WO2016146455A1 - Method for the treatment or prevention of eating disorders, overweight or obesity - Google Patents

Abstract

The invention relates to the fields of molecular biology and medicine, more specifically the invention is directed towards the treatment, delay, prevention or diagnosing of eating disorders, overweight, obesity or metabolic syndrome. More in particular, the invention provides a method for treating delaying or preventing an eating disorder wherein microRNA 216a or the complement thereof is administered to a subject in need of such a treatment.

Description

METHOD FOR THE TREATMENT OR PREVENTION OF EATING DISORDERS,

OVERWEIGHT OR OBESITY.

Field of the invention

The invention relates to the fields of molecular biology and medicine, more specifically the invention is directed towards the treatment, delay, prevention or diagnosing of eating disorders, overweight, obesity or metabolic syndrome.

Background of the invention

To achieve optimum health, the median body mass index for an adult population should be in the range of 21 to 23 kg/m2, while the goal for individuals should be to maintain body mass index in the range 18.5 to 24.9 kg/m2. Worldwide, at least 2.8 million people die each year as a result of being overweight or obese, and an estimated 35.8 million (2.3%) of global disability-adjusted life years are caused by overweight or obesity.

The characteristic of obesity is an increased food intake and the expansion of adipose tissue through hyperphaghia and hypertrophy of adipocytes.

Overweight and obesity are multi-organ disorders, which not only lead to an expansion of the adipose tissue but also lead to adverse systemic metabolic effects, such as a high blood pressure, hyperlipidemia (e.g. high cholesterol levels), increased circulating triglycerides and insulin resistance. Furthermore, an increased BMI, a measure of weight relative to height, is associated with increased risks of coronary heart disease, ischemic stroke and type 2 diabetes mellitus (Robert H. Eckel, Obesity and heart disease.

Circulation 1997). Raised BMI also increases the risk of cancer of the breast, colon, prostate, endometrium, kidney and gall bladder. Therefore mortality rates increase with increasing degrees of overweight, as measured by body mass index (Wolin KY et al., Obeisty and Cancer, Oncologist 2010; Wang et al., Health and economic burden of the projected obesity trends in the USA and the UK. Lancet 201 1 ).

Obesity is growing progressively among older age groups but even in younger patients obesity induces signs of premature cardiac aging, characterized by telomere shortening, disturbed mitochondrial function, activation of pro-apoptotic pathways and increased levels of the fetal genes atrial natriuretic peptide (ANP) and brain natriuretic peptide (BNP), which are associated with heart disease (Niemann B et al., Obesity induces signs of premature cardiac aging in younger patients: the role of mitochondria. J Am Coll Cardiol. 201 1 ).

An increase in BMI is associated with cardiovascular diseases, which is a broad term used to describe a range of diseases that affect the heart and/or blood vessels. The conditions include coronary artery disease, heart attack, high blood pressure, stroke and heart failure. A common form of cardiovascular disease is coronary artery disease (CAD), which affects the arteries that supply the heart muscle with blood. CAD is the leading cause of heart attacks.

Furthermore, an increase in BMI, associated with high blood pressure also causes other types of cardiovascular disease, such as stroke and heart failure.

Current treatment of overweight, obesity, hypertension, hyperlipidemia, insulin resistance and cardiovascular diseases focuses on treating the symptoms and signs and preventing the progression of the disease.

Overweight, adiposity and obesity are serious disorders that lead to a reduced life expectancy. Overweight and obesity can be controlled with medication, lifestyle change, and correction of any underlying disorder. However, obesity is usually a chronic illness, and it may worsen with other physical stressors. There is no real cure for this multi-organ disease at the moment.

Current treatment includes exercise, eating healthy foods, reduction in salty foods, and abstinence from smoking and drinking alcohol. Further, pharmacological management can be applied focused on relieving symptoms, maintaining a euvolemic state, and delaying progression of heart failure type 2 diabetes. FDA-approved drugs used include: Orlistat, Lorcaserin Hydrochloride, diet supplements such as diuretic agents, vasodilator agents, positive inotropes, ACE inhibitors, beta blockers, and aldosterone antagonists. Next to drugs, also surgery might be an option to reduce the overweight.

Recently, new drugs have been designed to augment weight loss and primarily function directly or indirectly as appetite suppressants to improve adherence to caloric restriction regimens. Serious side effects, however, have been associated with the use of all these drugs. PPARgamma agonists, such as rosiglitazone and pioglitazone, are currently the only drugs routinely prescribed to the overweight and obese patient population that have direct effects on adipose tissue metabolism. Both drugs promote adipose redistribution from visceral to subcutaneous adipose tissue depots, but also have undesirable side effects, including generalized weight gain and/or edema. Regulation of adipogenesis at the cellular level, however, for example, by inducing or repressing differentiation of preadipocytes to adipocytes, would provide a significantly enhanced method for controlling biochemical processes, such as, for example, the extent and/or tissue location for lipid deposition during excess caloric intake. What is desirable, therefore, are compositions and methods for their delivery to a selected mammal in need thereof using one or more systemic, localized, or cell-targeted delivery modalities to deliver agents capable of inducing, altering, controlling, modulating, or repressing at least one of adipocyte expression, adipocyte activity, and adipocyte differentiation.

Improved therapeutics for the treatment of eating disorders are therefore urgently needed.

Summary of the invention

The invention provides solutions for the above mentioned problems in that it provides a method for treating, delaying or preventing an eating disorder wherein microRNA 216a or the complement thereof is administered to a subject in need of such a treatment.

This method is particularly suited for the treatment of eating disorders that give rise to an increase of body weight, such as obesity or metabolic syndrome.

The invention also provides means and methods for treating eating disorders that give rise to a decrease of body weight by targeting the same mechanism, in that case however, the expression of miRNA216 is to be decreased. Such may be accomplished by administering an inhibitor of miRNA216a to the subject requiring treatment, such as for example an anti-miR216a.

Brief description of the drawings

Figure 1. Genomic localization of MicroRNA-216a.

Panel (a) Human miR 216a is clustered with miR-217, which are both encoded in the lincRNA gene MIR217HG-001 , located on the antisense strand on chromosomal locus 2p16.1.

Figure 2: MiR-216a is involved in white adipocyte differentiation.

Panel (a) Northern blotting of miR-216a shows the expression of this microRNA in different mouse tissues. Rnu6-2 (U6) and total RNA were used as loading controls.

Panel (b) Expression levels of miR-216a measured by RT-qPCR in control versus obese patients, and

Panel (c) in WT versus ob/ob mice.

Panel (d) Expression levels of miR-216a, measured by northern blotting, at day 0, 1 , 2, 3 and 4 of the differentiation process in 3T3L1 cells. Rnu6-2 (U6) was used as a loading control.

Panel (e) 3T3L1 cells were transfected with scrambled antimir (anti-scr- miR) or antimir for miR-216a (anti-miR-216a). Adding the serotonin receptor antagonists, Ketanserin (antagonist of Htr2a/2c) or SB-699551 (Antagonist of Htr5a), inhibited the hypertrophic effect of anti-miR-216a on adipocyte differentiation. The effect of anti-miR- 216a on adipocyte cell size was quantified.

Panel (f) 3T3L1 cells were transfected scrambled precursor (pre-scr- miR) and precursor for miR-216a (pre-miR-216a; miR-216a mimic). Treatment with pre- miR-216a inhibited 3T3L1 cell differentiation.

Figure 3: Gene targeting strategy of murine miR-216a.

Panel (a) Genomic structure of the miR-216a gene, the targeting vector, and the theoretical targeted allele, which deletes the complete precursor sequence of miR-216a.

Panel (b) Bglll-digested genomic Southern blot analysis of targeted ES cell clones shows an endogenous 5.1 -kb fragment, a targeted 1 1.9-kb fragment following homologous recombination, a targeted 10.2-kb fragment following FLP-mediated excision of the Neomicin cassette (Neo), and a 7.9-kb fragment following Cre-mediated excision of the miR-216a coding sequence.

Figure 4: Deficiency of miR-216a leads to increased food intake and obesity.

Panel (a) Compared to WT mice, miR-216a mice have a higher body weight, and

Panel (b) bigger white adipocytes, shown by an histological analysis of H&E stained abdominal white adipose tissue (representative images are shown) and

Panel (c) an increased food consumption (expressed as average amount of grams consumed per week (g/week),

Panel (d) increased plasma levels of non esterified fatty acids (NEFA),

Panel (e) increased fasting blood glucose levels and

Panel (f) increased urine glucose levels compared to WT mice. Figure 5: MiR-216a deficiency exacerbates high fat diet-induced obesity.

Panel (a) A representative picture of WT and miR-216a KO mice on chow versus high fat diet (HFD).

Panel (b) On both chow and HFD, miR-216a mice have a higher body weight,

Panel (c) a higher percentage of white adipocyte tissue (WAT) mass,

Panel (d) bigger white adipocytes, (representative H&E images are shown) and

Panel (e) increased food consumption (expressed as average amount of grams consumed per week (g/week).

Panel (f) Histological analysis of the kidney demonstrates that the proximal convoluted tubules of the mutant mice that fed either HFD (miR-216a KO HFD) or chow (miR-216a KO chow) showed moderate to severe intracellular fat deposition (renal lipidosis) when compared to the control mice. Affected tubules were markedly swollen and their cytoplasm contained moderate to high numbers of fat vacuoles with no significant degeneration, necrosis, or inflammation. The distal convoluted tubules, the medullary and papillary tubules were spared. The highest average recorded renal lipidosis score was measured in the miR-216a KO HFD mice (score 3.3), followed by the miR-216a KO chow mice (score 2.7) and then the WT HFD mice (score 1 .5). No significant renal lipidosis was present in the WT chow-fed mice (score 0). Figure 6: Serotonin receptors as downstream targets of miR-216a.

Panel (a): By using bioinformatics screens for miR-216a binding sites, the 3'UTR regions of Htrl d, Htr2a, Htr2c, Htr4 and Htr5a were identified as potential target sites of miRNA-216a.

Panel (b) Differential expression of 5-HT receptors in miR-216a KO mice. The expression of Htrl d, Htr2a, Htr2c, Htr4 and Htr5a was measured by RT-qPCR in both brain tissue and white adipose tissue of WT versus miR-216a KO mice.

Detailed description of the invention

It is an object of the present invention to provide a treatment, delay or prevention for eating disorders, such as overweight, adiposity, obesity and metabolic syndrome as well as their downstream consequences and effects, including cardio- metabolic disorders such atherosclerosis, dyslipidemia, hypertension, insulin resistance or heart disease.

In one embodiment, the invention relates to a method for treating delaying or preventing an eating disorder wherein microRNA 216a is administered to a subject in need of such a treatment.

MicroRNAs (miRNAs) are small RNA molecules encoded in the genomes of plants and animals which are functional without being translated into a protein. They are highly conserved and have a length of about 20 - 24 nucleotides. These micro RNAs usually regulate the expression of genes by binding to the 3'-untranslated regions (3'-UTRs) of specific mRNAs. Each miRNA is thought to regulate multiple genes, and since hundreds of miRNA genes are predicted to be present in higher eukaryotes the potential regulatory circuitry provided by miRNAs is enormous. Several research groups have provided evidence that miRNAs may act as key regulators of processes as diverse as early development, cell proliferation and cell death, apoptosis and fat metabolism, and cell differentiation. Recent studies of miRNA expression implicate miRNAs in brain development, chronic lymphocytic leukemia, colonic adenocarcinoma, Burkitt's

Lymphoma, and viral infection suggesting possible links between miRNAs and viral disease, neurodevelopment, and cancer.

Aberrant expression of miRNA, be it under- or overexpression, can result in many kinds of disorders. Recently, many different miRNA were identified that relate to specific diseases. As many miRNAs, however, regulate several hundreds of genes, for most miRNA-related diseases it is hitherto unknown which gene is regulated by the identified miRNA and is ultimately responsible for the disease.

Decreased expression of miRNA 216a has been associated with pancreatic cancer. (Hou et al., Nan Fang Yi Ke Da Xue Xue Bao. 2012 Nov; 32 (1 1 ):1628- 31 ) found that the expression of miRNA-216a was significantly lower in pancreatic cancer than in benign pancreas lesions (P=0.000). The expression of miRNA-216a was significantly correlated with the T stage of the tumor (P=0.002), but not with the patients' age, gender, smoking status, tumor stage, lymph node metastases, distant metastasis, tumor differentiation, nerve invasion, vessel invasion or serum CA19-9 level (P>0.05). They concluded that the down-regulated expression of miR-216a in pancreatic cancer suggests the involvement of miR-216a in the tumorigenesis and development of pancreatic cancer. miR-216a may therefore potentially serve as a novel tumor marker and also a prognostic factor for pancreatic cancer.

MiR 216a, or miRNA 216a or micro RNA216a are used interchangeably herein and preferably refer to 22-mer microRNA with the sequence: 5'

UAAUCUCAGCUGGCAACUGUGA 3'(SEQ ID NO: 1 ).

In the context of the present invention, the term microRNA 216a should not be so narrowly construed as not to include obvious alternatives such as modifications of the sequence according to SEQ ID NO: 1 . In some embodiments it may be

advantageous to use homologous sequences of SEQ ID NO: 1 such as sequences that may be obtained by introducing one or more point mutations in the sequence according to SEQ ID NO: 1. The use of a sequence that is at least 90% identical with the sequence according to SEQ ID NO: 1 is preferred. Such a sequence may have 20 or 21 nucleotides in common with SEQ ID NO: 1 , i.e. 2 point mutations or preferably 1 point mutation. Such a sequence is expressly included in the definition of the term miR 216a. In a preferred embodiment, however, the term "miR 316a" refers to a 22-mer microRNA with the sequence: 5' UAAUCUCAGCUGGCAACUGUGA 3' (SEQ ID NO: 1 ).

In some embodiments it may also be preferred to use the complement of the sequence according to SEQ ID NO: 1.

These and other modifications, equivalents and alternatives are well within reach of the skilled person when confronted with the present application. The skilled person will be very much aware when to apply the complement sequence of miRNA 216a or when it may be advantageous to use homologous equivalents of SEQ ID NO: 1 .

The term "eating disorder" is used herein to indicate a psychological illness defined by abnormal eating habits that may involve either insufficient or excessive food intake to the detriment of an individual's physical and mental health. Bulimia nervosa and anorexia nervosa are the most common specific forms of eating disorders that result in net weight loss of the patient. Other types of such eating disorders include binge eating disorder and OSFED.

Included in the term are also diseases that result in weight gain, such as diseases that result in overweight, severe overweight or obesity. For adults, overweight and obesity ranges are determined by using weight and height to calculate a number called the "body mass index" (BMI). BMI is used because, for most people, it correlates with their amount of body fat. An adult who has a BMI between 25 and 29.9 kg/m² is considered overweight. An adult who has a BMI of 30 kg/m² or higher is considered obese.

A child's weight status is determined using an age- and sex-specific percentile for BMI rather than the BMI categories used for adults because children's body composition varies as they age and varies between boys and girls. CDC Growth Charts are used to determine the corresponding BMI-for-age and sex percentile. For children and adolescents (aged 2— 19 years): Overweight is defined as a BMI at or above the 85th percentile and lower than the 95th percentile for children of the same age and sex. Obese is defined as a BMI at or above the 95th percentile for children of the same age and sex.

In a preferred embodiment of the invention, the term "eating disorder" refers to a disorder leading to a weight gain of the patient, such as a disease leading to overweight of the patient, such as a disorder selected from the group consisting of obesity or metabolic syndrome.

The term "metabolic syndrome" is well known in the art and refers to a disease characterized by a combination of blood pressure and blood glucose elevations, central obesity, elevated triglycerides and reduced HDL cholesterol. The present invention may also be advantageously used in the treatment of cardio-metabolic disorders such atherosclerosis, dyslipidemia, hypertension, insulin resistance or heart disease.

The skilled person is well aware of the meaning of the terms overweight, adiposity, obesity and metabolic syndrome. A widely used definition for the term

"adiposity" may be having a body fat weight % (fat weight/total weight) of greater than 25% in men, or 30% in women. Adiposity can be measured, for example, by air- displacement plethysmography, bioelectrical impedance analysis, dual energy X-ray absorptiometry, hydrostatic weighing, isotope dilution, or skin fold measurements. Body fat percentage can be estimated from a person's BMI by the following formula: (1 .2 x BMI) + (0.23 x age) - 5.4 - (10.8 x gender) where gender= 0 for women, 1 for men.

Metabolic syndrome is also known as a clustering of at least three of five of the following medical conditions: abdominal (central) obesity, elevated blood pressure, elevated fasting plasma glucose, high serum triglycerides, and low high-density lipoprotein (HDL) levels.

The main sign of metabolic syndrome is central obesity (also known as visceral, male-pattern or apple-shaped adiposity), overweight with adipose tissue accumulation particularly around the waist and trunk.

A joint interim statement of the International Diabetes Federation Task

Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute;

American Heart Association; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity published a guideline to harmonize the definition of the metabolic syndrome (Alberti et al., (2009). "Harmonizing the metabolic syndrome: a joint interim statement of the International Diabetes Federation

Task Force on Epidemiology and Prevention; National Heart, Lung, and Blood Institute;

American Heart Association; World Heart Federation; International Atherosclerosis Society; and International Association for the Study of Obesity.". Circulation 120 (16):

1640-5).

The present invention provides the insight that decreased expression of microRNA-216a causes overweight, obesity, increased appetite and food consumption associated with hyperlipidemia, insulin resistance and heart disease. miR-216a is clustered with miR-217 and together with miR-216b, these three microRNAs are located within the IncRNA MIR217HG-001 at human chromosomal locus 2p16.1 (Fig. 1 a).

Several serotonin receptor 3'UTR regions were identified as direct downstream target sites of miR-216a. Serotonin, also known as 5-hydroxytryptamine (5- HT), is a monoamine neurotransmitter involved in controlling body weight homeostasis. In white adipose tissue (WAT), gut-derived serotonin is required for differentiation of pre- adipocytes into mature adipocytes, whereas brainstem-derived serotonin affects appetite. It is shown herein that the serotonin receptors HTR1 D, HTR2A, HTR4 and HTR5A are a direct target of miR-216a. We show that a decrease in expression of miR-216a causes a significant upregulation of HTR1 D, HTR2A and HTR5A in WAT and HTR1 D, HTR2A, and HTR4 in brain tissue. On the other hand, HTR2C expression was significantly downregulated in brain tissue of miR-216a knock-out (KO) mice compared to wild type mice. This directly translates into an increase in weight or weight gain and eventually to obesity, increased appetite, cardio-metabolic diseases or metabolic syndrome.

The increased appetite as well as the differentiation and hypertrophy of white adipose tissue may be prevented, counteracted or delayed by increasing the level of microRNA 216a, thereby preventing, delaying or treating overweight or obesity.

MicroRNA 216a levels in the body of a subject may be raised, elevated or increased by methods well known in the art. The skilled person is well aware of the metes and bounds of such techniques and knows how to take measures against degradation of microRNAs in circulation when the miRNA 216a is administered

systemically, for instance via intravenous injection.

Alternatively, microRNA 216a may be administered through a targeting vector. Such vectors are known in the art and the skilled person knows how to employ them. Suitable examples may be SV40 or adeno-associated vectors. Adeno-associated vectors AAV2 or AAV8 (O'Neil, S.M. et al., Gene Ther. 2014 Jul;21 (7):653-61 . doi:

10.1038/gt.2014.38. Epub 2014 May 15) may be particularly suited to target miRNA 216a to white adipose tissue, whereas AAVrhI O may be used to target the micro RNA to the brain (Hordeaux, J. et al., Gene Ther. 2015 Jan 15. doi: 10.1038/gt.2014.121 ).

Additionally is provided a method for treating, diminishing,

counteracting, delaying and/or preventing eating disorders that result in unwanted weight loss, such as anorexia nervosa, bulimia nervosa or binge eating disorders comprising administering to an individual in need thereof an effective amount of an inhibitor of microRNA 216a.

MicroRNA 216a was found to be capable of decreasing the expression of HTR1 D, HTR2A, HTR4 or HTR5A or a combination of two or more of these serotonin receptors as well as inhibiting HTR2C. A method wherein the levels or presence of miRNA 216a is decreased is therefore particularly suitable for the prevention, delay or treatment of the above mentioned eating disorders such as anorexia nervosa, bulimia nervosa or binge eating.

Further provided is therefore an inhibitor of microRNA 216a for use in treating, diminishing, delaying and/or preventing eating disorders that result in unwanted weight loss, such as anorexia nervosa, bulimia nervosa or binge eating disorders.

The use of such inhibitor for the preparation of a medicament is also provided. As used herein, the term "inhibitor of microRNA 216a" is intended to comprise compounds that are capable of inhibiting or at least partly inhibiting the expression, the amount and/or the activity of microRNA 216a.

Inhibition of microRNA may be achieved through several methods. For instance, a nucleic acid molecule that is complementary to at least a functional part of said microRNA is used. Said functional part comprises at least 15 nucleotides, preferably at least 18 nucleotides, more preferably at least 20 nucleotides. After administration to a cell, said nucleic acid molecule then binds to said microRNA, thereby counteracting, delaying and/or at least in part inhibiting binding of said microRNA to the target gene and thereby counteracting the function of said microRNA, i.e. gene regulation. A person skilled in the art is aware of various methods to inhibit or partly inhibit microRNA. Non-limiting examples are for instance the use of a locked nucleic acid oligo (LNA), in which an extra bridge connecting the 2' and 4' carbons is present, where the bridge "locks" the ribose in the 3'- endo structural conformation. Further, non-limiting examples comprise a Morpholino oligo, a modified antisense molecule that does not degrade its target RNA molecule, and a 2'-0- methyl RNA oligo.

Therefore, in a one embodiment of the invention, an inhibitor, a use and/or a method according to the invention are provided wherein said inhibitor comprises a nucleic acid sequence with a length of at least 15 nucleotides, preferably at least 18 nucleotides, more preferably at least 20, 21 or 22 nucleotides, that is preferably complementary to microRNA 216a.

An inhibitor of non-coding RNA is especially useful if an efficient amount is able to reach a non-coding RNA, which it is supposed to inhibit. As said non-coding RNA is typically present inside a cell, said inhibitor is preferably able to inhibit said non- coding RNA inside said cell. As said inhibitor of non-coding RNA is especially useful for the treatment or prevention of eating disorders, said inhibitor is even more preferably able to inhibit expression, amount and/or activity of said non-coding RNA within a WAT or brain cell. In one embodiment said inhibitor is capable of being introduced into said cell, preferably a WAT or a brain cell. In one embodiment said inhibitor of non-coding RNA is itself able to penetrate a cell membrane and enter a cell, preferably a WAT or a brain cell. However, it is also possible to modify said inhibitor such, that it is thereafter capable of entering a cell, preferably a WAT or a brain cell. This is, however, not necessary because many transport systems capable of introducing a compound into a cell are known.

Thus, in a preferred embodiment, an inhibitor, a use and/or a method according to the invention is provided, wherein said inhibitor is capable of counteracting, inhibiting and/or decreasing the expression, amount and/or activity of said non-coding RNA in a cell, more preferably in a WAT or a brain cell.

Methods for introducing a microRNA or an inhibitor of microRNA into a cell are known in the art. Methods for introducing inhibitors, such as antisense nucleic acid, comprise for instance calcium phosphate transfection, DEAE-Dextran,

electroporation or liposome-mediated transfection. Alternatively, direct injection of the inhibitor is employed. Preferably however, a nucleic acid which is an inhibitor and/or which encodes an inhibitor is introduced into a cell by a vector, preferably a viral vector. Various terms are known in the art which refer to introduction of nucleic acid into a cell by a vector. Examples of such terms are "transduction", "transfection" and "transformation".

Techniques for generating a vector with a nucleic acid sequence and for introducing said vector into a cell are known in the art. Marker genes such as for instance antibiotic resistance or sensitivity genes and/or genes encoding markers such as cell surface antigens or fluorescent proteins like green fluorescence protein are preferably used in identifying cells containing the introduced nucleic acid, as is well known in the art.

Preferably, an inhibitor or a microRNA for use according to the invention is provided which is suitable to be introduced into a mammalian cell in vivo. Non-limiting examples of methods for use in the present invention are the coupling of said inhibitor to cell-penetrating peptides, or the use of liposomes containing said inhibitor.

Inhibition of microRNA 216a in a cell, leads to an increase or restoration of serotonin receptor HTR1 D, HTR2A, HTR4 or HTR5A or combination of two or more of these serotonin receptors and/or in combination with a decrease of HTR2C expression in said cell. This in turn leads to an increase in appetite and a loss of differentiation and hypertrophy of white adipose tissue.

In a preferred embodiment therefore, an inhibitor, use and/or method according to the invention is provided wherein said inhibitor of microRNA 216a is for example capable of increasing and/or restoring the expression of serotonin receptor HTR1 D, HTR2A, HTR4 or HTR5A or combination of two or more of these serotonin receptors and/or in combination with a decrease of HTR2C in a cell. To be able to counteract the function of microRNA 216a in a cell, said inhibitor is preferably able to penetrate the nucleus. It is generally accepted that small nucleic acid molecules, preferably antisense molecules, such as the before mentioned LNA, Morpholino, or 2'-0- methyl RNA oligos, can freely move between the cytoplasm and the nucleus. In one embodiment, however, an inhibitor that is not able to freely move between the cytosol and the nucleus is modified such as to target and penetrate the nuclear membrane. Methods to target the nucleus are well known in the art and include, for instance, the use of nuclear targeting vector, such as an adenovirus or adeno-associated vector.

In a preferred embodiment, an inhibitor of microRNA 216a, a use and/or a method according to the invention is provided, wherein said inhibitor comprises an antisense nucleic acid molecule. Preferably, an antisense nucleic acid molecule against microRNA 216a is used. Said antisense molecule preferably comprises at least 15 nucleotides. Even more preferably, said antisense molecule comprises at least 18 nucleotides. Most preferably, said antisense molecule comprises at least 20 nucleotides.

Preferably, said inhibitor of miR-216a comprises a nucleic acid sequence able to bind to miR-216a under physiological conditions. It is commonly thought that to be able to bind and inhibit the function of a microRNA, an antisense nucleic acid is allowed to have a few (preferably 1 or 2) mismatches. Thus, for instance in the case of a sequence according to SEQ ID NO: 1 , at least 20 nucleotides are preferably identical to the complementary sequence of miR-216a, such as 21 or 22 nucleotides.

Moreover, an antisense nucleic acid is allowed to be somewhat shorter than its target sequence. An antisense against miR-216a is preferably at least 20 nucleotides long. In a preferred embodiment, therefore, an inhibitor, use and/or method according to the invention is provided wherein said inhibitor comprises a nucleic acid molecule comprising a sequence with a length of at least 18, preferably at least 19 or 20 nucleotides with at least 90% sequence identity to at least 18, preferably at least 20 nucleotides of miR-216a, or the complement thereof. In one embodiment, said nucleic acid molecule comprises a sequence with a length of at least 20 nucleotides with at least 90% sequence identity to at least part of the sequence of SEQ ID NO: 1 , said part having at least 20 nucleotides. Said nucleic acid sequence is preferably at least 90% identical to that sequence.

One particularly preferred embodiment provides an inhibitor, a use, and/or a method according to the invention, wherein said inhibitor comprises:

- a nucleic acid sequence with a length of at least 20 nucleotides with at least 90% sequence identity to at least part of the sequence uaaucucagcuggcaacuguga (SEQ ID NO: 1 , hsa-miR-216a-5p) or the complement thereof, said part having at least 20 nucleotides, and/or a nucleic acid sequence with a length of at least 20 nucleotides with at least 90% sequence identity to at least part of the sequence of SEQ ID NO: 1 or the complement thereof, said part having at least 20 nucleotides.

The term "percentage sequence identity" is defined herein as the percentage of nucleotides in a nucleic acid sequence that is identical with the nucleotides in a nucleic acid sequence of interest, after aligning the sequences and optionally introducing gaps, if necessary, to achieve the maximum percent sequence identity.

Methods and computer programs for alignments are well known in the art. As used herein, the terms "nucleic acid sequence" and "nucleotides" also encompass non-natural molecules based on and/or derived from nucleic acid sequences, such as for instance artificially modified nucleic acid sequences, peptide nucleic acids, as well as nucleic acid sequences comprising at least one modified nucleotide and/or non-natural nucleotide such as for instance inosine.

Examples

Example 1 : Preparation of knock-out mice.

MiR-216a knock-out (KO) mice were generated according to standard procedures. More information about The Cre-lox and FLP-FRT (flippase-FLP recombinase target) systems is to be found at http://jaxmice.jax.org/jaxnotes/archive/501 c.html. In brief: A targeting vector was designed to flank the murine DNA miR-216a exon at the 5' end by a validated FRT-neomycin-Frt-Loxp cassette and by a single loxP site at the 3' end. Southern blotting was performed to select the embryonic stem (ES) cells containing the targeting vector before oocyte injection. Next, flippase (FLP)-mediated recombination was used to excise the neomycin cassette, which resulted in the miR-216a exon flanked by two loxP sites. miR-216a fl/fl mice were then crossed with PGK3-Cre mice in order to generate somatic miR-216a KO mice due to loxP-Cre recombination (Lallemand Y, Luria V, Haffner-Krausz R, Lonai P. 1998. Maternally expressed PGK-Cre transgene as a tool for early and uniform activation of the Cre site-specific recombinase. Transgenic Res 7:105-1 12). Afterwards, southern blotting was used to distinguish somatic miR-216a KO mice from WT mice (see Figure 3).

Example 2: Human samples.

Abdominal subcutaneous white adipose tissue (WAT) biopts from male non-diabetic obese patients (BMI> 30) were used to measure miR-216a expression.

These obese patients show an increased WAT mass, increased adipocyte size and increased blood glucose levels.

Example 3: Experimental animal model

MiR-216a knock-out mice and ob/ob mice were used as the animal model. Ob/ob is a leptin deficient mutant mouse that eats excessively and becomes profoundly obese and is often used a model for type 2 diabetes since these mice show an increase in body weight, an excessive appetite, increased blood glucose and insulin levels. All protocols were performed according to institutional guidelines and were approved by local Animal Care and Use Committees. Example 4: RNA isolation from mouse tissue or stable mammalian cell lines.

Total RNA was isolated from different mouse tissues or from cultured mammalian cells. Mice were sacrificed by cervical dislocation under isofluorane anesthesia. Whole organs (e.g. WAT, brain, heart, thymus, kidney, liver, spleen) were removed, cleaned in PBS and immediately put into liquid nitrogen. Tissues were put in 1 mL Trizol (Invitrogen) and homogenized several times at maximum speed, each time for about 1 minute (to prevent overheating), until complete disruption. Cultured cells were washed twice with ice cold PBS before adding Trizol and collecting the cell lysates in RNase-free tubes. After shaking the homogenates for 10 minutes at 4°C (to permit the complete dissociation of nucleoprotein complexes), 0.25 ml of chloroform per 1 ml of Trizol was added to each sample. Centrifugation at 12,000 g for 15 minutes at 4°C resulted in the separation of RNA (upper aqueous phase) from DNA and proteins (organic lower and intermediate phase). Aqueous phases (60% of the sample volume) were collected in new RNase-free tubes and RNA was precipitated with 1 ml of isopropanol by incubation at -80°C overnight and centrifugation at 12,000 g for 30 minutes at 4°C. The pellets, containing the RNA, were washed twice with 1 ml of 70% ethanol at 12,000 g for 5 minutes at 4°C. After decantation of the ethanol and total removal by evaporation, samples were dissolved in 20-30 uL of RNase-free water. RNA quantity from the individual tissues was measured with a NanoDrop® ND-1000 UV-Vis Spectrophotometer (Wilmington).

Example 5: Northern blotting.

Three micrograms of total RNA from WAT or other different tissues were fractionated on a denaturing 12% polyacrylamide gel containing 8 M urea, transferred to Nytran N membrane (Schleicher & Schuell, Germany) by capillary method and fixed by UV cross-linking according to the manufacturer's instructions. Membranes were hybridized with specific 5'-Digoxigenin (Dig)-labeled LNA detection probes (Exiqon) for miR-216a or U6 (loading control). Detection was performed with an antibody against Dig (Roche).

Example 6: LNA oligonucleotides and miRNA precursor molecules.

Antisense oligonucleotides targeting miR-216a were obtained from Exiqon (miRCURY LNA knockdown oligo mmu-miR-216a, LNA-miR-216a) and miR-216a precursor molecules were obtained from Ambion (Pre-miR™ mmu-miR-216a miRNA Precursor, pre-miR-216a). Example 7: Transient transfection of 3T3L1 cells.

3T3L1 cells were plated in DMEM supplemented with 10% FBS + 1 % Penicillin Streptomycin + 1 % L-Glutamine. At the moment the cells reach 100%

confluence, cells were transiently transfected with 100 nM of LNA-miR-216a, pre-miR- 216a or respective scrambled controls, with oligofectamine reagent (Invitrogen) according to the manufacturer's recommendations. Cells were washed the next day and

differentiation medium containing 1 ^g/ml insulin, 0.5mM IBMX and 1.0μΜ

dexamethasone was added. After 2 days, the differentiation medium was replaced by normal growth medium, supplemented with 1 ^g/ml insulin. To obtain fully mature adipocytes, cells were kept in culture for 14 days and refreshed the medium every 2 days.

Example 8: Immunocytochemistry and histology.

To visualize the lipids within the adipocytes, cultured 3T3L1 cells were stained with oil-red O. Fresh Oil Red O working solutions is prepared by mixing stock solution with distilled water (6:4), followed by incubation for 20 min and further filtration. Cells were washed twice with PBS and fixed with 4% formaldehyde in PBS for 1 h at room temperature. Subsequently, the cells were washed 1x with PBS, washed 1 x with 60% isopropanol, and dried. Oil Red O working solution (1.5 ml/dish) was added for 2 h. Next, dishes were washed extensively with distilled water, dried, and photographed.

WAT tissue samples were embedded in paraffin and stained for H&E in order to visualize adipocyte size. Also other organs, such as liver, kidney and pancreas were paraffin embedded and stained for H&E.

Example 9: Primer design and real-time PCR.

We designed primers targeted against HTR1 D, HTR2A, HTR2C, HTR4, HTR5A and L7. The primers were specific for mouse sequences (www.ensembl.org) and selected using Beacon Designer software (Invitrogen) based on the following

requirements: i) primer melting temperature of ~60°C, ii) GC-content of -55%, iii) preferably no G at 5' end, iv) avoid runs of more than 3 identical nucleotides, and v) amplicon length of -100 nucleotides. Specificity was checked with the Basic Local Alignment Search Tool (BLAST) and the specific melting point of the amplicons was analyzed using Biorad Dissociation curve software (iCycler, Biorad). All primer sets were tested for PCR efficiency and alternative primers were designed in case they fell outside the 5% efficiency range (3.14 < slope < 3.47). One μg of RNA from indicated hearts was reverse-transcribed using Superscript II reverse transcriptase (Invitrogen). PCR amplification was performed (in duplicate) as a singleplex reaction with 400 nM forward and reverse primers on 40 ng cDNA, in a total reaction volume of 25 μΙ. The PCR was cycled between 95 °C/30 s and 60 °C/30 for 40 cycles, following an initial denaturation step at 95 °C for 3 min. Real time PCR results were verified by electrophoresis of the reverse transcribed material in 1 .2% agarose gels and visualized under UV illumination after ethidium bromide staining. Transcript quantities were compared to the amount of endogenous control (L7). Primer sequences are available upon request.

Example 10: Statistical analysis.

The results are presented as mean values ± standard error of the mean (SEM). Statistical analyses were performed using Prism 5 software (GraphPad Software Inc.) and consisted of AN OVA followed by Turkey's post-test when group differences were detected at the 5% significance level, or Student's t-test when comparing two

experimental groups. Example 1 1 : Differential expression of miRNA-216a in WAT of obese subjects.

We profiled the expression levels of miR-216a in different mouse organs and observed a high expression of miR-216a in WAT tissue (Fig 1 b). Therefore, we further analyzed the expression of miR-216a in abdominal subcutaneous WAT from obese patients (figure 1 c) as well as ob/ob mice (figure 1 d), a mouse model for obesity. In WAT from both obese humans and mice, miR-216a expression was decreased compared to controls.

Example 12: miR-216a prevents adipocyte differentiation.

Hyperplasia is a critical event in the development of obesity. Therefore, we here investigated whether miR-216a affects this process. Northern blot analysis of miR-216a expression levels during adipocyte differentiation showed that miR-216a levels decrease with increasing days of differentiation (Fig. 2a), which is in line with the increased 5-HT2cR mRNA levels during adipocyte differentiation. To address the functional role of miR-216a in adipocyte differentiation, we induced miR-216a expression in 3T3L1 cells, a mouse pre-adipocyte cell line, by transfection with miR-216a precursor molecules or reduced miR-216a expression by transfection with anti-miR-216a molecules (Fig. 2b). Oil red O staining revealed that transfection with anti-miR-216a leads to formation of hypertrophic mature adipocytes. In line, adipocyte differentiation is completely inhibited upon miR-216a overexpression (figure 2b). Overexpression may be

accomplished for instance using a miR-216a mimic (Ambion), which is a small, chemically modified double-stranded RNA that mimics endogenous miR-216a and enable miR-216a functional analysis by up-regulation of miR-216a activity. (Fig. 2b).

Example 13: miR-216a deficiency leads to increased food intake and obesity.

To further establish the role of miRNA-216a in vivo, miR-216a knock-out mice were generated (Figure 3). A miR-216a genomic clone was isolated and a targeting vector was designed to introduce loxP sites flanking the complete precursor sequence encoding murine miR-216a plus a neomycine cassette, which was flanked by FRT sites (Fig. 3). By using a probe external to the short arm, Southern blotting of Bglll digested ES cell DNA revealed a clone that had undergone correct homologous recombination, which was used to generate gene targeted mice (Fig. 3). Following sequential crossbreeding with Flp deleter and Cre-deleter mice, miR-216a null mice were obtained, which lacked miR-216a expression in all tissues. Somatic miR-216a knockout (KO) mice displayed an increased food consumption associated with an increased body weight, a higher percentage of WAT mass as compared to wild-type (WT) mice (Fig 4a-c, Fig. 5).

Furthermore, miR-216a deletion evoked primary signs of insulin resistance and hyperlipidemia since miR-216a KO mice show increased plasma non- esterified fatty acid levels (NEFA) (Fig. 4d) and increased fasting blood glucose levels (Fig. 4e) as well as increased urine glucose levels (Fig. 4f). Following a high fat diet of 23 weeks, the phenotype of miR-216a mice became even more severe. MiR-216a KO mice displayed an exaggerated form of obesity, shown by increases in body weight, percentage WAT mass and food consumption compared to WT mice on a high fat diet (Fig. 5a-e). Histological analysis revealed that WAT, kidney and liver were the most affected organs by miR-216a deletion. MiR-216a KO mice on a high fat diet displayed marked adipocytes hypertrophy, mild vacuolar hepatopathy (non-lipid type) (Fig 5I), and moderate to severe renal lipidosis affecting mostly the proximal convoluted tubules (Fig. 5m).

Example 14: MiR-216a regulates expression of serotonin receptors.

Several 5-HTR receptor 3'UTR regions were identified as potential target sites of miRNA-216a. HTR1 D, HTR2A, HTR2C, HTR4 and HTR5A receptors all harbour an evolutionarily conserved 7-seed region to miR-216a (Fig. 6a). RT-qPCR measurements revealed that expression levels of the 5-HT receptors HTR1 D, HTR2A and HTR5A were upregulated in white adipose tissue (WAT) of miR216a KO mice, whereas HTR1 D, HTR2A, and HTR4 expression was upregulated in brain tissue of miR-216a KO mice, compared to WT mice. HTR2C expression was significantly downregulated in brain tissue of miR-216a KO mice compared to wild type mice (Fig. 6b). Together, these data indicate that several 5-HT receptors are downstream targets of miR-216a in vivo in both WAT and brain tissue. Furthermore, Oil red O staining revealed that transfection with anti-miR-216a, leads to formation of hypertrophic mature adipocytes, while treatment with Ketanserin (5-HT receptor 2A 2C antagonist) or SB- 699551 (5-HT receptor 5A antagonist) antagonized this anti-miR-216a-mediated effect

(Fig. 6c). Together these data indicate that these serotonin receptors function downstream of miR-216a and that these serotonin receptors are involved in miR-216a deficiency- induced obesity.

Example 15 Sequences disclosed herein.

The following table shows the sequences disclosed herein.

Table 1 Sequences.

Sequence (5'-3') SEQ ID NO: Name: Source

UAAUCUCAGCUGGCAACUGUGA 1 Hsa-miR216a Figure 6a

AGAG U GAC U U G G AG AG AGAU U C 2 Human Hrtl d (3'UTR) Figure 6a

UUUGGCUUAAAUUAAUAGAUUU 3 Mouse Hrtl d (3'UTR) Figure 6a

GGUUUUUUUUUUUUUGAGAUUG 4 Human Hrt2a (3'UTR) Figure 6a

UUUAACAUUGCCAAUGAGAUCU 5 Mouse Hrt2a (3'UTR) Figure 6a

CAUGCCUACAUUAGUGAGAUUU 6 Human Hrt2c (3'UTR) Figure 6a

CAUGCGUUAAAUAGUGAGAUUU 7 Mouse Hrt2c (3'UTR) Figure 6a

CUGGGCUUUUCCUCUGAGAUUC 8 Human Hrt4 (3'UTR) Figure 6a

AUCUAUCUCAUCUGAGAGAUUU 9 Mouse Hrt4 (3'UTR) Figure 6a

CAAUAUGGGCAGGUUGAGAUUG 10 Human Hrt5a (3'UTR) Figure 6a

UACUUGGGAUUUCCUUAGAUUU 1 1 Mouse Hrt5a (3'UTR) Figure 6a

SEQUENCE LISTING

<110> Universiteit Maastricht and Academisch Ziekenhuis

Maastricht

<120> METHOD FOR THE TREATMENT OR PREVENTION OF EATING DISORDERS,

OVERWEIGHT OR OBESITY

<130> 306 WO

<160> 11

<170> Patentln version 3.5

<210> 1

<211> 22

<212> RNA

<213> homo sapiens

<400> 1

uaaucucagc uggcaacugu ga

22

<210> 2

<211> 22

<212> RNA

<213> homo sapiens

<400> 2

agagugacuu ggagagagau uc

22

<210> 3

<211> 22

<212> RNA

<213> mus musculus

<400> 3

uuuggcuuaa auuaauagau uu

22

<210> 4

<211> 22

<212> RNA

<213> homo sapiens

<400> 4

gguuuuuuuu uuuuugagau ug 22

<210> 5

<211> 22

<212> RNA

<213> mus musculus

<400> 5

uuuaacauug ccaaugagau cu 22

<210> 6

<211> 22

<212> RNA

<213> homo sapiens

<400> 6

caugccuaca uuagugagau uu 22

<210> 7

<211> 22

<212> RNA

<213> mus musculus

<400> 7

caugcguuaa auagugagau uu 22

<210> 8

<211> 22

<212> RNA

<213> homo sapiens

<400> 8

cugggcuuuu ccucugagau uc 22

<210> 9

<211> 22

<212> RNA

<213> mus musculus

<400> 9

aucuaucuca ucugagagau uu <210> 10

<211> 22

<212> RNA

<213> homo sapiens

<400> 10

caauaugggc agguugagau ug 22

<210> 11

<211> 22

<212> RNA

<213> mus musculus

<400> 11

uacuugggau uuccuuagau uu 22

Claims

1 . Method for treating delaying or preventing an eating disorder wherein microRNA 216a or the complement thereof is administered to a subject in need of such a treatment.

2. Method according to claim 1 wherein the eating disorder is selected from the group consisting of adiposity, obesity or metabolic syndrome.

3. Method according to claim 2 wherein the eating disorder is adiposity.

4. Method according to claim 2 wherein the eating disorder is obesity.

5. Method according to claim 2 wherein the eating disorder is metabolic syndrome.

6. Method according to any one of claims 1 - 5 wherein the subject in need of such a treatment is an overweight person.

7. Method according to any one of claims 1 - 5 wherein the subject in need of such a treatment is an adipose person.

8. Method according to any one of claims 1 - 5 wherein the subject in need of such a treatment is an obese person.

9. Method according to any one of claims 1 - 8 wherein the microRNA is

administered in a targeting vector.

10. Method according to claim 9 wherein the targeting vector is an adeno-asociated virus vector.

1 1 . Method according to claim 10 wherein the adeno-associated virus vector is of serotype AAV2, AAV8 or AAVrhl O.