ES2752054T3 - Method for optimizing the assembly and production of heteromultimeric protein complexes - Google Patents

Abstract

A method of increasing the throughput of production of a protein complex comprising: (a) identifying one or more polypeptides in the complex that are most abundantly expressed in a cell compared to the other polypeptides in the complex; (b) modifying at least one nucleic acid molecule that encodes the most abundantly expressed polypeptides in the complex, in which the nucleic acid molecules are modified by altering the codon composition of the nucleic acid molecules resulting in a reduction in the expression of the polypeptides it encodes; (c) introducing the nucleic acid molecules into a cell; and (d) culturing the cell under conditions that allow the expression of all the polypeptides of the protein complex; wherein said reduction in expression is achieved by replacing certain codons with less frequently used codons in the cell, by encoding a change in the secondary structure of the mRNA or encoding a change in the translation rate, and in which the protein complex is a bispecific antibody.

Description

DESCRIPTION

Method for optimizing the assembly and production of heteromultimeric protein complexes

Field of the Invention

Methods are provided to improve the expression of protein complexes by adjusting the expression levels of each component required for complex assembly. These methods are effective in limiting the expression of the dominant chain and, therefore, balancing its relative abundance. The methods provided herein lead to a significant increase in productivity and final bispecific yields in both transient expression systems and stably transfected mammalian cells.

Background of the Invention

Recombinant expression in bacterial, yeast, insect, plant or mammalian cells is essential for the production of proteins that are used for research as well as for therapeutic applications. Recently, the performance of recombinant protein expression in Chinese hamster ovary (CHO) cells has been significantly improved by optimizing multiple parameters, such as the composition of the culture medium, the fermentation parameters, as well as the optimization of the constructs. which are used to drive the expression of the gene encoding the recombinant protein of interest.

Some proteins are composed of various polypeptides that can associate in complexes that can be covalently or non-covalently linked. Antibodies are an example of such a class of proteins, as they are composed of four polypeptides (i.e. two heavy chains and two light chains) that are linked by disulfide bonds. Due to its commercial and therapeutic importance, the expression of antibodies in CHO cells has been the subject of intense optimization efforts, with the aim of maximizing the expression of the two chains that make up the antibody. However, large differences can be observed since the expression levels can vary up to 200 times between the antibodies.

WO2012 / 023053 describes the production of antibodies in CHO cells, in which the level of light chain expression is altered by the use of different IRES elements. Meng Jia et al. MBIO, 5: 5, pp. E1704-1714 (2014), explains that for respiratory syncytial virus (RSV), the expression of the virulence genes NS1 and NS2 could be reduced by deoptimizing the codon. A.D. Westwood et al. Biotechnology Progress, 26: 6, pp. 1558-1566 (2010) describe that codon deoptimization of the mouse dhfr selectable marker gene was used to increase the stringency of selection. Strutzenberger K et al. J. of Biotechnology, 69: 2-3, pp. 215-226 (1999) teaches that the expression of a light chain in a recombinant CHO cell line, and with it, the secretion rate of the entire antibody decreases with time.

Previous optimization approaches aimed to increase expression levels of polypeptides to achieve higher production yields. In the case of protein complexes composed of multiple polypeptides, unbalanced expression can limit the assembly of the desired molecule, promote the production of unwanted products and limit the overall production yield. Accordingly, there remains a need for methods to improve the expression of protein complexes.

Summary of the Invention

The invention is defined by the appended claims. The methods of the disclosure improve the expression of protein complexes by adjusting the expression levels of each component required for complex assembly. Unlike the approaches described above, reducing the expression of one or more polypeptides in the protein complex improves the assembly and performance of the protein complex. The method is particularly suitable for optimizing the expression and performance of bispecific antibodies that are often based on the co-expression of multiple polypeptides. The unbalanced expression (too high or too low) of one of the components can lead to a significant decrease in the desired end product and an increase in the production of unwanted by-products. This limitation can affect both bispecific IgG-type formats as well as formats based on antibody fragments.

The method is particularly applicable for the optimization of the expression of bispecific antibodies called kA bodies (Fischer et al., Exploiting light chains for the scalable generation and platform purification of native human bispecific IgG. Nat. Comms, 6: 6113 (2015) ). This technology produces a fully human bispecific antibody (BsAb), consisting of a common heavy chain and two different light chains (one kappa and one lambda) (see eg WO 2012/023053). A proprietary tricistronic vector that includes these three chains is introduced into mammalian cells to produce bispecific antibodies (kA bodies) that contain a ^K chain and an A in addition to the two monospecific antibodies IgGK and IgGA.

In principle, if the two light chains are expressed at the same rate and are similarly assembled, the ratio for all three molecules should be 25% IgGK, 25% IgGA, and 50% IgGKA. However, sometimes observes an unbalanced level of expression of the two chains, which leads to a decrease in the bispecific yield. One solution might be to increase the expression of the least expressed string to restore balance. However, this approach has not been successful (as shown in the work examples provided in this document).

On the contrary, the methods of the disclosure are effective in limiting the expression of the dominant chain and, therefore, balancing its relative abundance. The methods disclosed in this document lead to a significant increase in productivity and final bispecific yields in both transient expression systems and stably transfected CHO cells. Therefore, the reduction of the expression of one or more polypeptides can lead to an overall increase in productivity. Although the examples provided herein use ^kA bodies, the methods disclosed in this document are applicable to other bispecific antibody formats and to any other protein complex composed of several different polypeptides. In some embodiments, the disclosure provides methods of increasing the throughput of production of a protein complex composed of multiple polypeptides by reducing the expression rate of one or more of the polypeptides. In some embodiments, reduction in expression of one of the polypeptides is accomplished by modifying the transcription rate, translation rate, or stability of the mRNA. In some embodiments, the reduction in the expression rate of one of the polypeptides is accomplished by modifying the secondary structure of the mRNA. In some embodiments, reduction in expression of one of the polypeptides is accomplished by modifying the transcription rate, modifying the translation rate, modifying the stability of the mRNA, modifying the secondary structure of the mRNA, or by a combination of any of these factors. .

In some embodiments, the reduction in the expression of one of the polypeptides in the protein complex is achieved by modifying the translation rate. In some embodiments, reduction in the expression of one of the polypeptides in the protein complex is achieved by altering the codon composition of that polypeptide. In some embodiments, reduction in the expression of one of the polypeptides in the protein complex is accomplished by modifying the translation rate and altering the codon composition of that polypeptide.

In some embodiments, the reduction in the expression of one of the polypeptides in the protein complex is achieved by modifying the translation rate. In some embodiments, reduction in the expression of one of the polypeptides in the protein complex is achieved by altering the codon composition of that polypeptide through replacement of certain codons with codons that are used less frequently in the host cell than It is used for the expression of the protein complex. In some embodiments, reduction in the expression of one of the polypeptides in the protein complex is accomplished by modifying the translation rate, and altering the codon composition of that polypeptide through replacement of certain codons with codons that are used with less frequency in the host cell than is used for the expression of the protein complex.

In some embodiments, the reduction in the expression of one of the polypeptides in the protein complex is achieved by modifying the translation rate. In some embodiments, reduction in the expression of one of the polypeptides in the protein complex is achieved by altering the codon composition of that polypeptide through replacement of certain codons with codons that are used less frequently in a host cell. mammal used for the expression of the protein complex. In some embodiments, reduction in the expression of one of the polypeptides in the protein complex is accomplished by modifying the translation rate and altering the codon composition of that polypeptide through replacement of certain codons with codons that are used with less frequency in a mammalian host cell used for expression of the protein complex. In some embodiments, the protein complex is a multispecific antibody. In some embodiments, the protein complex is a bispecific antibody. In some embodiments, the bispecific antibody is composed of two different light chains and a common heavy chain.

In some embodiments, the bispecific antibody includes a human lambda light chain and a human kappa light chain.

In some embodiments, the bispecific antibody includes first and second antigen binding regions, each comprising at least one complementarity determining region (CDR). In some embodiments, the first and second antigen binding regions each comprise at least two CDRs. In some embodiments, the first and second antigen binding regions each comprise three CDRs. In some embodiments, the CDRs are from an immunoglobulin heavy chain. In some embodiments, the heavy chain is a human heavy chain. In some embodiments, the CDRs are from a lambda light chain. In some embodiments, the CDRs are from a kappa light chain.

In some embodiments, the first antigen binding region comprises a first immunoglobulin heavy chain variable domain, and the second antigen binding region comprises a second immunoglobulin heavy chain variable domain.

In some embodiments, the first and second immunoglobulin heavy chain variable domains independently comprise a human CDR, a mouse CDR, a rat CDR, a rabbit CDR, a monkey CDR, a monkey CDR, a CDR Synthetic, and / or a Humanized CDR In some embodiments, the CDR is human and somatically mutated.

In some embodiments, the bispecific antibodies comprise a human framework region (FR). In some embodiments, the human FR is a somatically mutated human FR.

In some embodiments, bispecific antibodies are obtained by screening a phage library comprising variable regions of antibodies for reactivity to an antigen of interest.

In some embodiments, the first and / or second antigen-binding regions of bispecific antibodies are obtained by immunizing a non-human animal such as a mouse, rat, rabbit, monkey or monkey with an antigen of interest and identify an antibody variable region nucleic acid sequence encoding a specific variable region for the antigen of interest.

In some embodiments, the bispecific antibody is a fully human bispecific antibody and has an affinity for each epitope, independently, in the micromolar, nanomolar, or picomolar range.

In some embodiments, the bispecific antibody is non-immunogenic or substantially non-immunogenic in a human. In some embodiments, the bispecific antibody lacks a non-native human T cell epitope. In some embodiments, the modification of the CH1 region is either non-immunogenic or substantially non-immunogenic in a human.

In some embodiments, the antigen-binding protein comprises a heavy chain, where the heavy chain is non-immunogenic or substantially non-immunogenic in a human.

In some embodiments, the heavy chain has an amino acid sequence that does not contain a non-native T cell epitope. In some embodiments, the heavy chain comprises an amino acid sequence whose proteolysis cannot form an amino acid sequence of about 9 amino acids that is immunogenic in a human. In a specific embodiment, the human is a human being treated with the antigen-binding protein. In some embodiments, the heavy chain comprises an amino acid sequence whose proteolysis cannot form an amino acid sequence of from about 13 to about 17 amino acids that is immunogenic in a human. In a specific embodiment, the human is a human being treated with the antigen-binding protein.

In some embodiments, more than one protein complex is co-expressed. In some embodiments, more than one antibody is co-expressed.

Brief description of the figures

Figure 1 is an illustration depicting mutations introduced into the lambda light chain to modulate its expression. VLCL2, wild type sequence; VLCL2_0, stream optimized; VLCL2_1, VLCL2_2, VLCL2_3, sequences with higher levels of de-optimization.

Figure 2 is a graph indicating the concentration of IgG1 antibodies obtained in the supernatant of Peak producer cells measured with OCTET technology.

Figure 3A is a graph of the HIC profile of purified total IgG.

Figure 3B is a graph showing the different percentage of monospecific kappa antibody, monospecific lambda antibody, and bispecific IgG for the different constructs and which were derived from the HIC profiles.

Figure 4 is an isoelectric focused polyacrylamide gel showing expression of monoclonal and bispecific antibodies after affinity purification with CaptureSelect IgG Fc XL resin.

Figure 5 is a series of graphs indicating total IgG productivity for different constructs of various groups of CHO cells.

Figure 6A is a gel-like image representation of a series of Agilent protein 80 chips that controls the sizes of heavy and light chains of purified IgG under reducing and denaturing conditions. Figure 6B is a graph showing the ratio of the total kappa and lambda light chains for various CHO groups for each construct.

Figure 7 is a series of graphs showing the % distribution for Kappa mono, Lambda mono and bispecific antibodies expressed by various groups of CHO cells.

Figure 8 is a graph showing the results of an ELISA showing the specific binding of each arm of the bispecific antibody against two targets (hCD19 and hCD47), as well as an irrelevant control protein (hIL6R). Detailed description

Recombinant expression in bacterial, yeast, insect, plant or mammalian cells is essential for the production of proteins that are used for research as well as for therapeutic applications. Recently, the expression performance of recombinant proteins in Chinese hamster ovary cells has been significantly improved by optimizing multiple parameters, such as the composition of the culture medium, the fermentation parameters, as well as the optimization of the constructs that are used. to drive expression of the gene encoding the recombinant protein of interest. These include improvements at transcriptional and translational levels, as well as secondary mRNA structures and stability. Another important element is optimization of codon usage to match the expression host and avoid limitation due to low abundance tRNAs. The optimization process may also include removing sequence repeats, killer motifs, and splice sites and avoiding stable RNA secondary structures. Codon usage and GC content can be simultaneously adapted for expression in CHO cells or other host cells. The objective of such modifications is to maximize the translation and stability of the RNA so that the translation and, therefore, the expression of the desired polypeptide are maximum.

Some proteins are composed of various polypeptides that can associate in complexes that can be covalently or non-covalently linked. Antibodies are an example of such a class of proteins, as they are composed of four polypeptides (i.e. two heavy chains and two light chains) that are linked by disulfide bonds. Antibodies have a unique specificity for a target antigen that is driven by the Fab portion, while they can be coupled to the immune system through its Fc portion. A series of biologic cancer therapies currently in use are monoclonal antibodies directed against antigens that are overexpressed by targeted cancer cells. When such antibodies bind to tumor cells, various processes can be triggered, such as antibody-dependent cellular toxicity (ADCC), antibody-dependent cell phagocytosis, or complement-dependent cytotoxicity (CDC). Due to its commercial and therapeutic importance, the expression of antibodies in CHO cells has been the subject of intense optimization efforts, with the aim of maximizing the expression of the two chains that make up the antibody. However, large differences can be observed since the expression levels can vary up to 200 times between the antibodies. The level of expression is determined by several factors including the level of light chain synthesis and the compatibility of the light and heavy chain for assembly. High light chain expression appears to be beneficial for overall complete antibody secretion rates (Strutzenberger et al., Changes during subclone development and aging of human antibodyproducing recombinant CHO cells, J. Biotechnol., Vol. 69 (2- 3): 215-16 (1999)). In fact, reduced light chain expression leads to heavy chain accumulation in the endoplasmic reticulum and limits productivity.

Targeting or neutralizing a single protein with a monoclonal antibody is not always sufficient to achieve efficacy and this limits the therapeutic use of monoclonal antibodies. It is increasingly clear that in a number of diseases the neutralization of a component of a biological system is not enough to provide a beneficial effect. Therefore, multispecific antibodies capable of coupling more than one antigen have been developed, for example, bispecific antibodies. A large number of bispecific antibody formats have been described and two bispecific antibodies have been approved so far, while many others are currently in clinical trials (Kontermann RE, Brinkmann U., Bispecific antibodies, Drug Discover Today, (2015), available at dx. doi.org/10.1016/j.drudis.2015.02.2008). In many cases, the bispecific antibody is composed of more than two polypeptides. The correct assembly can be based on the random pairing of the chains, leading to a mixture of molecules from which the bispecific antibody can be purified. Alternatively, the interface of the chains can be designed so that the desired pairing can be preferably obtained. In any case, the coexpression of multiple chains implies greater complexity and relative expression rates and, therefore, the abundance of the chains that make up the bispecific molecule can potentially have a major impact on overall performance and efficiency in the join.

Previous optimization approaches aimed to increase expression levels of polypeptides to achieve higher production yields. In the case of protein complexes composed of multiple polypeptides, unbalanced expression can limit the assembly of the desired molecule, promote the production of unwanted products and limit the overall production yield.

The methods of the disclosure improve the expression of protein complexes by adjusting the expression levels of each component required for complex assembly. The methods of the disclosure are effective in limiting the expression of the dominant chain and, therefore, balancing its relative abundance. The methods disclosed in this document leads to a significant increase in productivity and final bispecific yields both in transient expression systems and in stably transfected CHO cells. Therefore, the reduction of the expression of one or more polypeptides can lead to an overall increase in productivity.

Table 1 is a table representing the constructs generated with different levels of sequence optimization and deoptimization.

Table 1

The sequences used are shown below in Tables 1.1, 1.2 and 1.3.

Table 1.1. VHCH WT (SEQ ID NO: 1) and VHCH OPT (SEQ ID NO: 2) sequences VHCH 1 ATGGAATGGAGCTGGGTCTTTCTCTTCTTCCTGTCAGTAACTACAGGTGT

OPT 1 VHCH ATGGAATGGTCCTGGGTGTTCCTGTTCTTCCTGTCCGTGACCACCGGCGT VHCH 51 CCACTCCGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTG VHCH OPT 51 CCACTCCGAGGTGCAGCTGCTGGAATCTGGCGGCGGACTGGTCCAGCCTG VHCH 101 GGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGC VHCH OPT 101 GAGGCTCCCTGAGACTGTCTTGCGCCGCCTCCGGCTTCACCTTCTCCAGC VHCH 151 TATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGT VHCH OPT 151 201 TACGCCATGTCCTGGGTGCGACAGGCCCCTGGCAAGGGACTGGAATGGGT VHCH CTCAGCTATTAGTGGTAGTGGTGGTAGCACATACTACGCAGACTCCGTGA

(continuation)

VHCH OPT 201 GTCCGCCATCTCCGGCTCCGGCGGCTCTACCTACTACGCCGACTCCGTGA VHCH 251 AGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTG VHCH OPT 251 AGGGCCGGTTCACCATCTCCCGGGACAACTCCAAGAACACCCTGTACCTG VHCH 301 CAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAA VHCH OPT 301 CAGATGAACTCCCTGCGGGCCGAGGACACCGCCGTGTACTACTGCGCCAA VHCH 351 AAGTTATGGTGCTTTTGACTACTGGGGCCAGGGAACCCTGGTCACAGTCT VHCH OPT 351 GTCCTACGGCGCCTTCGACTACTGGGGCCAGGGCACCCTGGTGACAGTGT VHCH 401 CGAGCGCCTCCACCAAGGGCCCATCGGTCTTCCCCCTGGCACCCTCCTCC VHCH OPT 401 CCTCCGCCTCCACCAAGGGCCCATCCGTGTTCCCTCTGGCCCCTTCCAGC VHCH 451 AAGAGCACCTCTGGGGGCACAGCGGCCCTGGGCTGCCTGGTCAAGGACTA VHCH OPT 451 AAGTCCACCTCTGGCGGAACCGCTGCCCTGGGCTGCCTGGTGAAAGACTA VHCH 501 CTTCCCCGAACCGGTGACAGTCTCGTGGAACTCAGGAGCCCTGACCAGCG VHCH OPT 501 CTTCCCCGAGCCCGTGACCGTGTCCTGGAACTCTGGCGCCCTGACCAGCG VHCH 551 GCGTGCACACCTTCCCGGCTGTCCTACAGTCCTCAGGACTCTACTCCCTC VHCH OPT 551 GAGTGCACACCTTCCCTGCCGTGCTGCAGTCCTCCGGCCTGTACTCCCTG VHCH 601 AGCAGCGTGGTGACTGTGCCCTCCAGCAGCTTGGGCACCCAGACCTACAT VHCH OPT 601 TCCTCCGTGGTGACCGTGCCCTCCAGCTCTCTGGGCACCCAGACCTACAT VHCH 651 CTGCAACGTGAATCACAAGCCCAGCAACACCAAGGTGGACAAGAGAGTTG VHCH OPT 651 CTGCAACGTGAACCACAAGCCCTCCAACACCAAGGTGGACAAGCGGGTGG VHCH 701 AGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAGCACCT VHCH OPT 701 AACCCAAGTCCTGCGACAAGACCCACACCTGTCCTCCCTGCCCTGCCCCT VHCH 751 GAACTCCTGGGGGGACCGTCAGTCTTCCTCTTCCCCCCAAAACCCAAGGA VHCH OPT 751 GAACTGCTGGGCGGACCCTCCGTGTTTCTGTTCCCCCCAAAGCCCAAGGA VHCH 801 CACCCTCATGATCTCCCGGACCCCTGAGGTCACATGCGTGGTGGTGGACG VHCH OPT 801 CACCCTGATGATCTCCCGGACCCCCGAAGTGACCTGCGTGGTGGTGGACG VHCH 851 TGAGCCACGAAGACCCTGAGGTCAAGTTCAACTGGTACGTGGACGGCGTG VHCH OPT 851 TGTCCCACGAGGACCCTGAAGTGAAGTTCAATTGGTACGTGGACGGCGTG VHCH 901 GAGGTGCATAATGCCAAGACAAAGCCGCGGGAGGAGCAGTACAACAGCAC VHCH OPT 901 GAAGTGCACAACGCCAAGACCAAGCCCAGAGAGGAACAGTACAACTCCAC VHCH 951 GTACCGTGTGGTCAGCGTCCTCACCGTCCTGCACCAGGACTGGCTGAATG VHCH OPT 951 CTATCGGGTGGTGTCTGTGCTGACCGTGCTGCACCAGGACTGGCTGAACG VHCH 1001 GCAAGGAGTACAAGTGCAAGGTCTCCAACAAAGCCCTCCCAGCCCCCATC VHCH OPT 1001 G CAAAGAGTACAAGTGCAAGGTCTCCAACAAGGCCCTGCCTGCCCCCATC VHCH 1051 GAGAAAACCATCTCCAAAGCCAAAGGGCAGCCCCGAGAACCACAGGTGTA VHCH OPT 1051 GAAAAGACCATCTCCAAGGCCAAGGGCCAGCCCCGCGAACCCCAGGTCTA VHCH 1101 TACCCTGCCCCCATCTCGGGAGGAGATGACCAAGAACCAGGTCAGCCTGA VHCH OPT 1101 CACACTGCCACCTAGCCGGGAAGAGATGACCAAGAACCAGGTGTCCCTGA VHCH 1151 CTTGCCTGGTCAAAGGCTTCTATCCCAGCGACATCGCCGTGGAGTGGGAG VHCH OPT 1151 CCTGTCTGGTGAAAGGCTTCTACCCCTCCGATATCGCCGTGGAATGGGAG VHCH 1201 AGCAACGGGCAGCCGGAGAACAACTACAAGACCACGCCTCCCGTGCTGGA VHCH OPT 1201 TCCAACGGCCAGCCCGAGAACAACTACAAGACCACCCCCCCTGTGCTGGA VHCH 1251 CTCCGACGGCTCCTTCTTCCTCTATAGCAAGCTCACCGTGGACAAGTCCA VHCH OPT 1251 CTCCGACGGCTCATTCTTCCTGTACTCCAAGCTGACCGTGGACAAGTCCC VHCH 1301 GGTGGCAGCAGGGGAACGTCTTCTCATGCTCCGTGATGCATGAGGCTCTG VHCH OPT 1301 GGTGGCAGCAGGGCAACGTGTTCTCCTGCAGCGTGATGCACGAGGCCCTG VHCH 1351 CACAACCACTACACGCAGAAGAGCCTCTCCCTGTCTCCGGGTTAA (SEQ ID NO : 1) VHCH OPT 1351 CACAACCACTACACCCAGAAGTCCCTGTCCCTGAGCCCCGGCTAA (SEQ ID NO: 2)

CMi COi i CMi COi i CMi CO i CMi COi

1— 1— 1— 1— 1— 1— 1— I— '1— 1— H

CL CL CL CL CL CL CL CL CL CL CL CL

o OO 1 - OOO 1 - OOO 1 - OOO

LU LU LU CL LU LU LU CL LU LU LU CL LU LU LU ^Q QQOQQQOQQQOQQQ CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM CM

or or or or or or or or or or or or or or or or or

>>>>>>>>>>>>>>>>>>

CL CL CL OLU OLU OLU C CL Q QCM

_One thousand

O or CM QCM

CM

_ l _ l O_ l O _ l O _ l

> or >>CM> CO Table 2 is a table showing the following data for each construct: Total IgG and amount of bispecific antibodies after purification, as well as the bispecific ratio determined by HIC.

Table 2

Table 3 represents the total IgG productivity, the% bispecific per HIC after protein A purification, and the amount of bispecific purified from the CHO cell culture supernatant for representative groups for each construct.

Table 3

The polynucleotides and constructs thereof used in the methods provided herein can be synthetically generated by a number of different protocols known to those of skill in the art. Constructs appropriate polynucleotides are purified using standard D recombinant ⁿ as described in, for example, Sambrook et to the techniques, Molecular Cloning. A Laboratory Manual, 2nd Ed, (1989) Cold Spring Harbor Press, Cold Spring Harbor. , NY, and under current regulations in the United States Department of HHS, National Institute of Health (NIH) guidelines for research on recombinant DNA.

Also provided herein are constructs comprising the described nucleic acids inserted into a vector, wherein such constructs can be used for a number of different screening applications as described in greater detail below. In some embodiments, a single vector (eg, a plasmid) will contain a nucleic acid coding sequence for a single peptide display framework. In other embodiments, a single vector (eg, a plasmid) will contain a nucleic acid coding sequence for two or more peptide display scaffolds.

Viral and non-viral vectors, including plasmids, can be prepared and used that provide for DNA replication encoding the biosensor and / or expression in a host cell. The choice of vector will depend on the type of cell in which propagation is desired and the purpose of propagation. Certain vectors are useful for amplifying and making large amounts of the desired DNA sequence. Other vectors are suitable for expression in cultured cells. Still other vectors are suitable for transformation and expression in cells in an entire animal or person. Choosing the appropriate vector is within the skill of the technique. Many of these vectors are commercially available. To prepare the constructs, the partial or full length polynucleotide is inserted into a vector usually by means of DNA ligase binding to a divided restriction enzyme site in the vector. Alternatively, the desired nucleotide sequence can be inserted by homologous recombination in vivo. Typically, this is accomplished by attaching regions of homology to the vector on the flanks of the desired nucleotide sequence. The regions of homology are aggregated by oligonucleotide ligation, or by polymerase chain reaction using primers that comprise both the region of homology and a portion of the desired nucleotide sequence, for example. Expression cassettes or systems are also provided which find use, among other applications, in the synthesis of peptide display scaffolds. For expression, the polynucleotide encoded gene product of the disclosure is expressed in any convenient expression system, including, for example, bacterial, yeast, insect, amphibian, and mammalian systems. Suitable vectors and host cells are described in US Patent No. 5,654,173. In the expression vector, a polynucleotide binds to a regulatory sequence as appropriate to obtain the desired expression properties. These regulatory sequences may include promoters (linked at the 5 'end of the sense chain or at the 3 'end of the antisense chain), enhancers, terminators, operators, repressors, and inducers. Promoters can be regulated or constitutive. In some situations, it may be desirable to use conditionally active promoters, such as tissue-specific or developmental-stage promoters. These are linked to the desired nucleotide sequence using the techniques described above for vector binding. Any technique known in the art can be used. In other words, the expression vector will provide a transcriptional and translational start region, which can be inducible or constitutive, in which the coding region is operably linked under the transcriptional control of the transcriptional start region, and a transcriptional termination region and translational. These control regions may be native to the species from which the nucleic acid is derived, or may be derived from exogenous sources.

Eukaryotic promoters suitable for use include, but are not limited to, the following: the mouse metallothionein I gene sequence promoter (Hamer et al., J. Mol. Appl. Gen. 1: 273-288, 1982); the herpes virus TK promoter (McKnight, Cell 31: 355-365, 1982); the SV40 early promoter (Benoist et al., Nature (London) 290: 304-310, 1981); the yeast gall gene sequence promoter (Johnston et al., Proc. Natl. Acad. Sci. (USA) 79: 6971-6975, 1982); Silver et al., Proc. Natl. Acad. Sci. (USA) 81: 5951-59SS, 1984), the CMV promoter, the EF-1 promoter, the ecdysone sensitive promoter or promoters, the tetracycline sensitive promoter and the like. Additionally, promoters can be, constitutive or regulable. Inducible elements are DNA sequence elements that act in conjunction with promoters and can bind to repressors (eg, lacO / LAC Iq repressor system in E. coli) or inducers (eg, gall / GAL4 inducer system in yeast) . In such cases, transcription is virtually "inactive" until the promoter is depressurized or induced, at which point the transcription is "activated."

Expression vectors generally have convenient restriction sites located close to the promoter sequence to provide insertion of nucleic acid sequences encoding heterologous proteins. An operable selectable marker may be present in the expression host. Expression vectors can be used, inter alia, for the screening methods described in greater detail below.

Expression cassettes can be prepared comprising a transcription start region, the gene or fragment thereof, and a transcription termination region. After DNA introduction, cells containing the construct can be selected using a selectable marker, cells are expanded, and then used for expression.

The expression systems described above can be used with prokaryotes or eukaryotes according to conventional ways, depending on the purpose of the expression. In some embodiments, a single-celled organism, such as E. coli, B. subtilis, S. cerevisiae, insect cells in combination with baculovirus vectors, or cells from a higher organism such as vertebrates, eg, COS 7 cells, HEK 293 , CHO, Xenopus oocytes, etc., can be used as expression host cells. In other situations, it is desirable to use eukaryotic cells, in which the expressed protein will benefit from native folding and post-translational modifications.

Specific expression systems of interest include expression systems derived from bacterial cells, yeast, insect cells, and mammalian cells. Bacterial expression systems include those described in Chang et al., Nature (1978) 275: 615; Goeddel et al., Nature (1979) 281: 544; Goeddel et al., Nucleic Acids Res. (1980) 8: 4057; EP 0036,776; United States Patent No. 4,551,433; DeBoer et al., Proc. Natl. Acad. Sci. (USA) (1983) 80: 21-25; and Siebenlist et al., Cell (1980) 20: 269.

Mammalian expression is performed as described in Dijkema et al., EMBO J. (1985) 4: 761, Gorman et al., Proc. Natl. Acad. Sci. (USA) (1982) 79: 6777, Boshart et al., Cell (1985) 41: 521 and US Patent No.

4,399,216. Other features of mammalian expression are provided as described in Ham and Wallace, Meth. Enz. (1979) 58:44, Barnes and Sato, Anal. Biochem. (1980) 102: 255, US Patent Nos.

4,767,704, 4,657,866, 4,927,762, 4,560,655, WO 90/103430, WO 87/00195, and U.S. RE 30,985.

As will be appreciated by those skilled in the art, the type of host cells suitable for use can vary widely. In some embodiments, the cell is a bacterial cell, a yeast cell, or a mammalian cell. In some embodiments, the biological entity is a bacterial cell. In some embodiments, the bacterial cell is Escherichia coli, Shigella sonnei, Shigella dysenteriae, Shigella flexneri, Salmonella typhii, Salmonella typhimurium, Salmonella enterica, Enterobacter aerogenes, Serratia marcescens, Yersinia pestis, Bacillus cereus, Bacillus cereus, Bacillus cereus, Bacillus cereus, Bacillus cereus, Bacillus cereus

The constructs can be introduced into the host cell by any of the standard means practiced by one skilled in the art to produce a cell line of the disclosure. Nucleic acid constructs can be administered, for example, with cationic lipids (Goddard, et al, Gene Therapy, 4: 1231-1236, 1997; Gorman, et al, Gene Therapy 4: 983-992, 1997; Chadwick, et al , Gene Therapy 4: 937-942, 1997; Gokhale, et al, Gene Therapy 4: 1289-1299, 1997; Gao, and Huang, Gene Therapy 2: 710-722, 1995), using viral vectors (Monahan, et al, Gene Therapy 4: 40-49, 1997; Onodera, et al, Blood 91: 30-36, 1998), through the absorption of "naked DNA", and the like.

Definitions

Unless otherwise defined, the scientific and technical terms used in connection with the present disclosure will have the meanings commonly understood by those skilled in the art. Additionally, unless the context requires otherwise, the singular terms will include pluralities and the plural terms will include the singular. Generally, the nomenclatures used in relation to cell and tissue culture techniques, molecular and chemical biology, and protein and oligo or polynucleotide hybridization described herein are well known and commonly used in the art. Standard techniques are used for the synthesis of recombinant DNA and oligonucleotides, as well as for tissue culture and transformation (eg, electroporation, lipofection). Enzymatic reactions and purification techniques are performed according to the manufacturer's specifications or as commonly accomplished in the art or as described herein. The above techniques and procedures are generally performed in accordance with conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. See, for example, Sambrook et al. Molecular Cloning: A Laboratory Manual (2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989)). The nomenclatures used in connection with, and the laboratory procedures and techniques of analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and commonly used in the art. Standard techniques are used for chemical synthesis, chemical analysis, pharmaceutical preparation, formulation, administration, and treatment of patients.

As used in accordance with this disclosure, the following terms, unless otherwise indicated, are understood to have the following meanings:

The term "polynucleotide" as referenced herein means a polymeric boron of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of any type of nucleotide. The term includes single-stranded and double-stranded forms of DNA.

The term "polypeptide" is used herein as a generic term to refer to native proteins, fragments, or mutants of a polypeptide sequence. Therefore, native and mutant protein fragments are species of the polypeptide genus. Preferred polypeptides according to the disclosure comprise cytokines and antibodies.

As used herein, the term "antibody" refers to immunoglobulin molecules and immunologically active portions of immunoglobulin (Ig) molecules, that is, molecules that contain an antigen binding site that specifically binds (immunoreacts with ) an antigen. Such antibodies include, but are not limited to, single chain polyclonal, monoclonal, chimeric, Fab, Fab ', and F (ab') ² fragments, and antibodies in a Fab expression library. By "specifically bind" or "immunoreact with" is meant that the antibody reacts with one or more antigenic determinants of the desired antigen and does not react (ie bind) with other polypeptides or bind with much lower affinity (Kd> 10 '6) with other polypeptides. The basic antibody structural unit is known to comprise a tetramer. Each tetramer is made up of two identical pairs of polypeptide chains, each pair having a "light" chain (approximately 25 kDa) and a "heavy" chain (approximately 50-70 kDa). The amino terminal portion of each chain includes a variable region of approximately 100 to 110 or more amino acids primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region primarily responsible for effector function. Human light chains are classified as kappa and lambda light chains. Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody isotype as IgM, IgD, IgG, IgA, and IgE, respectively. Within light and heavy chains, the variable and constant regions are linked by a "J" region of about 12 or more amino acids, and the heavy chain also includes a "D" region of about 10 more amino acids. See generally, Fundamental Immunology Ch. 7 (Paul, W., ea., 2nd ed. Raven Press, NY (1989)). The variable regions of each light / heavy chain pair form the antibody binding site.

The term "monoclonal antibody" (MAb) or "monoclonal antibody composition", as used herein, refers to a population of antibody molecules containing only one molecular species of antibody molecule consisting of a single product light chain gene and a single heavy chain gene product. In particular, the complementarity determining regions ( ^c D ^r ) of the monoclonal antibody are identical in all molecules of the population. MAbs contain an antigen binding site capable of immunoreacting with a particular epitope of the antigen characterized by a unique binding affinity for it.

In general, antibody molecules obtained from humans are related to any of the IgG, IgM, IgA, IgE and IgD classes, which differ from each other by the nature of the heavy chain present in the molecule. Certain Classes also have subclasses, such as IgG1, IgG2, and others. Additionally, in humans, the light chain can be a kappa chain or a lambda chain.

The term "fragments thereof" as used herein will mean a segment of a polynucleotide sequence or a polypeptide sequence that is less than the length of the entire sequence. Fragments as used herein comprise functional and non-functional regions. Fragments of different polynucleotide or polypeptide sequences are exchanged or combined to create a hybrid or "chimeric" molecule. The fragments are also used to modulate the binding characteristics of polypeptides to sequences of polynucleotides or other polypeptides.

The term "promoter sequence", as used herein, will mean a polynucleotide sequence that comprises a region of a gene that is controlled for initiation and rate of transcription. A promoter sequence comprises a binding site ^for R ⁿ polymerase and binding sites for other positive and negative regulatory elements. Positive regulatory elements promote gene expression under control of the promoter sequence. Negative regulatory elements repress gene expression under control of the promoter sequence. The promoter sequences used in this document are upstream or internal to the gene that is regulated. Specifically, the term "first promoter sequence" versus "second promoter sequence" refers to the relative position of the promoter sequence within the expression vector. The first promoter sequence is upstream of the second promoter sequence. The term "selection gene" as used herein will mean a polynucleotide sequence that encodes a polypeptide that is necessary for cell survival under the given culture conditions. If a cell has successfully incorporated the expression vector carrying the gene of interest, along with the selection gene, that cell will produce an element that will allow it to selectively survive under hostile culture conditions. "Selected" cells are those that survive under selective pressure and must have incorporated the expression vector. The term "selective pressure" as used herein will mean the addition of an element to the cell culture medium that inhibits the survival of cells that do not receive the DNA composition.

The term "endogenous gene" as used herein will mean a gene encompassed within the genomic sequence of a cell. The term "exogenous gene" as used herein will mean a gene not encompassed within the genomic sequence of a cell. Exogenous genes are introduced into cells by instant methods. The term "transgene", as used herein, will mean a gene that has been transferred from one organism to another.

As used herein, all twenty conventional amino acids and their abbreviations follow conventional use. See Immunology-A Synthesis (2nd Edition, ES Golub and DR Gren, Eds., Sinauer Associates, Sunderland Mass. (1991)). Stereoisomers (eg, D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as a, a-disubstituted amino acids, N-alkyl amino acids, lactic acid, and other unconventional amino acids may also be suitable components for polypeptides of the present disclosure. Examples of unconventional amino acids include: 4-hydroxyproline, Y-carboxyglutamate, £ -N, N, N-trimethylisin, £ -N-acetylsine, O-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, aN-methylarginine and other similar amino acids and imino acids (eg 4-hydroxyproline). In the polypeptide notation used herein, the left direction is the amino terminal direction and the right direction is the carboxyl terminal direction, in accordance with standard usage and convention. Similarly, unless otherwise specified, the left end of single chain polynucleotide sequences is the 5 'end, the left direction of double chain polynucleotide sequences is called the 5' direction. The direction of the 5 'to 3' addition of the nascent RNA transcripts is known as the transcription direction sequence regions in the DNA strand that have the same sequence as the RNA and that are 5 'to the 5' end of RNA transcription as "upstream sequences", regions of sequence in the DNA strand that have the same sequence as RNA and are at the 3 'to 3' end of RNA transcription are called "sequences descending ”.

Silent or conservative amino acid substitutions refer to the interchangeability of residues that have similar side chains. For example, a group of amino acids that have aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic hydroxyl side chains is serine and threonine; one group of amino acids having amide-containing side chains is asparagine and glutamine; one group of amino acids that have aromatic side chains is phenylalanine, tyrosine, and tryptophan; one group of amino acids that have basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulfur-containing side chains is cysteine and methionine. Preferred conservative amino acid substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, valine alanine, glutamic-aspartic, and asparagine-glutamine.

Silent or conservative replacements are those that take place within a family of amino acids that are related in their side chains. Genetically encoded amino acids are divided generally in families: (1) the acidic amino acids are aspartate, glutamate; (2) the basic amino acids are lysine, arginine, histidine; (3) the nonpolar amino acids are alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan, and (4) the uncharged polar amino acids are glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. Hydrophilic amino acids include arginine, asparagine, aspartate, glutamine, glutamate, histidine, lysine, serine, and threonine. Hydrophobic amino acids include alanine, cysteine, isoleucine, leucine, methionine, phenylalanine, proline, tryptophan, tyrosine, and valine. Other families of amino acids include (i) serine and threonine, which are the aliphatic-hydroxy family; (ii) asparagine and glutamine, which are the amide-containing family; (iii) alanine, valine, leucine and isoleucine, which are the aliphatic family; and (iv) phenylalanine, tryptophan, and tyrosine, which are the aromatic family. For example, it is reasonable to expect that an isolated replacement of a leucine with an isoleucine or valine, an aspartate with a glutamate, a threonine with a serine, or a similar replacement of an amino acid with a structurally related amino acid will not have a significant effect on binding or the properties of the resulting molecule, especially if the replacement does not involve an amino acid within a framework site. It can be easily determined whether an amino acid change results in a functional peptide by assaying for the specific activity of the polypeptide derivative. The assays are described in detail in this document. Those skilled in the art can easily prepare fragments or analogs of antibodies or immunoglobulin molecules. Preferred amino and carboxy termini of fragments or analogs occur near the limits of functional domains. Structural and functional domains can be identified by comparing nucleotide and / or amino acid sequence data with proprietary or public sequence databases. Preferably, computerized comparison methods are used to identify sequence motifs or predicted protein conformation domains that occur in other proteins of known structure and / or function. Methods are known for identifying protein sequences that fold into a known three-dimensional structure. Bowie et al. Science 253: 164 (1991). Therefore, the above examples demonstrate that those skilled in the art can recognize sequence motifs and structural conformations that can be used to define structural and functional domains according to the disclosure.

A silent or conservative amino acid substitution should not substantially change the structural characteristics of the parent sequence (for example, a replacement amino acid should not tend to break a helix that occurs in the parent sequence, or disrupt other types of secondary structure that characterizes the parent sequence). Examples of secondary and tertiary structures of recognized polypeptides are described in Proteins, Structures and Molecular Principles (Creighton, Ed., W. H. Freeman and Company, New York (1984)); Introduction to Protein Structure (C. Branden and J. Tooze, eds., Garland Publishing, New York, N.Y. (1991)); and Thornton et at. Nature 354: 105 (1991).

Other chemical terms herein are used in accordance with conventional use in the art, as exemplified by The McGraw-Hill Dictionary of Chemical Terms (Parker, S., Ed., McGraw-Hill, San Francisco (1985)) .

Examples

Example 1. Mutations introduced into the lambda light chain for optimization and deoptimization of codons in mammalian cells

The anti-CD19 x anti-CD47 44, bispecific antibody based on the technology of the body ^k A, it is composed of a common heavy chain and two different light chains. These chains are encoded by the construction of plasmid 44 (Table 1). When this expression plasmid is transfected into mammalian cells, three molecules are produced by random assembly of the three chains: a monospecific IgGK (containing two identical ^k light chains), a monospecific IgGA (containing two identical A light chains), and a bispecific IgGKA, (containing a light chain ^k and a light chain A). If the two light chains are expressed at the same rate and assemble equally, the theoretical ratio for the three molecules should be 25% IgGK, 25% IgGA, and 50% IgGKA. In the case of construct 44, there is preferential expression of the A light chains leading to suboptimal expression and performance of bispecific antibodies. In order to improve this situation, optimization and de-optimization of the different chains has been carried out to adjust the relative relations of the chains.

Codon optimization has been performed with the GeneOptimizer® (GeneArt) software, on heavy chains, kappa and lambda. Different candidates were generated by cloning the optimized or non-optimized chains into the wild-type plasmid encoding the bispecific antibody 44.

Three different levels of codon deoptimization were performed on the over-expressed lambda chain. Three constructs (3, 13, and 19 de-optimized lambda chains) were generated and combined with optimized kappa and heavy chains. Different degrees of deoptimization were applied to light chain A. Constructs 3, 13, and 19 contained increasingly deoptimized sequences (VLCL2-1, VLCL2-2, and VLCL2-3 respectively, see Figure 1). Constructs 17 and 15 were also generated with an optimized lambda chain (Table 1).

Example 2. Cloning and characterization of IgG expressed in Peak cells

The common heavy chain and two wild-type, codon-optimized or de-optimized light chains (one kappa and one lambda) were cloned into a single mammalian expression pNOVI vector under three independent CMV promoters. After sequence verification, IgG productivity for each construct in Peak cells was assessed by two independent transient transfections using Lipofectamine 2000. Seven days after transfection, total IgG expression was assessed by Octet technology. Except for candidate 15, no significant difference was observed between the candidates in terms of total IgG productivity. A trend towards a decrease in productivity was observed with construction 15 in which all the chains had been optimized (Figure 2). After 10 days of production in PEAK cells, the total IgGs were purified on the Fc XL resin.

The distribution of the three different forms of IgG, monospecific lambda, monospecific kappa, and bispecific antibody, was determined by HIC-HPLC analysis using the ProPac HIC-10 column (Dionex) (Figure 3A). A mobile phase gradient A (0.001M phosphate buffer 1M ammonium sulfate, pH 3.5) from 85 to 35% and an increasing mobile phase B gradient (0.001M acetonitrile phosphate buffer 10%, pH 3.5) of 15% were applied. to 100%. A blank was made with the mobile phase A, pH 7. The analysis of the peak of the HIC area (Figure 3B) shows a trend with an increase in the bispecific percentage for the deoptimized candidates 3, 13 and 19 compared to the wild type 44 and the optimized 15 and 17. The ratio of monospecific kappa and lambda for 3, 13 and 19 was significantly different compared to 44.

An IEF 7-11% was also performed to evaluate the total IgG distribution (Figure 4). The candidates with lambda optimization show an increase in monospecific lambda compared to clone 44 and less monospecific and bispecific kappa. Candidates 3, 13 and 19 showed a significant increase in kappa and bispecific monospecific.

Table 2 summarizes the data obtained for candidates expressed in PEAK cells. For candidates 3, 13 and 19, the final percentage of bispecific obtained was higher, with an increase in the bispecific ratio from 21.6% for 44 to 42.9% for candidate 13. Interestingly, the highest level of codon deoptimization (construction 19) of the lambda chain increases the productivity of the bispecific antibody.

Example 3. IgG Expression in Stably Transfected CHO Cells

After transfection by electroporation and selection with MSX, FACS screening was performed. The groups with the highest production were selected for production under loaded batch conditions. Total IgG productivity was evaluated for different groups using Octet technology (Figure 5). After purification by protein A, the relationship of the different chains was evaluated by electrophoresis on an Agilent protein 80 chip that monitors the sizes of the heavy and light chains under conditions of reduction and denaturation.

As shown in Agilent's analysis (Figure 6A), for 44, the lambda chain was more represented than the kappa chain. For various CHO groups, constructs 3 and 13 improved the balance between the two light chains. With increasing deoptimization of the lambda chain, the ratio was reversed compared to the initial construct (44 vs. 19). This was confirmed by calculating the relationship between the two light chains (Figure 6B). Thus, the balance between the two light chains, which was in favor of the lambda chain for 44, was gradually reversed, correlating with the level of deoptimization. When all the productive groups are analyzed, a significant difference can be observed between candidates 13, 19 and candidate 44, with more kappa light chain and less lambda light chain. Based on these results, Candidates 3 and 13 should show an increase in BsAb expression, since the two light chains are expressed at more equivalent levels. After purification by protein A, the relationship of the different forms of IgG was evaluated by HIC for all IgG-producing groups (Figure 7). The data shows that the level of monospecific lambda gradually decreases with the level of deoptimization and the inverse pattern for monospecific kappa is observed. Bispecific levels peak at about 40% with a very homogeneous distribution for constructs 3 and 13. Conversely, unbalanced expression of one of the two chains (as in 44 or 19) leads to a reduced level of production bispecific.

In order to confirm specific binding against their targets, the binding of all candidates to hCD19 and hCD47 was evaluated by ELISA (Figure 8). The two specific targets of the bispecific antibodies and an irrelevant protein at 2 pg / mL in PBS were coated overnight at 4 ° C in a 96-well streptavidin-coated microplate. After 3 washes with 0.05% (v / v) PBS Tween (PBST), the purified antibodies, diluted to 2 pg / mL in PBST 1% BSA, were incubated 30 min at 37 ° C in the plate. The wells were washed 3 times with PBST, and then a secondary antibody (horseradish peroxidase-coupled anti-human IgG Fc) was added and incubated 1 hr at 37 ° C. Tetramethylbenzidine was used to reveal ELISA and blocked with sulfuric acid. Absorbance was read at 450nm.

The expression of each candidate was expanded and the supernatants were collected after 10 days and clarified by centrifugation at 1,300 g for 10 minutes. The purification process was made up of three affinity stages. First, the Capture-Select IgG-CH1 affinity matrix (Life Technologies) was washed with PBS and then added to the clarified supernatant. After incubation overnight at 4 ° C, the supernatants were centrifuged at 1000g for 10 minutes, the supernatant was discarded, and the resin was washed twice with PBS. Then, the resin was transferred to rotating columns and a solution containing 50 mM glycine at pH 2.7 was used for the elution.

Various elution fractions were collected, pooled and desalted against PBS using Amicon 50 kDa ultra centrifugal filter units (Merck KGaA). The final product, containing total human IgG from the supernatant, was quantified using a Nanodrop spectrophotometer (NanoDrop Technologies, Wilmington, DE) and incubated for 15 minutes at room temperature and 20 rpm with the appropriate volume of KappaSelect affinity resin (GE Healthcare ). The incubation, resin recovery, elution and desalination steps were performed as previously described (Fischer et al., Nature Comms. 2015). The last affinity purification step was performed using the LambdaFabSelect affinity resin. The total IgG, the percentage of bispecific antibodies measured by HIC and the purified bispecific productivity of the CHO cell groups are summarized in Table 3. The data shows that the deoptimization and the reduced expression of the lambda chain lead to an increase in the total IgG and bispecific product productivity. The optimization method generated a 2.5-fold increase in bispecific antibody yield.

Claims (3)

1. A method of increasing the yield of production of a protein complex comprising: (a) identify one or more polypeptides in the complex that are most abundantly expressed in a cell compared to the other polypeptides in the complex; (b) modifying at least one nucleic acid molecule that encodes the most abundantly expressed polypeptides in the complex, in which nucleic acid molecules are modified by altering the codon composition of nucleic acid molecules resulting in a reduction in the expression of the polypeptides it encodes; (c) introducing the nucleic acid molecules into a cell; and (d) culturing the cell under conditions that allow the expression of all the polypeptides of the protein complex; wherein said reduction in expression is achieved by replacing certain codons with less frequently used codons in the cell, by encoding a change in the secondary structure of the mRNA or encoding a change in the translation rate, and wherein the protein complex is a bispecific antibody. 2. The method of claim 1, wherein the bispecific antibody is composed of two different light chains and a common heavy chain. 3. The method of claim 1, wherein more than one of the protein complex is co-expressed.