WO2016132103A1 - Cancer prognostic - Google Patents

Cancer prognostic Download PDF

Info

Publication number
WO2016132103A1
WO2016132103A1 PCT/GB2016/050357 GB2016050357W WO2016132103A1 WO 2016132103 A1 WO2016132103 A1 WO 2016132103A1 GB 2016050357 W GB2016050357 W GB 2016050357W WO 2016132103 A1 WO2016132103 A1 WO 2016132103A1
Authority
WO
WIPO (PCT)
Prior art keywords
lyna
lynb
lyn
protein
expression
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2016/050357
Other languages
French (fr)
Inventor
Matthew Smalley
Giusy TORNILLO
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University College Cardiff Consultants Ltd
Original Assignee
University College Cardiff Consultants Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University College Cardiff Consultants Ltd filed Critical University College Cardiff Consultants Ltd
Publication of WO2016132103A1 publication Critical patent/WO2016132103A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/106Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers

Definitions

  • the invention relates to a prognostic method for determining at least one, or combination, of the following: the progression of breast cancer in a subject suspected or diagnosed with breast cancer and/or response to treatment of said subject to a therapeutic treatment regimen for the treatment of same; a kit of parts for use in said method; and use of said method in a treatment regimen.
  • a major problem associated with cancer for example breast cancer, is the heterogeneity of the disease and as a consequence there exists no single standardised treatment regimen and a poor understanding of determining a patient's response to a given therapy.
  • Stratified medicine approaches aim to understand and exploit tumour heterogeneity to target existing and new therapies only to those patients who will derive the most benefit.
  • Breast cancer is a disease composed of many subtypes, and can broadly be divided into 3 clinical classifications: i) Estrogen Receptor [ER]+ Progesterone Receptor [PR]+ positive disease (for which anti-hormonal agents can be given); ii) HER2 amplified disease (for which Herceptin can be given); and iii) Basal-like breast cancer (also known as triple negative breast cancer, or TNBC, as it does not express the estrogen or progesterone receptors or have high levels of the HER2 gene).
  • HER2 amplified disease for which Herceptin can be given
  • Basal-like breast cancer also known as triple negative breast cancer, or TNBC, as it does not express the estrogen or progesterone receptors or have high levels of the HER2 gene).
  • TNBC can arise both in women with no family history of the disease and in women who are carriers of the BRCA1 mutated gene. It accounts for approximately 15%- 25% of all breast cancer cases. It is a highly aggressive form of breast cancer for which there is not as yet a specific therapy designed to target weaknesses in this disease. The only treatment option available apart from surgery and radiotherapy is general chemotherapy. However, whilst some TNBC's respond well to chemotherapy, many exhibit poor responsiveness and the 5 year survival rate is only approximately 40%. There is, therefore, an unmet clinical need for a therapy which can specifically be used to treat this form of breast cancer with reduced general toxicity.
  • LynA and LynB two splice variants of Lyn exist in blood cells, LynA and LynB, which differ by the presence of a small N-terminal amino acid sequence in LynA which is thought to have a potential regulatory tyrosine phosphorylation site.
  • Lyn splice variants that show differential expression in certain breast cancer subtypes.
  • Lyn isoforms are expressed at relatively equivalent levels; however, in tumours of the TNBC aggressive cancer subtype it was unexpectedly found that the mean ratio of expression of LynA:LynB was significantly higher.
  • the finding that the LynA: LynB ratio expression can be altered in all breast cancer types can be used to determine whether an individual will respond positively to treatment with particular therapies and in assessing the efficacy of a particular cancer treatment. In this way, treatment can be stratified accordingly.
  • a prognostic method for determining the progression of breast cancer in a subject suspected of having, or diagnosed with, breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein higher levels of LynA expression or LynA protein relative to LynB is indicative of a poor prognosis in said subject.
  • said method detects LynA and LynB mRNA or cDNA.
  • said method comprises:
  • breast cancer refers to any cancer or tumour originating from breast tissue including, but not limited to, Estrogen Receptor positive disease (ER+), human epidermal growth factor receptor 2 (HER2) amplified disease; or triple negative breast cancer (TNBC).
  • Estrogen Receptor positive disease ER+
  • HER2 human epidermal growth factor receptor 2
  • TNBC triple negative breast cancer
  • TNBC refers to the breast cancer sub-group wherein cancerous cells do not express the three common receptor types (estrogen receptors, progesterone receptors, or HER2) observed in other forms of the disease and as diagnosed by conventional means known in the field.
  • said breast cancer refers to ER+ or TNBC breast cancer subtypes, and most ideally, TNBC.
  • Reference herein to biological sample refers to a biopsy sample taken from a subject who has or is suspected of having breast cancer. Ideally, the biological sample is taken from the cancerous tumour site. Thus, more ideally still the sample is isolated.
  • said biological sample is a tissue biopsy.
  • said biological sample is a fluid sample comprising cells.
  • Lyn refers to the member of the Src family of intracellular membrane-associated protein tyrosine kinases (SFK) (HGNC symbol ID :6735). As is known to those skilled in the art, Lyn has two splice variants (via exon 2) that result in generation of p53 and p56 kDa protein isoforms that differ by a 20 amino acid region in the SH4 domain (figure 5A), designated as LynA (p56) and LynB (p53).
  • SFK membrane-associated protein tyrosine kinases
  • Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
  • levels of expression of the Lyn splice variants can be achieved by numerous detection techniques such as, but not limited to, nucleic acid detection including a polymerase chain reaction [PCR] based methods, or the like.
  • PCR polymerase chain reaction
  • the detection methods described above may be qualitative and/or quantitative.
  • other conventional techniques as will be appreciated by those skilled in the art, can be used in accordance with the invention.
  • said method is a PCR based method.
  • said PCR based method is Real Time [RT] PCR.
  • RNA preferably total RNA and, more preferably still, the amount of mRNA.
  • techniques available for measuring RNA content are well known and, indeed, routinely practised by those in the clinical diagnostics field. Such techniques may include reverse transcription of RNA to produce cDNA and an optional amplification step followed by the detection of the cDNA or a product thereof.
  • the level of gene expression may be measured by real-time quantitative PCR.
  • detection is most ideally achieved using isoform specific nucleic acid probes that can specifically and accurately detect, and preferably allow quantification of the level of expression of each respective splice variant.
  • isoform specific nucleic acid probes that can specifically and accurately detect, and preferably allow quantification of the level of expression of each respective splice variant.
  • the two Lyn splice variant isoforms differ by a 20 amino acid region in the SH4 domain at least one of the probes is designed to bind with or detect the part of the nucleic acid molecule encoding same or this part of one of the Lyn proteins; thus one probe is designed to bind with or detect LynA (p56) and the other LynB (p53).
  • probe(s) describes an oligonucleotide that hybridizes under physiological or reaction conditions to LynA or LynB target cDNA or RNA.
  • probe will recognize that the exact length of the oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence. It is preferred that the probe be constructed and arranged so as to bind selectively with the target under physiological/reaction conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological/reaction conditions.
  • the probes should comprise at least 7 and more preferably, at least 15 consecutive bases which are complementary to the target. Most preferably, the probes comprise a complementary sequence of 20-30 bases.
  • said probe(s) are designed by reference to the nucleotide sequence set forth in SEQ ID NO: 1 and SEQ ID NO: 2.
  • said probe(s) comprise or consist of a nucleotide sequence and are selected from the group consisting of SEQ ID NO: 3 or SEQ ID NO: 4.
  • the detection of LynA protein and LynB protein comprises the steps:
  • said antibody detection involves use of an immunoassay, for example an ELISA.
  • the method involves assaying for the protein encoded by each of the said splice variants and so, typically, but not exclusively, involves the use of agents that bind to the relevant proteins and so identify the LynA and LynB proteins.
  • agents are for example antibodies and, most ideally, monoclonal antibodies which, advantageously, have been labelled with a suitable tag whereby the existence of the bound antibody can be determined.
  • Assay techniques for identifying proteins are well known to those skilled in the art and, indeed, used every day by workers in the field of clinical diagnostics. Such assay techniques may be applied by the skilled worker to utilise the invention.
  • the level of expression is determined having regard to a reference gene or protein (for example GAPDH) within a control sample, wherein the control sample is a sample of normal tissue, ideally normal breast tissue, more ideally still, normal tissue taken from the same breast as the cancer biopsy tissue.
  • the expression of a given splice variant is determined having regard to a reference gene or protein, wherein the reference gene or protein may be the same gene or protein or another selected gene (such as a housekeeping gene) or protein within a control sample or from the same cancer biopsy tissue sample.
  • the level of expression of the splice variants is determined having regard to an internal standard where a genetic construct, such as a plasmid, expressing a known quantity of reference gene is used.
  • said method involves the determination of LynA and LynB expression, or LynA and LynB protein level, of the sample as a ratio compared to that of normal cells or tissue. Ideally, different amounts of this ratio are correlated with known cancer cell staging techniques such that a simple in vitro assay can be used to reliably inform a clinician about, not only the existence of a cancer, but also its likely progression. In a further preferred method of the invention, increased expression of LynA or LynA protein is seen in those samples from patients with later stage tumours.
  • Reference herein to increased level of expression or protein level refers to an increased expression or protein level of the LynA isoform compared to that of the LynB isoform in said sample. In all cases the normal, increased or decreased expression was statistically relevant at the 5% level or less.
  • Lyn isoforms show differential expression in certain breast cancer subtypes.
  • Lyn isoforms are expressed at relatively equivalent levels; however, in TNBC, for example, it was unexpectedly found that the ratio of expression of LynA: LynB was significantly higher. Therefore, increased expression of the LynA isoform is indicative of a more severe form of disease with poorer overall survival.
  • LynA is expressed between 1.3-3.0 fold higher relative to LynB or Lyn A is expressed between 1.8 - 2.0 fold higher relative to LynB.
  • a method to determine if a subject suspected or diagnosed with breast cancer will or will not respond to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein determines a treatment regimen for said subject.
  • said method detects LynA and LynB mRNA or cDNA.
  • said method comprises:
  • said Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
  • the detection of LynA protein and LynB protein comprises the steps:
  • Reference herein to response to treatment refers to the determination of the likelihood that a subject will react positively to particular treatment regimen or therapeutic agent leading to an improvement in a disease symptom as ascertained by appropriate conventional techniques used by those skilled in the art such as tumour volume and/or tumour number.
  • treatment comprises administration of a therapeutic agent such as, but not limited to, anti-Lyn therapeutics including broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like.
  • a therapeutic agent such as, but not limited to, anti-Lyn therapeutics including broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like.
  • said therapeutic is an anti-Lyn specific inhibitor.
  • said therapeutic is an anti-Lyn A specific inhibitor.
  • the method to determine if a subject suspected or diagnosed with breast cancer will or will not respond to a therapeutic treatment regimen or treatment for breast cancer involves undertaking one or more of the afore methods and where LynA is over expressed or Lyn A protein is high relative to LynB administering an anti-Lyn therapeutic including a broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like, dasatinib is particularly preferred.
  • sub-groups of breast cancer with increased LynA expression have a poorer prognosis and disease outcome can be used to stratify patients accordingly to determine those likely to respond most positively to anti-Lyn therapeutics such that informed treatment decisions can be made. More preferably, as it has been determined that increased LynA expression is indicative of poorer prognosis, stratification of those patients groups most likely to respond to specific anti-Lyn A therapeutics can be made.
  • a method to determine if a subject suspected or diagnosed with breast cancer is or is not responding to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein is a measure of a response to said treatment.
  • the relative expression of LynA to LynB can be used to assess how effective a treatment regimen is working, for example, by assaying for LynA and LynB expression, or LynA and LynB protein, during the course of a given therapy to determine if elevated LynA relative to LynB has declined in response to said treatment.
  • said method determines whether said treatment regimen is inhibiting or retarding the progress of cancer and is continued or is ceased.
  • said prognostic method determines whether said treatment regimen is not inhibiting or retarding the progress of cancer wherein said treatment regimen is altered.
  • kit for performing any one or more of aforementioned methods wherein said kit comprises:
  • said anti-Lyn therapeutic is a broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like, preferably dasatinib.
  • said therapeutic is an anti-Lyn A specific inhibitor.
  • any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
  • Figure 1 Human LynA mRNA nucleotide sequence (SEQ ID NO: 1), having NCBI Reference Sequence number NM_002350.3.
  • Figure 2 Human LynB mRNA nucleotide sequence (SEQ ID NO: 2), having NCBI Reference Sequence number NM_001 11 1097.2.
  • Figure 3 Human LynA amino acid sequence (SEQ ID NO: 5), having NCBI Reference Sequence: NP_002341.1.
  • Figure 4 Human LynB amino acid sequence (SEQ ID NO: 6), having NCBI Reference Sequence: NP_001 104567.1.
  • Figure 5 A) Schematic representation of LYN isoforms. Red 'lollipops' indicate negative regulatory phosphorylation sites. Green 'lollipops' indicate activating sites. It is unknown whether or not the pY32 site is a positive or negative regulator.
  • Mammary organoids were transduced with the following combinations of lentiviral vectors: shScr- and control WPI-vectors (shScr), shLyn- and control WPI-vectors (shLyn), shLyn- and WPI-vectors carrying either a shLyn- resistant form (indicated by *) of wild-type LynA (shLyn + LynA* WT) or a kinase- dead LynA mutant (shLyn + LynA* KD) (B), shLyn- and WPI-vectors carrying a shLyn-resistant form of wt LynB (shLyn + LynB* WT) (C). Lyn protein levels were determined by Western blot 5 days after transduction. Graphs show cell viability measured by metabolic activity at day 5 of culture from three independent experiments (B, C).
  • Figure 8 Lyn kinase activity is required for growth of Brcal -tumour cells in vitro and in vivo.
  • Primary BIgCre Brca1fx/fx p53+/- mouse mammary tumour cells (#1 , #2 and #3, three distinct tumours) were seeded on Matrigel and treated with vehicle or the indicated Dasatinib concentrations for 5 days. Cell viability was assessed by metabolic activity.
  • Graph show dose response curves using a Nonlinear Regression (Curve Fit) model (A).
  • Lyn A is up-regulated in TNBC and drives migration and invasion of TNBC cells. Lyn A knock-down in MDA-MB-231 cells (left panels). Growth of control (shScr) and Lyn A-knocked-down MDA-MB-231 cells (shLyn A), as measured by metabolic activity over 4 days in adherent culture conditions (middle panel). Migration and and invasion of shScr- and shLyn A- MDA-MB-231 cells, as assessed by transwell assay. Representative images of end-point assays and quantification of results from three independent experiments are shown (right panels) (A).
  • FIG. 1 In vivo Dasatinib treatment
  • Lyn A expression Correlation of Lyn A expression and Dasatinib IC50 (Inhibitory Concentration 50) in a set of 26 human breast cancer cell lines.
  • Expression of Lyn A mRNA was extracted from Affymetrix Exon Array datasets using a probeset specific for this Lyn splicing transcript (exon 3098998).
  • Dasatinib IC50s was taken from the prior art. Pearson's correlation coefficient (r) is shown on the right.
  • cDNA from normal human breast tissue from reduction mammoplasties
  • ten TNBC and ten ER+ breast cancers was obtained from the Breast Cancer Campaign Tissue Bank. All cancers were grade 3 tumours from pre-menopausal women,
  • RT-PCR DNA synthesis was carried out using QuantiTect Reverse Transcription Kit (Quiagen) according to the manufacturer's instructions. PCR reactions were performed using GoTaq® PCR Core System reagents (Promega). The following forward (fw) and reverse (rev) primers were used:
  • hLyn (SEQ ID NO: 9) fw 5'- AAGGGAAAGACAGCTTGAGTGA -3',
  • hESA (SEQ ID NO: 11) rev: 5'- TTTGCGGACTGCACTTCAGA -3'
  • hESA (SEQ ID NO: 12) rev 5'- CCAGATCCAGTTGTTCCCCA -3';
  • hGAPDH (SEQ ID NO: 13) fw 5'- GACCACAGTCCATGCCATCA -3',
  • hGAPDH (SEQ ID NO: 14) rev 5'- GTCAAAGGTGGAGGAGTGGG -3'.
  • PCR products were separated by agarose gel (2%) electrophoresis and band intensities were quantified using ImageJ image analysis software (http://www.rsbweb.nih.gov/ij/)
  • Protein extracts were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted with antibodies to phospho-Y396 Lyn (rabbit monoclonal, clone: EP503Y; ab40660, Abeam) and Lyn (mouse monoclonal, clone: LYN-01 ; ab1890, Abeam). GAPDH or alpha-tubulin was used as loading control. Detection of the resulting immunocomplexes was performed using HRP-conjugated secondary antibodies and enhanced chemiluminescent (ECL) reagents.
  • ECL enhanced chemiluminescent
  • Single cells were prepared from the third and fourth mammary glands of 10-12 week-old virgin female FVB mice as described previously [7].
  • Tumour cells were obtained from Blg-Cre Brca1 fx/fx p53 + " mice [1] by using gentleMACS mouse tumour dissociation kit (Mylteni Biotec). Cultures were maintained at 37 °C in a 5%02 atmosphere in complete growth medium (1 : 1 DMEM:Ham's F12 medium with 10% FCS, 5 ug/ml insulin, 10 ng/ml cholera toxin and 10 ng/ml epidermal growth factor). For three dimensional cultures cells were plated onto growth factor-reduced Matrigel in complete growth medium.
  • pLKO-1 lentiviral vectors containing shRNA- targeting mouse Lyn (shl_yn#1 : TRCN0000015994 and shl_yn#2: TRCN0000235890) and pLKO-1 control vector (shScr) were purchased from Sigma. Relative titres of viral supernatants were determined by transducing NIH 3T3 cells and analysing the number of transduced cells after selection for puromycin resistance. Variants of mouse LynA and LynB cDNA resistant to knock-down by shLyn#2 were generated by site-directed mutagenesis using the following primers: shLyn#2ResStep1 (SEQ ID NO: 15) fw: 5'-
  • the resulting LynA* and LynB* mutants were subcloned into pWPI lentiviral vectors.
  • a dual vector system was generated for inducible expression of shLyn#2 in response to doxycycline.
  • shLyn#2 and shScr sequences were inserted into pSEW lentiviral vectors downstream of a Tet operator (TetO)/H1 promoter.
  • TetO Tet operator
  • TetR Tetracycline Repressor
  • Cell density in monolayer cultures was determined by absorbance measurement following fixation and staining with crystal violet. In three dimensional cultures cell growth was measured using the CellTitre Glo cell viability reagent (Promega) and the GelCount platform. Cell migration and invasion assay
  • Invasion assays were performed using 24-well Transwell inserts (Corning) coated with Matrigel (BD Biosciences). Migration assays were performed similarly without Matrigel. Briefly, cells (75.000) were resuspended in 250 ⁇ _ serum-free medium and seeded into the upper chamber. 750 ⁇ _ of medium supplemented with 10% serum was added to the lower chamber. After 20 hours, cells on the lower side of the insert were fixed, stained with crystal violet and counted under a light microscope.
  • Dasatinib monohydrate was dissolved in DMSO at 20 mg/mL and stored in aliquots at -20°C. Aliquots were thawed and diluted in 5.1 % polyethylene glycol (PEG-400) and 5.1 % Tween 80 (vehicle) before use. Mice were subjected to a single injection of Dasatinib daily. Control mice were treated with an equivalent concentration of DMSO dissolved in vehicle buffer.
  • PEG-400 polyethylene glycol
  • Tween 80 vehicle
  • LynA and LynB Two alternative splicing isoforms, LynA and LynB, are expressed in the mouse mammary epithelium
  • the LynA: LynB ratio is a potential prognostic indicator in TNBC
  • Lyn A and Lyn B were expressed in an approximate 1 : 1 ratio (figure 6D).
  • the ratio of Lyn A was significantly higher than in normal tissue (figure 6D).
  • the Lyn A: Lyn B ratio is elevated in the subset of TNBC.
  • Example 4 The LynA:LynB ratio is a predictor of response to broad spectrum Src Kinase inhibitor therapy
  • Src family kinase inhibitors in particular dasatinib, are in clinical use for treatment of cancer but have not proved successful in breast cancer. Furthermore, they are typified by broad spectrum activity, so it is not known which kinases in the family they are inhibiting. We hypothesized that inhibition of Lyn would kill breast cancer cells and that this could be achieved by either short hairpins targeting Lyn or dasatinib treatment. Indeed, we have now shown that shLyn slows growth of normal mammary epithelial cells (Figure 6A) and kills mammary tumour cells both in in vitro and in vivo growth assays ( Figure 6B and D).
  • LynA:LynB ratio may indicate the sensitivity of breast cancer cells to broad spectrum Src family kinase inhibitors in general or to specific inhibitors of Lyn kinase.
  • TNBC is a subgroup of breast cancer patients characterized by lack of expression of ER, PR or lack of amplification of HER2.
  • TNBC treatment is chemotherapy with no approved/preferred therapeutic interventions, and thus survival rates are therefore relatively poor.
  • Lyn Kinase has been implicated in various leukaemia's and solid tumours including breast cancer, however, no specific Lyn kinase inhibitors exist. Two splice variants of Lyn are known (Lyn A and B) but the exact functionality of each isoform is unknown.
  • Lyn Kinase isoforms (LynA and LynB) are expressed at a ratio 1 : 1 in normal tissue; however, there exists a statistically significant differential expression of LynA: LynB in individual's correlating with disease severity, with increased expression of LynA indicative of poorer prognosis. Therefore, the ratio of LynA: LynB represents a prognostic test for breast cancer. Further, the ratio of LynA: LynB can be used to predict response of an individual to treatment, and thus be used to stratify patients according to those most likely to respond to a particular therapy.
  • LynA kinase activity mediates pro-growth signalling downstream of c-Kit in normal mammary epithelial cells
  • Lyn is required for growth of Brcal -deficient mammary tumour cells
  • Lyn kinase inhibitor Dasatinib To assess whether the kinase activity of Lyn was responsible for its ability to drive tumour cell growth, we exposed 3D cultures of primary Brcal-tumour cells to a range of concentrations of the Lyn kinase inhibitor Dasatinib and measured their viability after 5-6 days of treatment. All the three tumour cell lines were sensitive to Dasatinib with a reduction by 50% in the overall cell viability after treatment at a Dasatinib concentration between 0.1 microM and 1 microM ( Figure 8A).
  • LynA is up-regulated in human Triple Negative Breast Cancer and drives tumour cell aggressiveness
  • shLynA cells displayed about a 60% reduction in LynA protein levels compared to control (shScr) cells, with a LynA: LynB protein ratio approximately equal to 1 ( Figure 10A).
  • LynA knock-down resulted in an overall decrease in cell proliferation and a strong reduction in cell migration and invasion in vitro.
  • Lyn kinase exists as two isoforms, LynA and LynB, which are generated by alternative splicing and differ for a 21-amino-acid (aa) insert found in the NH2-terminal unique domain of LynA.
  • aa 21-amino-acid
  • c-Kit is required for growth and survival of the cells of origin of Brcal- mutation-associated breast cancer. Oncogene. 31, 869-883.
  • SWOG 0338 A phase II trial of imatinib mesylate in combination with capecitabine in metastatic breast cancer. J Clin Oncol 24: 10529.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biophysics (AREA)
  • Oncology (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

The invention relates to a prognostic method for determining at least one, or combination, of the following: the progression of cancer in a subject suspected or diagnosed with breast cancer and/or response to treatment of said subject to a therapeutic treatment regimen for the treatment of the same; a kit of parts for use in said method; and use of said method in a treatment regimen.

Description

Cancer Prognostic
Field of the Invention The invention relates to a prognostic method for determining at least one, or combination, of the following: the progression of breast cancer in a subject suspected or diagnosed with breast cancer and/or response to treatment of said subject to a therapeutic treatment regimen for the treatment of same; a kit of parts for use in said method; and use of said method in a treatment regimen.
Background of the Invention
A major problem associated with cancer, for example breast cancer, is the heterogeneity of the disease and as a consequence there exists no single standardised treatment regimen and a poor understanding of determining a patient's response to a given therapy. Stratified medicine approaches aim to understand and exploit tumour heterogeneity to target existing and new therapies only to those patients who will derive the most benefit. Breast cancer is a disease composed of many subtypes, and can broadly be divided into 3 clinical classifications: i) Estrogen Receptor [ER]+ Progesterone Receptor [PR]+ positive disease (for which anti-hormonal agents can be given); ii) HER2 amplified disease (for which Herceptin can be given); and iii) Basal-like breast cancer (also known as triple negative breast cancer, or TNBC, as it does not express the estrogen or progesterone receptors or have high levels of the HER2 gene).
TNBC can arise both in women with no family history of the disease and in women who are carriers of the BRCA1 mutated gene. It accounts for approximately 15%- 25% of all breast cancer cases. It is a highly aggressive form of breast cancer for which there is not as yet a specific therapy designed to target weaknesses in this disease. The only treatment option available apart from surgery and radiotherapy is general chemotherapy. However, whilst some TNBC's respond well to chemotherapy, many exhibit poor responsiveness and the 5 year survival rate is only approximately 40%. There is, therefore, an unmet clinical need for a therapy which can specifically be used to treat this form of breast cancer with reduced general toxicity.
The transformation of different breast stem and progenitor cell types is a key contributor to breast cancer heterogeneity. Using a comparative analysis of Brcal loss-of-function mouse mammary tumours arising in defined cell populations, we have demonstrated that the most likely cells of origin of human basal-like BRCA1 breast cancers (and indeed of sporadic non-BRCA1 basal-like breast cancers) are luminal ER- progenitor cells.
Molecular analysis demonstrated that both the transmembrane receptor tyrosine kinase, c-Kit and the intracellular non-receptor Src-family tyrosine kinase (SFK), Lyn (a downstream transducer of c-Kit signalling in haematopoietic cells), were highly expressed in Brcal mouse tumours and their luminal ER- progenitors of origin [1 ,2,3]. There is no such correlation of expression between Kit and other SFKs, supporting a role for Lyn in transducing c-Kit signalling in the normal mammary epithelium. Analysis of human breast cancers demonstrated that Lyn is also highly expressed in sporadic human basal-like breast cancers.
Analysis of c-Kit function in normal mammary progenitors demonstrated that its knockdown resulted in apoptosis of these cells. However, anti-c-KIT therapy has had limited success in human breast cancer treatment [4-6], suggesting that in transformed mammary cells the c-Kit survival signalling network may be activated downstream of the receptor, possibly by deregulated Lyn activity. Recent unpublished findings in our laboratory support a role for Lyn downstream of c-Kit, suggesting that Lyn activity does indeed become deregulated in breast cancer cells and also suggest a link between Brcal loss of function and up-regulation of Lyn function.
It has previously been reported that two splice variants of Lyn exist in blood cells, LynA and LynB, which differ by the presence of a small N-terminal amino acid sequence in LynA which is thought to have a potential regulatory tyrosine phosphorylation site. However, little is known concerning the significance and expression of these splice variants and their potential importance in disease. This disclosure relates to Lyn splice variants that show differential expression in certain breast cancer subtypes. In particular, in normal breast tissue Lyn isoforms are expressed at relatively equivalent levels; however, in tumours of the TNBC aggressive cancer subtype it was unexpectedly found that the mean ratio of expression of LynA:LynB was significantly higher. In contrast, this significant differential expression was not observed in ER+ positive breast tissue (although certain samples examined did have a high LynA:LynB ratio). Furthermore, in TNBC there was an association of a high LynA:LynB ratio with a rapid progression to metastatic disease, and a low LynA:LynB ratio with a slow progression. There was no such association in ER+ cancer. Therefore, these findings show that LynA: LynB ratio is prognostic in TNBC, with higher LynA expression attributed to poorer prognosis forming the basis of a prognostic test. Further, the finding that the LynA: LynB ratio expression can be altered in all breast cancer types can be used to determine whether an individual will respond positively to treatment with particular therapies and in assessing the efficacy of a particular cancer treatment. In this way, treatment can be stratified accordingly.
Statements of Invention
According to an aspect of the invention there is provided a prognostic method for determining the progression of breast cancer in a subject suspected of having, or diagnosed with, breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein higher levels of LynA expression or LynA protein relative to LynB is indicative of a poor prognosis in said subject.
In a preferred method of the invention said method detects LynA and LynB mRNA or cDNA. In a preferred method of the invention said method comprises:
i) providing a biological sample taken from a subject to be analyzed; ii) forming a reaction mixture comprising the biological sample and one or more nucleic acid probes complementary to all or part of the nucleotide encoding LynA and LynB;
iii) providing conditions to detect, or optionally amplify, a nucleic acid molecule encoding LynA and LynB in said biological sample;
iv) quantifying the level of expression of LynA and LynB in said biological sample and determining the level of expression of LynA relative to that of LynB wherein greater than a 1-fold increase in LynA expression relative to Lyn B indicates a poor prognosis for said subject. Reference herein to breast cancer refers to any cancer or tumour originating from breast tissue including, but not limited to, Estrogen Receptor positive disease (ER+), human epidermal growth factor receptor 2 (HER2) amplified disease; or triple negative breast cancer (TNBC). As is known to those skilled in the art, TNBC refers to the breast cancer sub-group wherein cancerous cells do not express the three common receptor types (estrogen receptors, progesterone receptors, or HER2) observed in other forms of the disease and as diagnosed by conventional means known in the field.
In a preferred method of the invention, said breast cancer refers to ER+ or TNBC breast cancer subtypes, and most ideally, TNBC.
Reference herein to biological sample refers to a biopsy sample taken from a subject who has or is suspected of having breast cancer. Ideally, the biological sample is taken from the cancerous tumour site. Thus, more ideally still the sample is isolated.
In a further preferred method of the invention said biological sample is a tissue biopsy. In a further preferred method of the invention said biological sample is a fluid sample comprising cells.
Reference herein to Lyn refers to the member of the Src family of intracellular membrane-associated protein tyrosine kinases (SFK) (HGNC symbol ID :6735). As is known to those skilled in the art, Lyn has two splice variants (via exon 2) that result in generation of p53 and p56 kDa protein isoforms that differ by a 20 amino acid region in the SH4 domain (figure 5A), designated as LynA (p56) and LynB (p53).
In a preferred method of the invention Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
As will be appreciated by those skilled in the art, levels of expression of the Lyn splice variants can be achieved by numerous detection techniques such as, but not limited to, nucleic acid detection including a polymerase chain reaction [PCR] based methods, or the like. The detection methods described above may be qualitative and/or quantitative. However, other conventional techniques, as will be appreciated by those skilled in the art, can be used in accordance with the invention.
In a preferred method of the invention said method is a PCR based method.
In a preferred method of the invention said PCR based method is Real Time [RT] PCR.
Ideally, the sample of tissue that is examined is assayed for the presence of RNA, preferably total RNA and, more preferably still, the amount of mRNA. It will be apparent to those skilled in the art that techniques available for measuring RNA content are well known and, indeed, routinely practised by those in the clinical diagnostics field. Such techniques may include reverse transcription of RNA to produce cDNA and an optional amplification step followed by the detection of the cDNA or a product thereof. In an alternative embodiment of the invention the level of gene expression may be measured by real-time quantitative PCR.
In a preferred embodiment, as will be appreciated by those skilled in the art, detection is most ideally achieved using isoform specific nucleic acid probes that can specifically and accurately detect, and preferably allow quantification of the level of expression of each respective splice variant. Given the two Lyn splice variant isoforms differ by a 20 amino acid region in the SH4 domain at least one of the probes is designed to bind with or detect the part of the nucleic acid molecule encoding same or this part of one of the Lyn proteins; thus one probe is designed to bind with or detect LynA (p56) and the other LynB (p53).
As used herein, the term "probe(s)" describes an oligonucleotide that hybridizes under physiological or reaction conditions to LynA or LynB target cDNA or RNA. Those skilled in the art will recognize that the exact length of the oligonucleotide and its degree of complementarity with its target will depend upon the specific target selected, including the sequence of the target and the particular bases which comprise that sequence. It is preferred that the probe be constructed and arranged so as to bind selectively with the target under physiological/reaction conditions, i.e., to hybridize substantially more to the target sequence than to any other sequence in the target cell under physiological/reaction conditions. In order to be sufficiently selective and potent the probes should comprise at least 7 and more preferably, at least 15 consecutive bases which are complementary to the target. Most preferably, the probes comprise a complementary sequence of 20-30 bases. In a preferred method of the invention said probe(s) are designed by reference to the nucleotide sequence set forth in SEQ ID NO: 1 and SEQ ID NO: 2. Preferably, said probe(s) comprise or consist of a nucleotide sequence and are selected from the group consisting of SEQ ID NO: 3 or SEQ ID NO: 4.
In an alternative preferred method of the invention the detection of LynA protein and LynB protein comprises the steps:
i) providing a biological sample from a subject to be analyzed; ii) forming a preparation comprising said sample and antibodies, that specifically bind polypeptides in said sample wherein said polypeptides comprise the amino acid sequence set forth in SEQ ID NO: 5 and SEQ ID NO: 6 to form antibody/polypeptide complexes;
detecting the complexes;
comparing the level of LynA protein relative to LynB protein wherein greater than a 1-fold increase in LynA protein relative to Lyn B protein indicates a poor prognosis for said subject.
In a preferred method of the invention said antibody detection involves use of an immunoassay, for example an ELISA.
In this alternative embodiment of the invention the method involves assaying for the protein encoded by each of the said splice variants and so, typically, but not exclusively, involves the use of agents that bind to the relevant proteins and so identify the LynA and LynB proteins. Common agents are for example antibodies and, most ideally, monoclonal antibodies which, advantageously, have been labelled with a suitable tag whereby the existence of the bound antibody can be determined. Assay techniques for identifying proteins are well known to those skilled in the art and, indeed, used every day by workers in the field of clinical diagnostics. Such assay techniques may be applied by the skilled worker to utilise the invention.
In further preferred methods of working the invention the level of expression is determined having regard to a reference gene or protein (for example GAPDH) within a control sample, wherein the control sample is a sample of normal tissue, ideally normal breast tissue, more ideally still, normal tissue taken from the same breast as the cancer biopsy tissue. Alternatively, the expression of a given splice variant is determined having regard to a reference gene or protein, wherein the reference gene or protein may be the same gene or protein or another selected gene (such as a housekeeping gene) or protein within a control sample or from the same cancer biopsy tissue sample. Alternatively still, the level of expression of the splice variants is determined having regard to an internal standard where a genetic construct, such as a plasmid, expressing a known quantity of reference gene is used.
In a preferred method of the invention said method involves the determination of LynA and LynB expression, or LynA and LynB protein level, of the sample as a ratio compared to that of normal cells or tissue. Ideally, different amounts of this ratio are correlated with known cancer cell staging techniques such that a simple in vitro assay can be used to reliably inform a clinician about, not only the existence of a cancer, but also its likely progression. In a further preferred method of the invention, increased expression of LynA or LynA protein is seen in those samples from patients with later stage tumours.
Reference herein to increased level of expression or protein level refers to an increased expression or protein level of the LynA isoform compared to that of the LynB isoform in said sample. In all cases the normal, increased or decreased expression was statistically relevant at the 5% level or less.
We have unexpectedly found that Lyn isoforms show differential expression in certain breast cancer subtypes. In particular, in normal tissue Lyn isoforms are expressed at relatively equivalent levels; however, in TNBC, for example, it was unexpectedly found that the ratio of expression of LynA: LynB was significantly higher. Therefore, increased expression of the LynA isoform is indicative of a more severe form of disease with poorer overall survival. In a preferred embodiment of the invention, LynA is expressed between 1.3-3.0 fold higher relative to LynB or Lyn A is expressed between 1.8 - 2.0 fold higher relative to LynB. According to a further aspect of the invention, there is provided a method to determine if a subject suspected or diagnosed with breast cancer will or will not respond to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein determines a treatment regimen for said subject.
In a preferred embodiment of this aspect of the invention said method detects LynA and LynB mRNA or cDNA.
In a preferred method of this aspect of invention said method comprises:
i) providing a biological sample taken from a subject to be analyzed; ii) forming a reaction comprising the biological sample and one or more nucleic acid probes complementary to all or part of the nucleotide encoding LynA and LynB;
iii) providing conditions to detect, or optionally amplify, a nucleic acid molecule encoding LynA and LynB in said biological sample;
iv) quantifying the level of expression of LynA and LynB in said biological sample and determining the level of expression of LynA relative to that of LynB wherein changes in the relative expression of LynA compared to expression of LynB determines the treatment of said subject.
In a preferred method of the invention said Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
In an alternative preferred method of this aspect of invention the detection of LynA protein and LynB protein comprises the steps:
i) providing an biological sample from a subject to be analysed; ii) forming a preparation comprising said sample and antibodies, that specifically bind polypeptides in said sample wherein said polypeptides comprise the amino acid sequence set forth in SEQ ID NO: 5 and SEQ ID NO: 6 to form antibody/polypeptide complexes;
detecting the complexes;
comparing the level of LynA protein relative to LynB protein wherein changes in the level of LynA protein relative to the level of LynB protein determines the treatment of said subject.
Reference herein to response to treatment refers to the determination of the likelihood that a subject will react positively to particular treatment regimen or therapeutic agent leading to an improvement in a disease symptom as ascertained by appropriate conventional techniques used by those skilled in the art such as tumour volume and/or tumour number.
In a preferred method of the invention, treatment comprises administration of a therapeutic agent such as, but not limited to, anti-Lyn therapeutics including broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like. Alternatively, said therapeutic is an anti-Lyn specific inhibitor. Alternatively, said therapeutic is an anti-Lyn A specific inhibitor. Accordingly, the method to determine if a subject suspected or diagnosed with breast cancer will or will not respond to a therapeutic treatment regimen or treatment for breast cancer involves undertaking one or more of the afore methods and where LynA is over expressed or Lyn A protein is high relative to LynB administering an anti-Lyn therapeutic including a broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like, dasatinib is particularly preferred.
As will be appreciated by those skilled in the art, the observation that sub-groups of breast cancer with increased LynA expression have a poorer prognosis and disease outcome can be used to stratify patients accordingly to determine those likely to respond most positively to anti-Lyn therapeutics such that informed treatment decisions can be made. More preferably, as it has been determined that increased LynA expression is indicative of poorer prognosis, stratification of those patients groups most likely to respond to specific anti-Lyn A therapeutics can be made. According to a further aspect of the invention, there is provided a method to determine if a subject suspected or diagnosed with breast cancer is or is not responding to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein is a measure of a response to said treatment.
As will be appreciated by those skilled in the art, in the above method of the invention the relative expression of LynA to LynB can be used to assess how effective a treatment regimen is working, for example, by assaying for LynA and LynB expression, or LynA and LynB protein, during the course of a given therapy to determine if elevated LynA relative to LynB has declined in response to said treatment.
In a preferred method of the invention said method determines whether said treatment regimen is inhibiting or retarding the progress of cancer and is continued or is ceased.
In an alternative preferred method of the invention said prognostic method determines whether said treatment regimen is not inhibiting or retarding the progress of cancer wherein said treatment regimen is altered.
According to a further aspect of the invention, there is provided a kit for performing any one or more of aforementioned methods wherein said kit comprises:
(a) a plurality of oligonucleotides or antibodies for detecting and quantifying the expression or protein level of LynA and LynB in a biological sample; and
(b) optionally reagents and instructions pertaining to the use of said probes or antibodies. Ideally, in each of the above aspects the instructions show how to determine expression or protein levels for each splice variant and the conclusions to be drawn in view of their relative expression levels. According to a yet further aspect of the invention there is provided a method of treatment of a subject suspected or diagnosed with breast cancer comprising:
i) obtaining a biological sample taken from said subject to be analysed; ii) quantifying the level of expression, or protein level, of Lyn tyrosine kinase splice variants, LynA and LynB, in said biological sample; iii) determining the level of expression, or protein level, of LynA relative to that of Lyn B; and
iv) where the level of expression, or protein level, of LynA is increased relative to that of LynB, administering an anti-Lyn therapeutic. In a preferred embodiment of the invention, said anti-Lyn therapeutic is a broad spectrum Src family tyrosine kinase inhibitor including dasatinib, nilotinib, bosutinib, saracatinib or the like, preferably dasatinib. Alternatively, and more preferably, said therapeutic is an anti-Lyn A specific inhibitor. Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", mean "including but not limited to" and do not exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.
All references, including any patent or patent application, cited in this specification are hereby incorporated by reference. No admission is made that any reference constitutes prior art. Further, no admission is made that any of the prior art constitutes part of the common general knowledge in the art. Preferred features of each aspect of the invention may be as described in connection with any of the other aspects.
Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings). Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith.
Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.
The Invention will now be described by way of example only with reference to the Examples below and to the following Figures wherein:
Figure 1 : Human LynA mRNA nucleotide sequence (SEQ ID NO: 1), having NCBI Reference Sequence number NM_002350.3.
Figure 2 : Human LynB mRNA nucleotide sequence (SEQ ID NO: 2), having NCBI Reference Sequence number NM_001 11 1097.2. Figure 3 : Human LynA amino acid sequence (SEQ ID NO: 5), having NCBI Reference Sequence: NP_002341.1.
Figure 4 : Human LynB amino acid sequence (SEQ ID NO: 6), having NCBI Reference Sequence: NP_001 104567.1.
Figure 5: A) Schematic representation of LYN isoforms. Red 'lollipops' indicate negative regulatory phosphorylation sites. Green 'lollipops' indicate activating sites. It is unknown whether or not the pY32 site is a positive or negative regulator. B) LynA and B isoforms are present in the mammary epithelium and in tumour tissue. LynA and LynB isoforms were detected by rtPCR in three samples of primary mouse mammary epithelium and nine samples of mouse mammary tumours. C) LYN activity is primarily driven by LYN-A. When total LYN was knocked down and LYN-A (left) or LYN-B (right) re-expressed in shRNA-resistant forms (indicated by *), LYN-A re-expression restored the majority of LYN activity whereas LYN-B re-expression did not significantly restore LYN activity. Analysis of LYN-A and LYN-B expression in human breast cancer cell lines by rtPCR, with quantitation shown above corresponding gel lanes. Note correspondence between ratios in basal (red), luminal (green) and 'normal' (blue) cell lines and the ratios in primary breast cancer samples shown in (D). D) Analysis of LYN-A, LYN-B and Epithelial Specific Antigen (ESA) in human breast tissue by rtPCR. Normal tissue (reduction mammoplasty; blue) samples were selected to contain >50% epithelium and the ESA rtPCR results were also used for normalisation to enable comparison between tumour and normal tissue. All tumour samples (from both TNBC, red, and ER positive disease, green) were grade III pre-menopausal. Both the raw PCR data and the quantified results are shown. E) Available survival data for samples shown in (D). No obvious correlations are seen in ER positive tumours between LYN-A/B ratio and survival, but notably there is a correlation in the TNBC group.
Figure 6: A) LYN knockdown suppresses growth of normal primary mouse mammary epithelial cells: (i) RNA by qPCR (RQ +/-95%CI; n= 2) and protein levels in cells expressing two shLyn constructs targeting total LYN. (ii) Growth of 3D mammary cell colonies is suppressed by LYN knockdown (as measured by mean+/- SD cell viability and colony area; n=2 independent experiments). B) LYN knockdown kills tumour cells in vitro in 2D culture (four independent cell lines; mean+/-SD of 3 technical replicates for each). C) Dasatinib treatment of mammary tumour cells in vitro in 3D culture suppresses LYN phosphorylation and kills cells in a dose- dependent manner (growth curves from four independent experiments, means+/-SD of 3 technical replicates, and one representative p-LYN western blot). D) Induction of shLyn in tumour cell xenografts in vivo significantly reduces tumour growth: (i) Relative tumour volume curves (means+/-SE) in xenografts of mouse tumour cells (derived from a mouse Brcal mammary tumour in-house) expressing dox-inducible shScr or shLyn. (ii) Images of representative end-point tumours, (iii) qrtPCR analysis (RQ+/-95%CI) of Lyn expression in modified tumour cells. Figure 7 Lyn kinase activity is required for c-Kit pro-growth signalling in normal mammary epithelial cells. Growth of mammary organoids treated for 4 days with vehicle or the indicated Dasatinib concentrations, as measured by metabolic activity (left panel) or colony area (middle panel). Data from three independent experiments are shown. Western blot analysis of Lyn autophosphorylation (Y397) in mammary organoids following Dasatinib or vehicle treatment. Tubulin was used as loading control (right panel) (A). Mammary organoids were transduced with the following combinations of lentiviral vectors: shScr- and control WPI-vectors (shScr), shLyn- and control WPI-vectors (shLyn), shLyn- and WPI-vectors carrying either a shLyn- resistant form (indicated by *) of wild-type LynA (shLyn + LynA* WT) or a kinase- dead LynA mutant (shLyn + LynA* KD) (B), shLyn- and WPI-vectors carrying a shLyn-resistant form of wt LynB (shLyn + LynB* WT) (C). Lyn protein levels were determined by Western blot 5 days after transduction. Graphs show cell viability measured by metabolic activity at day 5 of culture from three independent experiments (B, C).
Figure 8 Lyn kinase activity is required for growth of Brcal -tumour cells in vitro and in vivo. Primary BIgCre Brca1fx/fx p53+/- mouse mammary tumour cells (#1 , #2 and #3, three distinct tumours) were seeded on Matrigel and treated with vehicle or the indicated Dasatinib concentrations for 5 days. Cell viability was assessed by metabolic activity. Graph show dose response curves using a Nonlinear Regression (Curve Fit) model (A). Primary BIgCre Brca1fx/fx p53+/- mouse mammary tumour cells were transduced with the following combinations of lentiviral vectors: shScr- and control WPI-vectors (shScr), shLyn- and control WPI-vectors (shLyn), shLyn- and WPI-vectors carrying either a shLyn-resistant form (indicated by *) of wild-type LynA (shLyn + LynA* WT) or a kinase-dead LynA mutant (shLyn + LynA* KD). Lyn protein levels were determined by Western blot 6 days after transduction (right panels). Graphs show cell viability measured by metabolic activity at day 6 of culture on Matrigel from three independent experiments (left panels) (B).
Figure 9 Brcal -deficiency results in up-regulated Lyn activity.
Primary mouse mammary organoids were transduced with control (shScr) or Brcal - knock-down lentiviruses (shBrcal) and tested for levels of phospho-c-Kit (Y719), phospho-Lyn (Y397), Lyn, and GAPDH by Western blot after 4 days (left panels). Quantification of phospho-Lyn relative to total Lyn levels from three independent experiments (right panels). Brcal gene expression levels, as measured by qRT- PCR, is also shown (middle panels). (A). Western blot analysis of Lyn autophosphorylation levels in primary mouse mammary organoids transduced with control (Ctr) or HA-tagged Brcal (HA Brcal) WPI lentiviruses. Quantification of phospho-Lyn relative to total Lyn levels from three independent experiments is shown on the right (B). Western blot analysis of Lyn autophosphorylation levels in HCC1937 Brcal -deficient cells transduced with either control (Ctr) or HA Brcal - WPI lentiviruses. Representative blots from two independent experiments (C). Primary mouse mammary organoids were transduced with WPI lentiviral vectors, either control (Ctr) or expressing a constitutively active mutant Lyn (Lyn CA). 4 days after transduction both Ctr- and Lyn CA-organoids were exposed to Methyl MethaneSulfonate (MMS, 100 microM) or left untreated. After 3 hours, cells were lysed or left to recover, following MMS quenching with sodium thiosulfate (2.5%), for 1 , 2, 4 or 6 hours before lysis. Schematics of the experimental conditions (top left panel). Lysates were then analyzed for levels of phospho-Lyn (Y397), Lyn, cleaved PARP, phospho-Akt (S473), Akt and GAPDH by Western blot (top right panels). Quantification of phospho-Akt and cleaved PARP levels, relative to Akt and GAPDH levels, respectively, are shown in the graphs on the bottom. Three independent experiments (D).
Figure 10 5 Lyn A is up-regulated in TNBC and drives migration and invasion of TNBC cells. Lyn A knock-down in MDA-MB-231 cells (left panels). Growth of control (shScr) and Lyn A-knocked-down MDA-MB-231 cells (shLyn A), as measured by metabolic activity over 4 days in adherent culture conditions (middle panel). Migration and and invasion of shScr- and shLyn A- MDA-MB-231 cells, as assessed by transwell assay. Representative images of end-point assays and quantification of results from three independent experiments are shown (right panels) (A). Total Lyn knock-down and LynA or LynB reconstitution using shLyn- resistant forms of Lyn (Lyn*) in MDA-MB-231 cells (left panels). Growth (middle panels), migration and invasion (right panel) of the following MDA-MB-231 cells, control (shScr), Lyn-depleted (shLyn), expressing either Lyn A (shLyn + LynA*) or Lyn B (shLyn + LynB*) were assessed and quantified as in (A) (B).
Figure 1 1 In vivo Dasatinib treatment
Wild-type mice were subjected to daily intra-peritoneal injection (IP) of vehicle (N=2), Dasatinib - 5mg/Kg (N=2) or Dasatinib - 15mg/Kg (N=2) for 7 days. Body weight of each mouse was daily monitored and recorded (A). Mammary glands were harvested from each mouse treated as in (A) and lysed. Protein extracts were analyzed for levels of total Lyn and phosphorylated Lyn (Y397) by Western blot. GAPDH was used as loading control (B). BlgCre Brca1fx/fx p53+/- mouse carrying two mammary tumours, from the fourth left gland (L4) and third right gland (R3), respectively, was subjected to daily IP injection of Dasatinib (15mg/Kg). Tumour size was recorded every two days (C). Figure 12 Sensitivity to Dasatinib
Correlation of Lyn A expression and Dasatinib IC50 (Inhibitory Concentration 50) in a set of 26 human breast cancer cell lines. Expression of Lyn A mRNA was extracted from Affymetrix Exon Array datasets using a probeset specific for this Lyn splicing transcript (exon 3098998). Dasatinib IC50s, was taken from the prior art. Pearson's correlation coefficient (r) is shown on the right.
Table 1 : Oligonucleotides pertaining to SEQ ID NOs: 3 and 4.
MATERIALS AND METHODS Human Tumour material
cDNA from normal human breast tissue (from reduction mammoplasties), ten TNBC and ten ER+ breast cancers was obtained from the Breast Cancer Campaign Tissue Bank. All cancers were grade 3 tumours from pre-menopausal women,
Semi-quantitative RT-PCR DNA synthesis was carried out using QuantiTect Reverse Transcription Kit (Quiagen) according to the manufacturer's instructions. PCR reactions were performed using GoTaq® PCR Core System reagents (Promega). The following forward (fw) and reverse (rev) primers were used:
msLyn (SEQ ID NO: 7) fw 5'- AAGGAAAGACAATCTCAATGACG-3',
msLyn (SEQ ID NO: 8) rev 5'- CACCATTCCCCATGCTCTTCT-3';
hLyn (SEQ ID NO: 9) fw 5'- AAGGGAAAGACAGCTTGAGTGA -3',
hLyn (SEQ ID NO: 10) rev 5'- CACCATTCTCCATGCTCCTCC -3';
hESA (SEQ ID NO: 11) rev: 5'- TTTGCGGACTGCACTTCAGA -3',
hESA (SEQ ID NO: 12) rev 5'- CCAGATCCAGTTGTTCCCCA -3';
hGAPDH (SEQ ID NO: 13) fw 5'- GACCACAGTCCATGCCATCA -3',
hGAPDH (SEQ ID NO: 14) rev 5'- GTCAAAGGTGGAGGAGTGGG -3'.
PCR products were separated by agarose gel (2%) electrophoresis and band intensities were quantified using ImageJ image analysis software (http://www.rsbweb.nih.gov/ij/)
Gene expression analysis by quantitative real-time PCR
qPCR reactions were performed using TAQMAN Assays-on-Demand probes (Life Technologies) for Lyn (Assay ID: Mm 01217488_m1). Beta-actin (Assay ID: Mm 00607939_s1) and Ubiquitin C (Assay ID: Mm02525934_g1) were used as endogenous controls. Results were analyzed using the D-DCt method.
Western blot analysis
Protein extracts were separated by SDS-PAGE, transferred to PVDF membranes and immunoblotted with antibodies to phospho-Y396 Lyn (rabbit monoclonal, clone: EP503Y; ab40660, Abeam) and Lyn (mouse monoclonal, clone: LYN-01 ; ab1890, Abeam). GAPDH or alpha-tubulin was used as loading control. Detection of the resulting immunocomplexes was performed using HRP-conjugated secondary antibodies and enhanced chemiluminescent (ECL) reagents.
Isolation and culture of primary mouse mammary epithelial cells
Single cells were prepared from the third and fourth mammary glands of 10-12 week-old virgin female FVB mice as described previously [7]. Tumour cells were obtained from Blg-Cre Brca1fx/fx p53+ " mice [1] by using gentleMACS mouse tumour dissociation kit (Mylteni Biotec). Cultures were maintained at 37 °C in a 5%02 atmosphere in complete growth medium (1 : 1 DMEM:Ham's F12 medium with 10% FCS, 5 ug/ml insulin, 10 ng/ml cholera toxin and 10 ng/ml epidermal growth factor). For three dimensional cultures cells were plated onto growth factor-reduced Matrigel in complete growth medium.
Lentivirus generation and transduction of mouse mammary mammary epithelial cells
For constitutive Lyn knock-down, pLKO-1 lentiviral vectors containing shRNA- targeting mouse Lyn (shl_yn#1 : TRCN0000015994 and shl_yn#2: TRCN0000235890) and pLKO-1 control vector (shScr) were purchased from Sigma. Relative titres of viral supernatants were determined by transducing NIH 3T3 cells and analysing the number of transduced cells after selection for puromycin resistance. Variants of mouse LynA and LynB cDNA resistant to knock-down by shLyn#2 were generated by site-directed mutagenesis using the following primers: shLyn#2ResStep1 (SEQ ID NO: 15) fw: 5'-
CCTGGTCTCTGAATCACTGATGTGCAAAATTGCAGACTTTGGC -3' , shLyn#2ResStep1 (SEQ ID NO: 16) rev: 5'-
GCCAAAGTCTGCAATTTTGCACATCAGTGATTCAGAGACCAGG -3';
shLyn#2ResStep2 (SEQ ID NO: 17) fw:
CCTGGTCTCTGAATCTCTGATGTGTAAAATCGCAGACTTTGGC,
shLyn#2ResStep2 (SEQ ID NO: 18) rev:
GCCAAAGTCTGCGATTTTACACATCAGAGATTCAGAGACCAGG.
The resulting LynA* and LynB* mutants were subcloned into pWPI lentiviral vectors. For conditional Lyn knock-down a dual vector system was generated for inducible expression of shLyn#2 in response to doxycycline. shLyn#2 and shScr sequences were inserted into pSEW lentiviral vectors downstream of a Tet operator (TetO)/H1 promoter. The cDNA encoding Tetracycline Repressor (TetR) was subcloned into pHIV lentiviral vector. Primary mammary cells were transduced in suspension as described previously [2].
Cell viability and growth assays
Cell density in monolayer cultures was determined by absorbance measurement following fixation and staining with crystal violet. In three dimensional cultures cell growth was measured using the CellTitre Glo cell viability reagent (Promega) and the GelCount platform. Cell migration and invasion assay
Invasion assays were performed using 24-well Transwell inserts (Corning) coated with Matrigel (BD Biosciences). Migration assays were performed similarly without Matrigel. Briefly, cells (75.000) were resuspended in 250 μΙ_ serum-free medium and seeded into the upper chamber. 750 μΙ_ of medium supplemented with 10% serum was added to the lower chamber. After 20 hours, cells on the lower side of the insert were fixed, stained with crystal violet and counted under a light microscope.
Orthotopic transplantion of mouse mammary tumour cells
Primary mouse BlgCre Brca1fx fx p53+ " mammary tumour cells were transduced using pHIV-RFP-Tet repressor and pSEW-GFP-TO-H1 (-shScr or -shl_yn#2) lentiviral vectors. 250.000 cells were orthotopically injected into the fourth right mammary fat pad of nude mice. Mice were maintained on either a control (DOX-) or a doxycicline (DOX+) diet. Tumour volumes were calculated from caliper measurements of tumour width and length.
In vivo Dasatinib treatment
Dasatinib monohydrate was dissolved in DMSO at 20 mg/mL and stored in aliquots at -20°C. Aliquots were thawed and diluted in 5.1 % polyethylene glycol (PEG-400) and 5.1 % Tween 80 (vehicle) before use. Mice were subjected to a single injection of Dasatinib daily. Control mice were treated with an equivalent concentration of DMSO dissolved in vehicle buffer. Example 1
Two alternative splicing isoforms, LynA and LynB, are expressed in the mouse mammary epithelium
We have analysed expression of the the Src-family kinase Lyn in freshly isolated mouse mammary epithelium by reverse transcription PCR (rtPCR). Specifically, we tested whether two isoforms of Lyn, LynA and LynB (Figure 5A) are expressed. We confirmed that both LynA and LynB are expressed both in the normal mouse mammary epithelium and mouse mammary tumours (Figure 5B). We are the first group to demonstrate this. Note that we have discovered that a third, higher band seen in some of these samples is a PCR artefact formed from a heteroduplex of amplified LynA and LynB cDNA strands.
Example 2
Mammary cell growth is driven by LynA not Lyn B
To test whether LynA or LynB are primarily implicated in cell growth, we used short hairpin RNAs targeting Lyn (shLyn) to suppress endogenous Lyn levels (blocking both LynA and LynB) in normal primary mouse mammary epithelial cells. This resulted in a significant reduction in cell growth compared to a control construct expressing a scrambed short hairpin RNA (shScr). However, when we co-expressed shLyn and a construct which produced a modified form of LynA (LynA*) which cannot be targeted by shLyn, cell growth was restored to 90% of that of the shScr control (Figure 5C).
In contrast, when a modified LynB (LynB*) resistant to shLyn was co-expressed, there was no significant rescue of cell viability (Figure 5C). Therefore, mammary cell survival is primarily driven by the LynA isoform. Example 3
The LynA: LynB ratio is a potential prognostic indicator in TNBC We therefore examined the ratios and functions of Lyn A and Lyn B in human breast cancer samples. Using RT-PCR analysis of RNA levels with isoform-specific primers, in normal human breast tissue Lyn A and Lyn B were expressed in an approximate 1 : 1 ratio (figure 6D). However, in TNBC the ratio of Lyn A was significantly higher than in normal tissue (figure 6D). In contrast, in ER+ breast tissue there was no significant increase in the Lyn A: Lyn B ratio (figure 6D). This therefore shows that the Lyn A: Lyn B ratio is elevated in the subset of TNBC. Further, when assessing the outcome of the patients, the severity of the disease as defined by rapid time to recurrence correlated with the increase in Lyn A (figure 6E), indicating that the ratio of Lyn A: Lyn B is prognostic with a higher ratio leading to poorer prognosis.
Example 4 The LynA:LynB ratio is a predictor of response to broad spectrum Src Kinase inhibitor therapy
Src family kinase inhibitors, in particular dasatinib, are in clinical use for treatment of cancer but have not proved successful in breast cancer. Furthermore, they are typified by broad spectrum activity, so it is not known which kinases in the family they are inhibiting. We hypothesized that inhibition of Lyn would kill breast cancer cells and that this could be achieved by either short hairpins targeting Lyn or dasatinib treatment. Indeed, we have now shown that shLyn slows growth of normal mammary epithelial cells (Figure 6A) and kills mammary tumour cells both in in vitro and in vivo growth assays (Figure 6B and D). Finally we show that dasatinib therapy also kills mammary tumour cells and that this is correlated with a suppression of levels of the active (phospho-tyrosine 397) phosphorylated form of Lyn (Figure 6C). Notably, the pY397 form of Lyn corresponds with the size of LynA. Therefore, the LynA:LynB ratio may indicate the sensitivity of breast cancer cells to broad spectrum Src family kinase inhibitors in general or to specific inhibitors of Lyn kinase.
TNBC is a subgroup of breast cancer patients characterized by lack of expression of ER, PR or lack of amplification of HER2. Typically, TNBC treatment is chemotherapy with no approved/preferred therapeutic interventions, and thus survival rates are therefore relatively poor. Lyn Kinase has been implicated in various leukaemia's and solid tumours including breast cancer, however, no specific Lyn kinase inhibitors exist. Two splice variants of Lyn are known (Lyn A and B) but the exact functionality of each isoform is unknown. It has herein been shown that Lyn Kinase isoforms (LynA and LynB) are expressed at a ratio 1 : 1 in normal tissue; however, there exists a statistically significant differential expression of LynA: LynB in individual's correlating with disease severity, with increased expression of LynA indicative of poorer prognosis. Therefore, the ratio of LynA: LynB represents a prognostic test for breast cancer. Further, the ratio of LynA: LynB can be used to predict response of an individual to treatment, and thus be used to stratify patients according to those most likely to respond to a particular therapy.
Example 5
LynA kinase activity mediates pro-growth signalling downstream of c-Kit in normal mammary epithelial cells
To understand if the ability of Lyn to sustain mammary cell proliferation relies on its kinase activity, we first evaluated the effect of a range of concentrations of Dasatinib, a known Lyn kinase inhibitor [8], on the growth of primary mouse mammary epithelial cells. Upon treatment with Dasatinib, reduced Lyn phosphorylation levels corresponded to a decrease in cell growth rate, as assessed by a time-course analysis of both metabolic activity and size of mammary organoids over four days (Figure 7A). In agreement with these results, forced expression of a shRNA-resistant version of wild-type LynA (LynA* WT) but not of kinase dead LynA (T410K) mutant (LynA* KD) restored normal cell growth in shLyn-carrying mammary cells (Figure 7B). Interestingly, expression of a shRNA-resistant LynB form (LynB* WT) was not sufficient to revert the growth defects following Lyn knock-down (Figure 7C).
Example 6
Lyn is required for growth of Brcal -deficient mammary tumour cells To assess whether the kinase activity of Lyn was responsible for its ability to drive tumour cell growth, we exposed 3D cultures of primary Brcal-tumour cells to a range of concentrations of the Lyn kinase inhibitor Dasatinib and measured their viability after 5-6 days of treatment. All the three tumour cell lines were sensitive to Dasatinib with a reduction by 50% in the overall cell viability after treatment at a Dasatinib concentration between 0.1 microM and 1 microM (Figure 8A). In support of these results, expression of a shRNA-resistant version of wild-type LynA (LynA* WT) but not of kinase dead LynA (T410K) mutant (LynA* KD) re-established normal growth in 3D cultures of shLyn-transduced tumour cells (Figure 8B).
Example 7
Brcal -depletion leads to up-regulation of Lyn kinase activity Our data show that in normal mammary epithelial cells Lyn kinase activity is under the strict control of the c-Kit receptor, whereas in Brcal -mutant tumour cells Lyn functions independently of c-Kit. We hypothesized that inactivation of Brcal itself might contribute to dysregulation of Lyn kinase activity and we tested the effect of perturbations of Brcal levels on Lyn phosphorylation. Following Brca-1 knock-down, primary mouse mammary epithelial cells indeed exhibited up-regulation of Lyn phosphorylation with no change in c-Kit phosphorylation (Figure 9A). Conversely, Brcal overexpression resulted in reduced Lyn phosphorylation levels (Figure 9B). Furthermore, re-expression of Brcal (HA-Brca1) in human Brcal -deficient HCC1937 cells was sufficient to lower the extent of Lyn phosphorylation (Figure 9C). Hence, consistent with the ability of Brcal to negatively regulate Lyn activity in non- transformed mammary cells, Brcal deficiency triggers Lyn hyperactivation in tumour cells. Since Brcal is a well-known regulator of DNA repair and its depletion is associated with genomic instability, we examined whether persistent activation of Lyn could interfere with normal mammary cell response to DNA damage. Specifically, primary mouse mammary epithelial cells expressing a constitutively active Lyn mutant (LynA CA) were assessed for activation of survival and apoptotic signalling after exposure to the DNA damaging agent Methyl MethaneSulfonate (MMS) (Figure 9D). As shown in Figure 9D, hyperactivation of Lyn led to a marked transient increase in Akt phosphorylation and an overall reduction in cleaved PARP levels after MMS treatment, thus demonstrating that activated Lyn is able to boost up pro-survival signalling and oppose cell death upon genotoxic stress. Example 8
LynA is up-regulated in human Triple Negative Breast Cancer and drives tumour cell aggressiveness In order to understand whether selective elevated expression of the LynA variant confers malignant properties to TNBC cells, we specifically knocked-down LynA expression in MDA MB-231 cells. shLynA cells displayed about a 60% reduction in LynA protein levels compared to control (shScr) cells, with a LynA: LynB protein ratio approximately equal to 1 (Figure 10A). Importantly, LynA knock-down resulted in an overall decrease in cell proliferation and a strong reduction in cell migration and invasion in vitro. To exclude the possibility that the impaired growth, migration and invasion of shLynA knocked-down cells was due to a reduction in total Lyn levels rather than to depletion of the LynA form and to determine the specific contribution of each Lyn variant to the malignant behaviour of MDA MB-231 cells, we used a knock-down/reconstitution approach. After knocking-down total Lyn levels, either a LynA or a LynB variant (LynA* or LynB*), not targetable by the Lyn shRNA, was re-expressed in MDA MB-231 cells (Figure 10B). Total Lyn knock-down led to a decrease in cell growth, but expression of either LynA or LynB was sufficient to restore normal growth (Figure 10B), indicating that these two distinct Lyn isoforms play a redundant role in promoting tumour cell growth. Nevertheless, similar to total Lyn-depleted cells, cells expressing only LynB were markedly impaired in their migration and invasion. On the other hand, expression of LynA alone completely rescued the ability of shLyn-cells to migrate and invade (Figure 10B), demonstrating that LynA is the Lyn variant responsible for the aggressive properties of these cells. Thus, up-regulation of the specific splicing Lyn variant, LynA, represents a mechanism whereby TNBC acquire malignant properties.
Example 9 In vivo Dasatinib treatment
We evaluated the safety and tolerability of daily intraperitoneal injections of Dasatinib in wild-type mice (Figure 11 A). We also assessed the inhibition of Lyn kinase by Dasatinib treatment at different doses (Figure 1 1 B). We also tested the effects of Dasatinib on primary mammary tumours of BlgCre Brcal fx/fx p53+/- mice (Figure 1 1C). Our results confirmed that in vivo administration of Dasatinib is well tolerated and effectively inhibits Lyn phosphorylation (Figure 11A and 11 B). In addition, our preliminary data suggest that Dasatinib may inhibit growth of primary BlgCre Brca1fx/fx p53+/- mammary tumours. However, measurement of the LynA:LynB ratio may help stratify these tumours and predict their sensitivity to Dasatinib. Example 10
Sensitivity to Dasatinib
We correlated the sensitivity of breast cancer cell lines to Dasatinib ('IC50') taken from prior art [9] with LynA expression levels we had identified in the same cell lines. We plotted Dasatinib IC50s against LynA expression levels (Figure 12). We showed a strong correlation between Dasatinib sensitivity and LynA expression (P=0.001). These results suggest that LynA expression levels specifically (and not simply levels of total Lyn) predict sensitivity to Dasatinib in breast cancer and that as LynA expression increases the IC50 of Dasatinib declines thus indicating increasing sensitivity to Dasatinib in tumours with higher LynA expression.
Summary
Alternative splicing is emerging as a critical post-transcriptional regulatory mechanism for many cancer-associated genes. Alterations in the abundance or activity of alternative splicing regulators may lead to the preferential expression of spliced variants contributing to multiple aspects of tumour establishment and progression. Lyn kinase exists as two isoforms, LynA and LynB, which are generated by alternative splicing and differ for a 21-amino-acid (aa) insert found in the NH2-terminal unique domain of LynA. Here, for the first time, we report that LynA, rather than LynB, is endowed with pro-migratory and invasive properties and is the Lyn form preferentially up-regulated in human TNBC.
References
References
1. Molyneux G, Geyer FC, Magnay FA, McCarthy A, Kendrick H, Natrajan R et al. (2010). BRCA1 Basal-like Breast Cancers Originate from Luminal Epithelial Progenitors and Not from Basal Stem Cells. Cell Stem Cell 7: 403- 417).
2. Kendrick H, Regan JL, Magnay FA, Grigoriadis A, Mitsopoulos C, Zvelebil M et al. (2008) Transcriptome analysis of mammary epithelial subpopulations identifies novel determinants of lineage commitment and cell fate. BMC Genomics.9:951.
3. Regan JL, Kendrick H, Magnay FA, Vafaizadeh V , Groner B, Smalley MJ.
(2012). c-Kit is required for growth and survival of the cells of origin of Brcal- mutation-associated breast cancer. Oncogene. 31, 869-883.
4. Barton J, Liggett W, Mainwaring M, Hainsworth JD, Simons L, Spigel DR et al. (2006). Phase II pilot trial of imatinib mesylate with weekly docetaxel in metastatic breast cancer. J Clin Oncol 24: 10716. 881 .
5. Chew HK, Barlow W, Albain K, Lew D, Budd T, Allen G et al. (2006). SWOG 0338: A phase II trial of imatinib mesylate in combination with capecitabine in metastatic breast cancer. J Clin Oncol 24: 10529.
6. Haley BB, Ashfaq R, DeHaas M, Ramaswami A, Sikder K, Tripathy D.
(2007). A phase l/l I study of imatinib and docetaxel as neoadjuvant therapy in locally advanced breast cancer. J Clin Oncol 25: 1 1039.
7. Smalley MJ. (2010). Isolation, culture and analysis of mouse mammary epithelial cells. In: Ward A, Tosh D. Methods in Molecular Biology. Springer: Berlin, pp 139-170.
8. Choi YL, Bocanegra M, Kwon MJ, Shin YK, Nam SJ, Yang JH, Kao J, Godwin AK, Pollack JR. (2010). LYN is a mediator of epithelial- mesenchymal transition and a target of dasatinib in breast cancer. Cancer Res 70(6):2296-306. Huang F, Reeves K, Han X, Fairchild C, Platero S, Wong TW, Lee F, Shaw P, Clark E. (2007). Identification of candidate molecular markers predicting sensitivity in solid tumors to dasatinib: rationale for patient selection. Cancer Res 67(5):2226-38.
Figure imgf000030_0001

Claims

1 . A prognostic method for determining the progression of breast cancer in a subject suspected of or diagnosed with breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein higher levels of LynA expression or protein relative to LynB is indicative of a poor prognosis in said subject.
2. The prognostic method according to claim 1 comprising detecting LynA and LynB mRNA or cDNA.
3. The prognostic method according to claim 1 or claim 2 wherein said method comprises:
i) providing a biological sample taken from a subject to be analysed;
ii) forming a reaction comprising the biological sample and one or more nucleic acid probes complementary to all or part of the nucleotide encoding LynA and LynB;
iii) providing conditions to detect, or optionally amplify, a nucleic acid molecule encoding LynA and LynB in said biological sample;
iv) quantifying the level of expression of LynA and LynB in said biological sample and determining the level of expression of LynA relative to that of LynB wherein greater than a 1-fold increase in LynA expression relative to Lyn B indicates a poor prognosis for said subject.
4. The prognostic method according to any one of claims 2-3 wherein said Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.
5. The prognostic method according to any one of claims 1-4 wherein said method is a PCR based method.
6. The prognostic method according to any of claims 2-5 wherein said nucleic acid probe(s) is/are splice variant specific.
7. The prognostic method according to any one of claims 2-6 wherein said nucleic acid probes are designed by reference to the nucleotide sequence set forth in SEQ ID NO: 1 and SEQ ID NO: 2.
8. The prognostic method according to claim 1 wherein the detection of LynA protein and LynB protein comprises the steps:
i) providing a biological sample from a subject to be analysed; ii) forming a preparation comprising said sample and antibodies, that specifically bind polypeptides in said sample wherein said polypeptides comprise the amino acid sequence set forth in SEQ ID NO: 5 and SEQ ID NO: 6 to form antibody/polypeptide complexes;
iii) detecting the complexes;
iv) comparing the level of LynA protein relative to LynB protein wherein greater than a 1-fold increase in LynA protein relative to Lyn B protein indicates a poor prognosis for said subject.
9. The prognostic method according to claim 8 wherein said method comprises an immunoassay.
10. The prognostic method according to any one of claims 1-9 wherein said breast cancer refers to ER+ or TNBC breast cancer subtypes.
1 1 . The prognostic method according to any one of claims 1-10 wherein said biological sample is a tissue biopsy.
1 2. The prognostic method according to any one of claims 1-1 1 wherein said biological sample is a fluid sample comprising cells.
13. The prognostic method according to any one of claims 1-12 wherein LynA is expressed between 1.3-3.0 fold higher relative to LynB.
1 4. A method to determine if a subject suspected or diagnosed with breast cancer will or will not respond to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein determines a treatment regimen for said subject.
15. The method according to claim 14 wherein said method detects LynA and LynB mRNA or cDNA.
16. The method according to claim 15 wherein said method comprises:
i) providing a biological sample taken from a subject to be analysed;
ii) forming a reaction comprising the biological sample and one or more nucleic acid probes complementary to all or part of the nucleotide encoding LynA and LynB;
iii) providing conditions to detect, or optionally amplify, a nucleic acid molecule encoding LynA and LynB in said biological sample;
iv) quantifying the level of expression of LynA and LynB in said biological sample and determining the level of expression of LynA relative to that of LynB wherein changes in the relative expression of LynA compared to expression of LynB determines the treatment of said subject.
17. The method according to any one of claims 15-16 wherein said Lyn comprises the nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 .
18. The method according to claim 14 wherein the detection of LynA protein and LynB protein comprises the steps:
i) providing a biological sample from a subject to be analysed; ii) forming a preparation comprising said sample and antibodies, that specifically bind polypeptides in said sample wherein said polypeptides comprise the amino acid sequence set forth in SEQ ID NO: 5 and SEQ ID NO: 6 to form antibody/polypeptide complexes;
iii) detecting the complexes;
iv) comparing the level of LynA protein relative to LynB protein wherein changes in the level of LynA protein relative to the level of LynB protein determines the treatment of said subject.
19. The method according to any one of claims 14-18 wherein said treatment regimen or treatment comprises administering a Src family tyrosine kinase inhibitor.
20. The method according to claim 19 wherein said Src family tyrosine kinase inhibitor is an anti-Lyn A specific inhibitor.
21. The method according to claims 19 or 20 wherein said Src family tyrosine kinase inhibitor is dasatinib, nilotinib, bosutinib, or saracatinib.
22. The method according to claim 21 wherein said Src family tyrosine kinase inhibitor is dasatinib.
23. A method to determine if a subject suspected or diagnosed with breast cancer is or is not responding to a therapeutic treatment regimen for the treatment of breast cancer comprising detecting the expression of Lyn tyrosine kinase splice variant LynA relative to splice variant LynB, or detection of LynA protein relative to LynB protein, in a biological sample from a human subject wherein changes in the relative expression of LynA or level of LynA protein compared to expression of LynB or level of LynB protein is a measure of a response to said treatment.
24. The method according to claim 23 wherein said method determines whether said treatment regimen is inhibiting or retarding the progress of cancer and is continued or is ceased.
25. The method according to claim 23 wherein said method determines whether said treatment regimen is not inhibiting or retarding the progress of cancer wherein said treatment regimen is altered or amended.
26. A kit for performing the method according to any one of claims 1-25 wherein said kit comprises:
i) plurality of oligonucleotides or antibodies for detecting and quantifying the expression or protein level of LynA and LynB in a biological sample; and
ii) optionally reagents and instructions pertaining to the use of said probes or antibodies.
27. A method of treatment of a subject suspected or diagnosed with breast cancer comprising:
i) obtaining a biological sample taken from said subject to be analysed;
ii) quantifying the level of expression, or protein level, of Lyn tyrosine kinase splice variants, LynA and LynB, in said biological sample;
iii) determining the level of expression, or protein level, of LynA relative to that of Lyn B; and
iv) where the level of expression of LynA is increased relative to that of LynB, administering an anti-Lyn therapeutic.
28. The method of treatment according to claim 27 wherein said anti-Lyn therapeutic is a Src family tyrosine kinase inhibitor.
29. The method according to claim 27 wherein said Src family tyrosine kinase inhibitor is dasatinib, nilotinib, bosutinib or saracatinib.
30. The method according to claim 29 wherein said Src family tyrosine kinase inhibitor is dasatinib.
PCT/GB2016/050357 2015-02-20 2016-02-15 Cancer prognostic Ceased WO2016132103A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB201502840A GB201502840D0 (en) 2015-02-20 2015-02-20 Cancer prognostic
GB1502840.0 2015-02-20

Publications (1)

Publication Number Publication Date
WO2016132103A1 true WO2016132103A1 (en) 2016-08-25

Family

ID=52821908

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2016/050357 Ceased WO2016132103A1 (en) 2015-02-20 2016-02-15 Cancer prognostic

Country Status (2)

Country Link
GB (1) GB201502840D0 (en)
WO (1) WO2016132103A1 (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040058340A1 (en) * 2001-06-18 2004-03-25 Hongyue Dai Diagnosis and prognosis of breast cancer patients

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20040058340A1 (en) * 2001-06-18 2004-03-25 Hongyue Dai Diagnosis and prognosis of breast cancer patients

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
D. ALVAREZ-ERRICO ET AL: "Functional Analysis of Lyn Kinase A and B Isoforms Reveals Redundant and Distinct Roles in Fc RI-Dependent Mast Cell Activation", THE JOURNAL OF IMMUNOLOGY, vol. 184, no. 9, 1 May 2010 (2010-05-01), US, pages 5000 - 5008, XP055268795, ISSN: 0022-1767, DOI: 10.4049/jimmunol.0904064 *
LUIS J. SCHWARZ ET AL: "LYN-activating mutations mediate antiestrogen resistance in estrogen receptor-positive breast cancer", JOURNAL OF CLINICAL INVESTIGATION, vol. 124, no. 12, 17 November 2014 (2014-11-17), US, pages 5490 - 5502, XP055268797, ISSN: 0021-9738, DOI: 10.1172/JCI72573 *
T L YI ET AL: "Hematopoietic cells express two forms of lyn kinase differing by 21 amino acids in the amino terminus.", MOLECULAR AND CELLULAR BIOLOGY., vol. 11, no. 5, 1 May 1991 (1991-05-01), US, pages 2391 - 2398, XP055269596, ISSN: 0270-7306, DOI: 10.1128/MCB.11.5.2391 *

Also Published As

Publication number Publication date
GB201502840D0 (en) 2015-04-08

Similar Documents

Publication Publication Date Title
Li et al. ARID1A loss induces polymorphonuclear myeloid-derived suppressor cell chemotaxis and promotes prostate cancer progression
Zhou et al. SLFN11 inhibits hepatocellular carcinoma tumorigenesis and metastasis by targeting RPS4X via mTOR pathway
Liao et al. BRAF-activated LncRNA functions as a tumor suppressor in papillary thyroid cancer
AU2013273242B2 (en) Method for the diagnosis, prognosis and treatment of lung cancer metastasis
CN104797935B (en) Method for prognosis and the treatment of cancer metastasis
Wu et al. Tumor cell–derived TGFβ1 attenuates antitumor immune activity of T cells via regulation of PD-1 mRNA
EP3055429B1 (en) Method for the prognosis and treatment of metastasizing cancer of the bone originating from breast cancer
Fu et al. MicroRNA-222-3p/GNAI2/AKT axis inhibits epithelial ovarian cancer cell growth and associates with good overall survival
Han et al. ROBO3 promotes growth and metastasis of pancreatic carcinoma
Gonçalves et al. WNT6 is a novel oncogenic prognostic biomarker in human glioblastoma
Jian et al. Interleukin 7 receptor activates PI3K/Akt/mTOR signaling pathway via downregulation of Beclin‐1 in lung cancer
Jiang et al. MicroRNA-3127 promotes cell proliferation and tumorigenicity in hepatocellular carcinoma by disrupting of PI3K/AKT negative regulation
Li et al. Downregulation of Mig‐6 in nonsmall‐cell lung cancer is associated with EGFR signaling
WO2013134774A1 (en) Modulation of breast cancer growth by modulation of xbp1 activity
CN105435228A (en) New anti-tumor application and anti-tumor preparation of arsenic trioxide
WO2023059801A1 (en) Biomarkers for egfr-mediated resistance in oncogene-driven cancers and methods of treating, preventing, and/or ameliorating oncogene-driven cancers
US20170242015A1 (en) Map3k8 as a marker for selecting a patient affected with an ovarian cancer for a treatment with a mek inhibitor
JP5590693B2 (en) Biomarkers for estimating prognosis of cancer patients and use thereof
Wang et al. Long noncoding RNA LINC01703 exacerbates the malignant properties of non-small cell lung cancer by upregulating MACC1 in a MicroRNA-605-3p-mediated manner
EP3092492B1 (en) Treatment of tumors expressing mutant p53
Li et al. βKlotho is identified as a target for theranostics in non-small cell lung cancer
Zhao et al. LncRNA FOXD3-AS1/miR-128-3p axis-mediated IGF2BP3 in glioma stimulates cancer angiogenesis and progression
Liu et al. SNX17 mediates STAT3 activation to promote hepatocellular carcinoma progression via a retromer dependent mechanism
Talbot et al. Sonic hedgehog medulloblastomas are dependent on Netrin-1 for survival
Wang et al. The tRF-3024b hijacks miR-192-5p to increase BCL-2-mediated resistance to cytotoxic T lymphocytes in Esophageal Squamous Cell Carcinoma

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16704926

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16704926

Country of ref document: EP

Kind code of ref document: A1