCCCGGGACAACTCCAAGAACACCCTGTACCTG

301 CAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAA

301 CAGATGAACTCCCTGCGGGCCGAGGACACCGCCGTGTACTACTGCGCCAA

351 AAGTTATGGTGCTTTTGACTACTGGGGCCAGGGAACCCTGGTCACAGTCT

351 GTCCTACGGCGCCTTCGACTACTGGGGCCAGGGCACCCTGGTGACAGTGT 401 CGAGCGCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCC

401 CCTCCGCCTCCACCAAGGGCCCATCCGTGTTCCCTCTGGCCCCTTCCAGC

451 AAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTA

451 AAGTCCACCTCTGGCGGAACCGCTGCCCTGGGCTGCCTGGTGAAAGACTA

501 CTTCCCCGAACCGGTGACAGTCTCGTGGAACTCAGGAGCCCTGACCAGCG

501 CTTCCCCGAGCCCGTGACCGTGTCCTGGAACTCTGGCGCCCTGACCAGCG

551 GCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTC

551 GAGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTG

601 AGCAGCGTGGTGACTGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACAT

601 TCCTCCGTGGTGACCGTGCCCTCCAGCTCTCTGGGCACCCAGACCTACAT

651 CTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAGAGTTG

651 CTGCAACGTGAACCACAAGCCCTCCAACACCAAGGTGGACAAGCGGGTGG

701 AGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCT

701 AACCCAAGTCCTGCGACAAGACCCACACCTGTCCTCCCTGCCCTGCCCCT

751 GAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGA

751 GAACTGCTGGGCGGACCCTCCGTGTTTCTGTTCCCCCCAAAGCCCAAGGA

801 CACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACG 801 CACCCTGATGATCTCCCGGACCCCCGAAGTGACCTGCGTGGTGGTGGACG

851 TGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTG

851 TGTCCCACGAGGACCCTGAAGTGAAGTTCAATTGGTACGTGGACGGCGTG

901 GAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCAC

901 GAAGTGCACAACGCCAAGACCAAGCCCAGAGAGGAACAGTACAACTCCAC

951 GTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATG

951 CTATCGGGTGGTGTCTGTGCTGACCGTGCTGCACCAGGACTGGCTGAACG

1001 GCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATC

1001 GCAAAGAGTACAAGTGCAAGGTCTCCAACAAGGCCCTGCCTGCCCCCATC

1051 GAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTA

1051 GAAAAGACCATCTCCAAGGCCAAGGGCCAGCCCCGCGAACCCCAGGTCTA VHCH 1101 TACCCTGCCCCCATCTCGGGAGGAGATGACCAAGAACCAGGTCAGCCTGA

VHCH OPT 1101 CACACTGCCACCTAGCCGGGAAGAGATGACCAAGAACCAGGTGTCCCTGA

VHCH 1151 CTTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAG

VHCH OPT 1151 CCTGTCTGGTGAAAGGCTTCTACCCCTCCGATATCGCCGTGGAATGGGAG

VHCH 1201 AGCAACGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGA

VHCH OPT 1201 TCCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCTGTGCTGGA

VHCH 1251 CTCCGACGGCTCCTTCTTCCTCTATAGCAAGCTCACCGTGGACAAGTCCA

VHCH OPT 1251 CTCCGACGGCTCATTCTTCCTGTACTCCAAGCTGACCGTGGACAAGTCCC

VHCH 1301 GGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTG

VHCH OPT 1301 GGTGGCAGCAGGGCAACGTGTTCTCCTGCAGCGTGATGCACGAGGCCCTG

VHCH 1351 CACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTTAA (SEQ ID NO: 1)

VHCH OPT 1351 CACAACCACTACACCCAGAAGTCCCTGTCCCTGAGCCCCGGCTAA (SEQ ID NO: 2)

fable 1.2. VKCK WT (SEQ ID NO: 3) and VKCK OPT (SEQ ID NO: 4) sequences

VKCK 1 ATGAGTGTGCCCACTCAGGTCCTGGGGTTGCTGCTGCTGTGGCTTACAGATGCCAGATGTGACATCCAGA

JKCK OPT 1 ATGTCCGTGCCCACCCAGGTGCTGGGACTGCTGCTGCTGTGGCTGACCGACGCCAGATGCGACATCCAGA

VKCK 71 TGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCAGGCGAGTCA

VKCK OPT 71 TGACCCAGAGCCCTTCCAGCCTGAGCGCCTCCGTGGGCGACAGAGTGACCATCACCTGTCAGGCCTCCCA

VKCK 141 GTCCATTAGTAGTTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTACGCT

VKCK OPT 141 GTCCATCTCCTCCTACCTGAACTGGTATCAGCAGAAGCCCGGCAAGGCCCCTAAGCTGCTGATCTACGCC

VKCK 211 GCATCCTCGTTGGAAACAGGGGTCCCATCAAGGTTCAGTGGAAGTGGATCTGGGACAGATTTTACTTTCA

^""CK OPT 211 GCCTCCTCCCTGGAAACCGGCGTGCCCTCCAGATTCTCCGGCTCCGGCTCTGGCACCGACTTCACCTTCA

VKCK 281 CCATCAGCAGCCTGCAGCCTGAAGATATTGCAACATATTACTGTCAGCAGAAGCACCCCCGGGGGCCGAG

VKCK OPT 281 CCATCTCCAGCCTGCAGCCCGAGGATATCGCCACCTACTACTGCCAGCAGAAGCACCCTCGGGGCCCTAG

VKCK 351 GACCTTCGGCCAAGGGACCAAGGTGGAAATCAAACGTACGGTGGCTGCACCATCTGTCTTCATCTTCCCG

VKCK OPT 351 AACCTTCGGCCAGGGCACCAAGGTGGAAATCAAGCGGACCGTGGCCGCTCCCTCCGTGTTCATCTTCCCA

VKCK 421 CCATCTGATGAGCAGTTGAAATCTGGAACTGCCTCTGTTGTGTGCCTGCTGAATAACTTCTATCCCAGAG VKCK OPT 421 CCCTCCGACGAGCAGCTGAAGTCCGGCACCGCCAGCGTCGTGTGCCTGCTGAACAACTTCTACCCACGCG

VKCK 491 AGGCCAAAGTACAGTGGAAGGTGGATAACGCCCTCCAATCGGGTAACTCCCAGGAGAGTGTCACAGAGCA VKCK OPT 491 AGGCCAAGGTGCAGTGGAAGGTGGACAACGCCCTGCAGTCCGGCAACTCCCAGGAATCCGTCACCGAGCA

7KCK 561 GGACAGCAAGGACAGCACCTACAGCCTCAGCAGCACCCTGACGCTGAGCAAAGCAGACTACGAGAAACAC

7KCK OPT 561 GGACTCCAAGGACAGCACCTACTCCCTGTCCTCCACCCTGACCCTGTCCAAGGCCGACTACGAGAAGCAC

VKCK 631 AAAGTCTACGCCTGCGAAGTCACCCATCAGGGCCTGAGCTCGCCCGTCACAAAGAGCTTCAACAGGGGAG

VKCK OPT 631 AAGGTGTACGCCTGCGAAGTGACCCACCAGGGCCTGTCCAGCCCCGTGACCAAGTCCTTCAACCGGGGCG

VKCK 701 AGTGTTAA (SEQ ID NO: 3)

VKCK OPT 701 AGTGCTAA (SEQ ID NO: 4)

Table 1.3. Sequences for VLCL2 WT (SEQ ID NO: 5, shown in row 1 of the alignment), VLCL2 OPT (SEQ ID NO: 6, shown in row 2 of the ^~,: gnment), VLCL2 DEOPT_l (SEQ ID NO: 7, shown in row 3 of the alignment), VLCL2 DEOPT_2 (SEQ ID NO: 8, shown in row 4 of the gnment), and VLCL2 DEOPT_3 (SEQ ID NO: 9, shown in row 5 of the alignment) sequences

VLCL2 1 ATGAGTGTGCCCACTCAGGTCCTGGGGTTGCTGCTGCTGTGGCTTACAGATGCCAGATGCAATTTTATGCTGACTCAGCCCCACTCTGTG

VLCL20PT 1 ATGTCCGTGCCTACCCAGGTGCTGGGCCTGCTGCTGCTGTGGCTGACCGACGCCCGGTGCAACTTCATGCTGACCCAGCCCCACTCCGTG

VLCL2DEOPT 1 ATGTCCGTGCCTACCCAGGTCTTAGGCCTTCTGCTGCTCTGGTTGACAGACGCCCGGTGCAACTTCATGCTGACTCAGCCCCACAGTGTT

VLCL2DEOPT 1 ATGAGTGTACCGACTCAAGTACTTGGGCTTCTTCTTCTTTGGCTTACCGACGCACGTTGCAACTTCATGCTTACTCAACCGCACTCAGTA

VLCL2DEOPT 1 ATGTCGGTTCCGACGCAAGTATTAGGGCTCCTATTACTATGGTTAACGGACGCGCGTTGCAACTTCATGTTAACGCAACCGCATTCGGTA

/LCL2 91 ;GGAGTCTCCGGGGAAGACGGTAACCATCTCCTGCACCCGCAGCAGTGGCTCTATCGAAGATAAGTATGTGCAGTGGTACCAGCAGCGC

/LCL20PT . 91 ;CGAGTCCCCAGGCAAGACCGTGACCATCTCCTGCACCCGGTCCTCCGGCTCCATCGAGGACAAATACGTGCAGTGGTATCAGCAGCGG

/LCL2DE0PT 1 91 5CGAGTCTCCGGGAAAGACCGTGACAATCTCATGTACTAGATCCTCTGGGAGCATTGAGGACAAATACGTACAGTGGTATCAGCAAAGG

/LCL2DE0PT 2 91 ;AGAGTCACCGGGGAAAACTGTAACCATATCATGCACTCGTAGCAGTGGGAGCATAGAGGACAAATACGTCCAATGGTATCAACAACGT

VLCL2DE0PT 3 91 ;GGAATCGCCGGGGAAAACGGTTACGATATCGTGTACGCGTTCGTCGGGCTCGATAGAGGACAAATACGTCCAATGGTATCAACAACGT

VLCL2 181 CCGGGCAGTTCCCCCACCATTGTGATCTATTATGATAACGAAAGACCCTCTGGGGTCCCTGATCGGTTCTCTGGCTCCATCGACAGCTCC

VLCL2 OPT . 181 CCTGGCTCCTCCCCTACCATCGTGATCTACTACGACAACGAGCGGCCCTCCGGCGTGCCCGACCGGTTCTCTGGCTCTATCGACTCCTCC VLCL2DEOPT_L 181 CCCGGTAGTTCGCCAACCATCGTGATATATTACGATAATGAACGCCCTTCCGGCGTCCCAGATCGTTTTTCAGGATCTATTGACTCCAGT VLCL2DEOPT_2 181 CCGGGGTCATCACCGACCATAGTCATATATTACGACAACGAACGTCCGTCAGGTGTACCGGATCGTTTCTCAGGTTCAATAGACTCATCA VLCL2DEOPT_3 181 CCGGGGTCGTCGCCGACGATAGTCATATATTACGATAACGAACGTCCGTCGGGTGTACCGGATCGTTTTTCGGGTTCAATAGATTCGTCG

^TTT CL2 271 TCCAACTCTGCCTCCCTCACCATCTCTGGACTGAAGACTGAGGACGAGGCTGACTACTACTGTCAGACCTACGACCAGAGCCTGTATGGT

CL20PT . 271 TCCAACTCCGCCTCCCTGACCATCAGCGGCCTGAAAACCGAGGACGAGGCCGACTACTACTGCCAGACCTACGACCAGTCCCTGTACGGC VLCL2DEOPT_L 271 AGCAACTCTGCTTCACTAACGATCAGCGGGCTCAAGACAGAGGACGAAGCAGATTACTACTGCCAGACCTACGATCAATCCCTGTATGGC VLCL2DEOPT_2 271 AGCAACAGCGCCTCACTCACCATATCAGGGCTTAAAACCGAGGACGAAGCCGACTACTATTGCCAAACTTACGACCAAAGCCTCTACGGA VLCL2DEOPT_3 271 TCGAACTCGGCGAGTCTAACGATATCGGGGCTAAAAACGGAAGATGAGGCGGACTATTACTGCCAAACGTACGACCAATCGCTCTACGGA

VLCL2 361 TGGGTGTTCGGCGGAGGGACCAAGCTGACCGTCCTAGGTCAGCCCAAGGCTGCCCCCTCGGTCACTCTGTTCCCGCCCTCCTCTGAGGAG

VLCL20PT . 361 TGGGTGTTCGGCGGAGGCACCAAGCTGACCGTCCTAGGTCAACCCAAGGCCGCTCCCTCCGTGACCCTGTTCCCTCCATCCTCCGAGGAA VLCL2DEOPT_L 361 TGGGTGTTCGGTGGCGGAACTAAGCTGACCGTCCTAGGTCAACCCAAAGCCGCTCCTTCTGTTACTTTGTTTCCCCCAAGTAGCGAGGAA

VLCL2DE0PT 2 361 TGGGTATTCGGGGGTGGTACAAAACTTACTGTCCTAGGTCAACCGAAAGCAGCACCGTCAGTAACACTTTTTCCGCCGTCATCAGAGGAA

~

VLCL2DE0PT 3 361 TGGGTATTCGGTGGTGGAACGAAACTAACGGTCCTAGGTCAACCGAAAGCGGCACCGTCGGTTACGCTATTTCCGCCGTCGTCGGAAGAA

—

/LCL2 451 CTTCAAGCCAACAAGGCCACACTGGTGTGTCTCATAAGTGACTTCTACCCGGGAGCCGTGACAGTGGCTTGGAAAGCAGATAGCAGCCCC

/LCL20PT . 451

/LCL2DE0PT 1 451

/LCL2DE0PT 2 451

VLCL2DE0PT 3 451

VLCL2 541 GTCAAGGCGGGAGTGGAGACCACCACACCCTCCAAACAAAGCAACAACAAGTACGCGGCCAGCAGCTATCTGAGCCTGACGCCTGAGCAG

VLCL20PT . 541 GTGAAGGCCGGCGTGGAAACCACCACCCCTTCCAAGCAGTCCAACAACAAATACGCCGCCTCCTCCTACCTGTCCCTGACCCCTGAGCAG

VLCL2DE0PT_1 541 GTAAAGGCAGGCGTCGAGACAACCACTCCCTCAAAGCAGTCCAACAACAAATACGCCGCTTCGAGCTATCTGTCTTTGACGCCTGAACAG VLCL2DEOPT_2 541 GTCAAAGCAGGGGTAGAAACTACCACCCCGTCAAAGCAGAGCAACAACAAATACGCAGCAAGCTCATACCTCAGCCTTACCCCGGAACAA VLCL2DEOPT_3 541 GTCAAAGCGGGTGTAGAAACGACGACGCCGTCGAAGCAATCGAACAACAAATATGCGGCGTCGTCATACCTATCGCTAACGCCGGAACAA

^TTT CL2 631 TGGAAGTCCCACAGAAGCTACAGCTGCCAGGTCACGCATGAAGGGAGCACCGTGGAGAAGACAGTGGCCCCTACAGAATGTTCATAA

CL20PT . 631 TGGAAGTCCCACCGGTCCTACAGCTGCCAGGTCACACACGAGGGCTCCACCGTGGAAAAGACCGTGGCCCCTACCGAGTGCTCCTAA

VLCL2DE0PT_1 631 TGGAAGAGTCATCGAAGCTACTCATGCCAAGTGACCCACGAGGGATCTACAGTCGAGAAAACCGTGGCTCCAACTGAGTGTTCCTAA

VLCL2DEOPT_2 631 TGGAAATCACACCGTAGCTACTCATGCCAAGTAACCCACGAAGGGTCAACCGTAGAAAAAACTGTAGCACCGACCGAGTGCAGCTAA

VLCL2DE0PT 3 631 TGGAAATCGCATCGTTCGTATTCGTGCCAAGTAACGCATGAAGGGTCGACGGTAGAAAAAACGGTAGCGCCGACGGAATGTTCGTAA

[00044] Table 2 is a table showing the following data for each construct: total IgG and bispecific antibody quantity after purification as well as the proportion of bispecific determined by HIC.

Table 2.

[00045] Table 3 depicts total IgG productivity, bispecific % by HIC after protein A purification, and the amount of purified bispecific from CHO cell culture supernatant for representative pools for each construct.

Table 3.

[00046] The polynucleotides and constructs thereof used in the methods provided herein can be generated synthetically by a number of different protocols known to those of skill in the art. Appropriate polynucleotide constructs are purified using standard recombinant DNA techniques as described in, for example, Sambrook et ah, Molecular Cloning: A Laboratory Manual, 2nd Ed., (1989) Cold Spring Harbor Press, Cold Spring Harbor, NY, and under current regulations described in United States Dept. of HHS, National Institute of Health (NIH) Guidelines for Recombinant DNA Research.

[00047] Also provided are constructs comprising the nucleic acids described herein inserted into a vector, where such constructs may be used for a number of different screening applications as described in greater detail below. In some embodiments, a single vector (e.g., a plasmid) will contain nucleic acid coding sequence for a single peptide display scaffold. In other embodiments, a single vector (e.g., a plasmid) will contain nucleic acid coding sequence for a two or more peptide display scaffolds.

[00048] Viral and non- viral vectors may be prepared and used, including plasmids, which provide for replication of biosensor-encoding DNA and/or expression in a host cell. The choice of vector will depend on the type of cell in which propagation is desired and the purpose of propagation. Certain vectors are useful for amplifying and making large amounts of the desired DNA sequence. Other vectors are suitable for expression in cells in culture. Still other vectors are suitable for transformation and expression in cells in a whole animal or person. The choice of appropriate vector is well within the skill of the art. Many such vectors are available commercially. To prepare the constructs, the partial or full-length polynucleotide is inserted into a vector typically by means of DNA ligase attachment to a cleaved restriction enzyme site in the vector. Alternatively, the desired nucleotide sequence can be inserted by homologous recombination in vivo. Typically this is accomplished by attaching regions of homology to the vector on the flanks of the desired nucleotide sequence. Regions of homology are added by ligation of oligonucleotides, or by polymerase chain reaction using primers comprising both the region of homology and a portion of the desired nucleotide sequence, for example.

[00049] Also provided are expression cassettes or systems that find use in, among other applications, the synthesis of the peptide display scaffolds. For expression, the gene product encoded by a polynucleotide of the disclosure is expressed in any convenient expression system, including, for example, bacterial, yeast, insect, amphibian and mammalian systems. Suitable vectors and host cells are described in U.S. Patent No. 5,654, 173. In the expression vector, a polynucleotide is linked to a regulatory sequence as appropriate to obtain the desired expression properties. These regulatory sequences can include promoters (attached either at the 5' end of the sense strand or at the 3' end of the antisense strand), enhancers, terminators, operators, repressors, and inducers. The promoters can be regulated or constitutive. In some situations it may be desirable to use conditionally active promoters, such as tissue-specific or developmental stage-specific promoters. These are linked to the desired nucleotide sequence using the techniques described above for linkage to vectors. Any techniques known in the art can be used. In other words, the expression vector will provide a transcriptional and translational initiation region, which may be inducible or constitutive, where the coding region is operably linked under the transcriptional control of the transcriptional initiation region, and a transcriptional and translational termination region. These control regions may be native to the species from which the nucleic acid is obtained, or may be derived from exogenous sources.

[00050] Eukaryotic promoters suitable for use include, but are not limited to, the following: the promoter of the mouse metallothionein I gene sequence (Hamer et al, J. Mol. Appl. Gen. 1 :273-288, 1982); the TK promoter of Herpes virus (McKnight, Cell 31 :355- 365, 1982); the SV40 early promoter (Benoist et al, Nature (London) 290:304-310, 1981); the yeast gall gene sequence promoter (Johnston et al, Proc. Natl. Acad. Sci. (USA) 79:6971-6975, 1982); Silver et al, Proc. Natl. Acad. Sci. (USA) 81 :5951-59SS, 1984), the CMV promoter, the EF-1 promoter, Ecdysone-responsive promoter(s), tetracycline- responsive promoter, and the like.

[00051] Promoters may be, furthermore, either constitutive or regulatable. Inducible elements are DNA sequence elements that act in conjunction with promoters and may bind either repressors (e.g., lacO/LAC Iq repressor system in E. coli) or inducers (e.g., gall/GAL4 inducer system in yeast). In such cases, transcription is virtually "shut off until the promoter is derepressed or induced, at which point transcription is "turned-on."

[00052] Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding heterologous proteins. A selectable marker operative in the expression host may be present. Expression vectors may be used for, among other things, the screening methods described in greater detail below.

[00053] Expression cassettes may be prepared comprising a transcription initiation region, the gene or fragment thereof, and a transcriptional termination region. After introduction of the DNA, the cells containing the construct may be selected by means of a selectable marker, the cells expanded and then used for expression.

[00054] The above described expression systems may be employed with prokaryotes or eukaryotes in accordance with conventional ways, depending upon the purpose for expression. In some embodiments, a unicellular organism, such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells of a higher organism such as vertebrates, e.g., COS 7 cells, HEK 293, CHO, Xenopus Oocytes, etc., may be used as the expression host cells. In other situations, it is desirable to use eukaryotic cells, where the expressed protein will benefit from native folding and post-translational modifications.

[00055] Specific expression systems of interest include bacterial, yeast, insect cell and mammalian cell derived expression systems. Expression systems in bacteria include those described in Chang et al, Nature (1978) 275:615; Goeddel et al, Nature (1979) 281 :544; Goeddel et al, Nucleic Acids Res. (1980) 8:4057; EP 0 036,776; U.S. Patent No. 4,551,433; DeBoer et al, Proc. Natl Acad. Sci. (USA) (1983) 80:21-25; and Siebenlist et al, Ce// (1980) 20:269.

[00056] Mammalian expression is accomplished as described in Dijkema et al,

EMBO J. (1985) 4:761, Gorman et al, Proc. Natl. Acad. Sci. (USA) (1982) 79:6777, Boshart et al, Cell (1985) 41:521 and U.S. Patent No. 4,399,216. Other features of mammalian expression are facilitated as described in Ham and Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem. (1980) 102:255, U.S. Patent Nos. 4,767,704, 4,657,866, 4,927,762, 4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985.

[00057] As will be appreciated by those in the art, the type of host cells suitable for use can vary widely. In some embodiments, the cell is a bacterial cell, a yeast cell or a mammalian cell. In some embodiments, the biological entity is a bacterial cell. In some embodiments, the bacterial cell is Escherichia coli, Shigella sonnei, Shigella dysenteriae, Shigella flexneri, Salmonella typhii, Salmonella typhimurium, Salmonella enterica, Enterobacter aerogenes, Serratia marcescens, Yersinia pestis, Bacillus cereus, Bacillus subtilis, or Klebsiella pneumoniae.

[00058] The constructs can be introduced into the host cell by any one of the standard means practiced by one with skill in the art to produce a cell line of the disclosure. The nucleic acid constructs can be delivered, for example, with cationic lipids (Goddard, et al, Gene Therapy, 4: 1231-1236, 1997; Gorman, et al, Gene Therapy 4:983-992, 1997; Chadwick, et al, Gene Therapy 4:937-942, 1997; Gokhale, et al, Gene Therapy 4: 1289- 1299, 1997; Gao, and Huang, Gene Therapy 2:710-722, 1995, all of which are incorporated by reference herein), using viral vectors (Monahan, et al, Gene Therapy 4:40-49, 1997; Onodera, et al, Blood 91 :30-36, 1998, all of which are incorporated by reference herein), by uptake of "naked DNA", and the like.

Definitions

[00059] Unless otherwise defined, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. Generally,

nomenclatures utilized in connection with, and techniques of, cell and tissue culture, molecular biology, and protein and oligo- or polynucleotide chemistry and hybridization described herein are those well-known and commonly used in the art. Standard techniques are used for recombinant DNA and oligonucleotide synthesis, as well as tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques are performed according to manufacturer's specifications or as commonly accomplished in the art or as described herein. The foregoing techniques and procedures are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). The nomenclatures utilized in connection with, and the laboratory procedures and techniques of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques are used for chemical syntheses, chemical analyses, pharmaceutical preparation, formulation, delivery and treatment of patients.

[00060] As utilized in accordance with the present disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings:

[00061] The term "polynucleotide" as referred to herein means a polymeric boron of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide. The term includes single and double stranded forms of DNA. [00062] The term "polypeptide" is used herein as a generic term to refer to native protein, fragments, or mutants of a polypeptide sequence. Hence, native protein fragments, and mutants are species of the polypeptide genus. Preferred polypeptides in accordance with the disclosure comprise cytokines and antibodies.

[00063] As used herein, the term "antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, i.e., molecules that contain an antigen binding site that specifically binds (immunoreacts with) an antigen. Such antibodies include, but are not limited to, polyclonal, monoclonal, chimeric, single chain, F_ab, F_ab_' and F_(ay₎₂ fragments, and antibodies in an F_ab expression library. By "specifically bind" or "immunoreacts with" is meant that the antibody reacts with one or more antigenic determinants of the desired antigen and does not react (i.e., bind) with other polypeptides or binds at much lower affinity (¾ > 10^~6) with other polypeptides.

[00064] The basic antibody structural unit is known to comprise a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one "heavy" chain (about 50-70 kDa). The amino-terminal portion of each chain includes a variable region of about 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. Human light chains are classified as kappa and lambda light chains. Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. Within light and heavy chains, the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D" region of about 10 more amino acids. See generally, Fundamental Immunology Ch. 7 (Paul, W., ea., 2nd ed. Raven Press, N.Y. (1989)). The variable regions of each light/heavy chain pair form the antibody binding site.

[00065] The term "monoclonal antibody" (MAb) or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules that contain only one molecular species of antibody molecule consisting of a unique light chain gene product and a unique heavy chain gene product. In particular, the complementarity determining regions (CDRs) of the monoclonal antibody are identical in all the molecules of the population. MAbs contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for it. [00066] In general, antibody molecules obtained from humans relate to any of the classes IgG, IgM, IgA, IgE and IgD, which differ from one another by the nature of the heavy chain present in the molecule. Certain classes have subclasses as well, such as IgGi, IgG₂, and others. Furthermore, in humans, the light chain may be a kappa chain or a lambda chain.

[00067] The term "fragments thereof as used herein shall mean a segment of a polynucleotide sequence or polypeptide sequence that is less than the length of the entire sequence. Fragments as used herein comprised functional and non-functional regions.

Fragments from different polynucleotide or polypeptide sequences are exchanged or combined to create a hybrid or "chimeric" molecule. Fragments are also used to modulate polypeptide binding characteristics to either polynucleotide sequences or to other polypeptides.

[00068] The term "promoter sequence" as used herein shall mean a polynucleotide sequence comprising a region of a gene at which initiation and rate of transcription are controlled. A promoter sequence comprises an RNA polymerase binding site as well as binding sites for other positive and negative regulatory elements. Positive regulatory elements promote the expression of the gene under control of the promoter sequence.

Negative regulatory elements repress the express of the gene under control of the promoter sequence. Promoter sequences used herein are found either upstream or internal to the gene being regulated. Specifically, the term "first promoter sequence" versus "second promoter sequence" refers to the relative position of the promoter sequence within the expression vector. The first promoter sequence is upstream of the second promoter sequence.

[00069] The term "selection gene" as used herein shall mean a polynucleotide sequence encoding for a polypeptide that is necessary for the survival of the cell in the given culture conditions. If a cell has successfully incorporated the expression vector carrying the gene of interest, along with the selection gene, that cell will produce an element that will allow it to selectively survive under hostile culture conditions. "Selected" cells are those which survive under selective pressure and must have incorporated the expression vector. The term "selective pressure" as used herein shall mean the addition of an element to cell culture medium that inhibits the survival of cells not receiving the DNA composition.

[00070] The term "endogenous gene" as used herein shall mean a gene encompassed within the genomic sequence of a cell. The term "exogenous gene" as used herein shall mean a gene not encompassed within the genomic sequence of a cell. Exogenous genes are introduced into cells by the instant methods. The term "transgene" as used herein shall mean a gene that has been transferred from one organism to another.

[00071] As used herein, the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology - A Synthesis (2nd Edition, E.S. Golub and D.R. Gren, Eds., Sinauer Associates, Sunderland Mass. (1991)). Stereoisomers (e.g., D- amino acids) of the twenty conventional amino acids, unnatural amino acids such as α-, α- disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides of the present disclosure. Examples of unconventional amino acids include: 4 hydroxyproline, γ-carboxyglutamate, ε-Ν,Ν,Ν- trimethyllysine, ε -N-acetyllysine, O-phosphoserine, N- acetylserine, N-formylmethionine, 3-methylhistidine, 5 -hydroxy lysine, σ-Ν-methylarginine, and other similar amino acids and imino acids (e.g., 4- hydroxyproline). In the polypeptide notation used herein, the lefthand direction is the amino terminal direction and the righthand direction is the carboxy -terminal direction, in accordance with standard usage and convention.

[00072] Similarly, unless specified otherwise, the lefthand end of single- stranded polynucleotide sequences is the 5' end the lefthand direction of double-stranded

polynucleotide sequences is referred to as the 5' direction. The direction of 5' to 3' addition of nascent RNA transcripts is referred to as the transcription direction sequence regions on the DNA strand having the same sequence as the RNA and which are 5' to the 5' end of the RNA transcript are referred to as "upstream sequences", sequence regions on the DNA strand having the same sequence as the RNA and which are 3' to the 3' end of the RNA transcript are referred to as "downstream sequences".

[00073] Silent or conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic -hydroxyl side chains is serine and threonine; a group of amino acids having amide- containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur- containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine- arginine, alanine valine, glutamic- aspartic, and asparagine-glutamine. [00074] Silent or conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are generally divided into families: (1) acidic amino acids are aspartate, glutamate; (2) basic amino acids are lysine, arginine, histidine; (3) non-polar amino acids are alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and (4) uncharged polar amino acids are glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. The hydrophilic amino acids include arginine, asparagine, aspartate, glutamine, glutamate, histidine, lysine, serine, and threonine. The hydrophobic amino acids include alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine and valine. Other families of amino acids include (i) serine and threonine, which are the aliphatic -hydroxy family; (ii) asparagine and glutamine, which are the amide containing family; (iii) alanine, valine, leucine and isoleucine, which are the aliphatic family; and (iv) phenylalanine, tryptophan, and tyrosine, which are the aromatic family. For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a major effect on the binding or properties of the resulting molecule, especially if the replacement does not involve an amino acid within a framework site. Whether an amino acid change results in a functional peptide can readily be determined by assaying the specific activity of the polypeptide derivative. Assays are described in detail herein. Fragments or analogs of antibodies or immunoglobulin molecules can be readily prepared by those of ordinary skill in the art. Preferred amino- and carboxy -termini of fragments or analogs occur near boundaries of functional domains. Structural and functional domains can be identified by comparison of the nucleotide and/or amino acid sequence data to public or proprietary sequence databases. Preferably, computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and/or function. Methods to identify protein sequences that fold into a known three- dimensional structure are known. Bowie et al. Science 253 : 164 (1991). Thus, the foregoing examples demonstrate that those of skill in the art can recognize sequence motifs and structural conformations that may be used to define structural and functional domains in accordance with the disclosure.

[00075] A silent or conservative amino acid substitution should not substantially change the structural characteristics of the parent sequence (e.g., a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence). Examples of art-recognized polypeptide secondary and tertiary structures are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and Thornton et at. Nature 354: 105 (1991).

[00076] Other chemistry terms herein are used according to conventional usage in the art, as exemplified by The McGraw-Hill Dictionary of Chemical Terms (Parker, S., Ed., McGraw-Hill, San Francisco (1985)).

EXAMPLES

Example 1. Mutations introduced in the lambda light chain for codon optimization and deoptimization in mammalian cells

[00077] The anti-CD 19 x anti-CD47 bispecific antibody 44, which is based on the κλ-body technology, is composed by a common heavy chain and two different light chains. These chains are encoded by the plasmid construct 44 (Table 1). When this expression plasmid is transfected in mammalian cells, three molecules are produced by random assembly of the three chains: a monospecific IgGK (containing two identical κ light chains), a monospecific IgG (containing two identical λ light chains), and a bispecific ¾ϋκλ (containing one κ light chain and one λ light chain). If the two light chains are expressed at the same rate and assemble equally, the theoretical ratio for the three molecules should be 25% IgGK, 25% lgG and 50% ¾ϋκλ. In the case of the construct 44, there is a preferential expression of the λ light chains that leads to a suboptimal expression and yield of bispecific antibody. In order to improve this situation, optimization as well as deoptimization of the different chains has been performed to tune the relative ratios of the chains.

[00078] Codon optimization has been performed with the GeneOptimizer^® software

(GeneArt), on heavy, kappa and lambda chains. Different candidates were generated by cloning the optimized or not chains in the wild type plasmid of encoding the bispecific antibody 44.

[00079] Three different levels of codon deoptimization were performed on the lambda chain that is expressed in excess. Three constructs (3, 13 and 19 deoptimized lambda chain) were generated and combined with optimized heavy and kappa chains. Different degrees of deoptimization were applied to the λ light chain. Constructs 3, 13 lnd 19 contained increasingly deoptimized sequences (VLCL2-1, VLCL2-2 and VLCL2-3 respectively, see Figure 1). Constructs 17 and 15 with an optimized lambda chain were also generated (Table 1).

Example 2. Cloning and characterization of IgG expressed in Peak cells

[00080] The common heavy chain and two light chains (one kappa and one lambda) wild-type, optimized or deoptimized codon were cloned into a single mammalian expression pNOVI vector under three independent CMV promoters. After sequence verification, the IgG productivity for each construct was evaluated in Peak cells by two independent transient transfections using Lipofectamine 2000. Seven days after transfection, the total IgG expression was assessed by Octet technology. Except for the candidate 15, no major difference between the candidates in term of total IgG productivity was observed. A trend to a decrease in productivity was observed with construct 15 in which all chains had been optimized (Figure 2). After 10 days of production in PEAK cells, total IgG were purified on Fc XL resin.

[00081] The distribution of the three different forms of IgG, monospecific lambda, monospecific kappa and bispecific antibody, was determined by HIC-HPLC analysis using ProPac HIC- 10 column (Dionex) (Figure 3 A). A gradient of mobile phase A (0.001 M phosphate buffer + 1 M ammonium sulphate, pH 3.5) from 85 to 35% and a growing gradient of mobile phase B (0.001 M phosphate buffer + acetonitrile 10%, pH 3.5) from 15% to 100% were applied. A blank was performed with mobile phase A, pH 7. The analysis of HIC area peak (Figure 3B) shows a trend with increment of the percentage of bispecific for deoptimized candidates 3, 13 and 19 compared to wild-type 44 and optimized 15 and 17. The ratio of monospecific kappa and lambda for 3, 13 and 19 was significantly different compared to 44.

[00082] An IEF 7-11% was also performed to evaluate the distribution of total IgG

(Figure 4). Candidates with lambda optimization show an increment of monospecific lambda compared to clone 44 and less monospecific kappa and bispecific. Candidates 3, 13 and 19 showed a significant increase in monospecific kappa and bispecific.

[00083] Table 2 summarizes the data obtained for candidates expressed in PEAK cells. For the candidates 3, 13 and 19, the final percentage of bispecific obtained was higher, with an increase of the bispecific ratio from 21.6 % for 44 to 42.9% for candidate 13. Interestingly, the highest codon deoptimization (construct 19) level of lambda chain increases the productivity of bispecific antibody.

Example 3. IgG expression in stably transfected CHO cells

[00084] After transfection by electroporation and selection with MSX, a screening by

FACS was performed. The highest producing pools were selected for production in fed batch conditions. Total IgG productivity was assessed for different pools by Octet technology (Figure 5). After purification by protein A, the ratio of the different chains was assessed by electrophoresis on an Agilent protein 80 chip monitoring the sizes of the heavy and light chains in reducing and denaturing condition.

[00085] As shown on Agilent analysis (Figure 6A), for 44, the lambda chain was more represented than the kappa chain. For several CHO pools, the constructs 3 and 13 improved the equilibrium between the two light chains. With increased deoptimization of the lambda chain, the ratio was inversed when compared with the initial construct (44 versus 19). This was confirmed by calculating the ratio between the two light chains (Figure 6B). Thus the balance between the two light chains, which was in favor of lambda chain for 44, was reversed gradually, correlating with the level of deoptimization. When all the productive pools are analyzed, a significant difference can be observed between the candidates 13, 19 and the candidate 44, with more kappa light chain and less lambda light chain. Based on these results, candidates 3 and 13 should show an increase in BsAb expression, as the two light chains are expressed at more equivalent levels. After purification by protein A, the ratio of the different forms of IgG was assessed by HIC for all IgG producing pools (Figure 7). The data shows that the level of monospecific lambda decreases gradually with the deoptimization level and the inverse pattern is observed for monospecific kappa. The bispecific levels reach a maximum of approximately 40% with a very homogenous distribution for the constructs 3 and 13. In contrast, the unbalanced expression of one of the two chains (as in 44 or 19) leads to a reduced level of bispecific production.

[00086] In order to confirm the specific binding against their targets, all candidates were evaluated for binding to hCD19 and hCD47 by ELISA (Figure 8). The two specific targets of the bispecific antibodies and an irrelevant protein at 2 μg/mL in PBS were coated overnight at 4°C in 96-well streptavidin-coated microplate. After 3 wash with PBS 0.05% (v/v) Tween (PBST), purified antibodies, diluted at 2 μg/mL in PBST 1% BSA, were incubated 30 min at 37°C in the plate. Wells were washed 3 times with PBST, and then a secondary antibody (anti human IgG Fc coupled to horseradish peroxidase) was added and incubated lh at 37°C. Tetramethylbenzidine was used to reveal ELISA and was blocked with sulfuric acid. Absorbance was read at 450 nm.

[00087] The expression of each candidate was scaled up and supernatants were harvested after 10 days and clarified by centrifugation at l,300g for 10 min. The purification process was composed of three affinity steps. First, the CaptureSelect IgG-CHl affinity matrix (Life Technologies) was washed with PBS and then added to the clarified supernatant. After incubation overnight at 4°C, supernatants were centrifuged at 1,000 g for 10 min, the supernatant was discarded and the resin washed twice with PBS. Then, the resin was transferred to spin columns and a solution containing 50mM glycine at pH 2.7 was used for elution.

[00088] Several elution fractions were collected, pooled and desalted against PBS using 50 kDa Amicon Ultra Centrifugal filter units (Merck KGaA). The final product, containing total human IgG from the supernatant, was quantified using a Nanodrop spectrophotometer (NanoDrop Technologies, Wilmington, DE) and incubated for 15 min at RT and 20 rpm with the appropriate volume of KappaSelect affinity resin (GE Healthcare). Incubation, resin recovery, elution and desalting steps were performed as described previously (Fischer et al, Nature Comms. 2015). The last affinity purification step was performed using the LambdaFabSelect affinity resin. Total IgG, bispecific antibody percentage measured by HIC and purified bispecific productivity from CHO cell pools are summarized in Table 3. The data shows that deoptimization and reduced expression of the lambda chain leads to an increase of total IgG productivity and bispecific product. The optimization method generated an increase in yield of bispecific antibody of 2.5-fold.

Claims

What is claimed is:

1. A method to increase production yield of a protein complex that comprises more than one polypeptide, the method comprising:

(a) providing one or more nucleic acid molecules encoding the polypeptides in the protein complex;

(b) introducing the nucleic acid molecule(s) into a cell;

(c) culturing the cell under conditions that allow for the expression of polypeptides in the protein complex; and

(d) decreasing expression of at least one of the polypeptides in the protein complex.

2. The method of claim 1, wherein the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying transcription rate, translation rate, or mRNA stability.

3. The method of claim 1, wherein the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying mRNA secondary structure.

4. The method of claim 1, wherein the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying transcription rate, by modifying translation rate, by modifying mRNA stability, by modifying mRNA secondary structure, or by modifying any combination of these factors.

5. The method of claim 4, wherein the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate, by altering the codon composition of that polypeptide.

6. The method of claim 5, wherein the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate, by altering the codon composition of that polypeptide via the replacement of certain codons with codons that are less frequently used in the host cell that is used for expression of the protein complex.

7. The method of claim 6, wherein the reduction in expression of one of the polypeptides in the protein complex is achieved by modifying translation rate, by altering the codon composition of that polypeptide via the replacement of certain codons with codons that are less frequently used in a mammalian host cell used for expression of the protein complex.

8. The method of any one of claims 1 to7, wherein the protein complex is a multispecific antibody.

9. The method of any one of claims 1 to 7, wherein the protein complex is a bispecific antibody.

10. The method of claim 9, wherein the bispecific antibody is composed of two different light chains and a common heavy chain.

1 1. The method of any one of claims 1 to 7, wherein more than one protein complex is co-expressed.

12. The method of claim 11, wherein the protein complexes are antibodies, and wherein more than one antibody is co-expressed.