WO2016120886A2

WO2016120886A2 - A novel molecular diagnostic technique for detecting the different species of plasmodium

Info

Publication number: WO2016120886A2
Application number: PCT/IN2016/000023
Authority: WO
Inventors: Neelima MISHRA
Original assignee: Indian Council Of Medical Research
Priority date: 2015-01-30
Filing date: 2016-01-20
Publication date: 2016-08-04
Also published as: WO2016120886A3

Abstract

This invention relates to a process for detecting different species of Plasmodium such as P. falciparum, P. vivax, P. malarie and P. ovale.

Description

A NOVEL MOLECULAR DIAGNOSTIC TECHNIQUE FOR DETECTING THE DIFFERENT

SPECIES OF PLASMODIUM

FIELD OF THE INVENTION

This invention relates to a process for detecting different species of Plasmodium. BACKGROUND OF THE INVENTION

More than 0.88 million people are infected by malaria parasites in India [1]. Rapid and accurate diagnosis of malaria is essential to decrease morbidity and mortality caused by protozoan parasite Plasmodium. The routinely used methods for diagnosis of malaria include microscopy and Rapid diagnostic tests (RDTs). But these two methods are faced with a number of challenges like requirement of experienced manpower, good quality of equipment and ambient storage conditions etc. Various molecular methods have been developed and used, such as polymerase chain reaction (PCR), which aims at increasing the sensitivity and specificity of diagnosis of malaria parasite [2] however, they too have certain limitations. Since the introduction of PCR for malaria diagnosis, many processes have been evolved with new amplification methods such as Real-Time PCR and loop-mediated isothermal amplification (LAMP) [3, 4]. Although both of these methods have benefit over conventional PCR in turnaround time, the nested PCR originally described by Snounou et al. in 1993 [5] and improved in 1999 [6], continues to be the gold standard /reference method. However, limitations of nested PCR include its time-consuming operation, substantial risk of contamination and high cost-efficiency. The nested PCR targets small subunit of ribosomal RNA (18s locus) with a sensitivity of 1 to 10 parasites per microlitre (1-10 ρ/μΐ) [5], whereas a sensitivity of 5 ρ/μΐ was achieved using an amplification target on the 6kb mitochondrial genome [7]. Recently one study has used mitochondrial genome to identify different species, however it employed DNA sequencing to confirm the diagnosis [8]. DNA Sequencing itself is tedious, costly and time consuming process.

Therefore, the need exists in the art to develop a Plasmodium species specific PCR assays, which is based on previously described primers targeting the mitochondrial genome. OBJECTS OF THE INVENTION

It is, therefore, an object of this invention to propose a process for detecting different species of Plasmodium.

It is a further objection of this invention is to propose a process for detecting different species of Plasmodium, which is simple and cost-effective.

Yet another objection of this invention is to propose a process for detecting different species of Plasmodium, which is sensitive and superior to known PCR techniques.

These and other objections and advantages of the invention will be apparent from the ensuing description.

BRIEF DESCRIPTION OF THE ACCOMPANYING DIAGRAMS

FIGURE 1: Gel picture showing mitochondrial genome amplified product. Lane 1-100 bp marker and Lane 2-9 showing amplified fragment of mitochondrial gene.

FIGURE 2: Mitochondrial fragment after digestion with restriction enzymes Mlucl and Taql

DETAILED DESCRIPTION OF THE INVENTION:

Thus according to this invention is provided a process for detecting different species of Plasmodium.

In accordance with this invention, reference samples and field and clinic samples are collected, and the genomic, DNA is isolated followed by Plasmodium mitochondrial gene amplification by PCR-RFLP. The amplied PCR product is then subjected to digestion with restriction enzyme and sequenced. Sequencing is used for validation purpose to check if the correct band is amplified or not, but the procedure does not require sequencing for confirmation.

The invention will now be explained in greater details with the help of the following non-limiting example. EXAMPLES

Reference Sample: Reference samples of Plasmodium falciparum, Plasmodium vivax and Plasmodium malariae were taken from parasite bank facility of NIMR, New Delhi. Plasmodium ovale sample were from Filter spots (QC samples) sent under WHO accreditation of QC laboratory.

Field and Clinic Sample: Fifty samples were collected from Malaria Clinic of NIMR, New Delhi (between June-Aug. 2014) and fifty samples were taken from study site at Betul district of Madhya Pradesh where Therapeutic efficacy studies were conducted during 2011-2012.

Genomic Isolation: Genomic DNA was isolated from blood spots using QIAamp DNA minikit, (Qiagen, Germany) according to manufacturing protocol with slight modifications.

PCR amplification: Plasmodium mitochondrial gene amplification was performed in 20 μΐ reaction mixture containing 8.5 μΐ nuclease-free water, 2 μΐ of genomic DNA, 2 μΐ ΙΟχ PCR buffer (Life Technologies, Inc.), 3.2 μΐ of 25 mM MgC (Life Technologies, Inc.), 2 μΐ of 10 mM deoxynucleotide triphosphates (dNTP, Bangalore Genei), 1 μΐ of each forward and reverse primer (lOpmol) (GCC, biotech India) and 0.3μ1 of 5 U/ μΐ of AmpliTaq Gold® DNA Polymerase (Life Technologies, Inc.). The mitochondrial genome of Plasmodium was amplified using the forward primer 5 '-TCGCTTCTAACGGTGAAC -3 ' and reverse primer 5'- AATTGATAGTATCAGCTATCCATAG-3 '. Reactions were carried out in a Thermal cycler (Applied Biosystem). For Plasmodium mitochondrial gene amplification conditions were as follows: Step 1 , 95°C for 10 min; step 2, 95°C for 30 Second; step 3, 62°C for 20 second; step 4, 72°C for 15 second, repeat steps 2-4, 50 times, and final extension at 72°C for 10 min. (Reaction time: only 1 hour and 30 min) Digestion with restriction enzymes: Amplified PCR product was digested with Mlucl (NEB, Inc.) restriction enzymes for the identification of Plasmodium vivax, P. malaria and P. faldparum/P. o ale. Taql (NEB, Inc.) restriction enzyme was used to distinguish P. falciparum and P. ovale (Reaction time: 20-25 min).

Digested PCR product was analyzed on 2.5% agarose gel containing ethidium bromide (0.5 g/ml) and 0.5X TBE running buffer (pH 8.0). Digested PCR products were captured with the help of gel documentation system.

Sequencing: In order to standardize the method the inventors have validated the result by sequencing. For this, the amplified 220bp PCR products of species specific positive samples were sequenced in both directions using forward and reverse primers. The PCR products were purified with Qiagen purification Kit according to the manufacturer's instructions. Purified PCR products were sent to Macrogen Inc, Korea for DNA sequencing. DNA sequences were edited and aligned (CmstaTW method) with Blast.

Ethics: All sample used in the study were taken from studies of NIMR which had ethical approval vide ethics meeting held on 24.07.2014.

The details of methodology and the primers used are shown in Table- 1.

Table !

Primers Amplification Digestion With MluCI Digestion

With Taql

Forward - 95°C for 5min, Pv Pm Pf/Po Pf Po

5'-TCGCTTCTAACGGTGAAC-3 ' 62 for 20 sec,

Reverse72 for 15 sec, 216+4 139+49+ 189+2+ 220 147 s' AATTGATAGTATCAGCTATC Total 50 cycles 27+4 7+4 +78

CATAG-3' Product size:

220bp Mitochondrial region of Plasmodium species was amplified at 220bp fragment (Fig.l). Digestion with Mlucl restriction enzyme leads to fragment sizes for different species; 216 bp fragment for vivax, 139bp + 49bp + 27bp fragment for malariae and 189bp + 27bp fragment for falciparum/ovale. To distinguish P. falciparum and P.ovale amplified 220bp product was digested with Taql restriction enzyme which leads to digestion of ovale of fragment size 147bp and 78bp while falciparum was undigested with fragment size 220bp (Fig.2 & Table 2). The sequencing results further confirmed the results.

Summary of analysis of samples with microscopy, RDT and molecular diagnosis (Mitochondria gene) are shown in Table- 2.

Table-2

This technique was applied onto the field samples collected from site at Betul district of Madhya Pradesh and Malaria Clinic of NIMR, New Delhi (between June-Aug. 2014). All these samples were diagnosed by three different methods and comparative results of each were tabulated in Table 3. It was observed that the MtPCR technique according to the invention was much more sensitive and specific as compared to microscopy and RDT technique. 

The invention provides a simple, less time consuming and very cost effective method for distinction of four human Plasmodium species namely P. falciparum, P. ovale, P.vivax, P. malariae, while other methods such as nested PCR, real time PCR and sequencing requires more costly chemicals and they are comparatively more time consuming and tedious. A comparison between nested PCR and the novel PCR technique according to the invention shows the improvements (Table 4).

Comparison between nested PCR and Novel PCR

Table-4

S. No. Features Nested PCR method Novel PCR-RFLP method

1 Target gene 18s rRNA Mitochondrial (MT) gene (other techniques like LAMP (Complicated primer design) & other method also target this gene (Needs sequencing to differentiate between four species). Assays using mitochondrial targets show higher sensitivity given the higher copy number.

2 Principle Amplification of Amplification of mitrochondrial gene (MT conserved sequence gene) and further digestion with specific for different restriction enzymes

Plasmodium Species

3 Procedure 6 PCR reaction 1 PCR reaction + restriction digestion required required with only Two restriction enzymes (2 RE)

4 Total duration 25-30 hours 3-4 hours

of the technique

to get the result

5 Detection limit 10 parasite/ μΐ of blood 0.5 parasite/μΐ of blood

6 Quality of Nested PCR is usually Nested PCR is not required (only single result carried out that step PCR is done).

increase the chances of

contamination.

7 Cost per sample 540 rupees (cost for 120 rupees (cost for DNA isolation is

DNA isolation is excluded)

excluded)

Claims

WE CLAIM:

1. A process for detecting different species of Plasmodium such as P. falciparum, P. vivax, P. malane and P. ovale.

2. The process as claimed in claim 1 , comprising the steps of isolating the genomic DNA of Plasmodium species, subjecting the Plasmodium mitochondrial gene to amplification using a forward primer and a reverse primer to lead to an amplified product, followed by digestion of the amplified product with a restriction enzyme for the identification of the different Plasmodium species and analysis of the product, followed by sequencing the amplified PCR products.

3. The process as claimed in claim 2, wherein said step of amplification comprises the following steps:

Step 1 : 95°C for 10 minutes

Step 2: 95°C for 30 seconds

Step 3: 62°C for 20 seconds

Step 4: 72°C for 15 seconds

followed by repeating steps 2-4 50 times and final extension at 72°C for 10 minutes.

4. The process as claimed in claim 1, wherein primers used are:

Primers Amplification Digestion With Ml CI Digestion

With Taql

Forward- 95°C for 5min, Pv Pm Pf/Po Pf Po

5'-TCGCTTCTAACGGTGAAC-3' 62 for 20 sec,

Reverse72 for 15 sec, 216+4 139+49+ 189+2+ 220 147 s' AATTGATAGTATCAGCTATC Total 50 27+4 7+4 +78

CATAG-3' cycles Product

size: 220bp

5. The process as claimed in claim 1 , wherein for the step of digestion, MlucI restriction enzyme is used for P. νίυαχ, P. malana and P. falciparum.

6. The process as claimed in claim 1, wherein for the step of digestion, TaqI restriction enzyme is used for P. falciparum and P. ovale.