WO2016153305A1 - 표적 유전자 특이적 핵산 프로브 및 Fok Ι 제한효소 이량체를 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하기 위한 조성물 및 이의 용도 - Google Patents
표적 유전자 특이적 핵산 프로브 및 Fok Ι 제한효소 이량체를 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하기 위한 조성물 및 이의 용도 Download PDFInfo
- Publication number
- WO2016153305A1 WO2016153305A1 PCT/KR2016/003020 KR2016003020W WO2016153305A1 WO 2016153305 A1 WO2016153305 A1 WO 2016153305A1 KR 2016003020 W KR2016003020 W KR 2016003020W WO 2016153305 A1 WO2016153305 A1 WO 2016153305A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- gene
- glycine
- restriction enzyme
- target gene
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/10—Processes for the isolation, preparation or purification of DNA or RNA
- C12N15/102—Mutagenizing nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y301/00—Hydrolases acting on ester bonds (3.1)
- C12Y301/21—Endodeoxyribonucleases producing 5'-phosphomonoesters (3.1.21)
- C12Y301/21004—Type II site-specific deoxyribonuclease (3.1.21.4)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
Definitions
- the present invention relates to a composition for specifically editing a target gene in a cell using a target gene specific nucleic acid probe and a FokI restriction enzyme dimer, and more particularly, to (a) a nucleotide sequence of a target gene.
- a target gene recognition probe comprising a base sequence complementary to and a protein binding material linked to the complementary base sequence; And (b) an expression vector inserted such that a gene encoding a dimer linked to two FokI restriction enzymes and a gene encoding a protein binding to the protein binding substance are linked to each other and expressed as an active ingredient.
- the present invention relates to a method of specifically editing a target gene in a cell using a target gene specific editing composition.
- Gene editing technology that induces deletion, correction, or insertion only for specific gene sequences in a living genome has attracted much attention these days. The reason is that while genetic recombination technology has been the focus of past genetic engineering techniques, it now focuses on the functioning of genes by manipulating the genome in cells and further on the treatment of genetic diseases. Gene editing technology is currently attracting much attention around the world because of its accuracy and efficiency in removing certain genes from enormous size gene sequences in the biological genome.
- the earliest developed gene editing technique is the zinc-finger nuclease (ZFN) method.
- ZFN zinc-finger nuclease
- TALEN Transcription Activator-Like Effector Nucleases
- Korean Patent Publication No. 2011-0101175 discloses 'editing a genome of a rat using zinc finger nucleases'
- Korean Patent Publication No. 2012-0101532 discloses a 'TAL effector-mediated DNA modification'
- Korean Patent Publication No. 2014-0115335 'modified cascade ribonucleoprotein and uses thereof' are disclosed, but targets in cells using target gene specific nucleic acid probes and Fok I restriction enzyme dimers as in the present invention. There is no known method of specifically editing a gene and its use.
- the present invention is derived from the above requirements, in the present invention, a plurality of histidine expression sequences, which are proteins that bind to the FokI restriction enzyme dimer expression gene and EDTA included in the complementary sequence recognition nucleic acid probe of the target gene, After preparing the inserted expression vector, the target gene-specific probe and the divalent transition metal ion to which the vector and EDTA were bound were introduced into the cells. As a result, it was confirmed that the FokI restriction enzyme and the target gene specific probe were bound by the coordination bond between the probe which is a sequence recognition material of the target gene and histidine, which is a protein binding to EDTA, in the presence of a transition metal in the cell. .
- the present invention unlike the genetic engineering techniques that have been developed up to now, in the setting of the target gene specific probe, there is no need for the combination of the gene binding region in the genome, there is no limitation of the target recognition sequence in the living genome Regardless of whether the cytosine is methylated among the target gene sequences in the genome, the binding and cleavage force are maintained, and there is no off-target effect in the genome-like target gene sequence.
- the present invention has been completed.
- the present invention (a) a target gene recognition probe comprising a base sequence complementary to the base sequence of the target gene and a protein binding material linked to the complementary base sequence; And (b) an expression vector inserted such that a gene encoding a dimer linked to two FokI restriction enzymes and a gene encoding a protein binding to the protein binding substance are linked to each other and expressed as an active ingredient.
- a target gene recognition probe comprising a base sequence complementary to the base sequence of the target gene and a protein binding material linked to the complementary base sequence
- an expression vector inserted such that a gene encoding a dimer linked to two FokI restriction enzymes and a gene encoding a protein binding to the protein binding substance are linked to each other and expressed as an active ingredient.
- step (b) introducing into the cell a target gene recognition probe comprising the expression vector of step (a) and a nucleotide sequence complementary to the nucleotide sequence of the target gene and a protein binding material linked to the complementary nucleotide sequence;
- step (c) providing a method for specifically editing a target gene in a cell, the method comprising inducing the binding of the FokI restriction enzyme dimer expressed with the target gene recognition probe introduced into the cell of step (b).
- the present invention provides a target gene recognition probe comprising a base sequence complementary to the base sequence of the target gene and a protein binding material linked to the complementary base sequence; And an expression vector containing a FokI restriction enzyme dimer expression gene and a gene encoding a protein binding to the protein binding substance; is provided as a target gene specific editing kit.
- the present invention does not require the combination of gene binding regions in the genome, and there is no limitation of the target recognition sequence in the living genome, as well as in the genome, in the setting of target gene specific probes than other genetic engineering techniques developed to date. Even if cytosine is methylated in the target gene sequence, the binding and cleavage force are maintained, and since there is no off-target effect at all the similar target gene sequences in the genome, Editing can be performed.
- the present invention uses a nucleic acid probe as a configuration for recognizing the position to be edited in the gene in the cell, so in the case of the present invention to specifically recognize and access any position in the gene by designing the sequence of the nucleic acid probe accordingly.
- a nucleic acid probe as a configuration for recognizing the position to be edited in the gene in the cell, so in the case of the present invention to specifically recognize and access any position in the gene by designing the sequence of the nucleic acid probe accordingly.
- FokI restriction enzyme monomer required for DNA double strand cleavage with only one probe Since both can be placed in the edit position, they have simplicity compared to the CRISPR / CAS9 editing technique, and the expression vector included in the composition of the present invention contains only two FokI restriction enzymes and a linker ( Since cloning of about 2-3 kbp is possible, the payload is not excessive even when Adeno-Associate virus (AAV) or the like is used to deliver the composition of the present invention. It is more efficient than CAS9 editing technology.
- AAV Adeno-Associate virus
- the present invention is a very useful method in life science research such as medicine, pharmacy, biotechnology using genetic manipulation, and can greatly contribute to the development of gene therapy and biotechnology.
- FIG. 1 shows a method for binding a target gene specific nucleic acid probe and a FokI restriction enzyme dimer comprising a plurality of histidine expression sequences.
- Figure 2 is a FokI restriction enzyme dimer expression gene containing a plurality of histidine expression sequences inserted into the DNA vector, when later expressed as a protein, linked through coordination bonds with each other with the IDT-C2 (EDTA-C 2 ) compound The structure is shown.
- C-type refers to the presence of hexa histidine sequence, nuclear localization signal (NLS) sequence, myc epitope sequence at the carboxyl (-COOH) terminus of the FokI restriction enzyme dimer
- N-type refers to the presence of a hexa histidine sequence, a nuclear localization signal (NLS) sequence, and a myc epitope sequence at the amino group (-NH2) terminus of a FokI restriction enzyme dimer.
- FIG. 4 shows the structure of the Fok I restriction enzyme dimer expression protein conjugated with the target gene-specific nucleic acid probe and streptavidin bound biotin.
- C-type refers to the presence of streptavidin gene, nuclear localization signal (NLS) sequence and myc epitope sequence at the carboxyl (-COOH) end of the FokI restriction enzyme dimer.
- N-type refers to the presence of streptavidin gene, nuclear localization signal (NLS) sequence, myc epitope sequence at the amino group (-NH 2 ) end of the Fok I restriction enzyme dimer do. Considering the structure and mobility of the protein and the possibility of binding to the probe, two forms were produced.
- 5 shows four PCR products generated according to primer combinations for green fluorescent protein expressing genes.
- Primers were prepared to form products of 100bp and 70bp length during the polymerase chain reaction.
- the product formed after the polymerase chain reaction is denatured at 95 ° C. and immediately quenched to leave four types of DNA (P1, P2, P3, P4).
- Figure 6 shows the results of developing each of the four PCR products generated according to the primer combination for the green fluorescent protein expression gene on agarose gel.
- Lane 1 F1 + R primer
- Lane 2 immediately after annealing
- Figure 7 shows the activity of the FokI restriction enzyme dimer by confirming the fragmented DNA product after reacting the lysate obtained by expressing the FokI restriction enzyme dimer expression gene containing a plurality of histidine expression sequences in E. coli with a general DNA vector The result is confirmed.
- Lane 1 buffer; Lane 2, Mock extract; Lane 3, FokI restriction enzyme extract
- Probes 1 and 2 synthesized 26 deoxyribonucleic acid bases and 26 bases having complementary sequences in the 3 'direction from the initiation codon of the green fluorescent protein expressing gene, respectively. 2 ) combined. Lanes 1, 2, 3, 4 and 5 in the upper gel photograph represent Reagents 1, 2, 3, 4 and 5, respectively, shown in the table. (+, Addition;-, no addition)
- Treat is a gene editing function by transducing a cell line with a probe and a gene editing vector bound to IDTA-C2 (EDTA-C 2 ), and Control is a gene editing function by transducing only a gene editing vector into a cell line.
- C-type is the case where the hexa histidine sequence-binding vector is transduced into the cell line at the carboxyl (-COOH) terminal of the Fok I restriction enzyme dimer
- N-type is at the amino group (-NH2) terminal of the Fok I restriction enzyme dimer.
- TALEN is a case of transducing cell lines with a Transcription Activator-Like Effector Nucleases plasmid vector.
- FIG. 10 is a result of observing the cells transfected with the C-type FokI restriction enzyme gene expression vector, the probe, and the talen (TALEN) in the fluorescence microscope.
- Figure 11 shows endogenous lectin galactose-binding soluble 3 binding protein gene (Lectin, GALactoside-binding, Soluble, 3 Binding Protein, LGALS3BP) exon 3 specific nucleic acid probe position.
- T7 endonuclease 1 is a restriction enzyme that cleaves double-bonded DNA that is completely mismatched and wobbled, and is used to identify sequence insertions or deletions in genomic DNA. It is an enzyme.
- Figure 13 is a result of the polymerase chain reaction by producing a bidirectional primer for the LGALS3BP gene to confirm whether the endogenous human LGALS3BP gene edition (gene edition).
- FP1 + RP1 primer; FP2 + RP1 primer; gDNA, genomic DNA The primer sequence used was FP1 of 5'-tacaagctcagcaggggaga-3 '(SEQ ID NO: 1), and RP1 of 5'-ttcgtcttaggggatttgcc-3' (SEQ ID NO: 2) , FP2 is 5'-agatcttctacagaggccag-3 '(SEQ ID NO: 3).
- FIG. 14 shows the results of nucleotide sequences analyzed using nucleotide sequence primers by selecting two of the products amplified by PCR in FIG. 13 and binding to a DNA vector.
- FIG. 16 is a schematic diagram showing positions (A) and sequences (B) of four deoxyribonucleic acid probes selected from the human LGALS3BP gene exon 3, which are composed of 20 deoxyribonucleic acid bases and binds biotin in the 5 'direction. Form.
- results of a specific editing experiment (C) targeting human LGALS3BP gene exon 3 using the human probe are shown.
- FIG. 17 shows the preparation of a donor DNA vector required for substitution of the exon moiety comprising the glycosylation sequence of the endogenous murine immunoglobulin G1 (IgG1) gene.
- FIG. 18 is a DNA vector containing 5 ⁇ g of a FokI restriction enzyme dimer expression gene including a plurality of histidine expression sequences, nickel (Ni 2+ ), 0 mM, 5 mM, 50 mM, and 3 ⁇ M DNA probe, respectively, and a donor DNA vector shown in FIG. 17.
- 5 ⁇ g was introduced into rat NH-3T3 (NIH-3T3) cells.
- the primer sequence used was knock-in-F of 5'-gcagcaccaaggtggacaag-3 '(SEQ ID NO: 4) and knock-in-R of 5'-gtgctgggtgtggcagtgta-3' (SEQ ID NO: 5).
- No TF is the result of transfection of the cell line with the gene plasmid vector of N-type Fok I restriction enzyme dimer
- px458 is the result of transduction of the Cas9 gene plasmid vector into the cell line.
- Genetic editing is impossible because no function exists.
- CRISPR is a case of transducing a Cas9 gene plasmid vector and a single-stranded RNA guided plasmid vector into a cell line at the same time, and the gene recognition function is present and the gene can be edited.
- FokI is a case of transducing a FokI restriction enzyme dimer gene, an IDT-C2 DNA probe, and nickel (Ni. So4) into a cell line at the same time.
- T7 restriction enzyme 1 (T7 endonuclease 1, T7E1) is a restriction enzyme that cuts mismatched double-binding DNA, and was used to confirm the insertion or deletion of nucleotide sequences in genomic DNA.
- the primer sequence used was knock-in-F of 5'-gcagcaccaaggtggacaag-3 '(SEQ ID NO: 6) and knock-in-R of 5'-gtgctgggtgtggcagtgta-3' (SEQ ID NO: 7).
- No TF is the result of transducing the cell line with the gene plasmid vector of the N-type Fok I restriction enzyme dimer, and Donor DNA is the case of transducing the donor gene plasmid vector into the cell line. This is impossible.
- px458 is the result of transducing a Cas9 gene plasmid vector into a cell line. In both cases, gene editing is impossible because there is no target gene recognition function.
- CRISPR is a case of transducing a Cas9 gene plasmid vector and a single-stranded RNA guided plasmid vector into a cell line at the same time, and the gene recognition function is present and the gene can be edited.
- TALEN is a case of transducing a transcript activator-like effector nucleases plasmid vector into a cell line, and there is a target gene recognition function so that the gene can be edited.
- FokI is a case of transducing a FokI restriction enzyme dimer gene, an IDT-C2 DNA probe, and nickel (Ni. So4) into a cell line at the same time.
- the present invention (a) a target gene recognition probe comprising a base sequence complementary to the base sequence of the target gene and a protein binding material linked to the complementary base sequence; And (b) an expression vector inserted such that a gene encoding a dimer linked to two FokI restriction enzymes and a gene encoding a protein binding to the protein binding substance are linked to each other and expressed as an active ingredient.
- a target gene recognition probe comprising a base sequence complementary to the base sequence of the target gene and a protein binding material linked to the complementary base sequence
- an expression vector inserted such that a gene encoding a dimer linked to two FokI restriction enzymes and a gene encoding a protein binding to the protein binding substance are linked to each other and expressed as an active ingredient.
- DNA a genetic material in vivo, goes through a process of replication, which takes the original DNA as a template and turns it into two new DNAs, and the DNA polymerase complex plays a role.
- the place where DNA replication occurs is called the replication fork, where there is a moment when the double helix is exposed as a single helix.
- FokI dimer is bound through the biotin or EDTA to induce the cleavage of the double-stranded strand beyond the replication branch point.
- DNA damage can occur due to errors in the DNA replication process, or environmental factors such as ultraviolet rays and radiation, and two methods are used to repair them.
- the method of non-isomorphic terminal conjugation is prone to its own repair error, so that deletion or insertion of nucleotide sequences on nucleotides can be easily performed, and when applied to genetic engineering research, it can be used to remove specific gene functions in the genome.
- the method called homologous direct repair is a method that allows repair without deletion or insertion of nucleotide sequences on nucleotides.
- certain sequences present in the actual genome are inserted into the donor DNA vector By inserting additional sequences to be inserted into the genome into the cell, it can be used to insert specific foreign genes that did not originally exist in the genome.
- the nucleic acid probe and the FokI restriction enzyme dimer approach the nucleotide portion in which DNA replication is in progress on the genome in the nuclear membrane of the cell.
- the nucleic acid probe is bound to the base sequence complementary to its base sequence.
- the metal chelating agent or biotin bound to the end of this probe is histidine or tetravalent streptavidin or monovalent streptavidin at the end of the FokI restriction enzyme dimer.
- a Fok I restriction enzyme dimer binds to two strands of DNA nucleotides, respectively, and cleaves both strands.
- the donor DNA vector (the specific sequence present on the actual genome is inserted into the donor DNA vector and the base sequence to be inserted into the genome in the middle thereof) is introduced together.
- the gene sequence in the donor DNA allows the correct sequence to be corrected.
- the protein binding material of (a) may be a metal chelating agent or a biotin, and the preferred metal chelating agent may be an EDTA, but is not limited thereto. It doesn't work.
- the protein that binds to the protein binding material of (b) is a plurality of histidine, tetravalent streptavidin or monovalent streptavidin
- the plurality of histidines may be preferably hexa histidine, but is not limited thereto.
- the protein that binds to the nucleotide sequence recognition material of the target gene is hexa histidine, and when using biotin as the nucleotide sequence recognition material of the target gene, the base of the target gene
- the protein that binds the sequence recognition material may be tetravalent streptavidin or monovalent streptavidin.
- composition according to the embodiment of the present invention when using EDTA as a protein binding material linked to the nucleotide sequence recognition material of the target gene may further include a transition metal, the transition metal is Ni 2+ , Co 2+ or Zn 2+ and the like, but is not limited thereto.
- the probe is 10 to 100, preferably 10 to 50, more preferably 10 to 50 deoxyriboNucleic Acid (DNA) or Ribonucleic Acid (RNA) base having a sequence complementary to the target sequence 10-30 can be used.
- DNA deoxyriboNucleic Acid
- RNA Ribonucleic Acid
- the expression vector of (b) binds to a protein binding material linked to a FokI restriction enzyme dimer expression gene, a linker, a nucleotide sequence complementary to a nucleotide sequence of a target gene.
- the protein coding gene and the nuclear localization signal (NLS) sequence may be operably linked.
- the linker is to impart such a function, since the proteins encoded by the genes in the vector are intended to give a function that can have a flexible mobility when expressed in the cell, Any connection can be used.
- the linker may be from 1 to 10 glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 1-10 ), most preferably between FokI restriction enzyme dimer genes.
- Insert 10 glycine-glycine-glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 10 ) and insert three glycine-glycine-glycine-glycine-serine linkers between the FokI restriction enzyme monomer and the nuclear position signal (NLS) sequence. ((GGGGS) 3 ) may be inserted, but is not limited thereto.
- the expression vector is a protein coding gene, nuclear position signal (NLS) that binds to a protein binding material linked to a base sequence complementary to the base sequence of the target gene in the 5 ' ⁇ 3' direction Sequence, three glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 3 ), FokI restriction enzyme gene, ten glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 10 ) and FokI restriction enzymes The gene is operably linked; Or FokI restriction enzyme gene, 10 glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 10 ), FokI restriction enzyme gene, three glycine-glycine-glycine-glycine-serine linkages in the 5 ' ⁇ 3' direction.
- NLS nuclear position signal
- GGGGS nuclear position signal
- NLS nuclear position signal
- operably linked in the present invention is meant that the expression control sequence is effectively incorporated to control the expression of the coding sequence of interest.
- RNA polymerase can transcribe a coding sequence into RNA (even if it is an mRNA), and then can be translated into a protein encoded by the coding sequence, the coding sequence is "operably linked” and the expression of the expression control sequence in the cell. It is “under control.”
- regulatory regions can modulate, eg regulate, facilitate, or advance transcription in animal cells, animals, or animal tissue desired to express modified target nucleic acids.
- composition according to one embodiment of the present invention further comprises a myc epitope sequence between a nuclear position signal (NLS) sequence and three glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 3 ). It may include.
- the addition of the myc epitope sequence may be used to confirm whether protein expression in cells is confirmed through protein immunoblot (western blot).
- the gene editing or manipulation may be, but is not limited to, gene deletion, gene insertion, gene correction or chromosomal rearrangement.
- gene insertion when the target gene specific composition of the present invention and the donor DNA vector are transduced together in the cell, homologous recombination is induced by recognizing homologous base sequences of the donor DNA vector in the cell. By inserting between sequences, the desired gene can be inserted exactly at the target location in the chromosome.
- step (b) introducing into the cell a target gene recognition probe comprising the expression vector of step (a) and a nucleotide sequence complementary to the nucleotide sequence of the target gene and a protein binding material linked to the complementary nucleotide sequence;
- step (c) providing a method for specifically editing a target gene in a cell, the method comprising inducing the binding of the FokI restriction enzyme dimer expressed with the target gene recognition probe introduced into the cell of step (b).
- the protein binding material included in the probe of step (b) may be a metal chelating agent or biotin, and the preferred metal chelating agent may be EDTA. May be, but is not limited thereto.
- the protein that binds to the protein binding material linked to the base sequence complementary to the base sequence of the target gene of step (a) is a plurality of histidine, tetravalent streptavidin (tetravalent streptavidin ) Or monovalent streptavidin, and the plurality of histidines may preferably be hexa histidine, but is not limited thereto.
- the expression vector of step (a) is a protein binding material linked to the base sequence of the Fok I restriction enzyme dimer expression gene, linker, the target sequence and complementary
- the binding protein encoding gene and the nuclear localization signal (NLS) gene may be operably linked.
- the linker comprises three glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 3 ) or ten glycine-glycine-glycine-glycine-serine linkers (( GGGGS) 10 ), but is not limited thereto.
- the expression vector is a protein coding gene, nuclear position signal (NLS) that binds to a protein binding material linked to a base sequence complementary to the base sequence of the target gene in the 5 ' ⁇ 3' direction Sequence, three glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 3 ), FokI restriction enzyme gene, ten glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 10 ) and FokI restriction enzymes The gene is operably linked; Or FokI restriction enzyme gene, 10 glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 10 ), FokI restriction enzyme gene, three glycine-glycine-glycine-glycine-serine linkages in the 5 ' ⁇ 3' direction.
- NLS nuclear position signal
- GGGGS nuclear position signal
- NLS nuclear position signal
- the method according to an embodiment of the present invention further comprises a myc epitope sequence between a nuclear position signal (NLS) sequence and three glycine-glycine-glycine-glycine-serine linkers ((GGGGS) 3 ). It may include.
- NLS nuclear position signal
- GGGGS glycine-glycine-glycine-glycine-serine linkers
- the gene editing or manipulation may be gene deletion, gene insertion, gene correction or chromosomal rearrangement, but is not limited thereto.
- the introduction into the cell of step (b) may be a liposome delivery method or an electroporation method, preferably an electroshock method, but is not limited thereto. .
- the introduction of the expression vector and the target gene recognition probe into the cell may simultaneously introduce the expression vector and the target gene recognition probe, and the expression vector is first introduced into the cell.
- the target gene recognition probe may be introduced after the introduction, but is not limited thereto.
- the induction of binding of the FokI restriction enzyme and the target gene recognition probe introduced and expressed into the cell of step (c) may further include introducing a transition metal into the cell in step (b).
- a transition metal In the presence of a transition metal in a cell, coordination of EDTA, which is a sequence recognition material of a target gene, and histidine, a protein that binds EDTA, can induce binding of FokI restriction enzyme and a target gene recognition probe.
- the transition metal may be Ni 2+ , Co 2+ or Zn 2+ and the like, and preferably Ni 2+ , but is not limited thereto.
- the cell may be an animal cell, a plant cell or a microbial cell, but is not limited thereto.
- the present invention provides a target gene recognition probe comprising a base sequence complementary to the base sequence of the target gene and a protein binding material linked to the complementary base sequence; And an expression vector containing a FokI restriction enzyme dimer expression gene and a gene encoding a protein binding to the protein binding substance; is provided as a target gene specific editing kit.
- the 'target gene recognition probe' of the present invention has been used interchangeably with the same meaning as the 'target gene specific nucleic acid probe' or 'nucleic acid probe' described throughout the specification.
- the inventors have developed a new type of pluripotent gene editing technology, which synthesizes 26 deoxyribo nucleic acid (DNA) or ribonucleic acid (RNA) bases with sequences complementary to the target gene sequence. By using it as a target gene recognition material, it is possible to recognize a specific sequence in the organism very specifically.
- DNA deoxyribo nucleic acid
- RNA ribonucleic acid
- Two FokI restriction enzyme expression genes were mixed with 1 ⁇ l (50ng) of pMLM-290 and pMLM-292 plasmid vector DNA, 1 ⁇ l forward primer, 1 ⁇ l reverse primer, 17 ⁇ l distilled water, and PCR primix for 5 minutes at 95 ° C. After a total reaction of 30 seconds at 95 ° C., 30 seconds at 60 ° C., and 30 seconds at 72 ° C., a total of 30 times was obtained.
- FokI -290 forward primer 5'-TTGGATCCCAACTAGTCAAAAGTGAA-3 '(SEQ ID NO: 9)
- FokI -290 reverse primer 5'-TTGAGCTCGTTTATCTCGCCGTTATT-3 '(SEQ ID NO: 10)
- FokI -292 forward primer 5'-TTGTCGACCCCAACTAGTCAAAAGTGAACT-3 '(SEQ ID NO: 11)
- FokI -292 reverse primer 5'-TTCTCGAGCCTTAAAAGTTTATCTCGCCGT-3 '(SEQ ID NO: 12)
- the product was digested with 100 volts of 1.5% agarose gel, and only DNA was extracted therefrom.
- FokI restriction enzyme dimer expression gene Fok1-290 DNA, BamHI, SacI restriction enzyme was mixed and reacted for 16 hours at 37 °C.
- the pET-28a (+) plasmid vector DNA, BamHI, and SacI restriction enzymes having multiple histidine sequences were mixed and reacted at 37 ° C. for 16 hours.
- the restriction enzyme reaction was completed, the product was digested with 100 volts of 1.5% agarose gel, and only DNA was extracted therefrom. Each DNA, 10 ⁇ ligase buffer, and T4 DNA ligase were mixed and reacted at 16 ° C.
- the obtained product was transformed into DH5 ⁇ Escherichia coli strains and cultured in LB agar plates. The obtained transformed colonies were injected into LB medium and incubated at 37 ° C. at 250 rpm for 16 hours.
- the plasmid vector DNA was extracted from the obtained product, followed by nucleotide sequence analysis using a sequencing primer.
- T7 5'-TAATACGACTCACTATAGGG-3 '(SEQ ID NO: 13)
- FokI restriction enzyme expression gene Fok1-292 DNA, SalI, NotI restriction enzyme was mixed and reacted for 16 hours at 37 °C.
- PET-28a (+) plasmid vector DNA having multiple histidine sequences, SalI, NotI restriction enzyme was mixed and reacted at 37 ° C. for 16 hours.
- the product was digested with 100 volts of 1.5% agarose gel, and only DNA was extracted therefrom. Each DNA, 10 ⁇ ligase buffer, and T4 DNA ligase were mixed and reacted at 16 ° C. for 16 hours.
- the obtained product was transformed into DH5 ⁇ Escherichia coli strains and cultured in LB agar plates. The obtained transformed colonies were injected into LB medium and incubated at 37 ° C. at 250 rpm for 16 hours.
- the plasmid vector DNA was extracted from the obtained product, followed by nucleotide sequence analysis using a sequencing primer.
- T7 ter 5'-GCTAGTTATTGCTCAGCG-3 '(SEQ ID NO: 14)
- GGGGS linker Three glycine-glycine-glycine-glycine-glycine-serine linkers (GGGGS linker) were used between NhI and BamHI restriction enzymes between multiple histidine sequences in the pET-28a (+) plasmid vector and FokI restriction enzyme expression gene FokI- 290. Three glycine-glycine-glycine-glycine-serine linkers were inserted between SokI and SalI restriction enzymes between FokI restriction enzyme expression genes FokI -290 and FokI -292 (FIG. 1).
- the last base of the 26 deoxyribonucleic acid or ribonucleic acid bases was synthesized with deoxy-thymine or deoxy-uracil and bound to this site an EDDI-C2 (EDTA-C2) compound. (FIG. 2).
- the product was digested with 100 volts of 1.2% agarose gel, and extracted with only DNA. The mixture was reacted for 16 hours at 37 ° C. by mixing KpnI and ApaI restriction enzymes.
- pcDNA3.1 hygro (+) plasmid vector DNA, KpnI, ApaI restriction enzymes were mixed and reacted at 37 ° C. for 16 hours.
- the product was digested with 100 volts in 1.2% agarose gel, and only DNA was extracted therefrom. Each DNA, 10 ⁇ ligase buffer, and T4 DNA ligase were mixed and reacted at 16 ° C. for 16 hours.
- the obtained product was transformed into DH5 ⁇ Escherichia coli strains and cultured in LB agar plates.
- the obtained transformed colonies were injected into LB medium and incubated at 37 ° C. at 250 rpm for 16 hours.
- the plasmid vector DNA was extracted from the obtained product, followed by nucleotide sequence analysis using a sequencing primer.
- T7 5'-TAATACGACTCACTATAGGG-3 '(SEQ ID NO: 17)
- BGH-R 5'-TAGAAGGCACAGTCGAGG-3 '(SEQ ID NO: 18)
- the obtained plasmid vector DNA was inserted with a nuclear localization signal (NLS) sequence and a myc epitope sequence using NheI and BamHI restriction enzymes (FIG. 3).
- the obtained plasmid vector DNA was inserted into the plasmid vector using FokI restriction enzyme dimer expression gene and tetravalent streptavidin or monovalent streptavidin using XhoI restriction enzyme.
- Nuclear localization signal (NLS) sequences and myc epitope sequences were inserted together (FIG. 4).
- R1 5'-CCTCGCCGGACACGCTGAA-3 '(SEQ ID NO: 25)
- the product formed after the polymerase chain reaction was reacted at 95 ° C. for 5 minutes and immediately at 196 ° C., resulting in four types of DNA remaining (FIG. 5).
- the 100 bp DNA, 70 bp DNA immediately after the polymerase chain reaction thus obtained, and the DNA immediately after formation of the heterozygotes and the DNA reacted for 4 hours at 37 ° C. were each developed at 100 volts on an agarose gel (FIG. 6).
- the FokI restriction enzyme dimer expression gene and a number of histidine expression sequences were inserted into the pET-28a (+) plasmid vector and then transformed into the BL21 (DE3) Escherichia coli strain together with the E.
- E. coli expression plasmid vector without the foreign gene inserted. The obtained E. coli colonies (colony) were injected into the medium and incubated at 37 ° C. at 250 rpm for 16 hours. When the optical density reached 0.4-0.6 at an absorbance of 600 nm using an ultraviolet spectrophotometer, IPTG at a concentration of 0.1 mM was injected, and then grown at 18 ° C. at 180 rpm for 18 hours. The expanded Escherichia coli were centrifuged at 13,000 rpm for 15 minutes at 4 ° C and the supernatant was removed. The remaining precipitate was pulverized by applying ultrasonic waves while repeating the operation for 5 seconds and stopping for 10 seconds for 10 seconds.
- a lysate obtained by transforming a FokI restriction enzyme dimer expression gene and a number of histidine sequences into an E. coli expression plasmid vector was injected into a Histrep HP column and purified by AKTA purifier using an imidazole concentration gradient.
- AKTA purifier using an imidazole concentration gradient.
- the obtained protein and two green fluorescent protein expression gene probes, Ni 2+ and EDTA, were reacted with four types of DNA obtained in the previous experiment (see FIG. 5) for 14 hours at 37 ° C. under different injection conditions. And agarose gel development was performed (FIG. 8).
- IDD-C2 was respectively bound to the terminal of the nucleic acid probe.
- the green fluorescent protein expression gene was introduced into the human colorectal cancer cell line WIDr, and then, the fluorescence microscopy was observed to select the strong cells. After the final selection of cells capable of expressing the green fluorescent protein at all times, 5 ⁇ g of a plasmid vector containing 300 pM probe of the green fluorescent protein expressing gene, a FokI restriction enzyme dimer expressing gene, and multiple histidine sequences were inserted into the cells. (Ni 2+ ) 500 mM was introduced simultaneously.
- TALE Transcription activator binding regions
- Intracellular transduction was performed using lipofectamine 2000, one of the liposome delivery methods, and electroporation, under conditions of twice impacting for 1,250 volts for 20/1000 hours. After 96 hours of transduction, the cells were separated, and then the fluorescence intensities of 10,000 cells in the transduced cells were measured using FACS aria, which runs flow cytometry, and then calculated as a curve on a graph. (FIG. 9). Cells transduced with the C-type FokI restriction enzyme gene plasmid vector, probe and TALEN were observed under fluorescence microscopy (FIG. 10).
- Endogenous lectin galactose-binding soluble-binding protein 3 gene (Lectin, GALac-toside-binding, Soluble, 3 Binding Protein, LGALS3BP) synthesizes 26 bases complementary to the deoxyribonucleic acid sequence of exon 3 and this deoxyribonucleic acid probe Was bound to endi-C2 (Fig. 11).
- 5 ⁇ g of a pcDNA3.1 hygro (+) plasmid vector into which the FokI restriction enzyme dimer gene and a number of histidine sequences were inserted, 50 mM of nickel (Ni 2+ ), and 1 ⁇ M of a DNA probe were detected. -29) at the same time.
- a plasmid vector 50 mM of nickel (Ni 2+ ), and 3 ⁇ M of DNA probe, into which the FokI restriction enzyme dimer gene and a number of histidine sequences were inserted, were simultaneously introduced into human colon cancer cell line HT-29 (HT-29).
- Intracellular transduction was performed using lipofectamine 2000, one of the liposome delivery methods, and electroporation under three conditions of imparting shock at 1,600 volts for 10/1000 seconds. After 96 hours of transduction, the cells were subjected to electroporation, respectively. 48 hours after transfection, the genomic DNA was purified and polymerase chain reaction was performed using a bidirectional primer for LGALS3BP gene.
- R1 5'-ttcgtcttaggggatttgcc-3 '(SEQ ID NO: 29)
- the obtained polymerase chain reaction product was reacted for 5 minutes at 95 ° C., and the reaction was carried out for 91 times to decrease the temperature by 1 ° C. per minute.
- 12 ⁇ l of the obtained product 10 ⁇ l of restriction enzyme, 2 ⁇ l of T7 restriction enzyme, 0.5 ⁇ l of T7 restriction enzyme and 5.5 ⁇ l of distilled water were mixed and reacted at 37 ° C. for 20 minutes, and developed at 12 volts on 12% polyacrylamide gel (FIG. 12).
- Two of the products amplified by the polymerase chain reaction were screened, run at 100 volts on a 1.5% agarose gel, cleaved, and only DNA was extracted therefrom.
- Wild-type HT-29 cells and transfected HT-29 cells in culture were isolated from the culture dish using trypsin-IDT, lysed with NP40 (Nonidet-P40) buffer, and stopped for 1 second of operation for 1 second.
- the grinding was performed by applying ultrasonic waves while repeating for a total of 30 seconds. Centrifugation was performed at 4 DEG C for 15 minutes at 13,000 rpm, and only the supernatant was separated and quantified using a Bradford assay.
- the same concentrations of lysate were each mixed with 5 ⁇ buffer, Phosphate-Buffered Saline (PBS), reacted for 5 minutes at 95 ° C., and then developed on a 12% polyacrylamide gel.
- PBS Phosphate-Buffered Saline
- PVDF PolyVinylidene DiFluoride
- the second antibody anti-mIgG-HRP (mouse Immunoglobulin G-Horse Radish Peroxidase) was injected with 5% of skim milk (TBST (Tris-Buffered Saline + Tween20 0.1%)
- TBST Tris-Buffered Saline + Tween20 0.1%)
- the solution was mixed at a ratio of 1: 2,000 and the PVDF membrane was injected and stirred at room temperature for 1 hour.
- Six stirring washes were performed with TBST for 10 minutes and the color development solution was mixed with PVDF membranes and exposed to an X-ray film for printing with a developer (FIG. 15).
- a pUC19 donor plasmid vector was constructed to be substituted in the exon moiety containing the glycosylation sequence of the gene of immunoglobulin G1 involved in synthesizing the antibody in mice.
- a Sac I restriction enzyme recognition sequence which was not present in the glycosylation sequence of the original gene was inserted, and DNA probes were synthesized and sited for the substitution of nucleotide sequences (FIG. 17).
- FokI restriction enzyme dimer gene and multiple histidine sequences are inserted plasmid vector 5 ⁇ g, nickel (Ni 2+), respectively 0mM, 5mM, 50mM, DNA probe 3 ⁇ M, child H.
- the donor plasmid vector 5 ⁇ g rat yen ( NIH-3T3) cells were introduced.
- two pCS2TAL3-DD and pCS2TAL3-RR plasmid vectors were also prepared by using the TALEN method according to the substitution sites, and 5 ⁇ g each of the pCS2TAL3-DD and pCS2TAL3-RR plasmid vectors were introduced into the mouse NN-3T3 (NIH-3T3) cells. .
- the obtained polymerase chain reaction product was reacted for 5 minutes at 95 ° C., and the reaction was carried out for 91 times to decrease the temperature by 1 ° C. per minute.
- 12 ⁇ l of the obtained product 10 ⁇ l of restriction enzyme, 2 ⁇ l of T7 restriction enzyme, 0.5 ⁇ l of T7 restriction enzyme and 5.5 ⁇ l of distilled water were mixed and reacted at 37 ° C. for 20 minutes, and developed at 12 volts on 12% polyacrylamide gel (FIG. 18).
- the inventors have developed a new type of pluripotent gene editing technology, which synthesizes 26 deoxyribo nucleic acid (DNA) or ribonucleic acid (RNA) bases with sequences complementary to the target gene sequence. By using it as a target gene recognition material, it is possible to recognize a specific sequence in the organism very specifically.
- FokI restriction enzyme dimer expressing genes containing a number of histidine expression sequences were inserted into a DNA vector and subsequently linked to each other through coordination bonds with an IDT-C2 compound when expressed as a protein.
- GGGGS linkers 10 glycine-glycine-glycine-glycine-serine linkers (GGGGS linkers) are inserted between the FokI restriction enzyme dimer expression genes, and glycine-glycine-glycine- is inserted between the FokI restriction enzyme monomer and a number of histidine expressing genes. Three serine linkers (GGGGS linker) were inserted to allow for flexible motility when subsequently expressed as proteins in vivo (FIG. 1).
- Nuclear localization signal (NLS) genes were inserted so that when the gene expression vector was injected into a living cell, it was expressed as a protein and allowed to reside in the cell nucleus and bind to the genome.
- myc epitope sequence was able to determine whether the protein expression in the living cells in the future through protein immunoblot (protein immunoblot, western blot) (Fig. 3). Two types of C-type and N-type cases were prepared in consideration of the structure, motility and the possibility of binding to the probe.
- Nuclear localization signal (NLS) sequences were inserted so that when the gene expression vector was injected into a living cell, it was expressed as a protein and then resident in the cell nucleus to bind to the genome.
- NLS Nuclear localization signal
- the FokI restriction enzyme dimer expression gene including a plurality of histidine expression sequences was inserted into an E. coli expression DNA vector, and then transformed into BL21 (DE3) pluripotent E. coli cells, respectively, together with an E. coli expression DNA vector without a foreign gene. E. coli colonies thus obtained were injected into the liquid medium and grown at 37 ° C. When the optical density reached 0.4-0.6 at an absorbance of 600 nm, IPTG at a concentration of 0.1 mM was injected and grown at 18 ° C. for 18 hours. The so-proliferated E. coli was pulverized with ultrasonic waves to obtain a lysate. The product was reacted with a general DNA vector at 37 ° C.
- the base 26 having the FokI restriction enzyme dimer target specific green fluorescent protein expression in the 3 'direction from the initiation codon of the gene deoxyribonucleic acid base 26 and one which complementary to a sequence in order to determine the activity of the synthetic and distal ends, respectively IDT-C2 (EDTA-C2) was bound.
- the lysate obtained by transforming a FokI restriction enzyme dimer expression gene containing a plurality of histidine expression sequences into an E. coli expression DNA vector was subjected to affinity chromatography and ion-exchange chromatography. Purification was carried out. The obtained protein and two green fluorescent protein expression gene probes, Ni 2+ and EDTA, were reacted with four types of DNA obtained in the previous experiment (see FIG.
- the final selection of cells capable of expressing the green fluorescent protein at all times, and then the expression vector 5 containing the probe 300pM of the green fluorescent protein expression gene, FokI restriction enzyme dimer expression gene, and a number of histidine expression gene ⁇ g and nickel (Ni 2+ ) 500 mM were introduced simultaneously.
- nickel serves to bind to IDT-C2 in the cell.
- gene expression vectors were first introduced into cells, followed by the introduction of green fluorescent protein gene probes after 24 hours. For comparison with the TALEN method, 20 nucleotide sequences were selected from the start codon of the green fluorescent protein expressing gene and 20 nucleotide sequences were further selected by 12 nucleotide sequences in the 3 ′ direction.
- Each of the factor (TALE) binding regions were combined and inserted into the DNA vector, followed by introducing 5 ⁇ g of left and right vectors into the cell at the same time.
- Intracellular introduction was performed using lipofectamine 2000, which is one of liposome delivery methods, and electroporation, respectively.
- the cells were separated, and then the fluorescence intensity of 10,000 cells in all transduced cells was measured using flow cytometry, and then calculated as a curve on a graph.
- the introduction of C-type FokI restriction enzyme gene expression vector and probe into the cell resulted in a 19% reduction in green fluorescence expression, and the introduction of N-type FokI restriction enzyme gene expression vector and probe into the cell was green.
- the fluorescence expression rate was reduced by 5%.
- the result of using the TALEN method also reduced the green fluorescence expression rate by 5% (FIG. 9).
- C-type FokI restriction enzyme gene expression vector, a cell transfected with a probe and TALEN, respectively, were observed by fluorescence microscopy. As a result, many cells in which fluorescence expression disappeared were observed (FIG. 10).
- Endogenous lectin galactose-binding soluble binding protein 3 gene (Lectin, GALac-toside-binding, Soluble, 3 Binding Protein, LGALS3BP) is synthesized 20 bases complementary to the deoxyribonucleic acid nucleotide sequence of exon 3, and the deoxyribonucleic acid probe Binding to IDT-C2 at the end.
- a FokI restriction enzyme dimer expressing gene containing a number of histidine expression sequences was inserted into a DNA vector and subsequently linked through coordination bonds with an idieti-C2 compound bound to the end of the probe when expressed as a protein. (FIG. 11).
- a DNA vector into which FokI restriction enzyme dimer expression gene containing a plurality of histidine expression sequences 50 mM of nickel (Ni 2+ ), and 1 ⁇ M of DNA probe were added to human colon cancer cell line HT-29 (HT-29). Introduced simultaneously.
- 5 ⁇ g of a DNA vector, 50 ⁇ M of nickel (Ni 2+ ), and 3 ⁇ M of DNA probe inserted with FokI restriction enzyme dimer gene and a number of histidine-expressing genes were simultaneously introduced into human colon cancer cell line HT-29 (HT-29). I was. Intracellular introduction was performed using lipofectamine 2000, which is one of liposome delivery methods, and electroporation, respectively.
- a bidirectional primer for the LGALS3BP gene was prepared and subjected to a polymerase chain reaction to identify a gene amplification product inserted into the genome.
- a bidirectional primer for the LGALS3BP gene was prepared at the expected cleaved DNA site and subjected to a polymerase chain reaction to confirm a large number of unamplified products (FIG. 13).
- LGALS3BP gene of H-29 cells transfected with wild-type H-29 cells was confirmed by protein immunoblot (Western blot). Confirmed that no expression was observed. As a result, it was found that knock-out of specific genes was well performed (FIG. 15).
- FIG. 16C shows various types of defects (denoted by ⁇ ) and additions (denoted by +). If a deletion or addition occurs in multiples of three (e.g., 27 base deletions), the gene's function can be preserved, but otherwise, a frame shift of the gene is induced, resulting in gene targeting. Will give birth to. As a result, it was confirmed that the gene editing technology using the biotin-streptavidin interlinkage functioned properly in vivo (FIG. 16).
- a donor DNA vector to be substituted for the exon moiety containing the glycosylation sequence of the gene of immunoglobulin G1 involved in synthesizing the antibody in mice was constructed.
- the Sac I restriction enzyme recognition sequence which was not present in the glycosylation sequence of the original gene was inserted.
- glycosylation does not normally occur in immunoglobulin G1.
- DNA probes were synthesized according to the site to be replaced with the nucleotide sequence, and the ID-C2 was bound (FIG. 17).
- a FokI restriction enzyme dimer expressing gene containing a number of histidine expression sequences was inserted into a DNA vector and subsequently linked through coordination bonds with an idieti-C2 compound bound to the end of the probe when expressed as a protein.
- a number of restriction enzyme FokI dimer expressed genes including histidine expressed sequence the inserted DNA vector 5 ⁇ g, nickel (Ni 2+), respectively 0mM, 5mM, 50mM, DNA probe 3 ⁇ M, the donor DNA vector 5 ⁇ g the rat eye yen H. -3T3 (NIH-3T3) cells were introduced.
- T7 endonuclease 1 is a restriction enzyme that cleaves double-bonded DNA that is completely mismatched and wobbled, and is used to identify sequence insertions or deletions in genomic DNA. It is an enzyme.
- each truncated gene amplification product was confirmed (FIG. 18).
- each truncated gene amplification product was confirmed (FIG. 19).
- primers for amplification were synthesized to include target gene sites in the genome, followed by polymerase chain reaction. Three amplified products were ligated to the vector DNA, and nucleotide sequences were analyzed using sequencing primers. As a result, it was confirmed that the Sac I restriction enzyme recognition sequence was inserted in all three amplified products, and it was found that knock-in of the specific gene was well performed (FIG. 20).
Landscapes
- Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Crystallography & Structural Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
본 발명은 (a) 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및 (b) 두 개의 FokⅠ 제한효소가 서로 연결된 이량체를 코딩하는 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 서로 연결된 채 발현될 수 있도록 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 조성물 및 상기 표적 유전자 특이적 편집용 조성물을 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하는 방법을 제공한다.
Description
본 발명은 표적 유전자 특이적 핵산 프로브 및 FokⅠ 제한효소 이량체를 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하기 위한 조성물 및 이의 용도에 관한 것으로, 더욱 상세하게는 (a) 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및 (b) 두 개의 FokⅠ 제한효소가 서로 연결된 이량체를 코딩하는 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 서로 연결된 채 발현될 수 있도록 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 조성물을 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하는 방법에 관한 것이다.
생체 게놈 내에서 특정 유전자 염기서열만을 대상으로 삭제나 교정, 삽입을 유도하는 유전자 편집 기술은 요즘 세계적으로 큰 관심을 불러일으키고 있다. 그 이유는 과거의 유전 공학 기술 내에서 유전자 재조합 기술이 초점이었다면, 현재는 세포 내 게놈을 조작함으로써 유전자의 기능을 밝히고, 더 나아가서 유전 질환의 치료에 초점을 맞추고 있기 때문이다. 유전자 편집 기술은 기존의 유전자 재조합 기술과 비교했을 때, 생체 게놈 내 엄청난 크기의 유전자 염기서열 중 특정 유전자를 제거하는 정확성과 효율성을 보이기 때문에 현재 세계적으로 큰 주목을 받고 있다.
가장 최초에 개발된 유전자 편집 기술은 징크핑거 뉴클라아제(Zinc-Finger Nuclease, ZFN) 방법이다. 이 기술은 표적 유전자 서열과 결합이 가능한 단백질과 FokⅠ 제한효소를 결합시킨 형태인데, 이 표적 유전자 결합 영역의 조합 효율이 낮고 시간이 많이 걸리는 단점을 가지고 있다.
그 다음에 개발된 기술이 탈렌(Transcription Activator-Like Effector Nucleases, TALEN) 방법인데 식물체를 감염시키는 잔토모나스(Xanthomonas) 속 세균에서 처음으로 발견된 전사 인자를 이용한 기술이다. 이 기술은 DNA 표적 결합 영역의 조합에 시간이 많이 걸리는 점과 표적 유전자 서열이 반드시 티민(thymine)으로 시작해야 한다는 점, 표적 유전자 서열 중 시토신이 메칠화(methylation)되어 있으면 결합력이 감소되는 점, 생체 게놈 내 유사 표적 서열에서 활성을 띈다는 부작용(off-target effect) 등의 단점을 가지고 있다.
그리고 가장 최근에는 크리스퍼/카스9(Clustered Regularly Interspaced Short Palindromic Repeats/Cas9, CRISPR/Cas9) 방법이 개발되었는데, 1987년 최초로 대장균에서 크리스퍼가 보고된 이후, 활발한 연구 결과로 인해 이것은 세균 내부에 외부의 바이러스가 침입했을 때 이에 대항하는 획득성 면역 체계라는 사실이 규명되었다. 이 기술은 앞서 설명한 2가지 유전자 편집 기술들보다 효율도 높고 합성 가격도 많이 저렴한 편이다. 그러나 표적 유전자 서열에 반드시 아데닌/구아닌/시토신/티민-구아닌-구아닌(A/G/C/T-G-G, NGG, PAM 서열)이 반복되어야 결합이 가능하다는 점과 생체 게놈 내 유사 표적 유전자 서열에서 활성을 띈다는 부작용 등의 단점을 가지고 있다.
현존하는 유전자 편집 기술들은 지금까지도 활발히 연구가 진행되고 있는데 각각의 단점들을 지니고 있다. 그래서 이러한 단점들을 해결할 수 있는 보편적인 만능 유전자 편집 기술의 등장이 절실한 상황이다.
한편, 한국공개특허 제2011-0101175호에서는 '징크 핑거 뉴클레아제를 이용한 랫트의 유전체 편집'이 개시되어 있고, 한국공개특허 제2012-0101532호에서는 'TAL 이펙터-매개된 DNA 변형'이 개시되어 있고, 한국공개특허 제2014-0115335호에서는 '변형 캐스케이드 리보핵단백질 및 이의 용도'가 개시되어 있으나, 본 발명에서와 같이 표적 유전자 특이적 핵산 프로브 및 FokⅠ 제한효소 이량체를 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하는 방법 및 이의 용도에 대해서는 밝혀진 바가 전혀 없다.
본 발명은 상기와 같은 요구에 의해 도출된 것으로서, 본 발명에서는 FokⅠ 제한효소 이량체 발현 유전자 및 표적 유전자의 상보적인 염기서열 인식 핵산 프로브에 포함되어 있는 EDTA와 결합하는 단백질인 다수의 히스티딘 발현 서열이 삽입된 발현 벡터를 제조한 후, 상기 벡터와 EDTA가 결합된 표적 유전자 특이적 프로브 및 2가 전이금속이온을 세포 내로 도입하였다. 그 결과, 세포 내에서 전이금속의 존재 하에 표적 유전자의 염기서열 인식 물질인 프로브와 이에 포함되는 EDTA와 결합하는 단백질인 히스티딘간의 배위결합으로 FokⅠ 제한효소와 표적 유전자 특이적 프로브가 결합되는 것을 확인하였다. 또한, 상기 EDTA 대신 바이오틴이 결합된 표적 유전자 특이적 프로브와 바이오틴과 결합하는 단백질인 스트렙트아비딘 발현 서열이 삽입된 FokⅠ 제한효소 이량체 발현 유전자 발현 벡터를 세포 내로 도입한 결과, 표적 유전자의 염기서열 인식 물질인 프로브와 이에 포함되는 바이오틴과 결합하는 단백질인 스트렙트아비딘의 결합으로 FokⅠ 제한효소와 표적 유전자 특이적 프로브가 결합되는 것을 확인하였다. 본 발명에서는 상기와 같이 세포 내에서 결합되는 표적 유전자 특이적 프로브와 FokⅠ 제한효소 이량체를 이용하여 외생적 녹색형광단백질 발현 유전자의 특이적 넉-아웃(knock-out), 내생적 인간 LGALS3BP(렉틴 갈락토스-결합가용성결합단백질3) 유전자의 특이적 넉-아웃(knock-out) 및 내생적 쥐 면역 글로불린 G1(Immunoglobulin G1, IgG1) 유전자를 대상으로 하는 특이적 넉-인(knock-in) 등 세포 내에서 표적 유전자 특이적인 유전자 조작이 잘 이루어지는 것을 확인하였다.
이를 통해, 본 발명에서는 현재까지 개발되어 온 유전자 조작 기술과는 달리, 표적 유전자 특이적 프로브의 설정에 있어서, 게놈 내 유전자 결합 영역의 조합이 필요 없고, 생체 게놈 내 표적 인식 서열의 제한이 전혀 없어 게놈 내 표적 유전자 서열 중 시토신이 메칠화(methylation)되어 있어도 아무 상관없이 결합력과 절단력이 유지되며, 게놈 내 유사 표적 유전자 서열에서도 활성을 띄는 부작용(off-target effect)을 전혀 보이지 않는다는 점을 확인함으로써, 본 발명을 완성하였다.
상기 과제를 해결하기 위해, 본 발명은 (a) 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및 (b) 두 개의 FokⅠ 제한효소가 서로 연결된 이량체를 코딩하는 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 서로 연결된 채 발현될 수 있도록 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 조성물을 제공한다.
또한, 본 발명은
(a) FokⅠ 제한효소 이량체 발현 유전자 및 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자가 삽입된 발현 벡터를 제조하는 단계;
(b) 상기 (a) 단계의 발현 벡터 및 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브를 세포 내로 도입하는 단계; 및
(c) 상기 (b) 단계의 세포 내로 도입되어 발현된 FokⅠ 제한효소 이량체와 표적 유전자 인식 프로브의 결합을 유도하는 단계를 포함하는 세포 내에서 표적 유전자를 특이적으로 편집하는 방법을 제공한다.
또한, 본 발명은 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및 FokⅠ 제한효소 이량체 발현 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 키트를 제공한다.
본 발명은 현재까지 개발되어 온 다른 유전자 조작 기술보다 표적 유전자 특이적 프로브의 설정에 있어서, 게놈 내 유전자 결합 영역의 조합이 필요 없고, 생체 게놈 내 표적 인식 서열의 제한이 전혀 없을 뿐만 아니라, 게놈 내 표적 유전자 서열 중 시토신이 메칠화(methylation)되어 있어도 아무 상관없이 결합력과 절단력이 유지되며, 게놈 내 유사 표적 유전자 서열에서도 활성을 띄는 부작용(off-target effect)을 전혀 보이지 않으므로, 보다 효과적으로 표적 유전자의 편집을 수행할 수 있다.
특히, 본원 발명은 세포 내 유전자의 편집 대상 위치를 인식하기 위한 구성으로 핵산 프로브를 이용하므로, 본원 발명의 경우 핵산 프로브의 서열을 그에 맞게 설계함으로써 유전자 내의 그 어떤 위치라도 특이적으로 인식하고 접근하도록 할 수 있고, 그 결과 편집 위치를 선정함에 어떠한 제약도 없다는 점에서, 크리스퍼/카스9 편집 기술에 비해 보편성(universality)을 가진다.
또한, FokI 제한효소의 두 개를 링커로 서로 연결하여 이량체의 형태로 구성하고, 이러한 이량체를 위와 같은 프로브와 결합할 수 있도록 함으로써, 하나의 프로브만으로도 DNA 이중 가닥 절단에 필요한 FokI 제한효소 단량체 두 개를 모두 편집 위치에 배치시킬 수 있다는 점에서, 크리스퍼/카스9 편집 기술에 비해 단순성(simplicity)을 가지며, 아울러, 본원 발명의 조성물에 포함된 발현 벡터에는 FokI 제한효소 2개와 링커 정도만(약 2~3kbp)을 클로닝되면 가능되므로, 추후 본원 발명의 조성물을 전달(delivery)하기 위해 AAV(Adeno-Associate virus) 등을 이용하는 경우에도 페이로드(payload)가 과중하지 않다는 점에서, 크리스퍼/카스9 편집 기술에 비해 효율성(efficiency)을 가진다.
따라서, 본 발명은 유전자 조작을 이용하는 의학, 약학, 생명공학 등의 생명 과학 연구에서 매우 유용한 방법이며, 유전자 치료법과 생명공학의 발전에 크게 이바지할 수 있다.
도 1은 표적 유전자 특이적 핵산 프로브와 다수의 히스티딘 발현 서열을 포함한 FokⅠ 제한효소 이량체의 결합 방법을 나타낸 것이다.
도 2는 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 이디티에이-C2(EDTA-C2) 화합물과의 서로 간 배위 결합을 통해 연결하는 구조를 나타낸 것이다.
도 3은 EDTA가 결합된 표적 유전자 특이적 핵산 프로브와 다수의 히스티딘 발현 서열을 포함한 FokⅠ 제한효소 이량체 발현 단백질이 결합된 구조를 나타낸다. C-타입은 FokⅠ 제한효소 이량체의 카복실기(-COOH) 말단에 헥사 히스티딘 서열, 핵 위치화 신호(nuclear localization signal, NLS) 서열, 믹 항원 결정기(myc epitope) 서열이 존재하는 것을 지칭하고, N-타입은 FokⅠ 제한효소 이량체의 아미노기(-NH2) 말단에 헥사 히스티딘 서열, 핵 위치화 신호(nuclear localization signal, NLS) 서열, 믹 항원 결정기(myc epitope) 서열이 존재하는 것을 지칭한다. 단백질의 구조와 운동성, 프로브와의 결합 가능성을 고려해서 2가지 형태를 제작했다.
도 4는 바이오틴이 결합된 표적 유전자 특이적 핵산 프로브와 스트렙트아비딘이 결합된 FokⅠ 제한효소 이량체 발현 단백질 구조를 나타낸다. C-타입은 FokⅠ 제한효소 이량체의 카복실기(-COOH) 말단에 스트렙트아비딘 유전자, 핵 위치화 신호(nuclear localization signal, NLS) 서열, 믹 항원 결정기(myc epitope) 서열이 존재하는 것을 지칭하고, N-타입은 FokⅠ 제한효소 이량체의 아미노기(-NH2) 말단에 스트렙트아비딘 유전자, 핵 위치화 신호(nuclear localization signal, NLS) 서열, 믹 항원 결정기(myc epitope) 서열이 존재하는 것을 지칭한다. 단백질의 구조와 운동성, 프로브와의 결합 가능성을 고려해서 2가지 형태를 제작했다.
도 5는 녹색 형광 단백질 발현 유전자에 대한 프라이머 조합에 따라 생성된 4종의 PCR 산물을 나타낸다. 중합 효소 연쇄 반응 시 100bp와 70bp 길이의 산물이 형성되게 프라이머를 제작하였다. 중합 효소 연쇄 반응 후 형성된 산물을 95℃에서 변성시키고 즉시 급냉시키면 최종적으로 4가지 형태(P1, P2, P3, P4)의 DNA가 남게 된다.
도 6은 녹색 형광 단백질 발현 유전자에 대한 프라이머 조합에 따라 생성된 4종의 PCR 산물을 각각 아가로스 젤 상에서 전개시킨 결과이다. 레인 1, F1+R 프라이머; 레인 2, 어닐링한 직후; 레인 3, 어닐링한 후 4시간째; 레인 4, F2+R 프라이머 조합
도 7은 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 대장균에서 발현시켜 획득한 용해물을 일반 DNA 벡터와 반응시킨 후 절편화된 DNA 산물을 확인함으로써 FokI 제한효소 이량체의 활성을 확인한 결과이다. 레인 1, 버퍼; 레인 2, Mock 추출물; 레인 3, FokI 제한효소 추출물
도 8은 FokI 제한효소 이량체의 표적 특이적인 활성을 확인한 결과이다. 프로브(probe) 1, 2는 녹색 형광 단백질 발현 유전자의 개시 코돈부터 3'방향으로 디옥시리보핵산 염기 26개와 이것과 상보적인 서열을 가지는 염기 26개를 각각 합성하고 말단부에 이디티에이-C2(EDTA-C2)를 결합시킨 것이다. 상단의 젤 사진의 레인 1, 2, 3, 4 및 5는 표에 나타낸 Reagents 1, 2, 3, 4 및 5를 각각 나타낸다. (+, 첨가; -, 무첨가)
도 9는 외생적 녹색 형광 단백질 발현 유전자의 특이적 넉-아웃(knock-out) 실험 결과를 나타낸다. Treat는 이디티에이-C2(EDTA-C2)가 결합된 프로브와 유전자 편집 벡터를 세포주에 형질도입시킨 경우로써 유전자 편집 기능이 있고, Control은 유전자 편집 벡터만을 세포주에 형질도입시킨 경우로써 유전자 편집 기능이 없다. C-타입은 FokⅠ 제한효소 이량체의 카복실기(-COOH) 말단에 헥사 히스티딘 서열이 결합된 벡터를 세포주에 형질도입시킨 경우이고 N-type은 FokⅠ 제한효소 이량체의 아미노기(-NH2) 말단에 헥사 히스티딘 서열이 결합된 벡터를 세포주에 형질도입시킨 경우이다. TALEN은 탈렌(Transcription Activator-Like Effector Nucleases) 플라스미드 벡터를 세포주에 형질도입시킨 경우이다.
도 10은 도 9에 대한 결과물 중에서 C-유형의 FokI 제한효소 유전자 발현 벡터와 프로브, 탈렌(TALEN)을 각각 형질 도입시킨 세포를 형광 현미경으로 관찰한 결과이다.
도 11은 내생적 렉틴 갈락토스-결합 가용성 3 결합 단백질 유전자(Lectin, GALactoside-binding, Soluble, 3 Binding Protein, LGALS3BP) 엑손 3번 특이적인 핵산 프로브 위치를 나타낸다.
도 12는 FokI 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자가 삽입된 DNA 벡터 5㎍, 니켈(Ni2+) 50 mM, 내생적 렉틴 갈락토스-결합 가용성결합단백질3 유전자 특이적 DNA 프로브 1μM, 3μM을 인간 대장암 세포주인 에이치티-29(HT-29)에 동시에 도입시킨 결과이다. T7 제한효소 1(T7 endonuclease 1, T7E1)은 완전히 상보적으로 결합되지 않고(mismatch) 와블(wobble)이 형성된 이중결합 DNA를 절단하는 제한효소로서 지노믹 DNA 상의 염기서열 삽입이나 결실을 확인할 때 이용되는 효소이다.
도 13은 내생적 인간 LGALS3BP 유전자 조작(gene edition) 여부를 확인하기 위해 LGALS3BP 유전자용 양방향 프라이머를 제작해서 중합 효소 연쇄 반응을 실시한 결과이다. (FP1+RP1 프라이머; FP2+RP1 프라이머; gDNA, 게놈 DNA) 사용한 프라이머 서열은 FP1이 5'-tacaagctcagcaggggaga-3'(서열번호 1)이고, RP1은 5'-ttcgtcttaggggatttgcc-3'(서열번호 2), FP2는 5'-agatcttctacagaggccag-3'(서열번호 3)이다.
도 14는 도 13에서 PCR을 통해서 증폭된 산물 중 2개를 선별하여 DNA 벡터에 결합시켜 염기서열 분석용 프라이머를 이용해서 염기서열을 분석한 결과를 나타낸다.
도 15는 야생형(WT) HT-29 세포(WT)와 형질 도입시킨 HT-29 세포(23, 56)의 LGALS3BP 유전자의 발현 강도를 단백질 면역 흡착 검침법(protein immunoblot, western blot)을 통해서 확인한 결과이다. IB(immunoblot), LGALS3BP; IB(immunoblot), Gal-3.
도 16은 인간 LGALS3BP 유전자 엑손 3번 내에서 선정된 디옥시리보핵산 탐침자 4종의 위치(A)와 서열(B)을 표시한 모식도로 모두 디옥시리보핵산 염기 20개로 구성되어 있고 5' 방향에 바이오틴을 결합시킨 형태이다. 또한, 인간 상기 탐침자를 이용하여 인간 LGALS3BP 유전자 엑손 3번을 표적으로 한 특이적 편집 실험 결과(C)를 나타낸다.
도 17은 내생적 쥐 면역 글로불린 G1(Immunoglobulin G1, IgG1) 유전자의 당질화 서열을 포함하는 엑손 부분의 치환에 필요한 공여자 DNA 벡터의 제조를 나타낸다.
도 18은 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자가 삽입된 DNA 벡터 5㎍, 니켈(Ni2+), 각각 0mM, 5mM, 50mM, DNA 프로브 3μM, 도 17에 나타낸 공여자 DNA 벡터 5㎍을 쥐 엔아이에이치-3T3(NIH-3T3) 세포에 도입시킨 결과이다. 사용한 프라이머 서열은 knock-in-F가 5'-gcagcaccaaggtggacaag-3'(서열번호 4)이고, knock-in-R은 5'-gtgctgggtgtggcagtgta-3'(서열번호 5)이다. No T.F은 N-type FokⅠ 제한효소 이량체의 유전자 플라스미드 벡터만을 세포주에 형질도입시킨 결과이고, px458은 카스9(Cas9) 유전자 플라스미드 벡터를 세포주에 형질도입시킨 결과인데, 이 두 경우에는 표적 유전자 인식 기능이 존재하지 않아서 유전자 편집이 불가능하다. CRISPR는 카스9(Cas9) 유전자 플라스미드 벡터와 단일 가닥 안내자(single-guide) RNA 전사 플라스미드 벡터를 동시에 세포주에 형질도입시킨 경우로써, 표적 유전자 인식 기능이 존재해서 유전자 편집이 가능하다. FokI은 FokI 제한효소 이량체 유전자와 이디티에이-C2 DNA 프로브, 니켈(Ni·So4)을 동시에 세포주에 형질도입시킨 경우로써, 표적 유전자 인식 기능이 존재해서 유전자 편집이 가능하다. T7 제한효소 1(T7 endonuclease 1, T7E1)은 mismatch 이중결합 DNA를 절단하는 제한효소로써, 지노믹 DNA 내 염기서열의 삽입이나 결실 여부를 확인하기 위해서 사용했다.
도 19는 게놈 내 표적 유전자 염기서열에 존재하지 않았던 SacⅠ 제한효소 인식 서열이 공여자 DNA 벡터를 통해서 잘 삽입되었는지를 확인한 결과이다. 사용한 프라이머 서열은 knock-in-F가 5'-gcagcaccaaggtggacaag-3'(서열번호 6)이고, knock-in-R이 5'-gtgctgggtgtggcagtgta-3'(서열번호 7)이다. No T.F은 N-type FokⅠ 제한효소 이량체의 유전자 플라스미드 벡터만을 세포주에 형질도입시킨 결과이고, Donor DNA는 공여자 유전자 플라스미드 벡터를 세포주에 형질도입시킨 경우로써, 표적 유전자 인식 기능이 존재하지 않아서 유전자 편집이 불가능하다. px458은 카스9(Cas9) 유전자 플라스미드 벡터를 세포주에 형질도입시킨 결과인데, 이 두 경우에는 표적 유전자 인식 기능이 존재하지 않아서 유전자 편집이 불가능하다. CRISPR는 카스9(Cas9) 유전자 플라스미드 벡터와 단일 가닥 안내자(single-guide) RNA 전사 플라스미드 벡터를 동시에 세포주에 형질도입시킨 경우로써, 표적 유전자 인식 기능이 존재해서 유전자 편집이 가능하다. TALEN은 탈렌(Transcription Activator-Like Effector Nucleases) 유전자 플라스미드 벡터를 세포주에 형질도입시킨 경우로써, 표적 유전자 인식 기능이 존재해서 유전자 편집이 가능하다. FokI은 FokI 제한효소 이량체 유전자와 이디티에이-C2 DNA 프로브, 니켈(Ni·So4)을 동시에 세포주에 형질도입시킨 경우로써, 표적 유전자 인식 기능이 존재해서 유전자 편집이 가능하다.
도 20은 본 발명을 통해 유전자 조작된 쥐의 내생적 쥐 면역 글로불린 G1(Immunoglobulin G1, IgG1) 유전자 특이적 넉-인(knock-in)을 시퀀싱을 통해 확인한 결과이다.
상기 목적을 달성하기 위하여, 본 발명은 (a) 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및 (b) 두 개의 FokⅠ 제한효소가 서로 연결된 이량체를 코딩하는 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 서로 연결된 채 발현될 수 있도록 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 조성물을 제공한다.
일반적으로, 생체 내 유전 물질인 DNA는 복제되는 과정을 거치는데, 이것은 원본 DNA를 주형으로 삼아 새로운 두 개의 DNA로 만드는 과정이며, DNA 중합효소 복합체가 이 역할을 수행한다. DNA 복제가 발생하는 곳을 복제분기점 (Replication Fork)이라고 부르며, 이곳은 일시적으로 이중나선 가닥이 단일나선으로 노출하는 순간이 존재하게 된다. 이때 본 발명에서 제시한 표적 유전자 인식 프로브가 표적 유전자에 결합되게 되면, 바이오틴이나 EDTA를 매개로 FokI 이량체가 결합하여 복제분기점을 벗어난 이중나선가닥 부분의 절단을 유도하게 된다.
생체 세포 내에서는 이 DNA 복제 과정상 오류나, 자외선, 방사선 같은 환경적 요인 때문에 DNA 손상이 일어날 수 있으며, 이를 복구하기 위해 두 가지 방법을 동원한다. 첫번째, 비동형성 말단 접합이라는 방법은 자체적인 수선 오류가 발생하기 쉬워서 뉴클레오타이드 상 염기서열의 결실이나 삽입이 잘 일어나서 이를 유전 공학 연구 분야에 적용했을 때, 게놈 상 특정 유전자 기능 제거에 이용할 수 있다. 두번째, 동형 직접적 수선이라는 방법은 뉴클레오타이드 상 염기서열의 결실이나 삽입 없이 수선이 가능한 방법으로 유전 공학 연구 분야에 적용했을 때, 실제 게놈 상에 존재하는 특정 염기서열을 공여자 DNA 벡터에 삽입시키고 그 한가운데에 게놈 내에 삽입시키려는 염기서열을 추가적으로 삽입시켜 세포 내에 도입시키면, 게놈 내에 원래 존재하지 않던 특정 외래 유전자를 삽입시키는데 이용할 수 있다.
본 발명에 따른 표적 유전자 인식 프로브 및 FokⅠ 제한효소 이량체를 생체 내에 주입시키면 첫번째, 세포의 핵막 내 게놈 상에서 DNA 복제가 진행 중인 뉴클레오타이드 부분에 핵산 프로브 및 FokⅠ 제한효소 이량체가 접근하게 된다. 두번째, 핵산 프로브가 자신의 염기서열과 상보적인 염기서열에 가서 결합하게 된다. 세번째, 이 프로브의 말단에 결합된 메탈 킬레이트제(metal chelating agent) 또는 바이오틴이 FokⅠ 제한효소 이량체 말단의 히스티딘 또는 테트라벨런트 스트렙트아비딘(tetravalent streptavidin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin)과 결합하게 된다. 네번째, FokⅠ 제한효소 이량체가 DNA 뉴클레오타이드 두 가닥에 각각 결합해서 두 가닥을 모두 절단시킨다. 다섯번째, 생체 세포 내에서는 변형이 이루어진 염기서열 또는 이와 가까운 염기서열에 DNA를 수선하기 위한 여러 분자들이 결합하고, 이들은 여기에 또다른 분자들이 붙어 복합체를 이루도록 유도함으로써 실질적인 수선 과정이 이루어질 수 있게 한다. 여섯번째, 이 DNA 수선 작업 결과 수선 오류가 발생하고, 뉴클레오타이드 상 염기서열의 결실이나 삽입이 일어나서 원래 형태의 DNA와 다른 형태의 DNA가 형성되게 된다. 그러면서 특정 유전자 내 염기서열의 틀이동 (frame shift) 현상이 발생하고, 정지 코돈이 형성되면 유전자가 정상적인 아미노산을 합성하지 못하고, 그 결과 특정 유전자의 기능이 제거될 수 있다. 그리고, 세포 내에 핵산 프로브 및 FokⅠ 제한효소 이량체 외에 공여자 DNA 벡터(실제 게놈 상에 존재하는 특정 염기서열을 공여자 DNA 벡터에 삽입시키고 그 한가운데에 게놈 내에 삽입시키려는 염기서열을 추가적으로 삽입)를 같이 도입시키면 공여자 DNA에 있는 유전자서열로 원하는 서열을 교정할 수 있게 된다.
본 발명의 일 구현 예에 따른 조성물에서, 상기 (a)의 단백질 결합 물질은 금속 킬레이트제(metal chelating agent) 또는 바이오틴일 수 있고, 바람직한 금속 킬레이트제는 이디티에이(EDTA)일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 조성물에서, 상기 (b)의 단백질 결합 물질과 결합하는 단백질은 다수의 히스티딘, 테트라벨런트 스트렙트아비딘(tetravalent streptavidin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin)일 수 있고, 상기 다수의 히스티딘은 바람직하게는 헥사 히스티딘일 수 있으나, 이에 제한되지 않는다.
본 발명에서, 표적 유전자의 염기서열 인식 물질로 EDTA를 이용할 경우, 표적 유전자의 염기서열 인식 물질과 결합하는 단백질은 헥사 히스티딘이며, 표적 유전자의 염기서열 인식 물질로 바이오틴을 이용할 경우, 표적 유전자의 염기서열 인식 물질과 결합하는 단백질은 테트라벨런트 스트렙트아비딘(tetravalent streptavidin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin)일 수 있다.
본 발명의 일 구현 예에 따른 조성물에서, 표적 유전자의 염기서열 인식 물질과 연결된 단백질 결합 물질로 EDTA를 이용할 경우 전이금속을 추가로 포함할 수 있으며, 상기 전이금속은 Ni2+, Co2+ 또는 Zn2+ 등일 수 있으나, 이에 제한되지 않는다.
본 발명에서, 프로브는 표적 염기서열과 상보적인 서열을 가진 디옥시리보핵산(DeoxyriboNucleic Acid, DNA) 또는 리보핵산(RiboNucleic Acid, RNA) 염기 10~100개, 바람직하게는 10~50개, 더 바람직하게는 10~30개를 사용할 수 있다.
본 발명의 일 구현 예에 따른 조성물에서, 상기 (b)의 발현 벡터는 FokⅠ 제한효소 이량체 발현 유전자, 연결체(linker), 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자 및 핵 위치 신호(nuclear localization signal, NLS) 서열이 작동가능하게 연결된 것일 수 있다.
본 발명의 일 구현 예에 따른 조성물에서, 상기 연결체는 벡터 내에 유전자가 코딩하고 있는 단백질들이 세포 내에서 발현되었을 때, 유연한 운동성을 가질 수 있는 기능을 부여하고자 하므로, 이러한 기능을 부여할 수 있는 연결체로는 어느 것이나 가능하다. 바람직하게는, 상기 연결체는 1개부터 10개까지의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)1-10)일 수 있고, 가장 바람직하게는 FokⅠ 제한효소 이량체 유전자 사이에 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10)를 삽입하고, FokⅠ 제한효소 단량체와 핵 위치 신호(NLS) 서열 사이에는 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3)를 삽입할 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 조성물에서, 상기 발현 벡터는 5'→3' 방향으로 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자, 핵 위치 신호(NLS) 서열, 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3), FokⅠ 제한효소 유전자, 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10) 및 FokⅠ 제한효소 유전자가 작동가능하게 연결되거나; 또는 5'→3' 방향으로 FokⅠ 제한효소 유전자, 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10), FokⅠ 제한효소 유전자, 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3), 핵 위치 신호(NLS) 서열 및 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자가 작동가능하게 연결된 것일 수 있으나, 이에 제한되지 않는다.
본 발명에서 "작동가능하게 연결된"은 유전 구조체로 혼입되어 발현 제어 서열이 관심이 있는 코딩 서열의 발현을 효과적으로 제어하는 것을 의미한다. RNA 중합효소가 RNA (mRNA이더라도)로 코딩 서열을 전사할 수 있고, 이어서 코딩 서열에 의해 코딩된 단백질로 번역될 수 있는 경우, 코딩 서열은 "작동가능하게 연결되고", 세포 내의 발현 제어 서열의 "조절 하에" 있게 된다. 따라서, 조절 영역은 변형된 표적 핵산을 발현하도록 요망되는 동물 세포, 동물, 또는 동물 조직에서의 전사를 조정하거나, 예를 들어 조절하거나, 용이하게 하거나, 또는 진행시킬 수 있다.
본 발명의 일 구현 예에 따른 조성물은 핵 위치 신호(NLS) 서열과 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3) 사이에 믹 항원 결정기(myc epitope) 서열을 추가로 포함할 수 있다. 상기 믹 항원 결정기(myc epitope) 서열의 추가는 세포 내 단백질 발현 여부를 단백질 면역 흡착 검침법(protein immunoblot, western blot)을 통해 확인할 때 이용될 수 있다.
본 발명의 일 구현 예에 따른 조성물에서, 상기 유전자 편집 또는 조작은 유전자 결실, 유전자 삽입, 유전자 교정 또는 염색체 재배열일 수 있으나, 이에 제한되지 않는다. 상기 유전자 삽입은 세포 내에 본 발명의 표적 유전자 특이적 조작(gene edition)용 조성물과 공여 DNA 벡터를 같이 형질도입하면 세포 내에서는 공여 DNA 벡터의 상동염기서열들을 인식해 상동 재조합이 유도되어, 상동 염기서열 사이에 삽입시켜 원하는 유전자가 염색체 안의 표적 위치에 정확히 삽입될 수 있다.
또한, 본 발명은
(a) FokⅠ 제한효소 이량체 발현 유전자 및 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자가 삽입된 발현 벡터를 제조하는 단계;
(b) 상기 (a) 단계의 발현 벡터 및 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브를 세포 내로 도입하는 단계; 및
(c) 상기 (b) 단계의 세포 내로 도입되어 발현된 FokⅠ 제한효소 이량체와 표적 유전자 인식 프로브의 결합을 유도하는 단계를 포함하는 세포 내에서 표적 유전자를 특이적으로 편집하는 방법을 제공한다.
본 발명의 일 구현 예에 따른 방법에서, 상기 (b) 단계의 프로브에 포함된 단백질 결합 물질은 금속 킬레이트제(metal chelating agent) 또는 바이오틴일 수 있고, 바람직한 금속 킬레이트제는 이디티에이(EDTA)일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 (a) 단계의 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질은 다수의 히스티딘, 테트라벨런트 스트렙트아비딘(tetravalent streptavidin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin)일 수 있고, 상기 다수의 히스티딘은 바람직하게는 헥사 히스티딘일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 (a) 단계의 발현 벡터는 FokⅠ 제한효소 이량체 발현 유전자, 연결체(linker), 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자 및 핵 위치 신호(nuclear localization signal, NLS) 유전자가 작동가능하게 연결된 것일 수 있다.
본 발명의 일 구현 예에 따른 방법에서, 상기 연결체는 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3) 또는 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10)인 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 발현 벡터는 5'→3' 방향으로 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자, 핵 위치 신호(NLS) 서열, 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3), FokⅠ 제한효소 유전자, 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10) 및 FokⅠ 제한효소 유전자가 작동가능하게 연결되거나; 또는 5'→3' 방향으로 FokⅠ 제한효소 유전자, 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10), FokⅠ 제한효소 유전자, 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3), 핵 위치 신호(NLS) 서열 및 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자가 작동가능하게 연결된 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법은 핵 위치 신호(NLS) 서열과 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3) 사이에 믹 항원 결정기(myc epitope) 서열을 추가로 포함할 수 있다.
본 발명의 일 구현 예에 따른 방법에서, 상기 유전자 편집 또는 조작은 유전자 결실, 유전자 삽입, 유전자 교정 또는 염색체 재배열인 것일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 (b) 단계의 세포 내로의 도입은 리포좀 전달 방법 또는 전기충격법(electroporation)인 것일 수 있고, 바람직하게는 전기충격법일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 (b) 단계에서 발현 벡터 및 표적 유전자 인식 프로브의 세포 내로의 도입은 발현 벡터와 표적 유전자 인식 프로브를 동시에 도입할 수도 있고, 발현 벡터를 먼저 세포 내로 도입 후에 표적 유전자 인식 프로브를 도입할 수도 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 (c) 단계의 세포 내로 도입되어 발현된 FokⅠ 제한효소와 표적 유전자 인식 프로브의 결합 유도는 상기 (b) 단계에서 전이금속을 추가로 세포 내로 도입하여 세포 내에서 전이금속의 존재하에 표적 유전자의 염기서열 인식 물질인 EDTA와 EDTA와 결합하는 단백질인 히스티딘의 배위결합으로 FokⅠ 제한효소와 표적 유전자 인식 프로브의 결합을 유도할 수 있다. 상기 전이금속은 Ni2+, Co2+ 또는 Zn2+ 등일 수 있고, 바람직하게는 Ni2+일 수 있으나, 이에 제한되지 않는다.
본 발명의 일 구현 예에 따른 방법에서, 상기 세포는 동물 세포, 식물 세포 또는 미생물 세포일 수 있으나, 이에 제한되지 않는다.
또한, 본 발명은 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및 FokⅠ 제한효소 이량체 발현 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 키트를 제공한다.
본 발명의 '표적 유전자 인식 프로브'는 명세서 전반에 걸쳐 기재된 '표적 유전자 특이적 핵산 프로브' 또는 '핵산 프로브'와 동일한 의미로 혼용되었다.
이하, 본 발명을 실시예에 의해 상세히 설명한다. 단, 하기 실시예는 본 발명을 예시하는 것일 뿐, 본 발명의 내용이 하기 실시예에 한정되는 것은 아니다.
재료 및 방법
핵산 프로브와
FokⅠ
제한효소 이량체의 제조 및 이들의 결합 확인
본 발명자들은 새로운 형태의 만능형 유전자 편집 기술을 개발했으며, 이것은 표적 유전자 서열과 상보적인 서열을 가진 디옥시리보핵산(Deoxyribo Nucleic Acid, DNA) 또는 리보핵산(Ribo Nucleic Acid, RNA) 염기 26개를 합성하여 표적 유전자 인식 물질로 사용함으로써, 생물체 내 특정 염기서열을 매우 특이적으로 인식할 수 있다.
5'-ATGGTGAGCAAGGGCGAGGAGCTGXT-3'(서열번호 8), X=EDTA-C2-dT
FokI 제한효소 발현 유전자 2개는 pMLM-290과 pMLM-292 플라스미드 벡터 DNA 1㎕(50ng), 정방향 프라이머 1㎕, 역방향 프라이머 1㎕, 증류수 17㎕, PCR primix를 혼합하여 95℃에서 5분을 반응시키고, 95℃에서 30초, 60℃에서 30초, 72℃에서 30초를 총 30회 반응시킨 후, 72℃에서 7분을 반응시키는 중합효소 연쇄반응을 실시하여 획득하였다.
FokI-290 정방향 프라이머 : 5'-TTGGATCCCAACTAGTCAAAAGTGAA-3'(서열번호 9)
FokI-290 역방향 프라이머 : 5'-TTGAGCTCGTTTATCTCGCCGTTATT-3'(서열번호 10)
FokI-292 정방향 프라이머 : 5'-TTGTCGACCCCAACTAGTCAAAAGTGAACT-3'(서열번호 11)
FokI-292 역방향 프라이머 : 5'-TTCTCGAGCCTTAAAAGTTTATCTCGCCGT-3'(서열번호 12)
중합효소 연쇄반응이 완료된 산물은 1.5% 아가로스 젤에서 100 볼트로 전개시켜 절단한 후, 그 중에서 DNA만 추출하였다. FokI 제한효소 이량체 발현 유전자 Fok1-290 DNA, BamHI, SacI 제한효소를 혼합하여 37℃에서 16시간 동안 반응시켰다. 다수의 히스티딘 서열을 보유한 pET-28a(+) 플라스미드 벡터 DNA, BamHI, SacI 제한효소를 혼합하여 37℃에서 16시간 동안 반응시켰다. 제한효소 반응이 완료된 산물은 1.5% 아가로스 젤에서 100 볼트로 전개시켜 절단한 후, 그 중에서 DNA만 추출하였다. 각각의 DNA와 10×라이게이스 버퍼, T4 DNA 라이게이스를 혼합시켜 16℃에서 16시간 동안 반응시켰다. 획득된 산물은 DH5α 대장균 균주에 형질전환시키고 LB 아가 플레이트에 배양시켰다. 획득된 형질전환 군집들은 LB 배지에 주입시켜 37℃에서 250rpm으로 16시간 동안 배양시켰다. 획득된 산물에서 플라스미드 벡터 DNA를 추출한 다음 염기서열 분석용 프라이머를 이용해서 염기서열을 분석했다.
T7 : 5'-TAATACGACTCACTATAGGG-3'(서열번호 13)
FokI 제한효소 발현 유전자 Fok1-292 DNA, SalI, NotI 제한효소를 혼합하여 37℃에서 16시간 동안 반응시켰다. 다수의 히스티딘 서열을 보유한 pET-28a(+) 플라스미드 벡터 DNA, SalI, NotI 제한효소를 혼합하여 37℃에서 16시간 동안 반응시켰다. 제한효소 반응이 완료된 산물은 1.5% 아가로스 젤에서 100 볼트로 전개시켜 절단한 후, 그 중에서 DNA만 추출하였다. 각각의 DNA와 10×라이게이스 버퍼, T4 DNA 라이게이스를 혼합시켜 16℃에서 16시간 동안 반응시켰다. 획득된 산물은 DH5α 대장균 균주에 형질전환시키고 LB 아가 플레이트에 배양시켰다. 획득된 형질전환 군집들은 LB 배지에 주입시켜 37℃에서 250rpm으로 16시간 동안 배양시켰다. 획득된 산물에서 플라스미드 벡터 DNA를 추출한 다음 염기서열 분석용 프라이머를 이용해서 염기서열을 분석했다.
T7 ter : 5'-GCTAGTTATTGCTCAGCG-3'(서열번호 14)
pET-28a(+) 플라스미드 벡터 내의 다수의 히스티딘 서열과 FokI 제한효소 발현 유전자 FokI-290 사이에 NheI, BamHI 제한효소를 이용해서 글라이신-글라이신-글라이신-글라이신-세린 연결체(GGGGS linker) 3개를 삽입하고, FokI 제한효소 발현 유전자 FokI-290과 FokI-292 사이에 SacI, SalI 제한효소를 이용해서 글라이신-글라이신-글라이신-글라이신-세린 연결체(GGGGS linker) 3개를 삽입시켰다(도 1).
디옥시리보핵산 또는 리보핵산 염기 26개의 마지막 염기는 디옥시-티민(deoxy-thymine) 또는 디옥시-우라실(deoxy-uracil)로 합성하고, 이 부위에 이디티에이-C2(EDTA-C2) 화합물을 결합시켰다(도 2). 다수의 히스티딘 서열과 FokI 제한효소 발현 유전자 2개, 글라이신-글라이신-글라이신-글라이신-세린 연결체(GGGGS linker) 2개가 포함된 pET-28a(+) 플라스미드 벡터 DNA 1㎕(50ng), 정방향 프라이머 1㎕, 역방향 프라이머 1㎕, 증류수 17㎕, PCR 프리믹스를 혼합하여 95℃에서 5분을 반응시키고, 95℃에서 30초, 60℃에서 30초, 72℃에서 1분을 총 30회 반응시킨 후, 72℃에서 7분을 반응시키는 중합효소 연쇄반응을 실시하여 획득하였다.
C-his FokI 정방향 프라이머 : 5'-ttggtaccatgggcagcagccat-3'(서열번호 15)
C-his FokI 역방향 프라이머 : 5'- ttgggcccttaaaagtttatctcgccgtta-3' (서열번호 16)
중합효소 연쇄반응이 완료된 산물은 1.2% 아가로스 젤에서 100 볼트로 전개시켜 절단한 후, 그 중에서 DNA만 추출하고 KpnI, ApaI 제한효소를 혼합하여 37℃에서 16시간 동안 반응시켰다. pcDNA3.1 hygro(+) 플라스미드 벡터 DNA, KpnI, ApaI 제한효소를 혼합하여 37℃에서 16시간 동안 반응시켰다. 절단 반응이 완료된 산물들은 1.2% 아가로스 젤에서 100 볼트로 전개시켜 절단한 후, 그 중에서 DNA만 추출하였다. 각각의 DNA와 10×라이게이스 버퍼, T4 DNA 라이게이스를 혼합시켜 16℃에서 16시간 동안 반응시켰다. 획득된 산물은 DH5α 대장균 균주에 형질전환시키고 LB 아가 플레이트에 배양시켰다. 획득된 형질전환 군집들은 LB 배지에 주입시켜 37℃에서 250rpm으로 16시간 동안 배양시켰다. 획득된 산물에서 플라스미드 벡터 DNA를 추출한 다음 염기서열 분석용 프라이머를 이용해서 염기서열을 분석했다.
T7 : 5'-TAATACGACTCACTATAGGG-3'(서열번호 17)
BGH-R : 5'-TAGAAGGCACAGTCGAGG-3'(서열번호 18)
획득한 플라스미드 벡터 DNA를 NheI, BamHI 제한효소를 이용하여 핵 위치화 신호(nuclear localization signal, NLS) 서열과 믹 항원 결정기(myc epitope) 서열을 삽입시켰다(도 3).
핵 위치 신호(NLS) : 5'-CCAAAGAAAAAGAGAAAGGTT-3'(서열번호 19)
믹 항원 결정기 서열: 5'-GAACAAAAACTCATCTCAGAAGAGGATCTG-3'(서열번호 20)
획득한 플라스미드 벡터 DNA를 XhoI 제한효소를 이용하여 FokI 제한효소 이량체 발현 유전자와 테트라벨런트 스트렙트아비딘(tetravalent streptavidin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin)을 플라스미드 벡터 내에 삽입시켰다. 그리고 핵 위치화 신호(nuclear localization signal, NLS) 서열과 믹 항원 결정기(myc epitope) 서열을 같이 삽입시켰다(도 4).
핵산
프로브와
Fok
Ⅰ
제한효소
이량체의
생체 외 결합 확인
녹색 형광 단백질 발현 유전자의 개시 코돈부터 3' 방향으로 100개까지의 염기와 이와 상보적인 서열을 가지는 염기를 각각 합성한 다음, 중합 효소 연쇄 반응 시 100bp와 70bp 길이의 산물이 형성되게끔 프라이머를 제작하였다.
100bp 프라이머:
5'-ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACG
TAAACGGCCACAAGTTCAGCGTGTCCGGCGAGG-3'(서열번호 21)
70bp 프라이머:
5'-GGAGCGGCCTGTGCGACTTGAACACCGGCAAATGCAGCGGCAGGTCGAGCTGGTCCTACCCGTGGTGG
GG-3'(서열번호 22)
100bp와 70bp 길이의 DNA 각각 1㎍, 정방향 프라이머 2개 각각 1㎕, 역방향 프라이머 1㎕, 증류수 17㎕, PCR primix를 혼합하여 95℃에서 5분을 반응시키고, 95℃에서 30초, 60℃에서 30초, 72℃에서 30초를 총 30회 반응시킨 후, 72℃에서 7분을 반응시키는 중합효소 연쇄반응을 실시하였다.
F1 : 5'-ATGGTGAGCAAGGGCGAGGA-3'(서열번호 23)
F2 : 5'-GGGGTGGTGCCCATCCTGG-3'(서열번호 24)
R1 : 5'-CCTCGCCGGACACGCTGAA-3'(서열번호 25)
중합 효소 연쇄 반응 후 형성된 산물을 95℃에서 5분간 반응시키고 즉시 196℃에 반응시키면 최종적으로 4가지 형태의 DNA가 남게 된다(도 5). 이렇게 얻어진 중합 효소 연쇄 반응 직후의 100bp DNA, 70bp DNA, 그리고 이형 접합체를 형성시킨 직후의 DNA와 37℃에서 4시간 동안 반응시킨 DNA를 각각 아가로스 젤 상에서 100 볼트로 전개시켰다(도 6). FokI 제한효소 이량체 발현 유전자와 다수의 히스티딘 발현 서열을 pET-28a(+) 플라스미드 벡터 내에 삽입시킨 후, 외래 유전자가 삽입되지 않은 대장균 발현 플라스미드 벡터와 함께 BL21(DE3) 대장균 균주에 각각 형질전환시켰다. 획득된 대장균 군집(colony)을 배지에 주입시켜 37℃에서 250rpm으로 16시간 동안 배양시켰다. 자외선 분광 광도계를 이용해서 흡광도 600nm에서 광학 밀도가 0.4~0.6에 도달했을 때, 0.1mM 농도의 IPTG를 주입시키고, 18℃에서 180rpm으로 18시간 동안 증식시켰다. 증식된 대장균을 13,000rpm으로 15분 동안 4℃에서 원심분리시키고 상층액은 제거하였다. 남은 침전물에 10초간 동작 5초간 정지를 총 20분간 반복하면서 초음파를 가해서 분쇄를 실시했고, 13,000rpm으로 15분 동안 4℃에서 원심분리시킨 후, 상층액은 제거하였다. 원심분리를 실시한 다음, 침전물은 제거하고 용해물을 획득했다. 이 산물들을 일반 플라스미드 벡터와 함께 37℃에서 250rpm으로 14시간 동안 반응시킨 후 아가로스 젤 전개를 실시하였다(도 7). FokI 제한효소 이량체의 표적 특이적인 활성을 확인하기 위해서 녹색 형광 단백질 발현 유전자의 개시 코돈부터 3' 방향으로 디옥시리보핵산 염기 26개와 이것과 상보적인 서열을 가지는 염기 26개를 각각 합성하고 말단부에 이디티에이-C2(EDTA-C2)를 결합시켰다. FokI 제한효소 이량체 발현 유전자와 다수의 히스티딘 서열을 대장균 발현 플라스미드 벡터를 형질전환시켜 획득한 용해물을 히스트렙 HP 칼럼에 주입시켜 이미다졸 농도 구배를 이용하여 AKTA 퓨리파이어로 정제하였고, 획득한 산물을 다시 모노 Q 칼럼에 주입시켜 이온 간 전하 차이를 이용하여 AKTA 퓨리파이어로 정제하였다. 획득된 단백질과 녹색 형광 단백질 발현 유전자 프로브 2종류, Ni2+, EDTA를 각각 다른 주입 조건으로 선행 실험에서 얻은 4가지 형태(도 5 참조)의 DNA와 37℃에서 14시간 동안 반응시켰다. 그리고 아가로스 젤 전개를 실시하였다(도 8).
외생적 녹색 형광 단백질 발현 유전자의 특이적 넉-아웃(knock-out) 분석
녹색 형광 단백질 발현 유전자의 개시 코돈부터 디옥시리보핵산 염기와 리보핵산 염기 26개를 합성하고, 이것들과 상보적인 염기서열을 가지는 26개를 또한 합성했다.
5'-ATGGTGAGCAAGGGCGAGGAGCTGXT-3'(서열번호 26), X=EDTA-C2-dT
5'-AXCAGCTCCTCGCCCTTGCTCACCAT-3'(서열번호 27), X=EDTA-C2-dT
이 핵산 프로브의 말단부에 이디티에이-C2를 각각 결합시켰다. 그리고 인간 대장암 세포주인 더블유아이디알(WiDr)에 녹색 형광 단백질 발현 유전자를 도입시킨 다음, 형광 현미경으로 형광 강도를 관찰하면서 강도가 강한 세포들을 선별하는 작업을 반복했다. 녹색 형광 단백질이 항시 발현될 수 있는 세포를 최종 선별한 다음, 이 세포들에 녹색 형광 단백질 발현 유전자의 프로브 300pM과 FokI 제한효소 이량체 발현 유전자, 다수의 히스티딘 서열이 삽입된 플라스미드 벡터 5㎍, 니켈(Ni2+) 500mM을 동시에 도입시켰다. 대조군(control)으로써 FokI 제한효소 이량체 발현 유전자, 다수의 히스티딘 서열이 삽입된 플라스미드 벡터 5㎍만을 따로 세포에 도입시켰다. 또한 유전자 플라스미드 벡터를 먼저 세포 내에 도입시키고 24시간 후에 녹색 형광 단백질 유전자 프로브를 도입시키기도 했다. 탈렌(TALEN) 방법과의 비교 실험을 위해서 녹색 형광 단백질 발현 유전자의 개시 코돈부터 26개의 염기서열과 더 3' 방향으로 12개 염기서열만큼 더 진행된 시점부터 26개의 염기서열을 선정해서 전사 활성화 유사 인자(TALE) 결합 영역을 각각 조합해서 pCS2TAL3-DD 플라스미드 벡터와 pCS2TAL3-RR 플라스미드 벡터에 삽입한 다음, 2개 벡터를 각각 5㎍씩 동시에 세포 내에 도입했다. 세포 내 도입 방법은 리포좀 전달 방법 중 하나인 리포펙타민 2000(lipofectamine 2000)을 이용하는 방법과 전기 충격법(electroporation)을 1,250 볼트로 1,000분의 20초 시간 동안 충격 부여 2회 조건으로 각각 이용했다. 형질 도입 96시간 후 세포를 각각 분리한 다음, 흐름 세포 분석 방법(flow cytometry)을 구동시키는 FACS aria를 이용해서 형질 도입 세포 전체 중, 10,000개 세포의 형광 강도를 측정한 후 그래프 상의 곡선으로 산출시켰다(도 9). C-유형의 FokI 제한효소 유전자 플라스미드 벡터와 프로브, 탈렌(TALEN)을 각각 형질 도입시킨 세포를 형광 현미경으로 관찰하였다(도 10).
내생적 인간 LGALS3BP(렉틴 갈락토스-결합가용성결합결합단백질3) 유전자의 특이적 넉-아웃(knock-out) 분석
내생적 렉틴 갈락토스-결합가용성결합결합단백질3 유전자(Lectin, GALac-toside-binding, Soluble, 3 Binding Protein, LGALS3BP) 엑손 3번의 디옥시리보핵산 염기서열과 상보적인 염기 26개를 합성하고, 이 디옥시리보핵산 프로브의 말단부에 이디티에이-C2를 결합시켰다(도 11). 그리고 FokI 제한효소 이량체 유전자와 다수의 히스티딘 서열을 삽입된 pcDNA3.1 hygro(+) 플라스미드 벡터 5㎍, 니켈(Ni2+) 50mM, DNA 프로브 1μM을 인간 대장암 세포주인 에이치티-29(HT-29)에 동시에 도입시켰다. 또한 FokI 제한효소 이량체 유전자와 다수의 히스티딘 서열이 삽입된 플라스미드 벡터 5㎍, 니켈(Ni2+) 50mM, DNA 프로브 3μM도 인간 대장암 세포주인 에이치티-29(HT-29)에 동시에 도입시켰다. 세포 내 도입 방법은 리포좀 전달 방법 중 하나인 리포펙타민 2000(lipofectamine 2000)을 이용하는 방법과 전기 충격법(electroporation)을 1,600 볼트로 1,000분의 10초 시간 동안 충격 부여 3회 조건으로 각각 이용했다. 형질 도입 96시간 후 세포를 각각 전기 충격법(electroporation)을 이용했다. 형질 도입 48시간 후 지노믹 DNA를 정제하고, LGALS3BP 유전자용 양방향 프라이머를 이용하여 중합 효소 연쇄 반응을 실시했다.
지노믹 DNA 100ng, 정방향 프라이머 1㎕, 역방향 프라이머 1㎕, 증류수 9.5㎕, Pfu polymerase primix 12.5㎕를 혼합하여 95℃에서 5분을 반응시키고, 95℃에서 30초, 54℃에서 40초, 72℃에서 1분을 총 30회 반응시킨 후, 72℃에서 7분을 반응시키는 중합효소 연쇄반응을 실시하였다.
FP1 : 5'-tacaagctcagcaggggaga-3' (서열번호 28)
R1 : 5'-ttcgtcttaggggatttgcc-3' (서열번호 29)
FP2 : 5'-agatcttctacagaggccag-3'(서열번호 30)
획득된 중합효소 연쇄반응 산물은 95℃에서 5분을 반응시키고, 1분에 1℃씩 온도를 감소시키는 반응을 91회 동안 실시하였다. 획득된 산물 12㎕, 제한효소 10×버퍼 2㎕, T7 제한효소 1×버퍼 0.5㎕, 증류수 5.5㎕를 혼합시켜 37℃에서 20분간 반응시키고 12% 폴리아크릴 아마이드 젤에 70 볼트로 전개시켰다(도 12). 중합 효소 연쇄 반응을 통해서 증폭된 산물 중 2개를 선별하여 1.5% 아가로스 젤 상에서 100 볼트로 전개시켜 절단한 후, 그 중에서 DNA만 추출하였다. 추출된 DNA 산물 6.5㎕, 6×라이게이스 버퍼 1.5㎕, 피탑 블런트 V2 벡터 DNA 1㎕를 혼합하여 실온에서 1시간 동안 반응시켰다. 획득된 산물은 DH5α 대장균 균주에 형질전환시키고 LB 아가 플레이트에 배양시켰다. 획득된 형질전환 군집들은 LB 배지에 주입시켜 37℃에서 250rpm으로 16시간 동안 배양시켰다. 획득된 산물에서 플라스미드 벡터 DNA를 추출한 다음 염기서열 분석용 프라이머를 이용해서 염기서열을 분석했다(도 14).
M13F(-20) : 5'-GTAAAACGACGGCCAGT-3'(서열번호 31)
M13R(-20) : 5'-GGAAACAGCTATGACCATG-3'(서열번호 32)
배양 중인 야생형 에이치티-29 세포와 형질 도입시킨 에이치티-29 세포를 트립신-이디티에이를 이용해서 배양 접시에서 분리시킨 후, NP40(Nonidet-P40) 버퍼로 용해시키고, 2초간 동작 1초간 정지를 총 30초 간 반복하면서 초음파를 가해서 분쇄를 실시했다. 13,000rpm으로 15분 동안 4℃에서 원심분리시키고 상층액만 분리해서 브래드포드 정량법(Bradford assay)을 이용해서 정량하였다. 동일한 농도의 용해물을 각각, 5×버퍼, PBS(Phosphate-Buffered Saline)와 혼합시키고 95℃에서 5분간 반응시킨 후 12% 폴리아크릴 아마이드 젤에 전개시켰다.
PVDF(PolyVinylidene DiFluoride) 막에 100 볼트로 2시간 동안 이동시키고, 스킴 밀크가 5%로 주입된 TBST(Tris-Buffered Saline+Tween20 0.1%) 용액과 혼합시켜 실온에서 2시간 동안 교반하면서 블로킹했다. 1차 항체인 anti-LGALS3BP를 스킴 밀크가 5%로 주입된 TBST(Tris-Buffered Saline+Tween20 0.1%) 용액과 1:1,000 비율로 혼합시키고 PVDF 막을 주입시켜 4℃에서 16시간 동안 교반시켰다. TBST로 10분간 3회 교반 세척을 실시하고, 2차 항체인 anti-mIgG-HRP(mouse Immunoglobulin G-Horse Radish Peroxidase)를 스킴 밀크가 5%로 주입된 TBST(Tris-Buffered Saline+Tween20 0.1%) 용액과 1:2,000 비율로 혼합시키고 PVDF 막을 주입시켜 실온 에서 1시간 동안 교반시켰다. TBST로 10분간 6회 교반 세척을 실시하고 발색 용액을 PVDF 막과 혼합시켜 엑스레이 필름에 노출시켜서 현상기로 인화시켰다(도 15).
내생적 쥐 면역 글로불린 G1(Immunoglobulin G1, IgG1) 유전자를 대상으로 하는 넉-인(knock-in) 분석
쥐에서 항체를 합성시키는데 관여하는 면역 글로불린 G1의 유전자의 당질화 서열을 포함하는 엑손 부분 중 치환시킬 pUC19 공여자 플라스미드 벡터를 제작하였다. 이 플라스미드 벡터 내에 원래 유전자의 당질화 서열에 존재하지 않는 SacⅠ 제한효소 인식 서열을 삽입시켰고, 염기서열을 치환시킬 부위에 맞게 DNA 프로브를 합성하고 이디티에이-C2를 결합시켰다(도 17). 그리고 FokI 제한효소 이량체 유전자와 다수의 히스티딘 서열이 삽입된 플라스미드 벡터 5㎍, 니켈(Ni2+) 각각 0mM, 5mM, 50mM, DNA 프로브 3μM, 공여자 플라스미드 벡터 5㎍을 쥐 엔아이에이치-3T3(NIH-3T3) 세포에 도입시켰다. 또한 치환 부위에 맞게 탈렌(TALEN) 방법을 이용한 pCS2TAL3-DD와 pCS2TAL3-RR 플라스미드 벡터 2개도 제작하여, 공여자 플라스미드 벡터와 함께 각각 5㎍씩 쥐 엔아이에이치-3T3(NIH-3T3) 세포에 도입시켰다. 그리고 크리스퍼/카스9 방법을 이용하기 위해 치환 부위에 부합되는 디옥시리보핵산 염기 26개를 제작하여 pSpCas9-GFP 플라스미드 벡터에 삽입시킨 후, 공여자 플라스미드 벡터와 함께 각각 5㎍씩 쥐 엔아이에이치-3T3(NIH-3T3) 세포에 도입시켰다. 세포 내 도입 방법은 리포좀 전달 방법 중 하나인 리포펙타민 2000(lipofectamine 2000)을 이용하는 방법과 전기 충격법(electroporation)을 1,350 볼트로 1,000분의 20초 시간 동안 충격 부여 2회 조건으로 각각 이용했다. 형질 도입 48시간 후 지노믹 DNA를 정제하였다. 지노믹 DNA 100ng, 정방향 프라이머 1㎕, 역방향 프라이머 1㎕, 증류수 9.5㎕, Pfu polymerase primix 12.5㎕를 혼합하여 95℃에서 5분을 반응시키고, 95℃에서 20초, 60℃에서 40초, 72℃에서 1분을 총 30회 반응시킨 후, 72℃에서 7분을 반응시키는 중합효소 연쇄반응을 실시하였다.
Knock in-정방향 프라이머 : 5'-GCAGCACCAAAGTGGACAAG-3'(서열번호 33)
Knock in-역방향 프라이머 : 5'-GTGCTGGGTGTGGCAGTGTA-3'(서열번호 34)
획득된 중합효소 연쇄반응 산물은 95℃에서 5분을 반응시키고, 1분에 1℃씩 온도를 감소시키는 반응을 91회 동안 실시하였다. 획득된 산물 12㎕, 제한효소 10×버퍼 2㎕, T7 제한효소 1×버퍼 0.5㎕, 증류수 5.5㎕를 혼합시켜 37℃에서 20분간 반응시키고 12% 폴리아크릴 아마이드 젤에 70 볼트로 전개시켰다(도 18).
그리고 원래 게놈 내 표적 유전자 염기서열에 존재하지 않았던 SacⅠ 제한 효소 인식 서열이 공여자 플라스미드 벡터를 통해서 잘 삽입되었는지를 확인하고자, 최종적으로 게놈 내 표적 유전자 부위를 포함할 수 있도록 증폭용 프라이머를 합성해서 중합 효소 연쇄 반응을 실시했다(도 19).
Knock in-정방향 프라이머 : 5'-GCAGCACCAAAGTGGACAAG-3'(서열번호 35)
Knock in-역방향 프라이머 : 5'-GTGCTGGGTGTGGCAGTGTA-3'(서열번호 36)
추출된 DNA 산물 6.5㎕, 6×라이게이스 버퍼 1.5㎕, 피탑 블런트 V2 벡터DNA 1 ㎕를 혼합하여 실온에서 1시간 동안 반응시켰다. 획득된 산물은 DH5α 대장균 균주에 형질전환시키고 LB 아가 플레이트에 배양시켰다. 획득된 형질전환 군집들은 LB 배지에 주입시켜 37℃에서 250rpm으로 16시간 동안 배양시켰다. 획득된 산물에서 플라스미드 벡터 DNA를 추출한 다음 염기서열 분석용 프라이머를 이용해서 염기서열을 분석했다(도 20).
M13F(-20) : 5'-GTAAAACGACGGCCAGT-3'(서열번호 37)
M13R(-20) : 5'-GGAAACAGCTATGACCATG-3'(서열번호 38)
실시예 1. 핵산 프로브와
FokⅠ
제한효소 이량체의 결합 확인
본 발명자들은 새로운 형태의 만능형 유전자 편집 기술을 개발했으며, 이것은 표적 유전자 서열과 상보적인 서열을 가진 디옥시리보핵산(Deoxyribo Nucleic Acid, DNA) 또는 리보핵산(Ribo Nucleic Acid, RNA) 염기 26개를 합성하여 표적 유전자 인식 물질로 사용함으로써, 생물체 내 특정 염기서열을 매우 특이적으로 인식할 수 있다. 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 이디티에이-C2 화합물과의 서로 간 배위 결합을 통해 연결시킬 수 있게 만들었다. FokI 제한효소 이량체 발현 유전자 사이에는 글라이신-글라이신-글라이신-글라이신-세린 연결체(GGGGS linker) 10개를 삽입하고, FokI 제한효소 단량체와 다수의 히스티딘 발현 유전자 사이에는 글라이신-글라이신-글라이신-글라이신-세린 연결체(GGGGS linker) 3개를 삽입하여 차후에 생체 내에서 단백질로 발현됐을 때, 유연한 운동성을 가질 수 있게 만들었다(도 1).
그래서 실제로 이 만능형 유전자 편집 기술을 세포주에 적용시키기 위해 디옥시리보핵산 또는 리보핵산 염기 26개의 마지막 염기는 디옥시-티민(deoxy-thymine) 또는 디옥시-우라실(deoxy-uracil)로 합성하고, 이 부위에 이디티에이-C2(EDTA-C2) 화합물을 결합시켰다. 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 이디티에이-C2 화합물과의 서로 간 배위 결합을 통해 연결시킬 수 있게 만들었다(도 2).
그리고 핵 위치화 신호(nuclear localization signal, NLS) 유전자를 삽입시켜 생체 세포 내 유전자 발현 벡터를 주입했을 시 단백질로 발현된 후 세포핵 내에 상주하여 게놈에 결합될 수 있게 했다. 또한, 믹 항원 결정기(myc epitope) 서열을 같이 삽입시켜 차후 생체 세포 내 단백질 발현 여부를 단백질 면역 흡착 검침법(protein immunoblot, western blot)을 통해 확인할 수 있게 했다(도 3). 단백질의 구조와 운동성, 프로브와의 결합 가능성을 고려해서 2가지 형태인 C-type인 경우와 N-type인 경우를 제작했다.
또한, 디옥시리보핵산 또는 리보핵산 염기 20개의 마지막 염기에 바이오틴(biotin)을 결합시켜 표적 염기서열 인식 물질로 사용함으로써, 생물체 내 유전체 특정 염기서열을 매우 특이적으로 인식할 수 있다. 그리고 징크핑거 뉴클라아제와 탈렌 기술이 생체 내 유전자 인식 물질을 단백질로 사용함으로써 발생되는 활성 감소 문제를 해결할 수 있다. 테트라벨런트 스트렙트아비딘(tetravalent streptav-idin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin) 발현 유전자를 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 바이오틴과의 서로 간 결합을 통해 연결시킬 수 있게 만들었다. 그리고 핵 위치 신호(nuclear localization signal, NLS) 서열을 삽입시켜 생체 세포 내 유전자 발현 벡터를 주입했을 시 단백질로 발현된 후 세포핵 내에 상주하여 게놈에 결합될 수 있게 했다. 또한, 믹 항원 결정기(myc epitope) 서열을 같이 삽입시켜 차후 생체 세포 내 단백질 발현 여부를 단백질 면역 흡착 검침법(protein immunoblot, western blot)을 통해 확인할 수 있게 했다(도 4).
실시예 2. 핵산 프로브와
FokⅠ
제한효소 이량체의 생체 외 결합 확인
녹색 형광 단백질 발현 유전자의 개시 코돈부터 3'방향으로 100개까지의 염기와 이와 상보적인 서열을 가지는 염기를 각각 합성한 다음, 중합 효소 연쇄 반응 시 100bp와 70bp 길이의 산물이 형성되게끔 프라이머를 제작하였다. 중합 효소 연쇄 반응 후 형성된 산물을 95℃에서 변성시키고 즉시 급냉시키면 최종적으로 4가지 형태의 DNA가 남게 된다(도 5). 이렇게 얻어진 중합 효소 연쇄 반응 직후의 100bp DNA, 70bp DNA, 그리고 이형 접합체를 형성시킨 직후의 DNA와 37℃에서 4시간 동안 반응시킨 DNA를 각각 아가로스 젤 상에서 전개시켰다. 그 결과 이 2종류의 DNA 모두 이형 접합체를 형성시킨 DNA가 100bp DNA와 70bp DNA 사이에 정확하게 전개되는 것을 확인할 수 있었다(도 6).
그리고 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 대장균 발현 DNA 벡터 내에 삽입시킨 후, 외래 유전자가 삽입되지 않은 대장균 발현 DNA 벡터와 함께 BL21(DE3) 전능성 대장균 세포 내에 각각 형질전환시켰다. 그렇게 해서 획득된 대장균 콜로니(colony)를 액체 배지에 주입시켜 37℃에서 증식시켰다. 흡광도 600nm에서 광학 밀도가 0.4~0.6에 도달했을 때, 0.1mM 농도의 IPTG를 주입시키고, 18℃에서 18시간 동안 증식시켰다. 그렇게 증식된 대장균에 초음파를 가하면서 분쇄를 실시했고 용해물을 획득했다. 이 산물들을 일반 DNA 벡터와 함께 37℃에서 14시간 동안 반응시킨 후 아가로스 젤 전개를 실시한 결과, 일반 제한효소 버퍼와 대장균 발현 DNA 벡터를 형질전환시켜서 획득한 용해물을 일반 DNA 벡터와 반응시킨 산물에서는 절단 DNA가 확인되지 않았다. 반면 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 대장균 발현 DNA 벡터를 형질전환시켜 획득한 용해물을 일반 DNA 벡터와 반응시킨 산물에서는 절편화된 DNA가 확인되어 FokI 제한효소 이량체의 활성을 확인할 수 있었다(도 7).
또한, FokI 제한효소 이량체의 표적 특이적인 활성을 확인하기 위해서 녹색 형광 단백질 발현 유전자의 개시 코돈부터 3'방향으로 디옥시리보핵산 염기 26개와 이것과 상보적인 서열을 가지는 염기 26개를 각각 합성하고 말단부에 이디티에이-C2(EDTA-C2)를 결합시켰다. 그리고 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 대장균 발현 DNA 벡터를 형질전환시켜 획득한 용해물을 친화성 크로마토그래피(affinity chromatography)와 이온 교환 크로마토그래피(ion-exchange chromatography)를 거쳐 정제를 실시했다. 이렇게 획득한 단백질과 녹색 형광 단백질 발현 유전자 프로브 2종류, Ni2+, EDTA를 각각 다른 주입 조건으로 선행 실험에서 얻은 4가지 형태(도 5 참조)의 DNA와 37℃에서 14시간 동안 반응시켰다. 아가로스 젤 전개를 실시한 결과, FokI 단백질과 Ni2+, 프로브 2를 같이 반응시킨 DNA의 경우에 표적 DNA 부분(P2, P3)이 절단되어서 밴드가 희미해진 것을 관찰할 수 있었다. 또한 FokI 단백질과 Ni2+, EDTA, 프로브 2종류를 모두 주입시켜 반응시킨 경우에는 전체 DNA 밴드를 모두 절편화시키는 것을 확인했다. 이로써 FokI 제한효소 이량체 발현 유전자의 표적 특이적인 활성을 확인할 수 있었다(도 8).
실시예 3. 외생적 녹색 형광 단백질 발현 유전자의 특이적 넉-아웃(knock-out) 분석
녹색 형광 단백질 발현 유전자의 개시 코돈부터 디옥시리보핵산 염기와 리보핵산 염기 18개, 26개, 28개를 각각 합성하고, 이것들과 상보적인 염기서열을 가지는 18개, 26개, 28개를 또한 합성했다. 그리고 이 핵산 프로브의 말단부에 이디티에이-C2를 각각 결합시켰다. 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 프로브의 말단부에 결합되어 있는 이디티에이-C2 화합물과의 배위 결합을 통해 연결시킬 수 있게 만들었다. 그리고 인간 대장암 세포주인 더블유아이디알(WiDr)에 녹색 형광 단백질 발현 유전자를 도입시킨 다음, 형광 현미경으로 형광 강도를 관찰하면서 강도가 강한 세포들을 선별하는 작업을 반복했다. 그럼으로써 녹색 형광 단백질이 항시 발현될 수 있는 세포를 최종 선별한 다음, 이 세포들에 녹색 형광 단백질 발현 유전자의 프로브 300pM과 FokI 제한효소 이량체 발현 유전자, 다수의 히스티딘 발현 유전자가 삽입된 발현 벡터 5㎍, 니켈(Ni2+) 500mM을 동시에 도입시켰다. 이때 니켈은 세포 내에서 이디티에이-C2와 결합하는 역할을 한다. 또한 유전자 발현 벡터를 먼저 세포 내에 도입시키고 24시간 후에 녹색 형광 단백질 유전자 프로브를 도입시키기도 했다. 그리고 탈렌(TALEN) 방법과의 비교 실험을 위해서 녹색 형광 단백질 발현 유전자의 개시 코돈부터 20개의 염기서열과 더 3′방향으로 12개 염기서열만큼 더 진행된 시점부터 20개의 염기서열을 선정해서 전사 활성화 유사 인자(TALE) 결합 영역을 각각 조합해서 DNA 벡터에 삽입한 다음 왼쪽과 오른쪽 벡터를 각각 5㎍씩 동시에 세포 내에 도입했다. 세포 내 도입 방법은 리포좀 전달 방법 중 하나인 리포펙타민 2000(lipofectamine 2000)을 이용하는 방법과 전기 충격법(electroporation)을 각각 이용했다. 형질 도입 96시간 후 세포를 각각 분리한 다음, 흐름 세포 분석 방법(flow cytometry)을 이용해서 형질 도입 세포 전체 중, 일만 개 세포의 형광 강도를 측정한 후 그래프 상의 곡선으로 산출시켰다. 그 결과 C-유형의 FokI 제한효소 유전자 발현 벡터와 프로브를 세포 내 도입한 결과는 녹색 형광 발현율이 19% 감소했고, N-유형의 FokI 제한효소 유전자 발현 벡터와 프로브를 세포 내 도입한 결과는 녹색 형광 발현율이 5% 감소했다. 그리고 탈렌(TALEN) 방법을 이용한 결과 역시 녹색 형광 발현율이 5% 감소했다(도 9). C-유형의 FokI 제한효소 유전자 발현 벡터와 프로브, 탈렌(TALEN)을 각각 형질 도입시킨 세포를 형광 현미경으로 관찰한 결과, 각각 형광 발현이 사라진 세포들을 다수 관찰할 수 있었다(도 10).
실시예 4. 내생적 인간 LGALS3BP(렉틴 갈락토스-결합가용성결합단백질3) 유전자의 특이적 넉-아웃(knock-out) 분석
내생적 렉틴 갈락토스-결합가용성결합단백질3 유전자(Lectin, GALac-toside-binding, Soluble, 3 Binding Protein, LGALS3BP) 엑손 3번의 디옥시리보핵산 염기서열과 상보적인 염기 20개를 합성하고, 이 디옥시리보핵산 프로브의 말단부에 이디티에이-C2를 결합시켰다. 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 프로브의 말단부에 결합되어 있는 이디티에이-C2 화합물과의 배위 결합을 통해 연결시킬 수 있게 만들었다(도 11).
그리고 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자가 삽입된 DNA 벡터 5㎍, 니켈(Ni2+) 50mM, DNA 프로브 1μM을 인간 대장암 세포주인 에이치티-29(HT-29)에 동시에 도입시켰다. 또한 FokI 제한효소 이량체 유전자와 다수의 히스티딘 발현 유전자가 삽입된 DNA 벡터 5㎍, 니켈(Ni2+) 50mM, DNA 프로브 3μM도 인간 대장암 세포주인 에이치티-29(HT-29)에 동시에 도입시켰다. 세포 내 도입 방법은 리포좀 전달 방법 중 하나인 리포펙타민 2000(lipofectamine 2000)을 이용하는 방법과 전기 충격법(electroporation)을 각각 이용했다. 형질 도입 48시간 후 지노믹 DNA를 정제하고 LGALS3BP 유전자용 양방향 프라이머를 이용하여 중합 효소 연쇄 반응을 실시했다. 그리고 이형 접합 DNA 형태를 만들고 T7 제한효소 1와 반응시켜 폴리아크릴 아마이드 젤에 전개시켰다. 그 결과 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자가 삽입된 DNA 벡터 5㎍, 니켈(Ni2+) 50mM, DNA 프로브 3μM을 동시에 세포 내에 도입시킨 결과에서 절단된 유전자 증폭 산물을 확인했다(도 12).
LGALS3BP 유전자용 양방향 프라이머를 제작해서 중합 효소 연쇄 반응을 실시한 결과, 게놈 내 삽입된 유전자 증폭 산물을 확인했다. 예상 절단 DNA 부위에 LGALS3BP 유전자용 양방향 프라이머를 제작하여 중합 효소 연쇄 반응을 실시한 결과, 다수의 증폭되지 않은 산물을 또한 확인했다(도 13).
중합 효소 연쇄 반응을 통해서 증폭된 산물 중 2개를 선별하여 DNA 벡터에 결찰시켜 염기서열 분석용 프라이머를 이용해서 염기서열을 분석했다. 에이치티-29 세포 내 LGALS3BP 유전자의 대립 유전자(allele)는 총 3개가 존재하는데, 그 3개의 대립 유전자가 모두 특정 염기서열의 결실과 삽입이 이루어진 것을 확인했다(도 14).
그리고 단백질 면역 흡착 검침법(protein immunoblot, western blot)을 통해서 야생형 에이치티-29 세포와 형질 도입시킨 에이치티-29 세포의 LGALS3BP 유전자의 발현 강도를 확인했는데 야생형 세포는 발현 강도가 강한 반면, 형질 도입된 세포는 전혀 발현이 관찰되지 않은 것을 확인했다. 이로써 특이적인 유전자의 넉-아웃(kncok-out)이 잘 이루어진 것을 알 수 있었다(도 15).
또한, 내생적 렉틴 갈락토스-결합가용성결합단백질3 유전자(Lectin, GALac-toside-binding, Soluble, 3 Binding Protein, LGALS3BP) 엑손 3번의 디옥시리보핵산 염기서열과 상보적인 염기 20개를 합성하고, 이 디옥시리보핵산 프로브의 말단부에 바이오틴(Biotin)을 결합시켰다. 스트렙트아비딘(streptavidin) 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 프로브의 말단부에 결합되어 있는 바이오틴과의 결합을 통해 연결시킬 수 있게 만들었다(도 4).
인간 HT-29 세포 내에 LGALS3BP 유전자 엑손 3번의 디옥시리보핵산 탐침자 4종 각각과, FokI 제한 절단 효소 이량체 발현 유전자와 N-타입 모노벨런트 스트렙트아비딘 발현 유전자가 삽입된 플라스미드 벡터를 형질도입시킨 후 도출된 게놈 상 염기서열의 결실, 삽입을 확인한 결과, 바이오틴이 결합된 디옥시리보핵산 탐침자 4종 모두에서 일정 길이의 결실 또는 삽입이 이뤄진 것을 알 수 있었다.
인간 LGALS3BP의 엑손 3번의 특이적 핵산 프로브 및 FokⅠ 제한효소 이량체를 생체 내에 주입시키면 상기한 바와 같이 DNA의 이중절단이 유도되고 이를 복구하는 과정에서 복구 에러가 발생하여 다양한 형태의 유전자결손이나 첨가현상이 발생하게 된다. 도 16의 (C)는 다양한 형태의 결손(△로 표기)과 첨가(+로 표기)가 나타난 것을 보여주고 있다. 만약 3의 배수(예: 27염기 결손)로 결손이나 첨가가 일어난 경우 유전자의 기능은 보존될 수 있지만, 그렇지 않은 경우는 유전자의 틀이동(frame shift)이 유도되어 유전자 적중(gene targeting)의 결과를 낳게 된다. 이로써 바이오틴-스트렙트아비딘 간 결합을 이용한 유전자 편집기술이 생체 내에서 제대로 작동되는 것을 확인할 수 있었다(도 16).
실시예 5. 내생적 쥐 면역 글로불린 G1(Immunoglobulin G1, IgG1) 유전자를 대상으로 하는 넉-인(knock-in) 분석
쥐에서 항체를 합성시키는데 관여하는 면역 글로불린 G1의 유전자의 당질화 서열을 포함하는 엑손 부분 중 치환시킬 공여자 DNA 벡터를 제작하였다. 이 벡터 내에 원래 유전자의 당질화 서열에 존재하지 않는 SacⅠ 제한효소 인식 서열을 삽입시켰고, 이 벡터가 정상적으로 생체 게놈 내에 삽입되면 면역 글로불린 G1에서 정상적으로 당질화가 일어나지 않게 된다. 염기서열을 치환시킬 부위에 맞게 DNA 프로브를 합성하고 이디티에이-C2를 결합시켰다(도 17).
다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자를 DNA 벡터 내에 삽입시켜 차후 단백질로 발현됐을 때, 프로브의 말단부에 결합되어 있는 이디티에이-C2 화합물과의 배위 결합을 통해 연결시킬 수 있게 만들었다. 그리고 다수의 히스티딘 발현 서열을 포함한 FokI 제한효소 이량체 발현 유전자가 삽입된 DNA 벡터 5㎍, 니켈(Ni2+) 각각 0mM, 5mM, 50mM, DNA 프로브 3μM, 공여자 DNA 벡터 5㎍을 쥐 엔아이에이치-3T3(NIH-3T3) 세포에 도입시켰다. 또한 치환 부위에 맞게 탈렌(TALEN) 방법을 이용한 DNA 벡터 2쌍도 제작하여, 공여자 DNA 벡터와 함께 각각 5㎍씩 쥐 엔아이에이치-3T3(NIH-3T3) 세포에 도입시켰다. 그리고 크리스퍼/카스9 방법을 이용하기 위해 치환 부위에 부합되는 디옥시리보핵산 염기 20개를 제작하여 카스9 DNA 벡터에 삽입시킨 후, 공여자 DNA 벡터와 함께 각각 5㎍씩 쥐 엔아이에이치-3T3(NIH-3T3) 세포에 도입시켰다. 세포 내 도입 방법은 리포좀 전달 방법 중 하나인 리포펙타민 2000(lipofectamine 2000)을 이용하는 방법과 전기 충격법(electroporation)을 각각 이용했다. 형질 도입 48시간 후 지노믹 DNA를 정제하고 쥐 면역 글로불린 G1(Immunoglobulin G1, IgG1) 유전자용 양방향 프라이머를 이용하여 중합 효소 연쇄 반응을 실시했다. 그리고 이형 접합 DNA 형태를 만들고 T7 제한효소 1와 반응시켜 폴리 아크릴 아마이드 젤에 전개시켰다. T7 제한효소 1(T7 endonuclease 1, T7E1)은 완전히 상보적으로 결합되지 않고(mismatch) 와블(wobble)이 형성된 이중결합 DNA를 절단하는 제한효소로서 지노믹 DNA 상의 염기서열 삽입이나 결실을 확인할 때 이용되는 효소이다.
그 결과 각각의 절단된 유전자 증폭 산물을 확인했다(도 18). 그리고 원래 게놈 내 표적 유전자 염기서열에 존재하지 않았던 SacⅠ 제한효소 인식 서열이 공여자 DNA 벡터를 통해서 잘 삽입되었는지를 확인한 결과, 각각의 절단된 유전자 증폭 산물을 확인했다(도 19). 최종적으로 게놈 내 표적 유전자 부위를 포함할 수 있도록 증폭용 프라이머를 합성해서 중합 효소 연쇄 반응을 실시했다. 증폭된 산물 3개를 벡터 DNA에 결찰시켜 염기서열 분석용 프라이머를 이용해서 염기서열을 분석했다. 그 결과 증폭된 산물 3개 모두에서 SacⅠ 제한효소 인식 서열이 삽입된 것을 확인했고, 이로써 특이적인 유전자의 넉인(knock-in)이 잘 이루어진 것을 알 수 있었다(도 20).
Claims (19)
- (a) 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및(b) 두 개의 FokⅠ 제한효소가 서로 연결된 이량체를 코딩하는 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 서로 연결된 채 발현될 수 있도록 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 조성물.
- 제1항에 있어서, 상기 (a)의 단백질 결합 물질은 금속 킬레이트제(metal chelating agent) 또는 바이오틴인 것을 특징으로 하는 조성물.
- 제2항에 있어서, 상기 금속 킬레이트제는 이디티에이(EDTA)인 것을 특징으로 하는 조성물.
- 제3항에 있어서, 전이금속을 추가로 포함하는 것을 특징으로 하는 조성물.
- 제4항에 있어서, 상기 전이금속은 Ni2+, Co2+ 또는 Zn2+인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 (b)의 단백질 결합 물질과 결합하는 단백질은 다수의 히스티딘, 테트라벨런트 스트렙트아비딘(tetravalent streptavidin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin)인 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 (b)의 발현 벡터는 FokⅠ 제한효소 이량체 발현 유전자, 연결체(linker), 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자 및 핵 위치 신호(nuclear localization signal, NLS) 유전자가 작동가능하게 연결된 것을 특징으로 하는 조성물.
- 제7항에 있어서, 상기 연결체는 1개부터 10개까지의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)1-10) 인 것을 특징으로 하는 조성물.
- 제7항에 있어서, 상기 발현 벡터는 5'→3' 방향으로 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자, 핵 위치 신호(NLS) 서열, 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3), FokⅠ 제한효소 유전자, 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10) 및 FokⅠ 제한효소 유전자가 작동가능하게 연결되거나; 또는 5'→3' 방향으로 FokⅠ 제한효소 유전자, 10개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)10), FokⅠ 제한효소 유전자, 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3), 핵 위치 신호(NLS) 서열 및 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자가 작동가능하게 연결된 것을 특징으로 하는 조성물.
- 제9항에 있어서, 핵 위치 신호(NLS) 서열과 3개의 글라이신-글라이신-글라이신-글라이신-세린 연결체((GGGGS)3) 사이에 믹 항원 결정기(myc epitope) 서열을 추가로 포함하는 것을 특징으로 하는 조성물.
- 제1항에 있어서, 상기 유전자 특이적 편집은 유전자 결실, 유전자 삽입, 유전자 교정 또는 염색체 재배열인 것을 특징으로 하는 조성물.
- (a) FokⅠ 제한효소 이량체 발현 유전자 및 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자가 삽입된 발현 벡터를 제조하는 단계;(b) 상기 (a) 단계의 발현 벡터 및 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브를 세포 내로 도입하는 단계; 및(c) 상기 (b) 단계의 세포 내로 도입되어 발현된 FokⅠ 제한효소 이량체와 표적 유전자 인식 프로브의 결합을 유도하는 단계를 포함하는 세포 내에서 표적 유전자를 특이적으로 편집하는 방법.
- 제12항에 있어서, 상기 (b) 단계의 프로브에 포함된 단백질 결합 물질은 금속 킬레이트제(metal chelating agent) 또는 바이오틴인 것을 특징으로 하는 방법.
- 제13항에 있어서, 상기 금속 킬레이트제는 이디티에이(EDTA)인 것을 특징으로 하는 방법.
- 제12항에 있어서, 상기 (a) 단계의 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질은 다수의 히스티딘, 테트라벨런트 스트렙트아비딘(tetravalent streptavidin) 또는 모노벨런트 스트렙트아비딘(monovalent streptavidin)인 것을 특징으로 하는 방법.
- 제12항에 있어서, 상기 (a) 단계의 발현 벡터는 FokⅠ 제한효소 이량체 발현 유전자, 연결체(linker), 표적 유전자의 염기서열과 상보적인 염기서열에 연결된 단백질 결합 물질과 결합하는 단백질 코딩 유전자 및 핵 위치 신호(nuclear localization signal, NLS) 서열이 작동가능하게 연결된 것을 특징으로 하는 방법.
- 제12항에 있어서, 상기 (b) 단계의 세포 내로의 도입은 리포좀 전달 방법 또는 전기충격법(electroporation)인 것을 특징으로 하는 방법.
- 제12항에 있어서, 상기 세포는 동물 세포, 식물 세포 또는 미생물 세포인 것을 특징으로 하는 방법.
- 표적 유전자의 염기서열과 상보적인 염기서열 및 상기 상보적인 염기서열에 연결된 단백질 결합 물질을 포함하는 표적 유전자 인식 프로브; 및 FokⅠ 제한효소 이량체 발현 유전자 및 상기 단백질 결합 물질과 결합하는 단백질을 코딩하는 유전자가 삽입된 발현 벡터;를 유효성분으로 함유하는 표적 유전자 특이적 편집용 키트.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR20150042130 | 2015-03-26 | ||
| KR10-2015-0042130 | 2015-03-26 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016153305A1 true WO2016153305A1 (ko) | 2016-09-29 |
Family
ID=56979182
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2016/003020 Ceased WO2016153305A1 (ko) | 2015-03-26 | 2016-03-25 | 표적 유전자 특이적 핵산 프로브 및 Fok Ι 제한효소 이량체를 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하기 위한 조성물 및 이의 용도 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101675023B1 (ko) |
| WO (1) | WO2016153305A1 (ko) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130196373A1 (en) * | 2011-11-16 | 2013-08-01 | Sangamo Biosciences, Inc. | Modified dna-binding proteins and uses thereof |
| WO2015021426A1 (en) * | 2013-08-09 | 2015-02-12 | Sage Labs, Inc. | A crispr/cas system-based novel fusion protein and its application in genome editing |
| CN104357440A (zh) * | 2014-10-09 | 2015-02-18 | 中山大学 | 一对靶向斑马鱼Forkhead box n1基因的Talen识别序列及其mRNA制备方法 |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011072246A2 (en) * | 2009-12-10 | 2011-06-16 | Regents Of The University Of Minnesota | Tal effector-mediated dna modification |
| GB201122458D0 (en) * | 2011-12-30 | 2012-02-08 | Univ Wageningen | Modified cascade ribonucleoproteins and uses thereof |
-
2016
- 2016-03-25 KR KR1020160035655A patent/KR101675023B1/ko active Active
- 2016-03-25 WO PCT/KR2016/003020 patent/WO2016153305A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130196373A1 (en) * | 2011-11-16 | 2013-08-01 | Sangamo Biosciences, Inc. | Modified dna-binding proteins and uses thereof |
| WO2015021426A1 (en) * | 2013-08-09 | 2015-02-12 | Sage Labs, Inc. | A crispr/cas system-based novel fusion protein and its application in genome editing |
| CN104357440A (zh) * | 2014-10-09 | 2015-02-18 | 中山大学 | 一对靶向斑马鱼Forkhead box n1基因的Talen识别序列及其mRNA制备方法 |
Non-Patent Citations (2)
| Title |
|---|
| JEON, SEONG KOOK ET AL.: "Cleavage of Double-Stranded DNA by Engineered FokI Endonuclease", ACGG 2012 CONFERENCE, 2013, pages 113 * |
| TSAI, SHENGDAR Q. ET AL.: "Dimeric CRISPR RNA-guided Fokl Nucleases for Highly Specific Genome Editing", NATURE BIOTECHNOLOGY, vol. 32, no. 6, 25 April 2014 (2014-04-25), pages 569 - 576, XP055178523 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR20160115810A (ko) | 2016-10-06 |
| KR101675023B1 (ko) | 2016-11-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR102339365B1 (ko) | 키메라 게놈 조작 분자 및 방법 | |
| AU2018330197B2 (en) | Nuclease systems for genetic engineering | |
| US20210062170A1 (en) | Site-specific enzymes and methods of use | |
| KR102004076B1 (ko) | 3-성분 crispr/cas 복합체 시스템 및 그 용도 | |
| US6475798B2 (en) | P element derived vector and methods for its use | |
| KR20230074207A (ko) | 카고 뉴클레오타이드 서열을 전위시키기 위한 시스템 및 방법 | |
| WO2022065689A1 (ko) | 편집 효율이 향상된 프라임 편집 기반 유전자 교정용 조성물 및 이의 용도 | |
| CN120041438A (zh) | 用于改进的基因编辑的组合物和方法 | |
| US20180320186A1 (en) | Method for site-specific insertion of foreign dna into a genome in an animal cell and a cell obtained using same | |
| US5614398A (en) | Gene transfer system for insects | |
| EP3594339A1 (en) | Composition containing c2cl endonuclease for dielectric calibration and method for dielectric calibration using same | |
| WO2022059928A1 (ko) | 신규의 개량된 염기 편집 또는 교정용 융합단백질 및 이의 용도 | |
| CA3202361A1 (en) | Novel nucleic acid-guided nucleases | |
| WO2021125840A1 (ko) | Cpf1 및 키메릭 dna-rna 가이드를 포함하는 유전체 교정 또는 발현 억제용 조성물 | |
| KR20230054457A (ko) | 카고 뉴클레오타이드 서열을 전위시키는 시스템 및 방법 | |
| WO2016153305A1 (ko) | 표적 유전자 특이적 핵산 프로브 및 Fok Ι 제한효소 이량체를 이용하여 세포 내에서 표적 유전자를 특이적으로 편집하기 위한 조성물 및 이의 용도 | |
| EP3792347A1 (en) | Method for producing homozygous cells | |
| WO2024085674A1 (ko) | Cas 단백질 및 박테리아 톡신을 포함하는 융합 단백질 및 이의 용도 | |
| EA010864B1 (ru) | Улучшенные штаммы e.coli для продуцирования плазмидной днк | |
| WO2023008887A1 (ko) | 염기 편집기 및 이의 용도 | |
| WO2015182941A9 (ko) | 신규 카탈라아제 신호서열 및 이를 이용한 카탈라아제 발현방법 | |
| WO2022010241A1 (ko) | 질환 세포-특이적인 mirna에 의해 세포 생리 활성 조절 물질의 활성을 조절하는 복합체 및 이를 crispr/cas 시스템에 적용한 질환 특이적 유전자 조작용 복합체 | |
| JP6956995B2 (ja) | ゲノム編集方法 | |
| WO2020139031A1 (ko) | Crispr-cas를 기반으로 하는 유전자 교정용 조성물 | |
| EP4628580A1 (en) | Nuclease domain for breaking dna into two strands |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16769123 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16769123 Country of ref document: EP Kind code of ref document: A1 |