WO2016132103A1 - Pronostic du cancer - Google Patents

Pronostic du cancer Download PDF

Info

Publication number
WO2016132103A1
WO2016132103A1 PCT/GB2016/050357 GB2016050357W WO2016132103A1 WO 2016132103 A1 WO2016132103 A1 WO 2016132103A1 GB 2016050357 W GB2016050357 W GB 2016050357W WO 2016132103 A1 WO2016132103 A1 WO 2016132103A1
Authority
WO
WIPO (PCT)
Prior art keywords
lyna
lynb
lyn
protein
expression
Prior art date
Application number
PCT/GB2016/050357
Other languages
English (en)
Inventor
Matthew Smalley
Giusy TORNILLO
Original Assignee
University College Cardiff Consultants Limited
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University College Cardiff Consultants Limited filed Critical University College Cardiff Consultants Limited
Publication of WO2016132103A1 publication Critical patent/WO2016132103A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/118—Prognosis of disease development
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Definitions

  • the invention relates to a prognostic method for determining at least one, or combination, of the following: the progression of breast cancer in a subject suspected or diagnosed with breast cancer and/or response to treatment of said subject to a therapeutic treatment regimen for the treatment of same; a kit of parts for use in said method; and use of said method in a treatment regimen.
  • a major problem associated with cancer for example breast cancer, is the heterogeneity of the disease and as a consequence there exists no single standardised treatment regimen and a poor understanding of determining a patient's response to a given therapy.
  • Stratified medicine approaches aim to understand and exploit tumour heterogeneity to target existing and new therapies only to those patients who will derive the most benefit.
  • Breast cancer is a disease composed of many subtypes, and can broadly be divided into 3 clinical classifications: i) Estrogen Receptor [ER]+ Progesterone Receptor [PR]+ positive disease (for which anti-hormonal agents can be given); ii) HER2 amplified disease (for which Herceptin can be given); and iii) Basal-like breast cancer (also known as triple negative breast cancer, or TNBC, as it does not express the estrogen or progesterone receptors or have high levels of the HER2 gene).
  • HER2 amplified disease for which Herceptin can be given
  • Basal-like breast cancer also known as triple negative breast cancer, or TNBC, as it does not express the estrogen or progesterone receptors or have high levels of the HER2 gene).
  • TNBC can arise both in women with no family history of the disease and in women who are carriers of the BRCA1 mutated gene. It accounts for approximately 15%- 25% of all breast cancer cases. It is a highly aggressive form of breast cancer for which there is not as yet a specific therapy designed to target weaknesses in this disease. The only treatment option available apart from surgery and radiotherapy is general chemotherapy. However, whilst some TNBC's respond well to chemotherapy, many exhibit poor responsiveness and the 5 year survival rate is only approximately 40%. There is, therefore, an unmet clinical need for a therapy which can specifically be used to treat this form of breast cancer with reduced general toxicity.
  • LynA and LynB two splice variants of Lyn exist in blood cells, LynA and LynB, which differ by the presence of a small N-terminal amino acid sequence in LynA which is thought to have a potential regulatory tyrosine phosphorylation site.
  • Lyn splice variants that show differential expression in certain breast cancer subtypes.
  • Lyn isoforms are expressed at relatively equivalent levels; however, in tumours of the TNBC aggressive cancer subtype it was unexpectedly found that the mean ratio of expression of LynA:LynB was significantly higher.
  • the finding that the LynA: LynB ratio expression can be altered in all breast cancer types can be used to determine whether an individual will respond positively to treatment with particular therapies and in assessing the efficacy of a particular cancer treatment. In this way, treatment can be stratified accordingly.
  • a prognostic method for determining the progression of breast cancer in a subject suspected of having, or diagnosed with, breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein higher levels of LynA expression or LynA protein relative to LynB is indicative of a poor prognosis in said subject.
  • said method detects LynA and LynB mRNA or cDNA.
  • said method comprises:
  • breast cancer refers to any cancer or tumour originating from breast tissue including, but not limited to, Estrogen Receptor positive disease (ER+), human epidermal growth factor receptor 2 (HER2) amplified disease; or triple negative breast cancer (TNBC).
  • Estrogen Receptor positive disease ER+
  • HER2 human epidermal growth factor receptor 2
  • TNBC triple negative breast cancer
  • TNBC refers to the breast cancer sub-group wherein cancerous cells do not express the three common receptor types (estrogen receptors, progesterone receptors, or HER2) observed in other forms of the disease and as diagnosed by conventional means known in the field.
  • said breast cancer refers to ER+ or TNBC breast cancer subtypes, and most ideally, TNBC.
  • Reference herein to biological sample refers to a biopsy sample taken from a subject who has or is suspected of having breast cancer. Ideally, the biological sample is taken from the cancerous tumour site. Thus, more ideally still the sample is isolated.
  • said biological sample is a tissue biopsy.
  • said biological sample is a fluid sample comprising cells.
  • Lyn refers to the member of the Src family of intracellular membrane-associated protein tyrosine kinases (SFK) (HGNC symbol ID :6735). As is known to those skilled in the art, Lyn has two splice variants (via exon 2) that result in generation of p53 and p56 kDa protein isoforms that differ by a 20 amino acid region in the SH4 domain (figure 5A), designated as LynA (p56) and LynB (p53).
  • SFK membrane-associated protein tyrosine kinases
  • Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
  • levels of expression of the Lyn splice variants can be achieved by numerous detection techniques such as, but not limited to, nucleic acid detection including a polymerase chain reaction [PCR] based methods, or the like.
  • PCR polymerase chain reaction
  • the detection methods described above may be qualitative and/or quantitative.
  • other conventional techniques as will be appreciated by those skilled in the art, can be used in accordance with the invention.
  • said method is a PCR based method.
  • said PCR based method is Real Time [RT] PCR.
  • RNA preferably total RNA and, more preferably still, the amount of mRNA.
  • techniques available for measuring RNA content are well known and, indeed, routinely practised by those in the clinical diagnostics field. Such techniques may include reverse transcription of RNA to produce cDNA and an optional amplification step followed by the detection of the cDNA or a product thereof.
  • the level of gene expression may be measured by real-time quantitative PCR.
  • detection is most ideally achieved using isoform specific nucleic acid probes that can specifically and accurately detect, and preferably allow quantification of the level of expression of each respective splice variant.
  • isoform specific nucleic acid probes that can specifically and accurately detect, and preferably allow quantification of the level of expression of each respective splice variant.
  • the two Lyn splice variant isoforms differ by a 20 amino acid region in the SH4 domain at least one of the probes is designed to bind with or detect the part of the nucleic acid molecule encoding same or this part of one of the Lyn proteins; thus one probe is designed to bind with or detect LynA (p56) and the other LynB (p53).
  • probe(s) describes an oligonucleotide that hybridizes under physiological or reaction conditions to LynA or LynB target cDNA or RNA.
  • probe will recognize that the exact length of the oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence. It is preferred that the probe be constructed and arranged so as to bind selectively with the target under physiological/reaction conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological/reaction conditions.
  • the probes should comprise at least 7 and more preferably, at least 15 consecutive bases which are complementary to the target. Most preferably, the probes comprise a complementary sequence of 20-30 bases.
  • said probe(s) are designed by reference to the nucleotide sequence set forth in SEQ ID NO: 1 and SEQ ID NO: 2.
  • said probe(s) comprise or consist of a nucleotide sequence and are selected from the group consisting of SEQ ID NO: 3 or SEQ ID NO: 4.
  • the detection of LynA protein and LynB protein comprises the steps:
  • said antibody detection involves use of an immunoassay, for example an ELISA.
  • the method involves assaying for the protein encoded by each of the said splice variants and so, typically, but not exclusively, involves the use of agents that bind to the relevant proteins and so identify the LynA and LynB proteins.
  • agents are for example antibodies and, most ideally, monoclonal antibodies which, advantageously, have been labelled with a suitable tag whereby the existence of the bound antibody can be determined.
  • Assay techniques for identifying proteins are well known to those skilled in the art and, indeed, used every day by workers in the field of clinical diagnostics. Such assay techniques may be applied by the skilled worker to utilise the invention.
  • the level of expression is determined having regard to a reference gene or protein (for example GAPDH) within a control sample, wherein the control sample is a sample of normal tissue, ideally normal breast tissue, more ideally still, normal tissue taken from the same breast as the cancer biopsy tissue.
  • the expression of a given splice variant is determined having regard to a reference gene or protein, wherein the reference gene or protein may be the same gene or protein or another selected gene (such as a housekeeping gene) or protein within a control sample or from the same cancer biopsy tissue sample.
  • the level of expression of the splice variants is determined having regard to an internal standard where a genetic construct, such as a plasmid, expressing a known quantity of reference gene is used.
  • said method involves the determination of LynA and LynB expression, or LynA and LynB protein level, of the sample as a ratio compared to that of normal cells or tissue. Ideally, different amounts of this ratio are correlated with known cancer cell staging techniques such that a simple in vitro assay can be used to reliably inform a clinician about, not only the existence of a cancer, but also its likely progression. In a further preferred method of the invention, increased expression of LynA or LynA protein is seen in those samples from patients with later stage tumours.
  • Reference herein to increased level of expression or protein level refers to an increased expression or protein level of the LynA isoform compared to that of the LynB isoform in said sample. In all cases the normal, increased or decreased expression was statistically relevant at the 5% level or less.
  • Lyn isoforms show differential expression in certain breast cancer subtypes.
  • Lyn isoforms are expressed at relatively equivalent levels; however, in TNBC, for example, it was unexpectedly found that the ratio of expression of LynA: LynB was significantly higher. Therefore, increased expression of the LynA isoform is indicative of a more severe form of disease with poorer overall survival.
  • LynA is expressed between 1.3-3.0 fold higher relative to LynB or Lyn A is expressed between 1.8 - 2.0 fold higher relative to LynB.
  • a method to determine if a subject suspected or diagnosed with breast cancer will or will not respond to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein determines a treatment regimen for said subject.
  • said method detects LynA and LynB mRNA or cDNA.
  • said method comprises:
  • said Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
  • the detection of LynA protein and LynB protein comprises the steps:
  • Reference herein to response to treatment refers to the determination of the likelihood that a subject will react positively to particular treatment regimen or therapeutic agent leading to an improvement in a disease symptom as ascertained by appropriate conventional techniques used by those skilled in the art such as tumour volume and/or tumour number.
  • treatment comprises administration of a therapeutic agent such as, but not limited to, anti-Lyn therapeutics including broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like.
  • a therapeutic agent such as, but not limited to, anti-Lyn therapeutics including broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like.
  • said therapeutic is an anti-Lyn specific inhibitor.
  • said therapeutic is an anti-Lyn A specific inhibitor.
  • the method to determine if a subject suspected or diagnosed with breast cancer will or will not respond to a therapeutic treatment regimen or treatment for breast cancer involves undertaking one or more of the afore methods and where LynA is over expressed or Lyn A protein is high relative to LynB administering an anti-Lyn therapeutic including a broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like, dasatinib is particularly preferred.
  • sub-groups of breast cancer with increased LynA expression have a poorer prognosis and disease outcome can be used to stratify patients accordingly to determine those likely to respond most positively to anti-Lyn therapeutics such that informed treatment decisions can be made. More preferably, as it has been determined that increased LynA expression is indicative of poorer prognosis, stratification of those patients groups most likely to respond to specific anti-Lyn A therapeutics can be made.
  • a method to determine if a subject suspected or diagnosed with breast cancer is or is not responding to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein is a measure of a response to said treatment.
  • the relative expression of LynA to LynB can be used to assess how effective a treatment regimen is working, for example, by assaying for LynA and LynB expression, or LynA and LynB protein, during the course of a given therapy to determine if elevated LynA relative to LynB has declined in response to said treatment.
  • said method determines whether said treatment regimen is inhibiting or retarding the progress of cancer and is continued or is ceased.
  • said prognostic method determines whether said treatment regimen is not inhibiting or retarding the progress of cancer wherein said treatment regimen is altered.
  • kit for performing any one or more of aforementioned methods wherein said kit comprises:
  • said anti-Lyn therapeutic is a broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like, preferably dasatinib.
  • said therapeutic is an anti-Lyn A specific inhibitor.
  • any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
  • Figure 1 Human LynA mRNA nucleotide sequence (SEQ ID NO: 1), having NCBI Reference Sequence number NM_002350.3.
  • Figure 2 Human LynB mRNA nucleotide sequence (SEQ ID NO: 2), having NCBI Reference Sequence number NM_001 11 1097.2.
  • Figure 3 Human LynA amino acid sequence (SEQ ID NO: 5), having NCBI Reference Sequence: NP_002341.1.
  • Figure 4 Human LynB amino acid sequence (SEQ ID NO: 6), having NCBI Reference Sequence: NP_001 104567.1.
  • Figure 5 A) Schematic representation of LYN isoforms. Red 'lollipops' indicate negative regulatory phosphorylation sites. Green 'lollipops' indicate activating sites. It is unknown whether or not the pY32 site is a positive or negative regulator.
  • Mammary organoids were transduced with the following combinations of lentiviral vectors: shScr- and control WPI-vectors (shScr), shLyn- and control WPI-vectors (shLyn), shLyn- and WPI-vectors carrying either a shLyn- resistant form (indicated by *) of wild-type LynA (shLyn + LynA* WT) or a kinase- dead LynA mutant (shLyn + LynA* KD) (B), shLyn- and WPI-vectors carrying a shLyn-resistant form of wt LynB (shLyn + LynB* WT) (C). Lyn protein levels were determined by Western blot 5 days after transduction. Graphs show cell viability measured by metabolic activity at day 5 of culture from three independent experiments (B, C).
  • Figure 8 Lyn kinase activity is required for growth of Brcal -tumour cells in vitro and in vivo.
  • Primary BIgCre Brca1fx/fx p53+/- mouse mammary tumour cells (#1 , #2 and #3, three distinct tumours) were seeded on Matrigel and treated with vehicle or the indicated Dasatinib concentrations for 5 days. Cell viability was assessed by metabolic activity.
  • Graph show dose response curves using a Nonlinear Regression (Curve Fit) model (A).
  • Lyn A is up-regulated in TNBC and drives migration and invasion of TNBC cells. Lyn A knock-down in MDA-MB-231 cells (left panels). Growth of control (shScr) and Lyn A-knocked-down MDA-MB-231 cells (shLyn A), as measured by metabolic activity over 4 days in adherent culture conditions (middle panel). Migration and and invasion of shScr- and shLyn A- MDA-MB-231 cells, as assessed by transwell assay. Representative images of end-point assays and quantification of results from three independent experiments are shown (right panels) (A).
  • FIG. 1 In vivo Dasatinib treatment
  • Lyn A expression Correlation of Lyn A expression and Dasatinib IC50 (Inhibitory Concentration 50) in a set of 26 human breast cancer cell lines.
  • Expression of Lyn A mRNA was extracted from Affymetrix Exon Array datasets using a probeset specific for this Lyn splicing transcript (exon 3098998).
  • Dasatinib IC50s was taken from the prior art. Pearson's correlation coefficient (r) is shown on the right.
  • cDNA from normal human breast tissue from reduction mammoplasties
  • ten TNBC and ten ER+ breast cancers was obtained from the Breast Cancer Campaign Tissue Bank. All cancers were grade 3 tumours from pre-menopausal women,
  • RT-PCR DNA synthesis was carried out using QuantiTect Reverse Transcription Kit (Quiagen) according to the manufacturer's instructions. PCR reactions were performed using GoTaq® PCR Core System reagents (Promega). The following forward (fw) and reverse (rev) primers were used:
  • hLyn (SEQ ID NO: 9) fw 5'- AAGGGAAAGACAGCTTGAGTGA -3',
  • hESA (SEQ ID NO: 11) rev: 5'- TTTGCGGACTGCACTTCAGA -3'
  • hESA (SEQ ID NO: 12) rev 5'- CCAGATCCAGTTGTTCCCCA -3';
  • hGAPDH (SEQ ID NO: 13) fw 5'- GACCACAGTCCATGCCATCA -3',
  • hGAPDH (SEQ ID NO: 14) rev 5'- GTCAAAGGTGGAGGAGTGGG -3'.
  • PCR products were separated by agarose gel (2%) electrophoresis and band intensities were quantified using ImageJ image analysis software (http://www.rsbweb.nih.gov/ij/)
  • Protein extracts were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted with antibodies to phospho-Y396 Lyn (rabbit monoclonal, clone: EP503Y; ab40660, Abeam) and Lyn (mouse monoclonal, clone: LYN-01 ; ab1890, Abeam). GAPDH or alpha-tubulin was used as loading control. Detection of the resulting immunocomplexes was performed using HRP-conjugated secondary antibodies and enhanced chemiluminescent (ECL) reagents.
  • ECL enhanced chemiluminescent
  • Single cells were prepared from the third and fourth mammary glands of 10-12 week-old virgin female FVB mice as described previously [7].
  • Tumour cells were obtained from Blg-Cre Brca1 fx/fx p53 + " mice [1] by using gentleMACS mouse tumour dissociation kit (Mylteni Biotec). Cultures were maintained at 37 °C in a 5%02 atmosphere in complete growth medium (1 : 1 DMEM:Ham's F12 medium with 10% FCS, 5 ug/ml insulin, 10 ng/ml cholera toxin and 10 ng/ml epidermal growth factor). For three dimensional cultures cells were plated onto growth factor-reduced Matrigel in complete growth medium.
  • pLKO-1 lentiviral vectors containing shRNA- targeting mouse Lyn (shl_yn#1 : TRCN0000015994 and shl_yn#2: TRCN0000235890) and pLKO-1 control vector (shScr) were purchased from Sigma. Relative titres of viral supernatants were determined by transducing NIH 3T3 cells and analysing the number of transduced cells after selection for puromycin resistance. Variants of mouse LynA and LynB cDNA resistant to knock-down by shLyn#2 were generated by site-directed mutagenesis using the following primers: shLyn#2ResStep1 (SEQ ID NO: 15) fw: 5'-
  • the resulting LynA* and LynB* mutants were subcloned into pWPI lentiviral vectors.
  • a dual vector system was generated for inducible expression of shLyn#2 in response to doxycycline.
  • shLyn#2 and shScr sequences were inserted into pSEW lentiviral vectors downstream of a Tet operator (TetO)/H1 promoter.
  • TetO Tet operator
  • TetR Tetracycline Repressor
  • Cell density in monolayer cultures was determined by absorbance measurement following fixation and staining with crystal violet. In three dimensional cultures cell growth was measured using the CellTitre Glo cell viability reagent (Promega) and the GelCount platform. Cell migration and invasion assay
  • Invasion assays were performed using 24-well Transwell inserts (Corning) coated with Matrigel (BD Biosciences). Migration assays were performed similarly without Matrigel. Briefly, cells (75.000) were resuspended in 250 ⁇ _ serum-free medium and seeded into the upper chamber. 750 ⁇ _ of medium supplemented with 10% serum was added to the lower chamber. After 20 hours, cells on the lower side of the insert were fixed, stained with crystal violet and counted under a light microscope.
  • Dasatinib monohydrate was dissolved in DMSO at 20 mg/mL and stored in aliquots at -20°C. Aliquots were thawed and diluted in 5.1 % polyethylene glycol (PEG-400) and 5.1 % Tween 80 (vehicle) before use. Mice were subjected to a single injection of Dasatinib daily. Control mice were treated with an equivalent concentration of DMSO dissolved in vehicle buffer.
  • PEG-400 polyethylene glycol
  • Tween 80 vehicle
  • LynA and LynB Two alternative splicing isoforms, LynA and LynB, are expressed in the mouse mammary epithelium
  • the LynA: LynB ratio is a potential prognostic indicator in TNBC
  • Lyn A and Lyn B were expressed in an approximate 1 : 1 ratio (figure 6D).
  • the ratio of Lyn A was significantly higher than in normal tissue (figure 6D).
  • the Lyn A: Lyn B ratio is elevated in the subset of TNBC.
  • Example 4 The LynA:LynB ratio is a predictor of response to broad spectrum Src Kinase inhibitor therapy
  • Src family kinase inhibitors in particular dasatinib, are in clinical use for treatment of cancer but have not proved successful in breast cancer. Furthermore, they are typified by broad spectrum activity, so it is not known which kinases in the family they are inhibiting. We hypothesized that inhibition of Lyn would kill breast cancer cells and that this could be achieved by either short hairpins targeting Lyn or dasatinib treatment. Indeed, we have now shown that shLyn slows growth of normal mammary epithelial cells (Figure 6A) and kills mammary tumour cells both in in vitro and in vivo growth assays ( Figure 6B and D).
  • LynA:LynB ratio may indicate the sensitivity of breast cancer cells to broad spectrum Src family kinase inhibitors in general or to specific inhibitors of Lyn kinase.
  • TNBC is a subgroup of breast cancer patients characterized by lack of expression of ER, PR or lack of amplification of HER2.
  • TNBC treatment is chemotherapy with no approved/preferred therapeutic interventions, and thus survival rates are therefore relatively poor.
  • Lyn Kinase has been implicated in various leukaemia's and solid tumours including breast cancer, however, no specific Lyn kinase inhibitors exist. Two splice variants of Lyn are known (Lyn A and B) but the exact functionality of each isoform is unknown.
  • Lyn Kinase isoforms (LynA and LynB) are expressed at a ratio 1 : 1 in normal tissue; however, there exists a statistically significant differential expression of LynA: LynB in individual's correlating with disease severity, with increased expression of LynA indicative of poorer prognosis. Therefore, the ratio of LynA: LynB represents a prognostic test for breast cancer. Further, the ratio of LynA: LynB can be used to predict response of an individual to treatment, and thus be used to stratify patients according to those most likely to respond to a particular therapy.
  • LynA kinase activity mediates pro-growth signalling downstream of c-Kit in normal mammary epithelial cells
  • Lyn is required for growth of Brcal -deficient mammary tumour cells
  • Lyn kinase inhibitor Dasatinib To assess whether the kinase activity of Lyn was responsible for its ability to drive tumour cell growth, we exposed 3D cultures of primary Brcal-tumour cells to a range of concentrations of the Lyn kinase inhibitor Dasatinib and measured their viability after 5-6 days of treatment. All the three tumour cell lines were sensitive to Dasatinib with a reduction by 50% in the overall cell viability after treatment at a Dasatinib concentration between 0.1 microM and 1 microM ( Figure 8A).
  • LynA is up-regulated in human Triple Negative Breast Cancer and drives tumour cell aggressiveness
  • shLynA cells displayed about a 60% reduction in LynA protein levels compared to control (shScr) cells, with a LynA: LynB protein ratio approximately equal to 1 ( Figure 10A).
  • LynA knock-down resulted in an overall decrease in cell proliferation and a strong reduction in cell migration and invasion in vitro.
  • Lyn kinase exists as two isoforms, LynA and LynB, which are generated by alternative splicing and differ for a 21-amino-acid (aa) insert found in the NH2-terminal unique domain of LynA.
  • aa 21-amino-acid
  • c-Kit is required for growth and survival of the cells of origin of Brcal- mutation-associated breast cancer. Oncogene. 31, 869-883.
  • SWOG 0338 A phase II trial of imatinib mesylate in combination with capecitabine in metastatic breast cancer. J Clin Oncol 24: 10529.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un procédé pronostique pour déterminer au moins un, ou une combinaison, des éléments suivants : la progression d'un cancer chez un sujet soupçonné ou diagnostiqué d'être atteint d'un cancer du sein et/ou la réponse au traitement dudit sujet à un régime de traitement thérapeutique pour le traitement de celui-ci ; un kit de pièces destiné à être utilisé dans ledit procédé ; et l'utilisation dudit procédé dans un régime de traitement.
PCT/GB2016/050357 2015-02-20 2016-02-15 Pronostic du cancer WO2016132103A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1502840.0 2015-02-20
GB201502840A GB201502840D0 (en) 2015-02-20 2015-02-20 Cancer prognostic

Publications (1)

Publication Number Publication Date
WO2016132103A1 true WO2016132103A1 (fr) 2016-08-25

Family

ID=52821908

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2016/050357 WO2016132103A1 (fr) 2015-02-20 2016-02-15 Pronostic du cancer

Country Status (2)

Country Link
GB (1) GB201502840D0 (fr)
WO (1) WO2016132103A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040058340A1 (en) * 2001-06-18 2004-03-25 Hongyue Dai Diagnosis and prognosis of breast cancer patients

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040058340A1 (en) * 2001-06-18 2004-03-25 Hongyue Dai Diagnosis and prognosis of breast cancer patients

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
D. ALVAREZ-ERRICO ET AL: "Functional Analysis of Lyn Kinase A and B Isoforms Reveals Redundant and Distinct Roles in Fc RI-Dependent Mast Cell Activation", THE JOURNAL OF IMMUNOLOGY, vol. 184, no. 9, 1 May 2010 (2010-05-01), US, pages 5000 - 5008, XP055268795, ISSN: 0022-1767, DOI: 10.4049/jimmunol.0904064 *
LUIS J. SCHWARZ ET AL: "LYN-activating mutations mediate antiestrogen resistance in estrogen receptor-positive breast cancer", JOURNAL OF CLINICAL INVESTIGATION, vol. 124, no. 12, 17 November 2014 (2014-11-17), US, pages 5490 - 5502, XP055268797, ISSN: 0021-9738, DOI: 10.1172/JCI72573 *
T L YI ET AL: "Hematopoietic cells express two forms of lyn kinase differing by 21 amino acids in the amino terminus.", MOLECULAR AND CELLULAR BIOLOGY., vol. 11, no. 5, 1 May 1991 (1991-05-01), US, pages 2391 - 2398, XP055269596, ISSN: 0270-7306, DOI: 10.1128/MCB.11.5.2391 *

Also Published As

Publication number Publication date
GB201502840D0 (en) 2015-04-08

Similar Documents

Publication Publication Date Title
Grabocka et al. Mutant KRAS enhances tumor cell fitness by upregulating stress granules
Huang et al. LncRNA PVT1 triggers Cyto-protective autophagy and promotes pancreatic ductal adenocarcinoma development via the miR-20a-5p/ULK1 Axis
Xue et al. Long noncoding RNA GAS5 inhibits tumorigenesis and enhances radiosensitivity by suppressing miR-135b expression in non-small cell lung cancer
Liao et al. BRAF-activated LncRNA functions as a tumor suppressor in papillary thyroid cancer
Zhou et al. ZEB1 enhances Warburg effect to facilitate tumorigenesis and metastasis of HCC by transcriptionally activating PFKM
Cui et al. Myeloid-derived suppressor cells enhance stemness of cancer cells by inducing microRNA101 and suppressing the corepressor CtBP2
AU2013273242B2 (en) Method for the diagnosis, prognosis and treatment of lung cancer metastasis
Wang et al. Overexpression of TREM2 enhances glioma cell proliferation and invasion: a therapeutic target in human glioma
EP3055429B1 (fr) Procede pour le pronostic et traitement du cancer metastatiques des os originant du cancer du seins
Xu et al. Overexpression of wildtype EGFR is tumorigenic and denotes a therapeutic target in non-small cell lung cancer
Jiang et al. MicroRNA-3127 promotes cell proliferation and tumorigenicity in hepatocellular carcinoma by disrupting of PI3K/AKT negative regulation
Jian et al. Interleukin 7 receptor activates PI3K/Akt/mTOR signaling pathway via downregulation of Beclin‐1 in lung cancer
WO2013134774A1 (fr) Modulation de la croissance du cancer du sein par modulation de l'activité de la xbp1
Li et al. ARID1A loss induces polymorphonuclear myeloid-derived suppressor cell chemotaxis and promotes prostate cancer progression
Mohamed et al. miR-363 confers taxane resistance in ovarian cancer by targeting the Hippo pathway member, LATS2
Zhou et al. Targeting of the deubiquitinase USP9X attenuates B-cell acute lymphoblastic leukemia cell survival and overcomes glucocorticoid resistance
JP5590693B2 (ja) がん患者の予後推定用バイオマーカー及びその利用
US20170242015A1 (en) Map3k8 as a marker for selecting a patient affected with an ovarian cancer for a treatment with a mek inhibitor
Wang et al. Long noncoding RNA LINC01703 exacerbates the malignant properties of non-small cell lung cancer by upregulating MACC1 in a microRNA-605-3p-mediated manner
EP3092492B1 (fr) Traitement de tumeurs exprimant la p53 mutante
Shu et al. LINC00494 promotes ovarian cancer development and progression by modulating NFκB1 and FBXO32
JP2013503162A (ja) 乳癌の治療を目的としたｐａｘ２ターゲティング
WO2023059801A1 (fr) Biomarqueurs de résistance à médiation egfr dans des cancers provoqués par un oncogène et méthodes de traitement, de prévention et/ou d'atténuation de cancers provoqués par un oncogène
Tabassum et al. The DEAD-box RNA helicase DDX5 (p68) and β-catenin: The crucial regulators of FOXM1 gene expression in arbitrating colorectal cancer
Qin et al. LINC01207 promotes prostate cancer progression by sponging miR‑1182 to upregulate AKT3

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16704926

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16704926

Country of ref document: EP

Kind code of ref document: A1