WO2016138569A1 - Method of treatment of central neuropathic pain - Google Patents
Method of treatment of central neuropathic pain Download PDFInfo
- Publication number
- WO2016138569A1 WO2016138569A1 PCT/AU2016/050150 AU2016050150W WO2016138569A1 WO 2016138569 A1 WO2016138569 A1 WO 2016138569A1 AU 2016050150 W AU2016050150 W AU 2016050150W WO 2016138569 A1 WO2016138569 A1 WO 2016138569A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- compound
- subject
- mice
- neuropathic pain
- vehicle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/38—Heterocyclic compounds having sulfur as a ring hetero atom
- A61K31/385—Heterocyclic compounds having sulfur as a ring hetero atom having two or more sulfur atoms in the same ring
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/04—Centrally acting analgesics, e.g. opioids
Definitions
- the invention relates to the field of medical treatment. More particularly, this invention relates to the treatment of central neuropathic pain. Even more particularly, this invention relates to the treatment of central neuropathic pain associated with multiple sclerosis.
- Neuropathic pain is caused by damage to the nervous system resulting in pain signals being sent to the brain.
- the pain is often severe and, for some, can be debilitating.
- Neuropathic pain can be described as 'pins and needles', shooting, stabbing or burning pains and is often observed as a hypersensitivity to stimuli which would otherwise not invoke pain sensations (allodynia).
- the root cause of the damage or dysfunction can be within the peripheral nervous system, resulting in peripheral neuropathic pain (PNP), or the central nervous system (the brain and spinal cord), resulting in central neuropathic pain (CNP).
- PNP peripheral neuropathic pain
- CNP central neuropathic pain
- Neuropathic pain is recognised as being very difficult to treat in an effective and predictable way from patient to patient.
- TCAs tricyclic antidepressants
- SNRIs serotonin-norepinephrine reuptake inhibitors
- SNRIs serotonin-norepinephrine reuptake inhibitors
- voltage-gated calcium channel ⁇ 2- ⁇ subunit ligands such as gabapentin and pregabalin
- topical lignocaine are generally regarded as first line treatments.
- PNP may occur as a result of physical trauma; diabetes (diabetic neuropathy) or other metabolic conditions; viral infections; toxins; immune- related disorders; and cancers, amongst others.
- CNP may result from certain forms of stroke, spinal cord injuries and multiple sclerosis (MS).
- MS multiple sclerosis
- MS is an inflammatory demyelinating disease of the central nervous system (CNS) resulting in motor, sensory and cognitive impairment. It is the most common neurological disease in young adults affecting more than 2 million people globally. Pain is a common disabling symptom of MS with estimates of its prevalence varying in the range 29-86 %. The incidence of chronic pain in MS is not correlated with disease severity. Patients may experience nociceptive pain such as muscular cramps, leg spasms, headaches and migraine concurrently with neuropathic pain. The neuropathic pain is more persistent in nature and is one of the most commonly distressing symptoms experienced by patients even in the early stages of the disease. Neuropathic pain associated with MS is inadequately relieved or not relieved at all with conventional analgesics such as non-steroidal anti-inflammatory drugs or opioid analgesics such as morphine.
- analgesics such as non-steroidal anti-inflammatory drugs or opioid analgesics such as morphine.
- MS-induced neuropathic pain develops as a direct or indirect result of demyelinating lesions in the brain and spinal cord, and therefore is termed as CNP. Its clinical presentation can also be categorised as stimulus independent or dependent. The former includes persistent or paroxysmal pain, whereas evoked pain is characterised by hyperalgesia (exaggerated pain response to noxious stimuli) and allodynia.
- the present invention is predicated, at least in part, on the finding that R(+)-alpha-lipoic acid ((fl)-5-(1 ,2-dithiolan-3-yl)pentanoic acid referred to herein as R-ALA) has efficacy in the treatment of central neuropathic pain associated with MS.
- R-ALA R(+)-alpha-lipoic acid
- a-Lipoic acid (alpha lipoic acid) is otherwise known as thioctic acid or 6,8-dithiooctanoic acid and has a single chiral centre resulting in two enantiomers, (fl)-(+)-lipoic acid (R-ALA) and (S)-(-)-lipoic acid (S-ALA), which together in the racemic mixture can be referred to as (fl/S)-lipoic acid or Rac- ALA.
- R-ALA thioctic acid
- S-ALA S-(-)-lipoic acid
- Rac- ALA Rac- ALA
- U.S. 6,271 ,254 describes compositions comprising either R-ALA or S-ALA for use in combatting pain and inflammation and conferring certain cytoprotective effects.
- R-ALA is described as particularly demonstrating antiinflammatory activity while S-ALA acts mainly as an analgesic.
- S-ALA acts mainly as an analgesic.
- the only neuropathic syndromes mentioned are those of peripheral origin including polyneuropathy of diabetogenic, alcoholic, hepatic and uraemic origin.
- the compositions are not mentioned as being useful in treatment of CNP.
- U.S. 7,858,655 recites the use of a combination of at least two substances selected from ALA, ambroxol and ACE inhibitors in the treatment of neurodegenerative diseases.
- the neuroprotective effect of the combination therapy is discussed as potentially being useful in treating MS due to the effect
- U.S. 8,722,013 discusses the use of R-ALA in treating cryptogenic neuropathy.
- Cryptogenic neuropathy is described as a disease characterised by clinical signs and symptoms of the sensory and autonomic peripheral nerves and so it is a condition relating only to PNP.
- the prior use of Rac-ALA in treating paresthesia associated with diabetic polyneuropathy is discussed in the context of the claim not being backed up by the clinical evidence.
- R-ALA itself is then described as being effective against cryptogenic neuropathy although it is notable that no experimental evidence of biomarkers or objective measurements are provided and rather the alleged efficacy is based purely, in each experiment, on statements of the relief from symptoms of a single patient.
- MS-associated CNP The underlying pathophysiology of MS-associated CNP is poorly understood but there are very significant apparent underlying differences between PNP and CNP such that not only is it currently impossible to pin point a single effective CNP pathway target for drug therapy but it is also pointless to compare drugs effective in one condition as potentially being efficacious in the other. Each individual therapy must be tested against each condition; otherwise no prediction of efficacy can be made.
- EAE experimental autoimmune encephalomyelitis
- This new model of relapsing-remitting EAE is ideal for investigation of the pathophysiology of MS-associated neuropathic pain as mice are able to move their hind paws away from the applied stimuli (e.g. graded von Frey filaments) so that mechanical hypersensitivity in the hind paws, a hallmark feature of CNP, can be observed and assessed.
- the applied stimuli e.g. graded von Frey filaments
- CNP a hallmark feature of CNP
- MS animal models would only observe the onset of neuropathy and then hind limb paralysis of the animal would obscure any signs of CNP progression or management. It is only with the use of an optimised RR-EAE mouse model, as described in the experimental section herein that does not result in hind limb paralysis, that observations on the effect on CNP of a substance can be objectively measured.
- the invention provides a method of treatment or prevention of central neuropathic pain in a subject including the step of administering an effective amount of a compound of formula I, or a pharmaceutically effective salt or ester thereof;
- Formula I wherein Y is 1 to 6 carbon atoms; to the subject, to thereby treat or prevent the central neuropathic pain in the subject.
- the method of this aspect further includes the step of selecting a subject exhibiting one or a plurality of symptoms of central neuropathic pain.
- the method further includes the step of administering to the subject one or a plurality of additional agents.
- the one or plurality of additional agents are selected from the group consisting of a tricyclic antidepressant (TCA), a serotonin-norepinephrine reuptake inhibitor (SNRI), a voltage-gated calcium channel ⁇ 2- ⁇ subunit ligand, an opioid analgesic, an
- 2597367v1 antiepileptic a sodium channel antagonist, an N-methyl-d-aspartate receptor antagonist, topical capsaicin, a cannabinoid, an adenosine A1 agonist, a nicotinic acetylcholine receptor agonist, an immunomodulatory agent, an angiotensin II (AT2) receptor antagonist and any combination thereof.
- the invention provides a compound of formula I, or a pharmaceutically effective salt or ester thereof, for use in the treatment or prevention of central neuropathic pain in a subject.
- Y is suitably selected from 2, 3 or 4 carbon atoms.
- the compound of formula I is R-(+)-a-lipoic acid, or a pharmaceutically effective salt or ester thereof.
- the central neuropathic pain is or comprises central neuropathic pain associated with multiple sclerosis.
- the CNP associated with MS is or comprises CNP associated with relapsing-remitting MS (RR-MS).
- the compound modulates the function and/or expression level of a marker selected from the group consisting of BDNF, TrkB and pERK in one or a plurality of cells, tissues or organs of the subject.
- a marker selected from the group consisting of BDNF, TrkB and pERK
- the one or plurality of cells, tissues or organs are located in the central nervous system of the subject.
- the compound modulates the function and/or level of CD3+ T-cells in one or a plurality of tissues or organs of the subject.
- the one or plurality of tissues or organs are located in the central nervous system of the subject.
- the subject is suitably a human.
- FIG 1 is a series of graphical representations of hind paw hypersensitivity and clinical disease in an RR-EAE mouse model of MS- induced neuropathic pain showing it was progressively alleviated by once-daily administration of single s.c. bolus doses of R-ALA administered according to an intervention protocol at 15-35 d.p.i. (days post intervention);
- FIG 2 shows immunohistochemical analysis of the extent of CD3+ T- cell infiltration into the dorsal horn of lumbar (L4-L6) spinal cord sections from RR-EAE mice administered R-ALA at 10 mg kg ⁇ 1 day ⁇ 1 or vehicle, for 3-weeks (15-35 d.p.i.) relative to sham-mice administered vehicle by the same dosing schedule;
- FIG 3A and B show immunohistochemical analysis of CD1 1 b, BDNF, TrkB and pERK in the dorsal horn of lumbar (L4-L6) spinal cord sections from RR-EAE mice administered R-ALA at 10 mg kg ⁇ 1 day ⁇ 1 or vehicle, for 3-weeks relative to the corresponding data for vehicle-treated sham-mice;
- FIG 4 is a series of graphically represented western blot analyses of microglial activation (lba-1 ), as well as expression levels of BDNF, TrkB, pERK and total ERK in lumbar (L4-L6) spinal cord of RR-EAE mice administered R- ALA at 10 mg kg ⁇ 1 day ⁇ 1 or vehicle, for 3-weeks relative to the respective data for the lumbar spinal cord of vehicle-treated sham-mice;
- FIG 6 is a series of images showing that, in the dorsal horn of lumbar (L4-L6) spinal cord of vehicle-treated RR-EAE mice, BDNF is co-localised predominantly with (A) CD3+ T-cells. It is also co-localized with a subset of (B) neurons (NeuN) and to a lesser extent with (C) microglia/macrophages (CD1 1 b) and (D) minimally with astrocytes (GFAP). Scale bars represent 20 Mm;
- FIG 7 is a series of images showing that, in the dorsal horn of lumbar (L4-L6) spinal cord of vehicle-treated RR-EAE mice, TrkB is co-localised predominantly with (A) BDNF and (B) CD3+ T-cells. It is also co-localized with a subset of (C) neurons (NeuN) and to a lesser extent with (D) microglia/macrophages (lba-1 ) and (E) minimally with astrocytes (GFAP). Scale bars represent 20 ⁇ ;
- FIG 8 is a series of images showing that, in the dorsal horn of lumbar (L4-L6) spinal cord of vehicle-treated RR-EAE mice, pERK is co-localised predominantly with (A) CD3+ T-cells. It is also co-localized with a subset of (B) neurons (NeuN) and to a lesser extent with (C) microglia/macrophages (CD1 1 b) and (D) a subset of astrocytes (GFAP). Scale bars represent 20 ⁇ ;
- FIG 9 is a series of images showing total BDNF (pro-, truncated- and mature-BDNF) expression by western blot in lumbar (L4-L6) spinal cord of RR- EAE mice administered ALA at 10 mg kg ⁇ 1 day ⁇ 1 or vehicle, for 3-weeks relative to the respective data for the lumbar spinal cord of vehicle-treated sham-mice; and
- FIG 10 is a series of images showing immunohistochemical (IHC) analysis of CD1 1 b, BDNF, TrkB and pERK in the dorsal horn of lumbar (L4-L6) spinal cord sections from RR-EAE mice administered ALA at 10 mg kg ⁇ 1 day ⁇ 1 or vehicle, for 3-weeks relative to the corresponding data for vehicle treated sham-mice.
- IHC immunohistochemical
- administering As generally used herein, the terms “administering”, “administration” or “administered” describe the introduction of the compound or composition to a mammal such as by a particular route or vehicle. Routes of administration may include topical, parenteral and enteral which include oral, buccal, sub-lingual, nasal, anal, gastrointestinal, subcutaneous, intramuscular and intradermal routes of administration, although without limitation thereto.
- treat means administration of the compound or composition to a subject to at least ameliorate, reduce or
- 2597367v1 suppress existing signs or symptoms of central neuropathic pain experienced by a mammal.
- prevent prophylactically administering the compound or composition to a mammal who does not exhibit signs or symptoms of central neuropathic pain, but who is expected or anticipated to likely exhibit such signs or symptoms in the absence of prevention.
- Preventative treatment may at least lessen or partly ameliorate expected symptoms or signs or inhibit or delay the development or progression such symptoms.
- effective amount or “therapeutically effective amount” refers to the administration of an amount of the relevant active agent sufficient to prevent the occurrence of symptoms of the condition being treated, or to bring about a halt in the worsening of symptoms or to treat and alleviate or at least reduce the severity of the symptoms.
- the effective amount will vary in a manner which would be understood by a person of skill in the art with patient age, sex, weight etc. An appropriate dosage or dosage regime can be ascertained through routine trial.
- the terms "subject” or “individual” or “patient” may refer to any mammalian subject. Mammals may include, but are not restricted to, primates, livestock animals (e.g., sheep, cows, horses, donkeys, pigs), laboratory test animals (e.g., rabbits, mice, rats, guinea pigs, hamsters), companion animals (e.g., cats, dogs) and captive wild animals (e.g., foxes, deer, dingoes).
- a preferred subject is a human in need of treatment for a disease, disorder or condition as described herein. However, it will be understood that the aforementioned terms do not imply that symptoms are necessarily present.
- pharmaceutically acceptable salt refers to salts which are toxicologically safe for systemic or localised administration
- 2597367v1 such as salts prepared from pharmaceutically acceptable non-toxic bases or acids including inorganic or organic bases and inorganic or organic acids.
- the pharmaceutically acceptable salts may be selected from the group including alkali and alkali earth, ammonium, aluminium, iron, amine, glucosamine, chloride, sulphate, sulphonate, bisulphate, nitrate, citrate, tartrate, bitarate, phosphate, carbonate, bicarbonate, malate, maleate, napsylate, fumarate, succinate, acetate, benzoate, terephthalate, palmoate, piperazine, pectinate and S-methyl methionine salts and the like.
- the preferred pharmaceutically acceptable salt of any compound for administration to a subject is selected from the group consisting of sodium, potassium, ammonium, magnesium and calcium salts.
- alkyf refers to a straight-chain or branched alkyl substituent containing from, for example, 1 to about 6 carbon atoms, preferably 1 to about 5 carbon atoms, more preferably 1 to about 4 carbon atoms, even more preferably from 1 to about 3 carbon atoms. Such ranges include within their scope 2 to about 6 carbon atoms, 2 to about 5 carbon atoms, 2 to about 4 carbon atoms, 2 to about 3 carbon atoms, 3 to about 6 carbon atoms, 3 to about 5 carbon atoms and 3 or 4 carbon atoms.
- substituents may be selected from the group consisting of methyl, ethyl, propyl, isopropyl, n- butyl, sec-butyl, isobutyl, terf-butyl, pentyl, isoamyl, 2-methylbutyl, 3- methylbutyl, hexyl and the like.
- the number of carbons referred to relates to the carbon backbone only and does not include carbon atoms belonging to carbon chain branches or any substituents, for example the carbon atoms of an alkoxy substituent branching off the main carbon chain.
- Substituted alkyl includes alkyl substituted with one or more moieties selected from the group consisting of halo ⁇ e.g., CI, F, Br, and I); halogenated alkyl ⁇ e.g., CF 3 , 2-Br-ethyl, CH 2 F,
- estei refers to a 1 to 6 carbon ester moiety formed by reaction of the carboxyl group of a compound of formula I, or R-ALA in one embodiment, with an appropriate alcohol.
- the ester group formed may have 1 to 6, 1 to 5, 1 to 4, 1 to 3, 2 or 1 carbon atoms which may be in a straight chain or branched form and may be optionally substituted as described for substituted alkyl.
- the ester formed may be selected from methyl ester, ethyl ester, propyl ester, isopropyl ester, n-butyl ester, sec-butyl ester, isobutyl ester, te/ -butyl ester, pentyl ester, isoamyl ester, 2-methylbutyl ester, 3- methylbutyl ester, hexyl ester and the like.
- the ester group may alternatively be a phosphate or benzoate ester. Appropriate guidance on choice of ester formation is widely available to the person of skill in the art and such literature as "Prodrugs - from Serendipity to Rational Design"; K M.
- neuropathic pain behaviours in rodent models of CNP are associated with pathobiologic mechanisms in sensory neurons in the dorsal horn (laminae l-ll) of the spinal cord, as has been found and presented herein (our data). Due, presumably, to at least some of these underlying pathobiological differences, recommended drug treatments for the relief of peripheral neuropathic pain conditions (Dworkin etal., 2010) are often ineffective for alleviating MS-associated CNP (Khan et al., 2014a).
- a method of treatment or prevention of central neuropathic pain in a subject including the step of administering an effective amount of a compound of formula I, or a pharmaceutically effective salt or ester thereof;
- Formula I wherein Y is 1 to 6 carbon atoms; to the subject, to thereby treat or prevent the central neuropathic pain in the subject.
- the method of this aspect further includes the step of selecting a subject exhibiting one or more symptoms of central neuropathic pain.
- the subject may be diagnosed as exhibiting symptoms of central neuropathic pain by any means known in the art.
- central neuropathic pain may be diagnosed by identifying symptoms and neurological signs compatible with a lesion in the CNS, and excluding other possible causes of pain.
- Nonlimiting examples of neurological findings that may indicate a central neurological lesion in a subject may include a positive Babinski sign, accelerated tendon reflexes, and spasticity.
- a second aspect of the invention provides for a compound of formula I, or a pharmaceutically effective salt or ester thereof, for use in the treatment or prevention of central neuropathic pain in a subject.
- the compound of formula I may be for use in the manufacture of a medicament for the treatment or prevention of central neuropathic pain in a subject.
- Y is selected from 2, 3 or 4 carbon atoms.
- the compound of formula I is R-a-lipoic acid (R-ALA), or a pharmaceutically effective salt or ester thereof.
- the compound of formula I is a prodrug of R-ALA, or a pharmaceutically effective salt or ester thereof.
- prodrug or “prodrugs” as generally used herein, refer to a compound or compounds which upon administration to a subject in need thereof undergo cleavage in vivo such as by enzymatic or chemical processes to release the parent drug from which the prodrug is derived.
- the compound of formula I including R-ALA, is substantially enantiopure.
- R-ALA may be otherwise known or referred to as (fl)-(+)-lipoic or (fl)-5-(1 ,2-dithiolan-3-yl)pentanoic acid and is shown below:
- the compound modulates the function and/or expression level of a marker selected from the group consisting of BDNF, TrkB and pERK in one or a plurality of cells, tissues or organs of the subject.
- a marker selected from the group consisting of BDNF, TrkB and pERK
- the one or plurality of cells, tissues or organs are located in the central nervous system, such as a lumbar spinal dorsal horn, of the subject.
- marker refers to nucleic acid sequences or proteins or polypeptides or fragments thereof to be used for associating a disease state, such as CNP, with the marker.
- levels of gene expression and protein levels are quantifiable and a variation in quantification or the mere presence or absence of the expression may serve as markers.
- the presence or altered expression (e.g., increased expression) of one or more markers described hereinafter may also be utilised to indicate whether a subject is suitable for treatment and/or responding to treatment with the compound of formula I.
- the expression level of a marker such as a gene or protein
- a reference sample may be a biological sample taken from the subject prior to administration of the compound of the invention or one or a plurality of further subjects exhibiting symptoms of CNP.
- a "gene” is a nucleic acid which is a structural, genetic unit of a genome that may include one or more amino acid-encoding nucleotide sequences and one or more non-coding nucleotide sequences inclusive of promoters and other 5' untranslated sequences, introns, polyadenylation sequences and other 3' untranslated sequences, although without limitation thereto.
- a gene is a nucleic acid that comprises double-stranded DNA.
- protein is meant an amino acid polymer.
- the amino acids may be natural or non-natural amino acids, D- or L- amino acids as are well understood in the art.
- protein also includes within its scope phosphorylated forms of a protein (i.e., a phosphoprotein) and/or glycosylated forms of a protein (i.e. a glycoprotein).
- an expression level may be an absolute or relative amount of an expressed gene or gene product thereof inclusive of nucleic acids such as RNA, mRNA and cDNA and protein, including phosphoproteins. Accordingly, in particular embodiments, the expression level of a gene and/or a product thereof is compared to a control level of expression, such as the level of gene and/or protein expression of one or a plurality of "housekeeping" genes
- the administration of the compound of formula I results in an inhibition or decrease in the function and/or expression level of the marker.
- Determining, assessing, evaluating, assaying or measuring nucleic acids such as RNA, mRNA and cDNA may be performed by any technique known in the art. These may be techniques that include nucleic acid sequence amplification, nucleic acid hybridization, nucleotide sequencing, mass spectroscopy and combinations of any these.
- Nucleic acid amplification techniques typically include repeated cycles of annealing one or more primers to a "template” nucleotide sequence under appropriate conditions and using a polymerase to synthesize a nucleotide sequence complementary to the target, thereby "amplifying" the target nucleotide sequence.
- Nucleic acid amplification techniques are well known to the skilled addressee, and include but are not limited to polymerase chain reaction (PCR); strand displacement amplification (SDA); rolling circle replication (RCR); nucleic acid sequence-based amplification (NASBA), Q- ⁇ replicase amplification; helicase-dependent amplification (HAD); loop-mediated isothermal amplification (LAMP); nicking enzyme amplification reaction (NEAR) and recombinase polymerase amplification (RPA), although without limitation thereto.
- PCR polymerase chain reaction
- SDA strand displacement amplification
- RCR rolling circle replication
- NASBA nucleic acid sequence-based amplification
- HAD helicase-dependent amplification
- LAMP loop-mediated isothermal amplification
- NEAR nicking enzyme amplification reaction
- RPA recombinase polymerase amplification
- PCR includes quantitative and semi-quantitative PCR, real-time PCR, allele-specific PCR, methylation-specific PCR, asymmetric PCR, nested PCR, multiplex PCR, touch-down PCR and other variations and modifications to "basic" PCR amplification.
- Nucleic acid amplification techniques may be performed using DNA or RNA extracted, isolated or otherwise obtained from a cell or tissue source.
- nucleic acid amplification may be performed directly on appropriately treated cell or tissue samples.
- Nucleic acid hybridization typically includes hybridizing a nucleotide sequence, typically in the form of a probe, to a target nucleotide sequence under appropriate conditions, whereby the hybridized probe-target nucleotide sequence is subsequently detected.
- Non-limiting examples include Northern blotting, slot-blotting, in situ hybridization and fluorescence resonance energy transfer (FRET) detection, although without limitation thereto.
- Nucleic acid hybridization may be performed using DNA or RNA extracted, isolated, amplified or otherwise obtained from a cell or tissue source or directly on appropriately treated cell or tissue samples.
- nucleic acid amplification may be utilized.
- Determining, assessing, evaluating, assaying or measuring protein levels may be performed by any technique known in the art that is capable of detecting cell- or tissue-expressed proteins whether on the cell surface or intracellular ⁇ expressed, or proteins that are isolated, extracted or otherwise obtained from the cell of tissue source.
- These techniques include antibody- based detection that uses one or more antibodies which bind the protein, electrophoresis, isoelectric focussing, protein sequencing, chromatographic techniques and mass spectroscopy and combinations of these, although without limitation thereto.
- Antibody-based detection may include flow cytometry using fluorescently-labelled antibodies that bind the protein, ELISA, immunoblotting, immunoprecipitation, in situ hybridization, immunohistochemistry and immuncytochemistry, although without limitation thereto.
- Suitable techniques may be adapted for high throughput and/or rapid analysis such as using protein arrays such as a TissueMicroArrayTM (TMA), MSD MultiArraysTM and multiwell ELISA, although without limitation thereto.
- the compound modulates the function and/or level of CD3+ T-cells in one or a plurality of tissues or organs of the subject.
- the one or plurality of tissues or organs are located in the central nervous system, such as a lumbar spinal dorsal horn, of the subject.
- CD3+ T-cell or “CD3+ T-lymphocyte” means a T-cell or lymphocyte cell which expresses CD3 cell surface antigens. It would be understood that the level of CD3+ T-cells may be deemed to be “altered' or “modulated' when that level is higher/increased or lower/decreased when compared to a control or reference sample or level, such as those previously described herein.
- the administration of the compound of formula I results in a decrease or prevents an increase in the level of CD3+ T-cells in the one or plurality of tissues or organs of the subject.
- marker expression such as BDNF, TrkB and pERK, or CD3+ T-cell levels
- “higher”, “enhanced”, “increased” or “up regulated” as used herein refer to an increase in and/or amount or level of one or more of said markers, including gene products thereof, or CD3+ T-cells in a biological sample when compared to a control or reference sample or value or a further biological sample from a subject.
- the marker expression levels or CD3+ T-cell levels are increased if this level is more than about 0.5%, 1 %, 2%, 3%, 4%, 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%, 400% or at least about 500% greater than the level of expression of the corresponding marker or the CD3+ T-cell level in a control sample, reference value or further biological sample from a subject.
- marker expression such as BDNF, TrkB and pERK, or CD3+ T-cell levels
- marker expression such as BDNF, TrkB and pERK, or CD3+ T-cell levels
- 2597367v1 markers including gene products thereof, or CD3+ T-cells, in a biological sample when compared to a control or reference sample or value or further biological sample from a subject.
- the expression of a marker is decreased if its level of expression is less than about 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10%, or even less than about 5%, 4%, 3%, 2%, 1 %, 0.5%, 0.1 %, 0.01 %, 0.001 % or 0.0001 % of the level of expression of the corresponding marker in a control sample, reference value or further biological sample from a subject.
- a CD3+ T-cell level is decreased if said level is less than about 95%, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% or 10%, or even less than about 5%, 4%, 3%, 2%, 1 %, 0.5%, 0.1 %, 0.01 %, 0.001 % or 0.0001 % of the CD3+ T-cell level in a control sample, reference value or further biological sample from a subject.
- the compound of formula I which may be R- ALA, may be administered as part of a dietary supplement or nutraceutical composition.
- R-ALA is generally widely available as a dietary supplement, typically being sold based on its supposed anti-oxidant activity. It is expected that in some instances these commercially available formulations may be appropriate for use in the method of the present invention. It may be preferred, however, to produce a composition better suited to pharmaceutical demands and/or for chronic usage.
- the subject is a mammal exhibiting symptoms of CNP.
- the subject is a human exhibiting symptoms of CNP.
- Non-limiting examples of CNP symptoms may include allodynia, including dynamic mechanical allodynia and cold allodynia, paresthesia and dysesthesia (e.g., burning, tingling, pins and needles, cold, and pressing
- CNP 2597367v1 sensations.
- the pain associated with CNP may be described in terms such as burning, pricking, shooting, squeezing, and painful cold. Additionally, CNP can be spontaneous or stimulus-evoked and may be acute or chronic.
- Central neuropathic pain may be associated with lesions due to infarction, a compressive tumor or abscess, such as in the thalamus or brainstem, Parkinson's disease, a spinal cord injury, such as due to injury or operation, MS, myelitis, syphilis, ischaemia, haemorrhage, arteriovenous malformation and/or syringomyelia, but without limitation thereto.
- the CNP is CNP associated with MS. It would be appreciated by the skilled artisan that MS is generally a chronic inflammatory-demyelinating disease of the CNS typically characterised by motor impairment. In many patients, MS can also be associated with central neuropathic pain (CNP) which is unaffected by the clinical disease course. The occurrence of MS-associated pain has been estimated at about 29% of the patient population.
- CNP central neuropathic pain
- MS may be any known in the art.
- Relapsing-remitting MS (RR-MS) is typically the most frequently observed form of MS and is characterized by clearly defined relapses of increased disease activity and worsening symptoms. These are followed by remissions in which the disease doesn't progress.
- RR-MS Relapsing-remitting MS
- Primary-progressive MS is generally diagnosed in about 10% of MS patients at onset.
- Progressive- relapsing MS is considered the rarest form of MS, representing about 5% of MS patients.
- patients typically have clear relapses combined with a steady progression of the disease.
- the CNP is CNP associated with relapsing- remitting MS (RR-MS).
- the compound of formula I and compositions containing same may be administered by any suitable route or dose form, (including modified release and/or slow release dose forms) and the person skilled in the art will readily be able to determine the most suitable route and dose for the condition to be treated. Dosage will be at the discretion of the attendant physician or veterinarian, and will depend on the nature and state of the disease, disorder or condition to be treated, the age and general state of health of the subject to be treated, the route of administration, and any previous treatment which may have been administered.
- any carrier or diluent, or other excipients will depend on the route of administration or dose form, and again the person skilled in the art will readily be able to determine the most suitable formulation for each particular case.
- Frequently used carriers or auxiliaries include but are not limited to magnesium carbonate, magnesium aluminium silicate, titanium dioxide, silicon dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, alcohols, glycerol and polyhydric alcohols.
- Intravenous vehicles include fluid and nutrient replenishers.
- Preservatives include antimicrobials, anti-oxidants, chelating agents and inert gases.
- compositions include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described, for instance, in Remington's Pharmaceutical Sciences, 20th ed. Williams & Wilkins (2000) and The British National Formulary 43rd ed. (British Medical Association and Royal Pharmaceutical Society of Great Britain, 2002; http://bnf.rhn.net), the contents of which are hereby incorporated by reference.
- the pH and exact concentration of the various components of the pharmaceutical composition are adjusted according to routine skills in the art. See Goodman and Gilman's The Pharmacological Basis for Therapeutics (7th ed. , 1985).
- Diluents may include one or more of microcrystalline cellulose, lactose, mannitol, calcium phosphate, calcium sulfate, kaolin, dry starch, powdered sugar, and the like.
- Binders may include one or more of povidone, starch, stearic acid, gums, hydroxypropylmethyl cellulose and the like.
- Disintegrants may include one or more of starch, croscarmellose sodium, crospovidone, sodium starch glycolate and the like.
- Solvents may include one or more of ethanol, methanol, isopropanol, chloroform, acetone, methylethyl ketone, methylene chloride, water and the like.
- Lubricants may include one or more of magnesium stearate, zinc stearate, calcium stearate, stearic acid, sodium stearyl fumarate, hydrogenated vegetable oil, glyceryl behenate and the like.
- a glidant may be one or more of colloidal silicon dioxide, talc or cornstarch and the like.
- Buffers may include phosphate buffers, borate buffers and carbonate buffers, although without limitation thereto.
- Fillers may include one or more gels inclusive of gelatin, starch and synthetic polymer gels, although without limitation thereto.
- Coatings may comprise one or more of film formers, solvents, plasticizers and the like.
- Suitable film formers may be one or more of hydroxypropyl methyl cellulose, methyl hydroxyethyl cellulose, ethyl cellulose, hydroxypropyl cellulose, povidone, sodium carboxymethyl cellulose, polyethylene glycol, acrylates and the like.
- Suitable solvents may be one or more of water, ethanol, methanol, isopropanol, chloroform, acetone, methylethyl ketone, methylene chloride and the like.
- Plasticizers may be one or more of propylene glycol, castor oil, glycerin, polyethylene glycol, polysorbates, and the like.
- 2597367v1 composition may be in the form of a tablet, capsule, caplet, powder, an injectable liquid, a suppository, a slow release formulation, an osmotic pump formulation or any other form that is effective and safe for administration.
- the pharmaceutical compositions are preferably prepared and administered in dosage units.
- Solid dosage units include tablets, capsules and suppositories.
- different daily doses can be used for treatment of a subject. Under certain circumstances, however, higher or lower daily doses may be appropriate.
- the administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals or may be given in an extended, depot or slow release format.
- compositions according to the invention may be administered locally or, preferably, systemically in a therapeutically effective dose. Amounts effective for this use will, of course, depend on the severity of the disease and the weight and general state of the subject. Typically, dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of the cytotoxic side effects, if any.
- Formulations for oral use may be in the form of hard gelatin capsules, in which the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin. They may also be in the form of soft gelatin capsules, in which the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil.
- Aqueous suspensions normally contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions.
- excipients may be suspending agents such as sodium carboxymethyl cellulose, methyl cellulose, hydroxypropylmethylcellulose, sodium alginate,
- polyvinylpyrrolidone xanthan gum, gum tragacanth and gum acacia, magnesium silicate; dispersing or wetting agents, which may be (a) a naturally occurring phosphatide such as lecithin; (b) a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate; (c) a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadecaethylenoxycetanol; (d) a condensation product of ethylene oxide with a partial ester derived from a fatty acid and hexitol such as polyoxyethylene sorbitol monooleate, or (e) a condensation product of ethylene oxide with a partial ester derived from fatty acids and hexitol anhydrides, for example polyoxyethylene sorbitan monooleate.
- dispersing or wetting agents which may be (a) a naturally occurring phosphatide such as le
- the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension.
- This suspension may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as those mentioned above.
- the sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenteral ly-acceptable diluent or solvent, for example, as a solution in 1 ,3-butanediol.
- the acceptable vehicles and solvents which may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
- sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil may be employed, including synthetic mono-or diglycerides.
- fatty acids such as oleic acid may be used in the preparation of injectables.
- Dosage levels of the compound of formula I will usually be of the order of about 10mg to about 3000mg per day, with a preferred dosage range between about 50mg to about 2500mg per day.
- the lower limit for both of these ranges (10mg to 3000mg and 50mg to 2500mg) may in one embodiment be selected from 50mg, 100mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, 900mg or 10OOmg.
- the upper limit to be combined with any of these values or with either of the recited ranges may be selected from 2400mg,
- the method of the present invention further includes the step of administering to the subject one or a plurality of additional agents.
- the compounds of formula I may additionally be combined with the one or plurality of additional agents to provide an operative combination or co-treatment. It is intended to include any chemically compatible combination of pharmaceutically-active agents, as long as the combination does not negatively impact upon the activity of the compound of this invention.
- the compound of the present invention and the additional agent may be administered together, i.e. in a single dose form, or may be administered separately, i.e. in a separate dose form.
- the method of the present invention may include the administration of a compound of the present invention as defined above and may further comprise administration of an additional agent for the prevention, alleviation or/and treatment of CN P.
- the pharmaceutical composition derived therefrom may comprise a single dose form or may comprise a separate dose form comprising a first composition comprising a compound of the present invention as defined above and a second composition comprising the additional agent.
- the additional agent may be selected from the group consisting of a tricyclic antidepressant (TCA) (e.g., nortriptyline and amitriptyline), a serotonin-norepinephrine reuptake inhibitor (SNRI) (e.g., duloxetine and venlafaxine), a voltage-gated calcium channel ⁇ 2- ⁇ subunit ligand (e.g., gabapentin and pregabalin), an opioid analgesic (e.g.
- morphine oxycodone, methadone, fentanyl, tramadol
- an antiepileptic e.g., carbamazepine, lamotrigine, oxcarbazepine, topiramate, valproic acid
- a sodium channel antagonist e.g., mexiletine, lignocaine, bupivacaine
- an N- methyl-d-aspartate receptor antagonist e.g.
- ketamine memantine
- topical capsaicin a cannabinoid
- an adenosine A1 agonist e.g., a nicotinic acetylcholine receptor agonist
- an immunomodulatory agent e.g., thalidomide
- an angiotensin II (AT2) receptor antagonist e.g., losartan, candesartan, irbesartan, telmisartan, valsartan, fimasartan
- the compounds of formula I may be combined with nonpharmacological approaches to the treatment of CNP, including, but not limited to, cognitive-behavioral therapy, hypnosis, and neurostimulation therapies.
- the compounds of formula I may be utilized per se or in the form of a pharmaceutically acceptable ester, salt, solvate or prodrug.
- the compound of formula I may be provided as a pharmaceutically acceptable salt.
- a salt of the drug compound should be both pharmacologically and pharmaceutically acceptable, but non-pharmaceutically acceptable salts may conveniently be used to prepare the free active compound or pharmaceutically acceptable salts thereof and are not excluded from the scope of this invention.
- Such pharmacologically and pharmaceutically acceptable salts can be prepared by reaction of the drug with an organic or inorganic acid, using standard methods detailed in the literature.
- Examples of pharmaceutically acceptable salts of the compounds useful according to the invention include acid addition salts. Salts of non-
- Suitable acid addition salts according to the present invention include organic and inorganic acids.
- Preferred salts include those formed from hydrochloric, hydrobromic, sulfuric, phosphoric, citric, tartaric, lactic, pyruvic, acetic, succinic, fumaric, maleic, oxaloacetic, methanesulfonic, ethanesulfonic, p-toluenesulfonic, benzenesulfonic, and isethionic acids.
- compositions include propionic acid, glycolic acid, oxalic acid, malic acid, malonic acid, benzoic acid, cinnamic acid, mandelic acid, salicylic acid, and the like.
- pharmaceutically acceptable salts include, but are not limited to, sulfates, pyrosulfates, bisulfates, sulfites, bisulfites, phosphates, monohydrogenphosphates, dihydrogenphosphates, metaphosphates, pyrophosphates, chlorides, bromides, iodides, acetates, propionates, decanoates, caprylates, acrylates, formates, isobutyrates, caproates, heptanoates, propiolates, oxalates, malonates, succinates, suberates, sebacates, fumarates, maleates, butyne-1 ,4-dioates, hexyne-1 ,6-dioates
- An acid addition salt may be reconverted to the free base by treatment with a suitable base.
- Preparation of basic salts of acid moieties which may be present on a compound or prodrug useful according to the present invention may be prepared in a similar manner using a pharmaceutically acceptable base, such as sodium hydroxide, potassium hydroxide, ammonium hydroxide, calcium hydroxide, triethylamine, or the like.
- Esters of the compounds of formula I may be prepared through functionalization of the carboxyl group present on the compound.
- Prodrugs may be prepared through functionalization of the carboxyl group present on the compound.
- esters of compounds of the invention can be made by reaction with a carbonylating agent ⁇ e.g., ethyl formate, acetic anhydride, methoxyacetyl chloride, benzoyl chloride, methyl isocyanate, ethyl chloroformate, methanesulfonyl chloride) and a suitable base ⁇ e.g., 4-dimethylaminopyridine, pyridine, triethylamine, potassium carbonate) in a suitable organic solvent ⁇ e.g., tetrahydrofuran, acetone, methanol, pyridine, ⁇ , ⁇ -dimethylformamide) at a temperature of 0 °C to 60 °C.
- a carbonylating agent e.g., ethyl formate, acetic anhydride, methoxyacetyl chloride, benzoyl chloride, methyl isocyanate, ethyl chloroformate, methanes
- Prodrugs are typically prepared by covalent attachment of a moiety, which results in a compound that is therapeutically inactive until modified by an individual's metabolic system.
- Examples of pharmaceutically acceptable solvates include, but are not limited to, compounds of formula I in combination with water, isopropanol, ethanol, methanol, DMSO, ethyl acetate, acetic acid, or ethanolamine.
- the compounds of formula I used in the methods of the invention may exist in different forms.
- the compounds may exist in stable and metastable crystalline forms and isotropic and amorphous forms, all of which are intended to be within the scope of the present invention.
- the desired salt may be prepared by any suitable method known to the art, including treatment of the free base with an inorganic acid, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, or with an organic acid, such as acetic acid, maleic acid, succinic acid, mandelic acid, fumaric acid, malonic acid, pyruvic acid, oxalic acid, glycolic acid, salicylic acid, pyranosidyl acids such as glucuronic acid and galacturonic acid, alpha-hydroxy acids such as citric acid and tartaric acid, amino acids such as aspartic acid and glutamic acid, aromatic acids such as benzoic acid and cinnamic acid, sulfonic acids such a p-toluenesulfonic acid or ethanesulfonic acid, or the like.
- an inorganic acid such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid,
- the desired salt may be prepared by any suitable method known to the art, including treatment of the free acid with an inorganic or organic base, such as an amine (primary, secondary or tertiary), an alkali metal or alkaline earth metal hydroxide or the like.
- an inorganic or organic base such as an amine (primary, secondary or tertiary), an alkali metal or alkaline earth metal hydroxide or the like.
- suitable salts include organic salts derived from amino acids such as glycine and arginine, ammonia, primary, secondary and tertiary amines, and cyclic amines such as piperidine, morpholine and piperazine, and inorganic salts derived from sodium, calcium, potassium, magnesium, manganese, iron, copper, zinc, aluminum and lithium.
- the pharmaceutically acceptable carrier, diluent and/or excipient may be or include one or more of diluents, solvents, pH buffers, binders, fillers, emuisifiers, dissntegrants, polymers, lubricants, oils, fats, waxes, coatings, viscosity-modifying agents, glidants and the like.
- mice Female C57BL/6 mice aged 4-6 weeks were from The University of Queensland Biological Resources (UQBR). Mice were housed in groups of 6-8 per cage in a temperature-controlled facility (22-23°C) with a 12 h/12 h light/dark cycle. Rodent chow and water were available ad libitum. Ethics
- mice were immunised with 200 ⁇ g of MOG 3 5-55 (Mimotopes, Clayton, VIC, Australia) mixed with a solution of Quil A (45 ⁇ ig) in 100 ⁇ of phosphate-buffered saline (PBS) (Sigma-Aldrich, Sydney, NSW, Australia).
- MOG 3 5-55 Momotopes, Clayton, VIC, Australia
- Quil A 45 ⁇ ig
- PBS phosphate-buffered saline
- mice then received an intraperitoneal (i.p.) injection of pertussis toxin at 250 ng (Sigma-Aldrich) in PBS (1 ng ⁇ - 1 ) and this was repeated 48 h later (Khan et al., 2014b). Sham-mice (control group) received adjuvants only (Quil A and pertussis toxin). Clinical disease scoring of RR-EAE and sham-mice was undertaken once-daily in a blinded manner using a 5-point scale with half-point gradations (Table 1 ) (Khan et al., 2014b; Peiris et al., 2007).
- RR-EAE clinical disease was classified as present by clinical scores ⁇ 1 whereas clinical scores ⁇ 0.5 were regarded as disease remission or absence.
- General health and body weights of all mice were assessed prior to immunisation and once-daily thereafter in a blinded manner until study completion.
- ALA was from GeroNova Research Inc. (Richmond, CA, USA) and was supplied and used as the water-soluble sodium salt of the R-enantiomer of ALA (R-ALA). Dosing solutions of ALA were prepared in sterile water for injection (Pfizer, West Ryde, NSW, Australia). RR-EAE mice received once- daily s.c. injections of ALA at 3 or 10 mg kg- 1 day- 1 , or vehicle for 21
- RR-EAE mice administered the chronic ALA (10 mg kg- 1 day- 1 ) or vehicle treatments, as well as sham-mice (administered the chronic vehicle dosing regimen n 4/group for each technique), were euthanized with an overdose ((-300 mg kg- 1 ; i.e. 1 mL/kg of 325 mg/mL, i.p.) of pentobarbitone (Lethabarb ®, Virbac, Milperra, NSW, Australia) at 0.5-0.75 h post-dosing on the last treatment day (35 d.p.i.).
- an overdose ((-300 mg kg- 1 ; i.e. 1 mL/kg of 325 mg/mL, i.p.) of pentobarbitone (Lethabarb ®, Virbac, Milperra, NSW, Australia) at 0.5-0.75 h post-dosing on the last treatment day (35 d.p.i.).
- Lumbar (L4-L6) spinal cord tissues were removed for ex-vivo mode of action analyses using immunohistochemistry (IHC), western blotting and quantitative real-time PCR (RTqPCR).
- IHC immunohistochemistry
- RTqPCR quantitative real-time PCR
- mice were perfused with 4% paraformaldehyde (Sigma-Aldrich, Sydney, NSW, Australia) in ice cold 1 ⁇ PBS (pH 7.4; -100 mL/mouse) prior to removal of lumbar spinal cord tissues.
- Transverse cryosections (10-12 ⁇ ) were prepared and mounted on Superfrost Plus® slides (Thermo Fisher Scientific, Scoresby, VIC, Australia) prior to immunostaining, as per our previous report (Khan et al., 2014b).
- lumbar (L4-L6) spinal cord tissues were collected without perfusion and immediately stored at -80°C prior to further processing as described below.
- Sections of lumbar spinal cord were permeabilised with ice-cold acetone and incubated in blocking buffer containing 10% normal goat serum (Invitrogen, Mulgrave, VIC, Australia), 0.2% Triton-X (Sigma-Aldrich) and 0.05% Tween-20 in PBS solution prior to immunostaining (Khan etal., 2014b). Briefly, sections were incubated overnight with the relevant primary antibody at
- Additional antibodies used for co-localisation experiments were: monoclonal rabbit anti-CD3 (1 :200, Abeam, Cambridge, MA, USA); polyclonal rabbit anti- lba-1 (1 :600, Wako, Osaka, Japan) and monoclonal mouse anti-NeuN Alexa Flour 488 conjugated (1 :50, Millipore). Secondary antibodies used included: Cy3-goat anti-rat (1 :800, Jackson ImmunoResearch, Westgrove, PA, USA); Cy3-goat anti rabbit (1 :1000, Jackson); Alexa Flour 488 goat anti-rat (1 :500, Invitrogen) or Alexa Flour 488 goat anti-rabbit (1 :1000, Invitrogen). Primary and secondary antibodies were diluted in PBST containing 2% normal goat serum. Omission of primary antibodies on negative control sections during each staining procedure resulted in a complete absence of immunofluoresence (IF).
- IF immunofluoresence
- Lumbar spinal cord tissues were homogenised individually for each animal and protein extracted using radio-immunoprecipitation assay (RIPA) buffer. From each extract, 40 ⁇ g of total protein was loaded onto 4-20% gradient precast polyacrylamide gels (Bio-rad, Gladesville, NSW, Australia). Each gel was transferred to a 0.2 ⁇ nitrocellulose membrane (Bio-rad) and blocked in OdysseyTM blocking buffer (Li-cor, Lincoln, NE, USA). For phospho- specific antibodies, blocking buffer comprised 5% bovine serum albumin (BSA)/0.1 % Tween-20. Membranes were incubated overnight at ⁇ 4°C with
- Membranes were washed using PBST (3 x 5 min) and incubated in appropriate infrared dye-conjugated secondary antibodies (Li-cor) (1 :8000) for ⁇ 1 h at room temperature. Membranes were visualised using an Odyssey infrared scanner (Li-cor).
- RNA Miniprep Kits (Agilent, Santa Clara, CA, USA) were used to isolate total RNA individually from lumbar spinal cord tissue from each mouse.
- Complementary DNA cDNA
- cDNA reverse transcription kits Applied Biosystems, Mulgrave, VIC, Australia
- Quantitative BDNF and TrkB messenger RNA (mRNA) expression levels were analysed using SYBR ® Green PCR master mix (Applied Biosystems) and specific primers. The specificity of the real time PCR reaction was confirmed using melting curve analysis.
- Primers used were (i) 18S-forward: CCCTCCAATGGATCCTCGTT; 18S-reverse:
- Laminae l-ll of the spinal dorsal horn was targeted for all IHC analyses (FIG 10).
- Densitometric counts were quantified using Axiovision Rel. v4.8 software (Carl Zeiss, Gottingen, Germany) in a blinded manner (Khan et al., 2014b). Data are expressed as fold-changes in fluorescence intensity for sections from RR-EAE mice treated with ALA (10 mg kg-1 day-1 ) or vehicle, relative to the corresponding data for vehicle-treated sham-mice.
- mRNA levels were quantified relative to that for vehicle-treated sham-mice using the AAC T method (Schmittgen etal., 2008).
- the fold-changes for each target of interest were determined using the 2 _AACT method (Schmittgen et al., 2008).
- RR-EAE mice Mechanical hypersensitivity in the bilateral hind paws
- RR-EAE mice (Cohorts 1 and 2) treated with ALA at 3 or 10 mg kg- 1 day- 1 for 21 consecutive days commencing on day 15 d.p.i did not exhibit clinical disease relapses.
- the clinical disease patterns in Cohorts 1 and 2 of RR-EAE mice treated with ALA at 10 mg kg- 1 day- 1 were comparable (P > 0.05) to those from the corresponding vehicle-treated sham-mice at the end of treatment (35 d.p.i.) (FIG 1 ).
- CD3+ T-cell IF in the lumbar spinal dorsal horn did not differ significantly (P > 0.05) from that for vehicle-treated sham mice.
- BDNF-TrkB signalling in the spinal cord has been observed in peripheral neuropathic pain conditions (Vanelderen et al., 2010).
- expression levels of BDNF and TrkB in vehicle-treated RR-EAE mice exhibiting robust mechanical allodynia at 35 d.p.i. were investigated.
- pro-BDNF precursor of mature-BDNF
- truncated-BDNF intermediate protein
- mature-BDNF intermediate protein
- chronictreatmentwith ALA 10 mg kg- 1 day- 1 normalised lumbar spinal cord expression levels of pro-BDNF
- pERK was then examined in RR-EAE mice as a marker of neuronal and/or glial cell activation (Gao et al., 2009; Yamamoto et al., 2013).
- BDNF, TrkB and pERK were highly co-localised with CD3+ T-cells in the dorsal horn of lumbar spinal cord sections from RR EAE mice (FIGs 6-8). These markers were also co- localised with subsets of neurons (NeuN) and microglia/macrophages (CD1 1 b or Iba1 ) ( Figures 6-8). BDNF and TrkB were minimally co-localised with astrocytes (GFAP), whereas pERK was co-localised with a subset of astrocytes ( Figures 6-8). BDNF was highly co-localised with its receptor, TrkB, in the dorsal horn of lumbar spinal cord sections from these animals (FIGs 6-8).
- Chronic ALA treatment No signs of hepatic or renal toxicity
- Elevated expression levels of BDNF and TrkB in the lumbar spinal cord of RR EAE mice may be due to increased translation of BDNF and TrkB from mRNA in spinal cord neurons and/or glia.
- elevated spinal cord expression levels of BDNF and TrkB may be via a mechanism not involving enhanced local synthesis (Tonra et al., 1998). This latter notion is supported by reports of upregulated BDNF expression by infiltrating T-cells due to antigen stimulation and/or secondary to demyelination of CNS neurons (Gielen et al., 2003; Stadelmann et al., 2002).
- T-cell derived BDNF was originally proposed to be neuroprotective in the CNS of EAE-mice (Moalem et al., 2000; Stadelmann et al., 2002), more recent work suggests that T-cell derived BDNF is not critical for neuroprotective effects in the CNS of EAE-mice (Lee et al., 2012; Xin et al, 2012).
- 2597367v1 isoforms was normalised in RR-EAE mice administered chronic ALA treatment at 10 mg kg- 1 day- 1 for 3-weeks (FIG 4).
- the series of images in FIG 9 show total BDNF (pro-, truncated- and mature-BDNF) expression by western blot in lumbar (L4-L6) spinal cord of RR- EAE mice administered ALA at 10 mg kg "1 day "1 or vehicle, for 3-weeks relative to the respective data for the lumbar spinal cord of vehicle-treated sham-mice.
- BDNF pro-, truncated- and mature-BDNF
- RR-EAE mice treated with ALA (10 mg kg-1 day-1 ) lumbar spinal cord expression levels of CD1 1 b, BDNF, TrkB and pERK did not differ significantly (P > 0.05) from the respective data for the lumbar spinal cord of vehicle-treated sham-mice (one-way ANOVA followed by Tukey's multiple comparison test).
- mice Mean ( ⁇ SEM) plasma biochemical parameters and organ weights in mice.
- ALA alpha lipoic acid
- ALT alanine transaminase
- AST aspartate transam inase
- ALP alkaline phosphatise
- EAE experimental autoimmune encephalomyelitis
- kg kilogram
- L litre
- ⁇ m icromole
- mg milligram
- U/L units per litre
- SEM standard error mean
- Veh vehicle.
- BLOQ lower limit of quantification
- CD4+ T cell-mediated neuroprotection is independent of T cell-derived BDNF in a mouse facial nerve axotomy model. Brain Behav Immun 26(6): 886- 890.
- ERK is sequentially activated in neurons, microglia, and astrocytes by spinal nerve ligation and contributes to mechanical allodynia in this neuropathic pain model. Pain 114(1 -2): 149-159.
Landscapes
- Health & Medical Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Neurosurgery (AREA)
- Engineering & Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Pain & Pain Management (AREA)
- Neurology (AREA)
- Biomedical Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Epidemiology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
Description
Claims
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2015900754 | 2015-03-04 | ||
| AU2015900754A AU2015900754A0 (en) | 2015-03-04 | Method of treatment of central neuropathic pain |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016138569A1 true WO2016138569A1 (en) | 2016-09-09 |
Family
ID=56849179
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2016/050150 Ceased WO2016138569A1 (en) | 2015-03-04 | 2016-03-04 | Method of treatment of central neuropathic pain |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2016138569A1 (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5728735A (en) * | 1989-11-09 | 1998-03-17 | Asta Pharma Aktiengesellschaft | Pharmaceutical composition containing R-α-lipoic acid or S-α-lipoic acid as active ingredient |
| WO2013168011A1 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for the treatment of chronic pain |
| WO2013168010A1 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for treatment of severe pain |
| WO2013168008A1 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for the treatment of neurological diseases |
| WO2013168004A2 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for the treatment of fibromyalgia pain |
-
2016
- 2016-03-04 WO PCT/AU2016/050150 patent/WO2016138569A1/en not_active Ceased
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5728735A (en) * | 1989-11-09 | 1998-03-17 | Asta Pharma Aktiengesellschaft | Pharmaceutical composition containing R-α-lipoic acid or S-α-lipoic acid as active ingredient |
| WO2013168011A1 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for the treatment of chronic pain |
| WO2013168010A1 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for treatment of severe pain |
| WO2013168008A1 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for the treatment of neurological diseases |
| WO2013168004A2 (en) * | 2012-05-10 | 2013-11-14 | Mahesh Kandula | Compositions and methods for the treatment of fibromyalgia pain |
Non-Patent Citations (3)
| Title |
|---|
| HUTTUNEN, K.M. ET AL.: "Prodrugs-from Serendipity to Rational Design", PHARMACOLOGICAL REVIEWS, vol. 63, 2011, pages 750 - 771, XP055073805, DOI: doi:10.1124/pr.110.003459 * |
| KHAN, N. ET AL.: "Antiallodynic effects of alpha lipoic acid in an optimized RR-EAE mouse model of MS-neuropathic pain are accompanied by attenuation of upregulated BDNF-TrkB-ERK signaling in the dorsal horn of the spinal cord", PHARMACOLOGY RESEARCH & PERSPECTIVES, vol. 3, no. e00137, 2015, pages 1 - 16 * |
| SALINTHONE, S. ET AL.: "Lipoic acid stimulates cAMP production via G-protein coupled receptor-dependent and -independent mechanisms", JOURNAL OF NUTRITIONAL BIOCHEMISTRY, vol. 22, 2011, pages 681 - 690 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | DNA damage repair promotion in colonic epithelial cells by andrographolide downregulated cGAS‒STING pathway activation and contributed to the relief of CPT-11-induced intestinal mucositis | |
| US20230277492A1 (en) | Dietary product devoid of at least two non essential amino acids | |
| Gogliotti et al. | Total RNA sequencing of Rett syndrome autopsy samples identifies the M4 muscarinic receptor as a novel therapeutic target | |
| KR20180042155A (en) | How to cure cancer | |
| CA3109391A1 (en) | Methods related to bronchial premalignant lesion severity and progression | |
| US20220107328A1 (en) | Methods of treating liver diseases | |
| EP3870609A1 (en) | Methods of treating tumor | |
| AU2014302313A1 (en) | Rett syndrome and treatments therefore | |
| JP2023156274A (en) | Uses of myostatin antagonists, combinations containing them and uses thereof | |
| EP3220908B1 (en) | Compositions and methods for treating endometriosis | |
| Ullrich et al. | Epigenetic drugs in somatostatin type 2 receptor radionuclide theranostics and radiation transcriptomics in mouse pheochromocytoma models | |
| Wolff et al. | Age-dependent effects of serotonin-1A receptor gene deletion in spatial learning abilities in mice | |
| Wang et al. | Methyl-CpG-binding domain protein 3 promotes seizures by recruiting methyltransferase DNMT1 to enhance TREM2 methylation | |
| US11266617B2 (en) | Beta-hydroxybutyrate encapsulated PLGA nanoparticle compositions | |
| EP4185862A1 (en) | Compositions and methods for diagnosing and treating a dystonia | |
| WO2016138569A1 (en) | Method of treatment of central neuropathic pain | |
| Zhai et al. | LD-110, a potent LSD1 PROTAC degrader, suppresses tumor growth by inducing ER stress and apoptosis | |
| US20250161411A1 (en) | Tumor mhc class i expression is associated with interleukin-2 response in melanoma | |
| JP2021522271A (en) | Ways to improve frailty and aging | |
| CN111139299B (en) | Application of JOSD2 protein in preparing medicine for treating malignant tumor | |
| US20230130791A1 (en) | A Combined Inhibition of EGFR and NRF2 in The Treatment of Malignant Glioma | |
| CA3146165A1 (en) | Novel anticancer drug fl118 formulation in combination with immunotherapy for treatment of human cancer | |
| TWI672319B (en) | Methods for determining, predicting and treating cancer | |
| CA3117152A1 (en) | Identification of ppm1d mutations as a novel biomarker for nampti sensitivity | |
| US20240217911A1 (en) | A hydroxycarboxylic acid for the treatment of cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 16758386 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WPC | Withdrawal of priority claims after completion of the technical preparations for international publication |
Ref document number: 2015900754 Country of ref document: AU Date of ref document: 20170830 Free format text: WITHDRAWN AFTER TECHNICAL PREPARATION FINISHED |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 16758386 Country of ref document: EP Kind code of ref document: A1 |






