WO2016118842A1 - Treatment of lupus using metabolic modulators - Google Patents

Abstract

The present disclosure relates to methods and compositions to treat lupus and is based, in part, on the inventors' recognition and appreciation that CD4+ T cells have increased glycolysis and mitochondrial metabolism in lupus patients. Accordingly, the present invention provides methods and pharmaceutical compositions comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor, for the treatment of lupus.

Description

TREATMENT OF LUPUS USING METABOLIC MODULATORS

RELATED APPLICATIONS

[0001] This application claims priority under 35 U.S.C. § 119(e) to U.S. Provisional Application, U.S. S.N. 62/107,160, filed January 23, 2015, which is incorporated herein by reference in its entirety.

FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under grant number R01 AI045050 awarded by the National Institutes of Health. The government has certain rights in the invention.

BACKGROUND OF INVENTION

[0003] Currently there is no cure for systemic lupus erythematosus (SLE). The goal of treatment is to control symptoms. Current treatment options include high-dose

corticosteroids or medications to decrease the immune response, cytotoxic drugs to prevent cell growth, and B cell depletion treatment. Each of these treatment options has drawbacks. The use of corticosteroids or other immunomodulatory drugs increases the risk of infection. Cytotoxic drugs are associated with severe side effects, and therefore patients must be monitored closely. B cell depletion treatment is not cost-effective, and there remain concerns about its effectiveness in treating lupus. Accordingly, there remains a need for the development of novel treatments for SLE.

BRIEF SUMMARY OF INVENTION

[0004] Provided herein are compositions and methods effective for reduction of lymphocyte activation, reduction of autoantibody production and reduction of renal disease. In some aspects, the compositions and methods described herein are thus useful for the treatment of lupus. In some embodiments, the lupus is systemic lupus erythematosus (SLE). Accordingly, in some aspects, the invention provides treatments for lupus using metabolic modulators, in particular combinations of metabolic modulators. In some aspects the metabolic modulators are glycolysis inhibitors and/or mitochondrial metabolism inhibitors.

[0005] In some aspects, the disclosure relates to a composition comprising (i) a glycolysis inhibitor, and (ii) a mitochondrial metabolism inhibitor, for use in treating lupus in a subject. [0006] In some embodiments, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, I-BET, rapamycin and DCA, and pharmaceutically acceptable salts thereof.

[0007] In some embodiments, the mitochondrial metabolism inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQl, I-BET, digoxin, SR1001, CCI-779, everolimus, and ridaforolimus, and pharmaceutically acceptable salts thereof.

[0008] Aspects of the invention are based upon the surprising discovery that combinations of glycolysis inhibitors and mitochondrial metabolism inhibitors have synergistic effects in reducing the cellular metabolism of CD4+ T cells, and these synergistic effects are useful in the treatment of lupus. Therefore, in some aspects the disclosure relates to a composition comprising (i) a glycolysis inhibitor, and (ii) a mitochondrial metabolism inhibitor, for use in treating lupus in a subject having CD4+ T cells with increased glycolysis and mitochondrial metabolism .

[0009] In some embodiments, the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin. In some embodiments, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, I-BET, rapamycin and DCA, and the mitochondrial metabolism inhibitor is selected from the group consisting of PP242, NVP-BEZ235 (GSK1059615), JQl, I-BET, digoxin, SR1001, rapamycin, rapamycin analogs, CCI-779, everolimus, and ridaforolimus.

[0010] Provided herein are methods for reduction of lymphocyte activation, reduction of autoantibody production and reduction of renal disease. Without wishing to be bound by any particular theory, reduction of lymphocyte activation, autoantibody production and renal disease is useful for the treatment of lupus. Therefore, in some aspects, methods of treating lupus in a subject in need thereof by administering the compounds described herein are also provided. In some embodiments, the lupus is systemic lupus erythematosus (SLE).

[0011] In some aspects, the disclosure relates to a method for treating lupus, the method comprising administering a composition comprising (i) a glycolysis inhibitor, and (ii) a mitochondrial metabolism inhibitor to a subject. In some embodiments of the method, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, I-BET, rapamycin and DCA. In some embodiments of the method, the mitochondrial inhibitor is selected from the group consisting of metformin, PP242, NVP- BEZ235 (GSK1059615), JQl, I-BET, digoxin, SR1001, CCI-779, everolimus, and ridaforolimus. In some embodiments of the method, the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin.

[0012] Aspects of the invention relate to the surprising discovery that subjects having lupus show increased levels of glycolysis and mitochondrial metabolism in CD4+ T cells compared to subjects that do not have lupus. Therefore, in some aspects, the disclosure relates to a method for treating lupus, the method comprising administering a composition comprising (i) a glycolysis inhibitor, and (ii) a mitochondrial metabolism inhibitor to a subject having increased glycolysis and mitochondrial metabolism in CD4+ T cells. In some embodiments of the method, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, 1-BET, rapamycin and DCA. In some embodiments of the method, the mitochondrial inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQ1, 1-BET, digoxin, SR1001, CCI-779, everolimus, and ridaforolimus. In some embodiments of the method, the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin. In some embodiments of the method, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK- 15, CAL-101 (Idelalisib), JQ-1, 1-BET, rapamycin, and DCA, and the mitochondrial metabolism inhibitor is selected from the group consisting of PP242, NVP-BEZ235

(GSK1059615), JQ1, 1-BET, digoxin, SR1001, rapamycin, rapamycin analogs, CCI-779, everolimus, and ridaforolimus.

[0013] The disclosure also contemplates diagnostic methods. In some aspects, a subject having lupus displays increased glycolysis and mitochondrial metabolism in CD4+ T cells. Provided herein is a method for treating lupus, the method comprising: obtaining a biological sample from the subject; detecting the presence of increased glycolysis and/or mitochondrial metabolism in CD4+ T cells of the biological sample; and administering to the subject a composition comprising (i) a glycolysis inhibitor, and (ii) a mitochondrial metabolism inhibitor if the cells show increase glycolysis and/or mitochondrial metabolism. In some embodiments of the method, the biological sample is blood. In some embodiments of the method, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, 1-BET, rapamycin and DCA. In some embodiments of the method, the mitochondrial inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQ1, 1-BET, digoxin, SR1001, CCI-779, everolimus, and ridaforolimus. In some embodiments of the method, the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin. In some embodiments of the method, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK- 15, CAL- 101 (Idelalisib), JQ- 1, 1-BET, rapamycin, and DCA, and the mitochondrial metabolism inhibitor is selected from the group consisting of PP242, NVP-BEZ235

(GSK1059615), JQ1, 1-BET, digoxin, SR1001, rapamycin, rapamycin analogs, CCI-779, everolimus, and ridaforolimus.

[0014] The disclosure also provides kits for the treatment of lupus. In some embodiments the lupus is Systemic Lupus Erythematosus (SLE). In some aspects, the disclosure provides a kit for the treatment of lupus comprising: (i) a container comprising a pharmaceutical composition comprising a glycolysis inhibitor; (ii) a container comprising a pharmaceutical composition comprising a mitochondrial metabolism inhibitor; and, (iii) instructions for administering the pharmaceutical compositions of (i) and (ii) to a subject having lupus.

[0015] In some aspects, the disclosure provides a kit for the treatment of lupus comprising: (i) a container comprising a pharmaceutical composition comprising (a) a glycolysis inhibitor and (b) a mitochondrial metabolism inhibitor; and, (ii) instructions for administering the pharmaceutical composition to a subject having lupus.

[0016] In some embodiments, the glycolysis inhibitor is 2-DG and/or the mitochondrial metabolism inhibitor is metformin.

[0017] In some embodiments, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK- 15, CAL-101 (Idelalisib), JQ- 1, 1-BET, rapamycin and DCA and the mitochondrial metabolism inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQ1, 1-BET, digoxin, SR1001, CCI-779, everolimus, and ridaforolimus.

[0018] The details of one or more embodiments of the invention are set forth in the accompanying Detailed Description, Examples, Claims, and Figures. Other features, objects, and advantages of the invention will be apparent from the description and claims.

[0019] The references, web pages, scientific journal articles, patent applications, and issued patents cited in this application are incorporated herein by reference.

DEFINITIONS

[0020] As used herein, the term "lupus" refers to a chronic inflammatory autoimmune disease affecting multiple body systems, including the joints, kidneys, skin, blood cells, brain, heart and lungs. Lupus can be a systemic or local (e.g. cutaneous) disease. Systemic Lupus Erythematosus (SLE) is the most commonly occurring and serious form of the disease. SLE is characterized by the production of pathogenic anti-nuclear antibodies (ANA). [0021] The terms "treating", "treatment" and "treat", as used herein, refer to reversing, alleviating, delaying the onset of, or inhibiting the progress of a disease or disorder, or one or more signs or symptoms thereof, described herein. In some embodiments, treatment may be administered after one or more signs or symptoms have developed or have been observed. In other embodiments, treatment may be administered in the absence of signs or symptoms of the disease or condition. For example, treatment may be administered to a susceptible individual prior to the onset of symptoms (e.g., in light of a history of symptoms and/or in light of genetic or other susceptibility factors). Treatment may also be continued after symptoms have resolved, for example, to delay or prevent recurrence.

[0022] As used herein, the terms "administer," "administering," or "administration" refer to implanting, absorbing, ingesting, injecting, or inhaling a compound described herein or a pharmaceutical composition thereof .

[0023] The terms "effective amount" and "therapeutically effective amount," as used herein, refer to the amount or concentration of an inventive compound or composition, that, when administered to a subject, is effective to at least partially treat a condition from which the subject is suffering (e.g., lupus or systemic lupus erythematosus).

[0024] The term "subject," as used herein, refers to any animal. In certain embodiments, the subject is a mammal. In certain embodiments, the term "subject" refers to a human (e.g., man, woman, or child). The human may be of either sex and may be at any stage of development. In certain embodiments, the subject has been diagnosed with the condition or disease to be treated (e.g. , lupus or systemic lupus erythematosus). In other embodiments, the subject is at risk of developing the condition or disease (e.g., c lupus or systemic lupus erythematosus). In other embodiments, the subject is suspected of having the condition or disease (e.g. , lupus or systemic lupus erythematosus). In certain embodiments, the subject is an experimental animal (e.g., mouse, rat, dog, primate). The experimental animal may be genetically engineered. In certain embodiments, the subject is a domesticated animal (e.g., dog, cat, bird, horse, cow, goat, sheep).

[0025] The terms "metabolic modulator" and "modulator of metabolism," as used herein refer to an agent that is capable of modifying the metabolic pathways of a cell (for example, glycolysis, pyruvate decarboxylation, Kreb's cycle, and oxidative phosphorylation).

Metabolic modulators may upregulate or increase metabolism, or alternatively down-regulate or decrease metabolism. They can affect metabolism via direct (e.g. inhibiting enzyme activity) and/or indirect (e.g. limiting substrate availability) biochemical mechanisms.

Modulation of metabolism can also occur at the transcriptional and/or translational level. [0026] The term "glycolysis," as used herein, refers to the metabolic pathway that produces adenosine triphosphate (ATP) and NADH via the degradation of glucose to pyruvate, usually in the cytosol of a cell. The glycolysis pathway consists of a sequence of ten enzyme- catalyzed reactions; however, intermediates provide multiple entry points to the pathway. Three glycolytic enzymes (hexokinase, phosphofructokinase and pyruvate kinase) are classified as having irreversible activities; they are the natural points of regulation for flux through the glycolytic pathway.

[0027] As used herein, the term "mitochondrial metabolism" refers to the metabolic pathway that produces ATP via the citric acid (Kreb's) cycle and oxidative phosphorylation within the mitochondria of a cell. The citric acid cycle consists of ten enzyme-catalyzed reactions that yield NADH, which subsequently participates in oxidative phosphorylation to drive ATP synthesis.

[0028] The terms "inhibitor" and "enzyme inhibitor", as used herein, refer to a molecule that binds an enzyme and reduces or completely halts the activity of said enzyme. An inhibitor may prevent a substrate from entering the active site of the enzyme and/or prevent the enzyme from catalyzing a chemical reaction. Enzyme inhibitors may be reversible (i.e. non-covalently bound to the enzyme) or irreversible (i.e. covalently bound to the enzyme).

[0029] As used herein, the term "pharmaceutically acceptable salt" refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and other animals without undue toxicity, irritation, allergic response, and the like, and are commensurate with a reasonable benefit/risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, Berge et al. describe

pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 1977, 66, 1-19, incorporated herein by reference. Pharmaceutically acceptable salts of the compounds of this invention include those derived from suitable inorganic and organic acids and bases. The salts can be prepared during the final isolation and purification of the compounds or separately by reacting the appropriate compound in the form of the free base with a suitable acid.

Representative acid addition salts include acetate, adipate, alginate, L-ascorbate, aspartate, benzoate, benzenesulfonate (besylate), bisulfate, butyrate, camphorate, camphorsulfonate, citrate, digluconate, formate, fumarate, gentisate, glutarate, glycerophosphate, glycolate, hemisulfate, heptanoate, hexanoate, hippurate, hydrochloride, hydrobromide, hydroiodide, 2- hydroxyethansulfonate (isethionate), lactate, maleate, malonate, DL-mandelate,

mesitylenesulfonate, methanesulfonate, naphthylenesulfonate, nicotinate, 2- naphthalenesulfonate, oxalate, pamoate, pectinate, persulfate, 3-phenylproprionate, phosphonate, picrate, pivalate, propionate, pyroglutamate, succinate, sulfonate, tartrate, L- tartrate, trichloroacetate, trifluoroacetate, phosphate, glutamate, bicarbonate, para- toluenesulfonate (p-tosylate), and undecanoate. Also, basic groups in the compounds disclosed herein can be quaternized with methyl, ethyl, propyl, and butyl chlorides, bromides, and iodides; dimethyl, diethyl, dibutyl, and diamyl sulfates; decyl, lauryl, myristyl, and steryl chlorides, bromides, and iodides; and benzyl and phenethyl bromides. Examples of acids which can be employed to form therapeutically acceptable salts include inorganic acids such as hydrochloric acid, hydrobromic acid, sulfuric acid, and phosphoric acid; and organic acids such as oxalic acid, maleic acid, succinic acid, and citric acid. "Basic addition salts" refer to salts derived from appropriate bases, these salts including alkali metal, alkaline earth metal, and quaternary amine salts. Hence, the present invention contemplates sodium, potassium, magnesium, and calcium salts of the compounds disclosed herein, and the like. Basic addition salts can be prepared during the final isolation and purification of the compounds, often by reacting a carboxyl group with a suitable base such as the hydroxide, carbonate, or bicarbonate of a metal cation or with ammonia or an organic primary, secondary, or tertiary amine. The cations of therapeutically acceptable salts include lithium, sodium (by using, e.g., NaOH), potassium (by using, e.g., KOH), calcium (by using, e.g. , Ca(OH)₂), magnesium (by using, e.g. , Mg(OH)₂ and magnesium acetate), zinc, (by using, e.g., Zn(OH)₂ and zinc acetate), and aluminum, as well as nontoxic quaternary amine cations such as ammonium, tetramethylammonium, tetraethylammonium, methylamine, dimethylamine, trimethylamine, triethylamine, diethylamine, ethylamine, tributylamine, pyridine, N,N-dimethylaniline, N- methylpiperidine, N-methylmorpholine, dicyclohexylamine, procaine, dibenzylamine, N,N- dibenzylphenethylamine, 1-ephenamine, and N,N-dibenzylethylenediamine. Other representative organic amines useful for the formation of base addition salts include ethylenediamine, ethanolamine, diethanolamine, piperidine, piperazine, choline hydroxide, hydroxyethyl morpholine, hydroxyethyl pyrrolidone, imidazole, n-methyl-d-glucamine, Ν,Ν'- dibenzylethylenediamine, N,A^-diethylethanolamine, N,A^-dimethylethanolamine,

triethanolamine, and tromethamine. Basic amino acids (e.g., 1-glycine and 1-arginine) and amino acids which may be zwitterionic at neutral pH (e.g. , betaine (N,N,N-trimethylglycine)) are also contemplated.

[0030] As used herein, the term "biological sample" refers to a specimen obtained from the tissue or cells of an organism. Examples of biological samples include, but are not limited to, tissue or cells, bodily fluids (e.g. blood, urine, sweat), and genetic material (e.g. DNA). BRIEF DESCRIPTION OF DRAWINGS

[0031] Figure 1 A- J demonstrates CD4⁺ T cells from B6.Slel .Sle2.Sle3 triple congenic (TC) mice show an enhanced metabolism. Extracellular acidification rate (ECAR) (Figure 1A), Rate of Oxygen Consumption (OCR) (Figures IB and 1C), and Spare Respiratory Capacity (SRC) (Figure ID) levels were measured in total CD4⁺ T cells purified from 2 and 9 month old B6 and TC mice. FigureslB and 1C show OCR in 9 month old B6 and TC CD4⁺ T cells. Figure ID shows increased SRC levels in 9 month old TC ^CD4+ T cells. Figure IE shows extracellular lactate production from 3 month old B6 and TC CD4⁺ T cells. Figure IF shows ATP production by B6 and TC CD4⁺ T cells ex vivo, and after stimulation with PMA/ionomycin or anti-CD3/CD28. Figures 1G and 1H show ECAR and OCR,

respectively, in naive T cells (Tn) and effector memory T cells (Tern) from 9 month old B6 and TC mice. Figures II and 1J show ECAR and OCR, respectively in Tn from B6 and TC mice after 24 h stimulation with anti-CD3/CD28. Note: *P < 0.05; **P < 0.01; < 0.001; mean + SEM; n = 5-6 for Figures 1A-1D and Figures 1G-1H, and n = 3 for Figures IE- IF and Figures 1I-1J.

[0032] Figure 2A-C demonstrates CD4⁺ T cells from TC mice show an increased mTORCl activity. Figure 2A shows S6 and 4E-BP1 phosphorylation and expression of CD98 and CD71 on CD4⁺ T cells from 2 month old mice, shown for total CD4⁺ T cells as well as Tn, Tern and central memory T cells (Tcm) subsets (n = 4). Figures 2B and 2C show glycolysis and mitochondrial oxygen consumption in B6 CD4⁺ T cells stimulated with anti-CD3/CD8 with or without rapamycin (100 nM) for 24 h (n = 3). *P < 0.05; **P < 0.01; mean + SEM.

[0033] Figure 3A-G shows metabolic modulators normalize TC CD4⁺ T cell effector functions in vitro. Figure 3A shows interferon gamma (IFNy) production in CD4⁺ T cells stimulated with PMA/ionomycin for 6 h (Ctrl), in the presence of metformin (Met) (2 mM), 2-DG (5 mM), antimycin A/retonone (both 0.5 uM), or oligomycin (1 uM). Figures 3B and 3C show IFNy production in CD4⁺ T cells cultured under Thl condition for 3 d. Met or 2- DG (1 mM each) were added from day 0 (dO) (Figure3B) or d2 (Figure 3C). Figures 3D and 3E show representative FACS plots of CD4⁺ T cells for mitochondrial reactive oxygen species (mROS) (Figure 3D) and IL-2 (Figure 3E) production after 24h anti-CD3/CD28 stimulation. B6 and TC T cells were compared in the presence or absence (Ctrl) of Met (1 mM) added at the beginning of the culture. Figures 3F and 3G show quantification of mROS (Figure 3F) and intracellular IL-2 (Figure 3G) production in CD4⁺ T cells stimulated with anti-CD3/CD28 for 24 h. Note: *P < 0.05, **P < 0.01, ***P < 0.001; mean + SEM; n = 3-6. [0034] Figure 4A-I shows 10 month old B6 and TC mice that were assessed after receiving Met+2-DG or plain water (Ctrl) at 7 months old. Figures 4A and 4B show ECAR (Figure 4A) and OCR (Figure 4B) in CD4⁺ T cells. Figure 4C shows spleen weight (representative spleens in photo on the right). Figure 4D shows serum anti-dsDNA IgG in TC mice (2-way ANOVA test). Figure 4E shows initial (I) and terminal (T) serum anti-nuclear antibody (ANA) from TC mice. Representative images (left photo) and ANA intensity quantified in the graph on the right, in which each linked symbol represents a mouse. Untreated B6 mice are shown as control. Results were analyzed with paired i-tests. Figure 4F shows

autoantibody microarray analysis of terminal sera (IgG). Figure 4G shows immune complex deposition in TC glomeruli. Representative images with C3 and IgG2a deposits (left) and C3 intensity measured in 3-6 glomeruli per TC mouse. Figure 4H shows renal pathology assessed by severity rank (left) (median and interquantile range) and GN score distribution (right) (χ test). Figure 41 shows representative glomeruli (PAS stain) from untreated mice (left) showing large subendothelial deposits (arrows), and from treated mice (right) showing open capillaries and reduced hypercellularity (stars) (100X amplification). Note: *P < 0.05, **P < 0.01, ***P < 0.001; mean + SEM, n = 14 per group TC and n = 5 per group B6 mice.

[0035] Figure 5A-0 shows 3-month Met+2-DG treatment normalized CD4⁺ T cell phenotypes in aged TC mice. Figure 5A shows percentage of total splenic CD4⁺ T cells in B6 and TC mice. Figure 5B shows frequency of Foxp3⁺ CD25⁺ CD4⁺ Tregs. Figure 5C shows representative CD4⁺-gated FACS plots showing CD62L⁺ CD44^" Tn and CD62^" CD44⁺ Tern subsets in treated and control B6 and TC mice. Figure 5D shows frequency of Tern cells. Figure 5E shows frequency of CD69⁺ CD4⁺ T cells. Figure 5F shows representative FACS plots showing PD-l^hi CXCR5^hi BCL6⁺ Foxp3^" CD4⁺ Tfh and PD-l^hi CXCR5^hi BCL6⁺ Foxp3⁺ CD4⁺ Tfr subsets. Figures 5G and 5H show frequency of Tfh (Figure 5G) and Tfr (Figure5H) as percentage of CD4⁺ T cells. Figure 51 shows frequency of germinal center (GC) CD19⁺ B cells. Figures 5J and 5K show mROS (Figure 5J) and IL-2 (Figure 5K) production in CD4⁺ T cells after stimulation with anti-CD3/CD28 for 24 hours. Figures 5L- 50 show the effect of treatment on phosphorylation of S6 (Figure 5L) and 4E-BP1 (Figure 5M), as well as expression of CD98 (Figure 5N) and CD71 (Figure 50) in total, Tn, and Tern T cells. Note: *P < 0.05, **P < 0.01, ***P < 0.001; mean + SEM, n = 14 - 4.

[0036] Figure 6A-R shows Met+2-DG treatment for one month reversed

immunophenotypes in NZB/W mice. Figures 6A and 6B show ECAR (Figure 6A) and OCR (Figure 6B) in splenic CD4⁺ T cells at the end of the treatment. Figure 6C shows serum anti- dsDNA IgG expressed as the change between the terminal and the initial values for individual mice. Figure 6D shows serum ANA intensity with each linked symbol representing a mouse before and after treatment. Figures 6E and 6F show total serum IgM (Figure 6E) and IgG

(Figure 6F) expressed as change between the terminal and initial values for individual mice.

Figures 6G-6L show frequency of CD69⁺ (Figure 6G), Tern (Figure 6H), Treg (Figure 61),

Tfh (Figure 6J) and Tfr (Figure 6K) CD4⁺ T cells and GC B cells (Figure 6L) at the end of treatment. Figures 6M-6P show the effect of treatment of mTORCl targets: Phosphorylation of S6 (Figure 6M) and 4E-BP1 (Figure 6N) and expression of CD98 (Figure 60) and CD71

(Figure 6P) in total CD4⁺ T cells. Figures 6Q and 6R show renal pathology assessed by severity rank (Figure 6Q, median and interquantile range) as well as GN score distribution between mesangial (Mn) 2-3 and 4 (Figure 6R). Note: *P < 0.05, **P < 0.01; mean + SEM, n = 4-5 each treated and control. For Figure 6J, the significance is indicated for a 1 -tail t test.

[0037] Figure 7A-J shows CD4⁺ T cells from SLE patients have an enhanced metabolism and their functions can be normalized by Met treatment in vitro. Figures 7 A and IB show representative ECAR (Figure 7A) and OCR (Figure 7B) graphs of human CD4⁺ T cells during a mitochondrial stress test. Anti-CD3/CD28 or isotope controls, oligomycin, FCCP and antimycin A/retonone were added to the cells as indicated showing baseline and induced

SRCs (Figure 7B). Figures 7C-7E show ECAR (Figure 7C), OCR (Figure 6D) and SRC

(Figure 6E) in healthy control (HC) and SLE CD4⁺ T cells, with and without anti-CD3/CD28 activation (n = 19 HC and 20 SLE). Figures 7F-7H show correlations between Tn percentages and activated ECAR (Figure 7F) or basal OCR (Figure 7G), and between Treg percentages and activated ECAR (Figure 7H). For Figures 7F-7H, the significance of

Pearson correlation test is shown. Figure 71 shows IFNy production in Thl-polairized CD4⁺

T cells with or without Met. Figure 7J shows the percentage of HELIOS ⁺ FOXP3⁺ in CD4⁺

T cells after Treg polarization with and without Met. For Figures 71 and 7J, paired i-tests were used to compare the effect of treatment within each cohort, and unpaired t tests to compare between cohorts (n = 6; *P < 0.05, **P < 0.01, ***P < 0.001).

+

[0038] Figure 8A-C shows TC mice show enhanced CD4 T cell activation. Representative +

CD4 -gated FACS plots from B6 (left) and TC (right) mice at 7 months of age. Figure 8A

+

shows early activation marker CD69 expression. Figure 8B shows Tn (CD62L CD44 ), Tcm

(CD62L⁺ CD44⁺), and Tern (CD62L CD44⁺) memory subset distribution. Figure 8C shows intracellular IFNy production.

[0039] Figure 9A-E shows CD4⁺ T cells from TC mice show an altered expression of metabolic genes. A panel of selected genes differentially expressed in CD4⁺ T cells from 7 month old mice is shown. Figure 9A shows genes regulating glycolysis. Figures 9B-9C show expression of Pdkl (Figure 9B) Cptla (Figure 9C). Figure 9D shows fatty acid uptake by CD4⁺ T cells measured by Bodipy_ci__ci2 staining. Figure 9E shows genes regulating amino acid metabolism. qRT-PCR values for each gene were normalized for Ppia. Note: *P < 0.05; **P < 0.01; ***P < 0.001; mean + SEM; n = 7 for qRT-PCR and n = 4 for fatty acid uptake.

[0040] Figure 10A-B shows the effects of Met and 2-DG on CD4⁺ T cell metabolism and viability in vitro. Glycolysis and mitochondrial oxygen consumption in B6 CD4⁺ T cells stimulated anti-CD3/CD8 for 24 hours. Cells were treated with 2-DG (Figure 10A) or Met (Figure 10B) at the indicated concentrations. Statistical significance corresponds to comparisons to the untreated cells. Note: *P < 0.05; **P < 0.01; ***P < 0.001; mean + SEM; n = 3-8.

[0041] Figure 11 A-B shows the Met+2-DG treatment did not have adverse effects on body weight and blood sugar. Figure 11 A shows body weight. Treated and control TC mice were compared with a 2-way ANOVA. Figure 1 IB show blood glucose concentration (mean + SEM, n = 14 each treated and control TC and n = 5 each treated and control B6 mice).

[0042] Figure 12A-E shows Met+2-DG treatment does not affect normal humoral response. Figure 12A shows total serum IgM and IgG in 7 month old B6 and TC mice treated for 3 months with Met+2-DG or controls, expressed as the change between initial and terminal values. Figures 12B-12E show B6 mice treated with Met+2-DG were immunized with NP- KLH in alum 2 weeks after the treatment was started, then boosted 2 and 6 weeks later.

Control mice (Ctrl) received plain water. All mice were sacrificed at week 7. Figure 12B shows high affinity anti-NP₄ and low affinity anti-NP₂5 IgM and IgGl. Arrows of the X axes indicate immunization time points. Figure 12C shows the percentage and absolute numbers of B cells, GC B cells, and plasma cells. Figure 12D shows the percentage and absolute numbers of CD4⁺ T cells, Tern cells, and Tfh and Tfr cells. Figure 12E shows surface expression of effector function markers on CD4⁺ T cells. Note: means + SEM, n = 5 per group, *: P < 0.5; **: P < 0.01.

[0043] Figure 13 shows a 3-month Met+2-DG in vivo treatment resulted in a global normalization of TC CD4⁺ T cell effector phenotypes. Surface (and intracellular for BCL6) marker expression on CD4⁺ gated splenocytes from B6 control (n = 4), and control or treated TC (n = 7) mice. Representative histograms and mean + SEM. Dunnett's multiple comparison tests, *P < 0.05, **P < 0.01, ***P < 0.001. [0044] Figure 14A-N shows one-month Met+2-DG in vivo treatment significantly reduced disease severity in TC mice. Figures 14A-14B show ECAR (Figure 14A) and OCR (Figure 14B) in splenic CD4⁺ T cells at the end of the treatment. Figure 14C shows spleen weight. Figure 14D shows serum anti-dsDNA IgG in TC mice normalized to each mouse individual value before the treatment started (2-way ANOVA test). Figures 14E-14F show serum ANA in terminal samples and ANA intensity with each linked symbol representing a mouse before and after treatment. Value for one untreated B6 serum is shown as control. Figures 14G-14J show the percentage of CD69⁺ (Figure 14G), Tern (Figure 14H), and Treg (Figure 141) CD4⁺ T cells, and GC B cells (Figure 14J) in treated and control mice. Figures 14K and 14L show representative images with C3 and IgG2a deposits (Figure 14K), and C3 intensity measured in 3-6 glomeruli per mouse (Figure 14L). Figures 14M-14N show renal pathology assessed by severity rank (Figure 14M, median and interquantile range) as well as score distribution for mesangial and proliferative GN (Figure 14N). Note: *P < 0.05, **P < 0.01; mean + SEM, n = 4 each treated and control TC.

[0045] Figure 15A-D shows Met+2-DG treatment prevented autoantibody production in the chronic graft versus host disease (cGVHD) model. Met+2-DG or Met alone were used to treat B6 mice from the time of cGVHD induction, and disease phenotypes were assessed 3 weeks later. Figure 15A shows spleen weight. Figure 15B shows serum anti-dsDNA IgG measured weekly from cGVHD induction. Figures 15C-15D show the percentage of Tern (Figure 15C) and Tcm (Figure 15D) CD4⁺ T cells in the spleen 3 weeks after induction. Note: *P < 0.05, **P < 0.01; mean + SEM, n = 5 each treated group and n = 10 controls).

[0046] Figure 16A-P shows 2-DG treatment failed to reverse immunophenotypes in TC mice. 7 month old TC mice were treated with 2-DG for 1 month and disease phenotypes were compared to age-matched controls. Figures 16A-16B show ECAR (Figure 16 A) and OCR (Figure 16B) of splenic CD4⁺ T cells. Figure 16C shows spleen weight. Figures 16D and 16E show serum anti-dsDNA (Figure 16D) and anti-chromatin (Figure 16E) IgG expressed as the change between the terminal and initial values for individual mice. Figure 16F shows ANA intensity with each linked symbol representing a mouse before and after treatment. Figures 16G-16L show frequency of CD69⁺ (Figure 16G), Tern (Figure 16H), Tcm (Figure 161), Treg (Figure 16J), GC (Figure 16K) CD4⁺ T cells and GC B cells (Figure 16L). Figure 16M shows representative glomerular C3 and IgG2a immune complex deposition in TC glomeruli with deposits shown by green fluorescence. Figure 16N shows C3 intensity was measured in 3-6 glomeruli per mouse. Figures 160-16P show renal pathology assessed by severity rank (Figure 160, median and interquantile range) as well as GN score distribution (Figure 16P): mesangial (Mm), mesangial cellular (Mc), and proliferative (P). Note: *P < 0.05, **P < 0.01 ; mean + SEM, n = 8.

[0047] Figure 17A-N shows Met treatment failed to reverse immunophenotypes in TC mice. 7 month old TC mice were treated with Met for 1 month and disease phenotypes were compared to age-matched controls. Figures 17A- 17B show ECAR (Figure 17A) and OCR (Figure 17B) of splenic CD4⁺ T cells. Figure 17C shows spleen weight. Figure 17D shows serum anti-dsDNA IgG expressed as the change between the terminal and initial values for individual mice. Figure 17E shows ANA intensity at the end of the treatment. Untreated B6 are shown as controls. Figures 17F- 17J show frequency of CD69⁺ (Figure 17F), Tern (Figure 17G), Treg (Figure 17H), GC (Figure 171) CD4⁺ T cells and GC B cells (Figure 17J). Figure 17K shows representative C3 and IgG2a immune complex deposition in TC glomeruli.

Figure 17K shows C3 intensity was measured in 3-6 glomeruli per mouse. Figures 17M- 17N show renal pathology assessed by severity rank (Figure 17M, median and interquantile range) as well as GN score distribution (Figure 17N): mesangial (Mm), mesangial cellular (Mc) and proliferative (P). Note: *P < 0.05; mean + SEM, n = 10.

[0048] Figure 18 A- J shows FACS data. Figures 18A-18E show CD4⁺ T cell

immunophenotypes in HC and SLE patients according to the gates defined in the

representative FACS plots of CD3⁺ CD4⁺ gated cells shown below (n = 13 SLE, 11 HC). Figures 18F-18G show Basal ECAR (Figure 18F) and OCR (Figure 18G) in HC CD4⁺ T cells treated with HCQ, Dex or MMF for 24 hours. Representative results of n = 2. Comparisons were made with the untreated samples (Ctrl). Figure 18H shows representative CD4⁺-gated FACS plots of FOXP3 and HELIOS expression in Treg polarized CD4⁺ T cells with or without (Ctrl) Met. Figure 181 shows CFSE dilution of HELIOS⁺ FOXP3⁺ (black) and HELIOS^" FOXP3⁺ (gray) CD4⁺ T cell populations after Treg polarization. Figure 18J shows CFSE dilution of HELIOS⁺ FOXP3⁺ (left) and HELIOS^" FOXP3⁺ (right) populations after Treg polarization with or without Met. For Figure 181 and Figure 18 J, representative samples from n = 4.

DETAILED DESCRIPTION OF INVENTION

[0049] Provided herein are compounds, compositions, kits, uses, and methods for treating lupus (e.g. Systemic Lupus Erythematosus (SLE)) with modulators of cell growth and/or cellular metabolism, such as glycolysis inhibitors, mitochondrial metabolism inhibitors and inhibitors of the Myc pathway. SLE is an autoimmune disease in which autoreactive CD4⁺ T cells play a role. CD4⁺ T cells rely on glycolysis for inflammatory effector functions, but recent studies have shown that mitochondrial metabolism supports their chronic activation. Without wishing to be bound by any particular theory, the compositions described herein comprising (i) a glycolysis inhibitor, and (ii) a mitochondrial metabolism inhibitor normalize the cellular metabolism of CD4⁺ T cells in patients having SLE. The invention, therefore, provides compositions comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor for use in the treatment of SLE.

Useful Compounds and Pharmaceutical Compositions

[0050] Cellular respiration is the series of interrelated chemical reactions and processes that allow a cell to convert biochemical energy from nutrients into ATP and waste products. Two main pathways of cellular respiration are glycolysis and mitochondrial metabolism {i.e., the citric acid cycle and oxidative phosphorylation). Regulation of glycolysis is most often achieved by altering the activity and/or substrate availability of the three irreversible enzymes of the pathway (hexokinase, phosphofructokinase, and pyruvate kinase). Mitochondrial metabolism may be regulated in several ways, for example via alteration of ion channel flux or the modulation of citric acid cycle enzyme activity. The present invention is related, in part, to the discovery that both glycolysis and mitochondrial metabolism are elevated in CD4⁺ T cells from lupus patients. Accordingly, in some aspects, the disclosure provides compositions comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor for treating lupus in a subject.

[0051] Glycolysis inhibitors are generally known in the art and may be small molecules, proteins {e.g. antibodies) or nucleic acids {e.g. siRNA, miRNA, dsRNA). In some embodiments, the glycolysis inhibitor is a glucose analog. In some embodiments, the glycolysis inhibitor is a molecule that directly inhibits one or more enzymes in the glycolysis pathway {e.g. hexokinase, phosphofructokinase and/or pyruvate kinase). In some

embodiments, the glycolysis inhibitor is a molecule that indirectly inhibits the glycolysis pathway, for example via the modulation of transcription and/or translation of glycolysis pathway components. For example, bromodomain inhibitors may down-regulate the expression of enzymes involved in glycolysis. Glycolysis inhibitors may also modulate a pathway that regulates glycolysis and is not the glycolysis pathway {e.g. PI3K/Akt pathway). In some embodiments, the glycolysis inhibitor inhibits glucose transport, for example through the GLUT family of transporters. Thus, in some embodiments, the glycolysis inhibitor is selected from the group consisting of hexokinase inhibitor ,_phosphofructokinase inhibitor, pyruvate kinase inhibitor, Akt inhibitor, PI3K inhibitor, glucose analog, glucose transport inhibitor, bromodomain inhibitor and pyruvate kinase dehydrogenase (PDK) inhibitor. Non- limiting examples of small molecule glycolysis inhibitors include 2-DG, 3PO, PFK-15, CAL- 101 (Idelalisib), JQ-1, 1-BET, rapamycin, and DCA.

[0052] In some embodiments, the glycolysis inhibitor is represented by the formula:

(2-Deoxy-D-glucose), or a pharmaceutically acceptable salt thereof.

[0053] In some embodiments, the lycolysis inhibitor is represented by the formula:

(3-(3-pyridinyl)-l-(4-pyridinyl)-2-propen-l-one; 3PO), or a pharmaceutically acceptable salt thereof.

[0054] In some embodiments, the glycolysis inhibitor is represented by the formula:

(PFK-15), or a pharmaceutically acceptable salt thereof.

[0055] In some embodiments, the lycolysis inhibitor is represented by the formula:

(CAL-101 (Idelalisib)), or a pharmaceutically acceptable salt thereof. [0056] In some embodiments, the glycolysis inhibitor is represented by the formula:

((+)-JQl), or a pharmaceutically acceptable salt thereof.

[0057] In some embodiments, the glycolysis inhibitor is represented by the formula:

(I-BET), or a pharmaceutically acceptable salt thereof.

[0058] In some embodiments, the glycolysis inhibitor is represented by the formula:

(dichloroacetic acid; DCA).

[0059] Mitochondrial metabolism encompasses a series of complex biochemical pathways that result in the production of ATP for a cell. Major components of mitochondrial metabolism include pyruvate decarboxylation, the citric acid (Kreb' s) cycle, the electron transport chain and oxidative phosphorylation. The present disclosure contemplates the inhibition of at least one of the above-listed mitochondrial metabolism pathways.

Mitochondrial metabolism inhibitors may be small molecules, proteins (e.g. antibodies) or nucleic acids (e.g. siRNA, miRNA, dsRNA). In some embodiments, the mitochondrial metabolism inhibitor is a molecule that directly inhibits one or more enzymes involved in mitochondrial metabolism (for example, pyruvate dehydrogenase, any of the enzymes active in the citric acid cycle and ATP synthase). In some embodiments, the mitochondrial metabolism inhibitor is a molecule that indirectly inhibits the mitochondrial metabolism pathway, for example via the modulation of transcription and/or translation of mitochondrial metabolism pathway components (e.g. retinoic acid receptor-related orphan receptors; ROR).

[0060] Accordingly, in some embodiments, the mitochondrial metabolism inhibitor inhibits pyruvate decarboxylase. In some embodiments, the mitochondrial metabolism inhibitor inhibits oxidative phosphorylation. In some embodiments, the inhibitor of oxidative phosphorylation competitively inhibits oxygen binding to cytochrome c oxidase. In some embodiments, the inhibitor of oxidative phosphorylation inhibits ATP synthase. In some embodiments, the inhibitor of oxidative phosphorylation inhibits the transfer of electrons to ubiquinone (e.g. rotenone). In some embodiments, the inhibitor of oxidative phosphorylation inhibits succinate dehydrogenase. In some embodiments, the inhibitor of oxidative phosphorylation inhibits ATP-ADP translocase. In some embodiments, the inhibitor of oxidative phosphorylation inhibits mitochondrial ion channels.

[0061] Mitochondrial metabolism inhibitors may also modulate a pathway that indirectly regulates mitochondrial metabolism(e.g. the PI3K/Akt pathway and the mTOR pathway). In some embodiments, the mitochondrial metabolism inhibitor acts by modulating the PI3K/Akt pathway. In some embodiments, the PI3K/Akt pathway inhibitor directly inhibits PI3K. In some embodiments, the PI3K/Akt pathway inhibitor directly inhibits Akt. In some embodiments, the PI3K/Akt pathway inhibitor indirectly inhibits PI3K and/or Akt. In some embodiments, the mitochondrial metabolism inhibitor is a mTOR pathway inhibitor. In some embodiments, the mTOR pathway inhibitor directly inhibits mTOR. In some embodiments, the mTOR inhibitor is rapamycin or a rapamycin analog (rapalog). In some embodiments, the mTOR inhibitor is an imadazoquinoline or imadazoquinoline derivative. In some embodiments, the mTOR pathway inhibitor indirectly inhibits mTOR. In some

embodiments, the inhibitor of the mTOR pathway is a HIFla inhibitor. In some

embodiments, the HIFla inhibitor is a cardiac glycoside. In some embodiments, the inhibitor of the mTOR pathway is a bromodomain inhibitor.

[0062] In some embodiments, the mitochondrial metabolism inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQ1, 1-BET, digoxin, SR1001, CCI-779, everolimus, and ridaforolimus. [0063] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(Metformin), or a pharmaceutically acceptable salt thereof.

[0064] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(2 4-Amino -(l-methylethyl)-lH-pyrazolo[3,4-d]pyrimidin-3-yl]-lH-indol-5-ol; PP242), or a pharmaceutically acceptable salt thereof.

[0065] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(2-Methyl-2-{4 3-methyl-2-oxo-8-(quinolin-3-yl)-2,3-dihydro H-imidazo[4,5-c]quinolin-l- yl]phenyl}propanenitrile; BEZ235), or a pharmaceutically acceptable salt thereof.

[0066] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(Digoxin), or a pharmaceutically acceptable salt thereof.

[0067] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(SR1001), or a pharmaceutically acceptable salt thereof.

[0068] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(CCI-779), or a pharmaceutically acceptable salt thereof. [0069] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(Everolimus), or a pharmaceutically acceptable salt thereof.

[0070] In some embodiments, the mitochondrial metabolism inhibitor is represented by the formula:

(Ridaforolimus), or a pharmaceutically acceptable salt thereof.

[0071] In certain embodiments, the composition comprises (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor, wherein the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin. In some embodiments, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, 1-BET, rapamycin, and DC A and the mitochondrial metabolism inhibitor is selected from the group consisting of PP242, NVP-BEZ235 (GSK1059615), JQ1, 1-BET, digoxin, SRIOOI, rapamycin, rapamycin analogs, CCI-779, everolimus, and ridaforolimus.

[0072] The present invention provides pharmaceutical compositions comprising the compounds described herein, or pharmaceutically acceptable salts thereof, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition of the invention comprises (i) a glycolysis inhibitor, or a pharmaceutically acceptable salt thereof, and (ii) a mitochondrial metabolism inhibitor, or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the pharmaceutical composition of the invention comprises an inhibitor of the Myc pathway, or a pharmaceutically acceptable salt thereof, and optionally a pharmaceutically acceptable excipient. In certain embodiments, the composition comprising (i) a glycolysis inhibitor, or a pharmaceutically acceptable salt thereof, and (ii) a

mitochondrial metabolism inhibitor, or a pharmaceutically acceptable salt thereof, is provided in an effective amount in the pharmaceutical composition. In certain embodiments, the compound comprising an inhibitor of the Myc pathway, or a pharmaceutically acceptable salt thereof, is provided in an effective amount in the pharmaceutical composition. In certain embodiments, the effective amount is a therapeutically effective amount. In certain embodiments, the effective amount is a prophylactically effective amount.

[0073] In certain embodiments, the compound or pharmaceutical composition is a solid. In certain embodiments, the compound or pharmaceutical composition is a powder. In certain embodiments, the compound or pharmaceutical composition can be dissolved in a liquid to make a solution. In certain embodiments, the compound or pharmaceutical composition is dissolved in water to make an aqueous solution. In certain embodiments, the pharmaceutical composition is a liquid for parental injection. In certain embodiments, the pharmaceutical composition is a liquid (e.g., aqueous solution) for intravenous injection. In certain embodiments, the pharmaceutical composition is a liquid (e.g., aqueous solution) for subcutaneous injection.

[0074] After formulation with an appropriate pharmaceutically acceptable excipient in a desired dosage, the pharmaceutical compositions of this invention can be administered to humans and other animals orally, parenterally, intracisternally, intraperitoneally, topically, bucally, or the like, depending on the disease or condition being treated. In some

embodiments, a pharmaceutical composition comprising a glycolysis inhibitor and a pharmaceutical composition comprising a mitochondrial metabolism inhibitor are

administered separately, In some embodiments, a pharmaceutical composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor are administered simultaneously. In certain embodiments, a pharmaceutical composition comprising a glycolysis inhibitor and a pharmaceutical composition comprising a mitochondrial metabolism inhibitor are each administered separately ,orally or parenterally, at dosage levels of each pharmaceutical composition sufficient to deliver from about 0.001 mg/kg to about 200 mg/kg, about 0.001 mg/kg to about 100 mg/kg, about 0.01 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, preferably from about 0.1 mg/kg to about 40 mg/kg, preferably from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, and more preferably from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect. The desired dosage may be delivered three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered using multiple administrations (e.g., two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations). In certain embodiments, each composition described herein is administered at a dose that is below the dose at which the agent causes non-specific effects.

[0075] In some embodiments, a pharmaceutical composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor is administered orally or parenterally at dosage levels sufficient to deliver the combination of agents from about 0.001 mg/kg to about 200 mg/kg, about 0.001 mg/kg to about 100 mg/kg, about 0.01 mg/kg to about 100 mg/kg, from about 0.01 mg/kg to about 50 mg/kg, preferably from about 0.1 mg/kg to about 40 mg/kg, preferably from about 0.5 mg/kg to about 30 mg/kg, from about 0.01 mg/kg to about 10 mg/kg, from about 0.1 mg/kg to about 10 mg/kg, and more preferably from about 1 mg/kg to about 25 mg/kg, of subject body weight per day, one or more times a day, to obtain the desired therapeutic effect. The desired dosage may be delivered three times a day, two times a day, once a day, every other day, every third day, every week, every two weeks, every three weeks, or every four weeks. In certain embodiments, the desired dosage may be delivered using multiple administrations (e.g. , two, three, four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen, fourteen, or more administrations).

[0076] In certain embodiments, the pharmaceutical composition is administered at a dose of about 0.001 mg to about 3000 mg a day. In certain embodiments, the pharmaceutical composition is administered at a dose of about 0.01 mg to about 2000 mg a day. In certain embodiments, pharmaceutical composition is administered at a dose of about 0.01 mg to about 1000 mg a day. In certain embodiments, the pharmaceutical composition is

administered at a dose of about 0.1 mg to about 500 mg a day. In certain embodiments, the pharmaceutical composition is administered at a dose of about 1 mg to about 100 mg a day.

[0077] Pharmaceutical compositions described herein can be prepared by any method known in the art of pharmacology. In general, such preparatory methods include the steps of bringing the composition comprising (i) a glycolysis inhibitor, or a pharmaceutically acceptable salt thereof, and (ii) a mitochondrial metabolism inhibitor, or a pharmaceutically acceptable salt thereof, into association with a carrier and/or one or more other accessory ingredients, and then, if necessary and/or desirable, shaping and/or packaging the product into a desired single- or multi-dose unit.

[0078] Pharmaceutical compositions can be prepared, packaged, and/or sold in bulk, as a single unit dose, and/or as a plurality of single unit doses. As used herein, a "unit dose" is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient which would be administered to a subject and/or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage.

[0079] Relative amounts of the active ingredient, the pharmaceutically acceptable excipient, and/or any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and/or condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w/w) active ingredient. In some aspects, the disclosure describes the synergistic effects of glycolysis inhibitors and mitochondrial metabolism inhibitors for the treatment of lupus. Without wishing to be bound by any particular theory, pharmaceutical compositions comprising a glycolysis inhibitor and a mitochondrial metabolism inhibitor act synergistically to normalize metabolic function in the CD4+ T cells of lupus patients. It should be appreciated that due to this synergistic activity, in some embodiments, the therapeutically effective amount of glycolysis inhibitor and/or mitochondrial metabolism inhibitor will be less than if said glycolysis inhibitor or

mitochondrial metabolism inhibitor was administered as a monotherapy.

[0080] Pharmaceutically acceptable excipients used in the manufacture of provided pharmaceutical compositions include inert diluents, dispersing and/or granulating agents, surface active agents and/or emulsifiers, disintegrating agents, binding agents, preservatives, buffering agents, lubricating agents, and/or oils. Excipients such as cocoa butter and suppository waxes, coloring agents, coating agents, sweetening, flavoring, and perfuming agents may also be present in the composition.

[0081] Exemplary diluents include calcium carbonate, sodium carbonate, calcium phosphate, dicalcium phosphate, calcium sulfate, calcium hydrogen phosphate, sodium phosphate lactose, sucrose, cellulose, microcrystalline cellulose, kaolin, mannitol, sorbitol, inositol, sodium chloride, dry starch, cornstarch, powdered sugar, and mixtures thereof.

[0082] Exemplary granulating and/or dispersing agents include potato starch, corn starch, tapioca starch, sodium starch glycolate, clays, alginic acid, guar gum, citrus pulp, agar, bentonite, cellulose, and wood products, natural sponge, cation-exchange resins, calcium carbonate, silicates, sodium carbonate, cross-linked poly(vinyl-pyrrolidone) (crospovidone), sodium carboxymethyl starch (sodium starch glycolate), carboxymethyl cellulose, cross- linked sodium carboxymethyl cellulose (croscarmellose), methylcellulose, pregelatinized starch (starch 1500), microcrystalline starch, water insoluble starch, calcium carboxymethyl cellulose, magnesium aluminum silicate (Veegum), sodium lauryl sulfate, quaternary ammonium compounds, and mixtures thereof.

[0083] Exemplary surface active agents and/or emulsifiers include natural emulsifiers (e.g. acacia, agar, alginic acid, sodium alginate, tragacanth, chondrux, cholesterol, xanthan, pectin, gelatin, egg yolk, casein, wool fat, cholesterol, wax, and lecithin), colloidal clays (e.g.

bentonite (aluminum silicate) and Veegum (magnesium aluminum silicate)), long chain amino acid derivatives, high molecular weight alcohols (e.g. stearyl alcohol, cetyl alcohol, oleyl alcohol, triacetin monostearate, ethylene glycol distearate, glyceryl monostearate, and propylene glycol monostearate, polyvinyl alcohol), carbomers (e.g. carboxy polymethylene, polyacrylic acid, acrylic acid polymer, and carboxyvinyl polymer), carrageenan, cellulosic derivatives (e.g. carboxymethylcellulose sodium, powdered cellulose, hydroxymethyl cellulose, hydroxypropyl cellulose, hydroxypropyl methylcellulose, methylcellulose), sorbitan fatty acid esters (e.g. polyoxyethylene sorbitan monolaurate (Tween 20),

polyoxyethylene sorbitan (Tween 60), polyoxyethylene sorbitan monooleate (Tween 80), sorbitan monopalmitate (Span 40), sorbitan monostearate (Span 60), sorbitan tristearate (Span 65), glyceryl monooleate, sorbitan monooleate (Span 80)), polyoxyethylene esters (e.g.

polyoxyethylene monostearate (Myrj 45), polyoxyethylene hydrogenated castor oil, polyethoxylated castor oil, polyoxymethylene stearate, and Solutol), sucrose fatty acid esters, polyethylene glycol fatty acid esters (e.g. Cremophor™), polyoxyethylene ethers, (e.g.

polyoxyethylene lauryl ether (Brij 30)), poly(vinyl-pyrrolidone), diethylene glycol monolaurate, triethanolamine oleate, sodium oleate, potassium oleate, ethyl oleate, oleic acid, ethyl laurate, sodium lauryl sulfate, Pluronic F-68, Poloxamer- 188, cetrimonium bromide, cetylpyridinium chloride, benzalkonium chloride, docusate sodium, and/or mixtures thereof.

[0084] Exemplary binding agents include starch (e.g. cornstarch and starch paste), gelatin, sugars (e.g. sucrose, glucose, dextrose, dextrin, molasses, lactose, lactitol, mannitol, etc.), natural and synthetic gums (e.g. acacia, sodium alginate, extract of Irish moss, panwar gum, ghatti gum, mucilage of isapol husks, carboxymethylcellulose, methylcellulose,

ethylcellulose, hydroxyethylcellulose, hydroxypropyl cellulose, hydroxypropyl

methylcellulose, microcrystalline cellulose, cellulose acetate, poly(vinyl-pyrrolidone), magnesium aluminum silicate (Veegum), and larch arabogalactan), alginates, polyethylene oxide, polyethylene glycol, inorganic calcium salts, silicic acid, polymethacrylates, waxes, water, alcohol, and/or mixtures thereof.

[0085] Exemplary preservatives include antioxidants, chelating agents, antimicrobial preservatives, antifungal preservatives, alcohol preservatives, acidic preservatives, and other preservatives. In certain embodiments, the preservative is an antioxidant. In other embodiments, the preservative is a chelating agent.

[0086] Exemplary antioxidants include alpha tocopherol, ascorbic acid, acorbyl palmitate, butylated hydroxyanisole, butylated hydroxytoluene, monothioglycerol, potassium metabisulfite, propionic acid, propyl gallate, sodium ascorbate, sodium bisulfite, sodium metabisulfite, and sodium sulfite.

[0087] Exemplary chelating agents include ethylenediaminetetraacetic acid (EDTA) and salts and hydrates thereof (e.g., sodium edetate, disodium edetate, trisodium edetate, calcium disodium edetate, dipotassium edetate, and the like), citric acid and salts and hydrates thereof (e.g., citric acid monohydrate), fumaric acid and salts and hydrates thereof, malic acid and salts and hydrates thereof, phosphoric acid and salts and hydrates thereof, and tartaric acid and salts and hydrates thereof. Exemplary antimicrobial preservatives include benzalkonium chloride, benzethonium chloride, benzyl alcohol, bronopol, cetrimide, cetylpyridinium chloride, chlorhexidine, chlorobutanol, chlorocresol, chloroxylenol, cresol, ethyl alcohol, glycerin, hexetidine, imidurea, phenol, phenoxyethanol, phenylethyl alcohol, phenylmercuric nitrate, propylene glycol, and thimerosal.

[0088] Exemplary antifungal preservatives include butyl paraben, methyl paraben, ethyl paraben, propyl paraben, benzoic acid, hydroxybenzoic acid, potassium benzoate, potassium sorbate, sodium benzoate, sodium propionate, and sorbic acid.

[0089] Exemplary alcohol preservatives include ethanol, polyethylene glycol, phenol, phenolic compounds, bisphenol, chlorobutanol, hydroxybenzoate, and phenylethyl alcohol.

[0090] Exemplary acidic preservatives include vitamin A, vitamin C, vitamin E, beta- carotene, citric acid, acetic acid, dehydroacetic acid, ascorbic acid, sorbic acid, and phytic acid.

[0091] Other preservatives include tocopherol, tocopherol acetate, deteroxime mesylate, cetrimide, butylated hydroxyanisol (BHA), butylated hydroxytoluened (BHT),

ethylenediamine, sodium lauryl sulfate (SLS), sodium lauryl ether sulfate (SLES), sodium bisulfite, sodium metabisulfite, potassium sulfite, potassium metabisulfite, Glydant Plus, Phenonip, methylparaben, Germall 115, Germaben II, Neolone, Kathon, and Euxyl. [0092] Exemplary buffering agents include citrate buffer solutions, acetate buffer solutions, phosphate buffer solutions, ammonium chloride, calcium carbonate, calcium chloride, calcium citrate, calcium glubionate, calcium gluceptate, calcium gluconate, D-gluconic acid, calcium glycerophosphate, calcium lactate, propanoic acid, calcium levulinate, pentanoic acid, dibasic calcium phosphate, phosphoric acid, tribasic calcium phosphate, calcium hydroxide phosphate, potassium acetate, potassium chloride, potassium gluconate, potassium mixtures, dibasic potassium phosphate, monobasic potassium phosphate, potassium phosphate mixtures, sodium acetate, sodium bicarbonate, sodium chloride, sodium citrate, sodium lactate, dibasic sodium phosphate, monobasic sodium phosphate, sodium phosphate mixtures, tromethamine, magnesium hydroxide, aluminum hydroxide, alginic acid, pyro gen- free water, isotonic saline, Ringer's solution, ethyl alcohol, and mixtures thereof.

[0093] Exemplary lubricating agents include magnesium stearate, calcium stearate, stearic acid, silica, talc, malt, glyceryl behanate, hydrogenated vegetable oils, polyethylene glycol, sodium benzoate, sodium acetate, sodium chloride, leucine, magnesium lauryl sulfate, sodium lauryl sulfate, and mixtures thereof.

[0094] Exemplary natural oils include almond, apricot kernel, avocado, babassu, bergamot, black current seed, borage, cade, camomile, canola, caraway, carnauba, castor, cinnamon, cocoa butter, coconut, cod liver, coffee, corn, cotton seed, emu, eucalyptus, evening primrose, fish, flaxseed, geraniol, gourd, grape seed, hazel nut, hyssop, isopropyl myristate, jojoba, kukui nut, lavandin, lavender, lemon, litsea cubeba, macademia nut, mallow, mango seed, meadowfoam seed, mink, nutmeg, olive, orange, orange roughy, palm, palm kernel, peach kernel, peanut, poppy seed, pumpkin seed, rapeseed, rice bran, rosemary, safflower, sandalwood, sasquana, savoury, sea buckthorn, sesame, shea butter, silicone, soybean, sunflower, tea tree, thistle, tsubaki, vetiver, walnut, and wheat germ oils. Exemplary synthetic oils include, but are not limited to, butyl stearate, caprylic triglyceride, capric triglyceride, cyclomethicone, diethyl sebacate, dimethicone 360, isopropyl myristate, mineral oil, octyldodecanol, oleyl alcohol, silicone oil, and mixtures thereof.

[0095] Liquid dosage forms for oral and parenteral administration include, but are not limited to, pharmaceutically acceptable emulsions, microemulsions, solutions, suspensions, syrups, and elixirs. In addition to the active agents, the liquid dosage forms may contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers, such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3-butylene glycol,

dimethylformamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof. Besides inert diluents, oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents. In certain embodiments for parenteral administration, agents of the invention are mixed with solubilizing agents such CREMOPHOR EL^® (polyethoxylated castor oil), alcohols, oils, modified oils, glycols, polysorbates, cyclodextrins, polymers, and combinations thereof.

[0096] Injectable preparations, for example, sterile injectable aqueous or oleaginous suspensions, may be formulated according to the known art using suitable dispersing or wetting agents and suspending agents. Sterile injectable preparation may also be a sterile injectable solution, suspension or emulsion in a nontoxic parenterally acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, U.S. P. and isotonic sodium chloride solution. In addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium. For this purpose any bland fixed oil can be employed including synthetic mono- or diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.

[0097] Injectable formulations can be sterilized, for example, by filtration through a bacterial -retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium prior to use.

[0098] Solid dosage forms for oral administration include capsules, tablets, pills, powders, and granules. In such solid dosage forms, the active agent is mixed with at least one inert, pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidinone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example, cetyl alcohol and glycerol monostearate, h) absorbents such as kaolin and bentonite clay, and i) lubricants such as talc, calcium stearate, magnesium stearate, solid polyethylene glycols, sodium lauryl sulfate, and mixtures thereof. In the case of capsules, tablets and pills, the dosage form may also comprise buffering agents. [0099] Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes. Solid compositions of a similar type may also be employed as fillers in soft and hard-filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polethylene glycols and the like.

[00100] The active agents can also be in micro-encapsulated form with one or more excipients as noted above. The solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings, release controlling coatings and other coatings well known in the pharmaceutical formulating art. In such solid dosage forms the active agent may be admixed with at least one inert diluent such as sucrose, lactose or starch. Such dosage forms may also comprise, as is normal practice, additional substances other than inert diluents, e.g. , tableting lubricants and other tableting aids such a magnesium stearate and microcrystalline cellulose. In the case of capsules, tablets, and pills, the dosage forms may also comprise buffering agents. They may optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes.

[00101] Formulations suitable for topical administration include liquid or semi-liquid preparations such as liniments, lotions, gels, applicants, oil-in-water or water-in-oil emulsions such as creams, ointments, or pastes; or solutions or suspensions such as drops. Formulations for topical administration to the skin surface can be prepared by dispersing the drug with a dermatologically acceptable carrier such as a lotion, cream, ointment, or soap. Useful carriers are capable of forming a film or layer over the skin to localize application and inhibit removal. For topical administration to internal tissue surfaces, the agent can be dispersed in a liquid tissue adhesive or other substance known to enhance adsorption to a tissue surface. For example, hydroxypropylcellulose or fibrinogen/thrombin solutions can be used to advantage. Alternatively, tissue-coating solutions, such as pectin-containing formulations can be used. Ophthalmic formulation, ear drops, and eye drops are also contemplated as being within the scope of this invention. Additionally, the present invention contemplates the use of transdermal patches, which have the added advantage of providing controlled delivery of an agent to the body. Such dosage forms can be made by dissolving or dispensing the agent in the proper medium. Absorption enhancers can also be used to increase the flux of the agent across the skin. The rate can be controlled by either providing a rate controlling membrane or by dispersing the agent in a polymer matrix or gel.

[00102] Additionally, the carrier for a topical formulation can be in the form of a

hydroalcoholic system (e.g., liquids and gels), an anhydrous oil or silicone based system, or an emulsion system, including, but not limited to, oil-in-water, water-in-oil, water-in-oil-in- water, and oil-in- water- in- silicone emulsions. The emulsions can cover a broad range of consistencies including thin lotions (which can also be suitable for spray or aerosol delivery), creamy lotions, light creams, heavy creams, and the like. The emulsions can also include microemulsion systems. Other suitable topical carriers include anhydrous solids and semisolids (such as gels and sticks); and aqueous based mousse systems.

[00103] It will also be appreciated that the compositions described herein can be employed in combination therapies, that is, the compounds and pharmaceutical compositions can be administered concurrently with, prior to, or subsequent to, one or more other desired therapeutics or medical procedures. The particular combination of therapies (therapeutics or procedures) to employ in a combination regimen will take into account compatibility of the desired therapeutics and/or procedures and the desired therapeutic effect to be achieved. It will also be appreciated that the therapies employed may achieve a desired effect for the same disorder, or they may achieve different effects (e.g., control of any adverse effects).

[00104] In still another aspect, the present invention also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions of the present invention, and in certain embodiments, includes an additional approved therapeutic agent for use as a combination therapy. Optionally associated with such container(s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceutical products, which notice reflects approval by the agency of manufacture, use, or sale for human administration.

[00105] Also encompassed by the invention are kits (e.g., pharmaceutical packs). The kits provided may comprise an inventive pharmaceutical composition or compound and a container (e.g., a vial, ampule, bottle, syringe, and/or dispenser package, or other suitable container). In some embodiments, provided kits may optionally further include a second container comprising a second inventive pharmaceutical composition or compound and a container. In some embodiments, provided kits may optionally further include a third container comprising a pharmaceutical excipient for dilution or suspension of the inventive pharmaceutical composition(s) or compound(s). In some embodiments, the inventive pharmaceutical composition or compound provided in the first container and the

pharmaceutical composition or compound provided in the second container are combined to form one unit dosage form.

[00106] In some embodiments, the kit comprises (i) a pharmaceutical composition comprising a glycolysis inhibitor, or a pharmaceutically acceptable salt thereof, (ii) a pharmaceutical composition comprising a mitochondrial metabolism inhibitor or a

pharmaceutically acceptable salt thereof, and optionally, (iii) instructions for the

administration of the pharmaceutical compositions of (i) and (ii). In some embodiments, the pharmaceutical composition of (i) and the pharmaceutical composition of (ii) are

administered simultaneously. In some embodiments, the pharmaceutical composition of (i) and the pharmaceutical composition of (ii) are administered separately. In some

embodiments, the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin. In some embodiments, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, I-BET, rapamycin, and DCA and the mitochondrial metabolism inhibitor is selected from the group consisting of PP242, NVP-BEZ235 (GSK1059615), JQl, I-BET, digoxin, SRIOOI, rapamycin, rapamycin analogs, CCI-779, everolimus, and ridaforolimus.

[00107] Thus, in another aspect, provided are kits for treating and/or preventing a

pathological condition of a subject. In certain embodiments, the kits include a first container comprising a compound of the present invention, or a pharmaceutically acceptable salt, tautomer, stereoisomer, solvate, hydrate, polymorph, or composition thereof; and an instruction for administering the compound, or a pharmaceutically acceptable salt, tautomer, stereoisomer, solvate, hydrate, polymorph, or composition thereof, to the subject to treat and/or prevent the pathological condition. In certain embodiments, the kits of the present invention include one or more additional approved therapeutic agents for use as a

combination therapy. In certain embodiments, the instruction includes a notice in the form prescribed by a governmental agency regulating the manufacture, use, or sale of

pharmaceutical products, which notice reflects approval by the agency of manufacture, use, or sale for human administration. Treatment of Systemic Lupus Erythematosus (SLE)

[00108] Systemic Lupus Erythematosus (SLE) is an autoimmune disease in which autoreactive CD4⁺ T cells play a role. CD4⁺ T cells rely on glycolysis for inflammatory effector functions, but recent studies have shown that mitochondrial metabolism supports their chronic activation. The instant invention is based, in part, upon the discovery that both glycolysis and mitochondrial oxidative metabolism are elevated in CD4⁺ T cells from lupus- prone B6.Slel.Sle2.Sle3 (TC) mice as compared to non- autoimmune controls. Without wishing to be bound by any particular theory, the mitochondrial metabolism inhibitor metformin and the glucose metabolism inhibitor 2-deoxy-D-glucose (2-DG) reduce IFNy production and normalize T cell metabolism. As described herein, dual inhibition of glycolysis and mitochondrial metabolism is a novel therapeutic approach to treating SLE.

[00109] Accordingly, in some aspects the disclosure provides a method for treating lupus, the method comprising administering a composition comprising (i) a glycolysis inhibitor, and (ii) a mitochondrial metabolism inhibitor to a subject. In some embodiments of the method, the form of lupus is Systemic Lupus Erythematosus (SLE). In some embodiments of the method, the subject has increased glycolysis and mitochondrial metabolism in CD4⁺ T cells. In some embodiments of the method, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, 1-BET, rapamycin and DCA. In some embodiments of the method, the mitochondrial metabolism inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQ1, 1-BET, digoxin, SR1001, CCI-779, everolimus, and ridaforolimus. In some embodiments of the method, the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin. In some embodiments of the method, the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, 1-BET, rapamycin, and DCA and the mitochondrial metabolism inhibitor is selected from the group consisting of PP242, NVP-BEZ235 (GSK1059615), JQ1, 1-BET, digoxin, SR1001, rapamycin, rapamycin analogs, CCI-779, everolimus, and ridaforolimus.

[00110] In some aspects, provided herein is a method for treating lupus (e.g., SLE), the method comprising (a) obtaining a biological sample from a subject; (b) detecting the presence of increased glycolysis and/or increased mitochondrial metabolism in the CD4⁺ T cells of the subject; and (c) administering to the subject a composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor.

[00111] Collection of the biological sample may occur by any method known in the art. Non-limiting examples of biological samples include blood, plasma, urine, sweat, skin, cells, organ tissue (e.g. spleen tissue), nucleic acids, and hair. In some embodiments of the method, the biological sample is blood. In some embodiments of the method, the biological sample is CD4⁺ T cells isolated from a subject.

[00112] Methods for detecting glycolysis and/or mitochondrial metabolism are also known in the art (See, for example, Zhang et al. Nature Protoc, 2012 May 10;7(6): 1068-85). For example, glucose uptake, extracellular acidification rate (ECAR), and glycolytic flux (e.g. measurement of conversion from [5- 3H]glucose to 3 H ₂0) are all useful methods of identifying increased glycolysis. Measurement of mitochondrial metabolism may be performed by calculating oxygen consumption rate (OCR), or through the use of

mitochondrial membrane potential- sensing fluorescent dyes (e.g. Mito Red). Therefore, in order to detect increased glycolysis and/or increased mitochondrial metabolism, CD⁺4 T cells from a subject having or suspected of having lupus are analyzed by the above described methods, or any other clinically acceptable method, and the level of glycolysis and/or mitochondrial metabolism detected in said T cells is compared to the levels of glycolysis and/or mitochondrial metabolism in healthy control cells. In some embodiments, the levels of glycolysis and/or mitochondrial metabolism is said to be increased if it

is >1%, >10%, >20%, >30%, >40%, >50%, >60%, >70%, >80%, >90%, >100%, >200%, or >300% greater than the levels of the healthy control cells. In some embodiments of the method, detection is performed by physiological methods, for example, by the measurement of oxygen consumption rate or extracellular acidification rate. In some embodiments of the method, detection is performed by molecular or biochemical methods, for example, gene expression analysis (i.e. quantitative PCR), flow cytometry or measurement of extracellular lactate concentration (i.e. by L- Lactate Assay Kit).

EXAMPLES

[00113] In order that the invention described herein may be more fully understood, the following examples are set forth. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting this invention in any manner.

Introduction

[00114] The B6.Slel.Sle2.Sle3 lupus-prone mouse model (a triple congenic strain hereafter called TC) contains three NZM2410-derived lupus susceptibility loci, Slel, Sle2 and Sle3 on a non- autoimmune C57BL/6 (B6) background (28). TC mice spontaneously develop symptoms similar to SLE patients, including the production of anti-dsDNA and anti- chromatin IgG and a high penetrance of immune-complex mediated fatal glomerulonephritis (GN). Linkage and congenic recombinant analyses demonstrate the Slelc2 susceptibility locus corresponds to the reduced expression of the Estrogen Related Receptor Gamma (Esrrg) gene, which contributes to CD4⁺ T cell activation and increased IFNy secretion (29). Esrrg controls cellular metabolism by upregulating mitochondrial oxidative phosphorylation (OXPHOS) (30, 31), suggesting that cellular metabolism contributes to lupus pathogenesis through T cell activation, and that metabolism modulators could be used to reduce or reverse disease.

[00115] Described in the following examples is data demonstrating both glycolysis and mitochondrial oxygen consumption are elevated in CD4⁺ T cells from TC mice as compared to B6 mice. This enhanced metabolism was observed in naive T cells, and was amplified with age and activation. TC CD4⁺ T cells also show an enhanced mTORCl activity, a regulator of cell metabolism. In vitro, treatment with mitochondrial electron transport chain (ETC) complex I inhibitor metformin (Met) or glucose metabolism inhibitor 2-DG normalized IFNy production by TC CD4⁺ T cells. In vivo, a combined treatment of TC mice and other lupus models with Met and 2-DG normalized T cell metabolism and reversed disease phenotypes, including T cell activation, autoantibody production, and renal pathology. CD4 T cells from human SLE patients also showed enhanced glycolysis and mitochondrial metabolism compared to healthy controls. Metformin reduced the excessive IFNy production by CD4 T cells from SLE patients.

Example 1 - Materials and Methods

Selection Criteria

[00116] For the in vivo treatment, six to seven-month old anti-dsDNA IgG positive lupus mice and age-matched B6 controls were treated for 1 or 3 months with Met (3 mg/mL) or 2- DG (5 mg/mL), or a combination of the two, dissolved in drinking water to assess the ability of drugs to reverse disease. Age-matched control mice received plain drinking water.

Throughout the treatment, peripheral blood was collected biweekly to analyze ANA production; blood sugar level was monitored biweekly using AlphaTRAK Blood Sugar Monitoring System (Abbott Laboratories) and body weight was monitored weekly. At the end of the treatment, spleens were collected for flow cytometry and metabolic analysis of CD4⁺ T cells. One kidney was fixed in formalin and one was snap-frozen for evaluation of renal pathology. All experiments were conducted according to protocols approved by the University of Florida Institutional Animal Care and Use Committee. For human subjects, at least 20 ml of peripheral blood was obtained after signed informed consent in accordance with Institutional Review Board-reviewed protocols at the University of Florida. Female SLE patients fulfilled at least four of the revised SLE criteria of the American College of Rheumatology. Healthy female volunteers with no family history of autoimmune disease served as age and ethnicity-matched controls (HC). All patients were treated with at least one medication, none of them with a biologic treatment. The demographics and treatment regimens of the patients and HCs are summarized in Table 1.

Table 1. Human subject demographics and disease parameters

SLE patients HCs

Females 36 (100%) 29 (100%)

Males 0 (0%) 0 (0%)

Age (years) 38.81 ± 1.96 33.79 ^2.16

Caucasian Americans 18 (50%) 13 (45%)

African Americans 12 (33%) 10 (35%)

Hispanic Americans 5 (14%) 3 (10%)

Asians 0 (0%) 1 (3%)

Mixed 1 (3%) 2 (7%)

Steroids 14 (39%)

Hydroxychloroquine /

30 (83%)

Dapsone

CellCept 16 (44%)

Azathioprine 9 (25%)

Methotrexate 3 (8%)

Cyclophosphamide IV 1 (3%)

Renal involvement 29 (81 %)

SLEDAI [0-2] 19 (53%)

SLEDAI [4-9] 14 (39%)

SLEDAI > 10 3 (8%)

Mice

[00117] The generation of TC mice has been described previously (18). C57BL/6J (B6), B6(C)-H2-Ablbml2/KhEgJ (B6.H-2bml2) mice and (NZB x NZW)F1 (NZB/W) mice were purchased from the Jackson Laboratory. All mice were bred and maintained at the University of Florida in specific pathogen-free conditions. Only female mice were used in this study at the age indicated for each experiment. Chronic graft-versus-host disease (cGVHD) was induced as previously described (29). Briefly, B6 hosts received 8 x 10 B6.H-2bml2 splenocytes via intra-peritoneal injection. Sera were collected weekly for 3 weeks after induction and stored for ELISA measurement of autoantibodies. Hosts were sacrificed 3 weeks after transfer, kidneys were prepared for histology, and splenocytes were analyzed by flow cytometry.

Metabolic measurements

[00118] Single splenocyte suspensions were enriched for CD4⁺ T cells by negative selection with magnetic beads (Miltenyi). Naive (Tn: CD4⁺CD44^"CD62L⁺) and effector memory (Tern: CD4⁺CD44⁺CD62L^") subsets were sorted from CD4⁺-enriched splenocytes with a FACSAria cell sorter (BD Biosciences). Sorted mouse Tn were activated with plate-bound anti-CD3e (145-2C11, 2 ug/mL) and soluble anti-CD28 (37.51, 1 ug/mL) for 24 h. Glycolysis recorded as Extracellular Acidification Rate (ECAR) and oxygen consumption rate (OCR) were measured using either a XF24 or a XF96 Extracellular Flux Analyzers (Seahorse). Assay buffer was made of non-buffered RPMI medium (Sigma) supplemented with 2.5 uM dextrose, 2 mM glutamine and 1 uM Sodium Pyruvate. Samples were assayed at least in triplicates for 3 successive 8 min time intervals. Baseline ECAR and OCR values were averaged between replicates for these 3 time points. Mitochondrial spare respiratory capacity (SRC) was defined as the OCR difference between baseline and after injection of Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP). Extracellular lactate production was measured using L-Lactate Assay Kit (Abeam). Intracellular ATP was measured from splenic CD4⁺ T cells (10⁵ cells per sample) using the ATP Determination Kit (Life Technologies). Fatty acid uptake was measured by flow cytometry on freshly isolated splenocytes stained with anti-CD4 antibody and then with the Bodipy dye (Life Technology) at 37°C for 5 min.

Gene Expression Analysis

[00119] RNA from bead-enriched CD4⁺ T cells was isolated using the RNeasy mini-kit (Qiagen). cDNA was then synthesized using the ImProm-II Reverse Transcription System (Promega). Sybr Green (Applied Biosystems)-based quantitative PCR was performed using Cyclophilin A (Ppia) as control. Primer sequences are shown in Table 2. mRNA levels were expressed as Relative Quantities (RQ) to Ppia (cyclophylin).

Table 2. Primers for qPCR assays.

Gene Name Forward primer Reverse primer

Hypoxia-inducible factor 1- AGCTTCTGTTATGAGGCTCACC TGACTTGATGTTCATCGTCCTC alpha (SEQ ID NO.: 1) (SEQ ID NO.: 11)

Solute carrier family 16, TCACGGGTTTCTCCTACGC GCCAAAGCGGTTCACACAC member 3 (SEQ ID NO.: 2) (SEQ ID NO.: 12)

AGCGTATCCCTATCCACAAGTTCA GCAGTCCAGTGGCCTTCAGAG

Glutaminase 2 (SEQ ID NO.: 3) (SEQ ID NO.: 13) GACGAGTTTGACTGCCACATC CGCAACATAGAACGCATCCTT

Ornithine decarboxylase (SEQ ID NO.: 4) (SEQ ID NO.: 14)

GGACTTCGGGTCAGTGAATGC TCCTGAGAAGATTGTCGGGGA

Pyruvate dehydrogenase kinase (SEQ ID NO.: 5) (SEQ ID NO.: 15)

Carnitine palmitoyltransferase CCAGGCTACAGTGGGACATT GAACTTGCCCATGTCCTTGT 1A (SEQ ID NO.: 6) (SEQ ID NO.: 16)

CATTGTCAAGTACAGTCCACACT TTCCAATTACTCGGTTTTTGGGA

Lactate dehydrogenase A (SEQ ID NO.: 7) (SEQ ID NO.: 17)

GCCGCCTGGACATTGACTC CCATGAGAGAAATTCAGCCGAG

Pyruvate kinase muscle (SEQ ID NO.: 8) (SEQ ID NO.: 18)

TGATCGCCTGCTTATTCACGG AACCGCCTAGAAATCTCCAGA

Hexokinase 2 (SEQ ID NO.: 9) (SEQ ID NO.: 19)

CACAGCCAAGGGTCGATTCC CCCAGGTATCGTGCTTTGTCT

Cycophilin A (SEQ ID NO.: 10) (SEQ ID NO.: 20)

Flow Cytometry

[00120] Mouse live cells were detected with Fixable Viability Dye eFluor 780

(eBioscience). Antibodies specific for mouse CD4 (RM4-5), CD44 (IM7), CD62L (MEL- 14), CD25 (7D4), CD69 (H1.2F3), CD19 (1D3), IgM (11/41), CD71 (R17217), CD98 (RL388), GL-7 (GL7), PD-1 (J43), BCL6 (Kl 12-91), CXCR5 (2G8), CCR7 (4B 12), CD28 (37.51), CTLA-4 (UC10-4B9), CD95 (15A7), ICOS (7E.17G9), CD122 (ΤΜ-βΙ), ΙΡΝγ (XMG1.2), IL-2 (JES6-5H4) and Foxp3 (FJK-16s) were purchased from BD Biosciences or eBiosciences. Antibodies specific for pS6 Ser235/236 (D57.2.2E) and p4E-BPl Thr37/46 (236B4) were purchased from Cell Signaling. The immunophenotypes of human CD4+ T cells were determined with antibody panels emulated by the Human Immunophenotyping consortium (76). In addition, antibodies against IFNy-PE-Cy7 (4S.B3), FOXP3-FITC (206D), and HELIOS-PB (22F6) were purchased from BD Biosciences. When cytokine production was analyzed, cells were treated with leukocyte activation cocktail (BD

Biosciences) prior to staining per manufacturer's protocol. All intracellular staining was performed using a Fixation/Permeabilization kit (eBiosciences). Data acquisition was performed on an LSR Fortessa™ Cell Analyzer (BD Biosciences).

Cell Culture

[00121] Mouse splenic CD4⁺ T cells enriched by negative selection were stimulated by plate-bound anti-CD3e and anti-CD28 in RPMI supplemented with 10% FCS, HEPES, 2- Mercapto-ethanol, and penicillin-streptomycin (cRPMI) for 3 d. TGF-β (2.5 ng/ml) or IL-12 (10 ng/ml) was added for Treg and Thl differentiation, respectively. IL-2 and mitochondrial ROS (MitoSox^Tm Red, Life Technologies) production were measured in splenic CD4⁺ T cells stimulated by plate-bound anti-CD3e and anti-CD28 for 24 h. The dose of Met or 2-DG (Sigma) are indicated for each experiment. Human CD4⁺ T cells were enriched from peripheral blood using the RosetteSep® Enrichment Cocktail (StemCell Technologies). For polarization assays, cells were stimulated in cRPMI with beads coated with anti-CD3 and anti-CD28 (Dynabeads Human T-Activator, Life Technologies) for 6 d. IL- 12 (10 ng/ml), IL-2 (20 U) and anti-IL-4 (1 ug/ml) were added for Thl polarization, and TGF-β (20 ng/ml) and IL-2 (300 U) were added for Treg induction. For some of the Treg polarization assays, CD25^"CD127⁺ conventional T cells were sorted from enriched CD4⁺ T cells and labeled with CFSE (2uM, Life Technologies) prior to culture. Met was used at 1 mM. In some assays, Dexamethasone (Sigma), Hydroxychloroquine (Sigma) or Mycophenolate mofetil (Sigma) was added at the beginning of the culture at a concentration of 1 uM, which had no effect on viability, and ECAR and OCR were measured 24 hours later using the Seahorse Analyzer XF96.

Antibody measurement

[00122] Anti-dsDNA and anti-chromatin IgG were measured by ELISA from sera diluted 1 : 100 as previously described (28). Relative units were standardized using a B6. TC serum, arbitrarily setting its reactivity at a 1 : 100 dilution to 100 units. Anti-nuclear autoantibodies (ANA) were measured from sera diluted 1 :40 applied to Hep-2 cell slides (Inova) followed by a FITC-conjugated anti-mouse IgG (Southern Biotech) diluted 1 :50. ANA staining was quantified with the Metamorph 7.5 image analysis software (Molecular Devices,

Downingtown, PA, USA) as mean intensity. For each cohort of treated mice and control mice, ANA staining was performed for a single batch. Autoantibody microarray analysis was performed at the Microarray Core Facility in University of Texas Southwestern Medical Center.

Renal pathology

[00123] Glomerulonephritis was scored from hematoxylin and eosin and periodic acid Schiff stains using a semi-quantitative 0-4 scale, and qualified as mesangial (Mm), mesangial cellular (Mc) or proliferative (p) as previously described (68). In addition, the samples within each cohort were ranked according to increased severity by a pathologist (BPC) who did not have knowledge of the treatment status. The glomerular deposition of C3 and IgG2a immune complexes was performed on frozen kidney sections and scored as previously described (68). Glomerular size and the extent of C3 deposition were measured from anti-C3 stained sections averaging 4-6 glomeruli per sample, using Metamorph 7.5. Statistical Analysis

[00124] Statistical analyses were performed using the GraphPad Prism 6.0 software. Unless indicated, graphs show means and standard deviations of the mean (SEM) for each group and results were compared with 2-tailed t tests. Nonparametric tests and multiple comparisons were used as appropriate. Each in vitro experiment was performed at least twice with reproducible results.

Example 2 - CD4⁺ T cells from TC lupus mice exhibit elevated T cell metabolism

[00125] TC CD4⁺ T cells present with several immune abnormalities that are typical of lupus pathogenesis (28, 32), including T cell hyperactivation (Figure 8 A), accumulation of CD44⁺CD62L^" effector memory (Tern) and CD44⁺CD62L⁺ central memory T (Tern) cells (Figure 8B), as well as increased IFNy production (Figure 8C). To test whether these CD4⁺ T cell phenotypes were associated with alterations in cellular metabolism, their extracellular acidification rate (ECAR), which is primarily attributed to glycolysis, and the oxygen consumption rate (OCR), which corresponds to OXPHOS were measured. CD4⁺ T cells from 2 month old pre-disease TC mice showed enhanced ECAR and OCR compared to age- matched B6 counterparts. This difference in CD4⁺ T cell metabolism became more pronounced in 9 month old TC mice, which have developed clinical disease (Figure 1A-1C). CD4⁺ T cells from 9 month old TC mice also showed a significantly higher spare respiratory capacity (SRC) (Figure ID), an indication of cellular energy reserve that is essential for memory T cell formation and function (20). The enhanced glycolysis of TC CD4⁺ T cells was confirmed by increased extracellular lactate concentration (Figure IE). In spite of increased glycolysis and OXPHOS, TC CD4⁺ T cells presented intracellular ATP levels comparable to B6, both ex vivo and after activation (Figure IF). This result suggests that the increased metabolism leads to ATP consumption by TC CD4⁺ T cells to support elevated effector functions. Overall, CD4⁺ T cells from TC mice present with an enhanced cellular metabolism that precedes disease manifestation and increases as T cells become more activated and disease progresses.

[00126] Naive and activated CD4⁺ T cell subsets have different metabolic profiles (33). The expansion of Tern cells in TC mice (Figure 8B) may be the source of the elevated metabolism observed in total CD4⁺ T cells. Tern cells showed a significantly higher ECAR and, to a lesser extent, OCR, in than Tn cells in both B6 and TC mice (Figure 1G and 1H). This result implies that the higher percentage of Tern cells in TC mice contributes to the higher metabolism of total CD4⁺ T cells. However, TC Tn cells also showed a higher ECAR and OCR than B6 Tn cells, whereas Tern cell metabolism was not significantly different between strains.

[00127] To directly characterize the metabolism of TC CD4⁺ T cells after activation, the metabolic profiles of B6 and TC sorted Tn cells were compared following stimulation with anti-CD3 and anti-CD28 for 24 h. In vitro stimulated TC Tn cells exhibited significantly higher ECAR and OCR as compared to B6 (Figure II and 1J).

[00128] mTORC 1 is a sensor for cell energy state that regulates cell metabolism, growth and proliferation (34). mTORC 1 activity was increased in TC CD4⁺ T cells, as shown by an increased phosphorylation of S6 and 4E-BP1, two major mTORCl targets (Figure 2A). S6 phosphorylation was increased in each Tn, Tcm, and Tern subset of TC CD4⁺ T cells. TC CD4⁺ T cells also expressed higher levels of CD98 and CD71 (Figure 2A), two key nutrient receptors whose expression depends on mTORCl activity (35, 36). mTORCl inhibitor rapamycin significantly reduced glycolysis and mitochondrial oxygen consumption in anti- CD3/CD28 activated B6 CD4⁺ T cells (Figure 2B), linking mTORCl activity to both glycolysis and mitochondrial metabolism. These results indicate that naive TC CD4⁺ T cells exhibit increased glycolysis and mitochondrial oxygen consumption and that they respond to in vitro activation with a higher metabolism in comparison to naive non-autoimmune T cells.

[00129] To further study the metabolic program of lupus CD4⁺ T cells, the expression level of several metabolic pathway genes was compared in freshly isolated total CD4⁺ T cells from B6 and TC mice. TC CD4⁺ T cells showed elevated expression of Hifla (Figure 9A), which orchestrates glycolytic reprogramming (14). Consistently, we also found elevated expression of Hk2, which catalyzes the first step in glucose metabolism, and Slcl6a3, which encodes for MCT4 that exports lactate across the plasma membrane (Figure 9A). These results support the finding that TC CD4⁺ T cells have an enhanced glycolytic activity. Several metabolic pathways provide substrates for OXPHOS. Pyruvate can be converted to acetyl-CoA by the Pyruvate Dehydrogenase Complex (PDC) to fuel the TCA cycle, a process that is negatively regulated by pyruvate dehydrogenase kinase (Pdkl). Pdkl expression was significantly lower in TC than B6 CD4⁺ T cells (Figure 9B), which could lead to an increased availability of pyruvate for OXPHOS. This is consistent with a previous finding that T cell activation is associated with dampened Pdkl expression (16). Metabolites from fatty acid oxidation (FAO) are also important sources for the TCA cycle. Carnitine palmitoyltransferase 1A (Cptla) transports long chain fatty acid across the mitochondrial outer membrane and is a key FAO regulator (20). Cptla expression was significantly higher in TC CD4⁺ T cells than in B6 (Figure 9C). In addition, TC CD4⁺ T cells showed an enhanced uptake of fatty acids (Figure 9D). These data suggest that TC CD4⁺ T cells have a higher FAO. Finally, TC CD4⁺ T cells showed a higher expression of glutaminase 2 (Gls2) and ornithine decarboxylase (Ode) (Figure S2E), two genes involved in amino acid metabolism that are upregulated upon T cell activation (13). In summary, CD4⁺ T cells from lupus-prone TC mice present an enhanced metabolism fueled through both glycolysis and mitochondrial metabolism, with evidence that glucose, fatty acids and glutamine may all contribute to the latter.

Example 3 - TC CD4⁺ T cell dysfunction is normalized by metabolic modulators in vitro

[00130] This example examines whether targeting glycolysis and mitochondrial metabolism could normalize TC CD4⁺ T cell functions in vitro with 2-DG and metformin (Met). 2-DG is a glucose homolog that blocks hexokinase, the first rate-limiting enzyme of the glycolytic pathway, thereby inhibiting both glycolysis and glucose oxidation. Met regulates cell metabolism through complex mechanisms (37), including the inhibition of the mitochondrial complex I (38). 2-DG dose-dependently inhibited CD4⁺ T cell glycolysis, but also decreased mitochondrial oxygen consumption (Figure 10A), presumably by decreasing glucose oxidation. Consistent with its inhibition of Complex 1, Met dose-dependently inhibited oxygen consumption (Figure 10B). At a higher concentration (1 mM), Met increased glycolysis (Figure 10B), likely as an alternative pathway to generate ATP for cell survival.

[00131] Elevated production of IFNy is a hallmark of both mouse and human SLE (8, 39, 40). Significantly more CD4⁺ T cells produced IFNy in TC than in B6 mice after a short stimulation with PMA/Ionomycin that activates Thl cells already differentiated in vivo (Figure 3A). Met treatment during the PMA/Ionomycin stimulation significantly decreased IFNy production from both B6 and TC T cells (Figure 3A). The ATPase inhibitor oligomycin and the combination of Complex I III inhibitors Retonone/Antimycin A also significantly inhibited IFNy production, indicating that mitochondrial metabolism is required for IFNy production during early CD4⁺ T cell activation. 2-DG, however, had no effect, indicating that in the early stage, IFNy production does not rely on glycolysis. Under Thl polarizing condition, TC CD4⁺ T cells generated significantly more IFNy-producing cells than B6 (Figure 3B). Met added from the beginning of Thl polarization significantly decreased the percentage of CD4⁺ T cells producing IFNy in TC mice (Figure 3B), while it had no effect when added at day 2 (Figure 3C). As previously described (41), 2-DG added from the beginning of Thl polarization was not compatible with cell viability after the 3 -day culture. However, 2-DG added at day 2 dramatically reduced IFNy production in both strains without affecting cell viability (Figure 3C). These results show that, in both normal and lupus mice, IFNy production by CD4⁺ T cells depends on mitochondrial metabolism in the activation phase when it can be reduced by Met, whereas its production during the proliferation phase depends on glycolysis and can be reduced by 2-DG.

[00132] IL-2 production is defective in lupus T cells, and mitochondrial ROS (mROS) is required for optimal IL-2 production (42, 43). Anti-CD3/CD28 stimulated TC CD4⁺ T cells produced significantly less mROS (Figure 3D and F) and less IL-2 (Figure 3E and G) than B6 T cells. Through its inhibition of Complex I, we hypothesized that Met could lead to an accumulation of mROS and increase IL-2 production. Indeed, Met increased mROS production in both TC and B6 CD4⁺ T cells (Figure 3C and I), and Met-treated TC CD4⁺ T cells were similar to untreated B6 CD4⁺ T cells. Met treatment also resulted in a small but significant increase in IL-2 production in both strains (Figure 3E). In summary, TC CD4⁺ T cells display excessive IFNy production as well as a defective mROS induction and IL-2 secretion in vitro. Both Met and 2-DG inhibited their capacity to produce ΙΡΝγ, but at different stages of activation. Met also promoted mROS and IL-2 production. This resulted in an overall normalization of TC CD4⁺ T cell functions in vitro.

Example 4 - A treatment combining Met and 2-DG reversed disease in TC mice

[00133] To target glucose metabolism and mitochondrial metabolism simultaneously, 7 month old TC mice were treated with a combination of 2-DG and Met (Met+2-DG) in drinking water for 3 months. At that age, TC mice are at the early stage of clinical disease that includes splenomegaly, anti-dsDNA IgG production, accumulation of activated T (Figure 9) and B cells, as well as splenic plasma cells (28). The Met+2-DG treatment significantly decreased glycolysis (Figure 4 A) and mitochondrial oxygen consumption (Figure 4B) in TC CD4⁺ T cells to levels similar to that of B6 T cells, indicating that the treatment effectively targeted CD4⁺ T cell metabolism in vivo. The metabolism of B6 CD4⁺ T cells was however not affected, suggesting that the treatment is selective to the more metabolically-active TC cells. The Met+2-DG treatment significantly reduced splenomegaly in TC mice, but had little effect in B6 mice (Figure 4C). Importantly, the treatment significantly decreased the production of anti-dsDNA IgG, while it increased in untreated TC mice (Figure 4D). The level of serum anti-nuclear autoantibodies (ANA), which are another hallmark of lupus, was also significantly decreased by the Met+2-DG treatment (Figure 4E). The inhibitory effect of the treatment on autoantibody production was confirmed with antigens arrays, in which 4 out of 5 treated TC mice showed an identical profile to that of B6 mice (Figure 4F). The Met+2- DG treatment improved renal pathology, resulting in a lower level of C3 and IgG2a immune complex deposition in treated TC kidneys (Figure 4G). Furthermore, GN was significantly less severe in treated TC mice, either assessed by severity rank or by score distribution (Figure 4H and 41).

[00134] The influence of Met+2-DG treatment on lymphocyte activation and subset distribution was examined. Met+2-DG decreased the percentage of total splenic CD4⁺ T cells (Figure 5A). Aged TC mice showed a high percentage of Tregs, potentially a compensatory response to prolonged inflammation, and this percentage was significantly reduced by the Met+2-DG treatment (Figure 5B). CD4⁺ T cell activation measured as the percentages of Tern (Figure 5C and 5D) and CD69⁺ CD4⁺ T cells (Figure 5E) were significantly reduced by the treatment in TC mice. Globally, Met+2-DG decreased the expression of markers associated with activation and effector functions in TC CD4⁺ T cells, such as CD28, ICOS, CD40L, and CD95, and increased the expression of the inhibitory molecule CTLA-4 (Figure 13). For most markers, the expression level on CD4⁺ T cells from treated TC mice was similar to that of age-matched B6 mice. In conclusion, Met+2-DG treatment resulted in a profound and global reversal of T cell activation in TC mice, while it had no effect on B6 T cells.

[00135] TC spleens contain a high percentage of PD1⁺ CXCR5⁺ BCL6⁺ follicular (FO) T cells, which was significantly reduced by the treatment (Figure 5F), as well as the expression levels of PD1, CXCR5, and BCL6 (Figure 13). Both follicular helper (Tfh) and follicular regulatory (Tfr) T cell subsets were reduced in TC spleens after Met+2-DG treatment (Figure 5G and 5H), which reflects the overall decrease in FO T cells (Figure 5F). Within the FO T cells however, the Met+2-DG treatment significantly expanded Tfr at the expense of Tfh population (P < 0.05). TC mice also have an elevated frequency of GC B cells (44), which was significantly reduced after treatment (Figure 51). Finally, the Met+2-DG treatment restored the impaired production of mROS and IL-2 by TC CD4⁺ T cells (Figure 5J and 5K), and reduced mTORCl activity, as shown by a reduced S6 phosphorylation in total CD4⁺ T cells (Figure 5L), as well as a decreased expression level of CD71 and CD98 on all CD4⁺ cell T subsets (Figure 5N and 50). No change was observed for p4E-BPl (Figure 5M).

[00136] The treatment did not lead to any obvious side effects. Met+2-DG-treated TC and B6 mice maintained their body weight, while control TC mice showed a continuous weight loss that was likely due to the exacerbation of disease (Figure 11A). The treatment had also no effect on blood glucose (Figurel IB). The treatment did not result in a general humoral suppression since total serum IgM and IgG were unchanged in TC mice (Figure 12A). We observed a significant increase of total IgG in treated B6 mice for reasons that are not clear at this point. Furthermore, Met+2-DG treatment did not impair the humoral response in response to a foreign antigen (Figure 12B). Met+2-DG-treated B6 mice immunized with NP- KLH produced the same amount of anti-NP IgM and IgGl with no difference in affinity or kinetics. The number of B cells, germinal center (GC) B cells and plasma cells (Figure 12C), Tern CD4⁺ T cells, Tfh cells and Tfr cells were similar between treated and untreated mice (Figure 12D), with similar expression of effector surface markers (Figure 12E).

[00137] In summary, 3 months of Met+2-DG treatment reversed disease as measured by multiple established biomarkers in TC mice with no observable side effects. Moreover this treatment normalized CD4⁺ T cell activation and effector functions of TC mice, including their abnormal GC response. The same treatment had no effect on non- autoimmune B6 mice.

[00138] A shorter one-month treatment also led to a significantly decreased metabolism in TC CD4⁺ T cells (Figure 14 and 14B) and there was a trend for the reduction of spleen size (Figure 14C). The treatment significantly reduced the production of anti-dsDNA IgG (Figure 14D) and ANA (Figure 14E-14F), although the effect was less pronounced than the 3-month treatment (Figure 4D and 4E). This phenotypic reversal was accompanied by a reduction of CD4⁺ T cell activation (Figure 14G and 14H) as well as a reduction of the Treg and GC B cell (Figure 141 and 14J) subsets. The short-term treatment also decreased the amount of glomerular IgG2a immune complexes (Figure 14K and 14L), as well as the renal pathology (Figure 14M and 14N). Thus, treatment with Met+2-DG for only one month showed significant reversal of disease biomarkers in TC mice with minimum, if any, side effects.

Example 5 - The combination of Met and 2-DG treatment reversed disease phenotypes in other mouse models ofSLE

[00139] The impact of Met+2-DG treatment on disease phenotypes in two additional models of SLE, the NZB/W and chronic graft-versus-host disease (cGVHD)-induced models, was also investigated. Seven-month old female NZB/W mice treated with Met + 2-DG for 1 month showed a reduced CD4⁺ T cell metabolism, although the difference was significant only for oxygen consumption (Figure 6A and B). Met + 2-DG treatment also significantly decreased the production of anti-dsDNA IgG (Figure 6C) and reduced serum ANA levels, despite an increase in control mice (Figure 6D). Contrary to TC mice, the Met+2-DG treatment significantly decreased total IgG (Figure 6F) and there was a trend in the same direction for IgM (Figure 6E). CD4⁺ T cell activation (Figure 6G), the percentage of Tern and Treg CD4⁺ T cells (Figure 6H and 61), as well as the percentage of Tfh, Tfr and GC B cells (Figure 6J-6L) were all significantly decreased in NZB/W mice treated with Met+2-DG. The treatment also reduced mTORCl activity in total CD4⁺ T cells, with reduced S6 and 4E- BP1 phosphorylation, as well as CD71 expression (Figure 6M-6P). Renal pathology was however unchanged, as evaluated either through immune complex deposits and/or GN scores (Figure 6Q and 6R). Thus, treatment with Met+2-DG for one month reversed the

immunophenotypes in NZB/W mice, although it was not long enough to affect renal pathology.

[00140] The impact of Met+2-DG treatment was also assessed in the cGVHD induced model of lupus (45). Treatment did not affect the induced splenomegaly (Figure 15 A), but it reduced the production of anti-dsDNA IgG (Figure 15B). The treatment also decreased the percentage of Tcm, but not Tern CD4⁺ T cells (Figure 15C and 15D). Therefore, the combination of Met+2-DG prevented the induction of T-cell dependent production of autoantibodies. We also evaluated whether Met treatment alone could prevent the induction of autoimmunity in this model. Although this single treatment modality reduced

splenomegaly (Figure 15 A) and the size of the memory T cell subset (Figure 15C and 15D), it had no effect on the induction of anti-dsDNA IgG (Figure 15B). This suggested that the combination of the two metabolic inhibitors is required for the effective suppression of autoimmunity.

Example 6 - Metformin and 2DG show a synergistic effect in vivo

[00141] To study the relative contributions of 2-DG and Met to disease reversal, 7-month old TC mice were treated with either 2-DG or Met alone for one month at the dose used for the combination treatment. 2-DG significantly decreased glycolysis but had no significant effect on mitochondrial oxygen consumption by the CD4⁺ T cells from TC mice (Figure 16A and 16B). We did not observe any significant effect on spleen weight (Figure 16C), autoantibodies production (Figure 16D-16F), CD4⁺ T and B cell activation, or effector subset distribution in these treated mice (Figure 16G-16L). Although 2-DG treatment resulted in a lower amount of immune complex deposits in the kidneys (Figure 16M and 16N), renal pathology was not ameliorated (Figure 160 and 16P). Therefore, treating TC mice with 2- DG alone failed to reverse their autoimmune pathology. Met monotherapy did not alter either glycolysis or mitochondrial oxygen consumption in TC CD4⁺ T cells (Figure 17 A and 17B). It also had no significant effect on any of the biomarkers that were affected by the combination treatment (Figure 17C-17N). Therefore, Met alone had no effect on the established autoimmune pathology of TC mice. These results strongly suggest a synergistic effect between 2-DG and Met in reversing lupus phenotypes in vivo. Example 7 - CD4⁺ T cells from SLE patients exhibit elevated cellular metabolism

[00142] SLE patients present with a reduced percentage of naive CD4⁺CD45RA⁺CCR7⁺ T cells and a corresponding increase in CD4⁺CD45RA^"CCR7⁺ central memory T cells, leading to an altered ratio of Tn/Tcm subsets as compared to healthy controls (HCs) (Figure 18A- 18D). No significant difference was found in the percentage of circulating CD4⁺CD127^{" Λ}^ϋ25⁺ Tregs (Figure 18E). ECAR, OCR and SRC in CD4⁺ T cells purified from peripheral blood of SLE patients and HCs, with and without anti-CD3 and anti-CD28 activation were compared (Figure 7A-7B). SLE patients were all treated with at least one

immunosuppressive drug (Table 1), the question of whether three of the most commonly used drugs could affect CD4⁺ T cell metabolism was investigated. HC CD4⁺ T cells were treated for 24 h with either dexamethasone (Dex), hydroxychloroquine (HCQ) or mycophenolate mofetil (MMF) at a concentration that did not affect cell viability. Dex inhibited glycolysis but not mitochondrial oxygen consumption, whereas HCQ and especially MMF reduced both glycolysis and mitochondrial oxygen consumption (Figure 18F and 18G). Despite the decreased metabolism induced by these treatments, activated CD4⁺ T cells showed a significantly higher glycolysis in SLE than HC samples (Figure 7C), and both resting and activated SLE CD4⁺ T cells showed a higher oxygen consumption than HC T cells (Figure 7D). Notably, anti-CD3/CD28 activation induced a pronounced increase in both ECAR and OCR within just a few minutes (Figure 7 A and 7B), suggesting that both pathways are important for the early activation of human CD4⁺ T cells. Moreover, both resting and activated SLE CD4⁺ T cells have a significantly higher SRC (Figure 7B and 7E), which has been shown to be critical for memory T cell formation and function (20). These metabolic parameters were significantly correlated with the distribution of circulating CD4⁺ T cell subsets. The percentage of Tn was inversely correlated with both activated ECAR (Figure 7F) and basal OCR (Figure 7G) levels, while the percentage of Treg was positively correlated with activated ECAR (Figure 7H). These results strongly suggest that, as shown in the mouse, cellular metabolism regulates human CD4⁺ T cell activation and effector functions. Further, the results show a strong association between a dysregulated homeostasis in CD4⁺ T cells from SLE patients and an elevated metabolism in these cells. Example 8 - Met normalizes IFNy production and expands FOXP3⁺HELIOS⁺ Tregs following SLE CD4⁺ T cell activation in vitro

[00143] Consistent with the data produced in mouse models (Figure 3), human SLE CD4⁺ T cells produced significantly more IFNy than HCs after Thl induction (Figure 71).

Importantly, Met significantly decreased IFNy production in the CD4⁺ T cells from both SLE patients and HCs, resulting in comparable levels between the two cohorts (Figure 71). Met treatment also led to a significant decrease of IFNy production in both SLE and HC CD4⁺ T cells stimulated for 6 h with PMA/ionomycin directly after enrichment from blood samples (P < 0.05). The effect of Met on Treg polarization was also tested. FOXP3 alone is not a reliable marker to identify human Tregs, as it is also transiently expressed in activated conventional T cells (46). Expression of HELIOS has been associated with regulatory functions of human T cells, with CD4⁺FOXP3⁺HELIOS⁺ T cells demonstrating robust suppressive activity and lacking the ability of producing pro-inflammatory cytokines as compared to the CD4⁺FOXP3⁺HELIOS^" subset (47, 48). The SLE patients and HCs had comparable percentages of FOXP3⁺HELIOS^" and FOXP3⁺HELIOS⁺ CD4⁺ T cell populations after Treg polarization (Figure 18H and Figure 7K). However, Met treatment significantly increased the FOXP3⁺HELIOS⁺ population (Figure 7K) and correspondingly decreased the FOXP3⁺HELIOS^" population in both cohorts. FOXP3⁺HELIOS⁺ and FOXP3⁺HELIOS^" HC CD4⁺ T cell populations proliferated to the same extent during the Treg polarization assay (Figure 181), and Met mildly inhibited the proliferation of both populations to a similar extent (Figure 18 J). Therefore, Met treatment did not induce a proliferative advantage in the FOXP3⁺HELIOS⁺ population. Overall, these results showed that Met treatment normalized in vitro IFNy production by SLE CD4⁺ T cells, and promoted the expression of markers associated with regulatory functions.

Discussion

[00144] The examples described above demonstrate that CD4⁺ T cells from the TC lupus model as well as from SLE patients exhibit elevated glycolysis and mitochondrial oxidative metabolism as compared to non-autoimmune controls, both ex vivo and after activation in vitro. This is to our knowledge the first report that an autoimmune disease is associated with elevated metabolism in both patients and mouse. Moreover, the enhanced metabolism in CD4⁺ T cells is associated with an increased mTORCl activity.

[00145] Treating TC mice with a combination of Met and 2-DG normalized T cell metabolism and reversed disease phenotypes, including T cell activation, autoantibody production, and renal disease. The combination treatment was also effective on the NZB/W spontaneous lupus model and the cGVHD induced model. This result suggests that dysregulated T cell metabolism may be underlying SLE pathogenesis, and inhibiting T cell metabolism can be a novel therapeutic strategy for this disease.

[00146] Metabolic modulators have been evaluated for a number of diseases. Rapamycin reduced disease activity in MRL/lpr mice (51) and in SLE patients (52). Treatment with N- acetylcysteine, a precursor of gluthatione that blocks mTOR and reduces inflammation, improved disease outcome in NZB/W mice (53) and decreased disease activity in lupus patients (54). A clinically approved inhibitor of glycosphingolipids (GSL) biosynthesis, N- butyldeoxynojirimycin, normalized GSL metabolism, corrected signaling and functional defects in CD4⁺ T cells from SLE patients (55). Met is commonly used to treat type 2 diabetes, and 2-DG has been tested to treat cancer (56) and Alzheimer' s disease (57).

Interestingly, blocking either glycolysis or mitochondrial metabolism alone seems sufficient to relieve certain autoimmune diseases. Either 2-DG or Met can effectively inhibit the development of experimental autoimmune encephalomyelitis (EAE), a mouse model of multiple sclerosis (14, 58). 3PO, a small molecule inhibitor of PFKFB3, an enzyme that controls a rate limiting step of glycolysis, prevented the development of T cell-mediated delayed-hypersensitivity and imiquimod-induced psoriasis in the mouse (59). To the contrary, we showed in this study that a dual inhibition of glycolysis and mitochondrial metabolism is necessary for the reversal of lupus in TC model (60).

[00147] We report that CD4⁺ T cells from SLE patients display elevated glycolysis and oxidative respiration ex vivo, which correlated with T cell activation as well as the size of the Treg subset. Interestingly, we found that the immunosuppressive drugs commonly used in SLE patients reduce cellular metabolism of human CD4⁺ T cells. Therefore, we postulate that the metabolism of CD4⁺ T cells from untreated SLE patients could be even higher than what we report here for established patients under standard of care. Met treatment in vitro normalized IFNy production from SLE CD4⁺ T and enhanced the HELIOS expression in Tregs from SLE patients. These data showed that SLE patients also have abnormal CD4⁺ T cell metabolism and that Met could normalize these functions.

[00148] Our study provides possible mechanisms by which Met and 2-DG reversed immunophenotypes in vivo. Met regulates cellular metabolism through complex mechanisms (37). Besides inhibiting the mitochondrial respiratory chain complex I (61), it activates the AMPK pathway, which in turn switches cells from an anabolic to a catabolic state (62). The AMPK pathway antagonizes the mTOR pathway, which has a central role in regulating T cell function (63). Interestingly, Met could also inhibit mTOR activity in an AMPK independent manner (64). In this study, the in vivo treatment with a combination of Met+2-DG decreased T cell mitochondrial oxygen consumption as well as mTORCl signaling in both the TC and the NZBAV models. Therefore, inhibiting mitochondrial metabolism and antagonizing mTOR signaling are the likely mechanisms by which met normalized TC CD4⁺ T cell metabolism in vivo. We also observed a decrease in glycolysis after the Met+2-DG treatment, which is likely the mechanism by which 2-DG normalized TC CD4⁺ T cell metabolism in vivo.

[00149] In summary, we identified defective CD4 T cell metabolism as therapeutic target in both murine and human SLE. Met and 2-DG effectively altered CD4⁺ T cell metabolism and normalized lupus CD4⁺ T cell function in vitro. A combination of Met+2-DG treatment reversed established SLE disease in multiple mouse models of SLE, suggesting the potential of using metabolic modulators in the treatment of SLE.

References

1. G. C. Tsokos, Systemic lupus erythematosus. N.Engl.J. Med. 365, 2110-2121 (2011).

2. C. Mohan, S. Adams, V. Stanik, S. K. Datta, Nucleosome: a major immunogen for pathogenic autoantibody-inducing T cells of lupus. J. Exp. Med. 177, 1367-1381 (1993).

3. H. K. Kang, M. Y. Chiang, M. Liu, D. Ecklund, S. K. Datta, The histone peptide H4 71-94 alone is more effective than a cocktail of peptide epitopes in controlling lupus: immunoregulatory mechanisms. J. Clin. Immunol. 31, 379-394 (2011).

4. P. L. Kong, J. M. Odegard, F. Bouzahzah, J. Y. Choi, L. D. Eardley, C. E. Zielinski, J.

E. Craft, Intrinsic T cell defects in systemic autoimmunity. Ann. N. Y. Acad. Sci. 987, 60-67 (2003).

5. J. C. Crispin, V. C. Kyttaris, Y. T. Juang, G. C. Tsokos, How signaling and gene

transcription aberrations dictate the systemic lupus erythematosus T cell phenotype. Trends Immunol. 29, 110-115 (2008).

6. S. A. Apostolidis, L. A. Lieberman, K. Kis-Toth, J. C. Crispin, G. C. Tsokos, The dysregulation of cytokine networks in systemic lupus erythematosus. /. Interferon Cytokine Res. 31, 769-779 (2011).

7. A. N. Theofilopoulos, S. Koundouris, D. H. Kono, B. R. Lawson, The role of IFN- gamma in systemic lupus erythematosus: a challenge to the Thl/Th2 paradigm in autoimmunity. Arthritis Res. 3, 136-141 (2001). K. Ohl, K. Tenbrock, Inflammatory cytokines in systemic lupus erythematosus. J. Biomed. Biotechnol. 2011, 432595 (2011).

K. M. Pollard, D. M. Cauvi, C. B. Toomey, K. V. Morris, D. H. Kono, Interferon- gamma and systemic autoimmunity. Discov. Med. 16, 123-131 (2013).

C. J. Fox, P. S. Hammerman, C. B. Thompson, Fuel feeds function: energy

metabolism and the T-cell response. Nat. Rev. Immunol. 5, 844-852 (2005).

E. L. Pearce, M. C. Poffenberger, C. H. Chang, R. G. Jones, Fueling immunity:

insights into metabolism and lymphocyte function. Science 342, 1242454 (2013). K. A. Frauwirth, J. L. Riley, M. H. Harris, R. V. Parry, J. C. Rathmell, D. R. Plas, R. L. Elstrom, C. H. June, C. B. Thompson, The CD28 signaling pathway regulates glucose metabolism. Immunity 16, 769-777 (2002).

R. Wang, C. P. Dillon, L. Z. Shi, S. Milasta, R. Carter, D. Finkelstein, L. L.

McCormick, P. Fitzgerald, H. Chi, J. Munger, D. R. Green, The transcription factor Myc controls metabolic reprogramming upon T lymphocyte activation. Immunity 35, 871-882 (2011).

L. Z. Shi, R. Wang, G. Huang, P. Vogel, G. Neale, D. R. Green, H. Chi, HIFlalpha- dependent glycolytic pathway orchestrates a metabolic checkpoint for the

differentiation of TH17 and Treg cells. J. Exp. Med. 208, 1367-1376 (2011).

E. V. Dang, J. Barbi, H. Y. Yang, D. Jinasena, H. Yu, Y. Zheng, Z. Bordman, J. Fu, Y. Kim, H. R. Yen, W. Luo, K. Zeller, L. Shimoda, S. L. Topalian, G. L. Semenza, C. V. Dang, D. M. Pardoll, F. Pan, Control of T(H)17/T(reg) balance by hypoxia- inducible factor 1. Cell 146, 772-784 (2011).

R. D. Michalek, V. A. Gerriets, A. G. Nichols, M. Inoue, D. Kazmin, C. Y. Chang, M. A. Dwyer, E. R. Nelson, K. N. Pollizzi, O. Ilkayeva, V. Giguere, W. J. Zuercher, J. D. Powell, M. L. Shinohara, D. P. McDonnell, J. C. Rathmell, Estrogen-related receptor- ex is a metabolic regulator of effector T-cell activation and differentiation. Proc. Natl. Acad. Sci. U. S. A. 108, 18348-18353 (2011).

S. R. Jacobs, C. E. Herman, N. J. Maciver, J. A. Wofford, H. L. Wieman, J. J.

Hammen, J. C. Rathmell, Glucose uptake is limiting in T cell activation and requires CD28-mediated Akt-dependent and independent pathways. . Immunol. 180, 4476- 4486 (2008).

R. D. Michalek, V. A. Gerriets, S. R. Jacobs, A. N. Macintyre, N. J. Maciver, E. F. Mason, S. A. Sullivan, A. G. Nichols, J. C. Rathmell, Cutting edge: distinct glycolytic and lipid oxidative metabolic programs are essential for effector and regulatory CD4+ T cell subsets. J. Immunol. 186, 3299-3303 (2011).

E. L. Pearce, M. C. Walsh, P. J. Cejas, G. M. Harms, H. Shen, L. S. Wang, R. G. Jones, Y. Choi, Enhancing CD8 T-cell memory by modulating fatty acid metabolism. Nature 460, 103-107 (2009).

G. J. van der Windt, B. Everts, C. H. Chang, J. D. Curtis, T. C. Freitas, E. Amiel, E. J. Pearce, E. L. Pearce, Mitochondrial respiratory capacity is a critical regulator of CD8+ T cell memory development. Immunity 36, 68-78 (2012).

G. J. van der Windt, D. O'Sullivan, B. Everts, S. C. Huang, M. D. Buck, J. D. Curtis, C. H. Chang, A. M. Smith, T. Ai, B. Faubert, R. G. Jones, E. J. Pearce, E. L. Pearce, CD8 memory T cells have a bioenergetic advantage that underlies their rapid recall ability. Proc. Natl. Acad. Sci. U. S. A. 110, 14336-14341 (2013).

D. R. Wahl, B. Petersen, R. Warner, B. C. Richardson, G. D. Glick, A. W. Opipari, Characterization of the metabolic phenotype of chronically activated lymphocytes. Lupus 19, 1492-1501 (2010).

G. Nagy, A. Koncz, A. Perl, T cell activation-induced mitochondrial

hyperpolarization is mediated by Ca2+- and redox-dependent production of nitric oxide. J. Immunol. 171, 5188-5197 (2003).

D. R. Fernandez, T. Telarico, E. Bonilla, Q. Li, S. Banerjee, F. A. Middleton, P. E. Phillips, M. K. Crow, S. Oess, W. Muller-Esterl, A. Perl, Activation of mammalian target of rapamycin controls the loss of TCRzeta in lupus T cells through HRES- l/Rab4-regulated lysosomal degradation. J. Immunol. 182, 2063-2073 (2009).

D. Fernandez, E. Bonilla, N. Mirza, B. Niland, A. Perl, Rapamycin reduces disease activity and normalizes T cell activation-induced calcium fluxing in patients with systemic lupus erythematosus. Arthritis Rheum. 54, 2983-2988 (2006).

C. A. Byersdorfer, V. Tkachev, A. W. Opipari, S. Goodell, J. Swanson, S. Sandquist, G. D. Glick, J. L. Ferrara, Effector T cells require fatty acid metabolism during murine graft-versus-host disease. Blood 122, 3230-3237 (2013).

E. Gatza, D. R. Wahl, A. W. Opipari, T. B. Sundberg, P. Reddy, C. Liu, G. D. Glick, J. L. M. Ferrara, Manipulating the bioenergetics of alloreactive T cells causes their selective apoptosis and arrests graft-versus-host disease. Science Translational Medicine 3, 67ra68-67ra68 (2011).

L. Morel, B. P. Croker, K. R. Blenman, C. Mohan, G. Huang, G. Gilkeson, E. K. Wakeland, Genetic reconstitution of systemic lupus erythematosus immunopathology with polycongenic murine strains. Proc. Natl. Acad. Sci. U.S.A. 97, 6670-6675 (2000).

D. J. Perry, Y. Yin, T. Telarico, H. V. Baker, I. Dozmorov, A. Perl, L. Morel, Murine lupus susceptibility locus Slelc2 mediates CD4+ T cell activation and maps to estrogen-related receptor γ. . Immunol. 189, 793-803 (2012).

W. A. Alaynick, R. P. Kondo, W. Xie, W. He, C. R. Dufour, M. Downes, J. W.

Jonker, W. Giles, R. K. Naviaux, V. Giguere, R. M. Evans, ERRgamma directs and maintains the transition to oxidative metabolism in the postnatal heart. Cell Metab. 6, 13-24 (2007).

S. M. Rangwala, X. Wang, J. A. Calvo, L. Lindsley, Y. Zhang, G. Deyneko, V.

Beaulieu, J. Gao, G. Turner, J. Markovits, Estrogen-related receptor gamma is a key regulator of muscle mitochondrial activity and oxidative capacity. . Biol. Chem. 285, 22619-22629 (2010).

Z. Xu, B. Duan, B. P. Croker, L. Morel, STAT4 deficiency reduces autoantibody production and glomerulonephritis in a mouse model of lupus. Clin. Immunol. 120, 189-198 (2006).

N. J. Maclver, R. D. Michalek, J. C. Rathmell, Metabolic regulation of T

lymphocytes. Anna. Rev. Immunol. 31, 259-283 (2013).

K. Yang, H. Chi, mTOR and metabolic pathways in T cell quiescence and functional activation. Sem. Immunol. 24, 421-428 (2012).

A. P. Kelly, D. K. Finlay, H. J. Hinton, R. G. Clarke, E. Fiorini, F. Radtke, D. A. Cantrell, Notch-induced T cell development requires phosphoinositide-dependent kinase 1. EMBO J. 26, 3441-3450 (2007).

Y. Zheng, S. L. Collins, M. A. Lutz, A. N. Allen, T. P. Kole, P. E. Zarek, J. D.

Powell, A role for mammalian target of rapamycin in regulating T cell activation versus anergy. J. Immunol. 178, 2163-2170 (2007).

B. Viollet, B. Guigas, N. Sanz Garcia, J. Leclerc, M. Foretz, F. Andreelli, Cellular and molecular mechanisms of metformin: an overview. Clin. Sci. (Lond) 122, 253-270 (2012).

W. W. Wheaton, S. E. Weinberg, R. B. Hamanaka, S. Soberanes, L. B. Sullivan, E. Anso, A. Glasauer, E. Dufour, G. M. Mutlu, G. S. Budigner, N. S. Chandel,

Metformin inhibits mitochondrial complex I of cancer cells to reduce tumorigenesis. Elife 3, e02242 (2014). M. Harigai, M. Kawamoto, M. Hara, T. Kubota, N. Kamatani, N. Miyasaka,

Excessive production of IFN-gamma in patients with systemic lupus erythematosus and its contribution to induction of B lymphocyte stimulator/B cell-activating factor/TNF ligand superfamily-13B. J. Immunol. 181, 2211-2219 (2008).

T. Karonitsch, E. Feierl, C. W. Steiner, K. Dalwigk, A. Korb, N. Binder, A. Rapp, G. Steiner, C. Scheinecker, J. Smolen, M. Aringer, Activation of the interferon-gamma signaling pathway in systemic lupus erythematosus peripheral blood mononuclear cells. Arthritis Rheum. 60, 1463-1471 (2009).

K. Yang, S. Shrestha, H. Zeng, P. W. Karmaus, G. Neale, P. Vogel, D. A. Guertin, R. F. Lamb, H. Chi, T cell exit from quiescence and differentiation into Th2 cells depend on Raptor- mTORCl -mediated metabolic reprogramming. Immunity 39, 1043-1056 (2013).

L. A. Sena, S. Li, A. Jairaman, M. Prakriya, T. Ezponda, D. A. Hildeman, C. R.

Wang, P. T. Schumacker, J. D. Licht, H. Perlman, P. J. Bryce, N. S. Chandel, Mitochondria are required for antigen- specific T cell activation through reactive oxygen species signaling. Immunity 38, 225-236 (2013).

M. M. Kaminski, S. W. Sauer, C. D. Klemke, D. Suss, J. G. Okun, P. H. Krammer, K. Giilow, Mitochondrial reactive oxygen species control T cell activation by regulating IL-2 and IL-4 expression: mechanism of ciprofloxacin-mediated immunosuppression. J. Immunol. 184, 4827-4841 (2010).

A. Sang, H. Niu, J. Cullen, S. C. Choi, Y. Y. Zheng, H. Wang, M. J. Shlomchik, L. Morel, Activation of rheumatoid factor-specific B cells is antigen dependent and occurs preferentially outside of germinal centers in the lupus-prone NZM2410 mouse model. J. Immunol. 193, 1609-1921 (2014).

Y. Xu, L. Zeumer, W. Reeves, L. Morel, in Systemic Lupus Erythematosus, P.

Eggleton, F. J. Ward, Eds. (Springer New York, 2014), vol. 1134, chap. 9, pp. 103- 130.

M. A. Gavin, T. R. Torgerson, E. Houston, P. DeRoos, W. Y. Ho, A. Stray-Pedersen, E. L. Ocheltree, P. D. Greenberg, H. D. Ochs, A. Y. Rudensky, Single-cell analysis of normal and FOXP3-mutant human T cells: FOXP3 expression without regulatory T cell development. Proc. Natl. Acad. Sci. U. S. A. 103, 6659-6664 (2006).

A. Golding, S. Hasni, G. Illei, E. M. Shevach, The percentage of FoxP3+Helios+ Treg cells correlates positively with disease activity in systemic lupus erythematosus. Arthritis Rheum. 65, 2898-2906 (2013). D. J. Zabransky, C. J. Nirschl, N. M. Durham, B. V. Park, C. M. Ceccato, T. C.

Bruno, A. J. Tarn, D. Getnet, C. G. Drake, Phenotypic and functional properties of Helios+ regulatory T cells. PLoS One 7, e34547 (2012).

M. G. Vander Heiden, L. C. Cantley, C. B. Thompson, Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324, 1029-1033 (2009).

S. R. Jacobs, C. E. Herman, N. J. Maclver, J. A. Wofford, H. L. Wieman, J. J.

Hammen, J. C. Rathmell, Glucose uptake is limiting in T cell activation and requires CD28-mediated Akt-dependent and independent pathways. . Immunol. 180, 4476- 4486 (2008).

L. M. Warner, L. M. Adams, S. N. Sehgal, Rapamycin prolongs survival and arrests pathophysiologic changes in murine systemic lupus erythematosus. Arthritis Rheum. 37, 289-297 (1994).

D. Fernandez, E. Bonilla, N. Mirza, B. Niland, A. Perl, Rapamycin reduces disease activity and normalizes T cell activation-induced calcium fluxing in patients with systemic lupus erythematosus. Arthritis Rheum. 54, 2983-2988 (2006).

S. Suwannaroj, A. Lagoo, D. Keisler, R. W. McMurray, Antioxidants suppress mortality in the female NZB x NZW Fl mouse model of systemic lupus

erythematosus (SLE). Lupus 10, 258-265 (2001).

Z.-W. Lai, R. Hanczko, E. Bonilla, T. N. Caza, B. Clair, A. Bartos, G. Miklossy, J. Jimah, E. Doherty, H. Tily, L. Francis, R. Garcia, M. Dawood, J. Yu, I. Ramos, I. Coman, S. V. Faraone, P. E. Phillips, A. Perl, N-acetylcysteine reduces disease activity by blocking mTOR in T cells of lupus patients. Arthritis Rheum. 64, 2937- 2946 (2012).

G. McDonald, S. Deepak, L. Miguel, C. J. Hall, D. A. Isenberg, A. I. Magee, T. Butters, E. C. Jury, Normalizing glycosphingolipids restores function in CD4+ T cells from lupus patients. /. Clin. Invest. 124, 712-724 (2014).

R. Yamaguchi, G. Perkins, Finding a Panacea among Combination Cancer Therapies. Cancer Res. 72, 18-23 (2012).

J. Yao, S. Chen, Z. Mao, E. Cadenas, R. D. Brinton, 2-Deoxy-D-Glucose treatment induces ketogenesis, sustains mitochondrial function, and reduces pathology in female mouse model of Alzheimer's disease. PLoS ONE 6, e21788 (2011). N. Nath, M. Khan, M. K. Paintlia, I. Singh, M. N. Hoda, S. Giri, Metformin attenuated the autoimmune disease of the central nervous system in animal models of multiple sclerosis. J. Immunol. 182, 8005-8014 (2009).

S. Telang, B. Clem, A. Klarer, A. Clem, J. Trent, R. Bucala, J. Chesney, Small molecule inhibition of 6-Phosphofructo-2-Kinase suppresses T cell activation. . Transl. Med. 10, 95 (2012).

J.-H. Cheong, E. S. Park, J. Liang, J. B. Dennison, D. Tsavachidou, C. Nguyen- Charles, K. Wa Cheng, H. Hall, D. Zhang, Y. Lu, M. Ravoori, V. Kundra, J. Ajani, J.- S. Lee, W. Ki Hong, G. B. Mills, Dual inhibition of tumor energy pathway by 2- Deoxyglucose and metformin is effective against a broad spectrum of preclinical cancer models. Mol. Cancer Ther. 10, 2350-2362 (2011).

M. R. Owen, E. Doran, A. P. Halestrap, Evidence that metformin exerts its antidiabetic effects through inhibition of complex 1 of the mitochondrial respiratory chain. Biochem. J. 348, 607-614 (2000).

G. Zhou, R. Myers, Y. Li, Y. Chen, X. Shen, J. Fenyk-Melody, M. Wu, J. Ventre, T. Doebber, N. Fujii, N. Musi, M. F. Hirshman, L. J. Goodyear, D. E. Moller, Role of AMP-activated protein kinase in mechanism of metformin action. . Clin. Invest. 108, 1167-1174 (2001).

H. Chi, Regulation and function of mTOR signalling in T cell fate decisions. Nat. Rev. Immunol. 12, 325-338 (2012).

I. Ben Sahra, C. Regazzetti, G. Robert, K. Laurent, Y. Le Marchand-Brustel, P.

Auberger, J. F. Tanti, S. Giorgetti-Peraldi, F. Bost, Metformin, independent of AMPK, induces mTOR inhibition and cell-cycle arrest through REDD1. Cancer Res. 71, 4366-4372 (2011).

F. J. Dufort, B. F. Bleiman, M. R. Gumina, D. Blair, D. J. Wagner, M. F. Roberts, Y. Abu-Amer, T. C. Chiles, Cutting edge: IL-4-mediated protection of primary B lymphocytes from apoptosis via Stat6-dependent regulation of glycolytic metabolism. J. Immunol. 179, 4953-4957 (2007).

A. Del Prete, P. Zaccagnino, M. Di Paola, M. Saltarella, C. Oliveros Celis, B. Nico, G. Santoro, M. Lorusso, Role of mitochondria and reactive oxygen species in dendritic cell differentiation and functions. Free Radic. Biol. Med. 44, 1443-1451 (2008).

B. Everts, E. Amiel, S. C. Huang, A. M. Smith, C. H. Chang, W. Y. Lam, V.

Redmann, T. C. Freitas, J. Blagih, G. J. van der Windt, M. N. Artyomov, R. G. Jones, E. L. Pearce, E. J. Pearce, TLR-driven early glycolytic reprogramming via the kinases ΤΒΚΙ-ΙΚΚε supports the anabolic demands of dendritic cell activation. Nat. Immunol. 15, 323-332 (2014).

Z. Xu, C. M. Cuda, B. P. Croker, L. Morel, The NZM2410-derived lupus

susceptibility locus Sle2cl increases TH17 polarization and induces nephritis in Fas- deficient mice. Arthritis Rheum. 63, 764-774 (2011).

Claims

CLAIMS What is claimed is:

1. A method for treating lupus, the method comprising administering a composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor to a subject.

2. A method for treating lupus, the method comprising administering a composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor to a subject having increased glycolysis and mitochondrial metabolism in CD4+ T cells.

3. A composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor for use in treating lupus in a subject.

4. A composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor for use in treating lupus in a subject having increased glycolysis and mitochondrial metabolism in CD4+ T cells.

5. A method for treating lupus, the method comprising:

a. obtaining a biological sample from the subject;

b. detecting the presence of increased glycolysis and/or mitochondrial metabolism in the CD4+ T cells of the biological sample; and

c. administering to the subject a composition comprising (i) a glycolysis inhibitor and (ii) a mitochondrial metabolism inhibitor.

6. The method of any one of claims 1 to 5, wherein the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, I-BET and DCA.

7. The method of any one of claims 1 to 6, wherein the mitochondrial metabolism inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235

(GSK1059615), JQl, I-BET, digoxin, SRIOOI, CCI-779, everolimus, and ridaforolimus.

8. The method of any one of claims 1 to 5, wherein the glycolysis inhibitor is 2-DG, and the mitochondrial metabolism inhibitor is metformin.

9. The method of any one of claims 1 to 5, wherein the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, I-BET and DCA and the mitochondrial metabolism inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQl, I-BET, digoxin, SRIOOI, CCI-779, everolimus, and ridaforolimus.

10. The method of any one of claims 1 to 9, wherein the subject has systemic lupus erythematosus (SLE).

11. The method of claim 5, wherein the biological sample is blood.

12. A kit for the treatment of lupus comprising:

i. a container comprising a pharmaceutical composition comprising a glycolysis inhibitor;

ii. a container comprising a pharmaceutical composition comprising a

mitochondrial metabolism inhibitor; and,

iii. instructions for administering the pharmaceutical compositions of (i) and (ii) to a subject having lupus.

13. A kit for the treatment of lupus comprising:

i. a container comprising a pharmaceutical composition comprising (a) a

glycolysis inhibitor and (b) a mitochondrial metabolism inhibitor; and, ii. instructions for administering the pharmaceutical composition to a subject having lupus.

14. The kit of claim 12 or 13, wherein the glycolysis inhibitor is 2-DG and/or the mitochondrial metabolism inhibitor is metformin.

15. The kit of claim 12 or 13, wherein the glycolysis inhibitor is selected from the group consisting of 2-DG, 3PO, PFK-15, CAL-101 (Idelalisib), JQ-1, I-BET and DCA and the mitochondrial metabolism inhibitor is selected from the group consisting of metformin, PP242, NVP-BEZ235 (GSK1059615), JQl, I-BET, digoxin, SRIOOI, CCI-779, everolimus, and ridaforolimus.

16. The kit of any one of claims 12 to 15, wherein the lupus is Systemic Lupus

Erythematosus (SLE).