WO2016151599A1 - A bigenic mammalian expression vector - Google Patents
A bigenic mammalian expression vector Download PDFInfo
- Publication number
- WO2016151599A1 WO2016151599A1 PCT/IN2016/050089 IN2016050089W WO2016151599A1 WO 2016151599 A1 WO2016151599 A1 WO 2016151599A1 IN 2016050089 W IN2016050089 W IN 2016050089W WO 2016151599 A1 WO2016151599 A1 WO 2016151599A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- expression vector
- expression
- interest
- eukaryotic expression
- sequence
- Prior art date
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/10—Immunoglobulins specific features characterized by their source of isolation or production
- C07K2317/14—Specific host cells or culture conditions, e.g. components, pH or temperature
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/70—Vectors containing special elements for cloning, e.g. topoisomerase, adaptor sites
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/20—Vector systems having a special element relevant for transcription transcription of more than one cistron
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/46—Vector systems having a special element relevant for transcription elements influencing chromatin structure, e.g. scaffold/matrix attachment region, methylation free island
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/50—Vector systems having a special element relevant for transcription regulating RNA stability, not being an intron, e.g. poly A signal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/60—Vector systems having a special element relevant for transcription from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
- C12N2830/85—Vector systems having a special element relevant for transcription from vertebrates mammalian
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2830/00—Vector systems having a special element relevant for transcription
- C12N2830/80—Vector systems having a special element relevant for transcription from vertebrates
- C12N2830/90—Vector systems having a special element relevant for transcription from vertebrates avian
Definitions
- the inventive subject matter is related to the vector for high level expression of recombinant proteins in eukaryotic host. Specifically it is related to the mammalian expression vector facilitating high level expression of plurality of polypeptides together in a mammalian host.
- biopharmaceuticals are not readily accessible to the larger population of world because of very high price associated with them.
- the high price of biopharmaceutical drugs are because of very high manufacturing cost associated with them.
- One of the major reasons for high manufacturing cost is low level expression of these biopharmaceuticals in eukaryotic hosts. Although high level expression of these biopharmaceuticals can be obtained in prokaryotic host but there are many limitation of expression in prokaryotic hosts. Moreover some of the biopharmaceuticals cannot be expressed in prokaryotic hosts.
- Mammalian host systems are highly advantageous for production of therapeutic biopharmaceuticals and further it is very important to address the issue of high cost of production associated with them.
- Considerable efforts have been made to reduce the cost of manufacturing of biopharmaceuticals in mammalian hosts.
- Most of the efforts to reduce the cost has targeted to enhance the production of therapeutic biopharmaceuticals in various arts are by optimizing the factors which control the expression of product.
- the factors controlling expression level in mammalian hosts are external, e.g. culture conditions, as well as internal e.g. factors regulating efficiency and quality of transcription. It has been reported that improvement in external factors can enhance the expression and final yield to a limited extent only and these are considered to be commercially insignificant unless internal factors have been optimized to get an ideal level of expression.
- a vast number of arts are available that address the internal factors such as regulatory elements for improving the expression of therapeutic biopharmaceuticals in mammalian host cells.
- the regulatory elements mentioned here are gene sequences which regulate gene expression.
- a number of arts disclose positioning of these regulatory elements in expression vectors, flanking 5' and 3' of the gene of interest. Most frequently reported regulatory elements in arts are TATA boxes, promoters, enhancers, translation start and stop codons, polyadenylation sites etc.
- Some arts disclose inclusion of some additional regulatory sequences like introns of some eukaryotic genes, internal ribosome entry sites (IRES), matrix/scaffold attachment regions (MAR/SAR), certain viral genes, etc.
- IRS internal ribosome entry sites
- MAR/SAR matrix/scaffold attachment regions
- the presence of one or more of these additional sequences in expression vectors is found to be enhancing the expression of gene of interest in mammalian host cell but operable arrangement is required to achieve enhanced results.
- regulatory elements and their positioning in a vector is very important. Strategic use and positioning of strong or weak promoters, enhancers, initiation and stop codons, polyadenylation sequences, IRES, SAR/MAR or other regulatory elements in an expression vector design, to enhance the expression level of gene in mammalian host, is a crucial factor. Another very important factor in vector design is the choice of marker genes in expression vector and control of their degree of expression in host cell.
- Patent application no. US 12/226,938 discloses a mammalian bicistronic expression vector pABME 15 for high level expression of recombinant proteins in mammalian host cell.
- This vector utilizes endogenous viral sequences along with other regulatory elements to enhance expression of genes of interest in mammalian host cell.
- This application claims production of upto 30pg/cell/day of an antibody by use of this expression vector.
- the patent application no. US 13/812,488 discloses a mammalian expression vector design for expression of recombinant antibodies.
- This vector comprises of two transcription units.
- the first transcription unit comprises sequentially a promoter, a monoclonal antibody (MAb) light chain sequence, internal multi-polyadenylation sites, IRES sequence, selection marker gene and a single polyadenylation site.
- the second transcription unit sequentially comprises, a promoter, a MAb heavy chain and a single or multi polyadenylation site. Positioning of IRES sequence in this vector is downstream of the internal multi-polyadenylation sites, operably connecting internal multi-polyadenylation site with gene coding selection marker.
- This patent application does not disclose level of expression achieved through this vector.
- the US patent US7,935,808 discloses an eukaryotic polycistronic expression vector for expression of recombinant proteins, specifically the monoclonal antibodies.
- This vector uses Adeno promoter and SV40 poly A sequence, flanking 5' and 3' of the gene of interest respectively. This also uses gastrin terminator sequence.
- selectable marker DHFR
- this vector uses SV40 promoter and TK Poly A sequence.
- This patent also discloses the use of atleast one recombinant expression vector element (rEVE) to enhance the expression of recombinant proteins.
- the rEVE sequence comprises one or more matrix attachment regions (MARs) sequences, clustered at the 5' and/or 3' terminal regions of rEVE sequence. This patent reports upto 18 fold increase in expression level over the control by use of rEVE sequence.
- MARs matrix attachment regions
- Patent application number US 13/482,117 discloses a mammalian expression vector comprising; one or more expression cassettes for expressing polypeptide of interest (POI), an expression cassette for expressing mammalian selectable marker(MSM) gene and an expression cassette for mammalian amplifiable selectable marker (MASM) gene.
- POI polypeptide of interest
- MSM mammalian selectable marker
- MASM mammalian amplifiable selectable marker
- the expression cassete POI is flanked at 5' by the expression cassette MASM and at 3' by the expression cassette MSM.
- the expression cassette POI comprise a CMV promoter/enhancer sequence while expression cassette MSM and MASM have SV40 promoter or promoter/enhancer sequence.
- PCT publication number WO2010/072676 discloses a mammalian expression vector claiming a novel combination of regulatory elements and one or more selection marker gene.
- the new combination of selection marker gene disclosed here comprises of; SV40 enhancer and early promoter region, Human ⁇ -globin (Hbb) gene intron II and SV40 and synthetic poly A sequence. This vector provides facility to express two or more polypeptides of interest simultaneously.
- the main object of the inventive subject matter is to provide a expression vector having a novel operably linked combinations of regulatory elements to facilitate simultaneous high level expression of more than one polypeptides of interest.
- Another object of present inventive subject matter is to provide dual mode of selection for high producing transfected clones, by using selectable marker dihydrofolate reductase (DHFR) and two different class of antibiotic resistance marker genes such as glycopeptide antibiotic and aminonucleoside antibiotic.
- DHFR selectable marker dihydrofolate reductase
- a further object of the inventive subject matter is to decrease the cost involved in production and achieve higher yield of final product.
- the vector facilitates the simultaneous expression of plurality of polypeptides of interest in a host cell. It also facilitates the rapid, effective and more stringent screening of high producing clones. In one of the aspect of inventive subject matter this vector is particularly useful for production of biopharmaceuticals, such as monoclonal antibodies (MAbs), having more than one polypeptide chains. In one of the embodiment vector enhanced level of expression of biopharmaceutical is achieved along with easing of the selection and isolation of high producing host strains.
- the present inventive subject matter in its main embodiment provides a mammalian expression vector comprising three transcriptional cassettes, atleast two different antibiotic selection marker genes (i.e. glycopeptide antibiotic and/or aminonucleoside antibiotic) and atleast one matrix attachment region (MAR). All these components are operably connected in expression vector to facilitate high level expression of polypeptides of interest and easy selection of highly producing host cell clones.
- the first transcription cassette (transcription cassette I) is comprised of, operably connected, PCMV promoter, multiple cloning site one (MCS I) for cloning of first polypeptide of interest and SV40 poly A tail sequence.
- the second transcription cassette (transcription cassette II) is comprised of, operably connected, PCMV promoter, an amplifiable selectable marker gene and thymidine kinase (TK) poly A tail sequence.
- the third transcription cassette (transcription cassette III) is comprised of, operably connected, pEFla promoter, MCS II for cloning of second polypeptide of interest and BGH polyA tail sequence.
- MCS I and MCS II is used to clone nucleotide sequence of same or two different polypeptides.
- MCS I and MCS II is used for cloning nucleotide sequence of light and heavy chains of an antibody. If MCS I is used for cloning nucleotide sequence of light chain of an antibody then MCS II is used for cloning of heavy chain of that antibody and vice- versa.
- amplifiable selectable marker gene is the dihydrofolate reductase (DHFR) gene and antibiotic resistance markers genes such as glycopeptide antibiotic and aminonucleoside antibiotic genes, in some of the embodiment preferred antibiotic genes are zeomycin and puromycin.
- DHFR dihydrofolate reductase
- antibiotic resistance markers genes such as glycopeptide antibiotic and aminonucleoside antibiotic genes, in some of the embodiment preferred antibiotic genes are zeomycin and puromycin. The presence of these three marker genes facilitates the easy and cost effective selection of high producer clones of host cells.
- eukaryotic host cell for expression of protein of interest through vector.
- eukaryotic host cell is a mammalian host cell selected from the group of cells including but not limited to, a Chinese hamster ovary (CHO) cell, a mammalian stem cell, a human embryonic kidney (HEK) cell, a human B-cell or a myeloma cell, PER C6, Pichia cell lines and like.
- host cell is a CHO cell, which is DHFR deficient and can be put under methotrexate treatment to select transfected high producing clones and amplify the copy number of recombinant genes.
- inventive subject matter discloses the presence of matrix attachment region (MAR) sequence in present vector.
- MARs are usually AT-rich sequences of high unwinding propensity. These enforce a curved DNA structure. They are found to regulate transcription by controlling the chromatin state of DNA. They have been reported to stimulate expression of a transgene as well as reduce expression variability among cell clones.
- MAR sequence can be of human, xenopus, mouse or any other plant or animal origin.
- MAR sequence is a chicken lysozyme MAR sequence.
- inventive subject matter provides Process of transfection of vector, method of producing polypeptide using inventive vector comprising glycopeptide antibiotic and aminonucleoside antibiotic genes and kits containing bigenic vector.
- Figure 1 shows the schematic representation of the vector pBG I.
- Figure 2 shows the schematic representation of the vector pBG II.
- Figure 3 shows the schematic representation of the expression vector pBG-SVII without sequence for polypeptide of interest at MCS. This figure shows one of the embodiment wherein components of expression vector are operably connected with each other.
- Figure 4 depicts the schematic representation of construction of expression vector pBG-SV II. This figure shows the origin of different components of expression vector pBG-SV II.
- Figure 5 shows a graphical representation of Erythropoietin yields in fed batch fermentor production.
- Figure 6 shows a graphical representation of Anti-CD20 Monoclonal antibody yields in fed batch fermentor production using pBG-SVII.
- Figure 7 shows gel image of electrophoretic separation profile on Erythropoietin Lane 1 shows Molecular marker, Lane 2 shows expressed Erythropoietin samplel, Lane 3 shows expressed Erythropoietin sample 2 and Lane 4 shows reference standard used for Erythropoietin (i.e. Eprex).
- Figure 8 shows gel image of iso-electric-focusing electrophoresis pattern during purification pools for Erythropoietin, final purification pool is in lane 5.
- Gel image contains Lane 1 shows reference standard used for Erythropoietin (Epofer); Lane 2 Purification pool 1 ; Lane 3 Purification pool 2; Lane 4 Purification pool 3; Lane 5 Purification pool 4.
- Figure 9 shows Silver staining of pBG-SVII produced antibody, single cell clones (on Reducing Gel) Lane 1 shows molecular marker; Lane 2 to 9 shows different clones; Lane 10 shows standard Anti-CD-20 antibody.
- Figure 10 shows HPLC Chromatogram profile of pBG-SVII produced antibody with the Standard Anti-CD-20 antibody.
- the present inventive subject matter provides a bigenic mammalian expression vector pBG- SVII of 10086 base pairs, represented by the nucleotides of sequence ID: 1.
- the expression vector pBG-SVII design has a novel combination of regulatory elements and selection markers to facilitate simultaneous high level expression of plurality of polypeptides of interest.
- the present vector design also facilitates the rapid, easy and cost effective selection of high producing clones of host cells. This vector is particularly beneficial for production of various monoclonal antibodies.
- expression vector' used herein means a plasmid vector designed to introduce specific genes in host cell and command the cell's machinery for protein synthesis to produce the proteins encoded by these specific genes.
- An expression vector construct include regulatory elements e.g promoters, enhancers, transcription termination signals, MARs, IRES, etc and at- least one multiple cloning site (MCS) for cloning of gene of interest.
- MCS multiple cloning site
- 'regulatory element means characteristics of a segment of DNA which regulates the gene expression by increasing or decreasing the expression of specific gene. Most frequently used regulatory elements are TATA boxes, promoters, enhancers, translation start and stop codons, polyadenylation sites, introns, IRES, SAR/MAR, viral genes, etc.
- promoter' used herein means a nucleotide sequence which is capable of binding RNA polymerase and initiate transcription of a adjacent coding sequence.
- 'PCMV promoter' used herein means a promoter derived from human cytomegalovirus or human cytomegalovirus immediate early promoter.
- 'PEF-la promoter' used herein means a promoter derived from human elongation factor one alfa promoter. This promoter is a strong constitutive promoter that is used to drive ectopic gene expression.
- ⁇ 7 promoter' used herein means a prokaryotic constitutively active promoter.
- transcription cassette used herein means a stretch of nucleotide sequences comprising a promoter, a multiple cloning site with or without a cloned gene sequences and a polyadenylation sequence.
- polypeptide of interest means a nucleotide sequence incorporated in expression vector for expression of corresponding amino acid sequence.
- MCS multiple cloning site
- selectable marker used here in means a marker that will have function to protect the cell from a selective agent that would otherwise kill the cell or prevent its growth.
- Selectable markers are selected from group comprising but not limited to compounds having property of glycopeptide antibiotic and aminonucleoside antibiotic and their functional variants thereof, like zeocin, zeomycin, puromycin,.
- amplifiable selectable marker used herein means a marker which can be used as a selectable marker as well as for gene amplification.
- the amplifiable selectable marker used herein is dihydrofolate reductase (DHFR).
- DHFR catalyzes the conversion of folate to tetrahydrofolate, which is required for the biosynthesis of glycine from serine and for the biosynthesis of purines.
- DHFR deficient cells require the addition of thymidine, glycine and hypoxanthine to the medium to grow. This property is utilized for selection of transfected cells having active DHFR genes.
- Methotrexate a folate analog, binds and inhibits DHFR and in result causes death of cells.
- MTX Methotrexate
- the surviving population contains increased level of DHFR, resulting from an amplication of DHFR gene.
- High MTX resistant cells have several thousand copies of DHFR gene expressing several thousand fold elevated level of DHFR.
- DHFR gene is used in an expression vector as selectable marker along with a gene of interest then it helps in selection of high expressing cells, as high DHFR copies in cell also indicates the high copies of gene of interest in cells.
- matrix attachment regions also referred as 'cIMAR' are used here in means an A-T rich sequence of DNA of eukaryotic chromosome, where nuclear matrix attach. It is reported to organize the genome of eukaryotes in functional units within the cell nucleus. MARs have been associated with some enhancer sequences and linked to a number of processes e.g. transcription, transgene expression, transgene rearrangement, recombination, replication and stabilization of transfection.
- operably connected used herein means that different DNA sequences are juxtaposed in a manner that different components are in a relationship, permitting them to function in their intended manner.
- bigenic expression vector means an expression vector which has facility for simultaneous expression of atleast two polypeptides of interest in a mammalian host.
- the vector pBG-SVII is deposited for patent purposes under Budapest Treaty at Microbial Type Culture Collection and Gene Bank (MTCC), International Depositary Authority (IDA), Institute of Microbial Technology (IMTECH), Council of Scientific and Industrial Research (CSIR), Sector-39A, Chandigarh - 160 036.. The deposition was made on 11 th November 2014. The accession number awarded for this vector is MTCC 5968.
- the present inventive subject matter in its main embodiment provides a mammalian expression vector comprising; three transcription cassettes, atleast two different antibiotic selection marker genes and atleast one matrix attachment region (MAR).
- This vector has a pUC origin. All these components are operably connected in expression vector to facilitate high level expression of polypeptides of interest and easy and cost effective selection of high producing host cell clones.
- first transcription cassette is comprised of; operably connected, PCMV promoter, multiple cloning site one (MCS I) for cloning of first polypeptide of interest and SV40 poly A tail sequence.
- the second transcription cassette is comprised of PCMV promoter, an amplifiable selectable marker gene and thymidine kinase (TK) poly A tail sequence.
- the third transcription cassette is comprised of operably connected pEFla promoter, MCS II for cloning of second polypeptide of interest and BGH polyA tail sequence.
- selectable markers are operably connected to EM7 promoter.
- MCS I and MCS II is used to clone same or two different polypeptides.
- MCS I and MCS II are used for cloning of light and heavy chains of an antibody. If MCS I is used for cloning of light chain of an antibody then MCS II is used for cloning of heavy chain of that antibody and vice- versa.
- amplifiable selectable marker gene is the dihydrofolate reductase (DHFR) gene and antibiotic resistance markers are zeomycin and puromycin.
- DHFR dihydrofolate reductase
- antibiotic resistance markers are zeomycin and puromycin.
- the presence of these three marker genes facilitates the easy and cost effective selection of high producer clones of host cells.
- Another embodiment of the present inventive subject matter provides a eukaryotic host cell for expression of protein of interest in a mammalian host cell.
- the mammalian host cell can be, but not limited to, a Chinese hamster ovary (CHO) cell, a mammalian stem cell, a human embryonic kidney (HEK) cell, a human B-cell or a myeloma cell, PER C6, Pichia cell lines and like.
- host cell is a CHO cell which is DHFR deficient and can be put under methotrexate treatment to select transfected high producing clones and
- MARs matrix attachment region
- MARs are usually AT-rich sequences of high unwinding propensity. These enforce a curved DNA structure. They are found to regulate transcription by controlling the chromatin state of DNA. They have been reported to stimulate expression of a transgene as well as reduce expression variability among cell clones.
- MAR sequence can be of human, xenopus, mouse or any other plant or animal origin.
- MAR sequence is a chicken lysozyme MAR sequence.
- MAR sequence was isolated from chicken using following forward and reverse primer:- Forward clMAR cloning primer having sequence ID: 8 (sequence being 36 mer) 5' ATTTCGTCGAGCTAGCAAACAATATATTTCCAAATG 3' and Reverse clMAR cloning primer sequence ID: 9 (sequence being 36 mer) 5' AACCTGTACAGTTATATTATGCTAGCTCGACGAGGG 3 ' .
- generated bigenic eukaryotic expression vector comprises a transcription cassette I further comprising multiple cloning site I (MCS I); a transcription cassette II comprising amplifiable marker gene; a transcription cassette III comprising multiple cloning site II (MCS II); at least two antibiotic resistance marker genes and at least one matrix attachment region (MAR); wherein all these components are operably connected to facilitate simultaneous high level expression of polypeptide (s) of interest in eukaryotic host cell.
- MCS I multiple cloning site I
- MAR matrix attachment region
- a vector could be used with various polypeptide of interest and plurality combination of protein can be produced in a host cell e.g. hormone, antibodies, single chain antibodies, truncated polypeptide, chimeric proteins, ribozymes, markers, abzymes and like.
- protein of interest may not fold in native state and could require further biochemical processing to generate active protein using processes well known in state of art.
- signal peptides which can be used in compatible host strain system, it has been noted in state of art that all said signal peptides eventually lead to secretion of respective proteins. Similarly any signal peptide or leader sequence should work with present inventive subject matter in their respective compatible host strain.
- signal peptide is further modified to support the desired secretion, subsequently such signal peptide is operably linked to protein of interest.
- more than one signal peptide hybrid of two signal peptide is used for enhanced secretion.
- signal peptide is chemically synthesized and operably ligated to vector.
- multiple ways are provided to increase expression of gene in host strain some of them are codon optimization, use of stronger promoter, increasing copy number of vector, using combination of one or more vector with same protein of interest sequence, favorable media and culture factors, reducing competition, providing growth regulators etc.
- expression quantity is further increased by using any of the above method e.g. increased copy number of the vector.
- it is favorable to use nucleotide sequence encoding the protein of interest with effective codon utilization.
- the degeneracy of the genetic code permits variations of the nucleotide sequence, while still producing a polypeptide having the identical amino acid sequence as the polypeptide encoded by the native DNA sequence.
- codon optimization provides one with a means of designing such an altered DNA sequence.
- the design of codon optimized genes should take into account a variety of factors, including the frequency of codon usage in an organism, nearest neighbor frequencies, RNA stability, the potential for secondary structure formation, the route of synthesis and the intended future DNA manipulations of that gene.
- the preferred codon usage frequencies for a mutated enzyme should reflect the codon usages of host strain or organism that is intended to be used for recombinant protein expression.
- protein characteristics are defined by host cell production machinery, purification process, stability, enzymes present in cell etc. for example proteins produced in some cell may lack proper folding, glycosylation structure/profile or monomeric or multimeric nature etc.
- polypeptide produced by present inventive subject matter will eventually have characteristic glycosylation profile provided by host cell transfected with vector, therefore polypeptide molecules produced by host cell will be unique an novel in some biochemical aspect. Further in an aspect present inventive subject matter provides products having characteristic profile. In yet another aspect of present inventive subject matter kits can be made for host cell transfection containing vector. In such methods vector can or cannot have polypeptide of interest.
- Host strains transformed with vector in accordance with present inventive subject matter were screened and analyzed for identify and quantity by methods well known to person skilled in the art.
- qualitative and quantitative evaluation is performed by way of gel electrophoresis, chromatography, mass spectrophotometry, blotting and immunoassays. Methods and protocols are followed as per monographic specification of the respective instruments.
- mono-cistronic vector can yield higher product quantity in contrast to multimeric proteins (e.g. antibody IgG a dimer of heavy & light chain (H 2 L 2 ) which contains four polypeptide chains).
- multimeric proteins e.g. antibody IgG a dimer of heavy & light chain (H 2 L 2 ) which contains four polypeptide chains.
- production quantity of biologically active protein is measured by ELISA.
- Antibody being tetramer requires more stringent folding procedure and therefore production yields can be comparative lower than single polypeptide protein. Therefore theoretically it can be indirectly inferred that bicistronic expression can be compared with monocistronic expression by assuming bicistronic expression is multiple of monomeric units of molecule. For example antibody expression can be compared with monomeric expression by factor of four.
- the bigenic expression vector pBG-SV II was constructed using well established molecular biology techniques.
- the first fragment containing CMV promoter with MCS I and zeocin resistance gene along the EM7 promoter was amplified by polymerase chain reaction (PCR) from earlier vector pBG-1 along with Pvu I and Nhe I restriction enzyme sites.
- the second fragment containing EFl-a promoter with MCS II and origin of replication was amplified by polymerase chain Reaction (PCR) from earlier vector pBG-2 with Nhe I and Pvu I restriction enzyme sites.
- the matrix attachment region was amplified by PCR from Gallus gallus genomic DNA with primers [sequence ID: 8] and [sequence ID: 9] for incorporation of Nhe I restriction site at both the ends of the amplified region.
- the ligation reactions were set up for operably joining the three fragments together using T4 DNA ligase, and the ligation reaction were transformed into chemical competent of E. coli. The colonies were screened for the correct orientation of the desired fragments in the vector by specific sets of primers.
- the fragment containing puromycin resistance gene along the EM7 promoter, CMV promoter and DHFR was synthetically constructed and the fragment was cloned at the Pvu I site and the clones obtained were screened by PCR for the correct orientation of the cloned fragment.
- Schematic representation of construction of expression vector pBG-SV II is shown in figure 4.
- the bigenic expression vector pBG-SV II was thus obtained by series of PCR amplification, ligation and transformation reactions and was characterized by screening PCR and restriction enzyme digestion analysis.
- CHO cells were cultured in protein free, animal component free media [Life Technologies] in a suspension mode at 37° C in presence of 8% CO2.
- a purified pBG-MESV plasmid previously disclosed in Indian patent application 991/MUM/2012 containing erythropoietin gene [sequence ID: 10] was transfected in these cultured cells with appropriate ratio of DNA and lipid based transfection reagent (Chesnoy and Huang 2000, Hirko, Tang et al. 2003, Liu, Ren et al. 2003) 1 .
- the transfection methods used are well known in state of the art and some of them are explained in Green, M. R. and J. Sambrook (2012).
- Erythropoietin gene amplification is achieved by culturing transfected mini pool in the media containing methotrexate (MTX).
- MTX methotrexate
- One of the clone exhibited elevated EPO production with increasing concentrations of MTX, demonstrating successful gene amplification.
- Growing selected clones under gradual increase of MTX pressure resulted in amplified gene copy number. Gradual increase in the product titer was observed at various rounds of gene
- Expressed erythropoietin and standard were electrophoresed on 4-12% gradient sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) for 1 hour under a constant voltage of 150 V. Following electrophoreses, the gel was stained for 30 minutes with Silver stain resulting gel is shown as Figure 7. Electrophoretic separation profile on gel shows reference standard Eprex (marketed erythropoietin) has same profile for expressed erythropoietin. To further evaluate isoforms and their respective identity isoelectric focusing (IEF) is performed as described in manufacturer protocol in a polyacrylamide gel containing 5 M urea.
- IEF identity isoelectric focusing
- EXAMPLE-4 Expression of two polypeptides by pBG-SV II in Chinese hamster ovary (CHO) cells
- CHO cells were cultured in protein free, animal component free media in a suspension mode at 37 °C in presence of 8% CO2.
- a purified pBG-SV II plasmid containing c2b8 antibody, light [sequence ID: 11] and heavy chain sequences [sequence ID: 12] was transfected in these cultured cells with appropriate ratio of DNA and lipid based transfection reagent as example 2.
- the transfection method used are well known in state of the art and some of them are explained in Green, M. R. and J. Sambrook (2012). Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press New York, incorporated herein by reference only. Positive transfectants were selected by growing this transfected mini pool under chosen high concentration of puromycin/zeomycin and methotrexate (MTX). This pool is further taken for target gene amplification.
- MTX methotrexate
- Monoclonal antibody Rituxan (c2b8) gene amplification is achieved by culturing transfected mini pool in the media containing methotrexate (MTX). Growing these cells under gradual increase of MTX pressure, resulted in amplified gene copy number. Gradual increase in the product titer was observed at various rounds of gene amplification. Selected clones were further tested for cell line stability and mother bank and working bank storage by standard methods. Table 2 shows the gradual increase in product titer of antibody in trial batch. The purified protein was analyzed by isoelectric focusing, ELISA to determine product identity. No significant differences were observed in the expressed protein and reference protein. High producers were taken for cell line stability studies. Significant increase in production of antibody yield was found even in non-optimized trial batches transfected clones were expressing in range of 24-50 pg/cell/day.
- MTX methotrexate
- Transfected and further sequentially amplified CHO cell is cultivated via Fed-Batch method in a 5L bioreactor (Bioreactor make Celligen).
- a serum free cell culture medium is used consisting of an enriched amino acid supplemented Forti OptiCHO and ProCHO media in 80:20 ratio enriched with 6mM glutamine.
- For seed inoculation cell count being approximately 5xl0 5 cells/mL.
- Oxygen is set to 50% air saturation with temperature at around 37°C + 0.5°C and pH of media is set to 7.0 + 0.2.
- Other supplement nutrient cell boost and feed hydrolsate are added after 3-4 days to maintain cell viability at required state.
- Over the course of the cultivation the glucose concentration in bioreactor is kept between 3 to 5 g/L. After 2.5 days the reactor is filled to 5 L with fresh medium.
Landscapes
- Genetics & Genomics (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention provides a bi-cistronic bigenic mammalian expression vector. This mammalian expression vector is comprised of three transcription cassettes, transcription cassette one for expression of first polypeptide of interest, transcription cassette two for expression of DHFR gene and transcription cassette three for expression of second polypeptide of interest. The present vector also have atleast two different antibiotic selection marker genes and atleast one matrix attachment region (MAR). The expression vector facilitates high level expression of polypeptides of interest and easy and cost effective selection of high producing host cell clones.
Description
A BIGENIC MAMMALIAN EXPRESSION VECTOR
FIELD OF THE INVENTION
The inventive subject matter is related to the vector for high level expression of recombinant proteins in eukaryotic host. Specifically it is related to the mammalian expression vector facilitating high level expression of plurality of polypeptides together in a mammalian host.
BACKGROUND
The share of biopharmaceuticals in total market of pharmaceuticals is growing rapidly. The increasing demand of biopharmaceuticals is primarily due to their highly specific target of action and resulting significantly reduced toxicity and side effects as compared to small molecule based drugs. In spite of above advantages biopharmaceuticals are not readily accessible to the larger population of world because of very high price associated with them. The high price of biopharmaceutical drugs are because of very high manufacturing cost associated with them. One of the major reasons for high manufacturing cost is low level expression of these biopharmaceuticals in eukaryotic hosts. Although high level expression of these biopharmaceuticals can be obtained in prokaryotic host but there are many limitation of expression in prokaryotic hosts. Moreover some of the biopharmaceuticals cannot be expressed in prokaryotic hosts. Another limitation in production of biopharmaceuticals in prokaryotic hosts is increased cost of downstream processing and low yield of properly folded proteins. Mammalian expression advantages involves proper folding of proteins, correct post-translational modification etc. disadvantages being stringency of process, comparatively low yields and high cost of production. Therefore there is an urgent need to increase the expression of biopharmaceuticals in suitable mammalian host to decrease the cost.
Mammalian host systems are highly advantageous for production of therapeutic biopharmaceuticals and further it is very important to address the issue of high cost of production associated with them. Considerable efforts have been made to reduce the cost of manufacturing of biopharmaceuticals in mammalian hosts. Most of the efforts to reduce the cost has targeted to enhance the production of therapeutic biopharmaceuticals in various arts are by optimizing the factors which control the expression of product. The factors controlling expression level in mammalian hosts are external, e.g. culture conditions, as well as internal e.g. factors regulating efficiency and quality of transcription. It has been reported that
improvement in external factors can enhance the expression and final yield to a limited extent only and these are considered to be commercially insignificant unless internal factors have been optimized to get an ideal level of expression.
A vast number of arts are available that address the internal factors such as regulatory elements for improving the expression of therapeutic biopharmaceuticals in mammalian host cells. The regulatory elements mentioned here are gene sequences which regulate gene expression. A number of arts disclose positioning of these regulatory elements in expression vectors, flanking 5' and 3' of the gene of interest. Most frequently reported regulatory elements in arts are TATA boxes, promoters, enhancers, translation start and stop codons, polyadenylation sites etc. Some arts disclose inclusion of some additional regulatory sequences like introns of some eukaryotic genes, internal ribosome entry sites (IRES), matrix/scaffold attachment regions (MAR/SAR), certain viral genes, etc. The presence of one or more of these additional sequences in expression vectors is found to be enhancing the expression of gene of interest in mammalian host cell but operable arrangement is required to achieve enhanced results.
The choice of regulatory elements and their positioning in a vector is very important. Strategic use and positioning of strong or weak promoters, enhancers, initiation and stop codons, polyadenylation sequences, IRES, SAR/MAR or other regulatory elements in an expression vector design, to enhance the expression level of gene in mammalian host, is a crucial factor. Another very important factor in vector design is the choice of marker genes in expression vector and control of their degree of expression in host cell.
Various publications disclose a number of mammalian expression vector designs containing different combinations and strategic positioning of regulatory elements. Some of publications disclose monocistronic design of mammalian expression vectors while some others disclose bicistronic or polycistronic designs. Monocistronic designs of mammalian expression vectors are most prevalent in arts. Monocistronic mammalian expression vectors have been reported to have limitations in expression of proteins having multiple polypeptide chains. To overcome this limitation some arts have disclosed the strategy of co-transfecting a mammalian host cell with two or more vectors, each containing gene for single polypeptide of multimeric protein. It has been reported that yield obtained through this strategy is not satisfactory.
A number of arts disclose bicistronic or polycistronic design of mammalian expression vectors to overcome the limitations associated with monocistronic expression vectors. Patent application no. US 12/226,938 discloses a mammalian bicistronic expression vector pABME 15 for high level expression of recombinant proteins in mammalian host cell. This vector utilizes endogenous viral sequences along with other regulatory elements to enhance expression of genes of interest in mammalian host cell. This application claims production of upto 30pg/cell/day of an antibody by use of this expression vector.
The patent application no. US 13/812,488 discloses a mammalian expression vector design for expression of recombinant antibodies. This vector comprises of two transcription units. The first transcription unit comprises sequentially a promoter, a monoclonal antibody (MAb) light chain sequence, internal multi-polyadenylation sites, IRES sequence, selection marker gene and a single polyadenylation site. The second transcription unit sequentially comprises, a promoter, a MAb heavy chain and a single or multi polyadenylation site. Positioning of IRES sequence in this vector is downstream of the internal multi-polyadenylation sites, operably connecting internal multi-polyadenylation site with gene coding selection marker. This patent application does not disclose level of expression achieved through this vector.
The US patent US7,935,808 discloses an eukaryotic polycistronic expression vector for expression of recombinant proteins, specifically the monoclonal antibodies. This vector uses Adeno promoter and SV40 poly A sequence, flanking 5' and 3' of the gene of interest respectively. This also uses gastrin terminator sequence. For the expression of selectable marker, DHFR, this vector uses SV40 promoter and TK Poly A sequence. This patent also discloses the use of atleast one recombinant expression vector element (rEVE) to enhance the expression of recombinant proteins. The rEVE sequence comprises one or more matrix attachment regions (MARs) sequences, clustered at the 5' and/or 3' terminal regions of rEVE sequence. This patent reports upto 18 fold increase in expression level over the control by use of rEVE sequence.
Patent application number US 13/482,117 discloses a mammalian expression vector comprising; one or more expression cassettes for expressing polypeptide of interest (POI), an expression cassette for expressing mammalian selectable marker(MSM) gene and an expression cassette for mammalian amplifiable selectable marker (MASM) gene. The expression cassete POI is flanked at 5' by the expression cassette MASM and at 3' by the expression cassette MSM. The expression cassette POI comprise a CMV promoter/enhancer
sequence while expression cassette MSM and MASM have SV40 promoter or promoter/enhancer sequence.
PCT publication number WO2010/072676 discloses a mammalian expression vector claiming a novel combination of regulatory elements and one or more selection marker gene. The new combination of selection marker gene disclosed here comprises of; SV40 enhancer and early promoter region, Human β-globin (Hbb) gene intron II and SV40 and synthetic poly A sequence. This vector provides facility to express two or more polypeptides of interest simultaneously.
Various basic methods of molecular biology can be used in cloning, manipulating genetic materials are mentioned in J. Sambrook, E.F. Fritsch, T. Maniatis. Molecular Cloning, A Laboratory Manual, 3rd edition, CSHL Press, 2001, 2003 and 2012. This and all other reference patents and application manuals are incorporated herein by reference in their entirely. Furthermore, where a definition or use of a term in a reference, which is incorporated by reference herein is inconsistent or contrary to the definition of that term provided herein, the definition of that term provided herein applies and the definition of that term in the reference does not apply.
Various arts have disclosed different strategic combinations and positioning of regulatory elements and marker genes in mammalian expression vectors to get high level expression of polypetides of interest. There is still a need for expression vector which can facilitate commercially significant level of expression of polypeptides of interest.
OBJECT OF THE INVENTION
The main object of the inventive subject matter is to provide a expression vector having a novel operably linked combinations of regulatory elements to facilitate simultaneous high level expression of more than one polypeptides of interest. Another object of present inventive subject matter is to provide dual mode of selection for high producing transfected clones, by using selectable marker dihydrofolate reductase (DHFR) and two different class of antibiotic resistance marker genes such as glycopeptide antibiotic and aminonucleoside antibiotic. A further object of the inventive subject matter is to decrease the cost involved in production and achieve higher yield of final product. SUMMARY OF THE INVENTION
The present inventive subject matter provides a bigenic mammalian expression vector pBG- SV II of 10086 base pairs, represented by the nucleotides of sequence ID: 1. The vector facilitates the simultaneous expression of plurality of polypeptides of interest in a host cell. It also facilitates the rapid, effective and more stringent screening of high producing clones. In one of the aspect of inventive subject matter this vector is particularly useful for production of biopharmaceuticals, such as monoclonal antibodies (MAbs), having more than one polypeptide chains. In one of the embodiment vector enhanced level of expression of biopharmaceutical is achieved along with easing of the selection and isolation of high producing host strains. The present inventive subject matter in its main embodiment provides a mammalian expression vector comprising three transcriptional cassettes, atleast two different antibiotic selection marker genes (i.e. glycopeptide antibiotic and/or aminonucleoside antibiotic) and atleast one matrix attachment region (MAR). All these components are operably connected in expression vector to facilitate high level expression of polypeptides of interest and easy selection of highly producing host cell clones.
In one embodiment of the inventive subject matter, the first transcription cassette (transcription cassette I) is comprised of, operably connected, PCMV promoter, multiple cloning site one (MCS I) for cloning of first polypeptide of interest and SV40 poly A tail sequence. The second transcription cassette (transcription cassette II) is comprised of, operably connected, PCMV promoter, an amplifiable selectable marker gene and thymidine kinase (TK) poly A tail sequence. The third transcription cassette (transcription cassette III) is comprised of, operably connected, pEFla promoter, MCS II for cloning of second polypeptide of interest and BGH polyA tail sequence.
In a further embodiment of the inventive subject matter MCS I and MCS II is used to clone nucleotide sequence of same or two different polypeptides. In a preferred embodiment MCS I and MCS II is used for cloning nucleotide sequence of light and heavy chains of an antibody. If MCS I is used for cloning nucleotide sequence of light chain of an antibody then MCS II is used for cloning of heavy chain of that antibody and vice- versa.
In another embodiment of the present inventive subject matter amplifiable selectable marker gene is the dihydrofolate reductase (DHFR) gene and antibiotic resistance markers genes such as glycopeptide antibiotic and aminonucleoside antibiotic genes, in some of the embodiment preferred antibiotic genes are zeomycin and puromycin. The presence of these
three marker genes facilitates the easy and cost effective selection of high producer clones of host cells.
Another embodiment of the present inventive subject matter provides a eukaryotic host cell for expression of protein of interest through vector. In yet another embodiment eukaryotic host cell is a mammalian host cell selected from the group of cells including but not limited to, a Chinese hamster ovary (CHO) cell, a mammalian stem cell, a human embryonic kidney (HEK) cell, a human B-cell or a myeloma cell, PER C6, Pichia cell lines and like. In a preferred embodiment host cell is a CHO cell, which is DHFR deficient and can be put under methotrexate treatment to select transfected high producing clones and amplify the copy number of recombinant genes.
In further another embodiment inventive subject matter discloses the presence of matrix attachment region (MAR) sequence in present vector. MARs are usually AT-rich sequences of high unwinding propensity. These enforce a curved DNA structure. They are found to regulate transcription by controlling the chromatin state of DNA. They have been reported to stimulate expression of a transgene as well as reduce expression variability among cell clones. In particular embodiment of the inventive subject matter MAR sequence can be of human, xenopus, mouse or any other plant or animal origin. In a one of the embodiment MAR sequence is a chicken lysozyme MAR sequence.
In yet another aspect inventive subject matter provides Process of transfection of vector, method of producing polypeptide using inventive vector comprising glycopeptide antibiotic and aminonucleoside antibiotic genes and kits containing bigenic vector.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1 shows the schematic representation of the vector pBG I.
Figure 2 shows the schematic representation of the vector pBG II. Figure 3 shows the schematic representation of the expression vector pBG-SVII without sequence for polypeptide of interest at MCS. This figure shows one of the embodiment wherein components of expression vector are operably connected with each other.
Figure 4 depicts the schematic representation of construction of expression vector pBG-SV II. This figure shows the origin of different components of expression vector pBG-SV II.
Figure 5 shows a graphical representation of Erythropoietin yields in fed batch fermentor production.
Figure 6 shows a graphical representation of Anti-CD20 Monoclonal antibody yields in fed batch fermentor production using pBG-SVII.
Figure 7 shows gel image of electrophoretic separation profile on Erythropoietin Lane 1 shows Molecular marker, Lane 2 shows expressed Erythropoietin samplel, Lane 3 shows expressed Erythropoietin sample 2 and Lane 4 shows reference standard used for Erythropoietin (i.e. Eprex).
Figure 8 shows gel image of iso-electric-focusing electrophoresis pattern during purification pools for Erythropoietin, final purification pool is in lane 5. Gel image contains Lane 1 shows reference standard used for Erythropoietin (Epofer); Lane 2 Purification pool 1 ; Lane 3 Purification pool 2; Lane 4 Purification pool 3; Lane 5 Purification pool 4.
Figure 9 shows Silver staining of pBG-SVII produced antibody, single cell clones (on Reducing Gel) Lane 1 shows molecular marker; Lane 2 to 9 shows different clones; Lane 10 shows standard Anti-CD-20 antibody.
Figure 10 shows HPLC Chromatogram profile of pBG-SVII produced antibody with the Standard Anti-CD-20 antibody.
DETAILED DESCRIPTION
The present inventive subject matter provides a bigenic mammalian expression vector pBG- SVII of 10086 base pairs, represented by the nucleotides of sequence ID: 1. The expression vector pBG-SVII design has a novel combination of regulatory elements and selection markers to facilitate simultaneous high level expression of plurality of polypeptides of interest. The present vector design also facilitates the rapid, easy and cost effective selection of high producing clones of host cells. This vector is particularly beneficial for production of various monoclonal antibodies.
In describing and claiming the present inventive subject matter, terminology used should have meaning as set forth in definitions herein. Unless and otherwise defined herein scientific
and technical terms used in invention shall have the meaning that are commonly understood by those having ordinary skill in the art.
The term 'expression vector' used herein means a plasmid vector designed to introduce specific genes in host cell and command the cell's machinery for protein synthesis to produce the proteins encoded by these specific genes. An expression vector construct include regulatory elements e.g promoters, enhancers, transcription termination signals, MARs, IRES, etc and at- least one multiple cloning site (MCS) for cloning of gene of interest.
The term 'regulatory element' used herein means characteristics of a segment of DNA which regulates the gene expression by increasing or decreasing the expression of specific gene. Most frequently used regulatory elements are TATA boxes, promoters, enhancers, translation start and stop codons, polyadenylation sites, introns, IRES, SAR/MAR, viral genes, etc.
The term 'promoter' used herein means a nucleotide sequence which is capable of binding RNA polymerase and initiate transcription of a adjacent coding sequence.
The term 'PCMV promoter' used herein means a promoter derived from human cytomegalovirus or human cytomegalovirus immediate early promoter.
The term 'PEF-la promoter' used herein means a promoter derived from human elongation factor one alfa promoter. This promoter is a strong constitutive promoter that is used to drive ectopic gene expression.
The term ΈΜ7 promoter' used herein means a prokaryotic constitutively active promoter. The term "transcription cassette" used herein means a stretch of nucleotide sequences comprising a promoter, a multiple cloning site with or without a cloned gene sequences and a polyadenylation sequence.
The term "polypeptide of interest", "protein of interest" used herein means a nucleotide sequence incorporated in expression vector for expression of corresponding amino acid sequence.
The term "multiple cloning site (MCS)" used herein means a short segment of DNA containing multiple restriction sites for strategic cloning of one or more pieces of DNA.
The term "selectable marker" used here in means a marker that will have function to protect the cell from a selective agent that would otherwise kill the cell or prevent its growth.
Selectable markers are selected from group comprising but not limited to compounds having property of glycopeptide antibiotic and aminonucleoside antibiotic and their functional variants thereof, like zeocin, zeomycin, puromycin,.
The term "amplifiable selectable marker" used herein means a marker which can be used as a selectable marker as well as for gene amplification. The amplifiable selectable marker used herein is dihydrofolate reductase (DHFR). DHFR catalyzes the conversion of folate to tetrahydrofolate, which is required for the biosynthesis of glycine from serine and for the biosynthesis of purines. DHFR deficient cells require the addition of thymidine, glycine and hypoxanthine to the medium to grow. This property is utilized for selection of transfected cells having active DHFR genes.
Methotrexate (MTX), a folate analog, binds and inhibits DHFR and in result causes death of cells. When cells are selected for growth in sequentially increasing concentration of MTX, the surviving population contains increased level of DHFR, resulting from an amplication of DHFR gene. High MTX resistant cells have several thousand copies of DHFR gene expressing several thousand fold elevated level of DHFR. When DHFR gene is used in an expression vector as selectable marker along with a gene of interest then it helps in selection of high expressing cells, as high DHFR copies in cell also indicates the high copies of gene of interest in cells.
The term "matrix attachment regions" (MARs) also referred as 'cIMAR' are used here in means an A-T rich sequence of DNA of eukaryotic chromosome, where nuclear matrix attach. It is reported to organize the genome of eukaryotes in functional units within the cell nucleus. MARs have been associated with some enhancer sequences and linked to a number of processes e.g. transcription, transgene expression, transgene rearrangement, recombination, replication and stabilization of transfection. The term "operably connected" used herein means that different DNA sequences are juxtaposed in a manner that different components are in a relationship, permitting them to function in their intended manner.
The term "bigenic expression vector" used herein means an expression vector which has facility for simultaneous expression of atleast two polypeptides of interest in a mammalian host.
Vector deposition
The vector pBG-SVII is deposited for patent purposes under Budapest Treaty at Microbial Type Culture Collection and Gene Bank (MTCC), International Depositary Authority (IDA), Institute of Microbial Technology (IMTECH), Council of Scientific and Industrial Research (CSIR), Sector-39A, Chandigarh - 160 036.. The deposition was made on 11th November 2014. The accession number awarded for this vector is MTCC 5968.
The present inventive subject matter in its main embodiment provides a mammalian expression vector comprising; three transcription cassettes, atleast two different antibiotic selection marker genes and atleast one matrix attachment region (MAR). This vector has a pUC origin. All these components are operably connected in expression vector to facilitate high level expression of polypeptides of interest and easy and cost effective selection of high producing host cell clones.
In another embodiment of the inventive subject matter, first transcription cassette (transcription cassette I) is comprised of; operably connected, PCMV promoter, multiple cloning site one (MCS I) for cloning of first polypeptide of interest and SV40 poly A tail sequence. The second transcription cassette (transcription cassette II) is comprised of PCMV promoter, an amplifiable selectable marker gene and thymidine kinase (TK) poly A tail sequence. The third transcription cassette (transcription cassette III) is comprised of operably connected pEFla promoter, MCS II for cloning of second polypeptide of interest and BGH polyA tail sequence. In yet other embodiment selectable markers are operably connected to EM7 promoter.
In the vector of present inventive subject matter MCS I and MCS II is used to clone same or two different polypeptides. In a preferred embodiment MCS I and MCS II are used for cloning of light and heavy chains of an antibody. If MCS I is used for cloning of light chain of an antibody then MCS II is used for cloning of heavy chain of that antibody and vice- versa.
In another embodiment of the present inventive subject matter amplifiable selectable marker gene is the dihydrofolate reductase (DHFR) gene and antibiotic resistance markers are zeomycin and puromycin. The presence of these three marker genes facilitates the easy and cost effective selection of high producer clones of host cells. Another embodiment of the present inventive subject matter provides a eukaryotic host cell for expression of protein of interest in a mammalian host cell. The mammalian host cell can
be, but not limited to, a Chinese hamster ovary (CHO) cell, a mammalian stem cell, a human embryonic kidney (HEK) cell, a human B-cell or a myeloma cell, PER C6, Pichia cell lines and like. In a preferred embodiment host cell is a CHO cell which is DHFR deficient and can be put under methotrexate treatment to select transfected high producing clones and amplify the copy number of recombinant genes.
One other embodiment of the inventive subject matter discloses the presence of matrix attachment region (MAR) sequence in present vector. MARs are usually AT-rich sequences of high unwinding propensity. These enforce a curved DNA structure. They are found to regulate transcription by controlling the chromatin state of DNA. They have been reported to stimulate expression of a transgene as well as reduce expression variability among cell clones. In particular embodiment MAR sequence can be of human, xenopus, mouse or any other plant or animal origin. In one of the embodiment MAR sequence is a chicken lysozyme MAR sequence. In one of the embodiment MAR sequence was isolated from chicken using following forward and reverse primer:- Forward clMAR cloning primer having sequence ID: 8 (sequence being 36 mer) 5' ATTTCGTCGAGCTAGCAAACAATATATTTCCAAATG 3' and Reverse clMAR cloning primer sequence ID: 9 (sequence being 36 mer) 5' AACCTGTACAGTTATATTATGCTAGCTCGACGAGGG 3 ' .
In one of the embodiment vector comprised CMV promoter sequence ID: 1 operably linked to MCS I sequence ID: 2; operably linked to EM7 Zeomycin ; operably linked to clMAR sequence ID: 3; operably linked to EFl-a promoter sequence ID: 4; operably linked to MCS II sequence ID: 5; operably linked to BGH polyA; operably linked to pUC origin; operably linked to EM7 promoter sequence ID: 6; operably linked to Puromycin ; operably linked to CMV promoter sequence ID: 7; operably linked to DHFR; operably linked to TK polyA.
In one of the embodiment generated bigenic eukaryotic expression vector comprises a transcription cassette I further comprising multiple cloning site I (MCS I); a transcription cassette II comprising amplifiable marker gene; a transcription cassette III comprising multiple cloning site II (MCS II); at least two antibiotic resistance marker genes and at least one matrix attachment region (MAR); wherein all these components are operably connected to facilitate simultaneous high level expression of polypeptide (s) of interest in eukaryotic host cell.
Skilled artisan will know that a vector could be used with various polypeptide of interest and plurality combination of protein can be produced in a host cell e.g. hormone, antibodies,
single chain antibodies, truncated polypeptide, chimeric proteins, ribozymes, markers, abzymes and like. Skilled artisan will also understand that protein of interest may not fold in native state and could require further biochemical processing to generate active protein using processes well known in state of art. There are very well-known signal peptides which can be used in compatible host strain system, it has been noted in state of art that all said signal peptides eventually lead to secretion of respective proteins. Similarly any signal peptide or leader sequence should work with present inventive subject matter in their respective compatible host strain.
In one of the embodiment of present inventive subject matter signal peptide is further modified to support the desired secretion, subsequently such signal peptide is operably linked to protein of interest. In one aspect of inventive subject matter more than one signal peptide, hybrid of two signal peptide is used for enhanced secretion. In one of the embodiment signal peptide is chemically synthesized and operably ligated to vector.
In state of art multiple ways are provided to increase expression of gene in host strain some of them are codon optimization, use of stronger promoter, increasing copy number of vector, using combination of one or more vector with same protein of interest sequence, favorable media and culture factors, reducing competition, providing growth regulators etc. In one of the embodiment expression quantity is further increased by using any of the above method e.g. increased copy number of the vector. In some of the embodiment inventors suggests that it is favorable to use nucleotide sequence encoding the protein of interest with effective codon utilization. The degeneracy of the genetic code permits variations of the nucleotide sequence, while still producing a polypeptide having the identical amino acid sequence as the polypeptide encoded by the native DNA sequence. The procedure known as codon optimization provides one with a means of designing such an altered DNA sequence. The design of codon optimized genes should take into account a variety of factors, including the frequency of codon usage in an organism, nearest neighbor frequencies, RNA stability, the potential for secondary structure formation, the route of synthesis and the intended future DNA manipulations of that gene. The preferred codon usage frequencies for a mutated enzyme should reflect the codon usages of host strain or organism that is intended to be used for recombinant protein expression.
In general protein characteristics are defined by host cell production machinery, purification process, stability, enzymes present in cell etc. for example proteins produced in some cell may lack proper folding, glycosylation structure/profile or monomeric or multimeric nature etc. However such proteins may have same corresponding amino acid sequence subject to post-translational processing and modifications. Thus polypeptide produced by present inventive subject matter will eventually have characteristic glycosylation profile provided by host cell transfected with vector, therefore polypeptide molecules produced by host cell will be unique an novel in some biochemical aspect. Further in an aspect present inventive subject matter provides products having characteristic profile. In yet another aspect of present inventive subject matter kits can be made for host cell transfection containing vector. In such methods vector can or cannot have polypeptide of interest.
Host strains transformed with vector in accordance with present inventive subject matter were screened and analyzed for identify and quantity by methods well known to person skilled in the art. In one of the embodiments qualitative and quantitative evaluation is performed by way of gel electrophoresis, chromatography, mass spectrophotometry, blotting and immunoassays. Methods and protocols are followed as per monographic specification of the respective instruments.
It is well understood in art that expression profile of mono-cistronic vector can yield higher product quantity in contrast to multimeric proteins (e.g. antibody IgG a dimer of heavy & light chain (H2L2) which contains four polypeptide chains). In general production quantity of biologically active protein is measured by ELISA. Antibody being tetramer requires more stringent folding procedure and therefore production yields can be comparative lower than single polypeptide protein. Therefore theoretically it can be indirectly inferred that bicistronic expression can be compared with monocistronic expression by assuming bicistronic expression is multiple of monomeric units of molecule. For example antibody expression can be compared with monomeric expression by factor of four.
Generally, in the following examples the methods suggested and described in the respective manuals were applied with used factors, methods, agents and media etc. mentioned incorporated herein by reference. Basic methods of molecular biology were applied as described in J. Sambrook, E.F. Fritsch, T. Maniatis. Molecular Cloning, A Laboratory Manual, 3rd edition, CSHL Press, 2001, 2003 and 2012 incorporated herein by reference.
The present inventive subject matter is further described below by means of examples. The following examples are given to illustrate the present invention but are not to be construed as limiting.
EXAMPLE-1
Construction of inventive Bigenic Vector
The bigenic expression vector pBG-SV II was constructed using well established molecular biology techniques. The first fragment containing CMV promoter with MCS I and zeocin resistance gene along the EM7 promoter was amplified by polymerase chain reaction (PCR) from earlier vector pBG-1 along with Pvu I and Nhe I restriction enzyme sites.
The second fragment containing EFl-a promoter with MCS II and origin of replication was amplified by polymerase chain Reaction (PCR) from earlier vector pBG-2 with Nhe I and Pvu I restriction enzyme sites.
The matrix attachment region (MAR) was amplified by PCR from Gallus gallus genomic DNA with primers [sequence ID: 8] and [sequence ID: 9] for incorporation of Nhe I restriction site at both the ends of the amplified region.
The ligation reactions were set up for operably joining the three fragments together using T4 DNA ligase, and the ligation reaction were transformed into chemical competent of E. coli. The colonies were screened for the correct orientation of the desired fragments in the vector by specific sets of primers.
The fragment containing puromycin resistance gene along the EM7 promoter, CMV promoter and DHFR was synthetically constructed and the fragment was cloned at the Pvu I site and the clones obtained were screened by PCR for the correct orientation of the cloned fragment. Schematic representation of construction of expression vector pBG-SV II is shown in figure 4.
The bigenic expression vector pBG-SV II was thus obtained by series of PCR amplification, ligation and transformation reactions and was characterized by screening PCR and restriction enzyme digestion analysis.
EXAMPLE-2
Expression of single erythropoietin gene in Chinese hamster ovary (CHO) cells
CHO cells were cultured in protein free, animal component free media [Life Technologies] in a suspension mode at 37° C in presence of 8% CO2. A purified pBG-MESV plasmid previously disclosed in Indian patent application 991/MUM/2012 containing erythropoietin gene [sequence ID: 10] was transfected in these cultured cells with appropriate ratio of DNA and lipid based transfection reagent (Chesnoy and Huang 2000, Hirko, Tang et al. 2003, Liu, Ren et al. 2003)1. The transfection methods used are well known in state of the art and some of them are explained in Green, M. R. and J. Sambrook (2012). Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press New York, incorporated herein by reference only. The transfection mixture was incubated for 10-20 minutes and was added drop wise to the culture. Approximately thirty colones were screened after transfection by growing them under chosen high concentration of puromycin/zeomycin and methotrexate (MTX) e.g. 500nM. Two of the highly expressing clones were identified by ELISA and subjected to further increasing methotrexate amplification. This selected clone is further taken for target gene amplification. EXAMPLE-3
Erythropoietin clone expression and evaluation.
Erythropoietin gene amplification is achieved by culturing transfected mini pool in the media containing methotrexate (MTX). One of the clone exhibited elevated EPO production with increasing concentrations of MTX, demonstrating successful gene amplification. Growing selected clones under gradual increase of MTX pressure, resulted in amplified gene copy number. Gradual increase in the product titer was observed at various rounds of gene
1 Chesnoy, S. and L. Huang (2000). "Structure and function of lipid-DNA complexes for gene delivery." Annual review of biophysics and biomolecular structure 29(1): 27-47.
Hirko, A., et al. (2003). "Cationic lipid vectors for plasmid DNA delivery." Current medicinal chemistry 10(14): 1185-1193.
Liu, D., et al. (2003). "Cationic transfection lipids." Current medicinal chemistry 10(14): 1307-1315.
amplification. A titer of 2 grams/liter was achieved after final round of gene amplification. Selected clones were further tested for cell line stability and mother bank and working bank storage by standard methods. Table 1 shows the production yields obtained on erythropoietin clone after fed-batch manufacturing. The purified protein was analyzed by Silver staining (Figure 7) and isoelectric focusing (Figure 8), to determine product identity along with isoform distribution. No significant differences were observed in the expressed protein and reference protein.
Table 1
Expressed erythropoietin and standard were electrophoresed on 4-12% gradient sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) for 1 hour under a constant voltage of 150 V. Following electrophoreses, the gel was stained for 30 minutes with Silver stain resulting gel is shown as Figure 7. Electrophoretic separation profile on gel shows reference standard Eprex (marketed erythropoietin) has same profile for expressed erythropoietin. To further evaluate isoforms and their respective identity isoelectric focusing (IEF) is performed as described in manufacturer protocol in a polyacrylamide gel containing 5 M urea. Approximately 10 pg of sample was electrophoresed on 2-5% isoelectric focusing (IEF) gel for each 1 hour under four constant voltage steps of 100 V, 200 V, 400 V and 550 V. Following the electrophoreses, the gel was stained for 30 minutes with stain, resulting gel is shown as Figure 8. Four purification pool samples were used to perform IEF and it was observed that reference standard has same isoform profile as expressed erythropoietin.
EXAMPLE-4
Expression of two polypeptides by pBG-SV II in Chinese hamster ovary (CHO) cells
CHO cells were cultured in protein free, animal component free media in a suspension mode at 37 °C in presence of 8% CO2. A purified pBG-SV II plasmid containing c2b8 antibody, light [sequence ID: 11] and heavy chain sequences [sequence ID: 12], was transfected in these cultured cells with appropriate ratio of DNA and lipid based transfection reagent as example 2. The transfection method used are well known in state of the art and some of them are explained in Green, M. R. and J. Sambrook (2012). Molecular cloning: a laboratory manual, Cold Spring Harbor Laboratory Press New York, incorporated herein by reference only. Positive transfectants were selected by growing this transfected mini pool under chosen high concentration of puromycin/zeomycin and methotrexate (MTX). This pool is further taken for target gene amplification.
EXAMPLE S
Monoclonal antibody gene amplification
Monoclonal antibody Rituxan (c2b8) gene amplification is achieved by culturing transfected mini pool in the media containing methotrexate (MTX). Growing these cells under gradual increase of MTX pressure, resulted in amplified gene copy number. Gradual increase in the product titer was observed at various rounds of gene amplification. Selected clones were further tested for cell line stability and mother bank and working bank storage by standard methods. Table 2 shows the gradual increase in product titer of antibody in trial batch. The purified protein was analyzed by isoelectric focusing, ELISA to determine product identity. No significant differences were observed in the expressed protein and reference protein. High producers were taken for cell line stability studies. Significant increase in production of antibody yield was found even in non-optimized trial batches transfected clones were expressing in range of 24-50 pg/cell/day.
Transfected and further sequentially amplified CHO cell is cultivated via Fed-Batch method in a 5L bioreactor (Bioreactor make Celligen). In bioreactor a serum free cell culture medium is used consisting of an enriched amino acid supplemented Forti OptiCHO and ProCHO media in 80:20 ratio enriched with 6mM glutamine. For seed inoculation cell count being approximately 5xl05 cells/mL. Oxygen is set to 50% air saturation with temperature at around 37°C + 0.5°C and pH of media is set to 7.0 + 0.2. Other supplement nutrient cell boost and feed hydrolsate are added after 3-4 days to maintain cell viability at required state.
Over the course of the cultivation the glucose concentration in bioreactor is kept between 3 to 5 g/L. After 2.5 days the reactor is filled to 5 L with fresh medium.
Table 2
Between days 7, 8, 9, 10 and 11 the batch is extended by adding an enriched nutrient medium concentrate containing supplements to maintain growth and production. On day 11-13 production broth containing antibody is harvested. Expressed antibody and standard were electrophoresed on 4-12% gradient sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE) for 1 hour under a constant voltage of 150 V. Following electrophoreses, the gel was stained for 30 minutes with Silver stain resulting gel is shown as Figure 9. Electrophoretic separation profile on gel shows reference standard Anti-CD 20 antibody has same profile for pBG-SVII expressed antibody. Expressed antibody was further analyzed in high-performance liquid chromatography and results are shown as Figure 10. Finally purified sample was analyzed using HPLC and it was observed that reference standard has same purification pattern as expressed antibody. A medium not containing any components of animal origin is found to yield a comparable final antibody concentration.
Claims
1. A bigenic eukaryotic expression vector comprising:
a) a transcription cassette I comprising multiple cloning site 1 (MCS I); b) a transcription cassette II comprising amplifiable marker gene;
c) a transcription cassette III comprising multiple cloning site 2 (MCS II);
d) at least two antibiotic resistance marker genes and
e) at least one matrix attachment region (MAR);
wherein all these components are operably connected to facilitate expression of polypeptide (s) of interest in eukaryotic host cell.
2. The eukaryotic expression vector as claimed in claim 1 wherein eukaryotic expression vector is comprised of polynucleotide sequence of sequence id- 1.
3. The eukaryotic expression vector as claimed in claim 1 wherein transcription cassette
I is comprised of operably connected, PCMV promoter, MCS-I for cloning of gene for polypeptide of interest, and SV40 poly A sequences.
4. The eukaryotic expression vector as claimed in claim 1 wherein transcription cassette
II is comprised of operably connected, a CMV promoter, an amplifiable selectable marker gene and thymidine kinase poly A sequence.
5. The eukaryotic expression vector as claimed in claim 4 wherein amplifiable selectable marker gene is dihydrofolate reductase (DHFR).
6. The eukaryotic expression vector as claimed in claim 1 wherein transcription cassette
III is comprised of operably connected human elongation factor one alfa (pEFla) promoter, MCS-II for cloning of gene for polypeptide of interest and BGH poly A sequences.
7. The eukaryotic expression vector as claimed in claim 1 wherein antibiotic resistance marker genes are glycopeptide antibiotic and aminonucleoside antibiotic.
8. The eukaryotic expression vector as claimed in claim 1 wherein matrix attachment region (MAR) sequences are of human, Xenopus, mouse, plant or animal origin.
9. The eukaryotic expression vector as claimed in claim 8 wherein matrix attachment region (MAR) sequences is chicken lysozyme MAR element as sequence ID: 3.
10. The eukaryotic expression vector as claimed in claim 7 wherein expression of antibiotic resistance marker genes are under the control of EM7 promoter.
11. The eukaryotic expression vector as claimed in claim 1 wherein eukaryotic host cell is selected from group comprising of mammalian stem cell, mammalian embryonic stem
cells, Chinese hamster ovary (CHO) cells, baby hamster kidney (BHK) cells or myeloma cells or like.
12. The eukaryotic expression vector as claimed in claim 11 wherein eukaryotic host cell is Chinese hamster ovary (CHO) cell.
13. The eukaryotic expression vector as claimed in claim 3 or 6 wherein polypeptide of interest provides single protein or subunit of a multimeric protein.
14. The eukaryotic expression vector as claimed in claim 3 or 6 wherein polypeptide of interest is a subunit of a multimeric protein.
15. The eukaryotic expression vector as claimed in claim 3 or 6 wherein polypeptide of interest is either light or heavy chain sequence of an antibody.
16. A host cell transfected with expression vector according to any one of the preceding claims.
17. A host cell transfected with expression vector as claimed in claim 14 or 15.
18. A protein produced by process comprising culturing host cell transfected with expression vector of claim 14.
19. A protein produced by process comprising culturing host cell transfected with expression vector of claim 15.
20. A protein produced according to claim 19 contains a primary structure of an antibody.
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
IN989MU2015 | 2015-03-25 | ||
IN989/MUM/2015 | 2015-03-25 |
Publications (1)
Publication Number | Publication Date |
---|---|
WO2016151599A1 true WO2016151599A1 (en) | 2016-09-29 |
Family
ID=55967349
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/IN2016/050089 WO2016151599A1 (en) | 2015-03-25 | 2016-03-19 | A bigenic mammalian expression vector |
Country Status (1)
Country | Link |
---|---|
WO (1) | WO2016151599A1 (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113862298A (en) * | 2020-06-30 | 2021-12-31 | 石药集团中奇制药技术(石家庄)有限公司 | Recombinant expression vector |
Citations (7)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2007130543A2 (en) * | 2006-05-04 | 2007-11-15 | Abmaxis Inc. | Method for producing stable mammalian cell lines producing high levels of recombinant proteins |
US20080085537A1 (en) * | 2004-11-08 | 2008-04-10 | Chromagenics B.V. | Selection of host cells expressing protein at high levels |
EP2141237A1 (en) * | 2008-07-03 | 2010-01-06 | Mogam Biotechnology Research Institute | Method for reducing the fucose content of recombinant proteins |
WO2010072676A1 (en) | 2008-12-22 | 2010-07-01 | Lek Pharmaceuticals D.D. | Mammalian expression vector |
US7935808B2 (en) | 2007-03-30 | 2011-05-03 | Abbott Laboratories | Recombinant expression vector elements (rEVEs) for enhancing expression of recombinant proteins in host cells |
US20120271040A1 (en) | 2007-12-21 | 2012-10-25 | Novartis Ag | Mammalian expression vector |
WO2013175491A2 (en) * | 2012-03-30 | 2013-11-28 | Biogenomics Limited | Stable expression system for eukaryotic cells |
-
2016
- 2016-03-19 WO PCT/IN2016/050089 patent/WO2016151599A1/en active Application Filing
Patent Citations (8)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US20080085537A1 (en) * | 2004-11-08 | 2008-04-10 | Chromagenics B.V. | Selection of host cells expressing protein at high levels |
WO2007130543A2 (en) * | 2006-05-04 | 2007-11-15 | Abmaxis Inc. | Method for producing stable mammalian cell lines producing high levels of recombinant proteins |
US20110171729A1 (en) | 2006-05-04 | 2011-07-14 | Ab Maxis Inc. | Method for Producing Stable Mammalian Cell Lines Producing High Levels of Recombinant Proteins |
US7935808B2 (en) | 2007-03-30 | 2011-05-03 | Abbott Laboratories | Recombinant expression vector elements (rEVEs) for enhancing expression of recombinant proteins in host cells |
US20120271040A1 (en) | 2007-12-21 | 2012-10-25 | Novartis Ag | Mammalian expression vector |
EP2141237A1 (en) * | 2008-07-03 | 2010-01-06 | Mogam Biotechnology Research Institute | Method for reducing the fucose content of recombinant proteins |
WO2010072676A1 (en) | 2008-12-22 | 2010-07-01 | Lek Pharmaceuticals D.D. | Mammalian expression vector |
WO2013175491A2 (en) * | 2012-03-30 | 2013-11-28 | Biogenomics Limited | Stable expression system for eukaryotic cells |
Non-Patent Citations (5)
Title |
---|
CHESNOY, S.; L. HUANG: "Structure and function of lipid-DNA complexes for gene delivery", ANNUAL REVIEW OF BIOPHYSICS AND BIOMOLECULAR STRUCTURE, vol. 29, no. 1, 2000, pages 27 - 47, XP002664604 |
GREEN, M. R.; J. SAMBROOK: "Molecular cloning: a laboratory manual", 2012, COLD SPRING HARBOR LABORATORY PRESS |
HIRKO, A. ET AL.: "Cationic lipid vectors for plasmid DNA delivery", CURRENT MEDICINAL CHEMISTRY, vol. 10, no. 14, 2003, pages 1185 - 1193 |
J. SAMBROOK; E.F. FRITSCH; T. MANIATIS: "Molecular Cloning, A Laboratory Manual", 2001, CSHL PRESS |
LIU, D. ET AL.: "Cationic transfection lipids", CURRENT MEDICINAL CHEMISTRY, vol. 10, no. 14, 2003, pages 1307 - 1315 |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN113862298A (en) * | 2020-06-30 | 2021-12-31 | 石药集团中奇制药技术(石家庄)有限公司 | Recombinant expression vector |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
USRE49347E1 (en) | Mammalian expression vector | |
US8975391B2 (en) | Regulatory elements | |
US8957196B2 (en) | Vector and expression cell line for mass production of recombinant protein and a process of producing recombinant protein using same | |
EP2898077B1 (en) | Expression vectors comprising chimeric cytomegalovirus promoter and enhancer sequences | |
EP3088527B1 (en) | Expression vector having improved ability to express gene | |
US9260721B2 (en) | Expression vector and methods of producing high levels of proteins | |
EP3277818B1 (en) | Use of vitamins and vitamin metabolic genes and proteins for recombinant protein production in mammalian cells | |
WO2016151599A1 (en) | A bigenic mammalian expression vector | |
EP2938726B1 (en) | Heterologous intron within a signal peptide | |
US20120129770A1 (en) | Novel polynucleotide molecules for enhanced gene expression |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16722395 Country of ref document: EP Kind code of ref document: A1 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
122 | Ep: pct application non-entry in european phase |
Ref document number: 16722395 Country of ref document: EP Kind code of ref document: A1 |