WO2016131943A1 - Methods and pharmaceutical compositions for the treatment of obesity and complications arising therefrom including type 2 diabetes - Google Patents

Abstract

The present invention relates to methods and pharmaceutical compositions for the treatment of obesity and complications arising therefrom including type 2 diabetes. In particular, the present invention relates to a method of treating obesity and complications arising therefrom including type 2 diabetes in a subject in need thereof comprising chronically administering the subject with a therapeutically effective amount of a natriuretic peptide.

Description

METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF OBESITY AND COMPLICATIONS ARISING THEREFROM INCLUDING TYPE

2 DIABETES

FIELD OF THE INVENTION:

The present invention relates to methods and pharmaceutical compositions for the treatment of obesity and complications arising therefrom including type 2 diabetes. BACKGROUND OF THE INVENTION:

Obesity is a major risk factor of type 2 diabetes (T2D) and cardiovascular diseases (1, 2). Although multiple hypotheses have been proposed, the link between obesity and the risk of T2D is still poorly understood. Over the last decade, several large cohort studies reported an inverse association between plasma natriuretic peptides (NP) levels and body mass index (3, 4), and the risk of T2D (5, 6). Therefore, dysregulation of the NP system a "NP handicap", might be an important factor in the initiation and progression of metabolic dysfunction, making NP potential candidates linking obesity and T2D (7-9). NP including atrial-NP (ANP) and brain-NP (BNP) are mainly known as heart hormones secreted in response to cardiac overload and mechanical stretch in order to regulate blood volume and pressure (10, 11). ANP and BNP classically bind to a biologically active receptor-A (NPRA) that promotes cyclic GMP (cGMP) signaling (12). They are also quickly cleared from the circulation and degraded through NP clearance receptor (NPRC). The NPRA-to-NPRC ratio therefore controls the biological activity of NP at the target tissue level (13). Besides their well-documented role in the cardiovascular system, several studies revealed a metabolic role of NP (14, 15). Pioneering studies demonstrated a potent lipolytic role of these peptides in human adipose tissue (16, 17), while more recent studies indicated they may play a role in the "browning" of human white fat cells (18) as well as in favoring fat oxidative capacity in human skeletal muscle cells (19). The underlying mechanism involves activation of cGMP signaling, induction of PGCl (peroxisome proliferator-activated receptor coactivator-l ) and enhancement of mitochondrial respiration. Together these studies argue for an important role of NP in the regulation of whole- body energy metabolism. The lipolytic effect of NP is absent in mice naturally expressing high levels of NPRC in adipose tissue (18, 20). However mice overexpressing BNP are protected from diet-induced obesity and insulin resistance, which suggests that the protective effect of NP is achieved by targeting other metabolic tissues such as skeletal muscles (21). SUMMARY OF THE INVENTION:

The present invention relates to methods and pharmaceutical compositions for the treatment of obesity and complications arising therefrom including type 2 diabetes. In particular, the present invention is defined by the claims.

DETAILED DESCRIPTION OF THE INVENTION:

Natriuretic peptides (NP) levels are reduced in obesity and predict the risk of type 2 diabetes (T2D). Since skeletal muscle was recently shown as a key target tissue of NP, the inventors investigated muscle NP receptor (NPR) signaling in the context of obesity and T2D. Muscle NPRA correlated positively with whole-body insulin sensitivity in humans, and was strikingly down-regulated in obese subjects and recovered in response to diet-induced weight loss. In addition, muscle NP clearance receptor (NPRC) increased in individuals with impaired glucose tolerance and T2D. Muscle NPRA was also decreased in high fat diet-fed and genetically obese diabetic mice, while muscle NPRC was up-regulated in obese diabetic mice thus contributing to a "NP handicap". Although no acute effect of brain-NP (BNP) on insulin sensitivity was observed in lean mice, chronic BNP infusion improved blood glucose control and insulin sensitivity in skeletal muscle of obese and diabetic mice. This occurred in parallel of a reduced lipotoxic pressure in skeletal muscle due to an up-regulation of lipid oxidative capacity in a PGC la-dependent manner. Collectively, the data show that activation of NPRA signaling in skeletal muscle is important for the maintenance of long-term insulin sensitivity and has the potential to treat T2D.

Inventors have also demonstrated that NP gene receptor expression in human adipose tissue is altered in obesity as a function of body mass index (BMI). The degree of obesity correlated negatively with the expression of the biologically active receptor NPRA and positively with the expression of the clearance receptor NPRC. In addition, adipose NPRA expression associated inversely with fasting blood glucose and was down-regulated in prediabetes and T2D. A negative relationship was observed between adipose NPRA mRNA levels and insulin resistance (r=-0.65, p<0.0001), while a strong positive correlation was found with adipose GLUT4 and CHREBP mRNA levels independently of BMI . NP activated Akt and AS 160 through cGMP-dependent protein kinase and promoted glucose uptake in a dose- dependent manner in human adipocytes. NP treatment increased glucose oxidation and de novo lipogenesis independently of significant changes in gene expression. Collectively, these data support a role for NP in the regulation of blood glucose and insulin sensitivity through stimulation of glucose uptake in human adipose tissue.

Accordingly, the present invention relates to a method of treating obesity and complications arising therefrom including type 2 diabetes in a subject in need thereof comprising chronically administering the subject with a therapeutically effective amount of a natriuretic peptide.

As used herein the term "obesity" refers to a condition characterized by an excess of body fat. The operational definition of obesity is based on the Body Mass Index (BMI), which is calculated as body weight per height in meter squared (kg/m²). Obesity refers to a condition whereby an otherwise healthy subject has a BMI greater than or equal to 30 kg/m², or a condition whereby a subject with at least one co-morbidity has a BMI greater than or equal to 27 kg/m². An "obese subject" is an otherwise healthy subject with a BMI greater than or equal to 30 kg/m² or a subject with at least one co-morbidity with a BMI greater than or equal 27 kg/m². A "subject at risk of obesity" is an otherwise healthy subject with a BMI of 25 kg/m² to less than 30 kg/m² or a subject with at least one co-morbidity with a BMI of 25 kg/m² to less than 27 kg/m². The increased risks associated with obesity may occur at a lower BMI in people of Asian descent. In Asian and Asian-Pacific countries, including Japan, "obesity" refers to a condition whereby a subject with at least one obesity-induced or obesity-related co-morbidity that requires weight reduction or that would be improved by weight reduction, has a BMI greater than or equal to 25 kg/m². An "obese subject" in these countries refers to a subject with at least one obesity-induced or obesity-related co-morbidity that requires weight reduction or that would be improved by weight reduction, with a BMI greater than or equal to 25 kg/m². In these countries, a "subject at risk of obesity" is a person with a BMI of greater than 23 kg/m² to less than 25 kg/m².

As used herein, the term "type 2 diabetes" or "non-insulin dependent diabetes mellitus (NIDDM)" has its general meaning in the art. Type 2 diabetes often occurs when levels of insulin are normal or even elevated and appears to result from the inability of tissues to respond appropriately to insulin. Most of the type 2 diabetics are obese.

As used herein, the term "treatment" or "treat" refer to both prophylactic or preventive treatment as well as curative or disease modifying treatment, including treatment of patient at risk of contracting the disease or suspected to have contracted the disease as well as patients who are ill or have been diagnosed as suffering from a disease or medical condition, and includes suppression of clinical relapse. The treatment may be administered to a subject having a medical disorder or who ultimately may acquire the disorder, in order to prevent, cure, delay the onset of, reduce the severity of, or ameliorate one or more symptoms of a disorder or recurring disorder, or in order to prolong the survival of a subject beyond that expected in the absence of such treatment. By "therapeutic regimen" is meant the pattern of treatment of an illness, e.g., the pattern of dosing used during therapy. A therapeutic regimen may include an induction regimen and a maintenance regimen. The phrase "induction regimen" or "induction period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the initial treatment of a disease. The general goal of an induction regimen is to provide a high level of drug to a patient during the initial period of a treatment regimen. An induction regimen may employ (in part or in whole) a "loading regimen", which may include administering a greater dose of the drug than a physician would employ during a maintenance regimen, administering a drug more frequently than a physician would administer the drug during a maintenance regimen, or both. The phrase "maintenance regimen" or "maintenance period" refers to a therapeutic regimen (or the portion of a therapeutic regimen) that is used for the maintenance of a patient during treatment of an illness, e.g., to keep the patient in remission for long periods of time (months or years). A maintenance regimen may employ continuous therapy (e.g., administering a drug at a regular intervals, e.g., weekly, monthly, yearly, etc.) or intermittent therapy (e.g., interrupted treatment, intermittent treatment, treatment at relapse, or treatment upon achievement of a particular predetermined criteria [e.g., disease manifestation, etc.]). In particular, the method of the present invention is particularly suitable for improving blood glucose control, enhancing insulin signalling in skeletal muscle and adipose tissue, reducing lipotoxicity in skeletal muscle and adipose tissue, increasing lipid oxidative capacity in skeletal muscle and adipose tissue, or maintaining long-term insulin sensitivity in the subject.

As used herein, the term "natriuretic peptide" refers to a peptide that has the biological activity of promoting cyclic GMP (cGMP) signaling after binding to NPRA. Assays for testing such activity are known in the art, e.g., as described in U.S. Pat. Nos. 4,751 ,284 and 5,449,751. Examples of natriuretic peptides include, but are not limited to, atrial natriuretic peptide (ANP(99-126)), brain natriuretic peptide (BNP), C-type natriuretic peptide (CNP), Dendroaspis natriuretic peptide (DNP), urodilatin (URO, or ularitide), and any fragments of the prohormone ANP(1-126) or BNP precursor polypeptide. For further description of exemplary natriuretic peptides and their use or preparation, see, e.g., U.S. Pat. Nos. 4,751,284, 4,782,044, 4,895,932, 5,449,751, 5,461,142, 5,571,789, and 5,767,239. See also, Ha et al. Regul. Pept. 133(1-3): 13- 19, 2006. As used herein, the term "chronic administration" includes continued administration with natriuretic peptide over an extended period during a subject's lifetime, preferably for at least about three weeks, more preferably from about three months to about twenty years, more preferably from about six months to about ten years, more preferably still from about one year to about five years. Thus chronic administration can result from continuous infusion, either intravenously or subcutaneously; the use of a pump or metering system, either implanted or external, for continuous or intermittent delivery; or by the use of an extended release, slow release, sustained release or long acting formulation that is administered, for example, once daily, twice weekly, weekly, twice monthly, monthly, every other month or every third month. It should be recognized that the average or minimum plasma level need not be reached immediately upon administration of the formulation, but may take anywhere from hours to days to weeks to be reached. Once reached, the average or minimum plasma concentration is then maintained for the desired period of time to have its therapeutic effect. In some embodiments, the natriuretic peptide is administrated to the subject by the means of an implant, osmotic pump, cartridge, micro pump, or other means appreciated by the skilled artisan, as well-known in the art. In some embodiments, the natriuretic peptide is prepared with a carrier that will protect the peptide against rapid release, such as a controlled release formulation, including implants, and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthocsters, and polylactic acid. Many methods for the preparation of such formulations are available. Sec, e.g., Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., 1973, Marcel Dekker, Inc., New York.

By a "therapeutically effective amount" is meant a sufficient amount of the natriuretic peptide for the treatment of type 2 diabetes at a reasonable benefit/risk ratio applicable to any medical treatment. It will be understood that the total daily usage of the compounds and compositions of the present invention will be decided by the attending physician within the scope of sound medical judgment. The specific therapeutically effective dose level for any particular subject will depend upon a variety of factors including the age, body weight, general health, sex and diet of the subject; the time of administration, route of administration, and rate of excretion of the specific compound employed; the duration of the treatment; drugs used in combination or coincidental with the specific peptide employed; and like factors well known in the medical arts. For example, it is well known within the skill of the art to start doses of the compound at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved. However, the daily dosage of the products may be varied over a wide range from 0.01 to 1,000 mg per adult per day. Preferably, the compositions contain 0.01, 0.05, 0.1, 0.5, 1.0, 2.5, 5.0, 10.0, 15.0, 25.0, 50.0, 100, 250 and 500 mg of the active ingredient for the symptomatic adjustment of the dosage to the subject to be treated. A medicament typically contains from about 0.01 mg to about 500 mg of the active ingredient, preferably from 1 mg to about 100 mg of the active ingredient. An effective amount of the drug is ordinarily supplied at a dosage level from 0.0002 mg/kg to about 20 mg/kg of body weight per day, especially from about 0.001 mg/kg to 7 mg/kg of body weight per day. Typically the natriuretic peptide is combined with pharmaceutically acceptable excipients, and optionally sustained-release matrices, such as biodegradable polymers, to form pharmaceutical compositions. The term "Pharmaceutically" or "pharmaceutically acceptable" refers to molecular entities and compositions that do not produce an adverse, allergic or other untoward reaction when administered to a mammal, especially a human, as appropriate. A pharmaceutically acceptable carrier or excipient refers to a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type. The carrier can also be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), suitable mixtures thereof, and vegetables oils. The proper fluidity can be maintained, for example, by the use of a coating, such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. The prevention of the action of microorganisms can be brought about by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. In many cases, it will be preferable to include isotonic agents, for example, sugars or sodium chloride. Prolonged absorption of the injectable compositions can be brought about by the use in the compositions of agents delaying absorption, for example, aluminium monostearate and gelatin. In the pharmaceutical compositions of the present invention, the active ingredients of the invention can be administered in a unit administration form, as a mixture with conventional pharmaceutical supports. Suitable unit administration forms comprise oral-route forms such as tablets, gel capsules, powders, granules and oral suspensions or solutions, sublingual and buccal administration forms, aerosols, implants, subcutaneous, transdermal, topical, intraperitoneal, intramuscular, intravenous, subdermal, transdermal, intrathecal and intranasal administration forms and rectal administration forms. In some embodiments, the pharmaceutical composition of the invention is administered topically (i.e. in the respiratory tract of the subject). Therefore, the compositions can be formulated in the form of a spray, aerosol, solution, emulsion, or other form well-known to one of skill in the art. If the method of the invention comprises intranasal administration of a composition, the composition can be formulated in an aerosol form, spray, mist or in the form of drops. In particular, the active ingredients for use according to the present invention can be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebuliser, with the use of a suitable propellant (e.g., dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas). In the case of a pressurized aerosol the dosage unit may be determined by providing a valve to deliver a metered amount. Capsules and cartridges (composed of, e.g., gelatin) for use in an inhaler or insufflator may be formulated containing a powder mix of the compound and a suitable powder base such as lactose or starch.

The invention will be further illustrated by the following figures and examples. However, these examples and figures should not be interpreted in any way as limiting the scope of the present invention.

FIGURES:

Figure 1. Skeletal muscle NPR signaling relates to insulin sensitivity in humans. Correlation between vastus lateralis NPRA protein expression and (A) percent body fat, (B) glucose disposal rate measured by euglycemic hyperinsulinemic clamp and (C) muscle saturated ceramides content (n=15-20). (D) NPRA protein levels in skeletal muscle of lean and obese subjects and (E) in obese subjects pre- and post-calorie restriction (CR). (F) NPRC protein levels in skeletal muscle of obese subjects with normal glucose tolerance (NGT) and with impaired glucose tolerance and type 2 diabetes (IGT/T2D). **p<0.01 vs. lean; ^£p=0.06 vs. pre-CR; *p<0.05 vs. NGT (n=6-10 per group).

Figure 2. Defective NPR signaling in metabolic tissues of diet-induced obese mice.

Representative blots of NPRA and NPRC proteins in (A) skeletal muscle, (B) epidydimal white adipose tissue (EWAT), and (C) brown adipose tissue (BAT) of chow-fed and HFD-fed mice. (D) Quantitative bar graph of NPRA protein and (E) overnight fasting plasma BNP levels in chow and HFD-fed mice. *p<0.05 versus chow- fed mice (n=8-10 per group). Figure 3. Chronic BNP infusion protects from HFD-induced obesity and glucose intolerance. C57BL/6J mice were treated for 4 weeks with saline (0.9% NaCl) or with BNP (5 ng/kg/min) via mini-osmotic pumps after 12 weeks of HFD. (A) Follow-up of body weight during HFD and after mini-pump were placed. (B) Body composition at the end of treatment in saline- and BNP-treated obese mice. (C) Overnight fasting blood glucose in BNP-treated mice after 8 and 12 weeks of HFD. (D) Time-course of blood glucose levels during an i.p. glucose tolerance test and corresponding AUC. (E) Plasma insulin after a 6h fast (0 min) and 15 min after glucose bolus injection. *p<0.05, ***p<0.01 vs. saline (n=8-10).

Figure 4. Defective NPR signaling in metabolic tissues of obese diabetic mice. Representative blots of NPRA and NPRC proteins in (A) skeletal muscle, (B) EWAT, and (C) BAT of db/db and db/+ mice. (D) Quantitative bar graph of the NPRA-to-NPRC protein ratio and (E) overnight fasting plasma BNP levels in db/db and db/+ mice. *p<0.05, **p<0.01 versus db/+ mice (n=8-10 per group). Figure 5. Chronic BNP infusion improves blood glucose control in obese diabetic mice. 5 weeks old db/db mice were chronically treated for 4 weeks with saline (0.9% NaCl) or with BNP (10 ng/kg/min) via mini-osmotic pump. (A) Follow-up of body weight over 4 weeks of treatment with saline or BNP. (B) Body composition at the end of treatment. (C) Overnight fasting blood glucose, (D) HbAlc, and (E) overnight fasting insulin were measured after 4 weeks of BNP treatment. (F) Time-course of blood glucose levels during an intraperitoneal insulin tolerance test, and corresponding area under the curve (AUC) after 4 weeks of treatment. *p<0.05; **p<0.01; ***p<0.001 vs. saline-treated db/db mice (n=8-10).

Figure 6. Muscle-autonomous improvement of insulin signaling and reduced lipotoxicity in skeletal muscle of BNP-treated obese and diabetic mice. (A) Extensor digitorum longus muscles were incubated ex vivo in absence (-) or presence of 100 nM of insulin (+) and Ser473 Akt phosphorylation and total Akt were measured by western blot. (B) Total ceramides, (C) total sphingomyelin, (D) diacylglycerols sub-species content, (E) ex vivo palmitate oxidation rate, and (F) PGC-la gene expression in skeletal muscle of HFD-fed mice treated with saline and BNP 5 ng/kg/min. *p<0.05 versus saline (n=8-10).

Figure 7. Chronic NP treatment reduces lipotoxicity and increases lipid oxidative capacity in human primary myotubes. (A) Total lipid accumulation, (B) TAG and (C) DAG content were determined with [l-¹⁴C]oleate after 3-days chronic treatment with 100 nM of ANP and BNP in human differentiated myotubes. (D) Total palmitate oxidation rate was also measured in response to chronic ANP and BNP treatment. (E) PGC-la gene expression in response to 3-days treatment with ANP and BNP, and (F) in presence or absence of 500 nM of the selective PPAR5 antagonist GSK0660. **p<0.01; ***p<0.001 vs. control (n=4-10). (G) Ceramide species content in human primary myotubes in basal condition (BSA), and in response to overnight treatment with 500 μΜ of palmitate/BSA (Palm) in control myotubes and in response to 3-days treatment with ANP or BNP. *p<0.05; **p<0.01 vs. control palm (n=4).

Figure 8. Natriuretic peptide receptor expression in human adipose tissue in obesity and type 2 diabetes. Human adipose tissue gene expression of NPRA (A), NPRC (B), and the ratio of NPRA-to-NPRC (C) as a function of the obesity class. Human adipose NPRA mRNA levels in subjects with prediabetes and type 2 diabetes (D), in relation to quartiles of HOMA-IR (E), and in relation to blood fasting glucose (F). *p<0.05, **p<0.01, ***p<0.0001 (n=33-144 per group from cohort 1).

Figure 9. Natriuretic peptide receptor expression in human adipose tissue relates to insulin resistance and glucose metabolism. Relationships between human adipose tissue NPRA gene expression and HOMA-IR (A), adipose GLUT4 gene expression (B), adipose ChREBP gene expression (C). (n=56 from cohort 2).

Figure 10. Atrial natriuretic peptide promotes glucose uptake in human isolated adipocytes. Dose-response effect of ANP (A), and additive effect of ANP 100 nM with insulin (B), on 2-deoxyglucose uptake in human isolated adipocytes (n=13).

Figure 11. Natriuretic peptide induce glucose uptake in a cGMP-dependent manner in hMADS adipocytes. Dose-response effect of ANP (A) and BNP (B) on 2- deoxyglucose uptake in differentiated hMADS adipocytes (n=8). BNP (100 nM) mediated glucose uptake in absence or presence of (Rp)-8-pCPT-cGMPS 100 μΜ (PKG inhibitor) in differentiated hMADS adipocytes (n=8) (C). * p<0.05, ***p<0.0001 vs. control.

Figure 12: Natriuretic peptide enhance glucose metabolism in hMADS adipocytes. Effect of acute treatment with or without 100 nM of BNP on glucose oxidation (A), glucose incorporation into glycerol (B), and glucose incorporation into fatty acids (C). *p<0.05 vs. control (n=7).

Figure 13. ANP KO, insulin and glucose tolerance. Insulin and glucose tolerance tests were performed in wild-type (WT) and ANP knockout mice (KO) fed standard chow diet (A and B respectively) and high fat diet (60% kcal from fat) (C and D respectively). Repeated- measure two-way ANOVA were performed for genotype comparison and p value indicated on each graph (n=6-8). Figure SI. Correlation between muscle NPRA protein and clinical variables in humans. Correlation between vastus lateralis NPRA protein expression, and (A) percent body fat (n=21), and (B) the McAuley insulin sensitivity index measured during an oral glucose tolerance test in human subjects with normal glucose tolerance (n=18).

Figure S2. Acute effect of BNP injection on insulin sensitivity. Fasted C57BL/6 mice fed standard chow diet were injected intraperitoneously with saline (0.9% NaCl) or with BNP (1 μg/kg) solution (arrow) and fasting blood glucose was measured (A) every 10 min in the basal state and (B) every 15 min during an i.p. GTT (n=l 1). (C) Tissue-specific glucose uptake was measured during a radiolabeled GTT with [2-3H]deoxyglucose (n=6).

Figure S3. Effect of acute NP treatment on glucose uptake in human primary myotubes. Glucose uptake was measured in presence of 1, 10 and 50 μΜ of ANP or BNP, and 1 μΜ of insulin in human primary myotubes. *** p<0.001 vs. saline (n=6). Figure S4. Dose-response effect of BNP on body weight and glucose tolerance in

HFD-fed mice. Dose-dependent effect of BNP treatment on (A) body weight, (B) total daily food intake, and (C) glucose tolerance measured during an ipGTT in HFD-fed mice treated for 4 weeks with saline and BNP at 5 and 10 ng/kg/min. * p<0.05 vs. saline (n=6-8). Figure S5. Chronic BNP infusion reduces HFD-induced body weight and fat mass gain. (A) Longitudinal body weight gain, and (B) Fat mass gain in HFD-fed mice treated by saline and BNP 5 ng/kg/min for 4 weeks (n=8-10).

Figure S6. Chronic BNP treatment does not change lipid levels and gene expression in liver of db/db mice. (A) Total ceramides, (B) total diacylglycerols levels, and (C) mRNA levels of genes involved in fat oxidation and glucose metabolism in liver of saline- and BNP- treated db/db mice.

Figure S7. Chronic BNP treatment does not change lipid levels and gene expression in liver of HFD-fed mice. (A) Total ceramides, (B) total diacylglycerols levels, and (C) mRNA levels of genes involved in fat oxidation and glucose metabolism in liver of saline- and BNP- treated HFD-fed mice.

Figure S8. Expression of thermogenic and brown/beige gene markers in adipose tissues of db/db mice. PGCl , UCPl, TFAM, GLUTl and GLUT4 mRNA levels in (A) BAT and (B) EWAT of db/db mice treated for 4 weeks with BNP (n=8-10).

Figure S9. Expression of thermogenic and brown/beige gene markers in adipose tissues of HFD-fed mice. (A) PGCla, UCPl, TFAM, GLUTl and GLUT4 mRNA levels in BAT and (B) UCPl, GLUTl and GLUT4 gene expression in EWAT of HFD mice treated for 4 weeks with BNP (n=8-10).

Figure S10. Effect of acute BNP treatment on lipolysis in human primary myotubes. Time-course of (A) fatty acid (FA) release and (B) FA oxidation from endogenous pre-labeled TAG pools in response to 1 , 3 or 6 hours BNP treatment in the presence or absence of triacsin C to block FA recycling into TAG pools. (C) HSL Ser660 and (D) HSL Ser565 phosphorylation were measured after 10, 30 and 60 min acute stimulation with 100 nM of BNP in human primary myotubes (n=3-5).

Figure Sll. Effect of chronic NP treatment on basal ceramides content in human primary myotubes. Ceramide species content in human primary myotubes in basal condition (BSA) in control myotubes and in response to 3 -days treatment with 100 nM of ANP or BNP (n=4). EXAMPLES:

EXAMPLE1

Methods

Clinical studies and human subjects

Muscle biopsy samples from nine lean, nine obese with normal glucose tolerance, six obese with impaired glucose tolerance and four obese with type 2 diabetes subjects were obtained from three independent clinical studies. Study 1 included young lean and obese subjects (Figure 1 A-D) (42). Study 2 included middle-aged obese subjects with type 2 diabetes, and with impaired glucose tolerance at baseline and in response to 12-weeks of calorie restriction to induce weight loss and improve metabolic health (Figure 1E-F) (43). Study 3 included subjects with normal glucose tolerance but a wide range of body fat (Supplemental Figure 1) (44). The clinical characteristics of the subjects are summarized in Supplemental Table 1. Samples of vastus lateralis weighing 60-100 mg were obtained by muscle biopsy using the Bergstrom technique, blotted, cleaned, and snap-frozen in liquid nitrogen (45). Insulin sensitivity was measured by hyperinsulinemic euglycemic clamp (46). After an overnight fast, insulin (80 mU.m^.min^"1) and 20% glucose (to maintain plasma glucose at 90 mg/dL) were administered for 2h. Glucose and insulin were measured in three independent blood samples taken 10 min apart at baseline and again at steady-state after approximately 2h. Glucose disposal rate was adjusted by kilograms of fat-free mass. Body composition (considering a 3- compartments model) was determined using a total body Dual-Energy X-ray Absorptiometer (DPX, Software 3.6, Lunar Radiation Corp., Madison, WI).

Mice and diets

Five-week-old male diabetic-prone, obese db/db mice of the C57BL/KsJ-lept^db-lept^db strain with their non-diabetic lean littermates control db/+ were used. For high fat diet studies, we used regular C57BL/6J male mice (Janvier laboratories). The mice were housed in a pathogen-free barrier facility (12h light/dark cycle) with ad libitum access to water and food. After weaning, db/db and db/+ mice were fed a normal chow diet (A04, SAFE Diets) for 4 weeks. C57BL/6J mice were fed for 16 weeks either a normal chow diet (10%> energy as fat, Research Diets D 12450 J; Inc, New Brunswick, New Jersey) or high fat diet (HFD) containing 60% Kcal from fat (Research Diets D12492; Inc, New Brunswick, New Jersey).

BNP infusion studies

Mice were randomly assigned to receive a saline vehicle (NaCl 0.9%) and/or chronic rat/mouse BNP 1-32 (B9901, Sigma-Aldrich) at a rate of 5 ng/kg/min or 10 ng/kg/min. Treatments were chronically administered intraperitoneally with mini-osmotic pumps (Alzet, model 1004; Cupertino, CA, USA) (47). Mini-pumps were placed after 12 weeks of HFD and treatment was administered for 4 weeks in C57BL/6J mice and at 6 weeks of age in db/db mice. Body weight was measured weekly and body composition was assessed by quantitative nuclear magnetic resonance imaging (EchoMRI 3-in-l system; Echo Medical Systems).

Glucose and Insulin Tolerance Tests

Six hour- fasted mice were injected intraperitoneally with a bolus of D-glucose at 2g/kg (Sigma-Aldrich, Saint-Quentin Fallavier, France) and insulin 0.5U/kg (Insuman Rapid, Sanofi Aventis, France) for glucose and insulin tolerance tests respectively (GTT and ITT) (48). Blood glucose levels were monitored from the tip of the tail with a glucometer (Accucheck; Roche, Meylan, France) at 0, 15, 30, 45, 60, and 90 minutes after injection. Blood analyses and tissue collection

After an overnight fast, mice were decapitated and blood collected into tubes containing EDTA and protease inhibitors. Organs and tissues were rapidly excised and snap frozen in liquid nitrogen before being stored at -80°C. Blood glucose was assayed using the glucose oxidase technique (Biomerieux, Paris, France), and plasma insulin was measured using an ultrasensitive ELISA kit (ALPCO Diagnostics, Salem, New Hampshire). Plasma BNP was measured using the RayBio BNP Enzyme Immunoassay Kit (RayBiotech, Inc., Norcross, Georgia, USA). HbAlc and fructosamines were determined using a PENTRA 400 multi- analyzer.

Western blot analysis

Soleus and gastrocnemius skeletal muscles, and white and brown adipose tissue were homogenized at 4°C using the Precellys 24 (Bertin Technologies, Montigny-le-Bretonneux, France) in a buffer containing 50mM Tris-HCl (pH 8.0), 150mM NaCl, 1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1 % sodium dodecyl sulfate, 10 μΕ/mL protease inhibitor, 10 μΕ/mL phosphatase I inhibitor, and 10 μΐνητΐ. phosphatase II inhibitor (Sigma-Aldrich, Saint-Quentin- Fallavier, France). Tissue lysates were centrifuged at 14 OOOg for 25 minutes, and supernatants were stored at - 80°C. A total of 40 μg of solubilized proteins from tissue were run on a 4%- 20% gradient SDS-PAGE (BioRad, Hercules, California), transferred onto nitrocellulose membrane (Hybond ECL; Amersham Biosciences, Piscataway, New Jersey), and incubated with the primary antibodies: NPRA (Abeam), NPRC (Sigma-Aldrich), Akt (Cell Signaling Technology [CST] Inc., Beverly, MA) and phospho-Akt Ser473 (CST). Subsequently, immunoreactive proteins were revealed by enhanced chemiluminescence reagent (SuperSignal West Dura or SuperSignal West Femto; Thermo Scientific), visualized using the ChemiDoc MP Imaging System and data analyzed using the Image Lab 4.1 version software (Bio-Rad Laboratories, Hercules, USA). Glyceraldehyde-3 -phosphate dehydrogenase (GAPDH) (CST), a-tubulin (Sigma-Aldrich) and β-actin (CST) were used as internal controls.

Real-time qRT-PCR

Total RNA from plantaris skeletal muscle and primary myotubes was isolated in

RNeasy Lysis Buffer + β-mercaptoethanol reagent (Qiagen GmbH, Hilden, Germany). RNA yield was determined on a Nanodrop ND-1000 (Thermo Scientific, Rockford, IL, USA). Reverse transcriptase PCR was performed on a GeneAmp PCR System 9700 using the Multiscribe Reverse Transcriptase method (Applied Biosystems, Foster City, CA). Real-time quantitative PCR (qPCR) was performed to determine cDNA content. All primers were obtained from Applied Biosystems. Primers used were: 18S (Taqman assay ID: Hs99999901_sl), GLUT4 (Mm00436615_ml) and PGCla (SybrGreen probes). qPCR was performed on a StepOnePLus real-time PCR system (Applied Biosystems). For each primer, a standard curve was made prior to mRNA quantification to assess the optimal total cDNA quantity. All expression data were normalized by the 2^^Ci) method using 18S as internal control.

Triacylglycerol and diacylglycerol determination

Skeletal muscle tissues were homogenized in 1 mL of methanol/5 mM EGTA (2:1, v/v) with FAST-PREP (MP Biochemicals, Solon, Ohio). Lipids corresponding to 2 mg of tissue were extracted according to Bligh and Dyer (49) in methanol/water/dichloromethane (1.5 : 1.5 :2, v/v/v), in the presence of internal standards: 3 μg of stigmasterol, 3 μg of 1,3-dimyristine, 3 μg of cholesteryl heptadecanoate, and 20 μg of glyceryl trinonadecanoate. The dichloromethane phase was evaporated to dryness. Neutral lipids were purified over an SPE column (Macherey Nagel glass Chromabond pure silice, 200 mg). After washing the cartridge with 2 mL of chloroform, crude extract dissolved in 40 μΐ, of chloroform was applied and neutral lipids were eluted in 2 mL of chloroform:methanol (9: 1, v/v). The organic phase was evaporated to dryness and dissolved in 20 of ethyl acetate. One microliter of the lipid extract was analyzed by gas- liquid chromatography on a FOCUS Thermo Electron system using an Zebron-1 Phenomenex fused silica capillary columns (5 m x 0,32 mm inner diameter, 0.50 μιη of film thickness) (50). Oven temperature was programmed from 200°C to 350°C at a rate of 5°C per minute, and the carrier gas was hydrogen (0.5 bar). The injector and the detector were set at 315°C and 345°C, respectively. The equivalent of 0.3 mg of tissue was evaporated under nitrogen, the dry pellets were dissolved overnight in 0.2 mL of NaOH (0.1M), and proteins were measured with the Bio- Rad protein assay.

Ceramides and sphingomyelin determination

Total lipids extracts were prepared from 5 mg of tissue according to Bligh and Dyer in chloroform/methanol/water (2.5:2.5:2.1, v/v/v) in the presence of the internal standard ceramide NCI 5 (2 μg). The dried lipid extract was submitted to a mild alkaline treatment in methanolic NaOH 0.6 N (1 ml) and then to silylation in 50 μΐ BSTFA (l%TMSCl)/acetonitrile (1 : 1, v/v) overnight at room temperature (51). Sample (5 μΐ) was directly analyzed by gas-liquid chromatography (4890 Hewlett Packard system, using a RESTEK RTX-50 fused silica capillary columns, 30-m x0.32-mm i.d., 0.1-μιη film thickness). Oven temperature was programmed from 195°C to 310°C (12 minutes) at a rate of 3.5°C per minute, and the carrier gas was hydrogen (7.25 psi). The injector and the detector were set at 310°C and 340°C, respectively.

Skeletal muscle cell culture

Satellite cells from rectus abdominis biopsies of healthy, insulin-sensitive subjects (age

34.3 ± 2.5 years, BMI 26.0 ± 1.4 kg/m², fasting glucose 5.0 ± 0.2 mM) were isolated by trypsin digestion, preplated on an uncoated Petri dish for lh to remove fibroblasts and subsequently transferred to T-25 collagen-coated flasks in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% FBS and growth factors (human epidermal growth factor, BSA, dexamethasone, gentamycin, fungizone, fetuin) as previously described (42, 52). The biopsies were obtained with informed consent and approved by the National Committee for Research Ethics (Oslo, Norway). Myoblasts from several donors were pooled and grown at 37°C in a humidified atmosphere of 5% CO2. Differentiation of myoblasts into myotubes was initiated at -80% confluence by switching to a-minimum essential medium (a-MEM) with antibiotics, 2% FBS, and fetuin. Myotubes were differentiated up to 5 days and were treated with 100 nM human ANP (A1663, Sigma-Aldrich) or BNP (B5900, Sigma-Aldrich) every day for the last 3 days. Determination of FA metabolism

Cells were pulsed for 18h with [l-¹⁴C]oleate (1 μθ/πιΐ; PerkinElmer, Boston, MA) and unlabeled oleate (80 μΜ). At the end of incubation, myotubes were harvested in 0.2 ml SDS 0.1 % to determine oleate incorporation into total lipids, TAGs, DAGs and protein content. Total lipids were extracted in chloroform/methanol (2: 1 v/v) and separated by thin-layer chromatography (TLC) using heptane -isopropylether-acetic acid (60:40:4 v/v/v) as developing solvent as previously described (40). Incorporation rates were normalized to total protein content in each well.

Palmitate oxidation

This assay was performed as described previously (44). Briefly, muscle tissue was minced and homogenized in a modified sucrose-EDTA medium (250 mM sucrose, 1 mM EDTA, and 10 mM Tris-HCl [pH 7.4]). Palmitate oxidation rates were determined by measuring production of ¹⁴C-labeled acid-soluble metabolites (ASMs), a measure of tricarboxylic acid cycle intermediates and acetyl esters (incomplete oxidation), and [¹⁴C]C0₂. Total radioactivity of C0₂ and ASMs were determined by liquid scintillation counting. Data were expressed in nmol/h/mg of protein.

Statistics

Statistical analyses were performed using GraphPad Prism 5.0 for Windows (GraphPad Software Inc.). Normal distribution and homogeneity of variance of the data were tested using Shapiro-Wilk and F tests, respectively. One-way ANOVA followed by Tukey's post-hoc tests and Student's t-tests were performed to determine differences between groups, interventions and treatments. Two-way ANOVA followed by Bonferonni's post hoc tests were applied when appropriate. Linear regression was performed after log transformation of nonparametric data. All values in figures and tables are presented as mean ± SEM. Statistical significance was set at P < 0.05. Study approval

For human studies, all volunteers gave written informed consent and the protocol was approved by an institutional review board. Studies were performed according to the latest version of the Declaration of Helsinki and the Current International Conference on Harmonization (ICH) guidelines. For mouse studies, all experimental procedures were approved by a local institutional animal care and use committee and performed according to INSERM guidelines for the care and use of laboratory animals.

Results

Muscle NPRA and NPRC proteins relate to insulin sensitivity in humans

Muscle NPRA protein expression was investigated in human vastus lateralis biopsies of healthy volunteers with varying degree of body fat and insulin sensitivity. We observed that muscle NPRA protein was inversely related to body fat (Figure 1A and Supplemental Figure 1A), BMI, fasting insulin, indices of insulin resistance (Supplemental Table 2). In addition, muscle NPRA correlated positively with whole-body insulin sensitivity measured by euglycemic hyperinsulinemic clamp (Figure IB) and the insulin sensitivity index (Supplemental Figure IB), and negatively with total muscle saturated ceramide content (Figure 1C). Importantly, muscle NPRA protein content was significantly reduced (-65%) in obese subjects when compared to age-matched lean subjects (Figure ID). Conversely, muscle NPRA protein was up-regulated (1.8 fold) together with insulin sensitivity (+37%, 5.4±0.6 vs. 7.4±1.1 mg/min/kg for pre- and post-calorie restriction respectively, p=0.03) in obese subjects with impaired glucose tolerance in response to diet-induced weight loss (Figure IE). Finally, muscle NPRC protein content was unchanged in obese versus lean individuals with normal glucose tolerance (0.41±0.08 vs. 0.29±0.07 A.U., NS) but increased significantly in obese individuals with impaired glucose tolerance (IGT) and T2D (Figure IF). Together this suggests that skeletal muscle NPR signaling relates to insulin sensitivity in humans and is altered in obesity and T2D.

Impaired NPRA signaling in skeletal muscle and fat of diet-induced obese mice

Since both skeletal muscle and adipose tissue are known as key target tissues of NP both in humans and mice, we further examined NPR signaling in metabolic tissues of chow-fed versus HFD-fed mice. In line with human data, we found a significant down-regulation of NPRA protein in skeletal muscle (Figure 2A and D), as well as in white (Figure 2B and D) and brown fat (Figure 2C and D) of HFD-fed mice. No significant change in NPRC protein content was found in skeletal muscle and brown fat, while NPRC protein decreased significantly in white fat (0.48±0.08 vs. 0.14±0.04 A.U. for chow and HFD respectively, p<0.05). Plasma BNP levels were unchanged in HFD-fed mice compared to chow- fed mice (Figure 2E). Collectively, as in humans, our data indicate a reduced NPRA signaling in skeletal muscle of obese mice. Chronic BNP infusion protects against HFD-mediated obesity and glucose intolerance

Since muscle NPRA is associated with insulin sensitivity in humans, we assessed the effect of acute and chronic BNP infusion on glucose tolerance and insulin sensitivity in chow- fed and HFD-fed mice. Acute i.p. BNP injection did not affect fasting blood glucose levels over a time-course of 30 min (Supplemental Figure 2A), and had no effect on glucose excursion during an i.p. GTT (Supplemental Figure 2B). No effect of acute BNP injection was also seen on insulin sensitivity in skeletal muscle (Supplemental Figure 2C). We further assessed the influence of acute NP treatment on basal and insulin-stimulated glucose uptake in human primary skeletal muscle cells. No effect of increasing doses of ANP and BNP on glucose uptake was observed (Supplemental Figure 3). From these data we concluded that NPRA signaling likely influences insulin sensitivity in skeletal muscle indirectly.

Based on a previous study (22), we first conducted a dose-response BNP infusion study in HFD-fed mice. BNP was infused at two different doses (5 and 10 ng/kg/min) via mini- osmotic pump for 4 weeks in obese mice that were prior fed a HFD for 12 weeks. Before treatment, all three groups of mice had a similar body weight and fasting blood glucose level (data not shown). Chronic BNP infusion induced a dose-dependent inhibition of body weight gain on HFD (Supplemental Figure 4A), which may be partly accounted for by a lower daily food intake in BNP-treated mice (Supplemental Figure 4B). No change in locomotor activity was observed in BNP-treated versus saline mice (data not shown). Interestingly, BNP induced a dose-dependent improvement of glucose tolerance (Supplemental Figure 4C).

In light of our preliminary dose-response study and the observed effect on body weight gain, we next infused BNP at the dose of 5 ng/kg/min which raised plasma BNP levels by ~40% (data not shown). BNP-treated mice had a similar body weight (Figure 3 A) and body composition (Figure 3B) after saline and BNP treatment, but were relatively protected against HFD-induced body weight gain (p<0.01) (Supplemental Figure 5 A) and fat mass gain (-53%, p<0.05) (Supplemental Figure 5B). Chronic BNP treatment also significantly reduced fasting blood glucose levels in mice fed a HFD for 8 or 12 weeks (Figure 3C). Lower blood glucose in the fasting state was also accompanied by improved glucose tolerance (Figure 3D) in face of no change in fasting and peak insulin at 15 min during the intraperitoneal glucose tolerance test (GTT) (Figure 3E). In conclusion, while acute BNP treatment has no effect on insulin sensitivity, chronic BNP treatment improves glucose tolerance in HFD-fed mice.

Impaired NPR signaling in skeletal muscle of obese diabetic mice contributes to the "NP handicap"

We next examined NPR signaling in metabolic tissues from leptin receptor-deficient mice (db/db) that become spontaneously obese and T2D by the age of 8 weeks. In line with data in human skeletal muscle and HFD-fed mice, NPRA protein was down-regulated in skeletal muscle (Figure 4A) and white fat (Figure 4B) of db/db mice compared to control db/+ mice. In agreement with data in IGT/T2D individuals (Figure IE), we noted a remarkable up- regulation of NPRC in skeletal muscle (Figure 4A), as well as in white (Figure 4B) and brown (Figure 4C) fat of db/db mice. Overall the NPRA-to-NPRC protein ratio was markedly down- regulated in muscle and fat of db/db mice (Figure 4D), and associated with dramatically lower levels of plasma BNP in db/db mice (-80%, p<0.05) (Figure 4E). Importantly, muscle NPRC was negatively correlated with plasma BNP levels (Supplemental Table 3). These changes in NPR signaling and plasma NP characterized the "NP handicap" of db/db mice. No association was found between white and brown fat NPRC protein and plasma BNP levels (data not shown). Muscle NPRC was also positively related to fasting blood glucose, insulin and HbAlc (Supplemental Table 4), again suggesting a link between defective skeletal muscle NPR signaling and impaired glucose control. Collectively, these data suggest that obesity and T2D are accompanied by profound changes in NPR signaling in skeletal muscle contributing to reduce plasma BNP levels.

Chronic BNP infusion improves blood glucose control in obese diabetic mice

We next studied the influence of chronic (4 weeks) BNP infusion on blood glucose control in db/db mice. BNP was infused at a dose of 10 ng/kg/min to induce a nearly two fold increase in plasma BNP levels with the goal of rescuing the "NP handicap". Despite no change in body weight (Figure 5A) and composition (Figure 5B), BNP-treated db/db mice displayed significantly improved blood glucose control by reducing fasting plasma glucose (-21%) (Figure 5C) and HbAlc (-17%) (Figure 5D). This improved blood glucose control occurred in absence of noticeable changes in fasting insulin (Figure 5E). In addition insulin tolerance (Figure 5F) and insulin responsiveness (AAC ITT, area above the curve during the ITT, +36%, p=0.08) were improved in BNP-treated mice. In summary, chronic BNP treatment improves blood glucose control and peripheral insulin sensitivity in obese diabetic mice independently of changes in body weight, thus suggesting direct effect of NP on metabolic organs.

Enhanced insulin signaling, reduced lipotoxicity and increased lipid oxidative capacity in skeletal muscle of BNP-treated mice

We next studied the mechanism by which chronic BNP treatment improved blood glucose control and muscle insulin sensitivity in both HFD-fed and db/db mice. Insulin sensitivity is inhibited by the accumulation of toxic lipids such as diacylglycerols (DAG) and ceramides in skeletal muscle and liver (23, 24). No significant change in total DAG and ceramides was found in liver of BNP-treated db/db (Supplemental Figure 6A-B) and HFD-fed mice (Supplemental Figure 7A-B). No change as well in mRNA levels of genes involved in fat oxidation and glucose metabolism were not modified by BNP infusion in liver of db/db (Supplemental Figure 6C) and HFD-fed mice (Supplemental Figure 7C). Similarly, no change in the expression level of classical thermogenic genes in brown and white fat depots was observed in BNP-treated db/db (Supplemental Figure 8) and HFD-fed mice (Supplemental Figure 9). However, we observed a muscle-autonomous improvement of insulin-mediated Akt phosphorylation (p=0.02) (Figure 6A), which was paralleled by a reduced content of total ceramides (-17%) (Figure 6B) and sphingomyelin (-19%>) (Figure 6C) in skeletal muscle of BNP-treated HFD-fed mice, as well as a reduced content of total ceramides in db/db mice (52.4±4.4 vs. 40.0±5.1 ng^g protein for db/+ and db/db mice respectively, p<0.05). Total diacylglycerol content (ANOVA p<0.05) was also reduced in BNP-treated HFD-fed mice (Figure 6D). This lower lipotoxic pressure was paralleled by an up-regulation of muscle palmitate oxidation rate (+46%) (Figure 6E), and of PGCla mRNA levels in HFD-fed mice (Figure 6F) and in db/db mice (+32%, p=0.08). Collectively, the data indicate that chronic BNP treatment improves insulin sensitivity in skeletal muscle by reducing lipotoxicity and up- regulating fat oxidative capacity in a PGC la-dependent manner in obese and diabetic mice.

Chronic NP treatment reduces lipotoxicity and enhances lipid oxidative capacity in human primary myotubes

We previously demonstrated a functional NPR signaling in human primary myotubes

(19). Because NP are known to activate lipolysis in human adipocytes (25, 26), we here studied the acute effect of NP treatment on lipid metabolism. Acute treatment of myotubes with BNP did not influence lipid storage, endogenous TAG-derived fatty acid (FA) release (i.e. lipolysis) (Supplemental Figure 10A), and endogenous TAG-derived FA oxidation (Supplemental Figure 10B). We further tested whether NP could activate one of the rate-limiting enzymes of lipolysis. Acute BNP treatment of human myotubes did not influence hormone-sensitive lipase phosphorylation neither on the activating Ser660 residue (Supplemental Figure IOC) nor on the inhibitory Ser565 residue (Supplemental Figure 9D). In contrast, chronic treatment with NP for 3 days robustly reduced total lipid accumulation, total TAG and DAG content (one-way ANOVA p<0.001) (Figure 7A-C). In line with ex vivo muscle data in mice (Figure 6), reduced lipid accumulation was concomitant with an up-regulation of palmitate oxidation rate (+27% and +19% respectively for ANP and BNP treatment) (Figure 7D), and a significant induction of PGC-la gene expression (Figure 7E), which was independent of PPAR5 activation (Figure 7F). Based on the findings that muscle NPRA protein relates inversely with saturated ceramides content in human skeletal muscle (Figure 1C) and that chronic BNP treatment reduces ceramide content in skeletal muscle of HFD-fed mice (Figure 6B), we assessed the influence of chronic NP treatment on ceramide content in human primary myotubes. No significant effect of NP treatment on the content of total ceramides and various ceramide species (Supplemental Figure 11) was noticed in the basal condition with FA- free BSA treatment. When myotubes were challenged overnight with 500 μΜ of palmitate/BSA to induce ceramide production (2.7 fold, p=0.001), we observed a significant decrease of about 30%> in total and various ceramide species analyzed in response to chronic ANP and BNP treatment (Figure 7G). In summary, chronic NP treatment protects against lipotoxicity by up-regulating lipid oxidative capacity in human primary myotubes.

Discussion:

Although longitudinal prospective studies evoked that high baseline levels of plasma NP confer a reduced risk of developing T2D (5, 6), no study so far had demonstrated a mechanistic link between NP biological activity and T2D. We believe our data provide the first evidence that NPRA signaling in skeletal muscle is necessary for the maintenance of long-term insulin sensitivity by regulating lipid oxidative capacity and metabolism (Graphical abstract). Our data show for the first time that muscle NPRA signaling is impaired in the context of obesity and glucose intolerance in humans and mice. We also provide evidences that up- regulation of NPRC in muscle tissue can contribute to the "NP handicap" observed in T2D. Last but not least, increasing NP levels in obese and diabetic mice, with the goal to rescue the "NP handicap" and a normal NPRA signaling tissue response, markedly improves blood glucose control and insulin sensitivity in skeletal muscle. Over the last 15 years, cardiac NP have emerged as potent metabolic hormones (8, 14, 15). They were first studied for their unsuspected powerful lipolytic and lipid-mobilizing effect in human fat tissue. More recently they were shown to activate brown fat thermogenesis as well as to induce a "browning" of white fat cells through a p38 MAPK-ATF2 pathway (18). Our laboratory also reported functional NPRA signaling in human skeletal muscle cells that controls mitochondrial fat oxidative capacity (19). Although multiple studies investigated plasma NP levels in relation to various clinical variables and index of insulin sensitivity (27, 28), few studies have examined NPR signaling in metabolic tissues in the context of obesity and T2D. Thus despite previously reported associations between plasma NP levels and the risk of T2D (5, 6), the pathophysiological and mechanistic link between NP levels and T2D remains elusive. The goal of the present study was to examine, 1) NPR signaling in skeletal muscle of obese and diabetic humans and mice, and 2) how NPR signaling relates to metabolic dysfunction.

We first observed a significant positive association between muscle NPRA protein and insulin sensitivity measured by clamp in humans, at a dose that mainly reflects skeletal muscle insulin sensitivity. This observation is consistent with the negative association that we found between muscle NPRA and body fat, and between muscle NPRA and muscle total saturated ceramides content, two factors negatively influencing whole-body and muscle insulin sensitivity (23, 24). To our knowledge this is the first study reporting an association between skeletal muscle NPRA signaling and insulin sensitivity. This indicates that besides plasma NP levels, NPR signaling in skeletal muscle may influence insulin sensitivity. Additionally, muscle NPRA protein was dramatically down-regulated in obese individuals while increased in response to diet-induced weight loss and related improvement in insulin sensitivity. Although the biological factors modulating muscle NPRA protein content were not investigated in the current study, the data suggest that muscle NPRA behaves as a determinant of insulin sensitivity. Moreover, up-regulation of muscle NPRC as glucose tolerance deteriorates in obese subjects with impaired glucose tolerance and T2D can further repress biological activation of muscle NPRA and contribute to the "NP handicap" on the long-term. Considering that muscle mass represents up to 40% of total body weight, even a moderate increase in muscle NPRC expression could largely reduce plasma NP levels by an increased rate of clearance. Muscle NPRC might be induced by high blood insulin levels in obese subjects as glucose tolerance worsens independently of blood glucose concentrations as previously shown in adipose tissue (29). Importantly, these findings in human muscle were largely replicated in obese diabetic mice. NPRC protein content was increased in skeletal muscle, white fat, and brown fat of obese diabetic mice, but only muscle NPRC protein negatively correlated with plasma BNP levels, reflecting that an increased plasma BNP clearance by the muscle can contribute to the "NP handicap" observed in these mice. Our data are in line with other studies demonstrating that elevated NPRC mRNA levels in white fat relates to metabolic dysfunction in mice and humans (21, 30, 31). The "NP handicap" concept is supported by the fact that the half-life of NP in the blood circulation is substantially increased in NPRC knockout mice and the biological activity of NP significantly increased in target tissues (32).

Despite the observed link between muscle NPRA and insulin sensitivity, acute injection of BNP had no impact on fasting blood glucose, glucose tolerance and muscle insulin sensitivity in mice. Furthermore, no acute effect of NP on glucose uptake was observed in human primary myotubes. These findings are in agreement with at least one human study reporting no acute effect of BNP on insulin sensitivity and insulin secretion (33). However, previous studies reported that nitric oxide-mediated cGMP signaling could enhance glucose uptake in mouse skeletal muscle (34). It is likely that cGMP signaling in response to NP at the membrane and to nitric oxide within the cytosol are compartmentalized and do not activate the same downstream biological pathways (35). Altogether these data indicate that the link between NP signaling and insulin sensitivity observed in vivo is indirect. We therefore performed chronic BNP infusion studies in HFD-fed and obese diabetic db/db mice to assess the long-term influence of BNP treatment on blood glucose control and insulin sensitivity. BNP was preferred for infusion studies as it has a higher half-life than ANP (13). Strikingly, chronic BNP infusion, at doses mimicking a physiological increase of the peptide and targeted to rescue the "BNP handicap" and/or a normal tissue NPRA signaling response, very significantly improved blood glucose control in both mouse models of obesity-induced glucose intolerance and T2D. We observed over 20% reduction in fasting blood glucose levels as well as over 15% decrease in HbAlc which is clinically meaningful and strongly reduces the risk of T2D complications (36). Reduced blood glucose levels during fasting and upon oral glucose challenge occurred in absence of changes in blood insulin levels indicating an improved metabolic clearance of glucose and insulin sensitivity. These findings are in agreement with other studies showing that increasing plasma BNP levels either pharmacologically (22) and/or genetically (21) improves glucose tolerance in HFD-fed mice. In addition, although db/db and HFD-fed mice displayed improved blood glucose control despite no change in body weight and composition after BNP treatment, we noticed that BNP -treated mice resisted HFD-induced body weight gain due to a significantly reduced food intake. This is in agreement with at least one human study showing that BNP infusion inhibits food intake by reducing total and acylated ghrelin secretion (37). Although other peptides of the NP family such as C-type NP and uroguanylin have been shown to inhibit food intake (38, 39), these results require further research to unravel the mechanism by which BNP controls appetite and energy balance.

Improved blood glucose control and insulin sensitivity were independent of significant changes in total DAG and ceramides in liver, neither with noticeable changes in expression level of key metabolic genes in liver and thermogenic genes in white and brown fat of BNP- treated db/db and HFD-fed mice. However BNP -treated obese mice had an increased insulin- mediated Akt activation in skeletal muscle. Because Akt activation and phosphorylation is inhibited by lipotoxic lipids such as ceramides and DAG (23, 24), we measured ceramides and DAG in skeletal muscle. In agreement with the negative correlation found in humans between muscle NPRA and ceramides content, we found a reduced level of total ceramides and sphingomyelin in muscle of both HFD-fed and db/db mice chronically treated with BNP. Ceramides inhibit Akt activation and are produced de novo from saturated fatty acids and from sphingomyelin degradation (23). We also observed reduced muscle total DAG levels in BNP- treated mice. Interestingly, the reduced muscle lipotoxic lipid level was accompanied by a significant up-regulation of muscle fat oxidative capacity and PGC la gene expression. To demonstrate that elevated lipid oxidative capacity can reduce lipid accumulation, we chronically treated human primary myotubes with NP and showed increased palmitate oxidation rates and robustly reduced total lipid, TAG, and DAG accumulation. Chronic NP treatment also prevented palmitate-induced ceramide production in human primary myotubes. Although the precise mechanism was not investigated, it is likely that NP treatment reduces de novo ceramide production by increasing palmitate oxidation. We also show that NP-mediated elevated lipid oxidation involved the induction of PGC la which was independent of PPAR5 activation. We and others previously described a cGMP-dependent induction of PGC la gene expression by NP in white fat and skeletal muscle cells (18, 19). PPAR5 can be activated by lipid ligands derived from endogenous TAG lipolysis (40, 41). In contrast to what has been shown in human fat cell (25, 26), acute NP treatment of human primary myotubes did not influence the rate of lipolysis and TAG-derived FA oxidation or HSL phosphorylation at key regulatory sites.

In summary, our data provide the first evidences that NPRA signaling in skeletal muscle is pivotal for the maintenance of long-term insulin sensitivity by regulating lipid oxidative capacity through a PGC la-dependent pathway. We also provide convincing evidence that NPR signaling in skeletal muscle relates to insulin sensitivity and is disrupted in obese and diabetic humans and mice. Increasing plasma BNP levels in obese diabetic mice remarkably improves blood glucose control and could prove a novel therapeutic avenue for the management of T2D. Supplemental Table 1. Clinical characteristics of the subjects.

Lean Obese IGT/T2D

Sex (male/female) 6/3 5/4 6/4

Age (yrs) 23.8+0.8 23.7+0.8 46.7±3.4^c'^e

Body weight (kg) 68.3+3.3 87.7+6.3^b 103.3±4.1^c'^d

BMI (kg/m²) 22.5+0.5 32.9+0.5^c 34.3+1.2^C

Body fat (%) 19.7+2.5 27.9+2. l^a 30.1±1.4^C

GDR (mg.min^.kg ¹ FFM) 9.4+0.7 7.0+0.4^c 5.5+0.5^c'^d

Data are Mean + SEM. BMI: body mass index; GDR: glucose disposal rate; FFM: fat- mass. ^0.05, ^bp<0.01, ^cp<0.001 versus lean; ^0.05, ^ep<0.01 versus obese.

Supplemental Table 2. Correlation between muscle NPRA protein expression and biological variables in humans.

Human muscle NPRA 5

Variables r P

Body weight (kg) -0.46 0.06

BMI -0.46 0.05

HOMA-IR -0.48 0.04 10

rQUICKI 0.63 0.005

Fasting Insulin -0.52 0.03

BMI: body mass index; HOMA-IR: homeostasis model assessment of insulin resistance; revised QUICKI.

Supplemental Table 3. Correlation between log fasting plasma BNP and biological variables in db/+ and db/db mice.

Mouse Log [BNP]

Variables r P

Body weight (g) -0.69 0.0007

Fat Mass (%) -0.79 < 0.0001

Fasting glucose -0.76 < 0.0001

Fasting insulin -0.85 < 0.0001

HbAlc -0.70 0.0006

Fructosamines -0.82 < 0.0001

Muscle NPRC -0.59 0.02

Supplemental Table 4. Correlation between muscle NPRC protein expression and biological variables in db/+ and db/db mice.

Mouse muscle NPRC

Variables r P

Fasting glucose 0.64 0.011

Fasting insulin 0.61 0.016

HOMA-IR 0.63 0.012

HbAlc 0.65 0.009

Fructosamines 0.65 0.012

HOMA-IR: homeostasis model assessment of insulin resistance.

EXAMPLE 2 Clinical studies and human subjects

Cohort 1

The samples investigated in this paper were collected from 2006 to 2007 during the DiOGenes study, a pan-European randomized trial which was approved by the ethics committees of each of the 8 European centers participating to the program (NCT00390637). The DiOGenes project investigated the effects of diets with different content of protein and glycemic index on weight-loss maintenance and metabolic and cardiovascular risk factors after an 8-week calorie restriction phase, in obese/overweight individuals. Written informed consent was obtained from each patient according to the local ethics committee of the participating countries as previously described [1].

Healthy overweight (body mass index (BMI) >27 kg/m2) individuals, aged <65 years were eligible for the study. Exclusion criteria were BMI 45 kg/m2, liver or kidney diseases, cardiovascular diseases, diabetes mellitus type 1, special diets/eating disorders, systemic infections/chronic diseases, cancer within the last 10 years, weight change >3 kg within the previous 3 months, and other clinical disorders or use of prescription medication that might interfere with the outcome of the study.

A detailed description of inclusion and exclusion criteria has been published previously [2]. BMI was calculated by dividing weight in kilograms by the square of height in meters. Waist circumference was measured between the bottom of the ribs and the top of the hip bone. A detailed description of the DiOGenes intervention trial and main outcomes can be found in the core publication [1]. Briefly, among 1209 individuals screened, 932 entered a baseline clinical investigation day including anthropometric measures (height, weight, waist circumference, body composition), blood pressure measurements, fasting blood sampling, and subcutaneous adipose tissue biopsies were performed (at baseline and at the end of each phase). All procedures were standardized between the 8 study centers across Europe.

Cohort 2

Cohort 2 comprised 30 obese (BMI>30 kg/m2) otherwise healthy and 26 non-obese

(BMI<30 kg/m2) healthy women that have been described in detail previously [3]. All were pre-menopausal and free of continuous medication. They were investigated in the morning after an overnight fast in the midst of their menstrual cycle. Height, weight and waist circumference were determined. A venous blood sample was obtained for measurements of glucose and insulin and the values were used to calculate HOM A-IR [4] . An abdominal subcutaneous adipose tissue biopsy was obtained by needle aspiration as described [5].

Preparation of human isolated adipocytes

Samples of subcutaneous abdominal adipose tissue were obtained from overweight women (mean age 38 years; mean body mass index 25.1 kg/m2) undergoing reconstructive surgery at Rangueil hospital, Toulouse (France) under the agreement of INSERM guidelines and ethics committee. After removal, pieces of adipose tissue were placed in cooled, sterile plastic box and immediately transported to the laboratory. Then, adipose tissue was minced with scissors and digested by liberase (final concentration 15 μg/ml). Isolated adipocytes were obtained within 3h from the start of surgery. After filtration and washing as previously described [6], fat cell suspensions were diluted in the same medium as for digestion, but without liberase, i.e. Krebs - Ringer containing 15 mM sodium bicarbonate, 10 mM 4-(2- hydroxyethyl)-l-piperazineethanesulfonic acid and 3.5 % bovine serum albumin, pH was set at 7.4 after gassing with 95% C02/5% 02. The cell amount per incubation vial was equivalent to 27.6±3.0 mg lipid/400 μΐ for glucose uptake assays (without glucose and with 2 mM pyruvate), as determined by slight modifications of the method of Atgie et al. [7]. Culture of human multipotent adipose-derived stem cells

hMADS cells were cultured and maintained in proliferation medium (DMEM low glucose lg/1, 10% FBS, 2 mM L-glutamine, 10 mM HEPES buffer, 50 units/ml of penicillin, 50 mg/ml of streptomycin, supplemented with 2.5 ng/ml of human fibroblast growth factor 2 (FGF2)) as previously described [8]. The cells were inoculated in 6-well plates at a density of 44,000 cells/ml and kept at 37°C in 5% C02. Six days post-seeding, FGF2 was removed from proliferation medium. On the next day (day 0), the cells were incubated in differentiation medium (DM; serum-free proliferation medium/Ham's F-12 medium containing 10 μg/ml of transferrin, 10 nM of insulin, 0.2 nM triiodothyronine, 100 μΜ 3-isobutyl-l-methylxanthine, 1 μΜ dexamethasone and 100 nM rosiglitazone). At day 3, dexamethasone and 3-isobutyl-l- methylxanthine were omitted from DM and at day 10 rosiglitazone was also omitted. Human ANP or BNP treatment (100 nM) was carried out at day 14. Human FGF2, insulin, triiodothyronine, transferrin, 3-isobutyl-l-methylxanthine, and dexamethasone were from Sigma; L-glutamine, penicillin, and streptomycin from Invitrogen; Hepes, Dulbecco's modified Eagle medium low glucose, and Ham's F-12 medium from Lonza; and rosiglitazone from Alexis Biochemicals.

Gene microarrays

From adipose tissue biopsy total R A in Cohort 2, biotinylated complementary RNA was analyzed using the GeneChip Human Gene 1.0 ST Array (Affymetrix Inc., Santa Clara, CA). Slides were washed, stained, scanned and analyzed using standardized protocols (Affymetrix Inc.) as described previously [24]. Data are deposited at the National Center for Biotechnology Information Gene Expression Omnibus (GEO; http://ncbi.nim.nih.gov/geo) under the accession number GSE25402.

Microfluidic card

Total RNA was extracted from adipose tissue biopsies and RT-qPCR was performed using the FluidigmBioMark System as described in [25]. Briefly, cDNA was prepared from 500 ng of total RNA and diluted in water to 5 ng/μΐ (RNA equivalent). The reverse transcription step was checked using the 18S RNA expression level using StepOnePlus (Applied Biosystems). A multiplexed preamplification process was performed on every 1.25 μΐ cDNA using 14 cycle cDNA preamplification step (95°C for 15 sec and 60°C 4 min) and Taqman PreAmp Master Mix (Applied Biosystems) in a standard PCR thermocycler. Preamplified cDNA was diluted 1 :5 in 10 mM Tris, 1 mM EDTA (TE). Diluted cDNA (2.25 μΐ) was added to 2.5 μΐ Taqman Universal PCR Master Mix (Applied Biosystems) and 0.25 μΐ GE Sample Loading Reagent (Fluidigm). In a separate tube, 3.5 μΐ of Taqman Assay was added to 3.5 μΐ Sample Loading Reagent. Five μΐ cDNA samples were loaded into the sample inlet wells, and 5 μΐ assay samples were loaded into assay detector inlets. For each plate, 1 well was loaded with H20 as control for contamination. The chip was primed and placed into the NanoFlex Integrated fluidic circuit controller where 8 nl of cDNA and 1 nl of Assay were mixed. Real time PCR was run on the BioMark System (Fluidigm). Raw data obtained from the system's software using the default global threshold setting (BioMark Real-time PCR Analysis V2.1.1, Fluidigm) were checked using the graphical representation of the plate layout. PUMl, was found as the most stable gene using the geNorm algorithm [26], then raw Ct values were transformed to relative gene expression using the 2(AACt) method using PUMl mRNA level as reference.

Real-time qRT-PCR

Total RNA from cultured hMADS cells was isolated in RNeasy Lysis Buffer +/- mercaptoethanol reagent (Qiagen GmbH, Hilden, Germany). The quantity of the RNA was determined on a Nanodrop ND-1000 (Thermo Scientific, Rockford, IL, USA). Reverse transcriptase PCR was performed on a GeneAmp PCR System 9700 using the Multiscribe Reverse Transcriptase method (Applied Biosystems, Foster City, CA). Real-time quantitative PCR (qPCR) was performed to determine cDNA content. All primers were bought from Applied Biosystems. Primers used were : 18S (Taqman assay ID: Hs99999901_sl), ACC1 (Hs00167385_ml), FAS (Hs00188012_ml), ChREBP (Hs00975714_ml). ELOVL6, SYBR green primers, forward: CCATCCAATGGATGCAGGAAAAC; reverse: CCAGAGCACTAATGGCTTCCTC were purchased at Eurogentec. qPCR was then performed on a StepOnePLus real-time PCR system (Applied Biosystems). For each primer, a standard curve was made prior to mRNA quantification to assess the optimal total cDNA quantity. All expression data were normalized by the 2(AACt) method using 18S as internal control [25, 27].

Glucose uptake assay in isolated adipocytes

Fat cell suspensions were incubated with all tested agents for 45 min at 37°C in 400 μΐ final volume, with or without insulin or ANP. Then, an isotopic dilution of 2-deoxy-D- [3H]glucose (2-DG) was added to reach 50 nmol and 1,000,000 dpm/assay, and cells were incubated again for 10 min as previously described [28]. After stopping by addition of 100 μΜ cytochalasin B, cell suspension aliquots were centrifuged through diisononyl-phthalate layer to separate the adipocytes from the medium allowing counting the intracellular radioactive 2-DG, as an index of glucose uptake [29].

Glucose uptake assay in hMADS adipocytes

The day before the assay, insulin was removed from culture medium. After two washes with PBS, cells were incubated 50 min at 37°C without or with various concentrations of BNP (10-11 to 10-5 mol/1). Then, 125 μΜ 2-deoxy-D-glucose and 0.4 _μα 2-deoxy-D-[3H]glucose per well were added for 10 min incubation. Culture plates were put on ice and rinsed with 10 mM glucose in ice-cold PBS and then with ice-cold PBS. Cells were scraped in 0.05 N NaOH and 2-deoxy-D-glucose uptake was measured by liquid scintillation counting of cell lysate. Data are expressed as nanomoles per minute and were normalized per mg of protein [30].

Determination of glucose oxidation

The day before the assay, insulin was removed from culture medium. Cells were preincubated with a glucose- and serum- free medium for 90 min then exposed to DMEM low glucose (5.5 mM) supplemented with D-[U-14C]glucose (1 μ /πύ; PerkinElmer, Boston, MA) in the presence or absence of 100 nM insulin (Humulin®) for 3h. Following incubation, glucose oxidation rate was determined by measuring [14C]C02 by liquid scintillation counting as previously described [27].

Determination of glucose incorporation into glycerol and fatty acids

To determine glucose carbon incorporation into fatty acid and glycerol, neutral lipids were extracted after glucose oxidation as described above. They were dried and hydro lyzed in 1 ml 0.25 N NaOH in chloroform/methanol (1 : 1) for lh at 37°C. The solution was neutralized with 500 ml 0.5 N HC1 in methanol. FA and glycerol were separated by adding 1.7 ml chloroform, 860 ml water, and 1 ml chloroform/methanol (2: 1). Incorporation of 14C into glycerol and FA was measured by liquid scintillation counting of upper and lower phases, respectively. Specific activity was counted and used to determine the quantity of incorporated glucose equivalent. Data were normalized to total cell protein content.

Western blot

Differentiated hMADS cell lysates were extracted, transferred onto nitrocellulose membranes and blotted with the following primary antibodies (all from Cell Signaling Technology Inc., Beverly, MA): phospho-Akt Ser473 (#4060), phospho-Akt Thr308 (#2965), Akt (#4691), phospho-IRSl Tyr612 (#44816G), IRS1 (#3407), phospho-AS160 Thr642 (#4288), AS160 (#2670), phospho-p38 MAPK Thrl80/Tyrl82 (#921 1), and p38 MAPK (#9212), phospho-Raptor Ser792 (#2083), Raptor (#2280), phospho-Rictor Thrl l35 (#3606), Rictor (#2140), phospho-mTOR Ser2448 (#2971), mTOR (#2972), phospho-PDKl Ser241 (#3061), PDK1 (#3062). Immunoreactive proteins were detected by enhanced chemiluminescence reagent (SuperSignal West Dura or SuperSignal West Femto; Thermo Scientific), visualized using the ChemiDoc MP Imaging System and data analyzed using the Image Lab 4.1 version software (Bio-Rad Laboratories, Hercules, USA), a-tubulin (Sigma- Aldrich) was used as internal control.

Statistical analyses

All statistical analyses were performed using GraphPad Prism 5.0 for Windows (GraphPad Software Inc., San Diego, CA). Normal distribution and homogeneity of variance of the data were tested using Shapiro-Wilk and F tests, respectively. One-way ANOVA followed by Tukey's post-hoc tests and Student's t-tests were performed to determine differences between groups, interventions and treatments. Two-way ANOVA followed by Bonferonni's post hoc tests were applied when appropriate. Linear regression was performed after log transformation of nonparametric data. The false discovery rate for multiple testing was controlled by the Benjamini-Hochberg procedure with padj. values < 0.05 as threshold. All values in Figures and Tables are presented as mean ± SEM. Statistical significance was set at P < 0.05.

Results

Adipose NPR expression is altered in obesity and type 2 diabetes

NPRA and NPRC gene expression was investigated in human adipose tissue biopsy samples from Cohort 1. We observed a gradual down-regulation of adipose NPRA mRNA levels as a function of the obesity grade, with the lowest expression levels in subjects with BMI>40 kg/m2 (Figure 8A). In contrast, adipose NPRC mRNA levels were progressively higher as a function of BMI and were nearly doubled in subjects with BMI>40 kg.m-2 (Figure 8B). Thus the ratio of NPRA-to-NPRC gene expression was significantly reduced by 39% for BMI between 30 and 35 kg.m-2, and by 63% for BMI>40 kg.m-2 (Figure 8C). We also found a significant decrease in adipose NPRA expression in prediabetic (PreD, defined as impaired fasting glucose or glucose tolerance) and type 2 diabetic subjects compared to individuals with normal glucose tolerance (NGT) (Figure 8D). This association was independent of BMI as the average BMI was comparable between groups (NGT: 34.0±0.3, Pre-D: 34.2±0.4, T2D: 34.5±1.3 kg.m-2). Adipose NPRA mRNA levels were reduced as a function of the quartiles of HOMA-IR, demonstrating that the most insulin resistant individuals have the lowest NPRA gene expression in their adipose tissue (Figure 8E). In multivariate regression analyses, adipose NPRA levels correlated negatively with HOMA-IR (r=-0.20, p=0.008), even after adjustment for BMI (β=-0.123, padj.=0.031). No significant change in adipose NPRC levels was observed in prediabetic and diabetic subjects or as a function of quartiles of HOMA-IR. Finally, we observed a significant negative correlation (r=-0.26, p<0.0001) between adipose NPRA gene expression and fasting blood glucose at baseline (Figure 8F) which was independent of BMI (β=-0.229, padj.<0.0001). These data demonstrate a strong link between adipose NPR expression, obesity and blood glucose control.

Adipose NPRA expression relates to insulin sensitivity

The findings in Cohort 1 were validated in Cohort 2 showing a strong inverse relationship between adipose NPRA mRNA levels and HOMA-IR (Figure 9A). As whole-body insulin sensitivity has been linked to adipose GLUT4 and ChREBP expression [31, 32], we studied the relationships between these two genes and NPRA in cohort 2. NPRA was positively correlated with both GLUT4 (Figure 9B) and ChREBP (Figure 9C) mRNA levels in adipose tissue. Importantly, the correlation between NPRA, HOMA-IR,GLUT4 and ChREBP remained very significant even after statistical adjustment for BMI (Table 1). These robust associations were largely confirmed in cohort 1. Overall, our data indicate that adipose NPRA may be involved in the link between adipocyte glucose metabolism and whole-body insulin sensitivity.

Natriuretic peptides promote glucose uptake in human adipocytes

We assessed directly the effect of ANP on glucose uptake in human isolated adipocytes obtained from surgical samples. ANP dose-dependently activated glucose uptake with a 1.6 fold increase at doses of 10 and 100 nM (Figure 10A), and a 2.2 fold increase at the highest dose of 1 μΜ (data not shown). Of importance, ANP exhibited an additive effect on insulin stimulated-glucose uptake at lowest concentrations of 1 and 10 nM insulin (Figure 10B). To investigate the underlying molecular mechanism, we next switched to an established human adipocyte cell model system, i.e. human multipotent adipose-derived stem (hMADS) cells. This cell model has been previously used to study lipolysis and the browning process in response to NP [12, 33]. These cells express all the components of the NPR signaling pathway evidenced by the fact that NPRA was expressed at maximal levels early in the time-course of differentiation (day 3) and remained steady till the end of the differentiation process (day 13). NPRC and PRKGI (cGK-I) were expressed at lower levels throughout the time-course of differentiation. Similar to the findings in freshly isolated human adipocytes, ANP and BNP induced a dose-dependent increase in glucose uptake which resulted in a 1.5 and 2 fold maximal response in differentiated hMADS cells (Figure 11 A and B respectively). In comparison, the maximal insulin-induced glucose uptake was 2.5 about fold. ANP and BNP stimulated glucose uptake significantly starting from concentrations of 100 nM and upwards displaying EC50 of 0.24 and 0.53 μΜ, respectively. We next used BNP which is more stable than ANP for all subsequent experiments. Interestingly, BNP -induced glucose uptake was blunted in presence of (Rp)-8-pCPT-cGMPS 100 μΜ, a specific pharmacological inhibitor of cGK (Figure 11C). Collectively, these results indicate that NP promote glucose uptake in a cGMP-dependent manner in human adipocytes.

Natriuretic peptides activate Akt-signaling in human adipocytes

Glucose uptake in human adipocyte is mediated by the glucose transporter GLUT4 in response to insulin through activation of the IRS 1 -Akt-signaling pathway [34, 35]. Short-term treatment with BNP induced a time-dependent activation of Akt Ser473 phosphorylation, nearing 1.23 fold at 20 min and 3.7 fold at 60 min (p<0.0001). This effect was completely abolished by the cGK inhibitor (Rp)-8-pCPT-cGMPS. Similarly, BNP induced a 2-fold induction of Akt Thr308 phosphorylation that was totally abrogated by cGK inhibition. No change in IRS1 Tyr612 (data not shown) and 3-phosphoinositide-dependent protein kinase 1 (PDK1) phosphorylation were observed in response to acute NPs stimulation, indicating that the effect of NP is independent of that of the insulin signaling cascade. In line with this notion, BNP -mediated phosphorylation of Akt was associated with increased mTOR and Rictor phosphorylation, and reduced Raptor phosphorylation, indicating an activation of the mTORC2 and mTORCl complexes respectively. Finally, BNP-induced Akt activation was associated with a downstream activation of AS 160, a GTPase involved in GLUT4 translocation to the plasma membrane. As for Akt, BNP -mediated phosphorylation of AS 160 was totally abrogated by the addition of a pharmacological inhibitor of cGK. We also confirmed previous findings [12] showing that BNP treatment induces p38 MAPK (3.2 fold, p<0.0001) in a cGK-dependent manner. Interestingly, p38 MAPK phosphorylation was also induced by 8-bromo-cGMP (1.9 fold, p<0.01), a stable analog mimetic of cGMP (data not shown). In summary, our data demonstrate that NP promote glucose uptake through a cGK-dependent activation of mTORC2 and Akt signaling in human adipocytes. Natriuretic peptides enhance glucose metabolism in human adipocytes

We finally investigated the fate of the glucose taken up by the adipocytes in response to NP. BNP treatment induced both glucose oxidation (+19% versus control, p<0.05) (Figure 12A), and glucose incorporation into glycerol (+33% versus control, p<0.05) (Figure 12B) or fatty acids (+78% versus control, p<0.05) (Figure 12C). No significant change in mRNA levels of prototypical de novo lipogenic genes such as ChREBP, ACC 1 , FASN, and ELOVL6 was observed in response to 6h treatment with ANP or BNP.

ANP KO, insulin and glucose tolerance

Insulin and glucose tolerance tests were performed in wild-type (WT) and ANP knockout mice (KO) fed standard chow diet and high fat diet. Figure 13 shown that ANP KO mice are intolerants to insulin and glucose when they are fed with chow diet and high fat diet (Figure 13 A, B, C and D respectively). Table 1. Correlations between adipose NPRA gene expression and HOMA-IR, and adipose GLUT4 and ChREBP gene expression after adjustment for BMI.

NPRA BMI

Parameter Partial r p value Partial r p value

HOMA-IR -0.38 0.007 039 0.006

GLUT4 0.57 <0.0001 -0.18 0.19

ChREBP 0.57 0.0002 -0.13 0.37

Discussion:

Despite the robust inverse link between plasma NP levels, obesity and the incidence of T2D, no study has so far provided data showing a direct mechanistic link between NP signaling and glucose homeostasis in any target tissue. Herein, we provide some evidence that NP receptor expression, at least at the mRNA level, in adipose tissue is tightly related to blood glucose control and insulin sensitivity in different European populations. We further demonstrate a novel biological role of NP in human adipocytes where they directly promote glucose uptake and de novo lipogenesis in fat cells through a cGK-dependent pathway (Figure 7). Overall, our data suggest that NP signaling in human adipocytes is an important determinant of insulin sensitivity that is altered in obesity and T2D.

Previous studies have established that adipose tissue is a key target organ of NP [9, 11, 12, 22]. In this study, we took advantage of a large adipose tissue collection from cohort 1 to investigate NPR gene expression in the context of obesity and T2D. Due to the large sample size, we observed a very strong negative correlation between adipose NPRA gene expression and insulin resistance, suggesting that low adipose NPRA expression relates to low insulin sensitivity. In contrast, adipose NPRC mRNA levels were not associated with insulin resistance. Recent studies indicate that adipose glucose transporter-4 (GLUT4) and carbohydrate- responsive element binding protein (ChREBP) are major determinants of adipocyte and whole- body insulin sensitivity [31, 32]. In the current study, we found very robust relationships between adipose NPRA, HOMA-IR, GLUT4 and ChREBP mRNA levels in two independent cohorts. These relationships remained significant also after statistical adjustment for BMI in cohort 2, indicating that adipose NPRA behaves as a determinant of whole-body insulin sensitivity independently of body weight. In addition, we observed major differences in adipose tissue NPR expression in relation to degree of obesity and diabetic status. Due to paucity of tissue sample it was not possible to also measure protein expression. However previous studies in human adipose tissue suggest a close relationship. Thus, in agreement with recent studies [36-38] reporting on the mRNA and protein levels of NPRA and NPRC in obese and non-obese subjects and mice, NPRA expression was negatively and NPRC positively associated with BMI. Moreover, NPRA mRNA levels were lower in individuals with prediabetes and T2D compared with NGT subjects, an observation which fits well with previously reported animal studies in high-fat diet-fed and db/db mice [37, 39]. In light of the tight relationship observed between adipose NPRA and GLUT4, we next studied the effect of NP on glucose uptake in human adipocytes. We could first show that ANP dose-dependently activated glucose uptake in human isolated adipocytes. Although both the cGMP and the cAMP pathways promote lipolysis and browning of white adipocytes [5], they display contrasting effects with respect to glucose uptake which is inhibited by activating the cAMP-signaling pathway [40, 41]. Thus catecholamines inhibit glucose uptake by inducing lipolysis and facilitating the dissociation of the mTORCl/2 complex [41]. In the current study, we provide evidence that NP -mediated glucose uptake is independent of insulin and requires downstream cGMP-signaling since pharmacological inhibition of cGK blunts NP-mediated glucose uptake. Although, cGMP has been shown to mediate glucose uptake in skeletal muscle [42], this is the first study reporting that activation of cGMP-signaling by NP promotes glucose uptake in human adipocytes in a cGK-dependent manner. Interestingly, NP exhibited an additive effect on insulin- stimulated glucose uptake at low concentrations. This likely suggests that both pathways converge toward a common molecular target.

Insulin promotes glucose uptake in skeletal muscle cells and adipocytes through activation of the phosphadityl-inositol-3 -kinase/ Akt pathway leading to GLUT4 translocation to the plasma membrane [34, 35]. We here demonstrate that BNP treatment in hMADS adipocytes induces Akt phosphorylation at both Thr308 and Ser473 residues. Again this effect appears to be mediated by cGMP since pharmacological blockade of cGK completely abrogated BNP -mediated Akt phosphorylation. BNP -mediated Akt phosphorylation at Ser473 could also be potentiated by mTORC2 which is induced by BNP through phosphorylation of mTOR and Rictor. We confirmed that BNP -mediated cGMP signaling induced other downstream targets such as p38 MAPK phosphorylation in hMADS adipocytes as previously described [12]. Interestingly, BNP -mediated Akt activation was accompanied by an elevated phosphorylation of the Rab GTPase-activating protein AS 160 (also termed TBC1D4), which coordinates GLUT4 translocation to the plasma membrane in adipocytes and myocytes [43, 44]. Of interest, BNP did not affect the phosphorylation state of IRS 1 on the activating Tyr612 residue nor the upstream activator of Akt PDK1, thereby confirming that BNP and insulin have independent effects on glucose uptake.

Considering the tight relationship observed between adipose NPRA and ChREBP mRNA levels, we examined the fate of the glucose taken up by adipocytes in response to NP. We could demonstrate that about one third of the glucose taken up by the adipocyte was directed toward glucose oxidation while the remaining two thirds were incorporated into the glycerol backbone for triglyceride synthesis. Of interest, the fraction of glucose oxidized in response to NP treatment served for de novo production of fatty acids, i.e. de novo lipogenesis. Thus activation of NP signaling in adipocytes enhances de novo lipogenesis. No significant changes in prototypical genes of de novo lipogenesis were observed after NP treatment indicating that NP-mediated de novo lipogenesis likely results from NP-mediated glucose uptake independently of the transcriptional activity of the glucose-regulated transcription factor ChREBP. In light of the potent lipolytic effect of NPs previously observed in human adipocytes [8], it may seem paradoxical that NP can also trigger glucose uptake. Although speculative, this could reflect some sort of futile cycle by which NP enhances first glucose uptake and de novo lipogenesis, and then promotes triglyceride breakdown through lipolysis and fatty acid oxidation. This could also be viewed as a mechanism to prime the Krebs cycle and induce ATP production to sustain higher rates of lipolysis. The effect of NP on glucose uptake is also consistent with their browning effect in white adipocytes as glucose is an important substrate for brown adipocytes [12], and this futile cycle glucose uptake/lipolysis could provide an additional energy dissipating process in beige/brown adipocytes [45]. Indeed, futile cycling between de novo lipogenesis and fatty acid oxidation has been shown to be induced in adipose tissues during cold exposure or stimulation with a β-adrenergic agonist as recently discussed [46]. Such a dual effect on glucose uptake and lipolysis has also been observed in rat adipocytes treated with β-sitosterol [47]. In summary, our data suggest an important role of NPs in regulating adipocyte glucose metabolism and insulin sensitivity in humans. This occurs through NPRA in a cGMP-dependent manner and independently of the insulin pathway. Our clinical data also argue that adipose NPRA expression is tightly associated with whole-body insulin sensitivity. Future studies should investigate if increasing NPRA activation specifically in adipose tissue improves systemic insulin sensitivity before considering NPRA activation as a potential target to improve blood glucose control and insulin sensitivity.

REFERENCES:

Throughout this application, various references describe the state of the art to which this invention pertains. The disclosures of these references are hereby incorporated by reference into the present disclosure.

1. Arnlov, J., Ingelsson, E., Sundstrom, J., and Lind, L. 2010. Impact of body mass index and the metabolic syndrome on the risk of cardiovascular disease and death in middle- aged men. Circulation 121 :230-236.

2. Arnlov, J., Sundstrom, J., Ingelsson, E., and Lind, L. 2011. Impact of BMI and the metabolic syndrome on the risk of diabetes in middle-aged men. Diabetes Care 34:61-65.

3. Wang, T.J., Larson, M.G., Keyes, M.J., Levy, D., Benjamin, E.J., and Vasan, R.S. 2007. Association of plasma natriuretic peptide levels with metabolic risk factors in ambulatory individuals. Circulation 115: 1345-1353.

4. Wang, T.J., Larson, M.G., Levy, D., Benjamin, E.J., Leip, E.P., Wilson, P.W., and Vasan, R.S. 2004. Impact of obesity on plasma natriuretic peptide levels. Circulation

109:594-600.

5. Magnusson, M., Jujic, A., Hedblad, B., Engstrom, G., Persson, M., Struck, J., Morgenthaler, N.G., Nilsson, P., Newton-Cheh, C, Wang, T.J., et al. 2012. Low plasma level of atrial natriuretic peptide predicts development of diabetes: the prospective Malmo Diet and Cancer study. The Journal of clinical endocrinology and metabolism 97:638-645.

6. Lazo, M., Young, J.H., Brancati, F.L., Coresh, J., Whelton, S., Ndumele, C.E., Hoogeveen, R., Ballantyne, CM., and Selvin, E. 2013. NH2-terminal pro-brain natriuretic peptide and risk of diabetes. Diabetes 62:3189-3193.

7. Mora, C. 2013. Natriuretic peptides and fat metabolism. Curr Opin Clin Nutr Metab Care 16:645-649.

8. Wang, T.J. 2012. The natriuretic peptides and fat metabolism. N Engl J Med 367:377-378.

9. Mora, C, and Smith, S.R. 2009. Natriuretic peptides: new players in energy homeostasis. Diabetes 58:2726-2728.

10. Potter, L.R., Abbey-Hosch, S., and Dickey, D.M. 2006. Natriuretic peptides, their receptors, and cyclic guanosine monophosphate-dependent signaling functions. Endocrine reviews 27:47-72.

11. Gardner, D.G. 2003. Natriuretic peptides: markers or modulators of cardiac hypertrophy? Trends Endocrinol Metab 14:411-416. 12. Kuhn, M. 2003. Structure, regulation, and function of mammalian membrane guanylyl cyclase receptors, with a focus on guanylyl cyclase-A. Circ Res 93:700-709.

13. Potter, L.R. 2011. Natriuretic peptide metabolism, clearance and degradation. The FEBS journal 278: 1808-1817.

14. Mora, C, and Lafontan, M. 2013. Natriuretic peptides and cGMP signaling control of energy homeostasis. Am J Physiol Heart Circ Physiol 304:H358-368.

15. Collins, S. 2014. A heart-adipose tissue connection in the regulation of energy metabolism. Nat Rev Endocrinol 10: 157-163.

16. Mora, C, Crampes, F., Sengenes, C, De Glisezinski, I., Galitzky, J., Thalamas, C, Lafontan, M., and Berlan, M. 2004. Atrial natriuretic peptide contributes to physiological control of lipid mobilization in humans. FASEB journal : oj icial publication of the Federation of American Societies for Experimental Biology 18:908-910.

17. Sengenes, C, Berlan, M., De Glisezinski, I., Lafontan, M., and Galitzky, J. 2000. Natriuretic peptides: a new lipolytic pathway in human adipocytes. FASEB journal : official publication of the Federation of American Societies for Experimental Biology 14: 1345-1351.

18. Bordicchia, M., Liu, D., Amri, E.Z., Ailhaud, G., Dessi-Fulgheri, P., Zhang, C, Takahashi, N., Sarzani, R., and Collins, S. 2012. Cardiac natriuretic peptides act via p38 MAPK to induce the brown fat thermogenic program in mouse and human adipocytes. The Journal of clinical investigation 122 : 1022- 1036.

19. Engeli, S., Birkenfeld, A.L., Badin, P.M., Bourlier, V., Louche, K., Viguerie, N.,

Thalamas, C, Montastier, E., Larrouy, D., Harant, I., et al. 2012. Natriuretic peptides enhance the oxidative capacity of human skeletal muscle. J Clin Invest 122:4675-4679.

20. Sengenes, C, Zakaroff-Girard, A., Moulin, A., Berlan, M., Bouloumie, A., Lafontan, M., and Galitzky, J. 2002. Natriuretic peptide-dependent lipo lysis in fat cells is a primate specificity. American journal of physiology. Regulatory, integrative and comparative physiology 283:R257-265.

21. Miyashita, K., Itoh, FL, Tsujimoto, FL, Tamura, N., Fukunaga, Y., Sone, M., Yamahara, K., Taura, D., Inuzuka, M., Sonoyama, T., et al. 2009. Natriuretic peptides/cGMP/cGMP-dependent protein kinase cascades promote muscle mitochondrial biogenesis and prevent obesity. Diabetes 58:2880-2892.

22. Plante, E., Menaouar, A., Danalache, B.A., Broderick, T.L., Jankowski, M., and Gutkowska, J. 2014. Treatment with brain natriuretic peptide prevents the development of cardiac dysfunction in obese diabetic db/db mice. Diabetologia 57: 1257-1267. 23. Chavez, J. A., and Summers, S.A. 2012. A ceramide-centric view of insulin resistance. Cell Metab 15:585-594.

24. Samuel, V.T., and Shulman, G.I. 2012. Mechanisms for insulin resistance: common threads and missing links. Cell 148:852-871.

25. Mora, C, Galitzky, J., Sengenes, C, Crampes, F., Lafontan, M., and Berlan, M.

2004. Functional and pharmacological characterization of the natriuretic peptide-dependent lipolytic pathway in human fat cells. The Journal of pharmacology and experimental therapeutics 308:984-992.

26. Sengenes, C, Bouloumie, A., Hauner, H., Berlan, M., Busse, R., Lafontan, M., and Galitzky, J. 2003. Involvement of a cGMP-dependent pathway in the natriuretic peptide - mediated hormone-sensitive lipase phosphorylation in human adipocytes. The Journal of biological chemistry 278:48617-48626.

27. Walford, G.A., Ma, Y., Christophi, C.A., Goldberg, R.B., Jarolim, P., Horton, E., Mather, K.J., Barrett-Connor, E., Davis, J., Florez, J.C., et al. 2014. Circulating natriuretic peptide concentrations reflect changes in insulin sensitivity over time in the Diabetes Prevention Program. Diabetologia 57:935-939.

28. Khan, A.M., Cheng, S., Magnusson, M., Larson, M.G., Newton-Cheh, C, McCabe, EX., Coviello, A.D., Florez, J.C., Fox, C.S., Levy, D., et al. 2011. Cardiac natriuretic peptides, obesity, and insulin resistance: evidence from two community-based studies. The Journal of clinical endocrinology and metabolism 96:3242-3249.

29. Pivovarova, O., Gogebakan, O., Kloting, N., Sparwasser, A., Weickert, M.O., Haddad, I., Nikiforova, V.J., Bergmann, A., Kruse, M., Seltmann, A.C., et al. 2012. Insulin up- regulates natriuretic peptide clearance receptor expression in the subcutaneous fat depot in obese subjects: a missing link between CVD risk and obesity? The Journal of clinical endocrinology and metabolism 97:E731-739.

30. Sarzani, R., Dessi-Fulgheri, P., Salvi, F., Serenelli, M., Spagnolo, D., Cola, G., Pupita, M., Giantomassi, L., and Rappelli, A. 1999. A novel promoter variant of the natriuretic peptide clearance receptor gene is associated with lower atrial natriuretic peptide and higher blood pressure in obese hypertensives. JHypertens 17: 1301-1305.

31. Sarzani, R., Strazzullo, P., Salvi, F., Iacone, R., Pietrucci, F., Siani, A., Barba,

G., Gerardi, M.C., Dessi-Fulgheri, P., and Rappelli, A. 2004. Natriuretic peptide clearance receptor alleles and susceptibility to abdominal adiposity. Obes Res 12:351-356.

32. Matsukawa, N., Grzesik, W.J., Takahashi, N., Pandey, K.N., Pang, S., Yamauchi, M., and Smithies, O. 1999. The natriuretic peptide clearance receptor locally modulates the physiological effects of the natriuretic peptide system. Proceedings of the National Academy of Sciences of the United States of America 96:7403-7408.

33. Heinisch, B.B., Vila, G., Resl, M., Riedl, M., Dieplinger, B., Mueller, T., Luger, A., Pacini, G., and Clodi, M. 2012. B-type natriuretic peptide (BNP) affects the initial response to intravenous glucose: a randomised placebo-controlled cross-over study in healthy men. Diabetologia 55: 1400-1405.

34. Deshmukh, A.S., Long, Y.C., de Castro Barbosa, T., Karlsson, H.K., Glund, S., Zavadoski, W.J., Gibbs, E.M., Koistinen, H.A., Wallberg-Henriksson, H., and Zierath, J.R. 2010. Nitric oxide increases cyclic GMP levels, AMP-activated protein kinase (AMPK)alphal- specific activity and glucose transport in human skeletal muscle. Diabetologia 53: 1142-1150.

35. Nikolaev, V.O., Gambaryan, S., and Lohse, M.J. 2006. Fluorescent sensors for rapid monitoring of intracellular cGMP. Nat Methods 3:23-25.

36. DeFronzo, R.A., and Abdul-Ghani, M. 2011. Assessment and treatment of cardiovascular risk in prediabetes: impaired glucose tolerance and impaired fasting glucose. Am J Cardiol 108:3B-24B.

37. Vila, G., Grimm, G., Resl, M., Heinisch, B., Einwallner, E., Esterbauer, H., Dieplinger, B., Mueller, T., Luger, A., and Clodi, M. 2012. B-Type Natriuretic Peptide Modulates Ghrelin, Hunger, and Satiety in Healthy Men. Diabetes.

38. Yamada-Goto, N., Katsuura, G., Ebihara, K., Inuzuka, M., Ochi, Y., Yamashita, Y., Kusakabe, T., Yasoda, A., Satoh-Asahara, N., Ariyasu, H., et al. 2013.

Intracerebroventricular administration of C-type natriuretic peptide suppresses food intake via activation of the melanocortin system in mice. Diabetes 62: 1500-1504.

39. Valentino, M.A., Lin, J.E., Snook, A.E., Li, P., Kim, G.W., Marszalowicz, G., Magee, M.S., Hyslop, T., Schulz, S., and Waldman, S.A. 2011. A uroguanylin-GUCY2C endocrine axis regulates feeding in mice. J Clin Invest 121 :3578-3588.

40. Badin, P.M., Loubiere, C, Coonen, M., Louche, K., Tavernier, G., Bourlier, V., Mairal, A., Rustan, A.C., Smith, S.R., Langin, D., et al. 2012. Regulation of skeletal muscle lipolysis and oxidative metabolism by the co-lipase CGI-58. J Lipid Res 53:839-848.

41. Tang, T., Abbott, M.J., Ahmadian, M., Lopes, A.B., Wang, Y., and Sul, H.S. 2013. Desnutrin/ATGL activates PPARdelta to promote mitochondrial function for insulin secretion in islet beta cells. CellMetab 18:883-895.

42. Badin, P.M., Louche, K., Mairal, A., Liebisch, G., Schmitz, G., Rustan, A.C., Smith, S.R., Langin, D., and Mora, C. 2011. Altered skeletal muscle lipase expression and activity contribute to insulin resistance in humans. Diabetes 60: 1734-1742. 43. Riou, M.E., Pigeon, E., St-Onge, J., Tremblay, A., Marette, A., Weisnagel, S.J., and Joanisse, D.R. 2009. Predictors of cardiovascular fitness in sedentary men. Appl Physiol Nutr Metab 34:99-106.

44. Galgani, J.E., Vasquez, K., Watkins, G., Dupuy, A., Bertrand-Michel, J., Levade, T., and Mora, C. 2013. Enhanced Skeletal Muscle Lipid Oxidative Efficiency in

Insulin-Resistant vs Insulin- Sensitive Nondiabetic, Nonobese Humans. J Clin Endocrinol Metab.

45. Bergstrom, J. 1975. Percutaneous needle biopsy of skeletal muscle in physiological and clinical research. Scand J Clin Lab Invest 35:609-616.

46. DeFronzo, R.A., Tobin, J.D., and Andres, R. 1979. Glucose clamp technique: a method for quantifying insulin secretion and resistance. Am J Physiol 237:E214-223.

47. Vila, I.K., Badin, P.M., Marques, M.A., Monbrun, L., Lefort, C, Mir, L., Louche, K., Bourlier, V., Roussel, B., Gui, P., et al. 2014. Immune cell Toll-like receptor 4 mediates the development of obesity- and endotoxemia-associated adipose tissue fibrosis. Cell Rep 7: 1116-1129.

48. Badin, P.M., Vila, I.K., Louche, K., Mairal, A., Marques, M.A., Bourlier, V., Tavernier, G., Langin, D., and Mora, C. 2013. High-fat diet-mediated lipotoxicity and insulin resistance is related to impaired lipase expression in mouse skeletal muscle. Endocrinology 154: 1444-1453.

49. Bligh, E.G., and Dyer, W.J. 1959. A rapid method of total lipid extraction and purification. Can JBiochem Physiol 37:911-917.

50. Barrans, A., Collet, X., Barbaras, R., Jaspard, B., Manent, J., Vieu, C, Chap, H., and Perret, B. 1994. Hepatic lipase induces the formation of pre -beta 1 high density lipoprotein (HDL) from triacylglycerol-rich HDL2. A study comparing liver perfusion to in vitro incubation with lipases. J Biol Chem 269: 11572-11577.

51. Vieu, C, Terce, F., Chevy, F., Rolland, C, Barbaras, R., Chap, H., Wolf, C, Perret, B., and Collet, X. 2002. Coupled assay of sphingomyelin and ceramide molecular species by gas liquid chromatography. J Lipid Res 43:510-522.

52. Ukropcova, B., McNeil, M., Sereda, O., de Jonge, L., Xie, H., Bray, G.A., and Smith, S.R. 2005. Dynamic changes in fat oxidation in human primary myocytes mirror metabolic characteristics of the donor. J Clin Invest 115 : 1934- 1941.

Claims

CLAIMS:

1. A method of treating obesity and complications arising therefrom including type 2 diabetes in a subject in need thereof comprising chronically administering the subject with a therapeutically effective amount of a natriuretic peptide.

2. The method of claim 1 for improving blood glucose control, enhancing insulin signaling in skeletal muscle and adipose tissue reducing lipotoxicity in skeletal muscle, increasing lipid oxidative capacity in skeletal muscle and adipose tissue, or maintaining long-term insulin sensitivity in the subject.

3. The method of claim 1 wherein the natriuretic peptide is selected from the group consisting of atrial natriuretic peptide (ANP(99-126)), brain natriuretic peptide (BNP), C-type natriuretic peptide (CNP), Dendroaspis natriuretic peptide (DNP), urodilatin (URO, or ularitide), and any fragments of the prohormone ANP(1-126) or BNP precursor polypeptide.

4. The method of claim 1 wherein chronic administration results from continuous infusion, either intravenously or subcutaneously; the use of a pump or metering system, either implanted or external, for continuous or intermittent delivery; or by the use of an extended release, slow release, sustained release or long acting formulation that is administered.

5. The method of claim 1 wherein the natriuretic peptide is prepared with a carrier that will protect the peptide against rapid release, such as a controlled release formulation, including implants, and microencapsulated delivery systems.