WO2016141492A1 - Markers for mll-rearranged acute myeloid leukemias and uses thereof - Google Patents

Markers for mll-rearranged acute myeloid leukemias and uses thereof Download PDF

Info

Publication number
WO2016141492A1
WO2016141492A1 PCT/CA2016/050270 CA2016050270W WO2016141492A1 WO 2016141492 A1 WO2016141492 A1 WO 2016141492A1 CA 2016050270 W CA2016050270 W CA 2016050270W WO 2016141492 A1 WO2016141492 A1 WO 2016141492A1
Authority
WO
WIPO (PCT)
Prior art keywords
mll
leukemia
inhibitor
mutations
expression
Prior art date
Application number
PCT/CA2016/050270
Other languages
French (fr)
Inventor
Guy Sauvageau
Vincent-Philippe LAVALLÉE
Sébastien LEMIEUX
Josée HÉBERT
Sylvain Meloche
Irène BACCELLI
Bernhard LEHNERTZ
Original Assignee
Université de Montréal
Rsem, Limited Partnership
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Université de Montréal, Rsem, Limited Partnership filed Critical Université de Montréal
Publication of WO2016141492A1 publication Critical patent/WO2016141492A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/16—Amides, e.g. hydroxamic acids
    • A61K31/165—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/166—Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the carbon of a carboxamide group directly attached to the aromatic ring, e.g. procainamide, procarbazine, metoclopramide, labetalol
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4164—1,3-Diazoles
    • A61K31/4184—1,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
    • C07C259/00—Compounds containing carboxyl groups, an oxygen atom of a carboxyl group being replaced by a nitrogen atom, this nitrogen atom being further bound to an oxygen atom and not being part of nitro or nitroso groups
    • C07C259/04—Compounds containing carboxyl groups, an oxygen atom of a carboxyl group being replaced by a nitrogen atom, this nitrogen atom being further bound to an oxygen atom and not being part of nitro or nitroso groups without replacement of the other oxygen atom of the carboxyl group, e.g. hydroxamic acids
    • C07C259/10—Compounds containing carboxyl groups, an oxygen atom of a carboxyl group being replaced by a nitrogen atom, this nitrogen atom being further bound to an oxygen atom and not being part of nitro or nitroso groups without replacement of the other oxygen atom of the carboxyl group, e.g. hydroxamic acids having carbon atoms of hydroxamic groups bound to carbon atoms of six-membered aromatic rings
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D235/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings
    • C07D235/02—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, condensed with other rings condensed with carbocyclic rings or ring systems
    • C07D235/04—Benzimidazoles; Hydrogenated benzimidazoles
    • C07D235/06—Benzimidazoles; Hydrogenated benzimidazoles with only hydrogen atoms, hydrocarbon or substituted hydrocarbon radicals, directly attached in position 2
    • C07D235/08—Radicals containing only hydrogen and carbon atoms
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07D—HETEROCYCLIC COMPOUNDS
    • C07D471/00—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00
    • C07D471/02—Heterocyclic compounds containing nitrogen atoms as the only ring hetero atoms in the condensed system, at least one ring being a six-membered ring with one nitrogen atom, not provided for by groups C07D451/00 - C07D463/00 in which the condensed system contains two hetero rings
    • C07D471/04—Ortho-condensed systems
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to acute myeloid leukemias (AMLs), and more particularly to the diagnosis/prognosis of mixed lineage leukemia (MLLJ-rearranged acute myeloid leukemias [MLL leukemias).
  • AMLs acute myeloid leukemias
  • MMLJ-rearranged acute myeloid leukemias MMLL leukemias
  • the Mixed Lineage Leukemia ⁇ MLL, also termed KMT2A) gene on chromosome band 11 q23 is rearranged in approximately 5 to 10% of adult acute myeloid leukemias (AML) (hereafter called MLL-fusion or MLL-F leukemias).
  • AML acute myeloid leukemias
  • MLL-fusion or MLL-F leukemias This large gene (-90 kb) encodes for a histone methyltransferase protein of 3968 amino acids that methylates H3K4 and acetylates H4K16.
  • MLL rearrangements have been described of which the following genes are the most frequent MLL translocation partners: MLLT3 ⁇ AF9), MLLT4 ⁇ AF6), ELL, MLLT10 ⁇ AF10) and MLLT1 ⁇ ENL) 1 .
  • MLL-MLLT3 fusion MLL leukemias are typically associated with an adverse outcome.
  • NGS Next Generation Sequencing
  • TCGA Cancer Genome Atlas
  • MLL PTD partial tandem duplications
  • MLL leukemia minimal residual disease
  • MLK Mitogen-activated protein kinase kinase
  • MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
  • RTK Receptor Tyrosine Kinase
  • RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
  • VEGFR Vascular Endothelial Growth Factor Receptor
  • FLT3 inhibitor FMS-like receptor tyrosine kinase-3
  • RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
  • said at least one mutation is: a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS; a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS; a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS; a G to D substitution at a position corresponding to amino acid 13 of KRAS; an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or; a D to N substitution at a position corresponding to amino acid 594 of BRAF.
  • a method for predicting the sensitivity of mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia) cells to a Mitogen-activated protein kinase kinase (MEK) inhibitor or tyrosine kinase receptors (RTK) inhibitor comprising: determining the presence of a mutations in a member of the RAS pathway in said MLL leukemia cells; wherein the presence of said mutation is indicative that said MLL leukemia cells are more sensitive to an MEK inhibitor and/or more resistant to an RTK inhibitor relative to MLL leukemia cells not comprising said mutation in the member of the RAS pathway.
  • MLL leukemia mixed-lineage leukemia-rearranged acute myeloid leukemia
  • MEK Mitogen-activated protein kinase kinase
  • RTK tyrosine kinase receptors
  • MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
  • RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
  • RNA sequencing RNAseq
  • a higher expression of NKX2-3, MECOM, PCDH9, P2RY1 and/or IL12RB2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT4 rearrangement
  • a higher expression of NKX5-1, and/or a lower expression of MECOM and/or PROM1 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT3 rearrangement
  • RNA sequencing RNAseq
  • said one or more mutations is: a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS; a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS; a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS; a G to D substitution at a position corresponding to amino acid 13 of KRAS; an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or; a D to N substitution at a position corresponding to amino acid 594 of BRAF.
  • MLL leukemia mixed-lineage leukemia-rearranged acute myeloid leukemia
  • any one of items 47 to 49 wherein said method comprises determining whether the MLL leukemia cells from said patient comprise at least one mutation in a member of the RAS pathway.
  • 51 The method of item 50, wherein (i) if the MLL leukemia cells from said patient comprises at least one mutation in a member of the RAS pathway, said treatment comprises administering to said patient a Mitogen- activated protein kinase kinase (MEK) inhibitor, or (ii) if the MLL leukemia cells from said patient do not comprise at least one mutation in a member of the RAS pathway, said treatment comprises administering to said patient a Receptor Tyrosine Kinase (RTK) inhibitor.
  • MEK Mitogen- activated protein kinase kinase
  • RTK Receptor Tyrosine Kinase
  • MLL leukemia-rearranged [MLL) leukemia cells are associated with altered sensitivity of mixed-lineage leukemia-rearranged [MLL) leukemia cells to a drug or agent, said method comprising: measuring the response to said drug or agent in MLL leukemia cells comprising said one or more of the mutations or classes of mutations; and comparing said response to a control response in MLL leukemia cells that do not comprise said one or more of the mutations or classes of mutations,
  • a higher/more potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with an increased sensitivity, or decreased resistance, to said drug or agent
  • a lower/less potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with a decreased sensitivity, or increased resistance, to said drug or agent.
  • a method for detecting a MLL-ENAH fusion in a sample comprising contacting said sample with a first oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 to 1212 of the MLL protein, or to a complement thereof, and a second oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 17 to 591 of the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
  • a method for detecting a MLL-ENAH fusion in a sample comprising contacting said sample with an oligonucleotide comprising a first domain that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, and a second domain that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
  • a method for detecting a MLL-ENAH fusion in a sample comprising performing a sequencing reaction on said sample with (i) a MLL-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the ENAH protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample; and/or (ii) a ENAH-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the MLL protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample.
  • MLL leukemia is an MLL-fusion ⁇ MLL-F) leukemia or an MLL partial tandem duplication ⁇ MLL-P1D) leukemia.
  • MEK mitogen-activated protein kinase kinase
  • MEK mitogen-activated protein kinase kinase
  • MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
  • RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
  • VEGFR Vascular Endothelial Growth Factor Receptor
  • FLT3 inhibitor FMS-like receptor tyrosine kinase-3
  • RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
  • kits for the assessment of MLL leukemia comprising: (i) one or more reagents for measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, and/or of the transcripts of SEQ ID NO: 13-23, and/or at least one of mutations set forth in Table 3, in a biological sample.
  • kit of item 75 wherein said one or more reagents comprise one or more primers, probes and/or antibody.
  • Diamonds correspond to the 140 differentially expressed genes (difference ⁇ 1 or ⁇ -1) displayed in Tables 5 and 6, of which a selected subset is labeled. In order to logio transform expression values, a small constant of 0.0001 was added.
  • Figure 1 B shows the absolute expression levels in MLL-F vs non-MLL-F AML for a selection of most differentially expressed genes. Box limits represent 25 th and 75 th percentiles. Upper whiskers extend to the highest values that are within 1.5 x interquartile ranges (IQR) of the 75 th percentile and lower whiskers to the lowest value that are within 1 .5 x interquartile ranges of the 25 th percentile.
  • IQR interquartile ranges
  • Figures 2A to 2C show transcriptomic analyses of MLL-MLLT4 and MLL-MLLT3 subgroups. Comparative analysis of expressed genes in MLL-MLLT4 (Fig. 2A) and MLL-MLLT3 (Fig. 2B) subgroups based on the average of logio RPKM adjusted values for each group compared to AMLs with other MLL fusions. In order to perform logio transformations, a small constant of 0.0001 was added to expression values.
  • Fig. 2C Expression of MECOM, NKX2-3 and NKX5-1 genes in relation to MLL fusion partner.
  • Figure 3A shows a volcano plot illustrating the 140 differentially expressed genes selected in Fig. 1A.
  • FIG. 3B shows chromosome 15q 13.1 with the 5 genes associated to MLL-F AMLs. All Ensembl transcripts for these genes are shown (ENST00000563027, ENST00000563213, ENST00000430589, ENST00000567053, ENST00000563942, ENST00000515318, ENST00000512149, ENST00000565892, ENST00000562423, ENST00000566321 , ENST00000563202, ENST00000566178, ENST00000564604, ENST00000563144, ENST00000567390, ENST00000569815).
  • the LOC100289656 transcript marked with a star ⁇ ENST00000430589 corresponds to the RefSeq LOC100289656/NR_036475.2.
  • Figure 3C shows a waterfall representation based on LOC100289656 expression.
  • the enlargement panel shows the 45 samples with a LOC100289656 + expression ( ⁇ 1 RPKM). Sensitivity and specificity of LOC100289656 + as a marker for MLL-F AMLs is indicated.
  • Figure 3D shows a representation of MLL and ENAH proteins, with the corresponding novel MLL- ENAH fusion.
  • EVH enabled/VASP homology
  • Bromo bromodomain.
  • Figure 3G depicts the amino acid (upper, SEQ ID NO: 12) and nucleotide (lower, SEQ ID NO: 11 ) sequences of the fused regions of MLL (N-terminal, in bold) and ENAH (C-terminal, in italics) in the novel MLL- ENAH fusion of Figure 3D.
  • the glycine residue created by the fusion, and the encoding sequence GGC in the nucleotide sequence, are underlined.
  • Figure 4A shows a comparative analysis of LOC100289656 expression by RNA sequencing (RPKM + 0.0001) versus qRT-PCQ (LOC100289656 copies/10 4 ABL1 copies) in 1 14 leukemia samples with and without MLL rearrangements.
  • FIG. 4B shows the differential expression of LOC100289656 in different populations.
  • LOC100289656 expression is reported as the normalized (logio) value of LOC100289656 copy number per 10 4 ABL1 copy number.
  • a value of 0.01 defined as the minimum measurable copy number, was added to all LOC100289656 copy number values in order to apply logio transformation.
  • Figures 5A to 5D show a representative CASC10-based RT-qPCR assay for detection of minimal residual disease (MRD) in MLL-Fusions AML samples.
  • Figure 5A depicts the encoding nucleotide sequence (SEQ ID NO:10) and amino acid sequence (SEQ ID NO:11 ) of human CASC10.
  • Figure 5C is scatter plot showing robust correlation between RNA-Seq data (Log (RPKM + 0.0001 )) and RT-qPCR assays (Log (CASC10 copies/10 4 ABL1 copies) for CASC10 in 33 MLL + AML samples.
  • Figure 5D CASC10 expression is reported as the normalized (logio) value of CASC10 copy number per 10,000 ABL1 copy number. A value of 0.01 , defined as the minimum measurable copy number, was added to all CASC10 copy number values to apply Iog10 transformation. Samples below the dotted lines were undetectable (no CASC10 expression) with the RT-qPCR assay. Median values are indicated by a horizontal line.
  • CASC10 expression in normal peripheral blood samples and MLL-Fusions AML samples differed significantly using the Student t test (p valueO.0001 ).
  • the p value between CASC10 expression in MLL-Fusions AML samples and normal bone marrow samples is 0.01.
  • Figure 6A shows a detailed chromosomal positions and rearrangements of the cryptic MLL fusions identified in Fig. 3C.
  • Figure 6B shows Sanger sequencing confirming a fusion between MLL and ENAH genes in leukemic specimen 02H033.
  • Figure 6C shows the clinical and laboratory characteristics of sample 02H033.
  • Figure 6D shows co-occurring mutations in leukemia-associated genes in sample 02H033.
  • the atypical FLT3 A443T mutation could not be validated in non-tumoral DNA to determine whether it is acquired in the tumor or if it represents a germline polymorphism.
  • FIG. 7 shows the expression of LOC100289656 in MLL-F AMLs versus normal hematopoietic cell populations.
  • Figure 8A shows mutational, morphologic and cytogenetic data observed in MLL-F AMLs. Each column represents a patient sample. Darkness of the cell correlates to variant allele frequency. Genes without mutations are not shown.
  • Figure 8B shows SPI1 protein and mutations.
  • Figure 8C shows the expression of SPI1 and its targets in MLL-F AMLs. For SP/f-WT samples, genes with highest (circles) and lowest (triangles) SPI1 expression are shown.
  • Figure 8D shows bar graphs representing the variant allele frequency of each RAS mutated sample with co-occurring mutations, using an average coverage of 172X in transcriptome.
  • Figure 9 shows a confirmation of SPI1 mutations by Sanger sequencing.
  • Figure 10 shows RAS mutations variant allele frequency (VAF) in paired relapsed samples.
  • Figures 11A-11C show a layout of the single-agent chemical screen.
  • P-values were calculated using a Wilcoxon rank-sum test on EC50 values.
  • EGFR epidermal growth factor receptor
  • LSC leukemic stem cells
  • MEK mitogen-activated protein kinase kinase
  • MUT mutant
  • NK normal karyotype
  • RTK receptor tyrosine kinase
  • SEM standard error of the mean
  • WT wild type.
  • Figure 12B shows the average percentage of inhibition for MEKi alone (white), RTKi alone (black) or combinations of both (grey) with associated SEM for MLL-F RAS-WT (left panel) or MLL-F RAS-MUT (right panel) patients.
  • Drugs were used at their average EC25 concentrations as determined in Fig. 11 (see values in Table 22) and percentages of inhibition for single inhibitors correspond to measurements from the single-agent chemical screen (Fig. 11).
  • P-values were determined by one-way ANOVA and synergistic effects were evaluated by the R index as described in Materials and Methods.
  • An R > 1 indicates synergism, while an R ⁇ 1 .0 denotes an absence of synergism.
  • EGFR epidermal growth factor receptor
  • LSC leukemic stem cells
  • MEKi mitogen-activated protein kinase kinase inhibitor
  • MUT mutant
  • R synergistic ratio
  • RTKi receptor tyrosine kinase inhibitor
  • SEM standard error of the mean
  • WT wild type.
  • Figure 13 shows a scatter-plot representing absence of differentially expressed genes, in particular RT genes, between MLL RAS-WT and MLL RAS-MUT patients.
  • CSF1 R colony stimulating factor 1 receptor
  • EPHB6 Ephrin type B receptor 6
  • FDR false discovery rate
  • FLT3 Fms-related tyrosine kinase 3
  • INSR insulin receptor
  • LTK Leukocyte receptor tyrosine kinase
  • MUT mutant
  • RPKM reads per kilobase per million
  • RTK receptor tyrosine kinase
  • RYK related to receptor tyrosine kinase
  • WT wild type.
  • Figures 14A-14K show cufflinks isoform expression of RP1 1 -578F21.12_iso_2 ( Figure 14A); RP1 1- 26F2.1_iso_4 ( Figure 14B), RP1 1-578F21 .9_iso_1 ( Figure 14C), TASP1_iso_19 ( Figure 14D), RP11 - 578F21 .12_iso_23 ( Figure 14E), GOLGA8M_iso_2 ( Figure 14F), GOLGA8M_iso_1 ( Figure 14G), GOLGA8M_iso_6 ( Figure 14H), RP11 -1180F24.1_iso_1 ( Figure 141), WHAMMP2_iso_6 ( Figure 14J), MMRN1_iso_1 ( Figure 14K), for MLL-F AML subtype and normal hematopoietic populations.
  • MLL leukemias exhibit distinct mutational and transcriptional signatures relative to other AML subtypes, which may be useful for the characterization, diagnosis and prognosis of MLL leukemias.
  • the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemia), said method comprising: determining the presence of one or more of the mutations depicted in Table 3 in a leukemia cell (e.g., blood cell, bone marrow cell) sample from said subject: wherein the presence of said one or more mutations is indicative that said subject has a higher likelihood of suffering from MLL leukemia (i.e. higher likelihood relative to a subject not having said one or more of the mutations), and wherein the absence of said one or more mutations is indicative that said subject has a lower likelihood of suffering from MLL leukemia (i.e. lower likelihood relative to a subject having said one or more of the mutations).
  • MLL leukemia e.g., blood cell, bone marrow cell
  • the present invention relates to a method for determining whether the likelihood that an AML sample (e.g., a sample from a subject suspected of suffering from AML or known to suffer from AML) is an MLL leukemia sample, said method comprising: determining the presence of one or more of the mutations depicted in Table 3 in said AML sample: wherein the presence of said one or more mutations is indicative that said sample has a higher likelihood of being an MLL leukemia sample, and wherein the absence of said one or more mutations is indicative that said sample has a low likelihood of being an MLL leukemia sample (i.e. said sample is likely another type of AML sample).
  • AML sample e.g., a sample from a subject suspected of suffering from AML or known to suffer from AML
  • the present invention encompasses the detection of any mutation or any combination/sub- combination of the mutations defined herein (Table 3), for example the detection of a single mutation, or of 2, 3, 4, 5 or more of the mutations defined herein.
  • Ensembl accession numbers or reference ID corresponding to the genes of interest disclosed herein are depicted in Table 3 (second column).
  • the term "high likelihood" means that the individual is more likely to have the disorder or disease [MLL leukemia) than an individual without the mutation, or that the sample is more likely to be an MLL leukemia sample than an AML sample without the mutation.
  • MLL leukemia refers to an acute myeloid leukemia in which the mixed lineage leukemia ⁇ MLL, also termed KMT2A) gene on chromosome band 1 1q23 is rearranged.
  • MLL rearrangements have been described of which the following genes are the most frequent MLL translocation partners: MLLT3 ⁇ AF9), MLLT4 ⁇ AF6), ELL, MLLT10 ⁇ AF10) and MLLT1 ⁇ ENL).
  • MLL-MLLT3 fusion MLL leukemias are associated with poor prognosis and adverse outcome.
  • the rearrangement is a fusion (MLL-fusion or MLL-F AML).
  • the rearrangement is a partial tandem duplications (PTD) within the N-terminal domain of the MLL protein.
  • PTD partial tandem duplications
  • the determination of the mutation may be readily performed at the nucleic acid and/or protein level on a sample by a number of methods which are known in the art (see, e.g., Syvanen, Nat Rev Genet. 2001 Dec;2(12):930-42).
  • the presence of the mutation(s) may be detected at the genomic DNA, transcript (RNA or cDNA) or protein level.
  • suitable methods for determining sequences and polymorphisms at the nucleic acid level include sequencing of the nucleic acid sequence encompassing the mutation(s), e.g., in the genomic DNA or transcript (cDNA), for example by "Next Generation Sequencing” methods (e.g., genome sequencing, exome sequencing, RNA sequencing (RNA-seq)) or other sequencing methods; hybridization of a nucleic acid probe capable of specifically hybridizing to a nucleic acid sequence comprising the mutation(s) and not to (or to a lesser extent to) a corresponding nucleic acid sequence that does not comprises the mutation(s) (under comparable hybridization conditions, such as stringent hybridization conditions) (e.g., molecular beacons); restriction fragment length polymorphism analysis (RFLP); Amplified fragment length polymorphism PCR (AFLP-PCR); amplification of a nucleic
  • the determination of the presence of the mutation(s) may also be achieved at the polypeptide/protein level.
  • suitable methods for detecting alterations at the polypeptide level include sequencing of the encoded polypeptide; digestion of the encoded polypeptide followed by mass spectrometry or HPLC analysis of the peptide fragments, wherein the mutated polypeptide results in an altered mass spectrometry or HPLC spectrum as compared to the unmutated polypeptide; and immunodetection using an immunological reagent (e.g., an antibody, a ligand) which exhibits altered immunoreactivity with a mutated polypeptide relative to a corresponding unmutated polypeptide.
  • an immunological reagent e.g., an antibody, a ligand
  • Immunodetection can measure the amount of binding between a polypeptide molecule and an anti-protein antibody by the use of enzymatic, chromodynamic, radioactive, magnetic, or luminescent labels which are attached to either the anti-protein antibody or a secondary antibody which binds the anti-protein antibody.
  • other high affinity ligands may be used.
  • Immunoassays which can be used include e.g. ELISAs, Western blots, and other techniques known to those of ordinary skill in the art (see Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1999 and Edwards R, Immunodiagnostics: A Practical Approach, Oxford University Press, Oxford; England, 1999). Methods to generate antibodies exhibiting altered immunoreactivity with a mutated polypeptide relative to a corresponding unmutated polypeptide are described in more detail below.
  • microarrays e.g., SNP microarrays
  • protein-arrays e.g., SNP microarrays
  • antibody microarrays e.g., antibody microarrays
  • tissue microarrays e.g., tissue microarrays
  • electronic biochip or protein-chip based technologies see Schena M., Microarray Biochip Technology, Eaton Publishing, Natick, Mass., 2000.
  • nucleic acid-containing sequences may be amplified prior to or in conjunction with the detection methods noted herein.
  • the design of various primers for such amplification is known in the art.
  • a nucleic acid (RNA, cDNA, genomic DNA) comprising the mutation(s) may be amplified using primers hybridizing to sequences located on each side of the mutation(s).
  • Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, Am. Biotechnol. Lab. 8:14-25. Numerous amplification techniques have been described and can be readily adapted to suit particular needs of a person of ordinary skill.
  • Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the ⁇ replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1 177; Lizardi et al., 1988, BioTechnology 6:1 197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253-260; and Sambrook et al., 1989, supra).
  • amplification is carried out using PCR.
  • PCR Polymerase chain reaction
  • U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188 In general, PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected.
  • An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith.
  • the extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers.
  • the sample is analyzed to assess whether the mutation(s) to be detected is/are present. Detection of the amplified sequence may be carried out by visualization following Ethidium Bromide (EtBr) staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like.
  • EtBr Ethidium Bromide
  • Ligase chain reaction is carried out in accordance with known techniques (Weiss, 1991 , Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).
  • SDA Strand displacement amplification
  • Nucleic acid hybridization refers generally to the hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York,) and are commonly known in the art.
  • Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPCU, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1 % SDS at 42°C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3).
  • hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHP0 4 , 7% SDS, 1 mM EDTA at 65°C, and washing in 0.1 x SSC/0.1 % SDS at 68°C (see Ausubel, et al. (eds), 1989, supra).
  • a nitrocellulose filter can be incubated overnight at 65°C with a labeled probe specific to one or the other two alleles in a solution containing 50% formamide, high salt (5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 g/ml denatured carrier DNA (i.e.
  • the non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency).
  • Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York).
  • the selected temperature is based on the melting temperature (Tm) of the DNA hybrid (Sambrook et al. 1989, supra). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
  • the above-noted method further comprises obtaining or collecting a biological sample from a subject.
  • the above-noted sample can be from any source that contains biological material suitable for the detection of the mutation(s), such as genomic DNA, RNA (cDNA), and/or proteins, for example a tissue or cell sample from the subject (blood cells, lymph node cells, bone marrow cells, immune cells (e.g., lymphocytes), etc. that comprises leukemic cells (AML cells)).
  • the sample may be subjected to cell purification/enrichment techniques to obtain a cell population enriched in a specific cell subpopulation or cell type(s).
  • the sample may be subjected to commonly used isolation and/or purification techniques for enrichment in nucleic acids (genomic DNA, cDNA, mRNA) and/or proteins. Accordingly, in an embodiment, the method may be performed on an isolated nucleic acid and/or protein sample, such as isolated genomic DNA or cDNA sample.
  • the biological sample may be collected using any methods for collection of biological fluid, tissue or cell sample, such as venous puncture for collection of blood cell samples.
  • the present invention provides a method for determining whether one or more of the mutations or classes of mutations listed in Table 3 are associated with altered sensitivity of MLL leukemia cells to a drug or agent (e.g., a chemotherapeutic agent), said method comprising: (i) measuring the response (e.g.
  • the present invention provides a method for predicting the sensitivity of mixed- lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia) cells to a mitogen-activated protein kinase kinase (MEK) inhibitor or tyrosine kinase receptor (RTK) inhibitor, said method comprising: determining the presence of one or more of mutations in a member of the RAS pathway in said MLL leukemia cells; wherein the presence of said one or more mutations is indicative that said MLL leukemia cells are more sensitive to an MEK inhibitor and/or more resistant to an RTK inhibitor relative to MLL leukemia cells not comprising said one or more of mutations in the RAS pathway.
  • MLL leukemia mixed- lineage leukemia-rearranged acute myeloid leukemia
  • MEK mitogen-activated protein kinase kinase
  • RTK tyrosine kinase receptor
  • the term "member of the RAS pathway” as used herein refers to a protein involved in the signaling through the RAS-RAF-MEK-ERK pathway (also referred to as the "MAPK/ERK pathway”), which transmit the intracellular signal of activated receptor tyrosine kinases (RTKs).
  • Proteins involved in the RAS pathway include RTKs (FLT3, EGFR, etc.), RAS (HRAS, KRAS, NRAS), GRB2, SOS, SHP2 (PTPN11 ), SPRED1 , GAB2, and RAF (BRAF, RAF-1).
  • the mutation is a gain-of-function mutation in a gene encoding a positive regulator of the RAS pathway.
  • the mutation is a loss-of-function mutation in a gene encoding a negative regulator of the RAS pathway.
  • the mutation is in a gene encoding a protein that acts upstream of MEK in the RAS pathway.
  • the one or more mutations in a member of the RAS pathway are one or more mutations of the member of the RAS pathway listed in Table 3, e.g., KRAS, NRAS, PTPN11 and/or BRAF.
  • MEK inhibitor refers to an agent that inhibits the mitogen-activated protein kinase kinase enzymes MEK1 and/or MEK2, affect the MAPK/ERK pathway.
  • MEK inhibitors include Trametinib (GSK1 120212), Selumetinib, Binimetinib (MEK162), PD325901 , Refametinib (BAY 86- 9766), Pimasertib, Cobimetinib (XL518), CI-1040 (PD184352), AZD8330 (ARRY-424704), R04987655 (CH4987655), R05126766, WX-554, E6201 , and TAK-733. Examples of MEK inhibitors are also disclosed in Table 18 below.
  • RTK inhibitor refers to an agent that inhibits receptor tyrosine kinases such as an Epidermal Growth Factor Receptor (EGFR), such as Erb-B2 Receptor Tyrosine Kinase 2 (ErbB2/HER2), Fibroblast Growth Factor Receptor (FGFR), Platelet Derived Growth Factor Receptor (PDGFR), Vascular Endothelial Growth Factor Receptor (VEGFR), Aplastic Lymphoma Kinase (ALK), Focal Adhesion Kinase (FAK), Insulin-Like Growth Factor Receptor (IGF1 R and IGF2R), FMS-like receptor tyrosine kinase-3 (FLT3).
  • EGFR Epidermal Growth Factor Receptor
  • FGFR Fibroblast Growth Factor Receptor
  • PDGFR Platelet Derived Growth Factor Receptor
  • VEGFR Vascular Endothelial Growth Factor Receptor
  • ALK Aplastic Lymphoma Kina
  • RTK inhibitors examples include Afatinib, Axitinib, Cediranib (AZD-2171 ), Flt3 Inhibitor IV (CAS 819058-89- 4), Erlotinib, Gefitinib (ZD1839), Grandinin, Lapatinib, Lestaurtinib (CEP-701), Neratinib (HKI-272), Osimertinib/mereletinib (AZD9291), Pazopanib, Quizartinib (AC220), Regorafenib (BAY 73-4506), Semaxanib (SU5416), Sorafenib, Sunitinib (SU11248), Tivozanib (AV-951), ⁇ 8751 , Mubritinib (TAK-165) and Vandetanib. Examples of RTK inhibitors are also disclosed in Table 18 below.
  • the present invention provides administering a suitable therapy to a patient MLL- rearranged leukemia patient based on the above-mentioned sensitivity test.
  • the present invention provides a method for treating a patient diagnosed with mixed-lineage leukemia-rearranged (MLL) leukemia and at least one mutation in a member of the RAS pathway, comprising administering to said patient a Mitogen-activated protein kinase kinase (MEK) inhibitor, preferably Selumetinib and/or Trametinib.
  • MLK mixed-lineage leukemia-rearranged
  • MEK Mitogen-activated protein kinase kinase
  • the method comprises administering Selumetinib to said patient.
  • the method comprises administering Trametinib to said patient.
  • the method further comprises administering to said patient a Receptor Tyrosine Kinase (RTK) inhibitor (i.e. a combination therapy comprising a MEK inhibitor and an RTK inhibitor), preferably FLT3 inhibitor IV, VEGFR2 inhibitor Vl/Ki8751 , an EGFR inhibitor and/or Sorafenib.
  • RTK Receptor Tyrosine Kinase
  • the method further comprises administering FLT3 inhibitor IV to said patient.
  • the method further comprises administering VEGFR2 inhibitor Vl/Ki8751 to said patient.
  • the method further comprises administering an EGFR inhibitor to said patient.
  • the method further comprises administering Sorafenib to said patient.
  • the method comprises administering a combination of Selumetinib and VEGFR2 inhibitor Vl/Ki8751 to said patient. In another embodiment, the method comprises administering a combination of Selumetinib and Sorafenib to said patient. In another embodiment, the method comprises administering a combination of Trametinib and VEGFR2 inhibitor Vl/Ki8751 to said patient. In another embodiment, the method comprises administering a combination of Trametinib and Sorafenib to said patient.
  • the MEK inhibitor and RTK inhibitor may be administered or co-administered (e.g., consecutively, simultaneously, at different times) in any conventional dosage form.
  • Co-administration in the context of the present invention refers to the administration of more than one therapeutic in the course of a coordinated treatment to achieve an improved clinical outcome.
  • Such co-administration may also be coextensive, that is, occurring during overlapping periods of time.
  • a first agent e.g., MEK inhibitor
  • a second active agent e.g., RTK inhibitor
  • the agents may in an embodiment be combined/formulated in a single composition and thus administered at the same time.
  • the present invention provides a method for treating a patient diagnosed with mixed-lineage leukemia-rearranged ⁇ MLL) leukemia, the method comprising administering to said subject an effective amount of a compound having an EC50 below 10000 nM in at least one sample as set forth in Table 20 (Part A), or an analog thereof.
  • the compound or analog thereof has an EC50 below 5000 nM in at least one sample.
  • the compound or analog thereof has an EC50 below 4000 nM in at least one sample.
  • the compound or analog thereof has an EC50 below 3000 nM in at least one sample.
  • the compound or analog thereof has an EC50 below 2000 nM in at least one sample.
  • the compound or analog thereof has an EC50 below 1000 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 900 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 800 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 700 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 600 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 500 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 400 nM in at least one sample.
  • the compound or analog thereof has an EC50 below 300 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 200 nM in at least one sample. In embodiments, the compound or analog thereof has an EC50 below 100 nM, below 90 nm, below 80 nM, below 70 nM, below 60 nM, below 50 nM, below 40 nM, below 30 nM, or below 20 nM in at least one sample.
  • the compound is AZD-2014, AZD-8055, Dasatinib, the EGRF Inhibitor (CAS 879127-07-8), GDC- 0941 , Mubritinib, Quizartinib, R428, Selumetinib, Sorafenib Tosylate, Tanespimycin, Tipifarnib, Trametinib, Triciribine AKT inhibitor V, or an analog thereof.
  • the compound is Mubritinib or an analog thereof.
  • the present invention provides a method for treating a subject suffering from MLL leukemia or normal karyotype leukemia comprising administering to said subject an effective amount of Mubritinib or an analog thereof
  • the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemia), said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, in a leukemia cell sample from said subject: comparing said level of expression to a control/reference level of expression (e.g., expression in a non-MLL leukemia sample) and determining the likelihood that said subject suffers from MLL leukemia based on said comparison, wherein a differential expression of said at least one genes in said sample relative to said control sample is indicative that said subject has a high likelihood of suffering from MLL leukemia.
  • MLL leukemia Mixed-lineage leukemia-rearranged acute myeloid leukemia
  • a higher expression of said at least one genes depicted in Table 1 , and/or said at least one transcripts of SEQ ID NOs: 13-23, in said sample relative to a control non-MLL leukemia sample is indicative that said subject has a higher likelihood of suffering from MLL leukemia (i.e.
  • the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemia), said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Table 1 , and/or at least one of the transcripts of SEQ ID NOs: 13-23, in a leukemia cell sample from said subject: wherein a higher expression of said at least one genes in said sample relative to a control non-Mil. leukemia sample is indicative that said subject has a high likelihood of suffering from MLL leukemia (and vice versa).
  • MLL leukemia Mixed-lineage leukemia-rearranged acute myeloid leukemia
  • the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemiaj, said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Table 2 in a leukemia cell sample from said subject: wherein a lower expression of said at least one genes in said sample relative to a control non-M/l leukemia sample is indicative that said subject has a high likelihood of suffering from MLL leukemia (and vice versa).
  • MLL leukemiaj Mixed-lineage leukemia-rearranged acute myeloid leukemia
  • the present invention relates to a method for determining the likelihood that an AML sample is an MLL leukemia sample, said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Tables 1 and/or 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, in said AML sample: wherein a differential expression of said at least one genes in said sample relative to a control non-Mil leukemia sample is indicative that said sample has a high likelihood of being an MLL leukemia sample, and wherein a similar expression of said at least one genes in said sample relative to a control non-Mil leukemia sample is indicative that said sample has a low likelihood of being an MLL leukemia sample.
  • the above-noted method permits to determine whether a subject suffering from leukemia suffer from MLL leukemia or from another leukemia subgroup/subtype.
  • the present invention encompasses the determination of the level of expression of any gene/transcript or any combination/sub-combination of the genes/transcripts defined herein (e.g., those depicted in Tables 1 and/or 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23), for example the determination of the level of expression of a single gene, or of 2, 3, 4, 5 or more of the genes defined herein.
  • the detection of the level of expression overexpressed in MLL leukemia may be used to perform treatment/disease follow-up in a patient, for example to assess minimal residual disease (MRD) in a patient.
  • MLL leukemia minimal residual disease
  • MRD minimal residual disease
  • MRD MRD Assessment of MRD is useful, for example, for determining whether treatment has eradicated the leukemia or whether traces remain, comparing the efficacy of different treatments, monitoring patient remission status as well as detecting recurrence of the leukemia, and choosing the treatment that will best meet those needs.
  • the present invention provides a method for assessing MRD in a subject (e.g., a patient undergoing anti-leukemia therapy or who previously underwent anti-leukemia therapy for MLL leukemia), the method comprising determining/measuring the level of expression of at least one of the genes depicted in Table 1 , and/or at least one of the transcripts of SEQ ID NOs: 13-23, in a cell sample (e.g., blood cell sample) from said subject: wherein a higher expression of said at least one genes in said sample relative to a control non-Mil.
  • a subject e.g., a patient undergoing anti-leukemia therapy or who previously underwent anti-leukemia therapy for MLL leukemia
  • a cell sample e.g., blood cell sample
  • the method comprises determining/measuring the level of expression of CASC10 in the sample, for example using at least one of the primers/probes described below (SEQ ID NOs: 7-9).
  • the method comprises assessing MRD in a patient as defined above, and if MRD is detected, administering a suitable therapy to the patient.
  • the treatment/disease follow-up e.g., assessment of MRD, is performed periodically over a period of time, for example every week, every two weeks, every month, every two months, every six months or every year.
  • the determination of the expression of the one or more genes, transcripts or encoded gene products (e.g., mRNA, protein) listed above may be performed using any known methods to detect nucleic acids or proteins based on the reference ID in the EnsembI database for the genes defining the expression signature of MLL leukemia depicted in Table 1 and Table 2.
  • the expression is compared to a control or reference level (e.g., the level obtained a sample from a non-M/l leukemia sample) to assess the subject's likelihood of suffering from MLL leukemia, or the likelihood that the AML sample is an MLL leukemia sample.
  • nucleic acid amplification methods can be used to detect the level of expression of the one or more genes.
  • oligonucleotide primers and probes (which may be designed based on the known sequences of the genes and corresponding transcripts) may be used in amplification and detection methods that use nucleic acid substrates isolated by any of a variety of well-known and established methodologies (e.g., Sambrook et al., Molecular Cloning, A laboratory Manual, pp.
  • Methods for amplifying nucleic acids include, but are not limited to, for example the polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) (see e.g., U.S. Pat. Nos.
  • PCR polymerase chain reaction
  • RT-PCR reverse transcription PCR
  • ligase chain reaction LCR
  • SDA strand displacement amplification
  • tSDA Thermophilic SDA (tSDA) (see e.g., European Pat. No. 0 684 315) and methods described in U.S. Pat. No. 5,130,238; Lizardi et al., BioTechnol.
  • the methods include the use of Transcription Mediated Amplification (TMA), which employs an RNA polymerase to produce multiple RNA transcripts of a target region (see, e.g., U.S. Pat. Nos. 5,480,784; 5,399,491 and U.S. Publication No. 2006/46265).
  • TMA Transcription Mediated Amplification
  • the levels of nucleic acids may also be measured by "Next Generation Sequencing" (NGS) methods, such as RNA sequencing.
  • the nucleic acid or amplification product may be detected or quantified by hybridizing a labeled probe to a portion of the nucleic acid or amplified product.
  • the labeled probe contains a detectable group that may be, for example, a fluorescent moiety, chemiluminescent moiety, radioisotope, biotin, avidin, enzyme, enzyme substrate, or other reactive group.
  • Other well-known detection techniques include, for example, gel filtration, gel electrophoresis and visualization of the amplicons, and High Performance Liquid Chromatography (HPLC).
  • HPLC High Performance Liquid Chromatography
  • the level of amplified product is detected as the product accumulates.
  • the expression of the one or more genes, transcripts or encoded gene products is measured at the protein level.
  • Methods to measure the amount/level of proteins are well known in the art. Protein levels may be detected directly using a ligand binding specifically to the protein, such as an antibody or a fragment thereof.
  • a binding molecule or reagent e.g., antibody
  • is labeled/conjugated e.g., radio-labeled, chromophore-labeled, fluorophore-labeled, or enzyme-labeled to facilitate detection and quantification of the complex (direct detection).
  • protein levels may be detected indirectly, using a binding molecule or reagent, followed by the detection of the [protein/ binding molecule or reagent] complex using a second ligand (or second binding molecule) specifically recognizing the binding molecule or reagent (indirect detection).
  • a second ligand may be radio-labeled, chromophore- labeled, fluorophore-labeled, or enzyme-labeled to facilitate detection and quantification of the complex.
  • Enzymes used for labeling antibodies for immunoassays are known in the art, and the most widely used are horseradish peroxidase (HRP) and alkaline phosphatase (AP).
  • binding molecules or reagents include antibodies (monoclonal or polyclonal), natural or synthetic ligands, and the like.
  • Examples of methods to measure the amount/level of protein in a sample include, but are not limited to: Western blot, immunoblot, enzyme-linked immunosorbent assay (ELISA), "sandwich” immunoassays, radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance (SPR), chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical (IHC) analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, microcytometry, microarray, antibody array, microscopy (e.g., electron microscopy), flow cytometry, proteomic-based assays, and assays based on a property or activity of the protein including but not limited to ligand binding or interaction with other protein partners, enzymatic activity, fluorescence.
  • ELISA enzyme-linked immunosorbent assay
  • RIA radioimmunoassay
  • SPR surface plasmon
  • the level or activity of the protein of interest may be determined by the measuring the level of phosphorylation of the target in the presence of the test compound. If the protein of interest is a transcription factor known to induce the expression of one or more given target gene(s), the level or activity of the protein of interest may be determined by the measuring the level of expression of the target gene(s).
  • the reference or control level of expression and/or activity is a level measured in a non-Mil. leukemia sample (an AML sample from another AML subtype or a mixture of other AML subtypes).
  • Control level or “reference level” or “standard level” are used interchangeably herein and broadly refers to a separate baseline level measured in a comparable "control" sample, which is generally from a subject not suffering from the disease ⁇ MLL leukemia), for example an AML sample from another AML subtype (or a mixture of other AML subtypes).
  • the corresponding control level may be a level corresponding to an average or median level calculated based of the levels measured in several reference or control subjects (e.g., a pre-determined or established standard level).
  • the control level may be a pre-determined "cut-off value recognized in the art or established based on levels measured in samples from one or a group of control subjects.
  • control level may be adjusted or normalized for age, gender, race, or other parameters.
  • the "control level” can thus be a single number/value, equally applicable to every patient individually, or the control level can vary, according to specific subpopulations of patients. Thus, for example, older men might have a different control level than younger men, and women might have a different control level than men.
  • the predetermined standard level can be arranged, for example, where a tested population is divided equally (or unequally) into groups, such as a low-risk group, a medium-risk group and a high-risk group or into quadrants or quintiles, the lowest quadrant or quintile being individuals with the lowest risk (i.e., lowest level of expression of the one or more genes) and the highest quadrant or quintile being individuals with the highest risk (i.e., highest level of expression of the one or more genes).
  • the control levels according to the invention may be, in addition to predetermined levels or standards, levels measured in other samples (e.g. from healthy/normal subjects, or cancer patients) tested in parallel with the experimental sample.
  • the reference or control levels may correspond to normalized levels, i.e. reference or control values subjected to normalization based on the expression of a housekeeping gene (e.g. number of copy of the tested gene per number of copy of housekeeping gene).
  • Higher expression or “higher level of expression” as used herein refers to (i) higher expression of the one or more of the above-mentioned genes (protein and/or mRN A/transcript) in one or more given cells present in the sample (relative to the control) and/or (ii) higher amount of cells expressing the one or more genes in the sample (relative to the control).
  • “Lower expression” or “lower level of expression” as used herein refers to (i) lower expression of the one or more genes (protein and/or mRNA/transcript) in one or more given cells present in the sample (relative to the control) and/or (ii) lower amount of cells expressing the one or more genes in the sample (relative to the control).
  • higher or lower refers to a level of expression that is at least one standard deviation above or below the control level (e.g., the predetermined cut-off value) (e.g.
  • a “similar expression” or “similar level of expression” refers to a level of expression that is less than one standard deviation above or below the control level (e.g., the predetermined cut-off value) (e.g. that is not statistically significant as determined using a suitable statistical analysis).
  • higher or lower refers to a level of expression that is at least 1 .5, 2, 2.5, 3, 4 or 5 standard deviations above or below the control level (e.g., the predetermined cut-off value), and a "similar expression” or “similar level of expression” refers to a level of expression that is less than 1.5, 2, 2.5, 3, 4 or 5 standard deviation above or below the control level (e.g., the predetermined cut-off value).
  • higher expression refers to an expression that is at least 50% higher in the test sample relative to the control level.
  • “lower expression” refers to an expression that is at least 20, 25, 30, 35, 40, 45, or 50% lower in the test sample relative to the control level.
  • similar expression refers to an expression that varies by less than 20, 15, or 10% between the test sample and the control level. In another embodiment, higher or lower refers to a level of expression that is at least 2-, 5-, 10-, 25-, or 50-fold higher or lower in the test sample relative to the control sample.
  • the method described herein further comprises obtaining or collecting a biological sample from a subject.
  • the sample can be from any source that contains biological material suitable for the detection of the nucleic acid(s), such as genomic DNA, RNA (cDNA), and/or proteins, for example a tissue or cell sample from the subject (blood cells, immune cells (e.g., lymphocytes), bone marrow cells, etc. that comprises leukemic cells (AML cells).
  • the sample may be subjected to cell purification/enrichment techniques to obtain a cell population enriched in a specific cell subpopulation or cell type(s).
  • the sample may be subjected to commonly used isolation and/or purification techniques for enrichment in nucleic acids (genomic DNA, cDNA, mRNA) and/or proteins. Accordingly, in an embodiment, the method may be performed on an isolated nucleic acid and/or protein sample, such as cDNA.
  • the biological sample may be collected using any methods for collection of biological fluid, tissue or cell sample, such as venous puncture for collection of blood cell samples.
  • the term "biological sample comprising leukemic cells” as used herein refers to a crude leukemic cell sample, a sample enriched in certain cells (i.e., that has been subjected to cell purification/enrichment techniques), or isolated nucleic acids (RNA, cDNA, genomic DNA, subjected or not to nucleic acid amplification) and/or proteins from leukemic cells.
  • the biological sample comprising leukemic cells comprises nucleic acids (RNA, cDNA, genomic DNA) obtained or isolated from leukemic cells.
  • methods of diagnosis described herein may be at least partly, or wholly, performed in vitro. In a further embodiment, the method is wholly performed in vitro.
  • the method described herein comprises generating cDNA.
  • the method described herein comprises an assay involving amplification and/or hybridization of a nucleic acid molecule.
  • the method/assay described herein involves polymerase chain reaction (PCR).
  • the method/assay described herein involves RNA or exome sequencing.
  • the above-mentioned method comprises a step of normalizing the gene expression levels, i.e. normalization of the measured levels of the above-noted genes against a stably expressed control gene (or housekeeping gene) to facilitate the comparison between different samples.
  • Normalizing or “normalization” as used herein refers to the correction of raw gene expression values/data between different samples for sample to sample variations, to take into account differences in "extrinsic” parameters such as cellular input, nucleic acid (RNA) or protein quality, efficiency of reverse transcription (RT), amplification, labeling, purification, etc., i.e. differences not due to actual "intrinsic” variations in gene expression by the cells in the samples.
  • Such normalization is performed by correcting the raw gene expression values/data for a test gene (or gene of interest) based on the gene expression values/data measured for one or more "housekeeping” or “control” genes, i.e. whose expressions are known to be constant (i.e.
  • the above-mentioned method further comprises measuring the level of expression of a housekeeping gene in the biological sample.
  • Suitable housekeeping genes are known in the art and several examples are described in WO 2014/134728.
  • the method further comprises measuring the level of expression of one or more housekeeping genes in a biological sample from the subject.
  • the level of expression of the housekeeping gene is measured and the method comprises amplifying a housekeeping gene nucleic acid using a suitable pair of primers.
  • the housekeeping gene used for normalization is ABL1.
  • Suitable pairs of primers may be designed based on the nucleotide sequence of ABU, which may be found in GenBank Accession No.
  • the pair of primer comprises a first primer comprising at least 10 nucleotides of the sequence of SEQ ID NO:4 and a second primer comprising at least 10 nucleotides of the sequence of SEQ ID NO:5.
  • the above-mentioned method comprises a step of detection or quantification of the housekeeping gene nucleic acid (e.g. ABU) with a probe.
  • the housekeeping gene is ABU and the probe comprises at least 10 nucleotides of the sequence of SEQ ID NO: 6.
  • the above-mentioned methods may be combined with other markers, assays, methods and criteria for characterizing, diagnosing or prognosing MLL leukemias, i.e. genotypic/phenotypic features, chromosomal rearrangement, clinical features, etc.
  • the method comprises evaluating the cytology of the cells, e.g., blood or bone marrow cells.
  • the method comprises evaluating the size and number of MLL leukemic cells, evaluating the type of lymphocytes are affected, or evaluating whether changes appear in the chromosomes of MLL leukemic cells.
  • the above-mentioned methods further comprise selecting and/or administering a course of therapy or prophylaxis to said subject in accordance with the diagnostic/prognostic result. For example, if it is determined that the subject has a high likelihood of suffering from MLL leukemia, a more aggressive or an treatment regimen adapted for treatment of MLL leukemia may be used (and/or a treatment regimen known to be ineffective in such patients is avoided).
  • the methods further comprise subjecting the subject to a suitable anti-MLL leukemia therapy (e.g., bone marrow or hematopoietic stem cell transplantation, chemotherapy, etc.).
  • a suitable anti-MLL leukemia therapy e.g., bone marrow or hematopoietic stem cell transplantation, chemotherapy, etc.
  • the present invention provides a method for treating a patient with mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising: administering to the patient a suitable treatment for MLL leukemia in a subject identified using one or more of the methods described herein.
  • the above-mentioned method further comprises identifying a patient suffering from MLL leukemia using the methods defined above, i.e., by performing the methods.
  • the an ⁇ i-MLL leukemia treatment/therapy comprises chemotherapy, immunotherapy, radiation, bone marrow transplant, stem cell transplant, cord blood transplant, or a combination thereof.
  • the present invention provides a method for determining the chromosomal rearrangement in a subject suffering from mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising determining the expression profile one or more of the genes/transcripts depicted in Tables 11-16 in an MLL leukemia sample, wherein (i) an expression profile of the one or more of genes/transcripts depicted in Table 11 (1 1 a and/or 1 1 b) is indicative of MLL-MLLT4 rearrangement; (ii) an expression profile of the one or more of genes/transcripts depicted in Supplementary Table 12 (12a and/or 12b) is indicative of MLL-MLLT3 rearrangement; (iii) an expression profile of the one or more of genes/transcripts depicted in Table 13 (13a and/or 13b) is indicative of MLL-SEPT9 rearrangement; (iv) an expression profile of the one or more of genes/
  • the method comprises determining the level of expression of at least one of NKX2-3, PCDH9, NKX5-1, NKX2-5, MECOM, P2RY1, IL12RB2, SOX11, SP7, MSLN, BAALC, PROM1, IRX3, MKX, HOXB8, POU4F2 and FOXC1 in a leukemia cell sample from said subject, wherein
  • a higher expression of NKX2-3, MECOM, PCDH9, P2RY1 and/or IL12RB2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT4 rearrangement
  • a higher expression of NKX5-1, and/or a lower expression of MECOM and/or PROM1 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT3 rearrangement
  • a higher expression of NKX2-5 and/or MYF6, and/or a lower expression of BAALC, in said leukemia cell sample relative to a control sample is indicative of MLL-SEPT9 rearrangement
  • a higher expression of SP7 in said leukemia cell sample relative to a control sample is indicative of an MLL-ENL rearrangement
  • a higher expression of FOXC1 and/or or a lower expression of MSLN in said leukemia cell sample relative to a control sample is indicative of MLL-ELL rearrangement
  • a higher expression of PROM1, IRX3, MKX, HOXB8, and/or POU4F2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT10 rearrangement
  • a higher expression of SOX11 in said leukemia cell sample relative to a control sample is indicative of MLL-ENL or MLL-MLLT10 rearrangement.
  • the expression profile one or more of the genes/transcripts may be determined using any of the above-noted methods, for example at the nucleic acid level by RNA sequencing.
  • the present inventors have also identified a novel cryptic fusion representing an in frame translocation between exon 6 (according to transcript NM_005933) of MLL and exon 4 of ENAH.
  • This novel MLL-ENAH transcript encodes a protein of 1685 amino acids, in which the AT hook and CXXC zinc finger motifs of MLL are fused to the actin-binding EVH2 domain of ENAH.
  • the present invention provides a method for detecting a MLL-ENAH fusion in a sample (e.g., a leukemia cell sample), said method comprising contacting said sample with one or more oligonucleotide suitable for detecting MLL-ENAH fusion, for example by amplification, hybridization, sequencing or any other suitable method (e.g., any of the methods described above).
  • a sample e.g., a leukemia cell sample
  • oligonucleotide suitable for detecting MLL-ENAH fusion for example by amplification, hybridization, sequencing or any other suitable method (e.g., any of the methods described above).
  • the present invention provides a method for detecting a MLL-ENAH fusion in a sample (e.g., a leukemia cell sample), said method comprising contacting said sample with a first oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 to 1212 of the MLL protein, or to a complement thereof, and a second oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 17 to 591 of the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
  • a sample e.g., a leukemia cell sample
  • the first oligonucleotide hybridizes to a sequence of nucleotides in bold in Fig. 3G, or to the complement thereof.
  • the second oligonucleotide hybridizes to a sequence of nucleotides in italics in Fig. 3G, or to the complement thereof.
  • the present invention provides a method for detecting a MLL-ENAH fusion in a sample (e.g., a leukemia cell sample), said method comprising contacting said sample with an oligonucleotide that spans the junction between MLL and ENAH, i.e. that comprises a first portion that hybridizes to a nucleotide sequence derived from MLL, or to a complement thereof, and a second portion that hybridizes to a nucleotide sequence derived from ENAH, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
  • the oligonucleotide hybridizes to a sequence encompassing contiguous nucleotides in bold, underlined and in italics in Fig. 3G.
  • the present invention provides a method for detecting a MLL-ENAH fusion in a sample, said method comprising contacting said sample with an oligonucleotide comprising a first domain that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein (e.g., a sequence of nucleotides in bold in Fig. 3G), or to a complement thereof, and a second domain that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein (e.g., a sequence of nucleotides in italics in Fig. 3G) or to a complement thereof, under conditions suitable for nucleic acid hybridization.
  • an oligonucleotide comprising a first domain that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein (e.g., a sequence of nucleotides in bold in Fig. 3G), or to a complement thereof, and a second domain
  • said first oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof.
  • said second oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
  • said first domain hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof, and said second domain hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
  • the present invention provides a method for detecting a MLL-ENAH fusion in a sample, said method comprising performing a sequencing reaction on said sample with (i) a MLL-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the ENAH protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample; and/or (ii) a ENAH- specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the MLL protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample.
  • said MLL-specific oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof.
  • said ENAH-specific oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
  • the present invention provided an assay mixture for the assessment of MLL leukemia (e.g., for the diagnosis of MLL leukemia), the mixture comprising: a sample from a subject suspected of suffering from MLL leukemia; and reagents for detecting determining/measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, , and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least one of mutations set forth in Table 3.
  • the present invention provided a system for the assessment of MLL leukemia (e.g., for the diagnosis of MLL leukemia), the system comprising: a sample from a subject suspected of suffering from MLL leukemia; and one or more assays for detecting determining/measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least one of mutations set forth in Table 3.
  • the present invention further provides a kit for the assessment of MLL leukemia (e.g., for the diagnosis of MLL leukemia), the kit comprising: (i) one or more reagents for determining/measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least one of mutations set forth in Table 3, in a biological sample.
  • the kit comprises reagents for detecting the level of expression of at least 2, 3, 4, or 5 of the genes listed in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least 2, 3, 4, or 5 of the mutations set forth in Table 3, in a biological sample.
  • the one or more reagents comprise, for example, primer(s), probe(s), antibody(ies), solution(s), buffer(s), nucleic acid amplification reagent(s) (e.g., DNA polymerase, DNA polymerase cofactor, dNTPs), nucleic acid hybridization/detection reagent(s), and/or reagents for detecting antigen-antibody complexes, etc.
  • nucleic acid amplification reagent(s) e.g., DNA polymerase, DNA polymerase cofactor, dNTPs
  • nucleic acid hybridization/detection reagent(s) e.g., DNA polymerase, DNA polymerase cofactor, dNTPs
  • nucleic acid hybridization/detection reagent(s) e.g., DNA polymerase, DNA polymerase cofactor, dNTPs
  • nucleic acid hybridization/detection reagent(s) e.g.
  • the assay mixture or kit comprises one or more probes for detecting one or more nucleic acids correspond to the gene(s) depicted in Table 1 , Table 2 and/or Table 3, and/or at least one of the transcripts of SEQ ID NOs: 13-23.
  • the assay mixture or kit further comprises one or more reagents for determining/measuring the level of expression of at least one normalization/housekeeping gene (e.g., ABL1) in the sample. Examples of suitable pair of primers for amplifying a ABL1 nucleic acid, and of suitable probes for detecting a ABL1 nucleic acid, are described herein.
  • Such reagents probes, primers, antibodies, etc.
  • suitable detectable tags such as quenchers, chromophores, fluorophores, etc. to facilitate detection of the genes, transcripts or proteins of interest.
  • the kit may be divided into separate packages or compartments containing the respective reagent components explained above.
  • kits may optionally comprise one or more of the following: (1) instructions for using the reagents for the diagnosis of MLL leukemia; (2) one or more containers; and/or (3) appropriate controls/standards.
  • a kit can include reagents for collecting a biological sample from a patient and reagents for processing the biological sample.
  • the kits featured herein can also include an instruction sheet describing how to perform the assays for measuring gene expression.
  • the instruction sheet can also include instructions for how to determine a reference cohort (control patient population), including how to determine expression levels of genes in the reference cohort and how to assemble the expression data to establish a reference for comparison to a test patient.
  • the instruction sheet can also include instructions for assaying gene expression in a test patient and for comparing the expression level with the expression in the reference cohort to subsequently determine the appropriate treatment regimen for the test patient.
  • kits or assay mixture described herein for the diagnosis of MLL leukemia.
  • BACs were selected from the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgGateway) and obtained from BACPAC Resources Center (Children's Hospital Oakland Research Institute, Oakland, CA; http://bacpac.chori.org/). BAC probes were validated on normal metaphases and labeled with Spectrum Orange-dUTP by nick translation according to manufacturer's instructions (Abbott Molecular, Nick Translation kit 07J00-001), denatured and hybridized on pretreated slides.
  • FISH signals were captured using CytoVision® software version 4.02 (Leica Microsystems). Samples harboring an ML., translocation detected by standard cytogenetic analysis and/or presenting a typical FISH signal patterns were included in the MLL-F AML cohort.
  • RNA and DNA isolation were isolated from primary AML cells using Trizol® reagent according to the manufacturer ' s instructions (lnvitrogen®/Life Technologies®) with an additional purification on RNeasy® mini columns (Qiagen®) to obtain high quality RNA. DNA was isolated and purified using DNeasy® protocols (Qiagen®).
  • Variants were identified using Casava 1.8.2 and fusions or larger mutations such as partial tandem duplications with Tophat 2.0.7 and Cufflinks 2.1 .1 . All mutations in 55 leukemia-associated genes listed in Table 23 were analyzed as previously reported 38 . All variants reported had a variant allelic frequency (VAF) > 20%, >8 variant reads, ⁇ 20 total reads and a quality score ⁇ 20. Because NRAS, KRAS and FLT3 mutations are commonly found in minor clones 1 1 , a VAF of ⁇ 5% was tolerated if ⁇ 8 variant reads were present in "hotspots" of those genes.
  • VAF variant allelic frequency
  • Transcript levels are given as Reads Per Kilobase per Million mapped reads (RPKM) and genes are annotated according to RefSeq annotations (UCSC, April 16 th , 2014).
  • AML cells represented less than 80% of the bone marrow population
  • positive selection with an anti-CD33 was performed before RNA sequencing.
  • a fraction of the cells was not injected in mice but rather maintained in myeloid culture for RNA-sequencing at day 80 (labeled MLL-AF9 in Fig. 3F).
  • Plasmid standard curves were developed following the guidelines of the Europe against Cancer program 40 . Plasmids were obtained from Life Technologies®. According to the molecular weight of each plasmid (vector backbone pMA- T), 20 g were linearized with the Seal restriction enzyme for 1 h at 37°C. The digested plasmid was serially diluted in a Tris-EDTA solution (pH 8.0) containing 100 ng/ ⁇ of yeast tRNA (Sigma-Aldrich®). Six successive dilutions (200 000, 20 000, 2000, 200, 20 and 2 copies/ ⁇ ) were prepared and stored in 100 ⁇ aliquots at - 20°C.
  • the LOC100289656 (NR_036475.2) cDNA was amplified using the following forward: 5'- TGGGTTGTTAGCTCCAGATCA-3' (SEQ ID NO: 1) and reverse: 5'-AAACTGCACCTCCCCTCTTC-3' (SEQ ID NO: 2) primers. Sequence of the probe was: 5'-ACTCCTGATTTGGAAAAAGCTTCTTGAA-3' (SEQ ID NO: 3).
  • ABL1 -Forward 5'-TGGAGATAACACTCTAAGCATAACTAAAGGT-3' (SEQ ID NO: 4)
  • ABL1 -Reverse 5'- GATGTAGTTGCTTGGGACCCA-3' (SEQ ID NO: 5)
  • ABL1-Pmbe CCATTTTTGGTTTGGGCTTCACACCATT (SEQ ID NO: 6).
  • Amplification conditions were 2 min at 50°C and 10 min at 95°C, followed by 50 cycles of 15 sec at 95°C and 35 sec at 62°C. All samples were tested in duplicate.
  • IMDM IMDM
  • BIT bovine serum albumin, insulin, transferrin; Stem Cell Technologies®
  • 100 ng/mL SCF 100 ng/mL FLT3-L
  • 20 ng/mL IL-3 20 ng/mL G-CSF (Shenandoah®)
  • 10 "4 M ⁇ -mercaptoethanol 500nM SR1 (Alichem®), 500nM UM729 (synthesized at the Medicinal Chemistry Core Facility at the Institute for Research in Immunology and Cancer (IRIC)
  • gentamicin 50 ⁇ g/mL
  • ciprofloxacin 10 g/mL
  • EC50 or suboptimal EC25 values were calculated using ActivityBase® SARview Suite (IDBS, London, UK) and GraphPad® Prism 4.03 (La Jolla, CA, USA).
  • GSEA Gene Set Enrichment Analysis
  • WBC white blood cells
  • FAB French-American-British
  • t-AML therapy- related acute myeloid leukemia.
  • Table 6 Cytogenetic distribution of the non-JWLL-F AML cohort.
  • Table 7 Chromosomal breakpoints of MLL-F samples detected by RNA-sequencinq.
  • Table 8 84 overexpressed genes in MLL-F AML. Genes included in gene set enrichment datasets are
  • Table 9 56 underexpressed genes in MLL-F AML. Genes included in gene set enrichment datasets are indicated
  • Fig. 1A The HOXA/HOXB clusters were among the most discriminatory genes (Fig. 1A). Expression of other discriminatory genes is shown in Fig. 1 B. Gene set enrichment analysis identified strong enrichment for published sets of MLL-F leukemias, thus confirming an overlap between the instant data and existing microarray datasets (Tables 8-10) 5 8 . Detailed analyses of the 2 major subgroups ⁇ MLL-MLLT4 and MLL- MLLT3) (Tables 11-12) revealed that the homeobox NKX2-3 and NKX5-1 genes (also termed HMX3) were the most discriminatory (Figs. 2A-2C). Likewise, MECOM expression discriminated MLL-MLLT4, as previously reported 9 .
  • NKX2-5 was the single most preferentially expressed gene in the MLL-SEPT9 subgroup, which included 2 specimens (Table 13)).
  • Tables 14 to 16 show the genes showing differential expression in MLL-MLLT10, MLL-ELL and MLL-ENL, respectively.
  • Table 10 Geneset enrichments associated to MLL-F AML. Sets enriched for genes over- (a) and underexpressed (b) in MLL-F AMLs.
  • GSEA Gene Set Enrichment Analysis
  • POETIC STEM CEL hematopoietic stem cells, 15 316 7.45 x10-22 3.52 x10-i 8 L_UP HSC) compared to the CD133- cells.
  • the 'MLL signature 1 ' genes
  • AML acute myeloid leukemia
  • AML acute myeloid leukemia
  • Table 12b Genes underexpressed in MLL-MLLT3 AMLs.
  • PALM / ENSG00000099864 0,04099 2,60 4,03 -1,43
  • PROK2 / ENSG00000163421 0,037714 3,41 4,78 -1,37 X
  • Table 15 List of genes up- and down-regulated in MLL-ELL
  • Table 16 List of genes up- and down-regulated in MLL-ENL
  • NKAIN2/ENSG00000188580 0.987234 1.57 3.52 -1.95
  • FIGN / ENSG00000182263 0.987811 0.52 2.04 -1.53
  • CASC10 was also among the most overexpressed genes in MLL-F AML vs. non- lL-F AML samples, and thus an RT-qPCR assay was developed.
  • the CASC10 RT-qPCR assay was developed using the QuantStudioTM 7 system (QS7, ABI) in the fast mode (Fast Advanced MasterMixTM, Life Technologies®). The following primers, probe and cycling conditions were used:
  • Fig. 5C shows the good correlation between RNA-Seq data (Log (RPKM + 0.0001 )) and RT-qPCR assays for CASC10 expression in 33 MLL-F AML samples.
  • Fig. 5D shows that a significantly higher expression of CASC10 was measured in MLL-F AML samples relative to normal peripheral blood samples (p valueO.0001 , Student t test).
  • the 4 th cryptic fusion is novel, and represents an in frame translocation between exon 6 (according to transcript NM_005933) of MLL and exon 4 of ENAH (Fig. 3D). Confirmation of this new rearrangement and fusion transcript is provided in Fig. 6B.
  • This novel MLL-ENAH transcript encodes a protein of 1685 amino acids, in which the AT hook and CXXC zinc finger motifs of MLL are fused to the actin-binding EVH2 domain of ENAH 18 (Fig. 3D).
  • the nucleotide and amino acid sequences of the fused regions of MLL (N-terminal, in bold) and ENAH (C-terminal, in italics) are depicted in Fig. 3G.
  • LOC100289656 expression also identifies MLL PTD leukemias
  • LOC100289656 is edopically expressed in an experimental model of MLL-F AML
  • LOC100289656 is not expressed in normal bone marrow, cord blood, peripheral blood cells (Fig. 4B (using qRT-PCR) and Fig. 7 (using NGS)), nor in the majority of control leukemias not rearranged for MLL (Fig. 3C), suggesting that this gene may be under the direct or indirect regulation of MLL fusion genes.
  • human CD34 + cord blood cells were transduced with an MLL-AF9 virus and LOC100289656 expression was determined by NGS after transduction and also upon development of AML in vivo in immunocompromised NSG mice. Results showed a 77- and a >500-fold upregulation of this gene in these 2 conditions, respectively, (Fig. 3F) establishing a functional link between MLL-fusions and LOC100289656 expression, thus strengthening the validity of this marker in MLL-F AML.
  • Table 17 Detailed mutations identified in MLL-t AML.
  • the chemical screen allowed further characterization of proliferation/survival of MLL-F leukemic cells in vitro. Although no major difference was detected between the transcriptomes of MLL-F RAS-WT and MLL-F RAS-MU1 patient cells (Fig. 13), their responses to small inhibitory molecules were distinct. This finding highlights how transcriptional and chemical analyses can reveal complementary biological information.
  • Table 18 Suppliers, characteristics and ordering numbers for the compounds tested in the single- agent chemical screen
  • Tyrosine Kinase Inhibitor RTK FGFR and VEGFR Calbiochem 341607-5MG PD173074
  • OSI-906 (Linsitinib) RTK IGFI R and InsR Selleckchem S1091 p38 MAP Kinase Inhibitor
  • Table 19 List of the MLL-F AML samples used in chemical screens with clinical characteristics
  • Table 20 List of EC50 values in nM obtained for the 20 AML patient samples used in the single-agent chemical screen shown in Figs. 11A-C. MEK inhibitors are in italics.
  • Table 21 List of discriminatory inhibitors resulting from the comparison of M.L-F RAS-WT with M.L-F
  • MEK inhibitors are in italics.
  • Table 22 List of discriminatory inhibitors resulting from the comparison of NK RAS-WT with NK RAS- MUT patient cells and corresponding statistics.
  • NK Normal karyotype.
  • AVERAGE ECso (nM) AVERAGE ECso (nM) MEDIAN P-VALUE
  • Table 23 List of leukemia associated genes.
  • Table 24 Lists of variants identified in the MLL-F AML cohort, (left) Genes with variants in ⁇ 10% (3/31 ) of MLL-F AMLs, all investigated by Sanger sequencing of non-tumoral DNA. Genes found to have non recurrent somatic mutations (ZSCAN29 and PAK4: 1/3 somatic mutation and 2/3 germline variant each) were not included in Fig. 8A. (right) Genes with variants in 2/30 samples, not investigated by non-tumoral DNA
  • NCOR2 4 ACD CHD1 L GCC2 MED1 POLD1 TTLL5
  • Table 25 List of approximate average EC25 concentrations determined from Fig. 11 for MLL-F RAS- ⁇ NT and MLL-F RAS-Mlil patient cells, used for the chemical screen shown in Fig. 12.
  • Table 26 Gene isoforms expression for MLL-F AML subtype.
  • the isoform list was generated based on two parameters: (1 ) the ratio was calculated between the 10 th percentile expression value of the test group (i.e. MLL-F AMLs without relapse samples) and the 90 th percentile control group (all other AMLs without relapse samples). This ratio is under the column headed "factor_10_90" (2) All transcripts without significant expression differences were removed and then ranked by the factor_10_90 value.

Abstract

Genes exhibiting specific mutational and/or transcriptional patterns in mixed-lineage leukemia- rearranged acute myeloid leukemia (MLL leukemia) relative to other types of AMLs are disclosed. The use of these mutational and/or transcriptional patterns for the diagnosis, prognosis, characterization and/or treatment of MLL leukemia is also disclosed.

Description

MARKERS FOR MLL-REARRANGED ACUTE MYELOID LEUKEMIAS AND USES THEREOF
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] The present application claims the benefit of United States provisional application serial No. 62/132,114 filed on March 12, 2015, which is incorporated herein by reference in its entirety.
FIELD OF THE INVENTION
[0002] The present invention relates to acute myeloid leukemias (AMLs), and more particularly to the diagnosis/prognosis of mixed lineage leukemia (MLLJ-rearranged acute myeloid leukemias [MLL leukemias).
BACKGROUND OF THE INVENTION
[0003] The Mixed Lineage Leukemia {MLL, also termed KMT2A) gene on chromosome band 11 q23 is rearranged in approximately 5 to 10% of adult acute myeloid leukemias (AML) (hereafter called MLL-fusion or MLL-F leukemias). This large gene (-90 kb) encodes for a histone methyltransferase protein of 3968 amino acids that methylates H3K4 and acetylates H4K16. At least 120 different MLL rearrangements have been described of which the following genes are the most frequent MLL translocation partners: MLLT3 {AF9), MLLT4 {AF6), ELL, MLLT10 {AF10) and MLLT1 {ENL)1. With the exception of MLL-MLLT3 fusion, MLL leukemias are typically associated with an adverse outcome. Thus far, only a limited number of MLL leukemia samples (n=1 1) has been characterized by Next Generation Sequencing (NGS) by The Cancer Genome Atlas (TCGA) Research Network3, not allowing a comprehensive identification of mutations in this genetic subgroup. Thus, the full mutation spectrum remains unknown for this disease.
[0004] A second type of MLL rearrangement characterized by the partial tandem duplications (PTD) within the N-terminal domain of the protein is found in an additional 5-6% of human AMLs. These leukemias, called MLL PTD, are most commonly found in AML with normal karyotypes or with chromosome 1 1 trisomy. MLL PTD AMLs are also associated with an adverse outcome in several studies.
[0005] Although they are both characterized by a rearrangement of the MLL gene and have a poor clinical outcome, it remains unknown whether MLL-F and MLL PTD share common molecular grounds.
[0006] There is thus a need for a better characterization of the genetic and transcriptional signature of MLL leukemias, and the identification of markers useful for the diagnosis, prognosis and treatment of these diseases.
[0007] The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.
SUMMARY OF THE INVENTION
[0008] In accordance with the present invention, there is provided the following items 1 to 75: 1 . A method for determining the likelihood that a subject suffers from Mixed-Lineage Leukemia- rearranged acute myeloid leukemia [MLL leukemia), said method comprising:
determining the level of expression of at least one of the genes or pseudogenes depicted Table 1 and/or Table 2:
Table 1
Figure imgf000003_0001
Table 2
Gene Ensembl ID Gene Ensembl ID
FAM171 B ENSG00000144369 HOXB5 ENSG00000120075
UGT2B1 1 ENSG00000213759 GUCY1A3 ENSG00000164116
ACSM1 ENSG00000166743 NAT8B ENSG00000204872 ZNF418 ENSG00000196724 NR5A1 ENSG00000136931
SMAD1 ENSG00000170365 ZNF135 ENSG00000176293
CP A3 ENSG00000163751 ANGPT1 ENSG00000154188
OR2T8 ENSG00000177462 OR2L13 ENSG00000196071
F2RL1 ENSG00000164251 MYCNOS ENSG00000233718
STON2 ENSG00000140022 OR2L1 P ENSG00000224227
DNTT ENSG00000107447 LOC100130417 ENSG00000223764
C21orf128/UMODL1 -
ZNF492 ENSG00000229676 ENSG00000184385
AS1
ZNF471 ENSG00000196263 LOC101927720 ENSG00000266916
ZNF667-AS1 ENSG00000166770 S100Z ENSG00000171643
ZNF730 ENSG00000183850 TUSC8 ENSG00000237361
ZNF667 ENSG00000198046 MIR181 B1 ENSG00000207975
H0XB-AS1 ENSG00000230148 DYTN ENSG00000232125
MYCN ENSG00000134323 PRDM16 ENSG0000014261 1
H0XB3 ENSG00000120093 ZNF112 ENSG00000062370
UM0DL1 ENSG00000177398 HOXB6 ENSG0000010851 1
H0XB-AS3 ENSG00000233101 CEACAM8 ENSG00000124469
CPA6 ENSG00000165078 WT1 ENSG00000184937
ZNF625-ZNF20 ENSG00000213297 CA4 ENSG00000167434
H0XB4 ENSG00000182742
and/or of at least one of the transcripts of SEQ ID NOs: 13-23, in a leukemia cell sample from said subject, wherein (i) a higher expression of said at least one genes depicted in Table 1 and/or of said at least one transcripts of SEQ ID NOs: 13-23 in said sample relative to a control non-Mil. leukemia sample, is indicative that said subject has a high likelihood of suffering from MLL leukemia; and/or (ii) a lower expression of said at least one genes depicted in Table 2 in said sample relative to a control non-M/l leukemia sample, is indicative that said subject has a high likelihood of suffering from MLL leukemia.
2. The method of item 1 , wherein said method comprises determining the level of expression of CASC10.
3. The method of item 1 , wherein said method comprises determining the level of expression of at least one long intergenic non-coding RNA (lincRNA).
4. The method of item 3, wherein said lincRNA is LOC100289656 or LOC646278 (PDCD6IPP2).
5. The method of any one of items 1 to 4, wherein said method comprises determining the level of expression of at least one pseudogene.
6. The method of item 5, wherein said pseudogene is WHAMML2.
7. The method of any one of items 1 to 6, wherein said method comprises determining the level of expression of at least one HO gene.
8. The method of any one of items 1 to 7, wherein said method comprises determining the level of expression of at least one MECOM gene.
9. The method of any one of items 1 to 8, wherein said method is for assessing minimal residual disease (MRD) in a subject suffering from MLL leukemia. 10. A method for treating a patient diagnosed with mixed-lineage leukemia-rearranged [MLL) leukemia with at least one mutation in a member of the RAS pathway, comprising administering to said patient a Mitogen-activated protein kinase kinase (MEK) inhibitor.
1 1. The method of item 10, wherein said MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
12. The method of item 1 1 , wherein said MEK inhibitor is Selumetinib.
13. The method of item 1 1 , wherein said MEK inhibitor is Trametinib.
14. The method of any one of items 10 to 34, which further comprises administering to said patient a Receptor Tyrosine Kinase (RTK) inhibitor.
15. The method of item 14, wherein said RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
16. The method of item 14, wherein said RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
17. The method of item 16, wherein said RTK inhibitor is Sorafenib.
18. The method of item 16, wherein said RTK inhibitor is VEGFR2 inhibitor Vl/Ki8751
19. The method of item 16, wherein said RTK inhibitor is FLT3 inhibitor IV.
20. The method of any one of items 10 to 19, wherein said member of the RAS pathway is NRAS, KRAS, PTPN11/SHP-2 and/or BRAF.
21. The method of item 20, wherein said at least one mutation is: a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS; a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS; a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS; a G to D substitution at a position corresponding to amino acid 13 of KRAS; an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or; a D to N substitution at a position corresponding to amino acid 594 of BRAF.
22. A method for predicting the sensitivity of mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia) cells to a Mitogen-activated protein kinase kinase (MEK) inhibitor or tyrosine kinase receptors (RTK) inhibitor, said method comprising: determining the presence of a mutations in a member of the RAS pathway in said MLL leukemia cells; wherein the presence of said mutation is indicative that said MLL leukemia cells are more sensitive to an MEK inhibitor and/or more resistant to an RTK inhibitor relative to MLL leukemia cells not comprising said mutation in the member of the RAS pathway.
23. The method of item 22, wherein said MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
24. The method of item 23, wherein said MEK inhibitor is Selumetinib.
25. The method of item 23, wherein said MEK inhibitor is Trametinib. 26. The method of any one of items 22 to 25, wherein said RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
27. The method of item 26, wherein said RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
28. The method of item 27, wherein said RTK inhibitor is Sorafenib.
29. The method of item 27, wherein said RTK inhibitor is VEGFR2 inhibitor Vl/Ki8751
30. The method of item 27, wherein said RTK inhibitor is FLT3 inhibitor IV.
31. The method of any one of items 22 to 30, wherein said member of the RAS pathway is NRAS, KRAS, PTPN11/SHP-2 and/or BRAF.
32. The method of item 31 , wherein said one or more mutations in the member of the RAS pathway are one or more of the mutations defined in item 21 .
33. The method of any one of items 22 to 32, wherein the presence of said one or more mutations is determined by sequencing a region encompassing said one or more mutations in a nucleic acid present in said sample.
34. The method of item 33, wherein said nucleic acid is cDNA.
35. The method of item 33 or 34, wherein said sequencing is performed by RNA sequencing (RNAseq).
36. A method for determining the chromosomal rearrangement in a subject suffering from mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising: determining the expression profile one or more of the genes and/or pseudogenes depicted in Tables 11 to 16 in an MLL leukemia sample, wherein an expression profile of the one or more of genes and/or pseudogenes depicted in Tables 1 1 a/1 1 b is indicative of MLL-MLLT4 rearrangement; an expression profile of the one or more of genes and/or pseudogenes depicted in Tables 12a/12b is indicative of MLL-MLLT3 rearrangement; an expression profile of the one or more of genes and/or pseudogenes depicted in Tables 13a/13b is indicative of MLL- SEPT9 rearrangement; an expression profile of the one or more of genes and/or pseudogenes depicted in Table 16 is indicative of MLL-ENL rearrangement; an expression profile of the one or more of genes and/or pseudogenes depicted in Table 15 is indicative of MLL-ELL rearrangement; and an expression profile of the one or more of genes and/or pseudogenes depicted in Table 14 is indicative of MLL-MLLT10 rearrangement.
37. The method of item 36, comprising determining the level of expression of at least one of NKX2-3, PCDH9, NKX5-1, NKX2-5, MECOM, P2RY1, IL12RB2, SOX11, SP7, MSLN, BAALC, PROM1, IRX3, MKX, HOXB8, POU4F2 and FOXC1 in a leukemia cell sample from said subject, wherein: a higher expression of NKX2-3, MECOM, PCDH9, P2RY1 and/or IL12RB2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT4 rearrangement; a higher expression of NKX5-1, and/or a lower expression of MECOM and/or PROM1 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT3 rearrangement; a higher expression of NKX2-5 and/or MYF6, and/or a lower expression of BAALC, in said leukemia cell sample relative to a control sample is indicative of MLL-SEPT9 rearrangement; a higher expression of SP7 in said leukemia cell sample relative to a control sample is indicative of an MLL-ENL rearrangement; a higher expression of FOXC1 and/or or a lower expression of MSLN in said leukemia cell sample relative to a control sample is indicative of MLL-ELL rearrangement; a higher expression of PROM1, IRX3, MKX, HOXB8, and/or POU4F2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT10 rearrangement; and/or a higher expression of SOX11 in said leukemia cell sample relative to a control sample is indicative of MLL-ENL or MLL-MLL T10 rearrangement.
38. The method of any one of items 27 to 37, wherein said the level of expression is measured at the nucleic acid level.
39. The method of item 38, wherein said the level of expression is measured by RNA sequencing (RNAseq).
40. A method for determining the likelihood that a subject suffers from mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising:
determining the presence of one or more of the mutations depicted in Table 3 in a leukemia cell sample from said subject:
Table 3
Gene Ensembl ID Position Mutation
ASXL1 ENSG00000171456 chr20:31022441 G643FsX
BRAF ENSG00000157764 chr7:140453155 D594N
CBL ENSG00000110395 chr11 :1 19148991 C404Y
CBLB ENSG00000114423 chr3:105495385 R141*
FLT3 ENSG00000122025 chrl 3:28592642 D835H
FLT3 ENSG00000122025 chrl 3:28608098 K623I
FLT3 ENSG00000122025 chrl 3:28592640 D835E
IDH2 ENSG00000182054 chr15:90631934 R140Q
JAK2 ENSG00000096968 chr9:5073770 V617F
KRAS ENSG00000133703 chrl 2:25398284 G12V
KRAS ENSG00000133703 chrl 2:25398284 G12A
KRAS ENSG00000133703 chrl 2:25398281 G13D
NRAS ENSG00000213281 chrl 115256530 Q61 K
NRAS ENSG00000213281 chrl 115256529 Q61 R
NRAS ENSG00000213281 chrl 115258748 G12C
NRAS ENSG00000213281 chrl 115258747 G12A
NRAS ENSG00000213281 chrl 115258744 G13D
NRAS ENSG00000213281 chrl 115258745 G13C
SETD2 ENSG00000181555 chr3:47103717 R2077*
SPI1 ENSG00000066336 chM 1 :47376900 A232T
SPI1 ENSG00000066336 ch 1 :47376903 R231 C
SPI1 ENSG00000066336 chM 1 :47381436 PIOOFsX
SRSF2 ENSG00000161547 chrl 7:74732959 P95R
SRSF2 ENSG00000161547 chrl 7:74732959 P95H
STAG2 ENSG00000101972 chrX: 123159704 H20FsX
STAG2 ENSG00000101972 chrX: 123164841 E52FsX STAG2 ENSG00000101972 chrX 123229240 R1205*
STAG2 ENSG00000101972 chrX 123197868 F665FsX
TET2 ENSG00000168769 chr4 106196343 S1559FsX
TET2 ENSG00000168769 chr4 106157420 S774*
TET2 ENSG00000168769 chr4 106157023 Q642*
TP53 ENSG00000141510 chr17:7577120 R273H
TP53 ENSG00000141510 chr17:7577121 R273C
WT1 ENSG00000184937 ch 1 :32417924 P164FsX
ZRSR2 ENSG00000169249 chrX: 15838370 R290* wherein the presence of said one or more mutations is indicative that said subject has a high likelihood of suffering from MLL leukemia, and wherein the absence of said one or more mutations is indicative that said subject has a low likelihood of suffering from MLL leukemia.
41. The method of item 40, wherein said one or more mutations is in a member of the RAS pathway.
42. The method of item 41 , wherein said one or more mutations is: a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS; a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS; a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS; a G to D substitution at a position corresponding to amino acid 13 of KRAS; an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or; a D to N substitution at a position corresponding to amino acid 594 of BRAF.
43. The method of any one of items 40 to 42, wherein said one or more mutations is in SPI1.
44. The method of item 43, wherein said one or more mutations is: an R to C substitution at a position corresponding to amino acid 230 of SPI1; an A to T substitution at a position corresponding to amino acid 231 of SPI1; and/or a mutation causing a frameshift at a position corresponding to amino acid 99 of SPI1.
45. The method of any one of items 40 to 44, wherein said one or more mutations is in PAK4.
46. The method of item 45, wherein said one or more mutations is: an F to V substitution at a position corresponding to amino acid 17 of PAK4; a D to N substitution at a position corresponding to amino acid 26 of PAK4; and/or a G to S substitution at a position corresponding to amino acid 344 of PAK4.
47. A method for treating a patient with mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising administering to the patient a suitable treatment for MLL leukemia, wherein said patient with leukemia is identified using the method of any one of items 27 to 46.
48. The method of item 47, wherein said method further comprises performing the method of any one of items 27 to 46 to identify said patient.
49. The method of item 47 or 48, wherein said treatment comprises chemotherapy, immunotherapy, radiation, bone marrow transplant, stem cell transplant, cord blood transplant, or any combination thereof.
50. The method of any one of items 47 to 49, wherein said method comprises determining whether the MLL leukemia cells from said patient comprise at least one mutation in a member of the RAS pathway. 51. The method of item 50, wherein (i) if the MLL leukemia cells from said patient comprises at least one mutation in a member of the RAS pathway, said treatment comprises administering to said patient a Mitogen- activated protein kinase kinase (MEK) inhibitor, or (ii) if the MLL leukemia cells from said patient do not comprise at least one mutation in a member of the RAS pathway, said treatment comprises administering to said patient a Receptor Tyrosine Kinase (RTK) inhibitor.
52. A method for determining whether one or more of the mutations or classes of mutations listed in Table
3 set forth in item 40 are associated with altered sensitivity of mixed-lineage leukemia-rearranged [MLL) leukemia cells to a drug or agent, said method comprising: measuring the response to said drug or agent in MLL leukemia cells comprising said one or more of the mutations or classes of mutations; and comparing said response to a control response in MLL leukemia cells that do not comprise said one or more of the mutations or classes of mutations,
wherein a higher/more potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with an increased sensitivity, or decreased resistance, to said drug or agent, and wherein a lower/less potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with a decreased sensitivity, or increased resistance, to said drug or agent.
53. A method for detecting a MLL-ENAH fusion in a sample, said method comprising contacting said sample with a first oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 to 1212 of the MLL protein, or to a complement thereof, and a second oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 17 to 591 of the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
54. A method for detecting a MLL-ENAH fusion in a sample, said method comprising contacting said sample with an oligonucleotide comprising a first domain that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, and a second domain that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
55. The method of item 53, wherein said first oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof.
56. The method of item 53 or 55, wherein said second oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
57. The method of item 54, wherein said first domain hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof, and said second domain hybridizes to a portion of exon
4 of a nucleic acid encoding the ENAH protein, or to a complement thereof. 58. A method for detecting a MLL-ENAH fusion in a sample, said method comprising performing a sequencing reaction on said sample with (i) a MLL-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the ENAH protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample; and/or (ii) a ENAH-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the MLL protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample.
59. The method of item 58, wherein said MLL-specific oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof.
60. The method of item 58 or 59, wherein said ENAH-specific oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
61. The method of any one of items 1 to 60, wherein said MLL leukemia is an MLL-fusion {MLL-F) leukemia or an MLL partial tandem duplication {MLL-P1D) leukemia.
62. Use a mitogen-activated protein kinase kinase (MEK) inhibitor for treating a patient diagnosed with mixed-lineage leukemia-rearranged [MLL) leukemia with at least one mutation in a member of the RAS pathway.
63. Use a mitogen-activated protein kinase kinase (MEK) inhibitor for the manufacture of a medicament for treating a patient diagnosed with mixed-lineage leukemia-rearranged [MLL) leukemia with at least one mutation in a member of the RAS pathway.
64. The use of item 62 or 63, wherein said MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
65. The use of item 64, wherein said MEK inhibitor is Selumetinib.
66. The use of item 64, wherein said MEK inhibitor is Trametinib.
67. The use of any one of items 62 to 66, which further comprises use of a Receptor Tyrosine Kinase (RTK) inhibitor.
68. The use of item 67, wherein said RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
69. The use of item 67, wherein said RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
70. The use of item 69, wherein said RTK inhibitor is Sorafenib.
71. The use of item 69, wherein said RTK inhibitor is VEGFR2 inhibitor Vl/Ki8751
72. The use of item 69, wherein said RTK inhibitor is FLT3 inhibitor IV. 73. The use of any one of items 62 to 72, wherein said member of the RAS pathway is NRAS, KRAS, PTPN11/SHP-2 and/or BRAF.
74. The use of item 73, wherein said at least one mutation is: a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS; a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS; a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS; a G to D substitution at a position corresponding to amino acid 13 of KRAS; an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or; a D to N substitution at a position corresponding to amino acid 594 of BRAF.
75. A kit for the assessment of MLL leukemia, the kit comprising: (i) one or more reagents for measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, and/or of the transcripts of SEQ ID NO: 13-23, and/or at least one of mutations set forth in Table 3, in a biological sample.
76. The kit of item 75, wherein said one or more reagents comprise one or more primers, probes and/or antibody.
[0009] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0010] In the appended drawings:
[0011] Figure 1A shows a comparative analysis of expressed genes in MLL-F (n=31) vs non-MLL-F (n=384) AMLs based on the average of logio RPKM adjusted values for each group. Diamonds correspond to the 140 differentially expressed genes (difference≥ 1 or≤ -1) displayed in Tables 5 and 6, of which a selected subset is labeled. In order to logio transform expression values, a small constant of 0.0001 was added.
[0012] Figure 1 B shows the absolute expression levels in MLL-F vs non-MLL-F AML for a selection of most differentially expressed genes. Box limits represent 25th and 75th percentiles. Upper whiskers extend to the highest values that are within 1.5 x interquartile ranges (IQR) of the 75th percentile and lower whiskers to the lowest value that are within 1 .5 x interquartile ranges of the 25th percentile.
[0013] Figures 2A to 2C show transcriptomic analyses of MLL-MLLT4 and MLL-MLLT3 subgroups. Comparative analysis of expressed genes in MLL-MLLT4 (Fig. 2A) and MLL-MLLT3 (Fig. 2B) subgroups based on the average of logio RPKM adjusted values for each group compared to AMLs with other MLL fusions. In order to perform logio transformations, a small constant of 0.0001 was added to expression values. Fig. 2C: Expression of MECOM, NKX2-3 and NKX5-1 genes in relation to MLL fusion partner.
[0014] Figure 3A shows a volcano plot illustrating the 140 differentially expressed genes selected in Fig. 1A.
[0015] Figure 3B shows chromosome 15q 13.1 with the 5 genes associated to MLL-F AMLs. All Ensembl transcripts for these genes are shown (ENST00000563027, ENST00000563213, ENST00000430589, ENST00000567053, ENST00000563942, ENST00000515318, ENST00000512149, ENST00000565892, ENST00000562423, ENST00000566321 , ENST00000563202, ENST00000566178, ENST00000564604, ENST00000563144, ENST00000567390, ENST00000569815). The LOC100289656 transcript marked with a star {ENST00000430589) corresponds to the RefSeq LOC100289656/NR_036475.2.
[0016] Figure 3C shows a waterfall representation based on LOC100289656 expression. The enlargement panel shows the 45 samples with a LOC100289656+ expression (≥ 1 RPKM). Sensitivity and specificity of LOC100289656+ as a marker for MLL-F AMLs is indicated.
[0017] Figure 3D shows a representation of MLL and ENAH proteins, with the corresponding novel MLL- ENAH fusion. EVH: enabled/VASP homology, Bromo: bromodomain.
[0018] Figure 3E shows a Volcano plot comparing MLL PTDs (n=23) to other AMLs, excluding MLL-F leukemias (n=361 ). Genes on chr15q13.1 and chr15q1 1.2 are indicated by the arrows.
[0019] Figure 3F shows a comparison of LOC100289656 expression in normal cord blood CD34+ cells (n=17), in CD34+ cells transduced with MLL-AF9 (n=3), and in resulting xenografted AMLs in mice (n=1 1).
[0020] Figure 3G depicts the amino acid (upper, SEQ ID NO: 12) and nucleotide (lower, SEQ ID NO: 11 ) sequences of the fused regions of MLL (N-terminal, in bold) and ENAH (C-terminal, in italics) in the novel MLL- ENAH fusion of Figure 3D. The glycine residue created by the fusion, and the encoding sequence GGC in the nucleotide sequence, are underlined.
[0021] Figure 4A shows a comparative analysis of LOC100289656 expression by RNA sequencing (RPKM + 0.0001) versus qRT-PCQ (LOC100289656 copies/104 ABL1 copies) in 1 14 leukemia samples with and without MLL rearrangements.
[0022] Figure 4B shows the differential expression of LOC100289656 in different populations. LOC100289656 expression is reported as the normalized (logio) value of LOC100289656 copy number per 104 ABL1 copy number. A value of 0.01 , defined as the minimum measurable copy number, was added to all LOC100289656 copy number values in order to apply logio transformation. Number of samples used: normal bone marrow, n = 11 ; acute myeloid leukemia (AML) without MLL rearrangement with normal and intermediate abnormal karyotypes [MLL negative), n = 54; AML fusions, n = 42; AML MLL partial tandem duplication (PTD), n = 25; B-cell acute lymphoblastic leukemia (B-ALL) with t(4;11 )(q21 ;q23), n=7 and t(v;1 1q23)/MLL rearranged, n=2. Median values are indicated by a horizontal line. MLL negative and MLL-F AML samples differed significantly using the Student f test (p-value < 0.0001).
[0023] Figures 5A to 5D show a representative CASC10-based RT-qPCR assay for detection of minimal residual disease (MRD) in MLL-Fusions AML samples. Figure 5A depicts the encoding nucleotide sequence (SEQ ID NO:10) and amino acid sequence (SEQ ID NO:11 ) of human CASC10. Figure 5B: CASC10 RT- qPCR assay standard curve results. The amplification plot shows a wide dynamic range from 106 to 10 plasmid copies, and the table depicts cumulative results from 8 independent experiments. The test show high efficiency of ~ 98% and very good linearity (R2 = 0.997). Figure 5C is scatter plot showing robust correlation between RNA-Seq data (Log (RPKM + 0.0001 )) and RT-qPCR assays (Log (CASC10 copies/104 ABL1 copies) for CASC10 in 33 MLL+ AML samples. Figure 5D: CASC10 expression is reported as the normalized (logio) value of CASC10 copy number per 10,000 ABL1 copy number. A value of 0.01 , defined as the minimum measurable copy number, was added to all CASC10 copy number values to apply Iog10 transformation. Samples below the dotted lines were undetectable (no CASC10 expression) with the RT-qPCR assay. Median values are indicated by a horizontal line. CASC10 expression in normal peripheral blood samples and MLL-Fusions AML samples differed significantly using the Student t test (p valueO.0001 ). The p value between CASC10 expression in MLL-Fusions AML samples and normal bone marrow samples is 0.01.
[0024] Figure 6A shows a detailed chromosomal positions and rearrangements of the cryptic MLL fusions identified in Fig. 3C.
[0025] Figure 6B shows Sanger sequencing confirming a fusion between MLL and ENAH genes in leukemic specimen 02H033.
[0026] Figure 6C shows the clinical and laboratory characteristics of sample 02H033.
[0027] Figure 6D shows co-occurring mutations in leukemia-associated genes in sample 02H033. The atypical FLT3 A443T mutation could not be validated in non-tumoral DNA to determine whether it is acquired in the tumor or if it represents a germline polymorphism.
[0028] Figure 7 shows the expression of LOC100289656 in MLL-F AMLs versus normal hematopoietic cell populations. LOC100289656 expression in MLL-F AML compared to various normal control cells (CB CD34+ cells, total bone marrow and normal peripheral cells, as indicated) using RNA sequencing. Comparative panel with WT1 is displayed.
[0029] Figure 8A shows mutational, morphologic and cytogenetic data observed in MLL-F AMLs. Each column represents a patient sample. Darkness of the cell correlates to variant allele frequency. Genes without mutations are not shown.
[0030] Figure 8B shows SPI1 protein and mutations.
[0031] Figure 8C shows the expression of SPI1 and its targets in MLL-F AMLs. For SP/f-WT samples, genes with highest (circles) and lowest (triangles) SPI1 expression are shown.
[0032] Figure 8D shows bar graphs representing the variant allele frequency of each RAS mutated sample with co-occurring mutations, using an average coverage of 172X in transcriptome.
[0033] Figure 9 shows a confirmation of SPI1 mutations by Sanger sequencing.
[0034] Figure 10 shows RAS mutations variant allele frequency (VAF) in paired relapsed samples.
[0035] Figures 11A-11C show a layout of the single-agent chemical screen. Mean dose response curves with SEM and EC50-associated statistics of MLL-F AML patients with (RAS-MUT, n=4) or without (RAS-WT, n=6) mutations in the RAS-pathway genes, when exposed to MEK inhibitors (Figure 4B) or RTK inhibitors (Figure 4C). P-values were calculated using a Wilcoxon rank-sum test on EC50 values. EGFR: epidermal growth factor receptor, LSC: leukemic stem cells, MEK: mitogen-activated protein kinase kinase; MUT: mutant, NK: normal karyotype, RTK: receptor tyrosine kinase, SEM : standard error of the mean, WT: wild type.
[0036] Figure 12A shows a layout of the combinatorial chemical screen {MLL-F RAS-WT n=3 and MLL-F RAS-WJ n=3).
[0037] Figure 12B shows the average percentage of inhibition for MEKi alone (white), RTKi alone (black) or combinations of both (grey) with associated SEM for MLL-F RAS-WT (left panel) or MLL-F RAS-MUT (right panel) patients. Drugs were used at their average EC25 concentrations as determined in Fig. 11 (see values in Table 22) and percentages of inhibition for single inhibitors correspond to measurements from the single-agent chemical screen (Fig. 11). P-values were determined by one-way ANOVA and synergistic effects were evaluated by the R index as described in Materials and Methods. An R > 1 indicates synergism, while an R≤ 1 .0 denotes an absence of synergism. EGFR: epidermal growth factor receptor, LSC: leukemic stem cells, MEKi: mitogen-activated protein kinase kinase inhibitor; MUT: mutant, R: synergistic ratio, RTKi: receptor tyrosine kinase inhibitor, SEM: standard error of the mean, WT: wild type.
[0038] Figure 13 shows a scatter-plot representing absence of differentially expressed genes, in particular RT genes, between MLL RAS-WT and MLL RAS-MUT patients. CSF1 R: colony stimulating factor 1 receptor, EPHB6: Ephrin type B receptor 6, FDR: false discovery rate, FLT3: Fms-related tyrosine kinase 3, INSR: insulin receptor, LTK: Leukocyte receptor tyrosine kinase, MUT: mutant, RPKM: reads per kilobase per million, RTK: receptor tyrosine kinase, RYK: related to receptor tyrosine kinase, WT: wild type.
[0039] Figures 14A-14K show cufflinks isoform expression of RP1 1 -578F21.12_iso_2 (Figure 14A); RP1 1- 26F2.1_iso_4 (Figure 14B), RP1 1-578F21 .9_iso_1 (Figure 14C), TASP1_iso_19 (Figure 14D), RP11 - 578F21 .12_iso_23 (Figure 14E), GOLGA8M_iso_2 (Figure 14F), GOLGA8M_iso_1 (Figure 14G), GOLGA8M_iso_6 (Figure 14H), RP11 -1180F24.1_iso_1 (Figure 141), WHAMMP2_iso_6 (Figure 14J), MMRN1_iso_1 (Figure 14K), for MLL-F AML subtype and normal hematopoietic populations. Ab initio transcriptome assembly based on raw sequence data using Tophat/Cufflinks identifies the above-noted isoforms. Summary dotplot of various AML genetic subtypes and normal hematopoietic populations from bone marrow, cord blood, and peripheral blood show the indicated transcripts as robustly expressed in the majority of MLL AMLs. Each dot represents FPKM expression for one specimen and median values are indicated by a horizontal line. The straight line demarcates an FPKM of 1.0. A value of 0.0001 was added to all FPKM values in order to apply log 10 transformation.
DETAILED DESCRIPTION OF THE INVENTION
[0040] Terms and symbols of genetics, molecular biology, biochemistry and nucleic acid used herein follow those of standard treatises and texts in the field, e.g. Kornberg and Baker, DNA Replication, Second Edition (W University Science Books, 2005); Lehninger, Biochemistry, sixth Edition (W H Freeman & Co (Sd), New York, 2012); Strachan and Read, Human Molecular Genetics, Second Edition (Wiley-Liss, New York, 1999); Eckstein, editor, Oligonucleotides and Analogs: A Practical Approach (Oxford University Press, New York, 1991); Gait, editor, Oligonucleotide Synthesis: A Practical Approach (IRL Press, Oxford, 1984); and the like. All terms are to be understood with their typical meanings established in the relevant art.
[0041] The articles "a" and "an" are used herein to refer to one or to more than one (i.e. to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element. Throughout this specification, unless the context requires otherwise, the words "comprise," "comprises" and "comprising" will be understood to imply the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements.
[0042] In the studies described herein, the present inventors have shown that MLL leukemias exhibit distinct mutational and transcriptional signatures relative to other AML subtypes, which may be useful for the characterization, diagnosis and prognosis of MLL leukemias.
[0043] In an aspect, the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemia), said method comprising: determining the presence of one or more of the mutations depicted in Table 3 in a leukemia cell (e.g., blood cell, bone marrow cell) sample from said subject: wherein the presence of said one or more mutations is indicative that said subject has a higher likelihood of suffering from MLL leukemia (i.e. higher likelihood relative to a subject not having said one or more of the mutations), and wherein the absence of said one or more mutations is indicative that said subject has a lower likelihood of suffering from MLL leukemia (i.e. lower likelihood relative to a subject having said one or more of the mutations).
[0044] In another aspect, the present invention relates to a method for determining whether the likelihood that an AML sample (e.g., a sample from a subject suspected of suffering from AML or known to suffer from AML) is an MLL leukemia sample, said method comprising: determining the presence of one or more of the mutations depicted in Table 3 in said AML sample: wherein the presence of said one or more mutations is indicative that said sample has a higher likelihood of being an MLL leukemia sample, and wherein the absence of said one or more mutations is indicative that said sample has a low likelihood of being an MLL leukemia sample (i.e. said sample is likely another type of AML sample).
[0045] The present invention encompasses the detection of any mutation or any combination/sub- combination of the mutations defined herein (Table 3), for example the detection of a single mutation, or of 2, 3, 4, 5 or more of the mutations defined herein.
[0046] The Ensembl accession numbers or reference ID corresponding to the genes of interest disclosed herein are depicted in Table 3 (second column). The entire content and information, including the full sequences of the transcripts and encoded polypeptides, corresponding to the Ensembl gene ID Nos. disclosed herein (e.g., in Tables 1-3, 11-16), are incorporated herein by reference. [0047] As used herein, the term "high likelihood" means that the individual is more likely to have the disorder or disease [MLL leukemia) than an individual without the mutation, or that the sample is more likely to be an MLL leukemia sample than an AML sample without the mutation.
[0048] As used herein, the term MLL leukemia refers to an acute myeloid leukemia in which the mixed lineage leukemia {MLL, also termed KMT2A) gene on chromosome band 1 1q23 is rearranged. At least 120 different MLL rearrangements have been described of which the following genes are the most frequent MLL translocation partners: MLLT3 {AF9), MLLT4 {AF6), ELL, MLLT10 {AF10) and MLLT1 {ENL). With the exception of MLL-MLLT3 fusion, MLL leukemias are associated with poor prognosis and adverse outcome. In an embodiment, the rearrangement is a fusion (MLL-fusion or MLL-F AML). In another embodiment, the rearrangement is a partial tandem duplications (PTD) within the N-terminal domain of the MLL protein. MLL PTD AMLs are most commonly found in AML with normal karyotypes or with chromosome 11 trisomy.
[0049] Based on the reference ID in the Ensembl database for the genes mutated that are provided in Table 3 (second column) as well as the GenBank accession Nos. depicted in Table 17, the determination of the mutation may be readily performed at the nucleic acid and/or protein level on a sample by a number of methods which are known in the art (see, e.g., Syvanen, Nat Rev Genet. 2001 Dec;2(12):930-42).
[0050] For example, the presence of the mutation(s) may be detected at the genomic DNA, transcript (RNA or cDNA) or protein level. Examples of suitable methods for determining sequences and polymorphisms at the nucleic acid level include sequencing of the nucleic acid sequence encompassing the mutation(s), e.g., in the genomic DNA or transcript (cDNA), for example by "Next Generation Sequencing" methods (e.g., genome sequencing, exome sequencing, RNA sequencing (RNA-seq)) or other sequencing methods; hybridization of a nucleic acid probe capable of specifically hybridizing to a nucleic acid sequence comprising the mutation(s) and not to (or to a lesser extent to) a corresponding nucleic acid sequence that does not comprises the mutation(s) (under comparable hybridization conditions, such as stringent hybridization conditions) (e.g., molecular beacons); restriction fragment length polymorphism analysis (RFLP); Amplified fragment length polymorphism PCR (AFLP-PCR); amplification of a nucleic acid fragment comprising the mutation(s) using a primer specifically hybridizing to a nucleic acid sequence comprising the mutation(s), wherein the primer produces an amplified product if the mutation(s) is/are present and does not produce the same amplified product when a nucleic acid sequence not comprising the mutation(s) is used as a template for amplification, nucleic acid sequence based amplification (Nasba), primer extension assay, FLAP endonuclease assay (Invader assay, Olivier M. (2005). Mutat Res. 573(1 -2):103-10), 5' nuclease assay (McGuigan F.E. and Ralston S.H. (2002) Psychiatr Genet. 12(3):133-6), oligonucleotide ligase assay. Other methods include in situ hybridization analyses and single-stranded conformational polymorphism analyses. Several SNP genotyping platforms are commercially available. Additional methods will be apparent to one of skill in the art.
[0051] The determination of the presence of the mutation(s) may also be achieved at the polypeptide/protein level. Examples of suitable methods for detecting alterations at the polypeptide level (including polypeptides encoded by splice variants) include sequencing of the encoded polypeptide; digestion of the encoded polypeptide followed by mass spectrometry or HPLC analysis of the peptide fragments, wherein the mutated polypeptide results in an altered mass spectrometry or HPLC spectrum as compared to the unmutated polypeptide; and immunodetection using an immunological reagent (e.g., an antibody, a ligand) which exhibits altered immunoreactivity with a mutated polypeptide relative to a corresponding unmutated polypeptide. Immunodetection can measure the amount of binding between a polypeptide molecule and an anti-protein antibody by the use of enzymatic, chromodynamic, radioactive, magnetic, or luminescent labels which are attached to either the anti-protein antibody or a secondary antibody which binds the anti-protein antibody. In addition, other high affinity ligands may be used. Immunoassays which can be used include e.g. ELISAs, Western blots, and other techniques known to those of ordinary skill in the art (see Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y., 1999 and Edwards R, Immunodiagnostics: A Practical Approach, Oxford University Press, Oxford; England, 1999). Methods to generate antibodies exhibiting altered immunoreactivity with a mutated polypeptide relative to a corresponding unmutated polypeptide are described in more detail below.
[0052] All these detection techniques may also be employed in the format of microarrays (e.g., SNP microarrays), protein-arrays, antibody microarrays, tissue microarrays, electronic biochip or protein-chip based technologies (see Schena M., Microarray Biochip Technology, Eaton Publishing, Natick, Mass., 2000).
[0053] Further, nucleic acid-containing sequences may be amplified prior to or in conjunction with the detection methods noted herein. The design of various primers for such amplification is known in the art. For example, a nucleic acid (RNA, cDNA, genomic DNA) comprising the mutation(s) may be amplified using primers hybridizing to sequences located on each side of the mutation(s). Amplification of a selected, or target, nucleic acid sequence may be carried out by a number of suitable methods. See generally Kwoh et al., 1990, Am. Biotechnol. Lab. 8:14-25. Numerous amplification techniques have been described and can be readily adapted to suit particular needs of a person of ordinary skill. Non-limiting examples of amplification techniques include polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription-based amplification, the Οβ replicase system and NASBA (Kwoh et al., 1989, Proc. Natl. Acad. Sci. USA 86, 1173-1 177; Lizardi et al., 1988, BioTechnology 6:1 197-1202; Malek et al., 1994, Methods Mol. Biol., 28:253-260; and Sambrook et al., 1989, supra). Preferably, amplification is carried out using PCR.
[0054] Polymerase chain reaction (PCR) is carried out in accordance with known techniques. See, e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; and 4,965,188. In general, PCR involves, a treatment of a nucleic acid sample (e.g., in the presence of a heat stable DNA polymerase) under hybridizing conditions, with one oligonucleotide primer for each strand of the specific sequence to be detected. An extension product of each primer which is synthesized is complementary to each of the two nucleic acid strands, with the primers sufficiently complementary to each strand of the specific sequence to hybridize therewith. The extension product synthesized from each primer can also serve as a template for further synthesis of extension products using the same primers. Following a sufficient number of rounds of synthesis of extension products, the sample is analyzed to assess whether the mutation(s) to be detected is/are present. Detection of the amplified sequence may be carried out by visualization following Ethidium Bromide (EtBr) staining of the DNA following gel electrophoresis, or using a detectable label in accordance with known techniques, and the like. For a review on PCR techniques (see PCR Protocols, A Guide to Methods and Amplifications, Michael et al. Eds, Acad. Press, 1990).
[0055] Ligase chain reaction (LCR) is carried out in accordance with known techniques (Weiss, 1991 , Science 254:1292). Adaptation of the protocol to meet the desired needs can be carried out by a person of ordinary skill. Strand displacement amplification (SDA) is also carried out in accordance with known techniques or adaptations thereof to meet the particular needs (Walker et al., 1992, Proc. Natl. Acad. Sci. USA 89:392-396; and ibid., 1992, Nucleic Acids Res. 20:1691-1696).
[0056] "Nucleic acid hybridization" refers generally to the hybridization of two single-stranded nucleic acid molecules having complementary base sequences, which under appropriate conditions will form a thermodynamically favored double-stranded structure. Examples of hybridization conditions can be found in the two laboratory manuals referred above (Sambrook et al., 1989, supra and Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York,) and are commonly known in the art. Hybridization to filter-bound sequences under moderately stringent conditions may, for example, be performed in 0.5 M NaHPCU, 7% sodium dodecyl sulfate (SDS), 1 mM EDTA at 65°C, and washing in 0.2 x SSC/0.1 % SDS at 42°C (see Ausubel, et al. (eds), 1989, Current Protocols in Molecular Biology, Vol. 1 , Green Publishing Associates, Inc., and John Wiley & Sons, Inc., New York, at p. 2.10.3). Alternatively, hybridization to filter-bound sequences under stringent conditions may, for example, be performed in 0.5 M NaHP04, 7% SDS, 1 mM EDTA at 65°C, and washing in 0.1 x SSC/0.1 % SDS at 68°C (see Ausubel, et al. (eds), 1989, supra). In other examples of hybridization, a nitrocellulose filter can be incubated overnight at 65°C with a labeled probe specific to one or the other two alleles in a solution containing 50% formamide, high salt (5 x SSC or 5 x SSPE), 5 x Denhardt's solution, 1 % SDS, and 100 g/ml denatured carrier DNA (i.e. salmon sperm DNA). The non-specifically binding probe can then be washed off the filter by several washes in 0.2 x SSC/0.1 % SDS at a temperature which is selected in view of the desired stringency: room temperature (low stringency), 42°C (moderate stringency) or 65°C (high stringency). Hybridization conditions may be modified in accordance with known methods depending on the sequence of interest (see Tijssen, 1993, Laboratory Techniques in Biochemistry and Molecular Biology - Hybridization with Nucleic Acid Probes, Part I, Chapter 2 "Overview of principles of hybridization and the strategy of nucleic acid probe assays", Elsevier, New York). The selected temperature is based on the melting temperature (Tm) of the DNA hybrid (Sambrook et al. 1989, supra). Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point for the specific sequence at a defined ionic strength and pH.
[0057] In another embodiment, the above-noted method further comprises obtaining or collecting a biological sample from a subject. In various embodiments, the above-noted sample can be from any source that contains biological material suitable for the detection of the mutation(s), such as genomic DNA, RNA (cDNA), and/or proteins, for example a tissue or cell sample from the subject (blood cells, lymph node cells, bone marrow cells, immune cells (e.g., lymphocytes), etc. that comprises leukemic cells (AML cells)). The sample may be subjected to cell purification/enrichment techniques to obtain a cell population enriched in a specific cell subpopulation or cell type(s). The sample may be subjected to commonly used isolation and/or purification techniques for enrichment in nucleic acids (genomic DNA, cDNA, mRNA) and/or proteins. Accordingly, in an embodiment, the method may be performed on an isolated nucleic acid and/or protein sample, such as isolated genomic DNA or cDNA sample. The biological sample may be collected using any methods for collection of biological fluid, tissue or cell sample, such as venous puncture for collection of blood cell samples.
[0058] In the studies described herein, it is shown that certain mutations are associated with altered response to certain classes of drugs. More particularly, it is shown that mutations in members of the RAS pathway is associated with altered sensitivity or resistance to MEK inhibitors (MEKi) and/or RTK inhibitors (RTKi), and more particularly that MLL-F samples (but not normal karyotype AML samples) with RAS-pathway mutations are more sensitive to MEKi, but more resistant to several RTKi than their wild-type RAS-pathway counterparts. Furthermore, MEKi and RTKi exhibited a synergistic anti-tumor effect in MLL-F RAS-MU1 patient cells, but not in MLL-F RAS-WT samples.
[0059] Thus, in another aspect, the present invention provides a method for determining whether one or more of the mutations or classes of mutations listed in Table 3 are associated with altered sensitivity of MLL leukemia cells to a drug or agent (e.g., a chemotherapeutic agent), said method comprising: (i) measuring the response (e.g. inhibition of cell proliferation) to said drug or agent in MLL leukemia cells comprising said one or more of the mutations or classes of mutations; and (ii) comparing said response to a control response in MLL leukemia cells that do not comprise said one or more of the mutations or classes of mutations, wherein a higher/more potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with an increased sensitivity (or decreased resistance) to said drug or agent, and wherein a lower/less potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with a decreased sensitivity (or increased resistance) to said drug or agent.
[0060] In another aspect, the present invention provides a method for predicting the sensitivity of mixed- lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia) cells to a mitogen-activated protein kinase kinase (MEK) inhibitor or tyrosine kinase receptor (RTK) inhibitor, said method comprising: determining the presence of one or more of mutations in a member of the RAS pathway in said MLL leukemia cells; wherein the presence of said one or more mutations is indicative that said MLL leukemia cells are more sensitive to an MEK inhibitor and/or more resistant to an RTK inhibitor relative to MLL leukemia cells not comprising said one or more of mutations in the RAS pathway.
[0061] The term "member of the RAS pathway" as used herein refers to a protein involved in the signaling through the RAS-RAF-MEK-ERK pathway (also referred to as the "MAPK/ERK pathway"), which transmit the intracellular signal of activated receptor tyrosine kinases (RTKs). Proteins involved in the RAS pathway include RTKs (FLT3, EGFR, etc.), RAS (HRAS, KRAS, NRAS), GRB2, SOS, SHP2 (PTPN11 ), SPRED1 , GAB2, and RAF (BRAF, RAF-1). In an embodiment, the mutation is a gain-of-function mutation in a gene encoding a positive regulator of the RAS pathway. In another embodiment, the mutation is a loss-of-function mutation in a gene encoding a negative regulator of the RAS pathway. In another embodiment, the mutation is in a gene encoding a protein that acts upstream of MEK in the RAS pathway.
[0062] In an embodiment, the one or more mutations in a member of the RAS pathway are one or more mutations of the member of the RAS pathway listed in Table 3, e.g., KRAS, NRAS, PTPN11 and/or BRAF.
[0063] The term "MEK inhibitor" as used herein refers to an agent that inhibits the mitogen-activated protein kinase kinase enzymes MEK1 and/or MEK2, affect the MAPK/ERK pathway. Examples of MEK inhibitors include Trametinib (GSK1 120212), Selumetinib, Binimetinib (MEK162), PD325901 , Refametinib (BAY 86- 9766), Pimasertib, Cobimetinib (XL518), CI-1040 (PD184352), AZD8330 (ARRY-424704), R04987655 (CH4987655), R05126766, WX-554, E6201 , and TAK-733. Examples of MEK inhibitors are also disclosed in Table 18 below.
[0064] The term "RTK inhibitor" as used herein refers to an agent that inhibits receptor tyrosine kinases such as an Epidermal Growth Factor Receptor (EGFR), such as Erb-B2 Receptor Tyrosine Kinase 2 (ErbB2/HER2), Fibroblast Growth Factor Receptor (FGFR), Platelet Derived Growth Factor Receptor (PDGFR), Vascular Endothelial Growth Factor Receptor (VEGFR), Aplastic Lymphoma Kinase (ALK), Focal Adhesion Kinase (FAK), Insulin-Like Growth Factor Receptor (IGF1 R and IGF2R), FMS-like receptor tyrosine kinase-3 (FLT3). Examples of RTK inhibitors include Afatinib, Axitinib, Cediranib (AZD-2171 ), Flt3 Inhibitor IV (CAS 819058-89- 4), Erlotinib, Gefitinib (ZD1839), Grandinin, Lapatinib, Lestaurtinib (CEP-701), Neratinib (HKI-272), Osimertinib/mereletinib (AZD9291), Pazopanib, Quizartinib (AC220), Regorafenib (BAY 73-4506), Semaxanib (SU5416), Sorafenib, Sunitinib (SU11248), Tivozanib (AV-951), ΚΪ8751 , Mubritinib (TAK-165) and Vandetanib. Examples of RTK inhibitors are also disclosed in Table 18 below.
[0065] In another aspect, the present invention provides administering a suitable therapy to a patient MLL- rearranged leukemia patient based on the above-mentioned sensitivity test. In an embodiment, the present invention provides a method for treating a patient diagnosed with mixed-lineage leukemia-rearranged (MLL) leukemia and at least one mutation in a member of the RAS pathway, comprising administering to said patient a Mitogen-activated protein kinase kinase (MEK) inhibitor, preferably Selumetinib and/or Trametinib. In an embodiment, the method comprises administering Selumetinib to said patient. In another embodiment, the method comprises administering Trametinib to said patient.
[0066] In a further embodiment, the method further comprises administering to said patient a Receptor Tyrosine Kinase (RTK) inhibitor (i.e. a combination therapy comprising a MEK inhibitor and an RTK inhibitor), preferably FLT3 inhibitor IV, VEGFR2 inhibitor Vl/Ki8751 , an EGFR inhibitor and/or Sorafenib. In an embodiment, the method further comprises administering FLT3 inhibitor IV to said patient. In another embodiment, the method further comprises administering VEGFR2 inhibitor Vl/Ki8751 to said patient. In an embodiment, the method further comprises administering an EGFR inhibitor to said patient. In another embodiment, the method further comprises administering Sorafenib to said patient. In another embodiment, the method comprises administering a combination of Selumetinib and VEGFR2 inhibitor Vl/Ki8751 to said patient. In another embodiment, the method comprises administering a combination of Selumetinib and Sorafenib to said patient. In another embodiment, the method comprises administering a combination of Trametinib and VEGFR2 inhibitor Vl/Ki8751 to said patient. In another embodiment, the method comprises administering a combination of Trametinib and Sorafenib to said patient.
[0067] In an embodiment, in the above-mentioned combination therapy comprising a MEK inhibitor and an RTK inhibitor, the MEK inhibitor and RTK inhibitor may be administered or co-administered (e.g., consecutively, simultaneously, at different times) in any conventional dosage form. Co-administration in the context of the present invention refers to the administration of more than one therapeutic in the course of a coordinated treatment to achieve an improved clinical outcome. Such co-administration may also be coextensive, that is, occurring during overlapping periods of time. For example, a first agent (e.g., MEK inhibitor) may be administered to a patient before, concomitantly, before and after, or after a second active agent (e.g., RTK inhibitor) is administered. The agents may in an embodiment be combined/formulated in a single composition and thus administered at the same time.
[0068] In another aspect, the present invention provides a method for treating a patient diagnosed with mixed-lineage leukemia-rearranged {MLL) leukemia, the method comprising administering to said subject an effective amount of a compound having an EC50 below 10000 nM in at least one sample as set forth in Table 20 (Part A), or an analog thereof. In an embodiment, the compound or analog thereof has an EC50 below 5000 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 4000 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 3000 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 2000 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 1000 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 900 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 800 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 700 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 600 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 500 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 400 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 300 nM in at least one sample. In an embodiment, the compound or analog thereof has an EC50 below 200 nM in at least one sample. In embodiments, the compound or analog thereof has an EC50 below 100 nM, below 90 nm, below 80 nM, below 70 nM, below 60 nM, below 50 nM, below 40 nM, below 30 nM, or below 20 nM in at least one sample. In an embodiment, the compound is AZD-2014, AZD-8055, Dasatinib, the EGRF Inhibitor (CAS 879127-07-8), GDC- 0941 , Mubritinib, Quizartinib, R428, Selumetinib, Sorafenib Tosylate, Tanespimycin, Tipifarnib, Trametinib, Triciribine AKT inhibitor V, or an analog thereof. In a further embodiment, the compound is Mubritinib or an analog thereof. In another aspect, the present invention provides a method for treating a subject suffering from MLL leukemia or normal karyotype leukemia comprising administering to said subject an effective amount of Mubritinib or an analog thereof
[0069] In another aspect, the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemia), said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, in a leukemia cell sample from said subject: comparing said level of expression to a control/reference level of expression (e.g., expression in a non-MLL leukemia sample) and determining the likelihood that said subject suffers from MLL leukemia based on said comparison, wherein a differential expression of said at least one genes in said sample relative to said control sample is indicative that said subject has a high likelihood of suffering from MLL leukemia.
[0070] In an embodiment, a higher expression of said at least one genes depicted in Table 1 , and/or said at least one transcripts of SEQ ID NOs: 13-23, in said sample relative to a control non-MLL leukemia sample, is indicative that said subject has a higher likelihood of suffering from MLL leukemia (i.e. higher likelihood relative to a subject not having higher expression of said at least one genes and/or transcripts); and/or (ii) a lower expression of said at least one genes depicted in Table 2 in said sample relative to a control non-MLL leukemia sample, is indicative that said subject has a higher likelihood (relative to a subject not having lower expression of said at least one genes and/or transcripts) of suffering from MLL leukemia (and vice versa).
[0071] In another aspect, the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemia), said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Table 1 , and/or at least one of the transcripts of SEQ ID NOs: 13-23, in a leukemia cell sample from said subject: wherein a higher expression of said at least one genes in said sample relative to a control non-Mil. leukemia sample is indicative that said subject has a high likelihood of suffering from MLL leukemia (and vice versa).
[0072] In another aspect, the present invention relates to a method for determining the likelihood that a subject suffers from Mixed-lineage leukemia-rearranged acute myeloid leukemia (MLL leukemiaj, said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Table 2 in a leukemia cell sample from said subject: wherein a lower expression of said at least one genes in said sample relative to a control non-M/l leukemia sample is indicative that said subject has a high likelihood of suffering from MLL leukemia (and vice versa).
[0073] In another aspect, the present invention relates to a method for determining the likelihood that an AML sample is an MLL leukemia sample, said method comprising: determining/measuring the level of expression of at least one of the genes depicted in Tables 1 and/or 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, in said AML sample: wherein a differential expression of said at least one genes in said sample relative to a control non-Mil leukemia sample is indicative that said sample has a high likelihood of being an MLL leukemia sample, and wherein a similar expression of said at least one genes in said sample relative to a control non-Mil leukemia sample is indicative that said sample has a low likelihood of being an MLL leukemia sample.
[0074] In an embodiment, the above-noted method permits to determine whether a subject suffering from leukemia suffer from MLL leukemia or from another leukemia subgroup/subtype.
[0075] The present invention encompasses the determination of the level of expression of any gene/transcript or any combination/sub-combination of the genes/transcripts defined herein (e.g., those depicted in Tables 1 and/or 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23), for example the determination of the level of expression of a single gene, or of 2, 3, 4, 5 or more of the genes defined herein.
[0076] In an embodiment, the detection of the level of expression overexpressed in MLL leukemia (Table 1 and/or SEQ ID NOs: 13-23) may be used to perform treatment/disease follow-up in a patient, for example to assess minimal residual disease (MRD) in a patient. The term "minimal residual disease" or "MRD" refers to small numbers of leukemic cells that remain in the patient during treatment, or after treatment when the patient is in remission (no symptoms or signs of disease), which is the major cause of relapse in leukemia. Assessment of MRD is useful, for example, for determining whether treatment has eradicated the leukemia or whether traces remain, comparing the efficacy of different treatments, monitoring patient remission status as well as detecting recurrence of the leukemia, and choosing the treatment that will best meet those needs. Accordingly, in another aspect, the present invention provides a method for assessing MRD in a subject (e.g., a patient undergoing anti-leukemia therapy or who previously underwent anti-leukemia therapy for MLL leukemia), the method comprising determining/measuring the level of expression of at least one of the genes depicted in Table 1 , and/or at least one of the transcripts of SEQ ID NOs: 13-23, in a cell sample (e.g., blood cell sample) from said subject: wherein a higher expression of said at least one genes in said sample relative to a control non-Mil. leukemia sample is indicative that said subject has MRD, and wherein a similar or lower expression of said at least one genes in said sample relative to a control non-M/l leukemia sample is indicative that said subject does not have MRD. In an embodiment, the method comprises determining/measuring the level of expression of CASC10 in the sample, for example using at least one of the primers/probes described below (SEQ ID NOs: 7-9). Thus, in an embodiment, the method comprises assessing MRD in a patient as defined above, and if MRD is detected, administering a suitable therapy to the patient. In an embodiment, the treatment/disease follow-up, e.g., assessment of MRD, is performed periodically over a period of time, for example every week, every two weeks, every month, every two months, every six months or every year.
[0077] The determination of the expression of the one or more genes, transcripts or encoded gene products (e.g., mRNA, protein) listed above may be performed using any known methods to detect nucleic acids or proteins based on the reference ID in the EnsembI database for the genes defining the expression signature of MLL leukemia depicted in Table 1 and Table 2. In embodiments, the expression is compared to a control or reference level (e.g., the level obtained a sample from a non-M/l leukemia sample) to assess the subject's likelihood of suffering from MLL leukemia, or the likelihood that the AML sample is an MLL leukemia sample.
[0078] The levels of nucleic acid corresponding to the above-mentioned genes can then be evaluated according to the methods disclosed below, e.g., with or without the use of nucleic acid amplification methods. In some embodiments, nucleic acid amplification methods can be used to detect the level of expression of the one or more genes. For example, oligonucleotide primers and probes (which may be designed based on the known sequences of the genes and corresponding transcripts) may be used in amplification and detection methods that use nucleic acid substrates isolated by any of a variety of well-known and established methodologies (e.g., Sambrook et al., Molecular Cloning, A laboratory Manual, pp. 7.37-7.57 (2nd ed., 1989); Lin et al., in Diagnostic Molecular Microbiology, Principles and Applications, pp. 605-16 (Persing et al., eds. (1993); Ausubel et al., Current Protocols in Molecular Biology (2001 and later updates thereto)). Methods for amplifying nucleic acids include, but are not limited to, for example the polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) (see e.g., U.S. Pat. Nos. 4,683,195; 4,683,202; 4,800,159; 4,965,188), ligase chain reaction (LCR) (see, e.g., Weiss, Science 254: 1292-93 (1991 )), strand displacement amplification (SDA) (see e.g., Walker et al., Proc. Natl. Acad. Sci. USA 89:392-396 (1992); U.S. Pat. Nos. 5,270,184 and 5,455,166), Thermophilic SDA (tSDA) (see e.g., European Pat. No. 0 684 315) and methods described in U.S. Pat. No. 5,130,238; Lizardi et al., BioTechnol. 6:1 197-1202 (1988); Kwoh et al., Proc. Natl. Acad. Sci. USA 86:1173-77 (1989); Guatelli et al., Proc. Natl. Acad. Sci. USA 87:1874-78 (1990); U.S. Pat. Nos. 5,480,784; 5,399,491 ; U.S. Publication No. 2006/46265. The methods include the use of Transcription Mediated Amplification (TMA), which employs an RNA polymerase to produce multiple RNA transcripts of a target region (see, e.g., U.S. Pat. Nos. 5,480,784; 5,399,491 and U.S. Publication No. 2006/46265). The levels of nucleic acids may also be measured by "Next Generation Sequencing" (NGS) methods, such as RNA sequencing.
[0079] The nucleic acid or amplification product may be detected or quantified by hybridizing a labeled probe to a portion of the nucleic acid or amplified product. The labeled probe contains a detectable group that may be, for example, a fluorescent moiety, chemiluminescent moiety, radioisotope, biotin, avidin, enzyme, enzyme substrate, or other reactive group. Other well-known detection techniques include, for example, gel filtration, gel electrophoresis and visualization of the amplicons, and High Performance Liquid Chromatography (HPLC). In certain embodiments, for example using real-time TMA or real-time PCR, the level of amplified product is detected as the product accumulates.
[0080] In another embodiment, the expression of the one or more genes, transcripts or encoded gene products is measured at the protein level. Methods to measure the amount/level of proteins are well known in the art. Protein levels may be detected directly using a ligand binding specifically to the protein, such as an antibody or a fragment thereof. In embodiments, such a binding molecule or reagent (e.g., antibody) is labeled/conjugated, e.g., radio-labeled, chromophore-labeled, fluorophore-labeled, or enzyme-labeled to facilitate detection and quantification of the complex (direct detection). Alternatively, protein levels may be detected indirectly, using a binding molecule or reagent, followed by the detection of the [protein/ binding molecule or reagent] complex using a second ligand (or second binding molecule) specifically recognizing the binding molecule or reagent (indirect detection). Such a second ligand may be radio-labeled, chromophore- labeled, fluorophore-labeled, or enzyme-labeled to facilitate detection and quantification of the complex. Enzymes used for labeling antibodies for immunoassays are known in the art, and the most widely used are horseradish peroxidase (HRP) and alkaline phosphatase (AP). Examples of binding molecules or reagents include antibodies (monoclonal or polyclonal), natural or synthetic ligands, and the like.
[0081] Examples of methods to measure the amount/level of protein in a sample include, but are not limited to: Western blot, immunoblot, enzyme-linked immunosorbent assay (ELISA), "sandwich" immunoassays, radioimmunoassay (RIA), immunoprecipitation, surface plasmon resonance (SPR), chemiluminescence, fluorescent polarization, phosphorescence, immunohistochemical (IHC) analysis, matrix-assisted laser desorption/ionization time-of-flight (MALDI-TOF) mass spectrometry, microcytometry, microarray, antibody array, microscopy (e.g., electron microscopy), flow cytometry, proteomic-based assays, and assays based on a property or activity of the protein including but not limited to ligand binding or interaction with other protein partners, enzymatic activity, fluorescence. For example, if the protein of interest is a kinase known to phosphorylate of given target, the level or activity of the protein of interest may be determined by the measuring the level of phosphorylation of the target in the presence of the test compound. If the protein of interest is a transcription factor known to induce the expression of one or more given target gene(s), the level or activity of the protein of interest may be determined by the measuring the level of expression of the target gene(s).
[0082] In an embodiment, the reference or control level of expression and/or activity is a level measured in a non-Mil. leukemia sample (an AML sample from another AML subtype or a mixture of other AML subtypes).
[0083] "Control level" or "reference level" or "standard level" are used interchangeably herein and broadly refers to a separate baseline level measured in a comparable "control" sample, which is generally from a subject not suffering from the disease {MLL leukemia), for example an AML sample from another AML subtype (or a mixture of other AML subtypes). The corresponding control level may be a level corresponding to an average or median level calculated based of the levels measured in several reference or control subjects (e.g., a pre-determined or established standard level). The control level may be a pre-determined "cut-off value recognized in the art or established based on levels measured in samples from one or a group of control subjects. The corresponding reference/control level may be adjusted or normalized for age, gender, race, or other parameters. The "control level" can thus be a single number/value, equally applicable to every patient individually, or the control level can vary, according to specific subpopulations of patients. Thus, for example, older men might have a different control level than younger men, and women might have a different control level than men. The predetermined standard level can be arranged, for example, where a tested population is divided equally (or unequally) into groups, such as a low-risk group, a medium-risk group and a high-risk group or into quadrants or quintiles, the lowest quadrant or quintile being individuals with the lowest risk (i.e., lowest level of expression of the one or more genes) and the highest quadrant or quintile being individuals with the highest risk (i.e., highest level of expression of the one or more genes). It will also be understood that the control levels according to the invention may be, in addition to predetermined levels or standards, levels measured in other samples (e.g. from healthy/normal subjects, or cancer patients) tested in parallel with the experimental sample. The reference or control levels may correspond to normalized levels, i.e. reference or control values subjected to normalization based on the expression of a housekeeping gene (e.g. number of copy of the tested gene per number of copy of housekeeping gene).
[0084] "Higher expression" or "higher level of expression" as used herein refers to (i) higher expression of the one or more of the above-mentioned genes (protein and/or mRN A/transcript) in one or more given cells present in the sample (relative to the control) and/or (ii) higher amount of cells expressing the one or more genes in the sample (relative to the control). "Lower expression" or "lower level of expression" as used herein refers to (i) lower expression of the one or more genes (protein and/or mRNA/transcript) in one or more given cells present in the sample (relative to the control) and/or (ii) lower amount of cells expressing the one or more genes in the sample (relative to the control). In an embodiment, higher or lower refers to a level of expression that is at least one standard deviation above or below the control level (e.g., the predetermined cut-off value) (e.g. that is statistically significant as determined using a suitable statistical analysis), and a "similar expression" or "similar level of expression" refers to a level of expression that is less than one standard deviation above or below the control level (e.g., the predetermined cut-off value) (e.g. that is not statistically significant as determined using a suitable statistical analysis). In embodiments, higher or lower refers to a level of expression that is at least 1 .5, 2, 2.5, 3, 4 or 5 standard deviations above or below the control level (e.g., the predetermined cut-off value), and a "similar expression" or "similar level of expression" refers to a level of expression that is less than 1.5, 2, 2.5, 3, 4 or 5 standard deviation above or below the control level (e.g., the predetermined cut-off value). In another embodiment, "higher expression" refers to an expression that is at least 50% higher in the test sample relative to the control level. In an embodiment, "lower expression" refers to an expression that is at least 20, 25, 30, 35, 40, 45, or 50% lower in the test sample relative to the control level. In an embodiment, "similar expression" refers to an expression that varies by less than 20, 15, or 10% between the test sample and the control level. In another embodiment, higher or lower refers to a level of expression that is at least 2-, 5-, 10-, 25-, or 50-fold higher or lower in the test sample relative to the control sample.
[0085] In another embodiment, the method described herein further comprises obtaining or collecting a biological sample from a subject. In various embodiments, the sample can be from any source that contains biological material suitable for the detection of the nucleic acid(s), such as genomic DNA, RNA (cDNA), and/or proteins, for example a tissue or cell sample from the subject (blood cells, immune cells (e.g., lymphocytes), bone marrow cells, etc. that comprises leukemic cells (AML cells). The sample may be subjected to cell purification/enrichment techniques to obtain a cell population enriched in a specific cell subpopulation or cell type(s). The sample may be subjected to commonly used isolation and/or purification techniques for enrichment in nucleic acids (genomic DNA, cDNA, mRNA) and/or proteins. Accordingly, in an embodiment, the method may be performed on an isolated nucleic acid and/or protein sample, such as cDNA. The biological sample may be collected using any methods for collection of biological fluid, tissue or cell sample, such as venous puncture for collection of blood cell samples. Thus, the term "biological sample comprising leukemic cells" as used herein refers to a crude leukemic cell sample, a sample enriched in certain cells (i.e., that has been subjected to cell purification/enrichment techniques), or isolated nucleic acids (RNA, cDNA, genomic DNA, subjected or not to nucleic acid amplification) and/or proteins from leukemic cells. In an embodiment, the biological sample comprising leukemic cells comprises nucleic acids (RNA, cDNA, genomic DNA) obtained or isolated from leukemic cells.
[0086] In certain embodiments, methods of diagnosis described herein may be at least partly, or wholly, performed in vitro. In a further embodiment, the method is wholly performed in vitro.
[0087] In an embodiment, the method described herein comprises generating cDNA. In an embodiment, the method described herein comprises an assay involving amplification and/or hybridization of a nucleic acid molecule. In an embodiment, the method/assay described herein involves polymerase chain reaction (PCR). In an embodiment, the method/assay described herein involves RNA or exome sequencing. [0088] In an embodiment, the above-mentioned method comprises a step of normalizing the gene expression levels, i.e. normalization of the measured levels of the above-noted genes against a stably expressed control gene (or housekeeping gene) to facilitate the comparison between different samples. "Normalizing" or "normalization" as used herein refers to the correction of raw gene expression values/data between different samples for sample to sample variations, to take into account differences in "extrinsic" parameters such as cellular input, nucleic acid (RNA) or protein quality, efficiency of reverse transcription (RT), amplification, labeling, purification, etc., i.e. differences not due to actual "intrinsic" variations in gene expression by the cells in the samples. Such normalization is performed by correcting the raw gene expression values/data for a test gene (or gene of interest) based on the gene expression values/data measured for one or more "housekeeping" or "control" genes, i.e. whose expressions are known to be constant (i.e. to show relatively low variability) between the cells of different tissues and under different experimental conditions. Thus, in an embodiment, the above-mentioned method further comprises measuring the level of expression of a housekeeping gene in the biological sample. Suitable housekeeping genes are known in the art and several examples are described in WO 2014/134728.
[0089] In a further embodiment, the method further comprises measuring the level of expression of one or more housekeeping genes in a biological sample from the subject. In an embodiment, the level of expression of the housekeeping gene is measured and the method comprises amplifying a housekeeping gene nucleic acid using a suitable pair of primers. In an embodiment, the housekeeping gene used for normalization is ABL1. Suitable pairs of primers may be designed based on the nucleotide sequence of ABU, which may be found in GenBank Accession No. NM_001012750, NM_001012751 , NM_001012752, NM_001178116, NM_001 1781 19, NM_001 178120, NM_001178121 , NM_001178122, NM_001 178123, NM_001 178124, NM_001 178125 and NM_005470. In an embodiment, the pair of primer comprises a first primer comprising at least 10 nucleotides of the sequence of SEQ ID NO:4 and a second primer comprising at least 10 nucleotides of the sequence of SEQ ID NO:5. In an embodiment, the above-mentioned method comprises a step of detection or quantification of the housekeeping gene nucleic acid (e.g. ABU) with a probe. In an embodiment, the housekeeping gene is ABU and the probe comprises at least 10 nucleotides of the sequence of SEQ ID NO: 6.
[0090] In an embodiment, the above-mentioned methods may be combined with other markers, assays, methods and criteria for characterizing, diagnosing or prognosing MLL leukemias, i.e. genotypic/phenotypic features, chromosomal rearrangement, clinical features, etc. In an embodiment, the method comprises evaluating the cytology of the cells, e.g., blood or bone marrow cells. In an embodiment, the method comprises evaluating the size and number of MLL leukemic cells, evaluating the type of lymphocytes are affected, or evaluating whether changes appear in the chromosomes of MLL leukemic cells.
[0091] In an embodiment, the above-mentioned methods further comprise selecting and/or administering a course of therapy or prophylaxis to said subject in accordance with the diagnostic/prognostic result. For example, if it is determined that the subject has a high likelihood of suffering from MLL leukemia, a more aggressive or an treatment regimen adapted for treatment of MLL leukemia may be used (and/or a treatment regimen known to be ineffective in such patients is avoided). The methods further comprise subjecting the subject to a suitable anti-MLL leukemia therapy (e.g., bone marrow or hematopoietic stem cell transplantation, chemotherapy, etc.).
[0092] Accordingly, in another aspect, the present invention provides a method for treating a patient with mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising: administering to the patient a suitable treatment for MLL leukemia in a subject identified using one or more of the methods described herein. In an embodiment, the above-mentioned method further comprises identifying a patient suffering from MLL leukemia using the methods defined above, i.e., by performing the methods. In an embodiment, the an\i-MLL leukemia treatment/therapy comprises chemotherapy, immunotherapy, radiation, bone marrow transplant, stem cell transplant, cord blood transplant, or a combination thereof.
[0093] In the studies described herein, it is shown that different gene expression profiles are associated with different chromosomal rearrangement in MLL leukemic samples.
[0094] Accordingly, in another aspect, the present invention provides a method for determining the chromosomal rearrangement in a subject suffering from mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising determining the expression profile one or more of the genes/transcripts depicted in Tables 11-16 in an MLL leukemia sample, wherein (i) an expression profile of the one or more of genes/transcripts depicted in Table 11 (1 1 a and/or 1 1 b) is indicative of MLL-MLLT4 rearrangement; (ii) an expression profile of the one or more of genes/transcripts depicted in Supplementary Table 12 (12a and/or 12b) is indicative of MLL-MLLT3 rearrangement; (iii) an expression profile of the one or more of genes/transcripts depicted in Table 13 (13a and/or 13b) is indicative of MLL-SEPT9 rearrangement; (iv) an expression profile of the one or more of genes/transcripts depicted in Table 16 is indicative of MLL-ENL rearrangement; (v) an expression profile of the one or more of genes/transcripts depicted in Table 15 is indicative of MLL-ELL rearrangement; and (vi) an expression profile of the one or more of genes/transcripts depicted in Table 14 is indicative of MLL-MLLT10 rearrangement. In an embodiment, the method comprises determining the level of expression of at least one of NKX2-3, PCDH9, NKX5-1, NKX2-5, MECOM, P2RY1, IL12RB2, SOX11, SP7, MSLN, BAALC, PROM1, IRX3, MKX, HOXB8, POU4F2 and FOXC1 in a leukemia cell sample from said subject, wherein
a higher expression of NKX2-3, MECOM, PCDH9, P2RY1 and/or IL12RB2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT4 rearrangement;
a higher expression of NKX5-1, and/or a lower expression of MECOM and/or PROM1 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT3 rearrangement; a higher expression of NKX2-5 and/or MYF6, and/or a lower expression of BAALC, in said leukemia cell sample relative to a control sample is indicative of MLL-SEPT9 rearrangement;
a higher expression of SP7 in said leukemia cell sample relative to a control sample is indicative of an MLL-ENL rearrangement;
a higher expression of FOXC1 and/or or a lower expression of MSLN in said leukemia cell sample relative to a control sample is indicative of MLL-ELL rearrangement;
a higher expression of PROM1, IRX3, MKX, HOXB8, and/or POU4F2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT10 rearrangement; and
a higher expression of SOX11 in said leukemia cell sample relative to a control sample is indicative of MLL-ENL or MLL-MLLT10 rearrangement.
[0095] The expression profile one or more of the genes/transcripts may be determined using any of the above-noted methods, for example at the nucleic acid level by RNA sequencing.
[0096] The present inventors have also identified a novel cryptic fusion representing an in frame translocation between exon 6 (according to transcript NM_005933) of MLL and exon 4 of ENAH. This novel MLL-ENAH transcript encodes a protein of 1685 amino acids, in which the AT hook and CXXC zinc finger motifs of MLL are fused to the actin-binding EVH2 domain of ENAH.
[0097] Accordingly, in another aspect, the present invention provides a method for detecting a MLL-ENAH fusion in a sample (e.g., a leukemia cell sample), said method comprising contacting said sample with one or more oligonucleotide suitable for detecting MLL-ENAH fusion, for example by amplification, hybridization, sequencing or any other suitable method (e.g., any of the methods described above).
[0098] In an embodiment, the present invention provides a method for detecting a MLL-ENAH fusion in a sample (e.g., a leukemia cell sample), said method comprising contacting said sample with a first oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 to 1212 of the MLL protein, or to a complement thereof, and a second oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 17 to 591 of the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization. In an embodiment, the first oligonucleotide hybridizes to a sequence of nucleotides in bold in Fig. 3G, or to the complement thereof. In an embodiment, the second oligonucleotide hybridizes to a sequence of nucleotides in italics in Fig. 3G, or to the complement thereof.
[0099] In another embodiment, the present invention provides a method for detecting a MLL-ENAH fusion in a sample (e.g., a leukemia cell sample), said method comprising contacting said sample with an oligonucleotide that spans the junction between MLL and ENAH, i.e. that comprises a first portion that hybridizes to a nucleotide sequence derived from MLL, or to a complement thereof, and a second portion that hybridizes to a nucleotide sequence derived from ENAH, or to a complement thereof, under conditions suitable for nucleic acid hybridization. In an embodiment, the oligonucleotide hybridizes to a sequence encompassing contiguous nucleotides in bold, underlined and in italics in Fig. 3G.
[00100] In an embodiment, the present invention provides a method for detecting a MLL-ENAH fusion in a sample, said method comprising contacting said sample with an oligonucleotide comprising a first domain that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein (e.g., a sequence of nucleotides in bold in Fig. 3G), or to a complement thereof, and a second domain that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein (e.g., a sequence of nucleotides in italics in Fig. 3G) or to a complement thereof, under conditions suitable for nucleic acid hybridization. In an embodiment, said first oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof. In an embodiment, said second oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof. In a further embodiment, said first domain hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof, and said second domain hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
[00101] In an embodiment, the present invention provides a method for detecting a MLL-ENAH fusion in a sample, said method comprising performing a sequencing reaction on said sample with (i) a MLL-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the ENAH protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample; and/or (ii) a ENAH- specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the MLL protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample. In an embodiment, said MLL-specific oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof. In an embodiment, said ENAH-specific oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
[00102] In another aspect, the present invention provided an assay mixture for the assessment of MLL leukemia (e.g., for the diagnosis of MLL leukemia), the mixture comprising: a sample from a subject suspected of suffering from MLL leukemia; and reagents for detecting determining/measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, , and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least one of mutations set forth in Table 3.
[00103] In another aspect, the present invention provided a system for the assessment of MLL leukemia (e.g., for the diagnosis of MLL leukemia), the system comprising: a sample from a subject suspected of suffering from MLL leukemia; and one or more assays for detecting determining/measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least one of mutations set forth in Table 3. [00104] In another aspect, the present invention further provides a kit for the assessment of MLL leukemia (e.g., for the diagnosis of MLL leukemia), the kit comprising: (i) one or more reagents for determining/measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least one of mutations set forth in Table 3, in a biological sample. In an embodiment, the kit comprises reagents for detecting the level of expression of at least 2, 3, 4, or 5 of the genes listed in Table 1 and/or Table 2, and/or at least one of the transcripts of SEQ ID NOs: 13-23, and/or at least 2, 3, 4, or 5 of the mutations set forth in Table 3, in a biological sample.
[00105] In an embodiment, the one or more reagents comprise, for example, primer(s), probe(s), antibody(ies), solution(s), buffer(s), nucleic acid amplification reagent(s) (e.g., DNA polymerase, DNA polymerase cofactor, dNTPs), nucleic acid hybridization/detection reagent(s), and/or reagents for detecting antigen-antibody complexes, etc. In an embodiment, the assay mixture or kit comprises one or more pairs of primers for amplifying one or more nucleic acids correspond to the gene(s) depicted in Table 1 , Table 2 and/or Table 3, and/or at least one of the transcripts of SEQ ID NOs: 13-23. In an embodiment, the assay mixture or kit comprises one or more probes for detecting one or more nucleic acids correspond to the gene(s) depicted in Table 1 , Table 2 and/or Table 3, and/or at least one of the transcripts of SEQ ID NOs: 13-23. In an embodiment, the assay mixture or kit further comprises one or more reagents for determining/measuring the level of expression of at least one normalization/housekeeping gene (e.g., ABL1) in the sample. Examples of suitable pair of primers for amplifying a ABL1 nucleic acid, and of suitable probes for detecting a ABL1 nucleic acid, are described herein. Such reagents (probes, primers, antibodies, etc.) may be labelled with suitable detectable tags, such as quenchers, chromophores, fluorophores, etc. to facilitate detection of the genes, transcripts or proteins of interest.
[00106] Furthermore, in an embodiment, the kit may be divided into separate packages or compartments containing the respective reagent components explained above.
[00107] In addition, such a kit may optionally comprise one or more of the following: (1) instructions for using the reagents for the diagnosis of MLL leukemia; (2) one or more containers; and/or (3) appropriate controls/standards. Such a kit can include reagents for collecting a biological sample from a patient and reagents for processing the biological sample. The kits featured herein can also include an instruction sheet describing how to perform the assays for measuring gene expression. The instruction sheet can also include instructions for how to determine a reference cohort (control patient population), including how to determine expression levels of genes in the reference cohort and how to assemble the expression data to establish a reference for comparison to a test patient. The instruction sheet can also include instructions for assaying gene expression in a test patient and for comparing the expression level with the expression in the reference cohort to subsequently determine the appropriate treatment regimen for the test patient.
[00108] In another aspect, there is provided the use of the kit or assay mixture described herein for the diagnosis of MLL leukemia.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
[00109] The present invention is illustrated in further details by the following non-limiting examples.
Example 1 : Materials and Methods
[00110] Specimen collection, ethics and cohort characteristics. All samples were collected between 2001 and 2015 according to Quebec Leukemia Cell Bank (Banque des Cellules Leucemiques du Quebec, BCLQ) procedures after obtaining written informed consent from all patients. Normal bone marrow samples were obtained from the Quebec Leukemia Cell Bank and from Lonza. Normal cord blood (n=17) derived CD34+ cells were processed as previously described37. Peripheral mature cells populations (n=23) were isolated from the blood of 5 healthy donors).
[00111] Conventional cytogenetics and FISH analysis. Metaphase preparation for cytogenetics (G banding) and fluorescent in situ hybridization (FISH) experiments were performed according to standard procedures. The Vysis LSI MLL Dual Color, Break Apart Rearrangement Probe (Abbott Molecular) and the following Bacterial artificial chromosomes (BACs) probes were used for FISH analysis to confirm the MLL rearrangements and identify the MLL translocation partners : RP11 -727C8 targeting the MLLT4 gene at chromosomal band 6q27, RP1 1-588L23 {MLLT10, 10p12.31 ), RP11 -451 F21 {CASC5, 15q15.1), RP1 1- 952P13 {GAS7, 17p13.1 ), RP11-607B2 {MLLT6, 17q12), RP11 -449M1 {SEPT9, 17q25.3), RP1 1-908B10 {ELL, 19p13.11 ) and RP11 -819E16 (MLLT1, 19p13.3). The BACs were selected from the UCSC genome browser (http://genome.ucsc.edu/cgi-bin/hgGateway) and obtained from BACPAC Resources Center (Children's Hospital Oakland Research Institute, Oakland, CA; http://bacpac.chori.org/). BAC probes were validated on normal metaphases and labeled with Spectrum Orange-dUTP by nick translation according to manufacturer's instructions (Abbott Molecular, Nick Translation kit 07J00-001), denatured and hybridized on pretreated slides. Slides were incubated at 37°C for 18 hours in a humidified chamber, washed 10 to 30 seconds in 0.4X SSC/0.3% NP-40 and in 2X SSC/0.1 % NP-40 solutions at 55°C and counterstained with DAPI II (Abbott Molecular). FISH signals were captured using CytoVision® software version 4.02 (Leica Microsystems). Samples harboring an ML., translocation detected by standard cytogenetic analysis and/or presenting a typical FISH signal patterns were included in the MLL-F AML cohort.
[00112] RNA and DNA isolation. RNA was isolated from primary AML cells using Trizol® reagent according to the manufacturer's instructions (lnvitrogen®/Life Technologies®) with an additional purification on RNeasy® mini columns (Qiagen®) to obtain high quality RNA. DNA was isolated and purified using DNeasy® protocols (Qiagen®).
[00113] Next-generation sequencing and mutation validations. Workflow for sequencing, mutation analysis and transcripts quantification have been described previously38. A brief overview and protocol modifications are described below. Libraries were constructed with TruSeq® RNA / TruSeq® DNA Sample Preparation Kits (lllumina®). Sequencing was performed using an lllumina HiSeq® 2000 with 200 cycles paired end runs. Sequence data were mapped to the reference genome hg19 using the lllumina® Casava 1.8.2 package and Elandv2 mapping software according to RefSeq annotations (UCSC, April 16th, 2014).
[00114] Variants were identified using Casava 1.8.2 and fusions or larger mutations such as partial tandem duplications with Tophat 2.0.7 and Cufflinks 2.1 .1 . All mutations in 55 leukemia-associated genes listed in Table 23 were analyzed as previously reported38. All variants reported had a variant allelic frequency (VAF) > 20%, >8 variant reads,≥ 20 total reads and a quality score≥ 20. Because NRAS, KRAS and FLT3 mutations are commonly found in minor clones1 1, a VAF of ≥ 5% was tolerated if ≥ 8 variant reads were present in "hotspots" of those genes. In addition, a VAF of≥ 1 % was tolerated only if the same variant was found in both exome and transcriptome. In order to identify novel recurrent mutations in other genes (n = 24531 ), all genes with variants in RNA-sequencing of ≥ 3/31 MLL-F leukemia samples (-10%) were also systematically analyzed according to the previously described pipeline38 and are detailed in Table 24. Acquired or germline origin of all new variants not present in the COSMIC database were all confirmed by Sanger sequencing of non-tumoral DNA from mouth swabs or saliva.
[00115] Transcript levels are given as Reads Per Kilobase per Million mapped reads (RPKM) and genes are annotated according to RefSeq annotations (UCSC, April 16th, 2014).
[00116] /WLL-/AF9 AML mouse model. The generation of MLL-AF9 AML /n Vo from human stem/progenitor cord blood cells has already been published39. Briefly, single donor cord blood CD34+ cells were transduced with a retrovirus containing MLL-AF9 along with EGFP and then cultured in myeloid promoting conditions with IL3, SCF and 15% FCS. At day 30 of culture, cells were transplanted into sub-lethally irradiated female NSG mice (107 cells per mouse, average of 5 mice per experiment). Mice were analyzed 20-24 weeks after injection and the human engraftment was characterized. This experimental strategy generates both AMLs and B-ALLs in a 1 :1 ratio. If the AML cells represented less than 80% of the bone marrow population, positive selection with an anti-CD33 (Stem Cell Technologies®) was performed before RNA sequencing. A fraction of the cells was not injected in mice but rather maintained in myeloid culture for RNA-sequencing at day 80 (labeled MLL-AF9 in Fig. 3F).
[00117] LOC100289656 Real-Time quantitative polymerase chain reaction experiments. Plasmid standard curves were developed following the guidelines of the Europe Against Cancer program40. Plasmids were obtained from Life Technologies®. According to the molecular weight of each plasmid (vector backbone pMA- T), 20 g were linearized with the Seal restriction enzyme for 1 h at 37°C. The digested plasmid was serially diluted in a Tris-EDTA solution (pH 8.0) containing 100 ng/μΙ of yeast tRNA (Sigma-Aldrich®). Six successive dilutions (200 000, 20 000, 2000, 200, 20 and 2 copies/μΙ) were prepared and stored in 100 μΙ aliquots at - 20°C. Total RNA was extracted from 5 x 106 cells with TRIzol® reagent (Life Technologies®) and 1 g of RNA was reverse transcribed into cDNA using the QuantiTect® Reverse Transcription Kit (Qiagen®) in a 20 μΙ reaction mix according to the manufacturer's protocols. qRT-PCR was performed with the TaqMan® Gene expression Master Mix (Applied Biosystems®). The reaction mixture contained 12.5 μΙ of master mix, 500 nM of each primers, 200 nM FAM/ZEN/3' IBFQ probe (IDT), and 5 μΙ of cDNA (or plasmid dilutions) in a total volume of 25 μΙ. The LOC100289656 (NR_036475.2) cDNA was amplified using the following forward: 5'- TGGGTTGTTAGCTCCAGATCA-3' (SEQ ID NO: 1) and reverse: 5'-AAACTGCACCTCCCCTCTTC-3' (SEQ ID NO: 2) primers. Sequence of the probe was: 5'-ACTCCTGATTTGGAAAAAGCTTCTTGAA-3' (SEQ ID NO: 3). The primers and probe sequences of the ABL1 control housekeeping gene were selected according to 41 : ABL1 -Forward: 5'-TGGAGATAACACTCTAAGCATAACTAAAGGT-3' (SEQ ID NO: 4), ABL1 -Reverse: 5'- GATGTAGTTGCTTGGGACCCA-3' (SEQ ID NO: 5) and ABL1-Pmbe: CCATTTTTGGTTTGGGCTTCACACCATT (SEQ ID NO: 6). Amplification conditions were 2 min at 50°C and 10 min at 95°C, followed by 50 cycles of 15 sec at 95°C and 35 sec at 62°C. All samples were tested in duplicate.
[00118] Chemical screen - cell culture. Frozen AML mono-nucleated cells were thawed at 37°C in Iscove's modified Dulbecco's medium (IMDM) containing 20% FBS and DNase I (100 g/mL). Cells were then cultured in optimized AML growth medium: IMDM, 15% BIT (bovine serum albumin, insulin, transferrin; Stem Cell Technologies®), 100 ng/mL SCF, 50 ng/mL FLT3-L, 20 ng/mL IL-3, 20 ng/mL G-CSF (Shenandoah®), 10"4 M β-mercaptoethanol, 500nM SR1 (Alichem®), 500nM UM729 (synthesized at the Medicinal Chemistry Core Facility at the Institute for Research in Immunology and Cancer (IRIC)), gentamicin (50 μg/mL) and ciprofloxacin (10 g/mL) (Pabst et al., Nat Methods. 2014 Apr;1 1 (4):436-42).
[00119] Chemical screen - Selection of samples. Samples included in the single-agent chemical screen were pre-screened from our AML cohort for their proliferative capacity (Table 19). Ten different MLL-F AML samples (from which 6 did not display any mutation in the RAS-pathway (RAS-WT, no detectable RAS clone) and 4 carried mutations in the RAS-pathway (RAS-MUT, VAF>25%) as well as 10 different samples of AML with normal karyotype (NK) (from which 5 were RAS-WT and 5 were RAS-MUT, Table 19) were thus selected. Patient cells included in the combinatorial chemical screen consisted of 3 MLL-F RAS-MU1 and 3 MLL-F RAS- WT samples that were randomly selected from the primary screen.
[00120] Chemical screen - cell viability assay. Cells were seeded in 384-well plates at a density of 5,000 cells in 50 μί per well. Compounds were added to seeded cells in serial dilutions (10 dilutions, 1 :3, 10 μΜ down to 0.5 nM), in duplicates. In the combinatorial screen, compounds were added to seeded cells in duplicates at their EC25 concentrations as determined in the single-agent screen (Table 25).
[00121] In both chemical screens, cells treated with 0.1 % DMSO without additional compound were used as negative controls. Viable cell counts per well were evaluated after 6 days of culture using the CellTiterGlo® assay (Promega®) according to the manufacturer's instruction. The percent of inhibition was calculated as follows: 100 - (100 * (mean-luminescence(compound) / mean-luminescence (DMSO)); where mean- luminescence(compound) corresponds to the average of luminescent signals obtained for the two replicates of compound-treated cells, and mean-luminescence (DMSO) corresponds to the average of luminescent signals obtained for the replicates of control DMSO-treated cells.
[00122] In the single-agent screen, EC50 or suboptimal EC25 values (corresponding to the concentration of compound required to reach 50% or 25% of inhibition respectively) were calculated using ActivityBase® SARview Suite (IDBS, London, UK) and GraphPad® Prism 4.03 (La Jolla, CA, USA).
[00123] In the combinatorial screen, synergism between drug A and B was evaluated according to the method described in42 43: the ratio (R) between [the expected percentage of viable cells (Pexp = percent of viable cells for drug A at EC25 as measured in Fig. 11 x percent of viable cells for drug B at EC25 as measured in Fig. 11)] and [100 x observed percentage of viable cells (Pobs = percent of viable cells in presence of drug A + drug B both at their EC25 concentration, as measured in Fig. 12)] was calculated so as to evaluate the presence (R>1 ) or absence (R≤ 1 ) of synergy.
[00124] Chemical screen - compounds. All powders were dissolved in DMSO and diluted in culture medium immediately before use. Final DMSO concentration in all conditions was 0.1 %. The suppliers for each compound tested are listed in Table 18.
[00125] Statistics - Mutations and transcriptome. Fisher's exact test was used in the analysis of contingency tables. Analysis of differential gene expression was performed using the Wilcoxon rank-sum test and the false discovery rate (FDR) method was applied for global gene analysis as previously described38. For illustration of transcriptomes using scatterplot, genes with a differential expression of average logio RPKM≥ 1 between MLL and non MLL leukemias combined to an adjusted FDR q-value < 0.05 were considered differentially expressed in MLL AML. Gene Set Enrichment Analysis (GSEA) was performed by computing overlaps with curated gene sets in www.broadinstitute.org/gsea/msigdb/annotate.jsp (Subramanian, Tamayo, et ai, 2005, PNAS 102, 15545-15550) and Mootha, Lindgren, et al., 2003, Nat Genet 34, 267-273).
[00126] Generation of a full Leucegene-specific transcriptome annotation. Complementary to the Eland v2 mapping based on RefSeq annotations, a final "ab initio" transcriptome assembly was generated based on raw sequence data using Tophat/Cufflinks methodology. This pipeline, which had served to explore new putative non-coding genes, was refined to accommodate the simultaneous detection of new intergenic transcripts as well as novel splice isoforms of already annotated genes. This analysis utilized the Gencode (version 19) annotation, a significantly more comprehensive transcriptome annotation than Refseq, resulting in the discovery of 78,336 novel splice isoforms, 2,607 new intergenic transcribed loci (with 4,814 transcripts) and 1 ,789 new antisense transcripts. The annotation of novel genes/transcripts was merged with the Gencode (v19) annotation to obtain a complete Leucegene specific transcriptome catalog comprising roughly 51 ,000 genes and almost 280,000 transcripts. FPKM expression values on both isoform and gene levels across all Leucegene AML and control samples were computed using Cufflinks. Splice isoforms were identified with Tophat 2.0.7 and Cufflinks 2.1 .1 ., and are expressed in Fragments Per Kilobase of exon per Million fragments mapped (FPKM)).
[00127] Statistics - Chemical screen. For cases when leukemic cells did not respond to the compounds at the concentrations tested, EC50 values were arbitrarily reported at the highest dose tested = Ι ΟΟΟΟηΜ (corresponding to an under-estimation of the real EC50). Differences between groups of patients were evaluated using a Wilcoxon rank-sum test in R to probe for significance (version 3.1 .1). In order to alleviate the effects of ties, the test was carried out on (logio (EC50) + ε) values, where ε is a small normally distributed random value (μ=0, σ=0.001 ). Discriminatory inhibitors were compounds for which the median of the p-values of 5 consecutive simulations was O.05. In Fig. 12B, p-values were calculated using a one-way analysis of variance (ANOVA) in GraphPad® Prism 4.03.
Example 2: Exome/transcriptome analysis
[00128] The exome and transcriptome of 31 AML with MLL translocations, including 9 samples with t(9;11 )(p22;q23)/MZl-MLLT3 fusion gene, 8 with t(6; 11 )(q27;q23)/MLL-M.± Γ4 and 4 with t(11 ;19)(q23;p13.3)/MZ_Z_-EA Z_, were sequenced and compared to transcriptomes of 384 control non-MLL-F AMLs, which included 23 MLL PTD specimens. Baseline characteristics of cohorts are shown in Table 4 and additional clinical, morphological, cytogenetic and sequencing information of both cohorts is available in Tables 5a, 5b and 6. MLL fusion breakpoints detected by RNA-sequencing are detailed in Table 7.
Table 4: Characteristics of MLL and control cohorts studied herein
MLL (n=31 ) non-MLL (n=384)
AML
De novo 26 (83.9%) 363 (94.5%) t-AML 5 (16.1 %) 21 (5.5%)
Gender
Male 15 (48.4%) 220 (57.3%)
Female 16 (51.6%) 164 (42.7%)
Age(years)
Median 46 59
Range 20-75 17-87
WBC count(x 109/L)
Median 36.5 31.4
Range 1.8-184.6 0.8-361.2
FAB subtype
M0 2 (6.5%) 25 (6.5%)
Figure imgf000038_0001
WBC: white blood cells, FAB: French-American-British, t-AML: therapy- related acute myeloid leukemia.
Table 5a: Clinical and laboratory characteristics
Figure imgf000038_0002
10H031 25 F M5B 184.6 73 MLLT4 +
10H058 29 F M5A 2.9 88 X MLLT3 +
10H127 36 M M5A 65.8 92 MLLT3 +
12H057 34 F M2 6.1 62 MLLT4 +
14H031 47 M M5 14.7 89 X MLLT4 +
NC: Not e assifiable
Table 5b: Sequencing and mapping statistics
Figure imgf000039_0001
Average 171.87 47.97
Table 6: Cytogenetic distribution of the non-JWLL-F AML cohort.
non-MLL AML
(n=384)
Figure imgf000040_0001
Table 7: Chromosomal breakpoints of MLL-F samples detected by RNA-sequencinq.
Sample Fusion Gene 1 Position gene 1 Exon/lntron Gene 2 Position gene 2 Exon/lntron
01 H001 MLL-MLLT4 MLL chr11 1 18353207 8 MLLT4 chr6: 168265228 1
02H017 MLL-ENL MLL chr11 1 18355028 9 ENL chr19:6218051 7
02H032 MLL-MLLT6 MLL chr11 1 18353207 8 MLLT6 chr17:36868097 6
03H067 MLL-SEPT9 MLL chr11 1 18352806 7 SEPT9 chr17:75303222 1
04H041 MLL-SEPT9 MLL chr11 118352806 7 SEPT9 chM 7:75303222 1
04H080 NA NA NA NA NA NA NA
MLL-ELL MLL chr11 118355028 9 ELL chr19:18583691 2
04H121 MLL-ELL MLL chr11 118355689 10 ELL chr19:18583691 2
MLL-ELL MLL chr11 118359328 10 ELL chM 9: 18632730 1
05H025 MLL-MLLT3 MLL chr11 1 18353209 8 MLLT3 chr9:20365741 6
05H066 MLL-MLLT4 MLL chr11 1 18353207 8 MLLT4 chr6: 168265228 1
MLLT10-
05H128 MLL MLLT10 chr10:21959377 8 KMT2A chM 1 :1 18353209 8
MLL- CASC5 MLL chr11 :1 18353209 8 CASC5 chM 5:40920267 10
06H066
MLL- CASC5 MLL chr11 :1 18353209 8 CASC5 chM 5:40920267 9
06H088 MLL-MLLT4 MLL chr11 :1 18353209 8 MLLT4 chr6: 168265230 1
06H117 MLL-MLLT4 MLL chr11 :1 18353209 8 MLLT4 chr6: 168265230 1
MLL-GAS7 MLL chr11 :1 18353209 8 GAS7 chr17:9923213 2
MLL-GAS7 MLL chM 1 :1 18353209 8 GAS7 chr17:9923213
06H152 MLL-GAS7 MLL chr11 :1 18354897 8 GAS7 chM7:10017758 1
MLL-GAS7 MLL chr11 :1 18354897 8 GAS7 chM7:10101524 1
MLL-GAS7 MLL chr11 :1 18354897 8 GAS7 chr17:9929016 1
MLL-ELL MLL chr11 :118355028 9 ELL chr19:18583691 2
07H003
MLL-ELL MLL chM 1 :118359328 10 ELL chM 9: 18632730 1
07H041 MLL-MLLT3 MLL chM 1 :1 18353205 8 MLLT3 chr9:20365745 5
07H045 MLL-ENL MLL chM 1 :1 18353209 8 ENL chM 9:6222694 6
MLLT10-
07H160 MLL MLLT10 chr10:21940601 7 KMT2A chM 1 :1 18353209 8
08H021 MLL-MLLT3 MLL chM 1 :1 18355025 9 MLLT3 chr9:20365744 5
08H021 MLL-MLLT3 MLL chM 1 :1 18355687 10 MLLT3 chr9:20365743 5
08H085 MLL-ENL MLL chM 1 :1 18355943 10 ENL chM 9:6271264 1 08H129 MLL-MLLT4 MLL chr11 1 18353209 8 MLLT4 chr6: 168265230 1
08H139 MLL-ENL MLL chr11 1 18355026 9 ENL chrl 9:6270771 1
09H010 MLL-MLLT3 MLL chr11 1 18353207 8 MLLT3 chr9:20353595 9
MLL-ELL MLL chr11 1 18353209 8 ELL chrl 9: 18576727 3
09H018
MLL-ELL MLL chr11 1 18354897 8 ELL chrl 9: 18583644 2
09H032 MLL-MLLT3 MLL chr11 1 18353209 8 MLLT3 chr9:20354876 9
09H098 MLL-MLLT3 MLL chr11 1 18355028 9 MLLT3 chr9:20365741 6
10H031 MLL-MLLT4 MLL chr11 1 18353209 8 MLLT4 chr6: 168265230 1
10H058 MLL-MLLT3 MLL chr11 1 18353205 8 MLLT3 chr9:20365745 5
10H127 MLL-MLLT3 MLL chr11 1 18353209 8 MLLT3 chr9:20365741 6
12H057 MLL-MLLT4 MLL chr11 1 18353209 8 MLLT4 chr6: 168265230 1
14H031 MLL-MLLT4 MLL chr11 1 18353207 8 MLLT4 chr6: 168265228 1
Identification of L0C100289656 as an MLL-F specific pseudogene in human AML
[00129] 140 genes, representing -0.57% of RefSeq entries, with expression levels characteristic of MLL-F versus non-MLL-F specimens were identified. Of these genes, 84 were over- and 56 under-expressed (Fig. 1 A and Tables 8-9).
Table 8: 84 overexpressed genes in MLL-F AML. Genes included in gene set enrichment datasets are
Figure imgf000041_0001
CGNL1 1 .53E-09 2.06 3.08 1.02
L0C101929733 2.34E-09 1.25 3.48 2.22
MPPED1 2.65E-09 2.06 3.14 1.08
METTL7B 3.12E-09 4.10 5.22 1.13
ZNF521 3.75E-09 4.07 5.30 1.23
SYT17 4.00E-09 2.96 4.20 1.24 X
H0XA-AS3 4.80E-09 3.29 4.54 1.25
CCL22 9.91 E-09 1.73 3.09 1.36
KCNC3 1 .66E-08 3.17 4.35 1.18
SAGE1 1 .96E-08 1.50 3.80 2.29 X
UPK3A 2.07E-08 2.69 4.22 1.53
PENK 2.57E-08 1.79 3.83 2.04 X
CT45A5 2.61 E-08 1.12 3.40 2.28
GAS1 3.44E-08 2.65 3.75 1.10
CES1 3.45E-08 3.78 5.36 1.59 X X
SCUBE1 1 .20E-07 3.97 5.00 1.02
TMEM105 1 .28E-07 2.98 4.25 1.27
MSX2 1 .42E-07 1.52 3.14 1.62
MOCS1 1 .46E-07 2.46 3.57 1.11
KCNS1 1 .60E-07 2.06 3.11 1.05
TLE6 1 .62E-07 2.29 3.37 1.07
FEZ1 1 .90E-07 3.23 4.36 1.13 X
RSP01 1 .90E-07 1.66 3.07 1.40
ELOVL3 2.13E-07 2.73 3.84 1.11
C2 3.10E-07 3.95 4.98 1.03 X
OTOF 3.42E-07 2.25 3.33 1.07
LINC00482 3.85E-07 3.43 4.50 1.07
SLAMF9 4.86E-07 2.41 3.42 1.01
GPC3 6.85E-07 1.95 3.31 1.36
HOXA9 7.80E-07 4.81 5.97 1.16 X
LOC100996342 7.98E-07 2.45 3.48 1.02
SYT3 8.06E-07 1.88 3.04 1.15
LOC101928455 9.05E-07 2.76 3.77 1.01
TGM5 9.05E-07 3.13 4.21 1.09 X
LPAR3 1 .17E-06 2.35 3.64 1.29
KLHL30 1 .22E-06 1.81 3.02 1.21
HOXA10-AS 1 .32E-06 3.67 4.68 1.01
ADAMTSL2 1 .91 E-06 2.14 3.17 1.03
GPR126 2.05E-06 2.76 4.42 1.67
BVES 2.29E-06 1.73 3.09 1.36
CTSV 2.42E-06 2.08 3.28 1.20
MECOM 2.57E-06 1.69 3.42 1.72
CYB5R2 2.83E-06 2.52 3.74 1.23
TNNT1 3.29E-06 3.76 4.85 1.08
VAT1 L 5.18E-06 2.12 3.31 1.18
ADRA2C 5.72E-06 2.69 3.81 1.12 H0XA7 6.36E-06 3.91 5.08 1.18
CLEC2A 1 .21 E-05 1.43 3.02 1.59
H0XA6 1 .37E-05 3.94 5.22 1.28
TKTL1 2.31 E-05 3.06 4.30 1.24
PRKCDBP 2.76E-05 2.91 4.05 1.14
UNC5C 3.29E-05 1.84 3.22 1.38
KCNE1 L 3.41 E-05 3.45 4.69 1.24
SUM01 P1 3.72E-05 2.38 3.53 1.15
SYDE2 4.36E-05 2.55 3.64 1.09
HOXA11 5.61 E-05 2.77 3.93 1.16
CTGF 5.77E-05 3.15 4.31 1.16
PRL 7.20E-05 1.98 3.38 1.40
MSLN 8.22E-05 2.90 4.38 1.49
C3orf14 0.000104 2.55 3.75 1.20
NKAIN2 0.000134 2.09 3.28 1.19
DES 0.000202 2.65 3.72 1.06 X X
PPARGC1A 0.000377 2.22 3.27 1.06
ADAM23 0.00083 2.16 3.20 1.04
H0XA5 0.000836 4.49 5.51 1.03
ZFP57 0.002209 2.12 3.31 1.19
LAMP5 0.00261 1 3.03 4.10 1.07
DAPL1 0.003302 3.03 4.03 1.00 X X
* Valk et al. Prognostically Useful Gene-Expression Profiles in Acute Myeloid Leukemia. The New England Journal of Medicine 350, 1617-1628 (2004)
**Ross, M.E. Gene expression profiling of pediatric acute myelogenous leukemia. Blood (2004) 104(12):3679-87
Table 9: 56 underexpressed genes in MLL-F AML. Genes included in gene set enrichment datasets are indicated
Figure imgf000043_0001
STK32B 2.13E-07 4.14 2.91 -1.24 X X
CPA3 2.42E-07 5.34 4.05 -1.29
OR2T8 2.42E-07 3.20 1.92 -1.28
F2RL1 2.69E-07 3.82 2.76 -1.06
ST0N2 2.95E-07 4.41 3.35 -1.06
DNTT 4.44E-07 3.80 2.07 -1.74
ZNF492 5.14E-07 3.37 2.23 -1.13
HOXB2 6.17E-07 4.70 3.59 -1.10 X
APP 8.10E-07 5.11 4.08 -1.03 X X
ZNF471 9.03E-07 3.76 2.70 -1.06
ZNF667-AS1 1.14E-06 4.07 3.00 -1.07
ZNF730 1.17E-06 3.38 2.14 -1.24
ZNF667 1.80E-06 3.74 2.60 -1.14
H0XB-AS1 2.22E-06 4.02 2.76 -1.26
CYTL1 2.34E-06 5.12 3.87 -1.24 X X
MYCN 2.60E-06 4.55 3.25 -1.30
H0XB3 4.56E-06 4.57 3.41 -1.16
UM0DL1 4.75E-06 3.63 2.53 -1.09
H0XB-AS3 5.15E-06 3.40 1.23 -2.17
CPA6 5.37E-06 3.15 1.68 -1.47
ZNF625-ZNF20 5.38E-06 3.89 2.66 -1.23
BAALC 5.73E-06 4.69 3.38 -1.31 X X
H0XB4 5.83E-06 4.37 3.34 -1.03
H0XB5 7.39E-06 3.54 1.71 -1.83
GUCY1A3 7.44E-06 4.52 3.37 -1.15
NAT8B 7.44E-06 3.14 2.12 -1.03
NR5A1 8.50E-06 3.08 2.02 -1.06
TM4SF1 1.00E-05 4.09 2.98 -1.12 X X
ZNF135 1.14E-05 3.68 2.65 -1.03
ANGPT1 2.33E-05 4.76 3.75 -1.01
OR2L13 2.58E-05 3.11 1.82 -1.29
MYCNOS 2.95E-05 3.29 1.90 -1.38
OR2L1 P 3.78E-05 3.41 2.12 -1.28
LOCI 00130417 4.14E-05 3.29 2.24 -1.05
C21orf128 6.10E-05 3.28 2.06 -1.22
LOC101927720 7.08E-05 3.33 2.20 -1.13
S100Z 7.71 E-05 4.72 3.45 -1.27
CD34 9.70E-05 5.24 4.21 -1.03 X
TUSC8 9.79E-05 3.27 2.19 -1.08
MIR181 B1 0.000102 3.74 2.56 -1.18
DYTN 0.000117 3.58 2.24 -1.34
PRDM16 0.000123 3.08 1.93 -1.15
ZNF112 0.000186 3.06 2.01 -1.05
HOXB6 0.0002 3.67 2.31 -1.36
HPGDS 0.000234 4.19 3.18 -1.01 X X
CEACAM8 0.001 192 4.25 3.22 -1.04 WT1 0.002707 4.24 3.20 -1.04
CA4 0.006724 3.04 2.02 -1.02
Mullighan, C.G. et al. (2007) Leukemia 21 (9):2000-9
[00130] The HOXA/HOXB clusters were among the most discriminatory genes (Fig. 1A). Expression of other discriminatory genes is shown in Fig. 1 B. Gene set enrichment analysis identified strong enrichment for published sets of MLL-F leukemias, thus confirming an overlap between the instant data and existing microarray datasets (Tables 8-10)5 8. Detailed analyses of the 2 major subgroups {MLL-MLLT4 and MLL- MLLT3) (Tables 11-12) revealed that the homeobox NKX2-3 and NKX5-1 genes (also termed HMX3) were the most discriminatory (Figs. 2A-2C). Likewise, MECOM expression discriminated MLL-MLLT4, as previously reported9. Interestingly, another NKX gene, NKX2-5, was the single most preferentially expressed gene in the MLL-SEPT9 subgroup, which included 2 specimens (Table 13)). Tables 14 to 16 show the genes showing differential expression in MLL-MLLT10, MLL-ELL and MLL-ENL, respectively.
Table 10: Geneset enrichments associated to MLL-F AML. Sets enriched for genes over- (a) and underexpressed (b) in MLL-F AMLs. Gene Set Enrichment Analysis (GSEA) was performed by computing overlaps with curated gene sets in www.broadinstitute.org/gsea/msigdb/annotate.isp
Figure imgf000045_0001
# Genes in # Genes FDRq-
Gene Set Name Description p-value
Overlap in Set value
Genes up-regulated in
JAATINEN HEMATO CD133+ [GenelD=8842] cells
POETIC STEM CEL (hematopoietic stem cells, 15 316 7.45 x10-22 3.52 x10-i8 L_UP HSC) compared to the CD133- cells.
The 'MLL signature 1 ': genes
down-regulated in pediatric
AML (acute myeloid leukemia)
MULLIGHAN MLL
with rearranged MLL 11 242 5.95 x10-16 1.41 xlO-12 SIGNATURE_1_DN
[GenelD=4297] compared to
all AML cases with the intact
gene.
VERHAAK AML WIT Genes down-regulated in
10 246 4.35 xl O-14 6.85 x10-11 H_NPM1_MUTATED_ acute myeloid leukemia (AML) DN patients with mutated NPM1
[GenelD=4869l.
The 'MLL signature 2': genes
down-regulated in pediatric
AML (acute myeloid leukemia)
MULLIGHAN MLL
with rearranged MLL 10 281 1 .64 x10-13 1.94 x10-10 SIGNATURE_2_DN
[GenelD=4297] compared to
the AML cases with intact MLL
and NPM1 [GenelD=4869l.
Valk et al. The New England Journal of Medicine 350, 1617-1628 (2004)
Ross, M .E. Blood (2004) 104(12):3679-87
Jaatinen et al., Stem Cells. 2006 Mar;24(3):631-41 . Epub 2005 Oct 6.
Mullighan, C.G. et al. (2007) Leukemia 21 (9):2000-9
Verhaak et al., Blood. 2005 Dec 1 ;106(12):3747-54. Epub 2005 Aug 18.
Table 11a: Genes overexpressed in MLL-MLLT4 AMLs. The 20 genes with the greatest differential average (logio) expression between MLL-MLLT4 (n=8) and other MLL-F AMLs (n=23) are shown. Genes were only considered if FDR g-value was≤ 0.1 and if average expression in MLL-MLLT4 AMLs was≥ 0.1 RPKM
Figure imgf000046_0001
CXCL6 /
ENSG00000124875 0.061 3.64 1 .78 1 .87 0.78 0.05 15.74 0.61 0.02
L0C101927239 /
ENSG00000261156 0.032 3.18 1 .32 1 .86 0.16 0.02 8.08 0.15 0.01
RFPL1 S /
ENSG00000225465 0.085 3.67 2.13 1 .54 0.58 0.13 4.59 0.50 0.01
P2RY1 /
ENSG00000169860 0.006 5.75 4.27 1 .48 101 .15 2.87 35.22 102.12 1.91
SSPN /
ENSG00000123096 0.085 3.98 2.54 1 .44 2.26 0.20 1 1.17 1 .99 0.03
GCNT4 /
ENSG00000176928 0.029 4.13 2.77 1 .36 2.43 0.18 13.20 1 .84 0.04
NFIA /
ENSG00000162599 0.044 4.65 3.31 1 .34 4.98 0.84 5.91 3.62 0.14
TANC1 /
ENSG00000115183 0.023 4.92 3.59 1 .33 10.78 1.13 9.51 10.63 0.41
ROB04 /
ENSG00000154133 0.061 4.30 2.97 1 .33 3.42 0.45 7.64 2.81 0.07
C2orf40 /
ENSG00000119147 0.062 3.14 1 .82 1 .31 0.21 0.03 7.07 0.13 0.03
Table 11b: Genes underexpressed in MLL-MLL T4 AMLs
Figure imgf000047_0002
Table 12a: Genes overexpressed in MLL-MLLT3 AMLs. The 20 genes with the greatest differential average (logio) expression between MLL-MLLT3 (n=9) and other MLL-F AMLs (n=22) are shown. Genes were only considered if FDR gvalue was≤ 0.05 and if average expression in MLL-MLLT3 AMLs was≥ 0.1 RPKM
Figure imgf000047_0001
NKX5-1 /
ENSG0000018862 0.037 4.55 1.93 2.63 12.35 2.73 4.52 10.13 0.01
CNTN4 /
ENSG00000144619 0.040 3.50 1.09 2.41 3.42 1.66 2.06 0.31 0.00
TCF23 /
ENSG00000163792 0.013 3.79 1.50 2.30 0.92 0.05 19.46 0.73 0.01
HMSD /
ENSG00000221887 0.029 3.72 1.44 2.29 1.18 0.09 13.37 0.79 0.01
VTRNA2-1 /
ENSG00000270123 0.018 3.76 1.59 2.17 0.79 0.09 8.60 0.63 0.04
BVES-AS1 /
ENSG00000203808 0.025 3.28 1.13 2.15 0.24 0.04 6.49 0.20 0.00
LINC00477 /
ENSG00000197503 0.025 3.91 FDRl 1 qvaue-.79 2.12 1.18 0.12 9.94 1 .03 0.01
SNAP25 /
ENSG00000132639 0.028 3.79 1.72 2.06 1.78 0.05 34.76 1 .31 0.01
PENK / MLLMLLT3- ENSG00000181 195 0.028 5.28 3.24 2.04 27.12 4.57 5.93 31 .37 0.24
KCNE1 L / OhMLLter
ENSG00000176076 0.029 6.08 4.12 1 .96 236.18 50.65 4.66 240.37 0.22
ZNF536 /
Dffierence
ENSG00000198597 0.028 3.02 1.14 1 .88 0.26 0.02 12.68 0.09 0.00
TKTL1 / Titiranscrpon
ENSG00000007350 0.040 5.56 3.78 1 .77 193.38 27.23 ftacors 7.10 31.30 0.19
CADM1 / Hdiomeooman
ENSG00000182985 0.040 5.08 3.39 1 .68 23.58 4.79 4.9ti proens2 20.05 0.19
DPY19L2P1 /
Oncogenes
ENSG00000189212 0.017 3.15 1.47 1 .68 0.23 0.01 28.05 0.23 0.01
BVES /
P ktiiroennases
ENSG000001 12276 0.035 4.17 2.65 1 .52 1.71 0.40 4.31 1 .71 0.06
PTPRD / Ckdtiyone an ENSG00000153707 0.028 3.33 1.91 1 .42 0.30 0.19 1.60 0.24 0.0h ftt growacor1
NAV3 /
ENSG00000067798 0.032 3.92 2.54 1 .38 2.94 2.52 1.16 0.64 0.03
GIPR /
ENSG00000010310 0.029 4.59 3.22 1 .37 6.22 1.43 4.37 3.66 0.09
WWC1 /
ENSG000001 13645 0.025 4.02 2.68 1 .35 1.91 0.21 8.90 1 .82 0.1 1
HSPB6 /
ENSG00000004776 0.010 4.44 3.14 1 .30 5.21 0.47 11 .12 2.96 0.13
Table 12b: Genes underexpressed in MLL-MLLT3 AMLs.
As seen on scatterplot Gene families
GENE / Ensembl ID PR0M1 / ENSG00000007062 0,034488 2,31 4,68 -2,37
DYTN/ENSG00000232125 0,031233 0,57 2,88 -2,32
OR2L2 / ENSG00000203663 0,030678 0,30 2,58 -2,29
KRT17/ENSG00000128422 0,028131 2,08 4,15 -2,07
C20orf200 / OTTHUMTOOOO0109266 0,045079 0,63 2,69 -2,06
LOC100101266 (HAVCR1P1) /
ENSG00000268442 0,027467 0,80 2,76 -1,96
TTLL10/ENSG00000162571 0,048294 0,77 2,72 -1,96
TSHB/ENSG00000134200 0,036509 0,28 2,22 -1,94 X
DUSP27/ENSG00000198842 0,039415 0,64 2,57 -1,93
MAMDC2/ENSG00000165072 0,037714 2,41 4,33 -1,92
XKR3 / ENSG00000172967 0,043456 0,23 2,08 -1,85
LOC642864 (SPATA42) /
ENSG00000203897 0,03177 0,00 1,79 -1,79
STK32B/ENSG00000152953 0,025621 1,72 3,37 -1,65 X
CYTL1 / ENSG00000170891 0,027467 2,69 4,32 -1,63
ZNF442/ENSG00000198342 0,027321 1,95 3,53 -1,58
POF1B/ENSG00000124429 0,026575 0,00 1,54 -1,54
CD34 / ENSG00000174059 0,034488 3,12 4,64 -1,52
ZNF625/ENSG00000257591 0,035683 2,05 3,50 -1,44
PALM / ENSG00000099864 0,04099 2,60 4,03 -1,43
TMEM92/ENSG00000167105 0,045079 1,43 2,86 -1,43
UMODL1 / ENSG00000177398 0,047929 1,53 2,96 -1,43
ERG/ENSG00000157554 0,031233 3,11 4,50 -1,39 X X
PROK2 / ENSG00000163421 0,037714 3,41 4,78 -1,37 X
C1orf150 (GCSAML) /
ENSG00000169224 0,04099 2,61 3,96 -1,35
MACC1 / ENSG00000183742 0,045079 2,04 3,34 -1,30
LOC344887 / ENSG00000171658 0,047929 1,55 2,82 -1,26
ZNF486/ENSG00000256229 0,01105 2,43 3,64 -1,21
KIAA0125/ENSG00000226777 0,027467 3,12 4,33 -1,20
PRSS3/ENSG00000010438 0,04099 1,68 2,85 -1,17
ZFP30/ENSG00000120784 0,009832 2,63 3,79 -1,16 X
F2RL1 / ENSG00000164251 0,034488 1,95 3,10 -1,15
ZNF254/ENSG00000213096 0,008756 3,20 4,34 -1,15 X
MMP28/ENSG00000271447 0,045079 1,88 3,01 -1,13
IQCD/ENSG00000166578 0,028791 2,50 3,63 -1,12
ZNF737/ENSG00000237440 0,013793 2,62 3,71 -1,10
SH3RF3/ENSG00000172985 0,008756 2,74 3,83 -1,09
CMTM2/ENSG00000140932 0,031233 2,72 3,81 -1,09 X
RETN/ENSG00000104918 0,037714 3,88 4,95 -1,08 X
TCF4 / ENSG00000196628 0,04099 3,27 4,33 -1,06 X
PADI4/ENSG00000159339 0,027467 4,16 5,21 -1,05
ZNF382/ENSG00000161298 0,021891 2,58 3,62 -1,04
PLCB1 / ENSG00000182621 0,04099 3,14 4,17 -1,03
ZSCAN18/ENSG00000121413 0,027467 3,18 4,20 -1,03 TRPS1 / ENSG00000104447 0,04099 3,67 4,68 -1 ,02 X
ZNF91 / ENSG00000167232 0,015288 2,98 3,99 -1 ,01 X
RORC / ENSG00000143365 0,027321 1 ,85 2,86 -1 ,00 X
Table 13a: Genes overexpressed in MLL-SEPT9 AMLs. The 5 genes with the greatest differential average (logm) expression between MLL-SEPT9 (n=2) and other MLL-F AMLs (n=29) are shown. Genes were only considered if average expression in MLL-SEPT9 AMLs was≥ 0.1 RPKM.
FDRl qvaue-
SEPT9_
OhMLLter
Dffierence
Titiranscrpon
ftacors
Hdiomeooman
ti proens
Oncogenes
P ktiiroennases
Figure imgf000050_0001
Ckdtiyone an
Table 13b: Genes underexpressed in MLL-SEPT9 AMLs. h ftt growacor
As seen on scatterplot Gene families
GENE / Ensembl ID
TMEM 183A / ENSG00000163444 0.902706 0.00 3.85 -3.85
CLEC2A / ENSG00000188393 0.902706 0.00 3.18 -3.18
HIST1 H1 D / ENSG00000124575 0.902706 1 .07 4.18 -3.11
HIST1 H4E / ENSG00000276966 0.902706 1 .37 4.32 -2.95
KLRF2 / ENSG00000256797 0.902706 0.00 2.67 -2.67
HOXB6 / ENSG00000108511 0.902706 0.00 2.48 -2.48 X X
BAALC / ENSG00000164929 0.902706 1 .33 3.51 -2.17
CCL1 / ENSG00000108702 0.902706 1 .04 3.21 -2.16 X
MYCN / ENSG00000134323 0.902706 1 .22 3.37 -2.14 X X
LCN6 / ENSG00000267206 0.902706 0.00 2.09 -2.09 Table 14: List of genes up- and down-regulated in MLL-MLLT10
Figure imgf000051_0001
Table 15: List of genes up- and down-regulated in MLL-ELL
As seen on scatterplot Gene families GENE / Ensembl ID
PDZRN4 / ENSG00000165966 0.686831 4.53 1.91 2.62
F0XC1 / ENSG00000054598 0.527603 5.65 3.23 2.42 X
CRISP3 / ENSG00000096006 0.711954 5.04 2.65 2.40
PRG3 / ENSG00000156575 0.686831 4.84 2.59 2.25
EDIL3 / ENSG00000164176 0.686831 3.12 0.95 2.17
CRISP2/ENSG00000124490 0.6 FDRl9 FDRl qvaue qvaue-3-566 3.56 1.39 2.17
IL1RL1 /ENSG00000115602 0.6947 4.63 2.55 2.08
RHOJ / ENSG00000126785 0.6947 3.22 1.14 2.08
ELL
TMEM45A/ENSG00000181458 0.614072 4.64 2.70 1.95
COL4A5/ENSG00000188153 0.6947 4.61 2 OhMLL OhMLL t t.erer72 1.89
S100Z / ENSGOOOO0171643 0.6947 5.00 3.23 1.77
CFH/ENSG00000000971 0.527603 5.03 3.27 1 Dffi Dff.ierence7erence6
HOXA13/ENSG00000106031 0.829102 3.06 1.42 1.64 X X X
Titi T fitit ranscrponranscrponacors
DLK1 /ENSG00000185559 0.762024 3.15 1.52 1.63
ftacors Hdiomeooman
Hdi tiomeooman proens
ti proens
Oncogenes
Oncogenes
P ktiiroennases
P ktiiroennases
Ckdhtityone an grow Ckdtiyone an ftacor h ftt growacor
Figure imgf000052_0002
Table 16: List of genes up- and down-regulated in MLL-ENL
As seen on scatter plot Gene families
GENE /Ensembl ID
Figure imgf000052_0001
SOX11 /ENSG00000176887 0.987811 3.31 0.69 2.62 X
GREM1 / ENSG00000166923 0.987234 3.39 1.24 2.15 X
LCN6 / ENSG00000267206 0.987811 3.66 1.68 1.97 LCN8 / ENSG00000204001 0.987234 2.98 1.01 1.96
SP7/ENSG00000170374 0.987234 4.08 2.20 1.88
CDH11 / ENSG00000140937 0.987811 3.65 2.01 1.64 X
CD177/ENSG00000204936 0.987811 4.52 2.89 1.64
SLC6A3/ENSG00000142319 0.987811 2.78 1.20 1.58
MYL3/ENSG00000160808 0.987811 1.72 0.21 1.51
DDIT4L/ENSG00000145358 0.987811 4.13 2.67 1.46
HMX2/ENSG00000188816 0.987811 3.23 1.77 1.46 X X
PCDHGC3 /
0.987811 4.02 2.60 1.42
ENSG00000240184
FGF10/ENSG00000070193 0.987811 1.78 0.37 1.41 X
EBLN1 / ENSG00000223601 0.987811 2.96 1.58 1.38
NKD2/ENSG00000145506 0.987811 3.94 2.59 1.36
HMX3/ENSG00000188620 0.987811 3.86 2.51 1.36 X X
NKAIN2/ENSG00000188580 0.987234 1.57 3.52 -1.95
HTR1F/ENSG00000179097 0.987811 2.40 4.24 -1.84
S100Z/ENSG00000171643 0.987811 1.89 3.65 -1.75
ZG16B/ENSG00000162078 0.987234 2.10 3.72 -1.63
TIFAB/ENSG00000255833 0.987811 2.54 4.13 -1.59
MECOM / ENSG00000085276 0.987811 1.98 3.55 -1.57 X X
SAGE1 / ENSG00000181433 0.987811 2.43 3.98 -1.55
FIGN / ENSG00000182263 0.987811 0.52 2.04 -1.53
GPR126 (ADGRG6) /
0.987811 3.07 4.59 -1.52
ENSG00000112414
RNF217/ENSG00000146373 0.987811 2.75 4.25 -1.51
PF4/ENSG00000163737 0.987234 2.77 4.27 -1.50 X
CLEC10A/
0.987811 2.20 3.65 -1.45
ENSG00000132514
MMRN1 / ENSG00000138722 0.987234 3.58 5.01 -1.43
NKX2-3/ENSG00000119919 0.987811 1.06 2.48 -1.42 X X
SH3BP4 / ENSG00000130147 0.987234 2.38 3.75 -1.37
[00131] A large proportion (114/140 or 81%) of genes identified herein was not previously associated with MLL AML. Of these, a group of 5 adjacent genes and pseudogenes (LOC100289656, GOLGA6L7P, WHAMMP2, PDCD6IPP2, GOLGA8M) located on chromosome band 15q 13.1 represented the most significant differentially expressed transcripts in MLL -F AML (Fig.3A, 3B). In reference genome, this region of -120 kb is duplicated on chr15q11.2 and highly conserved with over 98% sequence identity. Of interest, genes from this duplicated segment are the second most highly correlated ones to MLL-F AML (Fig.3C), possibly indicating common transcriptional regulation. Expression of the most significant transcript LOC100289656 identified 87.1% of MLL-F AML specimens (sensitivity) and was 95.3% specific (Fig. 3C). Quantitative RT-PCR- (qRT-PCR) based validation confirmed the specific association between LOC100289656 and MLL-F AML (Figs.4A-4B), supporting that this pseudogene could be a useful clinical marker for MLL-F AML.
[00132] CASC10 was also among the most overexpressed genes in MLL-F AML vs. non- lL-F AML samples, and thus an RT-qPCR assay was developed. The CASC10 RT-qPCR assay was developed using the QuantStudio™ 7 system (QS7, ABI) in the fast mode (Fast Advanced MasterMix™, Life Technologies®). The following primers, probe and cycling conditions were used:
Type Sequence SEQ ID NO:
Forward primer 5'-AACGAAGCTGAACGCATTGG-3' 7
Reverse primer 5'-GGGTGGGGACGCCTCT-3' 8
Probe* 5'-TCAAGAAGATGCAATCGCGGGAG-3' 9
Cycling: 50 times, 95°C for 15 sec, 61 °C for 35 sec
*Custom probe from Integrated DNA Technologies (IDT®) labeled with a double quencher (ZEN™ and Iowa Black® FQ, IBFQ), and the fluorophore fluorescein amidite (6-FAM™).
[00133] Fig. 5B depicts the results of a representative CASC10 RT-qPCR assay standard amplification plot, showing a wide dynamic range from 106 to 10 plasmid copies. Based on the data obtained from 8 independent experiments, an efficiency of ~ 98% and a linearity R2 of = 0.997 were obtained. Fig. 5C shows the good correlation between RNA-Seq data (Log (RPKM + 0.0001 )) and RT-qPCR assays for CASC10 expression in 33 MLL-F AML samples. Fig. 5D shows that a significantly higher expression of CASC10 was measured in MLL-F AML samples relative to normal peripheral blood samples (p valueO.0001 , Student t test). The p value between CASC10 expression in MLL-F AML samples and normal bone marrow samples was 0.01 . These results confirm that CASC10 could be a useful clinical marker for MLL-F AML, and may be used to assess minimal residual disease in MLL-F AMLs, for example.
LOC100289656 expression reveals cryptic MLL fusions and a new MLL fusion partner
[00134] Among the 45 AML which expressed LOC100289656 at value >1 RPKM (hereafter called LOC100289656+ samples), 18 were not previously classified as MLL-F leukemias (Fig. 3C). Using NGS reads and a fusion detection algorithm, 5 of these harbored possible cryptic MLL translocations or insertions, of which 4 were confirmed by Sanger sequencing of fusion transcripts and/or FISH. Three of these were shown to be the MLL-MLLT10 fusion transcript (Fig. 3C, Fig. 6A).
[00135] The 4th cryptic fusion is novel, and represents an in frame translocation between exon 6 (according to transcript NM_005933) of MLL and exon 4 of ENAH (Fig. 3D). Confirmation of this new rearrangement and fusion transcript is provided in Fig. 6B. This novel MLL-ENAH transcript encodes a protein of 1685 amino acids, in which the AT hook and CXXC zinc finger motifs of MLL are fused to the actin-binding EVH2 domain of ENAH18 (Fig. 3D). The nucleotide and amino acid sequences of the fused regions of MLL (N-terminal, in bold) and ENAH (C-terminal, in italics) are depicted in Fig. 3G. The clinical, molecular and cytogenetic characteristics of this patient were typical for MLL-F AML and are shown in Fig. 6C. [00136] In summary, 22% (4/18) of LOC100289656+ specimens not previously classified as MLL-F leukemias had cryptic MLL fusions not detected by standard cytogenetics. No cryptic MLL fusions were found in the LOC10028965&™ group.
LOC100289656 expression also identifies MLL PTD leukemias
[00137] Of the 45 LOC100289656+ specimens, 14 did not harbor MLL fusions; however 4 of these were MLL PTDs (Fig. 3C). LOC100289656 expression was also the most distinguishing transcriptional feature of MLL PTD leukemias, which expressed noticeably higher levels of this gene than the non-MLL-F AML (mean of 0.5 vs. 0.1 RPKM for LOC100289656, FDR q-value = 0.0003, Fig. 3E), although expression of this gene was on average lower in MLL PTDs than in MLL-F leukemias (Fig. 3C, upper panel). This gene may thus represent a powerful clinical marker for all MLL-rearranged AMLs.
LOC100289656 is edopically expressed in an experimental model of MLL-F AML
[00138] LOC100289656 is not expressed in normal bone marrow, cord blood, peripheral blood cells (Fig. 4B (using qRT-PCR) and Fig. 7 (using NGS)), nor in the majority of control leukemias not rearranged for MLL (Fig. 3C), suggesting that this gene may be under the direct or indirect regulation of MLL fusion genes. To test this possibility, human CD34+ cord blood cells were transduced with an MLL-AF9 virus and LOC100289656 expression was determined by NGS after transduction and also upon development of AML in vivo in immunocompromised NSG mice. Results showed a 77- and a >500-fold upregulation of this gene in these 2 conditions, respectively, (Fig. 3F) establishing a functional link between MLL-fusions and LOC100289656 expression, thus strengthening the validity of this marker in MLL-F AML.
Example 3: Mutational analysis
Inadivation of SP11 transcriptional network in a subset of MLL-F leukemias
[00139] Seventeen different genes were found to be mutated in our MLL-F cohort (n = 31): NRAS (10/31 , 32%), KRAS (5/31 , 16%), SPI1, FLT3, SRSF2 and IDH2 (3/31 for each gene, 10%), TET2, ASXL1, STAG2 and TP53 (2/31 each) and PTPN11, BRAF, JAK2, CBL, CBLB, SETD2, WT1 and ZRSR2 (1/31 each) (Fig. 8A and detailed in Table 17). Acquired mutations in the transcription factor gene SPI1 (Fig. 8B and Fig. 9) were found in 3/31 MLL-F versus 1/384 non-MLL-F specimens (Fisher's exact test p = 0.001 ). Two of these mutations were found on adjacent amino acid residues (R231 C and A232T) of the ETS domain and 1 mutation induced a frameshift in the N-terminal part of the protein. The 2 ETS domain mutations appeared to behave as loss of function, since they were accompanied by a noticeable reduction in SPI target gene expression (CSF1 R, CSF3R and AIF1 )19"21, when compared to non-mutated specimens (see squared dots in right panels of Fig. 8C).
[00140] Notably, an additional sample with no detectable SPI1 mutations was characterized by low expression levels of both SPI1 and its target genes, possibly indicating an upstream defect in regulation of SPI1 gene expression with consequent loss of target gene expression, as found in the 2 specimens with mutations in the ETS domain (dots in rectangles in Fig. 8C). Altogether, these results suggest that SPI1 is recurrently mutated in MLL-F AML and highlight a possible mechanism at play.
Table 17: Detailed mutations identified in MLL-t AML.
Reference NCBI
Sample Gene Position** Mutation
Accession No.
08H021 ASXL1 chr20:31022441 G643FsX
NM_015338
06H152 ASXL1 chr20:31022441 G643FsX
05H025 BRAF chr7:140453155 D594N NM_004333
08H021 CBL chr11 :1 19148991 C404Y NM_005188
05H128 CBLB chr3: 105495385 R141 * NM_170662
04H121 FLT3 chr13:28592642 D835H
04H080 FLT3 chr13:28608098 K623I NM_004119
01 H001 FLT3 chr13:28592640 D835E
06H152 IDH2 chr15:90631934 R140Q
08H129 IDH2 chr15:90631934 R140Q NM_002168
08H139 IDH2 chr15:90631934 R140Q
06H152 JAK2 chr9:5073770 V617F NM_004972
09H098 KRAS chr12:25398284 G12V
10H022 KRAS chr12:25398284 G12V
09H032 KRAS chr12:25398281 G13D
10H055 KRAS chr12:25398281 G13D
NM_033360
01 H001 KRAS chr12:25398284 G12A
01 H001 KRAS chr12:25398281 G13D
07H041 KRAS chr12:25398281 G13D
14H031 KRAS chr12:25398284 G12A
10H058 NRAS chrl 115256530 Q61 K
03H067 NRAS chrl 115258748 G12C
07H160 NRAS chrl 115256529 Q61 R
07H003 NRAS chrl 115256530 Q61 K
10H031 NRAS chrl 115258747 G12A
06H117 NRAS chrl 115256530 Q61 K
06H117 NRAS chrl 115256529 Q61 R
04H041 NRAS chrl 115256529 Q61 R
NM_002524
01 H001 NRAS chrl 115256529 Q61 R
03H067 NRAS chrl 115256529 Q61 R
06H117 NRAS chrl 115258744 G13D
06H117 NRAS chrl 115258745 G13C
06H117 NRAS chrl 115258745 G13R
07H041 NRAS chrl 115258744 G13D
07H041 NRAS chrl 115258747 G12D
14H031 NRAS chrl 115256529 Q61 L
06H088 PTPN11 chr12:1 12888199 A72V NM_002834 04H121 SETD2 chr3:47103717 R2077* NM_014159
04H080 SPI1 ch 1 :47376900 A232T
07H045 SPI1 chrl 1 :47376903 R231 C NM_003120
08H139 SPI1 chrl 1 :47381436 PIOOFsX
02H032 SRSF2 chr17:74732959 P95R
06H152 SRSF2 chr17:74732959 P95H NM_003016
08H139 SRSF2 chr17:74732959 P95R
07H003 STAG2 chrX: 123159704 H20FsX
07H003 STAG2 chrX: 123164841 E52FsX
NM_001042749
07H003 STAG2 chrX: 123229240 R1205*
04H121 STAG2 chrX: 123197868 F665FsX
02H032 TET2 chr4: 106196343 S1559FsX
02H032 TET2 chr4: 106157420 S774* NM_001127208
04H121 TET2 chr4: 106157023 Q642*
05H025 TP53 chr17:7577120 R273H
NM_001276760
05H128 TP53 chr17:7577121 R273C
06H117 WT1 chrl 1 :32417924 P164FsX NM_024426
07H041 ZRSR2 chrX: 15838370 R290* NM_005089
* stop coc on
** Based on reference genome Hg19
RAS mutation status dictates response to small chemical compounds in MLL-F AML
[00141] 45% or 14/31 of MLL-F AMLs in the collection studied were mutated for components of the RAS- pathway (NRAS, KRAS, PTPN11, BRAF: Fig. 8A). Between one and five different variants of NRAS or KRAS were detected per leukemia, indicating mono- to oligoclonality of the disease, and a high likelihood of acquiring such anomaly in an MLL-F AML (Fig. 8A). The sum of mutations never exceeded a total variant allele frequency (VAF) of -50%, suggesting that these mutations were likely heterozygous in coexisting leukemic clones (Fig. 8D). Paired relapse samples were available for 2 specimens: 09H098; {KRAS G12V) and 09H032 {KRAS G13D). In both cases, KRAS mutant clones had expanded and were predominant at relapse (Fig. 10).
[00142] Using an in vitro chemical screen optimized for the maintenance of leukemia stem cell activity22 (Fig. 11A and Tables 18-20), the impact of these mutations on MLL-F AML cell response to a targeted library subset enriched for inhibitors of RAS-pathway components and receptor tyrosine kinases (RTKs) was investigated. Samples with RAS-pathway mutations {MLL-F RAS-MU1) were more sensitive to MEK inhibitors (MEKi) than their wild-type counterparts (Fig. 11 B and Tables 20-21), but more resistant to several RTK inhibitors (RTKi) (Fig. 11 C and Tables 20-21). Of note, RAS-associated differential sensitivities to MEKi and RTKi were not observed in the context of normal karyotype AML (Table 22). Most interestingly, a combinatorial approach (Fig. 12A) revealed that MEKi and RTKi synergize in MLL-F RAS-MU1 patient cells (Fig. 12B, right panel) but not in MLL-F RAS-WT samples (Fig. 12B, left panel), uncovering a strong synthetic lethality in this setting.
[00143] The chemical screen allowed further characterization of proliferation/survival of MLL-F leukemic cells in vitro. Although no major difference was detected between the transcriptomes of MLL-F RAS-WT and MLL-F RAS-MU1 patient cells (Fig. 13), their responses to small inhibitory molecules were distinct. This finding highlights how transcriptional and chemical analyses can reveal complementary biological information.
[00144] The results also show that RAS mutation status in MLL-F AML dictates sensitivity to at least a subset of RTKi, to which these cells become more resistant when RAS is mutated. Of interest, this resistance to RTKi could not be predicted by RTK expression levels or activating mutations in these genes (Fig. 10 and Table
Table 18: Suppliers, characteristics and ordering numbers for the compounds tested in the single- agent chemical screen
ORDERING
COMPOUND NAME Category Main target SUPPLIER
NUMBER
AGL 2043 RTK PDGFR Santa Cruz sc-203808
AMD3100 NA CXCR4 Selleckchem S8030
AZD-2014 PI3K mTOR Selleckchem S2783
AZD-8055 PI3K mTOR Selleckchem S1555
BYL719 PI3K Pi3Kci Selleckchem S2814 cFMS Receptor Inhibitor II RTK cFMS Calbiochem 344037-1 MG cFMS Receptor Inhibitor III RTK cFMS Calbiochem 344038-1 MG cFMS Receptor Inhibitor
RTK cFMS Calbiochem 344039-5MG IV
CI-1040 (PD 184352) RAS MEK Selleckchem S1020 c-Met Kinase Inhibitor III RTK c-Met Calbiochem 448105-2MG c-Met/RON Dual Kinase
RTK c-Met Calbiochem 448104-5MG Inhibitor
Dasatinib RTK Bcr-ABL Selleckchem S1021
E7080 (Lenvatinib)
RTK VEGFR2/3 AdooQ A10340 Bioscience
EGFR Inhibitor RTK EGFR Calbiochem 324674-1 MG
Enzastaurin PI3K AKT Selleckchem S1055
ERK Inhibitor II,
RAS ERK1 and 2 Calbiochem 328007 FR180204
Erlotinib RTK EGFR Selleckchem S1023
FGF/VEGF Receptor
Tyrosine Kinase Inhibitor, RTK FGFR and VEGFR Calbiochem 341607-5MG PD173074
Flt3 Inhibitor IV RTK Flt3 Calbiochem 343023-5MG
GDC-0941 PI3K Ρί3Κα/δ Selleckchem S1065
Gefitinib RTK EGFR Selleckchem S1025
GS-1 101 (idelalisib) CAL-
PI3K ΡΪ3Κ5 Selleckchem S2226 101
Imatinib Mesylate RTK Bcr-ABL Selleckchem S1026
Lapatinib (ditosylate) RTK ErbB2 Selleckchem S1028
Lenalidomide NA TNFci, IKZF1/2 Selleckchem S1029
Lonafarnib RAS RAS (H, K, N) Selleckchem S2797
LY 303511 NA negative control Calbiochem 440203 Masitinib RTK c-kit and PDGFR Selleckchem S1064
MK-2206 PI3K AKT Selleckchem S1078
MK2a Inhibitor RAS MK2a Calbiochem 475863
Mubritinib RTK ErbB2 Selleckchem S2216
Nilotinib RTK Bcr-ABL Selleckchem S1033
NVP-AEW541 RTK IGFR Cayman chemical 13641
NVP-BHG712 RTK EPHb4 Selleckchem S2202
OSI-027 PI3K mTOR Selleckchem S2624
OSI-906 (Linsitinib) RTK IGFI R and InsR Selleckchem S1091 p38 MAP Kinase Inhibitor
PI3K p38 MAPK Calbiochem 506156 V
PD 158780 RTK EGFR Calbiochem 513036-500UG
PD 98059 RAS MEK Calbiochem 513000
PDGFR Tyrosine Kinase
RTK PDGFR Calbiochem 521237-5MG Inhibitor VII
ΡΙ3-Κγ Inhibitor II PI3K ΡΙ3-Κγ Calbiochem 528108
AdooQ
Quizartinib RTK flt3 A10027
Bioscience
R428 RTK AXL Synkinase SYN-1 131
Rapamycin PI3K mTOR Selleckchem S1039
SAR245408 (XL147) PI3K Ρί3Κα/δ/γ Selleckchem S11 18
SB 203580 PI3K p38 MAPK Calbiochem 559389
SB590885 RAS B-RAF Selleckchem S2220
Selumetinib/AZD6244
RAS MEK Selleckchem S1008 (AstraZeneca)
RTK and
Sorafenib Tosylate VEGFR2 and RAF-1 Selleckchem S1040
RAS
SU1498 RTK VEGFR Calbiochem 572888-5MG
Tanespimycin/17-AAG RAS HSP90 Selleckchem S1 141
Tie2 Kinase Inhibitor RTK Tie2 Calbiochem 612085-5MG
Tipifarnib RAS RAS (H, N) Selleckchem S1453
Trametinib/GSK1120212 RAS MEK Selleckchem S2673
Triciribine AKT inhibitor V PI3K PKB/AKT Calbiochem 124012-1 MG
U0126 RAS MEK Selleckchem S1102
VEGFR2 Kinase Inhibitor
RTK VEGFR2 Calbiochem 676484-5MG VI, ΚΪ8751
Vemurafenib RAS B-RAFV600E Selleckchem S1267
VX-702 PI3K p38MAPK Selleckchem S6005
ZM 336372 RAS c-raf Selleckchem S2720
Table 19: List of the MLL-F AML samples used in chemical screens with clinical characteristics
RAS 6-day Single
patient Tissue Genetic MLL- mutation expansion agent combination # origin type Partner status fold in vitro screen screen
02H017 BM MLL-F ENL WT 2.29 Yes Yes
05H066 BM MLL-F MLLT4 WT 10.19 Yes Yes
06H088 BM MLL-F MLLT4 MUT 29 Yes No
06H1 17 BM MLL-F MLLT4 MUT 3.06 Yes Yes
07H160 Blood MLL-F Other MUT 2.8 Yes Yes 08H021 BM MLL-F MLLT3 WT 2.22 Yes No
09H010 BM MLL-F-F MLLT3 WT 8.9 Yes Yes
09H018 Blood MLL-F ELL WT 3.8 Yes No
10H031 Blood MLL-F MLLT4 MUT 1 .79 Yes Yes
10H127 Blood MLL-F MLLT3 WT 2.12 Yes No
05H149 Blood NK n/a WT 3.12 Yes No
06H144 Blood NK n/a MUT 2.2 Yes No
09H1 1 1 Blood NK n/a MUT n/a Yes No
09H1 13 BM NK n/a WT 5.92 Yes No
10H038 Blood NK n/a MUT 8.99 Yes No
10H056 BM NK n/a WT n/a Yes No
1 1 H095 BM NK n/a MUT n/a Yes No
1 1 H126 BM NK n/a WT n/a Yes No
1 1 H129 Blood NK n/a MUT 2.85 Yes No
12H030 Blood NK n/a WT 3.31 Yes No
Table 20: List of EC50 values in nM obtained for the 20 AML patient samples used in the single-agent chemical screen shown in Figs. 11A-C. MEK inhibitors are in italics.
Figure imgf000060_0001
Figure imgf000061_0001
Figure imgf000062_0001
Figure imgf000063_0001
* value was clipped to Ι ΟΟΟΟηΜ
Table 21 : List of discriminatory inhibitors resulting from the comparison of M.L-F RAS-WT with M.L-F
/¾4S-MUT patient cells and corresponding statistics. MEK inhibitors are in italics.
Figure imgf000063_0002
Table 22: List of discriminatory inhibitors resulting from the comparison of NK RAS-WT with NK RAS- MUT patient cells and corresponding statistics. NK: Normal karyotype. AVERAGE ECso (nM) AVERAGE ECso (nM) MEDIAN P-VALUE
DRUG NAME NK RAS MUT NK RAS WT WILCOXON
PDGFR Inhibitor VII 8029 2760 0.016
Table 23: List of leukemia associated genes.
Figure imgf000064_0001
Table 24: Lists of variants identified in the MLL-F AML cohort, (left) Genes with variants in≥10% (3/31 ) of MLL-F AMLs, all investigated by Sanger sequencing of non-tumoral DNA. Genes found to have non recurrent somatic mutations (ZSCAN29 and PAK4: 1/3 somatic mutation and 2/3 germline variant each) were not included in Fig. 8A. (right) Genes with variants in 2/30 samples, not investigated by non-tumoral DNA
seguencing.
# of MLL sample
Gene Comment Genes
with variant
ALMS1 5 ABCA5 CEP131 FGD3 MAGEF1 PIEZ01 TSC2
ABHD14B 5 ABHD1 1 CEP162 FLNB MALT1 PLEKHA8 TTC14
WDR90 4 ACACA CEP250 GALE MAP3K4 PLK1 TTLL4
NCOR2 4 ACD CHD1 L GCC2 MED1 POLD1 TTLL5
KMT2C 4 ACTR10 CHEK2 GGA2 MED16 POM 121 UBA7
DNHD1 4 ADAM 11 CHML GLTSCR2 MFHAS1 POR UBXN 1 1
ZSCAN29 3 1/3 somatic ADRB2 CNTRL GOLGB1 MFSD12 PRKCD USE1
ZBED6 3 ADRBK1 COG1 HEATR5B MFSD6 PTCD3 USP13
UBR4 3 AIM1 COL9A2 HEATR6 MLH1 PTPRC USP36
TTF1 3 AKNA CREBBP HIVEP3 MPP5 RAD54L2 VCAN
TBC1 D22A 3 ANKS1A CROCC HLA-A MROH6 RAPGEF2 VPS13A
SPI1 3 3/3 somatic ARHGAP35 CTC1 HNRNPDL MRPS31 RECQL4 VPS13B
SORD 3 ARID1 B CTH HOOK2 MSH2 RNF213 VPS13C
RNF123 3 ARMC5 CYP2F1 HSH2D MTMR9 RNF5 WASL
RNASEL 3 ARRDC1 DAPL1 IER5 NAA25 RNMTL1 WDFY4
RASA4 3 ATF6B DCLRE1C ISOC1 NBEAL2 RPGR WDSUB1
PLEC 3 ATP2B1 DDX20 ISY1 NDST2 RREB1 YEATS2
PCNXL3 3 ATR DDX60L JUP NDUFAF4 SACS ZBTB41
PAK4 3 1/3 somatic BMS1 DENND4A KAT6B NDUFV1 SDCCAG3 ZGRF1 NUP214 3 BPTF DGKZ KIAA0586 NISCH SEC23IP ZNF367
MEFV 3 BUD13 DLG1 KIAA1551 NKTR SH2B1 ZNF397
MDN1 3 C10orf12 DNAH1 KIAA1731 N0D2 SIPA1 ZNF407
MACF1 3 C11orf48 DYNC2H1 KIF26B NPC1 SLC35B2 ZNF469
LYST 3 C11orf82 EFCAB3 KLHL24 0BSL1 SLC9A8 ZNF518A
ITPR1 3 C16orf62 EME2 KMT2D 0RAI3 SPG11 ZNF587
ERC1 3 C2CD3 EPB41 L2 KNTC1 PABPN1 SRPR ZNF630
DEPDC5 3 CARF ERCC6L2 KRT14 PARP16 SRRM2 ZZZ3
CHD8 3 CCDC134 ESYT1 LAMP1 PCNT SUMF2
BRCA2 3 CCDC171 FAM129A LBR PEAK1 SURF2
ARL11 3 CCDC88B FANCL LIG3 PELP1 SVIL
ABCA7 3 CCNA1 FASN LRBA PET100 TIMM44
CDC37L1 FBX022 LRRC45 PET112 TMEM175
CDH23 FCGR1 B MAFK PFAS TPGS1
Table 25: List of approximate average EC25 concentrations determined from Fig. 11 for MLL-F RAS-\NT and MLL-F RAS-Mlil patient cells, used for the chemical screen shown in Fig. 12.
Figure imgf000065_0001
Example 4: Identification of gene isoforms expressed or overexpressed in MLL-F AML
[00145] The gene isoform transcripts depicted in Table 26 below were shown to be preferentially expressed in MLL-F AMLs, as shown in Figs. 14A-K.
Table 26: Gene isoforms expression for MLL-F AML subtype.
The isoform list was generated based on two parameters: (1 ) the ratio was calculated between the 10th percentile expression value of the test group (i.e. MLL-F AMLs without relapse samples) and the 90th percentile control group (all other AMLs without relapse samples). This ratio is under the column headed "factor_10_90" (2) All transcripts without significant expression differences were removed and then ranked by the factor_10_90 value. Class code: previously known isoforms (=); novel isoforms (Novel). Pseudo =
pseudogene. q. value = Mann-Whitney test with false discovery rate (FDR)
class closest ENSEMBL ref transcript name biotype locus factor_10_90 q.value
code ID / SEQ ID NO:
RP11- chr15: ENST00000566321.1 / 578F21.12_iso_2 pseudo 29032924-29103544 Novel 2.338044759 2.55E-20 SEQ ID NO: 13
chr15: ENST00000558839.1 /
RP11-26F2.1_iso_4 pseudo 23043276-23160025 Novel 1.895159242 1.31 E-20 SEQ ID NO: 14
chr15: ENST00000562515.2 /
RP11-578F21.9_iso_1 pseudo 28947099-29009297 = 1.832143147 4.30E-14 SEQ ID NO: 15 protein chr20: ENST00000483898.1 /
TASP1 iso 19 coding 13202417-13619771 _ 1.537727919 3.54E-16 SEQ ID NO: 16
RP11- chr15: ENST00000565892.1 / 578F21.12_iso_23 pseudo 29032924-29103544 _ 1.352131229 1.06E-16 SEQ ID NO: 17 protein chr15: ENST00000340249.3 /
GOLGA8M_iso_2 coding 28947099-29009297 _ 1.33105802 1.86E-14 SEQ ID NO: 18 protein chr15: ENST00000563027.1 /
GOLGA8M_iso_1 coding 28947099-29009297 _ 1.281599487 1.02E-13 SEQ ID NO: 19 protein chr15: ENST00000563027.1 /
GOLGA8M_iso_6 coding 28947099-29009297 Novel 1.181204651 3.71 E-14 SEQ ID NO: 20
RP11- chr15: ENST00000559896.1 / 1180F24.1_iso_1 pseudo 23178517-23215399 _ 1.163725068 8.64E-15 SEQ ID NO: 21 chr15: ENST00000563942.1 /
WHAMMP2_iso_6 pseudo 28947099-29009297 Novel 1.020556387 3.89E-13 SEQ ID NO: 22 protein chr4: ENST00000394980.1 /
MMRNUsoJ coding 90798869-90876875 Novel 1 3.03E-17 SEQ ID NO: 23
[00146] The scope of the claims should not be limited by the preferred embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole.
REFERENCES
[00147] 1 . Krivtsov, A.V. & Armstrong, S.A. MLL translocations, histone modifications and leukaemia stem-cell development. Nature Reviews Cancer 7, 823-833 (2007).
[00148] 2. Meyer, C. et al. The MLL recombinome of acute leukemias in 2013. Leukemia 27, 2165-2176 (2013).
[00149] 3. Daigle, S.R. et al. Selective Killing of Mixed Lineage Leukemia Cells by a Potent Small-Molecule DOT1 L Inhibitor. Cancer Cell 20, 53-65 (2011 ).
[00150] 4. Daigle, S.R. et al. Potent inhibition of DOT1 L as treatment of MLL-fusion leukemia. Blood 122, 1017-1025 (2013).
[00151] 5. Armstrong, S.A. et al. MLL translocations specify a distinct gene expression profile that distinguishes a unique leukemia. Nature Genetics 30, 41-47 (2001).
[00152] 6. Valk, P.J. et al. Prognostically useful gene-expression profiles in acute myeloid leukemia. The New England Journal of Medicine 350, 1617-1628 (2004).
[00153] 7. Mullighan, C.G. et al. Pediatric acute myeloid leukemia with NPM1 mutations is characterized by a gene expression profile with dysregulated HOX gene expression distinct from MLL-rearranged leukemias. Leukemia (2007).
[00154] 8. Ross, M.E. et al. Gene expression profiling of pediatric acute myelogenous leukemia. Blood 104, 3679-3687 (2004).
[00155] 9. Grossmann, V. et al. High incidence of RAS signalling pathway mutations in MLL-rearranged acute myeloid leukemia. Leukemia 27, 1933-1936 (2013).
[00156] 10. Groschel, S. et al. Deregulated expression of EVI1 defines a poor prognostic subset of MLL- rearranged acute myeloid leukemias: a study of the German-Austrian Acute Myeloid Leukemia Study Group and the Dutch-Belgian-Swiss HOVON/SAKK Cooperative Group. Journal of clinical oncology : official journal ofthe American Society of Clinical Oncology 31 , 95-103 (2012).
[00157] 1 1. The Cancer Genome Atlas Research, N. Genomic and Epigenomic Landscapes of Adult De Novo Acute Myeloid Leukemia. The New England Journal of Medicine 368, 2059-2074 (2013).
[00158] 12. Sandhofer, N. et al. Dual PI3K/mTOR inhibition shows antileukemic activity in MLL-rearranged acute myeloid leukemia. Leukemia (2014).
[00159] 13. Kampen, K.R. et al. Insights in dynamic kinome reprogramming as a consequence of MEK inhibition in MLL-rearranged AML. Leukemia 2S, 589-599 (2014).
[00160] 14. Steudel, C. et al. Comparative analysis of MLL partial tandem duplication and FLT3 internal tandem duplication mutations in 956 adult patients with acute myeloid leukemia. Genes, Chromosomes and Cancer 37, 237-251 (2003).
[00161] 15. Basecke, J., Whelan, J.T., Griesinger, F. & Bertrand, F.E. The MLL partial tandem duplication in acute myeloid leukaemia. British journal of haematology W5, 438-449 (2006).
[00162] 16. Grossmann, V. et al. A novel hierarchical prognostic model of AML solely based on molecular mutations. Blood 120, 2963-2972 (2012).
[00163] 17. KCihn, M .W. et al. MLL partial tandem duplication leukemia cells are sensitive to small molecule DOT1 L inhibition. Haematologica (2015).
[00164] 18. Kwiatkowski, A.V., Gertler, F.B. & Loureiro, J.J. Function and regulation of Ena/VASP proteins. Trends in Cell Biology (2003). <
[00165] 19. Zhou, J. et al. PU.1 is essential for MLL leukemia partially via crosstalk with the MEIS/HOX pathway. Leukemia !*, 1436-1448 (2014).
[00166] 20. Zhang, D.E., Hetherington, C.J., Chen, H.M. & Tenen, D.G. The macrophage transcription factor PU.1 directs tissue-specific expression of the macrophage colony-stimulating factor receptor. Molecular and cellular biology 14, 373-381 (1993).
[00167] 21. Iwama, A. et al. Use of RDA analysis of knockout mice to identify myeloid genes regulated in vivo by PU.1 and C/EBPalpha. Nucleic acids research 26, 3034-3043 (1998).
[00168] 22. Pabst, C. et al. Identification of small molecules that support human leukemia stem cell activity ex vivo. Nat Methods 11 , 436-42 (2014).
[00169] 23. Kodandapani, R. et al. A new pattern for helix-turn-helix recognition revealed by the PU.1 ETS- domain-DNA complex. Nature 380, 456-460 (1996).
[00170] 24. Cook, W.D. PU.1 is a suppressor of myeloid leukemia, inactivated in mice by gene deletion and mutation of its DNA binding domain. Blood (2004).
[00171] 25. Mueller, B.U. et al. Heterozygous PU.1 mutations are associated with acute myeloid leukemia. Blood 100, 998-1007 (2002).
[00172] 26. C/ΕΒΡ-β, C/ΕΒΡ-δ, PU.1 , AM L1 genes: mutational analysis in 381 samples of hematopoietic and solid malignancies. Leukemia Research 26, 451457 (2002).
[00173] 27. Lamandin, C. et al. Are PU.1 mutations frequent genetic events in acute myeloid leukemia (AML)? Blood 100, 4680-4681 (2002).
[00174] 28. Dohner, K. et al. Mutation analysis of the transcription factor PU.1 in younger adults (16 to 60 years) with acute myeloid leukemia: a study of the AML Study Group Ulm (AMLSG ULM). Blood 102, 1 (2003).
[00175] 29. Ley, T.J. et al. A pilot study of high-throughput, sequence-based mutational profiling of primary human acute myeloid leukemia cell genomes. Proceedings of the National Academy of Sciences (2003).
[00176] 30. Burgess, M.R. et al. Preclinical efficacy of MEK inhibition in Nras-mutant AML. Blood 124, 3947-55 (2014).
[00177] 31. Irving, J. et al. Ras pathway mutations are prevalent in relapsed childhood acute lymphoblastic leukemia and confer sensitivity to MEK inhibition. Blood 124, 3420-30 (2014). [00178] 32. Jain, N. et al. Phase II Study of the Oral MEK Inhibitor Selumetinib in Advanced Acute Myelogenous Leukemia: A University of Chicago Phase II Consortium Trial. Clinical Cancer Research (2013).
[00179] 33. Borthakur, G. et al. Phase l/ll Trial of the MEK1/2 Inhibitor Trametinib (GSK1 120212) in Relapsed/Refractory Myeloid Malignancies: Evidence of Activity in Patients with RAS Mutation-Positive Disease. Blood (ASH Annual Meeting Abstracts) 120(2012).
[00180] 34. Diaz, L.A., Jr. et al. The molecular evolution of acquired resistance to targeted EGFR blockade in colorectal cancers. Nature 486, 537-40 (2012).
[00181] 35. Prahallad, A. et al. Unresponsiveness of colon cancer to BRAF(V600E) inhibition through feedback activation of EGFR. Nature 483, 100-3 (2012).
[00182] 36. Misale, S. et al. Emergence of KRAS mutations and acquired resistance to anti-EGFR therapy in colorectal cancer. Nature 486, 532-6 (2012).
[00183] 37. Fares, I. et al. Pyrimidoindole derivatives are agonists of human hematopoietic stem cell self- renewal. Science (2014).
[00184] 38. Lavallee, V.-P. et al. EVI1 -rearranged acute myeloid leukemias are characterized by distinct molecular alterations. Blood 125, 140-143 (2014).
[00185] 39. Barabe, F., Kennedy, J.A., Hope, K.J. & Dick, J.E. Modeling the initiation and progression of human acute leukemia in mice. Science (New York, N. Y.) 316, 600-604 (2007).
[00186] 40. Gabert, J. et al. Standardization and quality control studies of 'real-time' quantitative reverse transcriptase polymerase chain reaction of fusion gene transcripts for residual disease detection in leukemia - A Europe Against Cancer Program. Leukemia (2003).
[00187] 41. Beillard, E. et al. Evaluation of candidate control genes for diagnosis and residual disease detection in leukemic patients using 'real-time' quantitative reverse-transcriptase polymerase chain reaction (RQ-PCR) - a Europe against cancer program. Leukemia (2003).
[00188] 42. Kern, D.H., Morgan, C.R. & Hildebrand-Zanki, S.U. In vitro pharmacodynamics of 1-beta-D- arabinofuranosylcytosine: synergy of antitumor activity with cis-diamminedichloroplatinum(ll). Cancer Res 48, 1 17-21 (1988).
[00189] 43. Rodenak Kladniew, B. et al. Synergistic antiproliferative and anticholesterogenic effects of linalool, 1 ,8-cineole, and simvastatin on human cell lines. Chem Biol Interact 214, 57-68 (2014).

Claims

CLAIMS:
1 . A method for determining the likelihood that a subject suffers from Mixed-Lineage Leukemia- rearranged acute myeloid leukemia [MLL leukemia), said method comprising:
determining the level of expression of at least one of the genes or pseudogenes depicted Table 1 and/or Table 2:
Table 1
Gene Ensembl ID Gene Ensembl ID
CASC10 ENSG00000204682 GPC3 ENSG00000147257
PDCD6IPP2 ENSG00000261377 LOC100996342 ENSG00000235478
GOLGA8M ENSG00000188626 SYT3 ENSG00000213023
GOLGA6L7P ENSG00000261649 LOC101928455 ENSG00000169554
WHAMMP2 ENSG00000248334 LPAR3 ENSG00000171517
SKIDA1 ENSG00000180592 KLHL30 ENSG00000168427
JMJD1 C-AS1 ENSG00000272767 HOXA10-AS ENSG00000253187
LOC100289656 ENSG00000232431 ADAMTSL2 ENSG00000197859
CLSTN2 ENSG00000158258 GPR126/ADGRG6 ENSG00000112414
PPP1 R27 ENSG00000182676 BVES ENSG000001 12276
MIR1915 ENSG00000222071 CTSV ENSG00000136943
SEL1 L2 ENSG00000101251 MECOM ENSG00000085276
PHACTR3 ENSG00000087495 CYB5R2 ENSG00000166394
IL22RA2 ENSG00000164485 TNNT1 ENSG00000105048
CGNL1 ENSG00000128849 VAT1 L ENSG00000171724
LOC101929733 ENSG00000271952 ADRA2C ENSG00000184160
MPPED1 ENSG00000186732 HOXA7 ENSG00000122592
METTL7B ENSG00000170439 CLEC2A ENSG00000188393
ZNF521 ENSG00000198795 HOXA6 ENSG00000106006
HOXA-AS3 ENSG00000254369 TKTL1 ENSG00000007350
CCL22 ENSG00000102962 PRKCDBP ENSG00000170955
KCNC3 ENSG00000131398 UNC5C ENSG00000182168
UPK3A ENSG00000100373 KCNE1 L/KCNE5 ENSG00000176076
CT45A5 ENSG00000228836 SUM01 P1 ENSG00000241721
GAS1 ENSG00000180447 SYDE2 ENSG00000097096
SCUBE1 ENSG00000159307 HOXA11 ENSG00000005073
TMEM105 ENSG00000185332 CTGF ENSG00000118523
MSX2 ENSG00000120149 PRL ENSG00000172179
MOCS1 ENSG00000124615 MSLN ENSG00000102854
KCNS1 ENSG00000124134 C3orf14 ENSG000001 14405
TLE6 ENSG00000104953 NKAIN2 ENSG00000188580
RSP01 ENSG00000169218 PPARGC1A ENSG00000109819
ELOVL3 ENSG000001 19915 ADAM23 ENSG00000114948
OTOF ENSG000001 15155 HOXA5 ENSG00000106004
LINC00482 ENSG00000185168 ZFP57 ENSG00000204644
SLAMF9 ENSG00000162723 LAMP5 ENSG00000125869
Table 2
Gene Ensembl ID Gene Ensembl ID
FAM171 B ENSG00000144369 HOXB5 ENSG00000120075 UGT2B1 1 ENSG00000213759 GUCY1A3 ENSG00000164116
ACSM1 ENSG00000166743 NAT8B ENSG00000204872
ZNF418 ENSG00000196724 NR5A1 ENSG00000136931
SMAD1 ENSG00000170365 ZNF135 ENSG00000176293
CP A3 ENSG00000163751 ANGPT1 ENSG00000154188
OR2T8 ENSG00000177462 OR2L13 ENSG00000196071
F2RL1 ENSG00000164251 MYCNOS ENSG00000233718
STON2 ENSG00000140022 OR2L1 P ENSG00000224227
DNTT ENSG00000107447 LOC100130417 ENSG00000223764
C21orf128/UMODL1 -
ZNF492 ENSG00000229676 ENSG00000184385
AS1
ZNF471 ENSG00000196263 LOC101927720 ENSG00000266916
ZNF667-AS1 ENSG00000166770 S100Z ENSG00000171643
ZNF730 ENSG00000183850 TUSC8 ENSG00000237361
ZNF667 ENSG00000198046 MIR181 B1 ENSG00000207975
HOXB-AS1 ENSG00000230148 DYTN ENSG00000232125
MYCN ENSG00000134323 PRDM16 ENSG0000014261 1
H0XB3 ENSG00000120093 ZNF112 ENSG00000062370
UM0DL1 ENSG00000177398 HOXB6 ENSG0000010851 1
H0XB-AS3 ENSG00000233101 CEACAM8 ENSG00000124469
CPA6 ENSG00000165078 WT1 ENSG00000184937
ZNF625-ZNF20 ENSG00000213297 CA4 ENSG00000167434
H0XB4 ENSG00000182742
and/or of at least one of the transcripts of SEQ ID NOs: 13-23, in a leukemia cell sample from said subject, wherein
(i) a higher expression of said at least one genes depicted in Table 1 and/or of said at least one transcripts of SEQ ID NOs: 13-23 in said sample relative to a control non-Mil. leukemia sample, is indicative that said subject has a high likelihood of suffering from MLL leukemia; and/or
(ii) a lower expression of said at least one genes depicted in Table 2 in said sample relative to a control non- Mil leukemia sample, is indicative that said subject has a high likelihood of suffering from MLL leukemia.
2. The method of claim 1 , wherein said method comprises determining the level of expression of CASC10.
3. The method of claim 1 , wherein said method comprises determining the level of expression of at least one long intergenic non-coding RNA (lincRNA).
4. The method of claim 3, wherein said lincRNA is LOC100289656 or LOC646278 (PDCD6IPP2).
5. The method of any one of claims 1 to 4, wherein said method comprises determining the level of expression of at least one pseudogene.
6. The method of claim 5, wherein said pseudogene is WHAMML2.
7. The method of any one of claims 1 to 6, wherein said method comprises determining the level of expression of at least one HO gene.
8. The method of any one of claims 1 to 7, wherein said method comprises determining the level of expression of at least one MECOM gene.
9. The method of any one of claims 1 to 8, wherein said method is for assessing minimal residual disease (MRD) in a subject suffering from MLL leukemia.
10. A method for treating a patient diagnosed with mixed-lineage leukemia-rearranged [MLL) leukemia with at least one mutation in a member of the RAS pathway, comprising administering to said patient a Mitogen- activated protein kinase kinase (MEK) inhibitor.
1 1. The method of claim 10, wherein said MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
12. The method of claim 1 1 , wherein said MEK inhibitor is Selumetinib.
13. The method of claim 1 1 , wherein said MEK inhibitor is Trametinib.
14. The method of any one of claims 10 to 34, which further comprises administering to said patient a Receptor Tyrosine Kinase (RTK) inhibitor.
15. The method of claim 14, wherein said RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
16. The method of claim 14, wherein said RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
17. The method of claim 16, wherein said RTK inhibitor is Sorafenib.
18. The method of claim 16, wherein said RTK inhibitor is VEGFR2 inhibitor Vl/Ki8751
19. The method of claim 16, wherein said RTK inhibitor is FLT3 inhibitor IV.
20. The method of any one of claims 10 to 19, wherein said member of the RAS pathway is NRAS, KRAS, PTPN11/SHP-2 and/or BRAF.
21.The method of claim 20, wherein said at least one mutation is:
a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS;
a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS;
a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS;
a G to D substitution at a position corresponding to amino acid 13 of KRAS;
an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or;
a D to N substitution at a position corresponding to amino acid 594 of BRAF.
22. A method for predicting the sensitivity of mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia) cells to a Mitogen-activated protein kinase kinase (MEK) inhibitor or tyrosine kinase receptors (RTK) inhibitor, said method comprising:
determining the presence of a mutations in a member of the RAS pathway in said MLL leukemia cells; wherein the presence of said mutation is indicative that said MLL leukemia cells are more sensitive to an MEK inhibitor and/or more resistant to an RTK inhibitor relative to MLL leukemia cells not comprising said mutation in the member of the RAS pathway.
23. The method of claim 22, wherein said MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
24. The method of claim 23, wherein said MEK inhibitor is Selumetinib.
25. The method of claim 23, wherein said MEK inhibitor is Trametinib.
26. The method of any one of claims 22 to 25, wherein said RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
27. The method of claim 26, wherein said RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
28. The method of claim 27, wherein said RTK inhibitor is Sorafenib.
29. The method of claim 27, wherein said RTK inhibitor is VEGFR2 inhibitor Vl/Ki8751
30. The method of claim 27, wherein said RTK inhibitor is FLT3 inhibitor IV.
31. The method of any one of claims 22 to 30, wherein said member of the RAS pathway is NRAS, KRAS, PTPN11/SHP-2 and/or BRAF.
32. The method of claim 31 , wherein said one or more mutations in the member of the RAS pathway are one or more of the mutations defined in claim 21 .
33. The method of any one of claims 22 to 32, wherein the presence of said one or more mutations is determined by sequencing a region encompassing said one or more mutations in a nucleic acid present in said sample.
34. The method of claim 33, wherein said nucleic acid is cDNA.
35. The method of claim 33 or 34, wherein said sequencing is performed by RNA sequencing (RNAseq).
36. A method for determining the chromosomal rearrangement in a subject suffering from mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising: determining the expression profile one or more of the genes and/or pseudogenes depicted in Tables 11 to 16 in an MLL leukemia sample, wherein
(i) an expression profile of the one or more of genes and/or pseudogenes depicted in Tables 11 a/11 b is indicative of MLL-MLLT4 rearrangement;
(ii) an expression profile of the one or more of genes and/or pseudogenes depicted in Tables 12a/12b is indicative of MLL-MLLT3 rearrangement;
(iii) an expression profile of the one or more of genes and/or pseudogenes depicted in Tables 13a/13b is indicative of MLL-SEPT9 rearrangement;
(iv) an expression profile of the one or more of genes and/or pseudogenes depicted in Table 16 is indicative of MLL-ENL rearrangement;
(v) an expression profile of the one or more of genes and/or pseudogenes depicted in Table 15 is indicative of MLL-ELL rearrangement; and
(vi) an expression profile of the one or more of genes and/or pseudogenes depicted in Table 14 is indicative of MLL-MLLT10 rearrangement.
37. The method of claim 36, comprising determining the level of expression of at least one of NKX2-3, PCDH9, NKX5-1, NKX2-5, MECOM, P2RY1, IL12RB2, SOX11, SP7, MSLN, BAALC, PROM1, IRX3, MKX, HOXB8, POU4F2 and FOXC1 in a leukemia cell sample from said subject, wherein
a higher expression of NKX2-3, MECOM, PCDH9, P2RY1 and/or IL12RB2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT4 rearrangement;
a higher expression of NKX5-1, and/or a lower expression of MECOM and/or PROM1 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT3 rearrangement;
a higher expression of NKX2-5 and/or MYF6, and/or a lower expression of BAALC, in said leukemia cell sample relative to a control sample is indicative of MLL-SEPT9 rearrangement;
a higher expression of SP7 in said leukemia cell sample relative to a control sample is indicative of an MLL-ENL rearrangement;
a higher expression of FOXC1 and/or or a lower expression of MSLN in said leukemia cell sample relative to a control sample is indicative of MLL-ELL rearrangement;
a higher expression of PROM1, IRX3, MKX, HOXB8, and/or POU4F2 in said leukemia cell sample relative to a control sample is indicative of MLL-MLLT10 rearrangement; and/or
a higher expression of SOX11 in said leukemia cell sample relative to a control sample is indicative of MLL-ENL or MLL-MLLT10 rearrangement.
38. The method of any one of claims 27 to 37, wherein said the level of expression is measured at the nucleic acid level.
39. The method of claim 38, wherein said the level of expression is measured by RNA sequencing (RNAseq).
40. A method for determining the likelihood that a subject suffers from mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising:
determining the presence of one or more of the mutations depicted in Table 3 in a leukemia cell sample from said subject:
Table 3
Figure imgf000075_0001
wherein the presence of said one or more mutations is indicative that said subject has a high likelihood of suffering from MLL leukemia, and wherein the absence of said one or more mutations is indicative that said subject has a low likelihood of suffering from MLL leukemia.
41. The method of claim 40, wherein said one or more mutations is in a member of the RAS pathway.
42. The method of claim 41 , wherein said one or more mutations is:
a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS;
a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS;
a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS;
a G to D substitution at a position corresponding to amino acid 13 of KRAS;
an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or;
a D to N substitution at a position corresponding to amino acid 594 of BRAF.
43. The method of any one of claims 40 to 42, wherein said one or more mutations is in SPI1.
44. The method of claim 43, wherein said one or more mutations is:
an R to C substitution at a position corresponding to amino acid 230 of SPI1;
an A to T substitution at a position corresponding to amino acid 231 of SPI1; and/or
a mutation causing a frameshift at a position corresponding to amino acid 99 of SPI1.
45. The method of any one of claims 40 to 44, wherein said one or more mutations is in PAK4.
46. The method of claim 45, wherein said one or more mutations is:
an F to V substitution at a position corresponding to amino acid 17 of PAK4;
a D to N substitution at a position corresponding to amino acid 26 of PAK4; and/or
a G to S substitution at a position corresponding to amino acid 344 of PAK4.
47. A method for treating a patient with mixed-lineage leukemia-rearranged acute myeloid leukemia [MLL leukemia), said method comprising administering to the patient a suitable treatment for MLL leukemia, wherein said patient with leukemia is identified using the method of any one of claims 27 to 46.
48. The method of claim 47, wherein said method further comprises performing the method of any one of claims 27 to 46 to identify said patient.
49. The method of claim 47 or 48, wherein said treatment comprises chemotherapy, immunotherapy, radiation, bone marrow transplant, stem cell transplant, cord blood transplant, or any combination thereof.
50. The method of any one of claims 47 to 49, wherein said method comprises determining whether the MLL leukemia cells from said patient comprise at least one mutation in a member of the RAS pathway.
51. The method of claim 50, wherein (i) if the MLL leukemia cells from said patient comprises at least one mutation in a member of the RAS pathway, said treatment comprises administering to said patient a Mitogen-activated protein kinase kinase (MEK) inhibitor, or (ii) if the MLL leukemia cells from said patient do not comprise at least one mutation in a member of the RAS pathway, said treatment comprises administering to said patient a Receptor Tyrosine Kinase (RTK) inhibitor.
52. A method for determining whether one or more of the mutations or classes of mutations listed in Table 3 set forth in claim 40 are associated with altered sensitivity of mixed-lineage leukemia-rearranged {MLL) leukemia cells to a drug or agent, said method comprising:
(i) measuring the response to said drug or agent in MLL leukemia cells comprising said one or more of the mutations or classes of mutations; and
(ii) comparing said response to a control response in MLL leukemia cells that do not comprise said one or more of the mutations or classes of mutations,
wherein a higher/more potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with an increased sensitivity, or decreased resistance, to said drug or agent, and
wherein a lower/less potent response measured in MLL leukemia cells comprising said one or more of the mutations or classes of mutations is indicative that said one or more of the mutations or classes of mutations is associated with a decreased sensitivity, or increased resistance, to said drug or agent.
53. A method for detecting a MLL-ENAH fusion in a sample, said method comprising contacting said sample with a first oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 1 to 1212 of the MLL protein, or to a complement thereof, and a second oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes amino acids 117 to 591 of the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
54. A method for detecting a MLL-ENAH fusion in a sample, said method comprising contacting said sample with an oligonucleotide comprising a first domain that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, and a second domain that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, under conditions suitable for nucleic acid hybridization.
55. The method of claim 53, wherein said first oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof.
56. The method of claim 53 or 55, wherein said second oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
57. The method of claim 54, wherein said first domain hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof, and said second domain hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
58. A method for detecting a MLL-ENAH fusion in a sample, said method comprising performing a sequencing reaction on said sample with (i) a MLL-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the MLL protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the ENAH protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample; and/or (ii) a ENAH-specific oligonucleotide that hybridizes to a portion of a nucleotide sequence that encodes the ENAH protein, or to a complement thereof, wherein the identification of a nucleotide sequence that encodes the MLL protein, or a complement thereof, is indicative of the presence of a MLL-ENAH fusion in the sample.
59. The method of claim 58, wherein said MLL-specific oligonucleotide hybridizes to a portion of exon 6 of a nucleic acid encoding the MLL protein, or to a complement thereof.
60. The method of claim 58 or 59, wherein said ENAH-specific oligonucleotide hybridizes to a portion of exon 4 of a nucleic acid encoding the ENAH protein, or to a complement thereof.
61. The method of any one of claims 1 to 60, wherein said MLL leukemia is an MLL-fusion {MLL-F) leukemia or an MLL partial tandem duplication {MLL-P1D) leukemia.
62. Use a mitogen-activated protein kinase kinase (MEK) inhibitor for treating a patient diagnosed with mixed- lineage leukemia-rearranged [MLL) leukemia with at least one mutation in a member of the RAS pathway.
63. Use a mitogen-activated protein kinase kinase (MEK) inhibitor for the manufacture of a medicament for treating a patient diagnosed with mixed-lineage leukemia-rearranged [MLL) leukemia with at least one mutation in a member of the RAS pathway.
64. The use of claim 62 or 63, wherein said MEK inhibitor is Selumetinib, CI-1040 (PD184352), and/or Trametinib.
65. The use of claim 64, wherein said MEK inhibitor is Selumetinib.
66. The use of claim 64, wherein said MEK inhibitor is Trametinib.
67. The use of any one of claims 62 to 66, which further comprises use of a Receptor Tyrosine Kinase (RTK) inhibitor.
68. The use of claim 67, wherein said RTK inhibitor is a Vascular Endothelial Growth Factor Receptor (VEGFR) inhibitor and/or an FMS-like receptor tyrosine kinase-3 (FLT3 inhibitor).
69. The use of claim 67, wherein said RTK inhibitor is Sorafenib, VEGFR2 inhibitor Vl/Ki8751 , and/or FLT3 inhibitor IV.
70. The use of claim 69, wherein said RTK inhibitor is Sorafenib.
71. The use of claim 69, wherein said RTK inhibitor is VEGFR2 inhibitor Vl/Ki8751
72. The use of claim 69, wherein said RTK inhibitor is FLT3 inhibitor IV.
73. The use of any one of claims 62 to 72, wherein said member of the RAS pathway is NRAS, KRAS, PTPN11/SHP-2 and/or BRAF.
74. The use of claim 73, wherein said at least one mutation is:
a G to C or G to A substitution at a position corresponding to amino acid 12 of NRAS;
a Q to K or Q to R substitution at a position corresponding to amino acid 61 of NRAS;
a G to V or G to A substitution at a position corresponding to amino acid 12 of KRAS;
a G to D substitution at a position corresponding to amino acid 13 of KRAS;
an A to V substitution at a position corresponding to amino acid 72 of PTPN11; and/or;
a D to N substitution at a position corresponding to amino acid 594 of BRAF.
75. A kit for the assessment of MLL leukemia, the kit comprising: (i) one or more reagents for measuring the level of expression of at least one of the genes listed in Table 1 and/or Table 2, and/or of the transcripts of SEQ ID NO: 13-23, and/or at least one of mutations set forth in Table 3, in a biological sample.
76. The kit of claim 75, wherein said one or more reagents comprise one or more primers, probes and/or antibody.
PCT/CA2016/050270 2015-03-12 2016-03-11 Markers for mll-rearranged acute myeloid leukemias and uses thereof WO2016141492A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562132114P 2015-03-12 2015-03-12
US62/132,114 2015-03-12

Publications (1)

Publication Number Publication Date
WO2016141492A1 true WO2016141492A1 (en) 2016-09-15

Family

ID=56879780

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2016/050270 WO2016141492A1 (en) 2015-03-12 2016-03-11 Markers for mll-rearranged acute myeloid leukemias and uses thereof

Country Status (1)

Country Link
WO (1) WO2016141492A1 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018081830A1 (en) * 2016-10-31 2018-05-03 Oregon Health & Science University Combinations of agents to treat hematological malignancies
WO2020033585A1 (en) * 2018-08-07 2020-02-13 The Broad Institute, Inc. Methods for combinatorial screening and use of therapeutic targets thereof
CN112725275A (en) * 2021-01-09 2021-04-30 海南苏生生物科技有限公司 Signal pathway inhibitor and drug for up-regulating MLLT3 gene expression, and application of signal pathway inhibitor

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
BENETATOS ET AL.: "MicroRNAs mark in the MLL-rearranged leukemia", ANN HEMATOL, vol. 92, 2013, pages 1439 - 1450, XP055308826 *
GULLEY ET AL.: "Genetic Tests To Evaluate Prognosis and Predict Therapeutic Response in Acute Myeloid Leukemia", JOURNAL OF MOLECULAR DIAGNOSTIC, vol. 12, no. 1, January 2010 (2010-01-01), pages 15, XP055308824 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018081830A1 (en) * 2016-10-31 2018-05-03 Oregon Health & Science University Combinations of agents to treat hematological malignancies
WO2020033585A1 (en) * 2018-08-07 2020-02-13 The Broad Institute, Inc. Methods for combinatorial screening and use of therapeutic targets thereof
CN112725275A (en) * 2021-01-09 2021-04-30 海南苏生生物科技有限公司 Signal pathway inhibitor and drug for up-regulating MLLT3 gene expression, and application of signal pathway inhibitor

Similar Documents

Publication Publication Date Title
Lavallée et al. The transcriptomic landscape and directed chemical interrogation of MLL-rearranged acute myeloid leukemias
Meldi et al. Specific molecular signatures predict decitabine response in chronic myelomonocytic leukemia
Wheeler et al. Molecular features of cancers exhibiting exceptional responses to treatment
Kanojia et al. Genomic landscape of liposarcoma
Thol et al. Prognostic significance of ASXL1 mutations in patients with myelodysplastic syndromes
EP1751309B1 (en) Methods for prediction of clinical outcome to epidermal growth factor receptor inhibitors by cancer patients
Marceau-Renaut et al. Molecular profiling defines distinct prognostic subgroups in childhood AML: a report from the French ELAM02 study group
US20150031641A1 (en) Methods and compositions for the diagnosis, prognosis and treatment of acute myeloid leukemia
Aitken et al. Prognostic and therapeutic implications of measurable residual disease in acute myeloid leukemia
WO2013055530A1 (en) Diagnostic methylation markers of epithelial or mesenchymal phenotype and response to egfr kinase inhibitor in tumours or tumour cells
AU2005201935B2 (en) Prognostic for hematological malignancy
WO2009015233A2 (en) Gefitinib sensitivity-related gene expression and products and methods related thereto
JP6034784B2 (en) Method for determining an acute leukemia response to treatment with a farnesyltransferase inhibitor
US20200188361A1 (en) Use of mitochondrial activity inhibitors for the treatment of poor prognosis acute myeloid leukemia
Hayden et al. Variation in DNA repair genes XRCC3, XRCC4, XRCC5 and susceptibility to myeloma
EP1836313A2 (en) Methods for assessing patients with acute myeloid leukemia
Zhang et al. Genetic mutational analysis of pediatric acute lymphoblastic leukemia from a single center in China using exon sequencing
WO2017020128A1 (en) Markers for acute myeloid leukemias with core binding factor rearrangements and other genetic subtypes and uses thereof
WO2016141492A1 (en) Markers for mll-rearranged acute myeloid leukemias and uses thereof
Liu et al. Comprehensive analysis of the prognostic signature of mutation-derived genome instability-related lncRNAs for patients with endometrial cancer
US7932036B1 (en) Methods of determining acute myeloid leukemia response to treatment with farnesyltransferase
WO2012090073A2 (en) Methods and compositions for predicting chemotherapy sensitivity
El Achi et al. Biomarkers in acute myeloid leukemia: leveraging next generation sequencing data for optimal therapeutic strategies
JP2013212052A (en) Kras variant and tumor biology
US20170307619A1 (en) MARKERS OF POOR PROGNOSIS ACUTE MYELOID LEUKEMIAS (AMLs) AND USES THEREOF

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16760989

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16760989

Country of ref document: EP

Kind code of ref document: A1