WO2016125940A1 - 세포내 대안적 텔로미어 유지 활성에 관여하는 엘리먼트 및 그 용도 - Google Patents
세포내 대안적 텔로미어 유지 활성에 관여하는 엘리먼트 및 그 용도 Download PDFInfo
- Publication number
- WO2016125940A1 WO2016125940A1 PCT/KR2015/001315 KR2015001315W WO2016125940A1 WO 2016125940 A1 WO2016125940 A1 WO 2016125940A1 KR 2015001315 W KR2015001315 W KR 2015001315W WO 2016125940 A1 WO2016125940 A1 WO 2016125940A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- alt
- polynucleotide
- seq
- sequence
- ttaggc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/136—Screening for pharmacological compounds
Definitions
- the present application relates to the mechanisms involved in telomere length extension in cells, the involvement of which relates to nucleic acid sequences and their use.
- telomeres are repeating sequences located at the ends of chromosomes, which limit the number of divisions of cells to an appropriate level based on their length, and when the telomere length becomes shorter than the appropriate level, the cells stop dividing. Thus, telomeres prevent the continuous division of normal cells, thereby inhibiting normal cells from developing into cancer cells.
- cancer cells have a mechanism for maintaining sufficient telomere length to continuously divide beyond a limited number of divisions, and currently known mechanisms include telomer synthesis and telomerase activation through telomerase activity and alternative lengthening mechanisms.
- Telomere ALT
- This mechanism is an important target of cancer treatment because cancer cells continue to divide through telomerase or telomeres maintenance mechanism by ALT under certain conditions. Therefore, it is very important to determine whether cancer cells are ALT or telomerase positive. In addition, it is necessary to develop cancer treatment by identifying telomerase maintenance mechanism.
- telomere length retention mechanism It is herein an alternative telomere length retention mechanism and its use.
- the present application comprises three types of unit sequences of (TTAGGC) x (TCAGGC) y (TTAGGC) z in each of the 5 'and / or 3' of the polynucleotide of SEQ ID NO: 1 to the polynucleotide of SEQ ID NO: Polynucleotides comprising a first sequence (eg T-ALT 1); Or a second sequence comprising three types of unit sequences of (TTAGGC) l (TTAGTA or TTAGTC) m (TTAGGC) n in each of 5 ′ and / or 3 ′ of the polynucleotide of SEQ ID NO: 2 in the polynucleotide of SEQ ID NO: 2 A sequence selected from polynucleotides comprising a sequence (eg, T-ALT 2), wherein the order of the three types of unit sequences in the first sequence and the second sequence, respectively, is random, and the x, y, z, l, m and n
- the T-ALT element according to the present invention is present in the proximal to telomere present on the chromosome of a nematode or cell, and in one embodiment, each of the three types of unit sequences may be lacking or repeating. For example, it may be changed depending on the degree of activity of the ALT is not particularly limited, for example, the x, y, z, l, m and n may be 0 or an integer between 1 and 100, respectively.
- the element according to the present application may be applied to various biological samples and usefully used for detecting ALT positive cancer, and in this aspect, the present disclosure provides a composition for detecting ALT positive cancer, including a polynucleotide or an element detecting element according to the present application. do.
- the application has identified mechanisms of ALT and elements involved therein, in which aspect the present invention also provides a method for providing a nematode; Exposing the nematodes to an environment that may cause cancer; Treating a test substance that is expected to inhibit the maintenance of telomeres to the nymphs before, after or with exposure to the cancer causing environment; And detecting a T-ALT (Template-Alternative Lengthening of Telomere) element from the control group treated with the test substance and the control group not treated with the test substance.
- T-ALT Temporative Lengthening of Telomere
- the present disclosure provides a method for measuring the ALT activity of a nematode, the method comprising the steps of providing DNA from a nematode; Amplifying a T-ALT element from the DNA; And quantitatively or qualitatively detecting the amplified product, wherein the presence of the amplified product, ALT, indicates ALT activity.
- the present application discloses T-ALT elements that act on alternative telomere length retention mechanisms and their use.
- the element according to the present application can be used as a marker for detecting intracellular ALT activity or useful for screening of cancer drug substances. Also, it is possible to identify cancer cells that depend on ALT, develop customized therapies for cancer cells, study ALT positive cancer, It can be usefully used for ALT mechanism research.
- FIG. 1 relates to the isolation of stable ALT survivors in nymphs with specific telomere sequences.
- Figure 1a schematically shows the experimental process for this
- Figure 1b is a result of quantitative analysis of the telomeres of surviving individuals CB4856 trt-1, pot-2 (tm1400), CS1 and CS2 using FISH as a result of telomeres in embryos Detection was performed using a Cy-3-TTAGGC * 3 PNA probe (red), DNA was counterstained with DAPI (blue), the top panel represents the representative value of each survivor, and the statistic was T-test (* P-value). ⁇ 0.0001) and mean values are indicated by red bars.
- Figure 1C shows N2, CB4856, pot-1 (tm1620), pot-2 (tm1400), and all cleaved by a combination of restriction enzymes that recognize and cut six nucleic acids NheI, DraI, ApaI, NdeI, XhoI, NcoI and SacI TRF analysis of CS survivors is shown, probed with DIG-TTAGGC * 4, and pot-1 (tm1620) and pot-2 (tm1400) were used as positive controls for long telomeres.
- 1D shows the results of TRF analysis on CS survivors probed with DIG-TTAGGC * 4 after CB4856, CB4856 trt-1, and HinfI cleavage.
- FIG. 2 shows the result that the surviving entity used the T-ALT1 element as the ALT.
- FIG. 2A shows the associated heatmap of CB4856 SNVs maintained after crossbreeding, and the right panel is an enlarged photograph of the vicinity of the T-ALT locus of the V chromosome.
- 2B shows the fold shifted from the mean readdepth plot of CS survivors (CS1x4-1, CS1x4-2 and CS2x4) that were crosscrossed with CB4856 trt-1, N2 trt-1, CS1, CS2 and N2.
- FIG. 2C is a reconstruction (red bar) reconstructed from the readout, whereby a pair was aligned to T-ALT 1 to determine the locus of the genome, Southern blot using single-point PCR and T-ALT 1 probe of CB4856.
- FIG. 2d is a FISH result using the T-ALT 1 probe and telomere probe in the embryo stage, the scale bar is 10 ⁇ m, DAPI; Green, T-ALT 1; Red, telomeres.
- Figure 2e is a DNA cut with a restriction enzyme indicated by the result of TRF analysis using a T-ALT 1 probe and a telomer probe and hybridized with the indicated probe, abbreviations as follows: RE, restriction endonuclease; C, CB4856 trt-1; S, CS1 survivor; H, HindIII; B, BamHI; Nc, NcoI; Nd, NdeI; Nh, NheI; S, SacI; Mixture of Mix, HindIII, BamHI, NcoI, NdeI, NheI and SacI.
- RE restriction endonuclease
- C CB4856 trt-1
- S CS1 survivor
- H HindIII
- B BamHI
- Nc NcoI
- Nd NdeI
- Nh NheI
- S SacI
- Mixture of Mix HindIII, BamHI, NcoI, NdeI, NheI and SacI.
- FIG. 3 shows the results of analyzing N2 survivors using T-ALT 2 as ALT.
- Figure 3a is a trf analysis of telomeres of N2 survivors were digested genomes of N2 trt-1 and NS survivors (NS1 to NS5) with the indicated restriction enzymes and then hybridized with (TTAGGC) * 4 repeat sequence, the arrow is cleaved T-ALT 2 element.
- Figure 3b shows the changed fold in the mean read depth plots of N2 trt-1 and N2 survivors, which were changed in the mean read depth of the parent N2 trt-1 (grey bar) to correct for variations due to strain specific changes.
- FIG. 3C shows the result of TRF analysis for N2 survivor telomeres. DNA was digested with HinfI and hybridized with (TTAGGC) * 4 probe, and the probe was removed for the same blot and re-hybridized with T-ALT 2 specific probe. .
- 3D shows the results of FISH analysis using T-ALT and telomere probes in embryos of CB4856 trt-1, N2 trt-1 and all survivors, with scale bars 10 ⁇ m; Blue, DAPI; Green, T-ALT; Red, telomeres.
- 4 shows that cis-cloning of the T-ALT donor into the proximal telomeres followed by trans-cloning to other chromosomal ends following the ALT mechanism.
- 4A shows the folds changed from the average coverage of SNVs (WBvar00067712 and WBvar00067717) derived from WGS data of N2 trt-1, CB4856 trt-1, CS1 and CS2, with N2 alleles (blue) and CB4856 (red) alleles Are plotted individually, and because of the large differences in values, they do not represent the Y-axis and the middle is omitted.
- SNVs WBvar00067712 and WBvar00067717
- CB4856-derived SNVs are located at the right end of chromosome V of CB4856, not N2, and designed to bind single-point PCR primers (chromosome V, cccaccggaaacgaataaat) and proximal telomeres of T-ALT 1 Primer pair (red arrow) (Reverse 5'-AACAAGCTTCTGGCACGTCT-3'SEQ ID NO. 4, Forward 5'-GAAGGATGGGATGGAACTGA-3'SEQ ID NO. 3), and the top panel was repeated with the T-ALT 1 element and surroundings.
- Telomeres black boxes
- asterisks represent CB4856 SNVs
- dotted portions represent dielectric positions and abbreviations as follows: CB, CB4856; Rev, reverse primer;
- 4C shows the nucleotide changes of WBvar00067712 and WBvar00067717 of internal and telomeres T-ALT 1, with the N2 alleles in blue, the CB alleles in red, and the positions of the nucleotides are indicated in panel B.
- FIG. FIG. 4D is a schematic representation of T-ALT 2 on the N2 genome, wherein the primers used in FIG.
- FIG. 4E shows that the CB4856 wild type isolate lacks the T-ALT 2 reservoir, and PCR amplification products using the indicated primers were electrophoresed and stained with aceticium bromide, abbreviated as follows: N2, N2; CB, CB4856.
- 4F is the variant read count value obtained from WGS data of CB4856 trt-1, N2 trt-1 and all NS survivors, which were normalized to the total sequence coverage for each sample.
- 4G shows a feasible model, wherein the internal dielectric region with ITS can act as an ALT template for a nematode ALT survivor, which has been split from a hypothetical clay ancestor, followed by the T-ALT donor in telomeres. It also indicates that cis-cloning has already occurred independently in nature, and after telomeris crysis, it also indicates that the T-ALT reservoir of subtelomeres can be used as a telomer retaining template.
- FIG. 5 is a result of analyzing the T-ALT 2 element locus replicated to the chromosome end in NS 1 survivor
- Figure 5b is a T-ALT 2 element specific primer (cctgccaacctatatgctcc, SEQ ID NO: 7) and chromosome terminal specific primer (PCR analysis using the right arm of chromosome V: cccaccggaaacgaataaat, the right arm of chromosome X: tttccagcctccattacgtc, the left arm of chromosome II: cgacccgtcatcgtttaca) is shown schematically.
- 5B shows the sequence analysis of the chromosome ends and the T-ALT 2 element boundary, with the upper panel as the right arm of chromosome V, the middle panel as the right arm of chromosome X, and the lower panel as the left arm of chromosome II, red.
- Is T-ALT 2 yellow is the telomeres repeat sequence, and blue is the chromosome end.
- the existing telomeres appear to be preceded by a process of eliminating all the telomeres, but after this mechanism, the structure of the nucleotide sequence is chromosome end specific sequence-T-ALT specific sequence-telomere repeat sequence-T-ALT It is expected to form in the form of a specific sequence-a telomere repeat sequence-a T-ALT specific sequence, i.e., after the foremost unit, the T-ALT specific sequence is expected to have a structure that is flanked with telomeres.
- Figure 5c shows that the replicated T-ALT 2 has a tambour repeat pattern, PCR amplified with the indicated primer (Forward 5'-cctgccaacctatatgctcc-3 'SEQ ID NO: 7, Reverse 5'-ggagcatataggttggcagg-3' SEQ ID NO: 8) Then, it was detected by Southern blot.
- Figure 5d is a live subject NS1 as a result of quantitative PCR analysis of the copy number using T-ALT 2-specific primer (Forward 5'-gttttcatgctaaattcaaaacg-3 'SEQ ID NO: 5, Reverse 5'-aaacacaggagcatataggttgg-3' SEQ ID NO: 6) And increased copy number of T-ALT 2 in NS2, compared with act-1 gene.
- FIG. 6 shows a result of analyzing a set of genes responding to increased gamma rays in all ALT survivors.
- gamma-ray response gene sets increased in CS1x4-1 and Cs1x4-2 survivors. This set indicates an increase in the false discovery rate (FDR) q-value ⁇ 0.005
- B is the GSEA result of N2 survivors
- the gamma-ray response gene set increased in NS1 and NS2 survivors, which set the FDR q- increase in value ⁇ 0.005.
- T-ALT 1 and T-ALT 2 are compared with the T-ALT elements identified herein.
- the present application relates to polynucleotides aka, DNA signatures or T-ALT (Template-ALT) elements involved in alternative lengthening of telomere (ALT) mechanisms / processes, which are important for uncontrolled continuous division of cells such as cancer cells. It is based on identification.
- telomeres are repeating sequences located at the ends of chromosomes, which limit the number of divisions of cells to an appropriate level based on their length, and when the telomere length becomes shorter than the appropriate level, the cells stop dividing. Thus, telomeres prevent the continuous division of normal cells, thereby inhibiting normal cells from developing into cancer cells. Thus, cancer cells have a mechanism for maintaining sufficient telomere length to continuously divide beyond a limited number of divisions, one of which is the Alternative Lengthening of Telomere (ALT).
- ALT Alternative Lengthening of Telomere
- telomere refers to a process for maintaining the telomere length present at the chromosome end, and includes means, methods and / or mechanisms for maintaining telomere length except for telomere length maintenance through telomerase activity. do.
- ALT positive herein means a cell or an individual in which ALT is activated, ie, in the presence of ALT.
- the present disclosure provides a polynucleotide of SEQ ID NO: 1 to 5 'and / or 3' of each polynucleotide of SEQ ID NO: 1, wherein 5 '-(TTAGGC) x (TCAGGC) y (TTAGGC) z -3'.
- TTAGGC, TCAGGC, and TTAGGC which are the three repeating or unit sequences constituting the first and second sequences according to the present application
- TTAGGC, TTAGTM, and TTAGTM which are the repeating sequences of the second sequence
- T-ALT is a polynucleotide present in the proximal to telomere present on the chromosome of a nematode or a cell, and in one embodiment, each of the three types of unit sequences may be absent or repeated.
- the number may vary depending on the degree of activity of the ALT, and is not particularly limited.
- the x, y, z, l, m and n may be 0 or an integer between 1 and 100, respectively.
- the T-ALT element herein refers to a polynucleotide that acts on an alternative lengthening of telomere ALT mechanism.
- a T-ALT element is a polynucleotide of sequence SEQ ID NO: 1 (ie, first sequence-SEQ ID NO: 1-first sequence) flanked by a first sequence, or It may be represented as a polynucleotide of the sequence of SEQ ID NO: 2 (ie, the second sequence-SEQ ID NO: 2-second sequence) flanked by a second sequence and is derived from a nematode.
- the T-ALT element or polynucleotide according to the present invention may be usefully used for the determination of ALT positive cells, which may be useful for identifying ALT-dependent cancer cells, developing customized treatments for the cancer cells, studying ALT positive cancers, and studying ALT mechanisms. Can be used.
- the present application also relates to a vector comprising said polynucleotides or to a nymph transformed with said vector.
- nematodes can be useful for identifying cancer cells that depend on ALT, developing customized treatments for the cancer cells, studying ALT positive cancers, and studying ALT mechanisms.
- the present invention also relates to a composition for detecting ALT positive cells or for detecting ALT positive cancer, comprising the polynucleotide detecting material according to the present application.
- Detection herein includes quantitative and / or qualitative analysis of polynucleotides according to the present application, including the detection of presence, absence, and detection of expression levels, which methods are known in the art, and will be practiced by those skilled in the art. You will be able to choose the appropriate method.
- detecting substance or detecting reagent is a substance capable of detecting the polypeptide of the present invention quantitatively or for the determination of the presence.
- Methods and reagents for detecting nucleic acid levels are well known and may include, for example, primers capable of specifically amplifying all or part of the polypeptide, or probes capable of specifically detecting, which may be chip-based. Or may be used together with nanoparticles.
- primer refers to an oligonucleotide having a sequence complementary to at least a portion of a polypeptide according to the invention, specific for the polynucleotide to be detected herein, and polymerization in a polymerization reaction using a polymerase such as a polymerase chain reaction. Is the starting point of.
- Primers herein also include those having high sequence similarity. High sequence similarity is at least 70% sequence similarity using GCG FastA (Genetics Computer Group, Madison, Wis. USA), MacVector 4.5 (Kodak / iBI software package) or other sequencing methods or programs known in the art. Say that there is. Primers can be synthesized through known methods or synthesis companies in the art, and are at least about 5 nucleotides in length.
- Oligonucleotides comprising the primers of the present application may be labeled with a suitable substance that can be visualized depending on the method of detection.
- the labeling material includes radioisotopes, polypeptide labeling materials, fluorescent materials, coloring materials, and the like. Such a label may be introduced into itself during oligonucleotide synthesis, or may be introduced during polymerization if PCR is used.
- Radioactive materials include beta, gamma and alpha ray emitters and include 32 P, 35 S and 125 I. Fluorescent materials are excited when they absorb energy, and fluorescein and rhodamine are examples of materials that emit visible light while returning from the excited state to the ground state.
- Polypeptide labeling agents include antigenic substances such as biotin, digoxygenin, and enzymes such as horsered peroxidase.
- Chromic materials include chemiluminescent materials that emit energy absorbed by chemical reactions such as oxyluminescence.
- detection means detecting the presence or absence of a nucleic acid, and is not limited to, for example, nucleic acid specific DNA-DNA, a hybridization reaction based, but not limited thereto. It can be accomplished using a variety of methods in the art, such as amplification including analysis, inch hybridization, Southern blot analysis, microchip analysis, PCR (including quantitative and qualitative PCR, real-time quantitative qualitative PCR).
- it is used for nucleic acid amplification, in particular for PCR.
- PCR Polymerase Chain Reaction
- PCR Polymerase Chain Reaction
- This concept includes both qualitative analysis PCR to identify, quantitative PCR to measure the amount of specific nucleic acid, and real-time PCR that enables qualitative and quantitative analysis by tracking the PCR process in real time.
- the product amplified by PCR (amplicon) has a sequence corresponding to the molecule used as a template, and can be analyzed by various methods known in the art.
- Such methods include, for example, gel electrophoresis, real time PCR analysis, quantitative PCR, single strand conformational polymorphism (SSCP), restriction fragment length polymorphism (RFLP), capillary zone electrophoresis (CZE), WAVE (HPLC- based nucleic acid analyzing technology) and microchips, but are not limited to such.
- SSCP single strand conformational polymorphism
- RFLP restriction fragment length polymorphism
- CZE capillary zone electrophoresis
- WAVE HPLC- based nucleic acid analyzing technology
- T-ALT D donor
- T-ALT R reserve
- the present disclosure provides a method for providing an elm nematode; Exposing the nematodes to an environment that may cause cancer; Treating a test substance that is expected to inhibit the maintenance of telomeres to the nymphs before, after or with exposure to the cancer causing environment; And detecting a T-ALT (Template-Alternative Lengthening of Telomere) element from the control group treated with the test substance and the control group not treated with the test substance.
- T-ALT Temporative Lengthening of Telomere
- TRF Terminal Restriction Fragment
- the T-ALT element comprises a T-ALT donor present in the chromosome that acts as a donor and a T-ALT reservoir (R) generated by replicating the donor proximal to the cis or trans telomere, which See what has been described.
- the detection refers to the T-ALT reservoir present in the proximal to telomere, the proximal refers to a position within 10,000 bp from the telomeres.
- C. elegans according to the present application can be maintained according to known methods. Environments that can cause cancer in the method according to the present application may be irradiated with the nematode, for example, 60 gy irradiated with gamma rays, or reference may be made to others described in the following literature (Meier et al. Genome Res. 24/2014: 1624-1636; and Subramaniam et al. Current Biology 2003. 13: 134-139).
- the nematodes are treated with test substances that are expected to inhibit telomere length retention prior to, simultaneously with or after exposure to the cancer causing environment.
- test substance used in this method depends on the specific test method and the type of test substance used, and those skilled in the art will be able to select an appropriate amount.
- Experimental results showed a decrease in the activity of ALT activity in the presence of the test substance, i.e. less T-ALT, in particular less T-ALT reservoirs (R), compared to the control group, compared to the control group not in contact with the test substance. In this case, it is selected as a candidate substance.
- test substance herein is meant a substance that is expected to inhibit telomere length retention, such as low molecular weight compounds, high molecular weight compounds, mixtures of compounds (eg, natural extracts or cell or tissue cultures), or biopharmaceuticals (eg, , Proteins, antibodies, peptides, DNA, RNA, antisense oligonucleotides, RNAi, aptamers, RNAzyme and DNAzyme), or sugars and lipids, and the like.
- the test substance may be a polypeptide having two or more amino acid residues, such as 6, 10, 12, 20 or less or more than 20 such as 50 amino acid residues.
- test substance can be obtained from a library of synthetic or natural compounds and methods of obtaining libraries of such compounds are known in the art.
- Synthetic compound libraries are commercially available from Maybridge Chemical Co. (UK), Comgenex (USA), Brandon Associates (USA), Microsource (USA), and Sigma-Aldrich (USA), and libraries of natural compounds are available from Pan Laboratories (USA). ) And MycoSearch (USA).
- Test materials can be obtained by a variety of combinatorial library methods known in the art, for example, biological libraries, spatially addressable parallel solid phase or solution phase libraries, deconvolution By the required synthetic library method, “1-bead 1-compound” library method, and synthetic library method using affinity chromatography screening.
- compounds having a low molecular weight therapeutic effect may be used.
- compounds of about 1000 Da in weight such as 400 Da, 600 Da or 800 Da can be used.
- such compounds may form part of a compound library, and the number of compounds constituting the library may vary from tens to millions.
- Such compound libraries include peptides, peptoids and other cyclic or linear oligomeric compounds, and small molecule compounds based on templates such as benzodiazepines, hydantoin, biaryls, carbocycles and polycycle compounds (such as naphthalene, phenoty) Azine, acridine, steroids, and the like), carbohydrate and amino acid derivatives, dihydropyridine, benzhydryl and heterocycles (such as triazine, indole, thiazolidine, etc.), but these are merely illustrative. It is not limited to this.
- Particularly included herein are substances capable of inhibiting ALT activity among such low molecular weight compounds.
- Biologics can also be used for screening, for example.
- Biologics refers to cells or biomolecules
- biomolecules refer to proteins, nucleic acids, carbohydrates, lipids or substances produced using cellular systems in vivo and ex vivo.
- Biomolecules may be provided alone or in combination with other biomolecules or cells.
- Biomolecules include, for example, proteins or biological organics found in polynucleotides, peptides, antibodies, or other plasma.
- the method according to the invention further comprises detecting the position of the telomeres.
- the T-ALT element to be detected in the method according to the invention is in particular a T-ALT reservoir, which is located proximal to the telomeres, so for the detection of the T-ALT elements it is necessary to analyze the sequences near the telomeres.
- the present disclosure also relates to a method of measuring the ALT activity of an Elfin nematode.
- the method comprises the steps of providing DNA from a nematode; Amplifying a T-ALT element from the DNA; And quantitatively or qualitatively detecting the amplified product, wherein the presence of ALT indicates ALT activity.
- the DNA derived from the nematodes means genomic DNA, and T-ALT elements and other amplification and detection methods can be referred to the aforementioned.
- the method can measure the activity of ALT can be used as a research tool in areas such as telomere basic research, cancer research, etc., as well as useful in the field of diagnosis and anti-cancer strategy of cancer.
- the present invention may be practiced using conventional techniques that are within the skill of one of ordinary skill in the art of cell biology, cell culture, molecular biology, gene transformation techniques, microbiology, DNA recombination techniques unless otherwise noted.
- a more detailed description of the general technology can be found in Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. Eds., John Wiley & Sons 1999); See DNA Cloning, Volumes I and II (Glover ed., 1985).
- the nematodes were incubated at 20 ° C under standard conditions (see Brenner, Genetics 1974. 77 (1): 71-94).
- the strains used in the present invention are as follows: Bristol N2 wild strain, Hawaiian CB4856 wild type isolate, trt-1 (ok410) I. N2 trt-1 (ok410) was crossbred with Hawaiian CB4856 to produce CB4856 trt-1 (ok410). In order to maximize the effect of cross-crossing, the SNPs of all chromosomal markers were identified. The trt-1 (ok410) mutation was identified by PCR, and the trt-1 (ok410) strain was cross-bred with wild-type N2 to produce early generation N2 trt-1 (ok410).
- Synchronized L4 nematodes were treated with 50 mM EMS in M9 buffer for 4 hours. The treated P0 nematodes were then allowed to lay eggs for 12 hours. The F1 nematode was then isolated to remove the P0 nematode. Initially, about 100 F1 eggs were transferred to a new plate, and then from the F2 generation, 10 to 15 nematodes were manually transferred every generation.
- E. coli HT115 expressing DsRNA was incubated overnight at 37 ° C. in LB containing 1 mM ampicillin and then seeded on NGM plates containing 1 mM IPTG and 1 mM ampicillin. In each generation, 10-15 L1 larvae were then transferred to fresh RNAi media plates.
- FISH Telomere Fluorescence In situ Hybridization
- pre-crosslinking solution 3X SSC, 50% formamide, 10% dextran sulfate, 50 ⁇ g / ml heparin, 100 ⁇ g / ml yeast tRNA, 100 ⁇ g / ml salmon sperm DNA.
- PNA- (TTAGGC) 3 probes were incubated in a humid chamber at 37 ° C. for 16 hours and then washed twice at 37 ° C. with wash solution (2 ⁇ SSC and 50% formamide) for 15 minutes each. After washing three times with PBS-T, slides were counterstained with DAPI, mounted with anti-bleaching reagent Vectashield (Vector Laboratory), and photographed with a confocal microscope (LSM200, Zeiss).
- T-ALT 1 probe was labeled with digoxygenin (DIG) and fluorescence by FISH method. After FISH analysis, slides were blocked for 1 hour at room temperature with PBS-T solution containing 5% BSA and then treated with rhodamine bound anti-DIG antibody for 3 hours. After washing twice with PBS-T the slides were mounted and analyzed as described above. Telomere signals were analyzed using TFL-TELO software (Dr. Peter Lansdorp, Terry Fox Laboratory, Vancouver). Probes used for in situ hybridization are the same as SEQ ID NO: 9 (T-ALT 1) and SEQ ID NO: 10 (T-ALT 2).
- nematodes were harvested and washed five times with M9 buffer. Nematodes were then thawed for 8 hours in lysis buffer (100 ⁇ g / ml proteinase K, 50 mM KCL, 10 mM Tris pH 8.3, 2.5 mM MgCl 2, 0.45% NP-40, 0.45% Tween-20, 1% beta-mercaptoethanol). . DNA was then extracted using phenol-chloroform and ethanol precipitated. DNA was dissolved in TE buffer, treated with RNAase (10 ⁇ g / ml) for 2 hours, then extracted again and dissolved in buffer TE (Tris EDTA).
- Tris EDTA Tris EDTA
- TAGGC 30 probe was labeled with DIG-UTP using a PCR amplified telomere sequence cloned into a T-easy vector.
- T-ALT I and T-ALT II probes were labeled with DIG-UTP using primers targeting regions specific for T-ALTs.
- the probes used for Southern blots are identical to SEQ ID NO: 11 (T-ALT 1) and SEQ ID NO: 12 (T-ALT 2).
- telomeres-subtelomeres borders amplified the border regions by PCR.
- forward primers were designed for telomeres-near DNA to extend to telomeres and reverse primers were designed from T-ALT 1 specific sequence (first exon of T26H2.5).
- CS1 genomic DNA and N2 genomic DNA were used as templates.
- a total of 30 cycles of PCR were performed and conditions were as follows: annealing 60 ° C. and elongation for a total of 3 minutes. After the product was electrophoresed, the CS1-specific bands were cut out, DNA was extracted, and the sequences were analyzed using the same primers as those used for PCR.
- WS243 C. elegans genome and tin data as reference genomes were obtained from the Wormbase website (www.wormbase.org).
- Trimmomatics was applied to remove illumina adapter sequences (AM Bolger, et al., Bioinformatics, btu170 (2014)). Incorrect data at the 3 'and 5' ends were removed.
- the pretreated results were aligned using Burrows-Wheeler Aligner software (version 0.7.5a) aligned with the reference genome (H. Li, et al., Bioinformatics 25, 1754-1760 (2009)).
- the read results were aligned against the reference genome using the BWA-MEM algorithm using internal coefficients.
- Picard's SortSam and MarkDuplicates and GATK's indel realignment (McKenna et al., Genome research 20, 1297-1303 (2010)) and BQSR (base quality score recalibration) were applied (A. McKenna, et al. , Genome research 20, 1297-1303 (2010)).
- BQSR base quality score recalibration
- T-ALT 1 was amplified from the CB4856 allele (T-ALT 1 reservoir), which is not present in the N2 genome
- the T-ALT 1 reservoir was derived from CB4856 trt-1 sequencing data using internal setting of CLC workbench 7 (Qiagen). Newly constructed. Using BWA, CS1 readings were collected only when at least one of the pairs mapped to the rebuilt T-ALT 1 reservoir. The collected results were used to generate contig sequences, and the resulting results were aligned with the N2 genome using BLAST search.
- telomeres In order to identify the regions related to telomeres, the paired ends associated with them were extracted using a file containing telomer readings. The readings when all pairs were telomeres were excluded, leaving only the readings mapped to the genome. In addition to the locus surrounding the sub-telomere region and the telomeres, most of the readings were mapped to T-ALT1 for CS1 and CS2 and T-ALT2 for NS1 and NS2.
- the average genome coverage across the genomes was determined using the SAMtools program (AR Quinlan, et al., Bioinformatics 26, 841-842 (2010)) after eliminating duplicate and low mapping quality (q ⁇ 20) readings.
- the genomecov was analyzed.
- the lead depth was evaluated for each nucleotide of the dielectric and normalized by the average coverage, expressed as a change in multiples for the lead depth.
- the change fold of the lead depth compared to the parent strain was subtracted from the ALT survivors. Linear plots of genome-wide and extra-left specific read depth changes were generated in R.
- Telomere variants were analyzed using a file containing telomere readings. The number of each variant type was counted in the readout of a subset of each library as previously described (D. Conomos et al., Ibid ). The presence of each repeat variant was analyzed in each subset readout, their frequency was calculated and a pie chart was generated.
- RNA-Seq readings were first mapped to the C. elegans genome with Tophat2 using a given transcript annotation (D. Kim, G et al., Genome Biol 14, R36 (2013)), followed by Cufflinks.
- the cuffquant and cuffnorm software of the package were used to determine how many known transcripts in RPKM were normalized over the entire sample.
- GSEA Gene set enrichment analysis
- G0 Gene ontology (G0) annotation data for C. elegans was obtained from the Wormbase website (www.wormbase.org). A set of genes that change upon exposure were obtained from S. Greiss, et al., BMC genomics 9, 334 (2008). For all pairs of ALT samples and wild type samples, GSEA was performed using the data obtained above (A. Subramanian, et al., PNAS 102, 15545-15550 (2005)).
- Example 1 Screening and characterization of the nematode lacking the telomerase gene trt-1, trt-1 (ok410)
- the wild type Elites N2 and CB4856 strains described in the experimental method were treated with ethylmethanesulfonate (EMS), a DNA alkylating agent, and the survivors were selected.
- EMS ethylmethanesulfonate
- the results are described in FIG. Two of the six (CS 1 to CS6) CS strains and two of the five (NS1 to NS5) strains were maintained for at least 300 generations in a manner that delivered 10 to 15 individuals in each generation without a gross phenotype. This indicates that the ALT strain remains stable.
- telomeres were longer than the parent (see FIGS. 1B and 1C).
- the standard nymph telomeres were cleaved by the non-cut HinfI enzyme, indicating that additional sequences are included in the telomeres of the surviving individuals, which is different from the parent individual. In a manner that extends the telomere length to retain the dielectric.
- the T-ALT 1 element contains a uniquely mapped sequence (SEQ ID NO: 1) comprising the first exon and promoter of the coding gene T26H2.5 of the nematode, and two interstitial telomere-like sequences (ITS)) is flanked, and the structure and sequence are as described in FIG. 7. T-ALT 1 was found in all survivors. To determine the location of T-ALT 1, extract all pair-terminal sequence reads mapped to the T-ALT 1 element, using overlapping pairs to 200 bp to 1.7 Contiguous fragments of kb length were constructed and five contigs aligned to both the T-ALT 1 element and the chromosome end were identified.
- a specific primer (5'-AACAAGCTTCTGGCACGTCT-3 'SEQ ID NO: 4) on the T-ALT 1 element a specific primer on the chromosome end (right arm of chromosome I: 5'-TGTGCGGGGAGGGAGTATTA-3', right arm of chromosome II: PCR was performed using 5'-CGATGCGAAGAGATGGGAGT-3 ', the left arm of chromosome III: 5'-GCCTAAAAGCGCGAAATCCT-3'), and the amplification was performed only in the survivor as shown in FIG. 2C.
- the FISH experiment showed that the T-ALT 1 element probe and the telomere probe were located in the same place (see FIG.
- TRF analysis was performed using a restriction enzyme that cuts out a region not present in the T-ALT 1 element and a restriction enzyme that cuts the element.
- FIG. 2E when the T-ALT 1 element is not cut, it is analyzed by TRF.
- One telomere length was shown to be longer, indicating that there are several copies of the T-ALT 1 element in the survivor.
- telomeres Following analysis of elements derived from N2 trt-1-derived ALT survivors, longer telomeres were observed in NS1 and NS2 among the survivors, and the standard telomeres were clearly distinguishable in TRF analysis using uncut restriction enzymes. (See FIG. 3A). These bands are very different from those of CB4856-derived survivors, and WGS analysis of NS1 & NS2 identified specific genomic elements close to the telomeres 5 'of chromosome I (see FIG. 3B), which is called the' Template of ALT 2 '. Named the (T-ALT 2) element. Probes specific for the T-ALT 2 element were found to be located in telomeres in TRF and FISH analysis (FIGS. 3C and 3D).
- T-ALT 2 element This indicates the presence of the T-ALT 2 element at the chromosomal end of NS1 & NS2 survivors, which is consistent with the results of FIG. 5.
- the structure of the T-ALT 2 element is similar to the structure of the T-ALT 1 element as shown in FIG. 7, ie, centered on the sequence (SEQ ID NO: 2), and the repeat sequence is located in the same direction on both sides.
- telomeres In nematodes lacking telomeres, it is known to overcome stellarity without maintaining telomeres by maintaining large populations (C. Cheng, et al., PNAS 109, 7805-7810 (2012)). In contrast, the living subject of the present application was stably maintained by introducing a T-ALT structure into telomeres and transferring to a new plate several dogs for each generation for culturing.
- T-ALT 2 element Similar to the T-ALT 1 element, which is replicated proximal to the terminal telomeres in the inner region, the T-ALT 2 element was also replicated proximal to the left arm of chromosome I at the inner locus (T-ALT2 D locus) (FIG. 4D). This was not detected in the CB4856 genome (FIG. 4E). These results indicate that the mechanism of ALT in CB4856 and N2 evolved into different T-ALT reservoirs. During ALT activation, variant sequences of the T-ALT2 R locus, but not T-ALT2 D, appeared in NS survivors, indicating that T-ALT 2 R acted as a template for ALT (FIG. 4E).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Analytical Chemistry (AREA)
- Microbiology (AREA)
- Physics & Mathematics (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Pathology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Food Science & Technology (AREA)
- Medicinal Chemistry (AREA)
- General Physics & Mathematics (AREA)
- Oncology (AREA)
- Hospice & Palliative Care (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
본원은 대안적 텔로미어 길이 유지 기전에 작용하는 T-ALT 1 및 2 엘리먼트 및 그 용도를 개시한다. 본원에 따른 엘리먼트는 세포내 ALT 활성을 검출하는 마커로서 사용되거나 또는 암 치료제 물질 등의 스크리닝에 유용하게 사용될 수 있다.
Description
본원은 세포내의 텔로미어 길이 연장과 관련된 기전, 이에 관여는 핵산 서열 및 그 용도와 관련된 것이다.
선형 염색체는 말단의 복제가 완전하지 않아, 복제를 거듭할수록 그 길이가 점차 줄어들게 된다. 텔로미어는 염색체 말단에 위치하는 반복되는 서열로 그 길이를 기준으로 세포의 분열 횟수를 적절한 수준으로 제한하는 역할을 하며, 텔로미어 길이가 적정 수준보다 짧아지게 되면 세포는 분열을 멈추게 된다. 따라서 텔로미어는 정상세포의 지속적 분열을 방지하여, 결국 정상세포가 암세포로 발전하는 것을 억제하게 된다.
따라서 암세포는 제한된 분열 횟수를 넘어 계속적으로 분열하기 위해 충분한 텔로미어 길이를 유지하기 위한 기작을 가지고 있으며, 현재 알려진 기작으로는 텔로머라아제(telomerase) 활성을 통한 텔로미어 합성 및 대안적 텔로미어 유지기작 (Alternative Lengthening of Telomere, ALT)이 존재한다. 전자의 경우 2009년에 노벨상을 수상할 정도로 많은 연구가 축적되어 있지만 후자인 대안적 텔로미어 유지 기작 및 그 활성과 관련되서는 거의 알려진 것이 없다.
J. D. Henson et al (C-circles are specific and quantifiable markers of alternative-lengthening-of-telomeres activity. Nature biotechnology 27, 1181-1185 (2009))은 인간 세포에서 ALT로서 C-circle 형성을 개시한다.
암세포는 특정 조건하에서 텔로머라제 의하거나 또는 ALT에 의한 텔로미어 유지기작을 통해 분열을 지속하기 때문에, 이러한 기작은 암치료의 중요한 표적이 된다. 따라서, 암세포가 ALT 또는 텔로머라제 양성 인지 여부를 판별하는 것은 매우 중요하다. 아울러, 텔로머라제 유지 기작의 규명을 통한 암치료제 개발도 필요하다.
본원에서는 대안적 텔로미어 길이 유지 기작 및 그 용도를 제공하고자 한다.
한 양태에서 본원은 서열번호 1의 폴리뉴클레오타이드에 상기 서열번호 1의 폴리뉴클레오타이드의 5‘ 및/또는 3’ 각각에 (TTAGGC)x(TCAGGC)y(TTAGGC)z의 3 종류의 단위서열을 포함하는 제 1 서열을 포함하는 폴리뉴클레오타이드 (예를 들면 T-ALT 1); 또는 서열번호 2의 폴리뉴클레오타이드에 상기 서열번호 2의 폴리뉴클레오타이드의 5‘ 및/또는 3’ 각각에 (TTAGGC)l(TTAGTA 또는 TTAGTC)m(TTAGGC)n의 3 종류의 단위서열을 포함하는 제 2 서열을 포함하는 폴리뉴클레오타이드 (예를 들면 T-ALT 2)로부터 선택되고, 상기 제 1 서열 및 제 2 서열에서 각각 상기 3 종류의 단위서열의 순서는 무작위이며, 상기 x, y, z, l, m 및 n은 0 또는 1 이상의 정수로, 각각 동일하거나 상이한 것인, 대안적 텔로미어 유지 (Alternative Lengthening of Telomere ALT) 기작에 작용하는 폴리뉴클레오타이드 또는 엘리먼트를 제공한다.
본원에 따른 T-ALT 엘리먼트는 선충 또는 세포의 염색체에 존재하는 텔로미어 근위 (proximal to telomere)에 존재하는 것으로, 일 구현예에서 상기 세 종류의 단위서열 각각은 결여되거나 반복될 수 있는 것으로, 예를 들면 ALT의 활성 정도에 따라 변할 수 있는 것으로 특별히 제한되는 것은 아니고 예를 들면 상기 x, y, z, l, m 및 n은 각각 0 또는 1에서 100 사이의 정수일 수 있다.
본원에 따른 엘리먼트는 각종 생물학적 시료에 적용되어 ALT 양성용 암의 검출에 유용하게 사용될 수 있으며, 이런 측면에서 본원은 본원에 따른 폴리뉴클레오타이드 또는 엘리먼트 검출용 물질을 포함하는, ALT 양성 암 검출용 조성물을 제공한다.
본원은 ALT의 기전 및 이에 관여하는 엘리먼트를 규명한 것으로, 이런 측면에서 본원은 또한 꼬마선충을 제공하는 단계; 상기 꼬마선충을 암을 유발할 수 있는 환경에 노출하는 단계; 상기 암 유발환경 노출 전, 노출 후 또는 노출과 함께, 상기 꼬마선충에 텔로미어의 유지를 억제할 것으로 기대되는 시험물질을 처리하는 단계; 및 상기 시험물질로 처리된 꼬마선충과 상기 시험물질로 처리되지 않은 대조군에서 T-ALT (Template-Alternative Lengthening of Telomere) 엘리먼트를 검출하는 단계를 포함하며, 상기 시험물질로 처리된 꼬마선충에서 상기 대조군과 비교하여 T-ALT의 부재 또는 대조군과 비교하여 증폭된 서열 길이가 짧은 경우 상기 시험물질을 암치료용 후보물질로 선별하는 것인, ALT 양성 암치료제 스크리닝 방법을 제공한다.
다른 양태에서 본원은 꼬마선충의 ALT 활성을 측정하는 방법을 제공하며 상기 방법은 꼬마선충 유래의 DNA를 제공하는 단계; 상기 DNA로부터 T-ALT 엘리먼트를 증폭하는 단계; 및 상기 증폭된 산물을 정량 또는 정성적으로 검출하는 단계를 포함하며 상기 증폭된 산물 즉, ALT의 존재는 ALT 활성을 나타낸다.
본원은 대안적 텔로미어 길이 유지 기전에 작용하는 T-ALT 엘리먼트 및 그 용도를 개시한다. 본원에 따른 엘리먼트는 세포내 ALT 활성을 검출하는 마커로서 사용되거나 또는 암 치료제 물질 등의 스크리닝에 유용하게 사용될 수 있다 또한 ALT에 의존하는 암세포 판별, 상기 암세포에 대한 맞춤형 치료법 개발, ALT 양성 암 연구, ALT 기전 연구 등에 유용하게 사용될 수 있다.
도 1은 특정 텔로미어 서열을 갖는 꼬마선충에서 안정적 ALT 생존개체의 분리와 관련된 것이다. 도 1a는 이를 위한 실험과정을 도식적으로 나타낸 것이며, 도 1b는 생존개체 CB4856 trt-1, pot-2(tm1400), CS1 및 CS2의 텔로미어 길이를 FISH를 이용하여 정량분석한 결과로 텔로미어는 배아에서 Cy-3-TTAGGC*3 PNA 프로브 (적색)을 사용하여 검출하였으며, DNA는 DAPI (청색)로 카운터염색하였고, 위쪽 패널은 각 생존개체의 대푯값을 나타내며, 통계는 T-test (* P-value < 0.0001) 로 처리하였으며, 평균(Mean) 값은 적색 막대로 나타냈다. 도 1c는 N2, CB4856, pot-1(tm1620), pot-2(tm1400), 및 NheI, DraI, ApaI, NdeI, XhoI, NcoI 및 SacI 6개 핵산을 인식하여 자르는 제한효소의 조합으로 절단된 모든 CS 생존개체에 대한 TRF 분석을 나타내며, DIG-TTAGGC*4 로 프로빙하였으며, 긴 텔로미어에 대한 양성 대조군으로는 pot-1(tm1620) 및 pot-2(tm1400)를 사용하였다. 도 1d는 CB4856, CB4856 trt-1, HinfI 절단 후 DIG-TTAGGC*4로 프로빙된 CS 생존개체에 대한 TRF 분석 결과이다.
도 2는 생존개체가 ALT로서 T-ALT1 엘리먼트를 사용하였음을 보여주는 결과이다. 도 2a는 이종교배 후 유지된 CB4856 SNVs의 연합 히트맵을 나타내며, 오른쪽 패널은 V 염색체의 T-ALT 좌위 근방을 확대한 사진이다. 도 2b는 CB4856 trt-1, N2 trt-1, CS1, CS2 및 N2와 이종교배된 CS 생존개체 (CS1x4-1, CS1x4-2 및 CS2x4)의 평균 리드뎁쓰 플랏으로부터 변화된 배수를 나타낸 것으로, 스트레인 특이적 변화에 의한 편차를 보정하기 위해 모 CB4856 trt-1(grey bar)의 평균 리드뎁쓰에 있어 변화된 배수를 ALT 생존개체의 값에서 차감하였으며, 아래 패널은 염색체 V의 T-ALT를 확대한 것으로 여기에서 내부의 반복되는 텔로미어는 검은색 막대로 나타냈고, T-ALT 좌위 양쪽의 유전자 구조는 보라색 막대로 나타냈다. 도 2c는 판독결과로부터 재구축된 콘티그(적색 막대)로, 한 쌍을 T-ALT 1에 정렬하여 유전체의 좌위를 결정하였으며, 단절점 PCR 및 CB4856의 T-ALT 1 프로브를 이용용한 서던블랏으로 트랜스복제를 확인하였으며, CS1 생존개체는 T-ALT와 서브텔로미어의 경계를 증폭하는 프라이머를 사용하여 분석 (아래 패널)하였으며, 별표는 BLAST로 예측된 단절점 (검은색) 또는 확인된 단절점 (적색)을 나타낸다. 도 2d는 배아단계에서 T-ALT 1 프로브와 텔로미어 프로브를 이용한 FISH 결과로, 스케일바는 10μm이고, DAPI; 녹색, T-ALT 1; 적색, 텔로미어를 나타낸다. 도 2e는 T-ALT 1 프로브와 텔로미어 프로브를 이용한 TRF 분석 결과로 표시된 제한효소로 DNA를 절단하고 표시된 프로브로 교잡하였으며, 약자는 다음과 같다: RE, 제한효소 (restriction endonuclease); C, CB4856 trt-1; S, CS1 생존개체; H, HindIII; B, BamHI; Nc, NcoI; Nd, NdeI; Nh, NheI; S, SacI; Mix, HindIII, BamHI, NcoI, NdeI, NheI 및 SacI의 혼합물.
도 3은 ALT로서 T-ALT 2를 이용한 N2 생존개체를 분석한 결과이다. 도 3a는 N2 생존개체의 텔로미어에 대한 TRF 분석으로 N2 trt-1 및 NS 생존개체 (NS1 내지 NS5)의 유전체를 표시된 제한효소로 절단한 후 (TTAGGC)*4 반복서열로 교잡하였으며, 화살표는 절단된 T-ALT 2 엘레먼트이다. 도 3b는 N2 trt-1 및 N2 생존개체의 평균 리드뎁쓰 플롯에서 변화된 배수를 나타내는 것으로, 스트레인 특이적 변화에 의한 편차를 보정하기 위해 모 N2 trt-1 (grey bar)의 평균 리드뎁쓰에 있어 변화된 배수를 ALT 생존개체의 값에서 차감하였으며, 아래 패널은 I 염색체상의 T-ALT를 확대한 것이며, 내부 반복 텔로미어는 검은색으로 나타냈다. 도 3c는 N2 생존개체 텔로미어에 대한 TRF 분석결과로 DNA를 HinfI으로 절단한 후 (TTAGGC)*4 프로브로 교잡하였으며, 동일한 블랏에 대해 프로브를 제거한 후, T-ALT 2 특이적 프로브로 재교잡하였다. 도 3d는 CB4856 trt-1, N2 trt-1 및 모든 생존개체의 배아에서 T-ALT 및 텔로미어 프로브를 사용한 FISH 분석 결과로 스케일바는 10μm; 청색, DAPI; 녹색, T-ALT; 적색, 텔로미어를 나타낸다.
도 4는 ALT 기전에 T-ALT 도너의 근위 텔로미어로의 시스-복제 및 뒤이은 다른 염색체 말단으로의 트랜스-복제가 관여되어 있음을 나타내는 것이다. 도 4a는 N2 trt-1, CB4856 trt-1, CS1 및 CS2의 WGS 데이터 유래의 SNVs (WBvar00067712 및 WBvar00067717)의 평균 커버리지로부터 변화된 배수를 나타내는 것으로, N2 대립유전자 (청색) 및 CB4856(적색) 대립유전자는 개별적으로 플랏팅되었으며, 수치의 큰 차이로 인해, Y 축을 다 나타내지 못하고 중간을 생략하고 표시하였다. 도 4b는 CB4856-유래의 SNVs는 N2가 아닌, CB4856의 염색체 V의 오른편 말단에 위치한 것으로 나타났으며, 단절점 PCR 프라이머 (염색체 V, cccaccggaaacgaataaat) 와 T-ALT 1 의 근위 텔로미어에 결합하도록 디자인된 프라이머쌍 (적색 화살표)(Reverse 5‘-AACAAGCTTCTGGCACGTCT-3’서열번호 4, Forward 5‘-GAAGGATGGGATGGAACTGA-3’서열번호 3)을 이용하여 수행하였으며, 위패널은 T-ALT 1 엘리먼트 및 주변의 반복되는 텔로미어 (검은색 박스)를 나태내고, 별표는 CB4856 SNVs를 나타내고, 점선으로 표시된 부분은 유전체 위치를 나타내며 약자는 다음과 같다: CB, CB4856; Rev, 역방향 프라이머; For, 정방향 프라이머. 도 4c는 내부 및 텔로미어 T-ALT 1의 WBvar00067712 및 WBvar00067717의 뉴클레오타이드 변화를 나타낸 것으로, N2 대립유전자는 청색으로, CB 대립유전자는 적색으로 나타냈으며, 뉴클레오타이드의 위치는 패널 B에 표시되어 있다. 도 4d는 N2 유전체 상의 T-ALT 2를 도식적으로 나타낸 것으로, 도 4e에 사용된 프라이머는 증폭산물의 크기와 함께 적색 화살표로 나타냈으며, T-ALT 도너 및 저장소에 특이한 반복 변이체 (별표)도 표시되어 있다. 도 4e는 CB4856 야생형 분리체에서는 T-ALT 2 저장소가 결여되어 있음을 나타내는 것으로, 표시된 프라이머를 사용한 PCR 증폭산물은 전기영동한 후 에씨디움 브로마이드로 염색하였으며 약자는 다음과 같다: N2, N2; CB, CB4856. 도 4f는 CB4856 trt-1, N2 trt-1 및 모든 NS 생존개체의 WGS 데이터에서 수득한 변이체 판독 카운트 값으로, 상기 값은 각 시료에 대한 총 서열 커버리지로 노말라이즈되었다. 도 4g는 실행가능 모델을 나타내는 것으로, ITS가 있는 내부 유전체부위는 꼬마선충 ALT 생존개체의 ALT 주형으로 작용할 수 있으며, 상기 모델은 가상의 공토 조상으로부터 갈라져나온 후, 텔로미어로의 T-ALT 도너의 시스-복제가 이미 자연에서 독립적으로 발생하였음을 나타내고, 텔로미어 크라이시스 후에, 서브텔로미어의 T-ALT 저장소가 텔로미어 유지용 주형으로서 사용될 수 있음을 또한 나타낸다.
도 5는 NS 1 생존개체에서 염색체 말단으로 복제된 T-ALT 2 엘리먼트 좌위를 분석한 결과로, 도 5b는 T-ALT 2 엘리먼트 특이적 프라이머 (cctgccaacctatatgctcc, 서열번호 7)와 염색체 말단 특이적 프라이머 (염색체 V의 오른쪽 암: cccaccggaaacgaataaat, 염색체 X의 오른쪽 암: tttccagcctccattacgtc, 염색체 II의 왼쪽 암: cgacccgtcatcgtttaca)를 이용한 PCR 분석을 도식적으로 나타낸 것이다. 도 5b는 염색체 말단 및 T-ALT 2 엘리먼트 경계의 서열을 분석한 결과로 위쪽 패널은 염색체 V의 오른쪽 암이고, 중간 패널은 염색체X의 오른쪽 암이고, 아래 패널은 염색체 II의 왼쪽 암으로, 적색은 T-ALT 2, 노란색은 텔로미어 반복서열, 파랑색은 염색체 말단을 나타낸다. 도5b에 있는 결과만으로 보면 기존의 텔로미어는 모조리 제거하는 과정이 선행되는 것으로 보이나, 이러한 기작 이후에 염기서열의 구조는 염색체 말단 특이적 서열 - T-ALT 특이적 서열 - 텔로미어 반복 서열 - T-ALT 특이적 서열 - 텔로미어 반복 서열 - T-ALT 특이적 서열의 형태로 형성될 것으로 판단되며, 즉, 가장 앞쪽의 단위 이후에는 T-ALT 특이적 서열이 텔로미어로 플랭킹 되는 구조를 가질 것으로 예측된다. 도 5c는 복제된 T-ALT 2가 탬덤 반복 패턴을 가짐을 보여주는 것으로, 표시된 프라이머 (Forward 5'-cctgccaacctatatgctcc-3' 서열번호 7, Reverse 5'-ggagcatataggttggcagg-3' 서열번호 8)로 PCR 증폭한 후 서던블랏으로 검출하였다. N: N2 NS1: NS 생존개체. 도 5d는 T-ALT 2 특이적 프라이머 (Forward 5'-gttttcatgctaaattcaaaacg-3' 서열번호 5, Reverse 5'-aaacacaggagcatataggttgg-3' 서열번호 6)를 이용한 카피수를 정량 PCR로 분석한 결과로 생존개체 NS1 및 NS2에서 T-ALT 2의 카피수가 증가하였음을 나타내며, 카피수는 act-1유전자와 비교하였다.
도 6은 모든 ALT 생존개체에서 증가된 감마선에 반응한 유전자 세트를 분석한 결과로, A는 CB4856 생존개체의 GSEA 분석결과로 감마선 반응 유전자 세트가 CS1x4-1과 Cs1x4-2 생존개체에서 증가하였으며, 이러한 세트는 FDR (false discovery rate) q-value < 0.005에서 증가하였음을 나타내며, B는 N2 생존개체의 GSEA 결과로, 감마선 반응 유전자 세트가 NS1 및 NS2 생존개체에서 증가하였으며, 이러한 세트는 FDR q-value < 0.005에서 증가하였음을 나타낸다.
도 7은 본원에서 규명된 T-ALT 엘리먼트로 T-ALT 1 및 T-ALT 2의 특징을 비교하는 표 및 각 구조를 도식적으로 나타낸 것이다.
본원은 암세포와 같은 세포의 제어되지 않은 계속적 분열에 중요한, 대안적 텔로미어 유지 (Alternative Lengthening of Telomere, ALT) 기작/과정에 관여하는 폴리뉴클레오타이드 일명, DNA 시그니쳐 또는 T-ALT (Template-ALT) 엘리먼트의 규명에 근거한 것이다.
선형 염색체는 말단의 복제가 완전하지 않아, 복제를 거듭할수록 그 길이가 점차 줄어들게 된다. 텔로미어는 염색체 말단에 위치하는 반복되는 서열로 그 길이를 기준으로 세포의 분열 횟수를 적절한 수준으로 제한하는 역할을 하며, 텔로미어 길이가 적정 수준보다 짧아지게 되면 세포는 분열을 멈추게 된다. 따라서 텔로미어는 정상세포의 지속적 분열을 방지하여, 결국 정상세포가 암세포로 발전하는 것을 억제하게 된다. 따라서 암세포는 제한된 분열 횟수를 넘어 계속적으로 분열하기 위해 충분한 텔로미어 길이를 유지하기 위한 기작을 가지고 있으며, 그 중 하나가 ALT (Alternative Lengthening of Telomere)이다.
본원에서 ALT (Alternative Lengthening of Telomere)란 염색체 말단에 존재하는 텔로미어 길이를 유지하는 과정을 일컫는 것으로, 텔로머라제 활성을 통한 텔로미어 길이 유지를 제외한 텔로미어 길이 유지를 위한 수단, 방법 및/또는 기전을 포함한다.
본원에서 ALT 양성은 ALT가 활성화되어 있는, 즉 ALT 존재하여 작용하는 세포 또는 개체를 의미한다.
따라서 한 양태에서 본원은 서열번호 1의 폴리뉴클레오타이드에 상기 서열번호 1의 폴리뉴클레오타이드의 5‘ 및/또는 3’ 각각에, 5‘-(TTAGGC)x(TCAGGC)y(TTAGGC)z-3’의 3 종류의 반복 또는 단위서열을 포함하는 제 1 서열을 포함하는 폴리뉴클레오타이드 또는 서열번호 2의 폴리뉴클레오타이드에 상기 서열번호 2의 폴리뉴클레오타이드의 5' 및/또는 3’ 각각에 5‘-(TTAGGC)l(TTAGTM)m(TTAGTM)n-3’의 3 종류의 반복 또는 단위서열을 포함하는 제 2 서열을 포함하는 폴리뉴클레오타이드로부터 선택되며, 상기 제 2 서열에서 M은 A 또는 C이다.
본원에 따른 제 1 및 제 2 서열을 구성하는 3 종류 각 반복 또는 단위 서열 즉 제 1 서열의 반복서열인 TTAGGC, TCAGGC, 및 TTAGGC, 그리고 제 2 서열의 반복서열인 TTAGGC, TTAGTM, TTAGTM의 순서는 위에 기재된 순서대로 한정되는 것은 아니며, 즉 무작위이며, 예를 들면 (TTAGGC)x(TCAGGC)y(TTAGGC)z, (TCAGGC)y(TTAGGC)z(TTAGGC)x, (TCAGGC)y(TTAGGC)x(TTAGGC)z, (TTAGGC)z(TTAGGC)x(TCAGGC)y 등과 같이 배열될 수 있으며, 상기 x, y, z, l, m 및 n은 0 또는 1 이상의 정수로, 각각 동일하거나 상이할 수 있다.
본원에 따른 T-ALT는 선충 또는 세포의 염색체에 존재하는 텔로미어 근위 (proximal to telomere)에 존재하는 폴리뉴클레오타이드로, 일 구현예에서 상기 세 종류의 단위서열 각각은 결여되거나 반복될 수 있는 것으로, 예를 들면 ALT의 활성 정도에 따라 특히 그 숫자가 변할 수 있는 것으로 특별히 제한되는 것은 아니고 예를 들면 상기 x, y, z, l, m 및 n은 각각 0 또는 1 내지 100 사이의 정수일 수 있다.
본원에서 T-ALT 엘리먼트는 대안적 텔로미어 유지 (Alternative Lengthening of Telomere ALT) 기작에 작용하는 폴리뉴클레오타이드를 일컫는 것이다.
일 구현예에서 도 5를 참조하면, 본원에 따른 T-ALT 엘리먼트는 제 1 서열로 플랭킹된 서열번호 1의 서열 (즉, 제1 서열-서열번호 1-제1 서열)의 폴리뉴클레오타이드, 또는 제2 서열로 플랭킹된 서열번호 2의 서열 (즉, 제2 서열- 서열번호 2-제2 서열)의 폴리뉴클레오타이드와 같이 나타낼 수 있으며 꼬마선충 유래이다.
본원에 따른 T-ALT 엘리먼트 또는 폴리뉴클레오타이드는 ALT 양성 세포의 판별에 유용하게 사용될 수 있으며, 이는 ALT에 의존하는 암세포 판별, 상기 암세포에 대한 맞춤형 치료법 개발, ALT 양성 암 연구, ALT 기전 연구 등에 유용하게 사용될 수 있다.
다른 양태에서 본원은 또한 상기 폴리뉴클레오타이드를 포함하는 벡터 또는 상기 벡터로 형질전환된 꼬마선충에 관한 것이다. 이러한 꼬마선충은 ALT에 의존하는 암세포 판별, 상기 암세포에 대한 맞춤형 치료법 개발, ALT 양성 암 연구, ALT 기전 연구 등에 유용하게 사용될 수 있다.
따라서 다른 양태에서 본원은 또한 본원에 따른 폴리뉴클레오타이드 검출용 물질을 포함하는, ALT 양성 세포 검출용, 또는 ALT 양성 암검출용 조성물에 관한 것이다.
본원에서 검출이란, 본원에 따른 폴리뉴클레오타이드의 정량 및/또는 정성 분석을 포함하는 것으로, 존재, 부존재의 검출 및 발현량 검출을 포함하는 것으로 이러한 방법은 당업계에 공지되어 있으며, 당업자라면 본원의 실시를 위해 적절한 방법을 선택할 수 있을 것이다.
본원에서 용어 검출용 물질 또는 검출시약은 본원의 폴리펩타이드를 정량적으로 또는 존재여부의 판단을 위해 이를 검출할 수 있는 물질이다. 핵산 수준의 검출 방법 및 시약은 공지된 것으로서, 예를 들면 상기 폴리펩타이드의 전부 또는 일부를 특이적으로 증폭할 수 있는 프라이머, 또는 특이적으로 검출할 수 있는 프로브를 포함할 수 있으며, 이들은 칩 방식 또는 나노입자(nanoparticle)과 함께 사용될 수 있다.
본원에서 사용된 용어 프라이머는 본원에서 검출하는 폴리뉴클레오타이드에 특이적인, 본원에 따른 폴리펩타이드의 적어도 일부분에 상보적인 서열을 갖는 올리고뉴클레오타이드를 말하며, 중합효소연쇄반응과 같은 폴리머라제를 사용한 중합반응에서 중합의 시작점이 된다.
본원의 프라이머는 이와 높은 서열유사성을 갖는 것을 또한 포함한다. 높은 서열유사성이란, GCG FastA (Genetics Computer Group, Madison, Wis.USA), MacVector 4.5 (Kodak/iBI software package) 또는 기타 당업계에 공지된 서열분석 방법 또는 프로그램을 이용하여, 적어도 70% 이상의 서열유사성이 있는 것을 말한다. 프라이머는 당업계의 공지된 방법 또는 합성회사를 통하여 합성할 수 있으며, 길이는 적어도 약 5개 뉴클레오타이드이다.
본원의 프라이머를 포함하는 올리고뉴클레오타이드는 검출하는 방법에 따라 시각화 할 수 있는 적절한 물질로 표지될 수 있다. 상기 표지물질은 방사선동위원소, 폴리펩타이드성 표지물질, 형광물질, 발색물질 등과 같은 것을 포함한다. 이러한 표지물질은 올리고뉴클레오타이드 합성시에 그 자체에 도입될 수 도 있고, PCR을 사용하는 경우 중합과정에서 도입될 수 있다. 방사선물질은 베타, 감마 및 알파선 방출체를 포함하는 것으로, 32P,35S 및 125I를 포함한다. 형광물질은 에너지를 흡수하면 여기되고, 여기상태에서 기저상태로 되돌아가면서 가시광선을 방출하는 물질로 플로세신 및 로다민을 예로 들 수 있다. 폴리펩타이드성 표지물질은 바이오틴, 디그옥시제닌과 같은 항원성 물질과 호스레디쉬퍼옥시다제와 같은 효소를 포함한다. 발색물질은 화학반응으로 흡수한 에너지를 방출하는 화학발광물질 예를 들면 옥시루미네슨스와 같은 것을 포함한다.
본원에 따른 일 구현예에서, 검출은 핵산의 존재여부 또는 존재할 경우 그 양을 검출하는 것을 의미하는 것으로서 핵산 특이적 DNA-DNA, 혼성화 반응을 기본으로는 하는 예를 들면 이로 제한하는 것은 아니나, TRF 분석, 인치츄 교잡, 서던블랏 분석, 마이크로칩분석, PCR (정량적 및 정성적 PCR, 실시간 정량적 정성적 PCR 포함)을 포함하는 증폭과 같은 당업계의 다양한 방법을 사용하여 달성될 수 있다.
일 구현예에서는 핵산 증폭에 사용되며, 특히 PCR에 사용될 수 있다.
본원에서 사용된 용어 PCR (Polymerase Chain Reaction)은 중합효소를 사용하여 핵산을 연쇄적으로 합성하여 개시 핵산물질을 기하급수적으로 증폭하는 방법으로 당업계에 널리 공지된 방법으로, 특정 핵산의 존재 유무를 확인하는 정성분석 PCR, 특정핵산의 양을 측정하는 정량 PCR 및 PCR 과정을 실시간으로 추적하여 정성 및 정량 분석을 가능하게 하는 실시간 PCR을 모두 포함하는 개념이다. PCR에 의해 증폭된 산물(amplicon)은 주형으로 사용한 분자와 상응하는 서열을 가지며, 당업계에 공지된 다양한 방법으로 분석될 수 있다. 이러한 방법은 당업계에 공지된 것으로서 예를 들면 젤 전기영동, 실시간 PCR 분석, 정량 PCR, SSCP (single strand conformational polymorphism), RFLP(restriction fragment length polymorphism), CZE(capillary zone electrophoresis), WAVE (HPLC-based nucleic acid analyzing technology) 및 마이크로칩을 포함하나, 이로 제한하는 것은 아니다.
본 이론으로 제한하고자 하는 것은 아니나, 일 구현예에서 본원에 따른 폴리펩타이드가 관여하는 ALT 기전은 도 4에 기재된 바와 같다. 도 4에 따르면, T-ALT D (도너)가 텔로미어 근위(proximal to telomere)로 시스-복제되고, 이어 다른 염색체 말단으로의 트랜스-복제되어 T-ALT R (저장소)를 생성하여 T-ALT 저장소가 텔로미어 유지용 주형으로서 사용된다.
따라서 한 양태에서 본원은 꼬마선충을 제공하는 단계; 상기 꼬마선충을 암을 유발할 수 있는 환경에 노출하는 단계; 상기 암 유발환경 노출 전, 노출 후 또는 노출과 함께, 상기 꼬마선충에 텔로미어의 유지를 억제할 것으로 기대되는 시험물질을 처리하는 단계; 및 상기 시험물질로 처리된 꼬마선충과 상기 시험물질로 처리되지 않은 대조군에서 T-ALT (Template-Alternative Lengthening of Telomere) 엘리먼트를 검출하는 단계를 포함하며, 상기 시험물질로 처리된 꼬마선충에서 상기 대조군과 비교하여 T-ALT의 부재 또는 T-ALT의 반복 정도가 짧은 경우, 상기 시험물질을 암치료용 후보물질로 선별하는 것인, ALT 양성 암치료제 스크리닝 방법을 제공한다.
본원에 따른 방법에서 T-ALT의 부재 또는 T-ALT의 반복 정도는 공지된 기술을 이용하여 검출될 수 있으며, 앞서 기술한 바를 참조할 수 있다. 예를 들면 TRF(Terminal Restriction Fragment) 분석, PCR, 정량 PCR, 인시츄교잡, 서던블랏, 또는 서열분석 방법이 사용될 수 있다.
본원에 따른 방법에서 T-ALT 엘리먼트는 도너로 작용하는 염색체 내에 존재하는 T-ALT 도너 및 상기 도너가 시스 또는 트랜스로 텔로미어 근위에 복제되어 생성된 T-ALT 저장소 (R)을 포함하며, 이는 앞서 설명한 바를 참조할 수 있다. 본원에 따른 일 구현예에서 검출은 텔로미어 근위 (proximal to telomere)에 존재하는 T-ALT 저장소를 일컫는 것으로, 근위란, 텔로미어로부터 10,000bp 내의 위치를 일컫는 것이다.
본원에 따른 꼬마선충 (C.elegans)은 공지의 방법대로 유지될 수 있다. 본원에 따른 방법에서 암을 유발할 수 있는 환경이란, 상기 꼬마선충을 방사선으로 조사 예를 들면 감마선을 60gy 조사할 수 있으며, 또는 기타 하기 문헌에 기재된 것을 참조할 수 있다 (Meier et al. Genome Res. 2014. 24: 1624-1636; 및 Subramaniam et al. Current Biology 2003. 13: 134-139).
꼬마선충은 암 유발 환경 노출 전에, 동시에 또는 노출 후에 텔로미어 길이 유지를 억제할 것으로 기대되는 시험물질로 처리된다.
본 방법에서 사용되는 시험물질의 양 및 종류 등은 사용하는 구체적인 실험방법 및 시험물질의 종류에 따라 달라지며, 당업자라면 적절한 양을 선택할 수 있을 것이다. 실험결과 시험물질과 접촉되지 않은 대조군과 비교하여 시험물질의 존재하에서 ALT 활성의 활성의 감소 즉, T-ALT의 부재 또는 대조군과 비교하여 T-ALT 특히 T-ALT 저장소 (R)이 적게 검출된 경우 이를 후보물질로 선별한다. 대조군과 비교 약 99% 이하 감소, 약 95% 이하 감소, 약 90% 감소, 약 85% 감소, 약 80% 감소, 약 75% 감소, 약 70% 감소, 약 65% 이하 감소, 약 60% 이하 감소, 약 55% 감소, 약 50% 이하 감소, 약 45% 이하 감소, 약 40% 이하 감소, 약 30% 이하 감소, 약 20% 이하 감소를 의미하나, 이를 벋어나는 범위를 제외하는 것은 아니다.
본원의 "시험물질"은 텔로미어 길이 유지를 억제할 것으로 기대되는 물질을 의미하여, 저분자량 화합물, 고분자량 화합물, 화합물들의 혼합물(예컨대, 천연 추출물 또는 세포 또는 조직 배양물), 또는 바이오의약품(예컨대, 단백질, 항체, 펩타이드, DNA, RNA, 안티센스 올리고뉴클레오타이드, RNAi, 앱타머, RNAzyme 및 DNAzyme), 또는 당 및 지질 등을 포함하나 이로 한정하는 것은 아니다. 상기 시험물질은 2개 이상의 아미노산 잔기, 예컨대 6개, 10개, 12개, 20개 이하 또는 20개 초과 예컨대 50개 아미노산 잔기를 갖는 폴리펩타이드일 수 있다. 상기 시험 물질은 합성 또는 천연 화합물의 라이브러리로부터 얻을 수 있으며 이러한 화합물의 라이브러리를 얻는 방법은 당업계에 공지되어 있다. 합성 화합물 라이브러리는 Maybridge Chemical Co.(UK), Comgenex(USA), Brandon Associates(USA), Microsource(USA) 및 Sigma-Aldrich(USA)에서 상업적으로 구입 가능하며, 천연 화합물의 라이브러리는 Pan Laboratories(USA) 및 MycoSearch(USA)에서 상업적으로 구입 가능하다. 시험 물질은 당업계에 공지된 다양한 조합 라이브러리 방법에 의해 얻을 수 있으며, 예를 들어, 생물학적 라이브러리, 공간 어드레서블 패러럴 고상 또는 액상 라이브러리(spatially addressable parallel solid phase or solution phase libraries), 디컨볼루션이 요구되는 합성 라이브러리 방법, “1-비드 1-화합물” 라이브러리 방법, 그리고 친화성 크로마토그래피 선별을 이용하는 합성 라이브러리 방법에 의해 얻을 수 있다. 분자 라이브러리의 합성 방법은, DeWitt et al., Proc. Natl. Acad. Sci. U.S.A. 90, 6909, 1993; Erb et al. Proc. Natl. Acad. Sci. U.S.A. 91, 11422, 1994; Zuckermann et al., J. Med. Chem. 37, 2678, 1994; Cho et al., Science 261, 1303, 1993; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2059, 1994; Carell et al., Angew. Chem. Int. Ed. Engl. 33, 2061; Gallop et al., J. Med. Chem. 37, 1233, 1994 등에 개시되어 있다.
예를 들면 본원에 따른 스크리닝 목적을 위해서는 화합물은 저분자량의 치료효과를 갖는 것이 사용될 수 있다. 예를 들면 중량이 400 Da, 600 Da 또는 800 Da과 같은 약 1000 Da 내외의 화합물이 사용될 수 있다. 목적에 따라 이러한 화합물은 화합물 라이브러리의 일부를 구성할 수 있으며, 라이브러리를 구성하는 화합물의 숫자도 수십개부터 수백만개까지 다양하다. 이러한 화합물 라이브러리는 펩타이드, 펩토이드 및 기타 환형 또는 선형의 올리고머성 화합물, 및 주형을 기본으로 하는 저분자 화합물, 예컨대 벤조디아제핀, 하이단토인, 바이아릴, 카보사이클 및 폴리사이클 화합물 (예컨대 나프탈렌, 페노티아진, 아크리딘, 스테로이드 등), 카보하이드레이트 및 아미노산 유도체, 디하이드로피리딘, 벤즈하이드릴 및 헤테로사이클 (예컨대 트리아진, 인돌, 티아졸리딘 등)을 포함하는 것일 수 있으나, 이는 단지 예시적인 것으로 이로 한정되는 것은 아니다.
본원에서는 특히 이러한 저분자 화합물 중 ALT 활성을 억제할 수 있는 물질이 포함된다.
또한 예를 들면 바이올로직스가 스크리닝에 사용될 수 있다. 바이올로직스는 세포 또는 바이오분자를 일컫는 것으로, 바이오분자란, 단백질, 핵산, 탄수화물, 지질 또는 생체내 및 생체외에서 세포 시스템 등을 이용하여 생산된 물질을 일컫는 것이다. 바이오분자를 단독으로 또는 다른 바이오분자 또는 세포와 조합으로 제공될 수 있다. 바이오분자는 예를 들면, 폴리뉴클레오타이드, 펩타이드, 항체, 또는 기타 혈장에서 발견되는 단백질 또는 생물학적 유기물질을 포함하는 것이다.
본원에 따른 방법은 텔로미어의 위치를 검출하는 단계를 추가로 포함한다. 본원에 따른 방법에서 검출되는 T-ALT 엘리먼트는 특히 T-ALT 저장소로, 이는 텔로미어의 근위에 위치하기 때문에, T-ALT 엘리먼트의 검출을 위해서는 텔로미어 근위의 서열을 분석하는 것이 필요하다.
기타 본원에 따른 방법에 사용되는 검출 방법은 앞서 언급한 바를 참조할 수 있다.
다른 양태에서 본원은 또한 꼬마선충의 ALT 활성을 측정하는 방법에 관한 것이다. 일 구현예에서 상기 방법은 꼬마선충 유래의 DNA를 제공하는 단계; 상기 DNA로부터 T-ALT 엘리먼트를 증폭하는 단계; 및 상기 증폭된 산물을 정량 또는 정성적으로 검출하는 단계를 포함하며, 상기 ALT의 존재는 ALT 활성을 나타내는 것이다.
상기 방법에서 꼬마선충 유래의 DNA는 유전체 DNA를 의미하며, T-ALT 엘리먼트, 기타 증폭 및 검출 방법은 앞서 언급한 바를 참조할 수 있다.
상기 방법은 ALT의 활성을 측정은 텔로미어 기초 연구, 암 연구와 같은 분야 등에서 연구 툴로서 사용될 수 있음은 물론 암의 진단 및 항암전략 수립 분야에서 유용하게 사용될 수 있다.
이하, 본 발명의 이해를 돕기 위해서 실시예를 제시한다. 그러나 하기의 실시예는 본 발명을 보다 쉽게 이해하기 위하여 제공되는 것일 뿐 본 발명이 하기의 실시예에 한정되는 것은 아니다.
본 발명은 달리 언급이 없는 한 세포생물학, 세포배양, 분자생물학, 유전자 형질전환 기술, 미생물학, DNA 재조합기술에 관한 당업자의 기술수준 내인 통상의 기술을 사용하여 실시될 수 있다. 또한, 일반적인 기술에 관한 보다 자세한 설명은 Molecular Biotechnology: (Bernard et al., ASM press 1994); Molecular Cloning: A Laboratory Manual, 3rd Ed. (Sambrook et al., Harbor Laboratory Press 2001); Short Protocols in Molecular Biology, 4th Ed. (Ausubel et al. eds., John Wiley &Sons 1999); DNA Cloning, Volumes I and II (Glover ed., 1985)을 참고할 수 있다.
실시예
실험방법 및 재료
꼬마선충 (Caenorhabditis elegans)선별 및 배양
꼬마선충은 표준조건 (Brenner, Genetics 1974. 77(1): 71-94에 기재된 사항 참고)에서 20°C에서 배양하였다. 본 발명에 사용된 스트레인은 다음과 같다: Bristol N2 야생주, Hawaiian CB4856 야생형 분리체, trt-1(ok410)I. N2 trt-1(ok410)는 Hawaiian CB4856와 이종교배하여 CB4856 trt-1(ok410)을 생산하였다. 이종교배의 효과를 극대화시키기 위하여, 모든 염색체 마커의 SNP를 확인하였다. trt-1(ok410) 돌연변이는 PCR로 확인하였으며, trt-1(ok410) 주는 야생형 N2와 이종교배하여 초기 세대의 N2 trt-1(ok410)를 생산하였다.
EMS 처리
동시화된 L4 선충을 M9 완충액 중 50 mM EMS로 4시간 동안 처리하였다. 그 후 처리된 P0 선충이 12시간 동안 알을 낳도록 하였다. 이어 P0 선충을 제거하여 F1 선충을 분리하였다. 초기에 약 100개의 F1 알을 새로운 플레이트에 옮기고, 이어 F2 세대부터는 10~15 마리의 선충을 매 세대마다 수작업으로 옮겼다.
RNA 간섭
DsRNA를 발현하는 E. coli HT115를 1 mM 앰피실린을 포함하는 LB에서 37°C로 하룻밤 배양한 후 1 mM IPTG 및 1 mM 앰피실린을 포함하는 NGM 플레이트에 시딩하였다. 이어 매 세대에서, 10-15 L1 유충을 새로운 RNAi 배지 플레이트로 옮겼다.
텔로미어 형광 인시츄 교잡 (FISH)
성체 선충을 블리칭하여 알을 분리하였다. 분리된 알은 2% 파라포름알데하이드로 고정하였다. 알이 담긴 시험관을 액체 질소에 얼린 후 온수에서 녹여 알을 깼다. 폴리라이신으로 코팅된 슬라이드에 알을 안착시킨 후, 0.1% 트윈-20을 포함하는 인산완충용액 (PBST)로 3회 세척하여 잔류하는 PFA를 제거하였다. 이어 슬라이드를 아세톤 및 메탄올에 -20℃에서 각각 5분간 넣어둔 후 0.1% 트윈-20을 포함하는 2 X SSC (0.3 M NaCl, 0.03 M sodium citrate)에서 재수화하였다. 슬라이드를 전교잡 용액 (3X SSC, 50% formamide, 10% dextran sulfate, 50 μg/ml heparin, 100 μg/ml yeast tRNA, 100 μg/ml salmon sperm DNA)에서 37℃로 1시간동안 처리하여 블락킹하였다. PNA-(TTAGGC)3 프로브를 16시간 동안 37℃로 습한 챔버에서 배양한 후, 세척액 (2X SSC 및 50 % formamide)으로 각 15분씩 37°C에서 2회 세척하였다. PBS-T로 3회 세척 후, 슬라이드를 DAPI로 카운터 염색 한 후, 항탈색 시약 Vectashield (Vector Laboratory)으로 마운팅 한 후, 콘포칼 현미경(LSM200, Zeiss)으로 촬영하였다.
T-ALT 1 프로브는 디그옥시제닌 (DIG)으로 표지되었으며, FISH 방법으로 형광분석하였다. FISH 분석 후에, 슬라이드는 5% BSA를 포함하는 PBS-T 용액으로 1시간동안 실온에서 블락킹 한 후, 로다민 결합된 항-DIG 항체로 3시간 동안 처리하였다. PBS-T로 2회 세척한 후 슬라이드를 마운팅하고 상술한 바와 같이 분석하였다. 텔로미어 신호는 TFL-TELO 소프트웨어 (Dr. Peter Lansdorp, Terry Fox Laboratory, Vancouver)를 이용하여 분석하였다. 인시츄교잡에 사용된 프로브는 서열번호 9 (T-ALT 1)과 서열번호 10 (T-ALT 2)와 같다.
텔로미어 서던 블랏
유전체 DNA를 수득하기 위해, 선충을 수확하여 5회 M9 완충액으로 세척하였다. 이어 선충을 융해 완충액 (100μg/ml proteinase K, 50 mM KCL, 10 mM Tris pH 8.3, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20, 1 % beta-mercaptoethanol)에서 8시간 동안 융해하였다. 이어 DNA는 페놀-클로로포름을 사용하여 추출하고 에탄올 침전하였다. DNA를 TE 완충액에 녹인 후 RNAase (10μg/ml)로 2시간 처리한 후 다시 추출한 후 완충액 TE(Tris EDTA)에 녹였다.
서던 블랏을 위해, 5μg의 DNA를 1 유니트의 제한효소로 처리한 후 펄스필드 전기영동 장치를 이용하여 분리한 후 Zeta 프로브 막 (Bio-Rad)으로 하룻밤동안 DNA를 블랏팅 하였다. 이어 막을 UV로 가교한 후 DIG Easy 교잡 완충액 중에서 프로브와 42℃로 16시간 동안 교잡하였다. 이어 막을 실온에서 2x SSC, 0.1 % SDS로 2회 세척하고, 0.2x SSC, 0.1 % SDS로 42℃에서 2회 세척하였다. DIG-표지된 프로브를 항-DIG-AP 항체 화학발광 검출키트 (Roche) 및 ImageQuant LAS-4000 biomolecular imager (GE healthcare)를 사용하여 검출하였다. 프로브 (TTAGGC)30 probe를 T-easy 벡터에 클로닝된 PCR 증폭되는 텔로미어 서열을 이용하여 DIG-UTP로 표지하였다. T-ALT I 및 T-ALT II 프로브는 T-ALTs에 특이한 영역을 표적으로 하는 프라이머를 사용하여 DIG-UTP로 표지하였다. 서던블랏에 사용된 프로브는 서열번호 11 (T-ALT 1)과 서열번호 12 (T-ALT 2)와 같다.
BAL 31 엑소뉴클레아제 처리
DNA 5μg을 10 unit의 BAL 31으로 30℃에서 1x BAL 31 완충액 중에서 처리하였다. 반응은 최종농도 25mM의 EGTA로 처리하여 중단하였으며, 처리된 DNA는 에탄올 침전으로 회수하고 BamHI으로 처리하였다.
텔로미어-서브텔로미어 경계의 서열분석
텔로미어-서브텔로미어 경계의 서열분석은 경계영역을 PCR로 증폭하였다. 이를 위해, 전방 프라이머는 텔로미어로 연장되도록 텔로미어-근접 DNA에 대하여 디자인하였으며, 역방 프라이머는 T-ALT 1 특이적 서열 (T26H2.5의 제1 엑손)로부터 디자인하였다. CS1 유전체 DNA 및 N2 유전체 DNA를 주형으로 사용하였다. 총 30주기의 PCR을 수행하였으며 조건은 다음과 같다: 총 3분간 어닐링 60 ℃ 및 신장. 산물을 전기영동 후, CS1-특이적 밴드를 잘라내어 DNA를 추출한 후 PCR에 사용된 프라이머와 동일한 프라이머로 서열을 분석하였다.
전체 유전체 서열분석
DNA는 300bp 크기로 절단하고 평균 인서트 크기가 430bp의 서열분석 라이브러리를 만든 후 Hiseq2000 platform (Illumina, USA) 을 이용하여 분석하였다.
변이체 발굴
EMS 및 CB4856 연관된 변이체를 이용한 변이체 발굴을 위해, 참조 유전체로서 WS243 C. elegans 유전체 및 주석 테이터를 Wormbase website (www.wormbase.org)에서 수득하였다. 미가공 서열분석 데이터 처리를 위해, Trimmomatics를 적용하여 illumina 어뎁터 서열을 제거하였다 (A. M. Bolger, et al., Bioinformatics, btu170 (2014)). 정확하지 않은 3’ 및 5’ 말단의 데이터를 제거하였다. 전처리된 결과를 상기 참조 유전체와 정렬한Burrows-Wheeler Aligner software (version 0.7.5a)를 이용하여 정렬하였다(H. Li, et al., Bioinformatics 25, 1754-1760 (2009)). 판독 결과는 내정 계수를 이용하여 BWA-MEM 알고리즘을 이용하여 참조 유전체에 대하여 정렬하였다. 변이체를 불러내기 전에, Picard’s SortSam 및 MarkDuplicates 및 GATK’s indel realignment (McKenna et al., Genome research 20, 1297-1303 (2010)) 및 BQSR (base quality score recalibration)을 적용하였다 (A. McKenna, et al., Genome research 20, 1297-1303 (2010)). 인델(indel) 정렬의 경우에는 참조 유전체와 생존개체 사이의 상당한 유전적 차이로 인해 매우 엄격한 계수를 사용하였다. 참조 유전체의 주석으로부터, SNP 및 인델을 선별하고 BQSR에 사용하였다. GATK 최선 실시에 의하면, 변이체 발굴 및 유전형 결정은 GATK 반수체 분석기를 사용하여 모든 시료에 대하여 동시에 수행하였다. 이어, 커버리지 4의 최소 원(raw) 뎁쓰로 표준 하드 필터링을 적용하였다.
T-ALT 1 콘티그 생성
T-ALT 1는 N2 유전체에는 없는 CB4856 대립유전자 (T-ALT 1 reservoir)로부터 증폭되었기 때문에, T-ALT 1 저장소는 CLC workbench 7 (Qiagen)를 내정세팅을 이용하여 CB4856 trt-1 서열분석 데이터로부터 새로 구축하였다. BWA를 사용하여, 한 쌍 중 적어도 하나가 재구축된 T-ALT 1 저장소에 맵핑되는 경우에만, CS1 판독결과를 수집하였다. 수집된 결과를 이용하여 콘티그 서열을 생성하였으며, 생성된 결과를 BLAST 서치를 이용하여 N2 유전체와 정렬하였다.
텔로미어 리드(read) 분석을 위한 전체 유전체 서열 분석
전체 유전체 서열 데이터를 BWA (H. Li, et al, ibid)를 이용하여 ce10/WBcel215 참조 어셈블리에 정렬하고, SAMtools (H. Li, et al., Bioinformatics 25, 2078-2079 (2009))을 이용하여 bam 파일로 변환하였다. 선충주와 상이한 Bam 파일을 종전에 기술된 소프트웨어 (http://sourceforge.net/projects/motifcounter/) (D. Conomos, et al., The Journal of cell biology 199, 893-906 (2012))를 이용하여 텔로미어 내에서 유래된 것으로 예측되는 리드에 대하여 분석하였다. 요약하면, 적어도 6개의 공통 (canonical) 텔로미어 반복 (TTAGGC)을 포함하는 판독결과 (read)를 추출한 후 별도의 파일로 저장하였다. 판독결과의 수를 세고 총 판독결과 밀도에 대하여 노말라이즈 하여 텔로미어 길이를 추론하였다. 저장된 파일은 이어 스플리트- 페어 영역 및 변이체 불러오기에 사용하였다.
T-ALT 바이오인포메틱스 분석
텔로미어와 관련있는 영역을 규명하기 위하여, 텔로머 판독결과를 포함하는 파일을 이용하여 이와 관련된 쌍으로된 말단을 추출하였다. 모든 쌍이 텔로미어인 경우의 판독결과는 제외하였으며, 오로지 한 쌍만이 유전체에 맵핑되는 판독결과만을 남겨두었다. 서브 텔로미어 영역 및 사이 텔로미어를 둘러싸는 좌위에 부가하여, CS1 및 CS2의 경우는 T-ALT1에, 그리고 NS1 및 NS2의 경우에는 T-ALT2에 대부분의 판독결과가 맵핑되었다.
유전체에 걸쳐 평균 유전체 커버리지는 SAMtools를 이용하여 중복 및 낮은 맵핑 품질 (q<20) 의 판독결과를 제거한 후 BedTools package (A. R. Quinlan, et al., Bioinformatics 26, 841-842 (2010))의 프로그램인 genomecov를 이용하여 분석하였다. 리드뎁쓰는 유전체의 매 뉴클레오타이드에 대하여 평가되었으며 평균커버리지로 나누어 노말라이즈 하여 리드뎁쓰에 대한 배수의 변화로 나타냈다. 유전체에 걸친 스트레인 특이적 변화를 고려하여 모 스트레인과 비교한 리드뎁쓰의 변화 배수를 ALT 생존개체에서 차감하였다. 유전체 걸친 그리고 좌외 특이적 리드뎁쓰 변화에 대한 선형 플롯을 R로 생성하였다.
텔로미어 변이체 불러오기
텔로미어 변이체는 텔로미어 판독결과를 포함하는 파일을 이용하여 분석하였다. 각 변이체 유형의 수는 종전에 기술된 바와 같이 각 라이브러리의 서브세트의 판독결과내에서 카운트하였다 (D. Conomos et al., ibid). 각 반복 변이체의 존재여부는 각 서브세트 판독결과내에서 분석하고, 이들의 빈도를 계산하고 파이 차트를 생성하였다.
mRNA 서열분석
Tuxedo pipeline (Tophat2 and Cufflinks pipeline) (C. Trapnell, et al., Nature protocols 7, 562-578 (2012)를 사용하여 전처리된 RNA-Seq 판독결과를 참조 유전체에 정렬하고 전사체의 발현 정도를 측정하였다. 요약하면, 우선 주어진 전사체 주석을 이용하여 Tophat2으로 RNA-Seq 판독결과를 C. elegans 유전체에 맵핑하였다 (D. Kim, G et al., Genome Biol 14, R36 (2013)). 이어 Cufflinks package (C. Trapnell, et al., Nature biotechnology 28, 511-515 (2010))의 cuffquant 및 cuffnorm 소프트웨어를 사용하여 전 시료에 걸쳐 노말라이즈된 RPKM에서 알려진 전사체가 얼마나 많은지 측정하였다.
유전자 세트 강화 분석 (Gene set enrichment analysis (GSEA)
C. elegans에 대한 유전자 온톨로지 (G0)주석 데이터를 Wormbase website (www.wormbase.org)에서 수득하였다. 피폭시 변화하는 유전자 세트는 참고문헌 (S. Greiss, et al., BMC genomics 9, 334 (2008)) 에서 수득하였다. ALT 시료 및 야생형 시료의 모든 쌍에 대하여, 상기 수득한 데이터를 이용하여 GSEA를 수행하였다 (A. Subramanian, et al., PNAS 102, 15545-15550 (2005)).
실시예 1: 텔로머라제 유전자 trt-1, trt-1(ok410)이 결여된 꼬마선충 선별 및 특징 규명
실험방법에 기재된 야생형 꼬마선충 N2 및 CB4856 스트레인을 DNA 알킬화제인 에틸메탄설포네이트 (EMS)로 처리한 후 생존개체를 선별하였다. 결과는 도 1에 기재되어 있다. 선별된 모든 6개 (CS 1 내지 CS6)의 CS 주 및 5개 (NS1 내지 NS5) 중 2 개의 NS 주는 gross 표현형 없이 매 세대에서 10 내지 15 개체를 전달하는 방식으로 적어도 300 세대동안 유지되었으며, 이는 ALT 주(strain)가 안정적으로 유지되고 있음을 나타내는 것이다.
CS 생존개체를 FISH, 말단제한단편 (TRF) 및 전체 유전체 서열 분석 결과 텔로미어의 길이가 모 개체보다 긴 것으로 나타났다 (도 1b 및 1c 참조). 이러한 텔로미어는 BAL31 엑소뉴클리아제 처리로 없어졌으며 이는 텔로미어가 염색체 말단에 존재하고 있음을 나타낸다. 아울러 도 1d에 나타난 바와 같이, 표준 꼬마선충 텔로미어는 자르지 않는 HinfI 효소로 절단한 결과 절단되었으며, 이는 생존개체의 텔로미어 내에 부가의 서열이 포함되어 있음을 나타내는 것으로, 이는 생존개체가 모 개체와는 다른 방식으로 텔로미어 길이를 연장시켜 유전체를 유지하고 있음을 나타내는 것이다.
실시예 2 : T-ALT 엘레멘트 규명 및 특징
아울러 상기와 같은 생존개체에서 관찰된 ALT와 관련된 유전체 부위를 규명하기 위하여, 연관맵핑 분석을 수행한 결과, V 염색체 상의 한 부위에 존재하는 두 개의 CB4856 trt-1-derived SNV (Single Nucleotide Variation)를 발견하였으며, 이 부위가 CS1 및 CS2 생존개체에서 ALT 유도와 높은 관련성이 있음을 나타낸다 (도 2a 참조).
이어 도 2b에 나타난 바와 같이 CS1 및 CS2에서 유전체 서열 전체를 분석한 결과 1,446 bp (chrV:19,229,654-19,231,100) 의 ALT 표현형과 연관된 2 SNV를 포괄하는 유전체 영역을 규명하였으며, 이들은 평균 서열 뎁쓰와 비교하여 100배 이상 높은 값을 나타냈으며, 이는 Template for ALT element 1 (T-ALT 1)으로 명명하고, 이는 상당한 이종교배 후에서 가장 많이 증폭된 서열인 것으로 나타났다.
T-ALT 1 엘레먼트는 꼬마선충의 코딩 유전자 T26H2.5의 제1 엑손 및 프로모터를 포함하는 유니크하게 맵핑되는 서열 (서열번호 1)을 포함하며, 같은 방향의 두 개의 반복서열 (interstitial telomere-like sequences (ITS))이 플랭킹하고 있으며, 구조 및 서열은 도 7에 기재된 바와 같다. T-ALT 1은 모든 생존개체에서 발견되었다 T-ALT 1의 위치를 결정하기 위하여, T-ALT 1 엘리먼트에 맵핑되는 모든 쌍-말단 서열 리드를 추출하며, 오버랩핑되는 쌍을 이용하여 200bp to 1.7kb 길이의 인접하는 단편을 구축하였고, T-ALT 1 엘리먼트 및 염색체 말단 모두에 정렬되는 5개의 콘티그를 규명하였다. 이어 T-ALT 1 엘리먼트에 특이적 프라이머 (5'-AACAAGCTTCTGGCACGTCT-3' 서열번호 4), 염색체 말단에 특이적 프라이머 (염색체 I의 오른쪽 Arm : 5'-TGTGCGGGGAGGGAGTATTA-3' , 염색체 II의 오른쪽 Arm : 5'-CGATGCGAAGAGATGGGAGT-3', 염색체 III의 왼쪽 Arm : 5'-GCCTAAAAGCGCGAAATCCT-3') 를 이용하여 PCR을 수행한 결과 도 2c에 기재된 바와 같이 생존개체에서만 증폭되었다. 이어 FISH 실험을 수행한 결과, T-ALT 1 엘리먼트 프로브와 텔로미어 프로브가 같은 곳에 위치하는 것으로 나타났다 (도 2d 참조). 이어 T-ALT 1 엘리먼트에 없는 부위를 자르는 제한효소 및 상기 엘리먼트를 자르는 제한효소를 이용하여 TRF 분석을 수행한 결과, 도 2e에 나타난 바와 같이, T-ALT 1 엘리먼트가 잘리지 않은 경우에 TRF로 분석한 텔로미어 길이가 더 긴 것으로 나타났으며, 이는 T-ALT 1 엘리먼트가 생존개체에서 여러 카피가 존재한다는 것을 나타낸다.
이어 N2 trt-1-유래 ALT 생존개체 유래의 엘리먼트를 분석한 결과, 생존개체 중 NS1 및 NS2에서 더 긴 길이의 텔로미어가 관찰되었으며, 표준 텔로미어는 자르지 않는 제한효소를 이용한 TRF 분석에서 뚜렷이 구분되는 밴드가 나타났다 (도 3a 참조). 이러한 밴드는 CB4856 유래 생존개체의 결과가 아주 상이한 것으로, NS1 & NS2에 대한 WGS 분석결과 염색체 I의 텔로미어 5'에 근접한 특이적 유전체 엘리먼트를 규명하였고(도 3b 참조), 이를 ‘Template of ALT 2’ (T-ALT 2) 엘리먼트로 명명하였다. T-ALT 2 엘리먼트에 특이적인 프로브는 TRF 와 FISH 분석에서 텔로미어에 위치하는 것으로 나타났다 (도 3c 및 3d). 이는 NS1 & NS2 생존개체의 염색체 말단에 T-ALT 2 엘리먼트가 존재하는 것을 나타내며, 도 5의 결과와도 일치하는 것이다. T-ALT 2 엘리먼트의 구조는 도 7에 나타난 바와 같이 T-ALT 1 엘리먼트 구조와 유사하며, 즉 서열 (서열번호 2의 서열)을 가운데 두고, 반복서열이 양 쪽에 동일한 방향으로 위치하고 있다.
텔로미어 유전자가 결여된 꼬마선충의 경우 스테릴러티를 큰 집단의 유지를 통해서 텔로미어 길이 유지 없이도 극복하는 것으로 알려져 있다 (C. Cheng, et al., PNAS 109, 7805-7810 (2012)). 이와 대조적으로, 본원의 생존개체는 텔로미어에 T-ALT 구조를 도입하고, 배양을 위해 각 세대별로 몇 마리씩 새로운 플레이트로 옮기는 방식으로 안정적으로 유지할 수 있었다.
이러한 이유는 EMS가 DNA 손상 반응을 상승시킨 것으로 판단되며, 생존개체에 대한 RNA-seq 분석결과 ALT 생존개체에서 유의적으로 변경된 유전자는 감마 조사에 의해 유도된 유전자 변화와 상관이 있는 것으로 나타났다 (도 6). 이러한 결과는 인간 ALT 세포와 유사하게 꼬마선충에서도 DSB (double strand break) 반응이 변경되었다는 것을 나타낸다.
실시예 3 : ALT에서 T-ALT 엘리먼트 작용 기전
CS 생존개체와 연관된 두 개의 SNV 분석 결과, 모 CB4856 개체 및 CS 생존개체 모두 상기 CB4856 유래 SNV에 대하여 헤테로자이코트인 것으로 나타났다. 또한 상기 CB4856 유래된 SNV는 N2 유래된 변이체에 대하여 생존개체에 많이 있는 것으로 나타났다 (도 4a). CS1의 경우, N2-유래 변이체를 포함하는 리드는 유전체 평균 서열 뎁쓰 (0.9 배)로 나타났으며, CB4856-유래 변이체를 포함하는 리드는 평균 뎁쓰보다 76배 많았다. 마찬가지로 N2 유래된 변이체를 포함하는 CS2는 평균적 수준으로 나타난 반면 (1.2 배), CB4856 유래 변이체를 포함하는 리드는 상당히 증가하였다 (122 배)(도 4a). PCR 및 서열분석을 통해 염색체 V 영역의 내부 T-ALT 1의 SNV 서열은 N2-type SNV에 대해 호모자이고트인 것으로 나타났다. 부가하여, 상기 영역은 모 CB4856 개체에서 중복되었다. 이러한 결과는 CB4856-유래로 명명된 SNV가 실제로는 CB4856 유전체의 다른 부위에 위치하는 것을 나타낸다. 추가 분석 결과 CB4856-유래 SNV는 CB4856 개체주 및 생존개체에서 염색체 V의 오른 말단에 위치한ㄴ 것으로 나타났으나 N2에서는 그렇지 않았다 (도 4b, c). 이는 염색체 내에, T-ATL 1이 두 개의 부위 즉, 염색체 안쪽에 위치하는 T-ALT 1 도너 donor (T-ALT1 D) 및 텔로미어 근위에 존재하는 T-ALT 1 저장소 (T-ALT 1 R)로 위치하고 있음을 나타낸다.
내부 영역에서 말단의 텔로미어 근위로 복제되는 T-ALT 1 엘리먼트와 유사하게, T-ALT 2 엘리먼트도 내부 좌위 (T-ALT2 D 좌위)에서 염색체 I의 왼편 암의 근위로 복제되었으며 (도 4d), 이는 CB4856 유전체에서는 검출되지 않았다 (도 4e). 이러한 결과는 CB4856 and N2 에서 ALT의 기전으로 서로 상이한 T-ALT 저장소로 진화하였음을 나타낸다. ALT 활성화동안, T-ALT2 D가 아닌, T-ALT2 R 좌위의 변이체 반복서열이 NS 생존개체에 많이 나타났으며, 이는 T-ALT 2 R이 ALT의 주형으로 작용하였음을 나타낸다 (도 4e).
이상에서 본원의 예시적인 실시예에 대하여 상세하게 설명하였지만 본원의 권리범위는 이에 한정되는 것은 아니고 다음의 청구범위에서 정의하고 있는 본원의 기본 개념을 이용한 당업자의 여러 변형 및 개량 형태 또한 본원의 권리범위에 속하는 것이다.
본 발명에서 사용되는 모든 기술용어는, 달리 정의되지 않는 이상, 본 발명의 관련 분야에서 통상의 당업자가 일반적으로 이해하는 바와 같은 의미로 사용된다. 본 명세서에 참고문헌으로 기재되는 모든 간행물의 내용은 본 발명에 도입된다.
Claims (11)
- 대안적 텔로미어 유지 (Alternative Lengthening of Telomere ALT) 기작에 작용하는 폴리뉴클레오타이드로,상기 폴리뉴클레오타이드는 서열번호 1의 폴리뉴클레오타이드에 상기 서열번호 1의 폴리뉴클레오타이드의 5' 또는 3', 또는 5' 및 3' 각각에 5'-(TTAGGC)x(TCAGGC)y(TTAGGC)z-3’의 3 종류의 단위서열을 포함하는 제 1 서열이 연결된 폴리뉴클레오타이드; 또는서열번호 2의 폴리뉴클레오타이드에 상기 서열번호 2의 폴리뉴클레오타이드의 5' 또는 3', 또는 5' 및 3' 각각에 5'-(TTAGGC)l(TTAGTM)m(TTAGGC)n-3’의 3 종류의 단위서열을 포함하는 제 2 서열이 연결된 폴리뉴클레오타이드이고상기 제 1 서열 및 제 2 서열 각각에서 상기 3 종류의 단위서열의 순서는 무작위이며, 상기 제 2 서열에서 M은 A 또는 C이고,상기 x, y, z, l, m 및 n은 0 또는 1 이상의 정수로, 각각 동일하거나 상이한 것인, 대안적 텔로미어 유지 (Alternative Lengthening of Telomere ALT) 기작에 작용하는 폴리뉴클레오타이드.
- 제 1 항에 있어서, 상기 x, y, z, l, m 및 n은 각각 1에서 100사이의 정수인, 폴리뉴클레오타이드.
- 제 1 항 또는 제 2 항에 따른 폴리뉴클레오타이드 검출용 물질을 포함하는, ALT 양성 암 검출용 조성물.
- 꼬마선충을 제공하는 단계;상기 꼬마선충을 암을 유발할 수 있는 환경에 노출하는 단계;상기 암 유발환경 노출 전, 노출 후 또는 노출과 함께, 상기 꼬마선충에 텔로미어의 유지를 억제할 것으로 기대되는 시험물질을 처리하는 단계; 및상기 시험물질로 처리된 꼬마선충과 상기 시험물질로 처리되지 않은 대조군에서 T-ALT (Template-Alternative Lengthening of Telomere) 기작에 작용하는 엘리먼트를 검출하는 단계를 포함하며,상기 T-ALT 엘리먼트는 서열번호 1의 폴리뉴클레오타이드에 상기 서열번호 1의 폴리뉴클레오타이드의 5' 또는 3', 또는 5' 및 3’ 각각에 5'-(TTAGGC)x(TCAGGC)y(TTAGGC)z-3’의 제 1 서열의 폴리뉴클레오타이드가 연결된 폴리뉴클레오타이드, 또는 서열번호 2의 폴리뉴클레오타이드에 상기 서열번호 2의 폴리뉴클레오타이드의 5' 또는 3', 또는 5' 및 3' 각각에 5'-(TTAGGC)l(TTAGTM)m(TTAGGC)n-3’의 제 2 서열의 폴리뉴클레오타이드가 연결된 폴리뉴클레오타이드로, 상기 x, y, z, l, m 및 n은 0 또는 1 이상의 정수로 각각 동일하거나 상이하며,상기 시험물질로 처리된 꼬마선충에서 상기 대조군과 비교하여 T-ALT의 부재 또는 대조군과 비교하여 T-ALT 길이가 짧은 경우, 상기 시험물질을 암치료용 후보물질로 선별하는 것인, ALT 양성 암치료제 스크리닝 방법.
- 제 4 항에 있어서, 상기 x, y, z, l, m 및 n은 각각 1에서 100사이의 정수인, 폴리뉴클레오타이드.
- 제 4 항 또는 제 5 항에 있어서, 상기 T-ALT는 상기 선충의 염색체에 존재하는 텔로미어 근위 (proximal to telomere)에 존재하는 것인, 방법.
- 제 4 항 내지 제 6 항 중 어느 한 항에 있어서, 상기 방법은 텔로미어를 검출하는 단계를 추가로 포함하는 것인, 방법.
- 제 4 항 내지 제 7 항 중 어느 한 항에 있어서, 상기 검출은 TRF(Terminal Restriction Fragment) 분석, PCR, 정량 PCR, 인시츄교잡, 서던블랏, 또는 서열분석 방법으로 수행되는 것인, 방법.
- 제 8 항에 있어서,상기 PCR은 서열번호 3 및 서열번호 4의 프라이머 세트, 서열번호 5 및 서열번호 6의 프라이머 세트 또는 서열번호 7 및 서열번호 8의 프라이머 세트를 이용하여 수행되며,상기 인시츄교잡은 서열번호 9 또는 서열번호 10으로 표시되는 프로브를 이용하여 수행되며,상기 서던블랏은 서열번호 11 또는 서열번호 12로 표시되는 프로브를 이용하여 수행되는 것인, 방법.
- 꼬마선충의 ALT 활성을 측정하는 방법으로, 상기 방법은꼬마선충 유래의 DNA를 제공하는 단계;상기 DNA로부터 T-ALT 엘리먼트를 증폭하는 단계; 및상기 증폭된 산물을 정량 또는 정성적으로 검출하는 단계를 포함하며,상기 T-ALT 엘리먼트는 서열번호 1의 폴리뉴클레오타이드에 상기 서열번호 1의 폴리뉴클레오타이드의 5' 또는 3', 또는 5' 및 3’ 각각에 5'-(TTAGGC)x(TCAGGC)y(TTAGGC)z-3’의 제 1 서열의 폴리뉴클레오타이드가 연결된 폴리뉴클레오타이드, 또는 서열번호 2의 폴리뉴클레오타이드에 상기 서열번호 2의 폴리뉴클레오타이드의 5' 또는 3', 또는 5' 및 3' 각각에 5'-(TTAGGC)l(TTAGTM)m(TTAGGC)n-3’의 제 2 서열의 폴리뉴클레오타이드가 연결된 폴리뉴클레오타이드로, 상기 x, y, z, l, m 및 n은 0 또는 1 이상의 정수로 각각 동일하거나 상이하며, 상기 T-ALT 엘레멘트의 존재는 ALT 활성을 나타내는 것인, 방법.
- 제 10 항에 있어서, 상기 T-ALT는 상기 선충에 존재하는 텔로미어 근위 (proximal to telomere)에 존재하는 것인, 방법.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| KR10-2015-0016480 | 2015-02-03 | ||
| KR1020150016480A KR101734636B1 (ko) | 2015-02-03 | 2015-02-03 | 세포내 대안적 텔로미어 유지 활성에 관여하는 엘리먼트 및 그 용도 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016125940A1 true WO2016125940A1 (ko) | 2016-08-11 |
Family
ID=56564268
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/KR2015/001315 Ceased WO2016125940A1 (ko) | 2015-02-03 | 2015-02-10 | 세포내 대안적 텔로미어 유지 활성에 관여하는 엘리먼트 및 그 용도 |
Country Status (2)
| Country | Link |
|---|---|
| KR (1) | KR101734636B1 (ko) |
| WO (1) | WO2016125940A1 (ko) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20250109618A (ko) * | 2024-01-09 | 2025-07-17 | 서울대학교산학협력단 | 대안적 텔로미어 유지 기전 양성 암 또는 노화의 예방 또는 치료용 조성물 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20020077618A (ko) * | 2001-04-02 | 2002-10-12 | 주식회사 알엔에이 | 텔로미어를 이용한 항암제 후보물질의 선별방법 |
| KR20110011306A (ko) * | 2009-07-28 | 2011-02-08 | 경북대학교 산학협력단 | 텔로미어 유지 유전자를 이용한 폐암 감수성 진단용 마커 및 폐암 감수성 예측 및 판단 방법 |
| EP2623105A2 (en) * | 2004-01-15 | 2013-08-07 | Alt Solutions, Inc. | Modulation of line-1 reverse transcriptase |
-
2015
- 2015-02-03 KR KR1020150016480A patent/KR101734636B1/ko active Active
- 2015-02-10 WO PCT/KR2015/001315 patent/WO2016125940A1/ko not_active Ceased
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR20020077618A (ko) * | 2001-04-02 | 2002-10-12 | 주식회사 알엔에이 | 텔로미어를 이용한 항암제 후보물질의 선별방법 |
| EP2623105A2 (en) * | 2004-01-15 | 2013-08-07 | Alt Solutions, Inc. | Modulation of line-1 reverse transcriptase |
| KR20110011306A (ko) * | 2009-07-28 | 2011-02-08 | 경북대학교 산학협력단 | 텔로미어 유지 유전자를 이용한 폐암 감수성 진단용 마커 및 폐암 감수성 예측 및 판단 방법 |
Non-Patent Citations (3)
| Title |
|---|
| JEITANY, MAYA ET AL.: "A Preclinical Mouse Model of Glioma with an Alternative Mechanism of Telomere Maintenance (ALT)", INTERNATIONAL JOURNAL OF CANCER, vol. 136, no. 7, 11 September 2014 (2014-09-11), pages 1546 - 1558 * |
| QUEISSER, ANGELA ET AL.: "Inhibition of Telomerase induces Alternative Lengthening of Telomeres during Human Esophageal Carcinogenesis", CANCER GENETICS, vol. 206, no. 11, 11 October 2013 (2013-10-11), pages 374 - 386 * |
| SEO, BEOM SEOK ET AL.: "Dissecting Alternative Lengthening of Telomeres in the Nematode Caenorhabditis Elegans", PROCEEDINGS OF ''AN EMBO CONFERENCE SERIES'', ''TELOMERES, TELOMERASE AND DISEASE, 4 May 2014 (2014-05-04), Brussels, Belgium, pages 183 * |
Also Published As
| Publication number | Publication date |
|---|---|
| KR101734636B1 (ko) | 2017-05-11 |
| KR20160095336A (ko) | 2016-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Mangiante et al. | Multiomic analysis of malignant pleural mesothelioma identifies molecular axes and specialized tumor profiles driving intertumor heterogeneity | |
| US12305224B2 (en) | Multiplex labeling of molecules by sequential hybridization barcoding | |
| US10510435B2 (en) | Error correction of multiplex imaging analysis by sequential hybridization | |
| Krupp et al. | Exonic mosaic mutations contribute risk for autism spectrum disorder | |
| US20230039899A1 (en) | In situ rna analysis using probe pair ligation | |
| Houston et al. | Development and validation of a high density SNP genotyping array for Atlantic salmon (Salmo salar) | |
| Cole et al. | Mouse tetrad analysis provides insights into recombination mechanisms and hotspot evolutionary dynamics | |
| CN111394426B (zh) | 用于个人表观基因组学的至天然染色质的转座 | |
| KR20220012849A (ko) | 단일 세포 유전 구조 변이의 포괄적인 검출 | |
| US20170029876A1 (en) | Method for detecting, quantifying and mapping damage and/or repair of dna strands | |
| Jonkhout et al. | Subcellular relocalization and nuclear redistribution of the RNA methyltransferases TRMT1 and TRMT1L upon neuronal activation | |
| Pérez-Arques et al. | RNAi epimutations conferring antifungal drug resistance are inheritable | |
| Cockrell et al. | Nucleolar organizer regions as transcription-based scaffolds of nucleolar structure and function | |
| WO2016125940A1 (ko) | 세포내 대안적 텔로미어 유지 활성에 관여하는 엘리먼트 및 그 용도 | |
| Wendte et al. | The Pol IV largest subunit CTD quantitatively affects siRNA levels guiding RNA-directed DNA methylation | |
| Bisht et al. | Molecular combing solutions to characterize replication kinetics and genome rearrangements | |
| Ramirez et al. | Nanopore long-read sequencing unveils genomic disruptions in Alzheimer’s disease | |
| Shaw et al. | Gene dosage change of TPTE and BAGE2 and breakpoint analysis in Robertsonian Down syndrome | |
| Huang et al. | Advances in Nanopore and Photoelectron-Based High-Throughput Sequencing Technology for Single-Molecule Sequencing | |
| Díaz Navarro | Development of a tool for the identification of somatic mutations and analysis of non-coding mutations in cancer | |
| Shah et al. | Non-denaturing bisulfite treatment and single-molecule real-time sequencing reveals D-loop footprints, their length, position and distribution | |
| Balducci et al. | TLX1 translocation variants and enhancer hijacking influence clinical outcome in T‐cell acute lymphoblastic leukemia | |
| Morin et al. | Cancer transcriptome sequencing and analysis | |
| Milbury | Genome instability in multiple myeloma-associated DIS3 exonuclease domain mutants | |
| Leija Salazar | Investigation of somatic mutations in synucleinopathies |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15881258 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15881258 Country of ref document: EP Kind code of ref document: A1 |