WO2016118353A1 - Polythérapie avec des anticorps anti-cd74 et anti-cd20 chez des patients atteints d'un lymphome b non-hodgkinien réfractaire et récidivant - Google Patents

Polythérapie avec des anticorps anti-cd74 et anti-cd20 chez des patients atteints d'un lymphome b non-hodgkinien réfractaire et récidivant Download PDF

Info

Publication number
WO2016118353A1
WO2016118353A1 PCT/US2016/012854 US2016012854W WO2016118353A1 WO 2016118353 A1 WO2016118353 A1 WO 2016118353A1 US 2016012854 W US2016012854 W US 2016012854W WO 2016118353 A1 WO2016118353 A1 WO 2016118353A1
Authority
WO
WIPO (PCT)
Prior art keywords
antibody
antibodies
lymphoma
seq
patients
Prior art date
Application number
PCT/US2016/012854
Other languages
English (en)
Inventor
David M. Goldenberg
William A. WEGENER
Original Assignee
Immunomedics, Inc.
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Immunomedics, Inc. filed Critical Immunomedics, Inc.
Priority to CA2970738A priority Critical patent/CA2970738A1/fr
Priority to EP16740510.9A priority patent/EP3247395A1/fr
Publication of WO2016118353A1 publication Critical patent/WO2016118353A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C07K16/2833—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily against MHC-molecules, e.g. HLA-molecules
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • A61K2039/507—Comprising a combination of two or more separate antibodies
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/545—Medicinal preparations containing antigens or antibodies characterised by the dose, timing or administration schedule
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/31—Immunoglobulins specific features characterized by aspects of specificity or valency multispecific
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
    • C07K2317/35—Valency
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/732—Antibody-dependent cellular cytotoxicity [ADCC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
    • C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
    • C07K2317/734—Complement-dependent cytotoxicity [CDC]
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
    • C07K2317/94—Stability, e.g. half-life, pH, temperature or enzyme-resistance
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction

Definitions

  • the present invention concerns compositions and methods of use of combination therapy using at least one anti-CD74 antibody or antigen-binding fragment thereof and at least one anti-CD20 antibody or antigen-binding fragment thereof.
  • the compositions and methods are not limiting and the anti-CD74 and anti-CD20 antibodies or fragments may be utilized in combination with one or more additional therapeutic agents.
  • the other therapeutic agent may be another antibody or fragment thereof against the same or a different target antigen, including but not limited to CD 19, CD20, CD21, CD22, CD23, CD37, CD40, CD40L, CD52, CD80 or HLA-DR.
  • the other therapeutic agent may be an immunomodulator, a cytotoxic agent, a drug, a toxin, an anti -angiogenic agent, a proapoptotic agent or a radionuclide.
  • the compositions and methods are of use to treat human patients with relapsed/refractory B-cell non-Hodgkin's lymphoma (NHL), including but not limited to follicular lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma, lymphoplasmacytic lymphoma and marginal zone lymphoma.
  • NHL relapsed/refractory B-cell non-Hodgkin's lymphoma
  • follicular lymphoma including but not limited to follicular lymphoma, diffuse large B-cell lymphoma (DLBCL), mantle cell lymphoma, lymphoplasmacytic lymphoma and marginal zone lymphoma.
  • the patients to be treated have an indolent form
  • the combination of anti-CD74 and anti-CD20 antibodies or fragments thereof is effective to treat patients who are refractory to or relapsed from previous treatment with standard therapies against NHL.
  • the patients to be treated are refractory to and/or relapsed from rituximab therapy.
  • the patients may be treated with an induction dose of anti-CD20 antibody at 200 mg/m 2 per week, with anti-CD74 antibody administered at a dose of 8, 16 or 20 mg/kg once or twice a week.
  • the anti-CD20 antibody is veltuzumab (hA20) and the anti-CD74 antibody is milatuzumab (hLLl).
  • the combination of anti-CD74 and anti-CD20 antibodies or fragments thereof is significantly more efficacious for treating indolent NHL than either agent administered alone or the sum of effects of the two agents administered separately.
  • the first clinical evidence of an apparent advantage of combining two antibodies against different cancer cell antigens involved the administration of rituximab (chimeric anti- CD20) and epratuzumab (humanized anti-CD22 antibody) in patients with non-Hodgkin lymphoma (NHL).
  • rituximab chimeric anti- CD20
  • epratuzumab humanized anti-CD22 antibody
  • NHL non-Hodgkin lymphoma
  • the present invention concerns improved compositions and methods of use of combination therapy with at least one anti-CD74 and at least one anti-CD20 antibody or fragment thereof.
  • the combination may be used alone, or else with one or more other therapeutic agents.
  • the combination therapy is of use to treat human patients with
  • the combination is effective to treat patients who had previously relapsed from or shown resistance to standard therapies for NHL, such as radiation therapy, rituximab, CHOP or R-CHOP.
  • standard therapies for NHL such as radiation therapy, rituximab, CHOP or R-CHOP.
  • the anti-CD74 antibody is an hLLl antibody (also known as milatuzumab) that comprises the light chain complementarity-determining region (CDR) sequences CDRl (RSSQSLVHRNGNTYLH; SEQ ID NO: l), CDR2 (TVSNRFS; SEQ ID NO:2), and CDR3 (SQSSHVPPT; SEQ ID NO:3) and the heavy chain variable region CDR sequences CDRl (NYGVN; SEQ ID NO:4), CDR2 (WINPNTGEPTFDDDFKG; SEQ ID NO: 5), and CDR3 (SRGKNEAWFAY; SEQ ID NO:6).
  • CDR light chain complementarity-determining region
  • a humanized LL1 (hLLl) anti-CD74 antibody suitable for use is disclosed in U.S. Patent No. 7,312,318, incorporated herein by reference from Col. 35, line 1 through Col. 42, line 27 and FIG. 1 through FIG. 4.
  • other known and/or commercially available anti-CD74 antibodies may be utilized, such as LS-B1963, LS-B2594, LS-B1859, LS-B2598, LS-C5525, LS-C44929, etc. (LSBio, Seattle, WA); LN2
  • the anti-CD74 antibody may be selected such that it competes with or blocks binding to CD74 of an LL1 antibody comprising the light chain CDR sequences CDRl
  • the anti-CD74 antibody may bind to the same epitope of CD74 as an LL1 antibody.
  • Many examples of anti-CD20 antibodies are known in the art and any such known antibody or fragment thereof may be utilized.
  • the anti-CD20 antibody is an hA20 antibody (also known as veltuzumab) that comprises the light chain complementarity-determining region (CDR) sequences CDR1 (RASSSVSYIH; SEQ ID NO:7), CDR2 (ATSNLAS; SEQ ID NO:8), and CDR3 (QQWTSNPPT; SEQ ID NO:9) and the heavy chain variable region CDR sequences CDR1 (SYNMH; SEQ ID NO: 10), CDR2 (AIYPGNGDTSYNQKFKG; SEQ ID NO: 11), and CDR3 (STYYGGDWYFDV; SEQ ID NO: 12).
  • CDR light chain complementarity-determining region
  • anti-CD20 antibodies such as rituximab
  • the anti-CD20 antibody may be selected such that it competes with or blocks binding to CD20 of an hA20 antibody comprising the light chain complementarity-determining region (CDR) sequences CDR1 (RASSSVSYIH; SEQ ID NO:7), CDR2 (ATSNLAS; SEQ ID NO: 8), and CDR3 (QQWTSNPPT; SEQ ID NO: 9) and the heavy chain variable region CDR sequences CDR1 (SYNMH; SEQ ID NO: 10), CDR2 (AIYPGNGDTSYNQKFKG; SEQ ID NO: 11), and CDR3 (STYYGGDWYFDV; SEQ ID NO: 12).
  • the anti- CD20 antibody may bind to the same epitope of CD20 as a hA20 antibody.
  • the antibodies or fragments thereof may be used as naked antibodies, alone or in combination with one or more therapeutic agents. Alternatively, the antibodies or fragments may be utilized as immunoconjugates, attached to one or more therapeutic agents. (For methods of making immunoconjugates, see, e.g., U.S. Patent Nos.
  • Therapeutic agents may be selected from the group consisting of a radionuclide, a cytotoxin, a chemotherapeutic agent, a drug, a pro-drug, a toxin, an enzyme, an immunomodulator, an anti -angiogenic agent, a pro-apoptotic agent, a cytokine, a hormone, an oligonucleotide molecule (e.g., an antisense molecule or a gene) or another antibody or fragment thereof.
  • a radionuclide e.g., a cytotoxin, a chemotherapeutic agent, a drug, a pro-drug, a toxin, an enzyme, an immunomodulator, an anti -angiogenic agent, a pro-apoptotic agent, a cytokine, a hormone, an oligonucleotide molecule (e.g., an antisense molecule or a gene) or another antibody or fragment thereof.
  • the therapeutic agent may be selected from the group consisting of aplidin, azaribine, anastrozole, azacytidine, bleomycin, bortezomib, biyostatin-1, busulfan, calicheamycin, camptothecin, 10-hydroxycamptothecin, carmustine, Celebrex, chlorambucil, cisplatin, irinotecan (CPT-1 1), SN-38, carboplatin, cladribine, cyclophosphamide, cytarabine, dacarbazine, docetaxel, dactinomycin, daunomycin glucuronide, daunorubicin,
  • the therapeutic agent may comprise a radionuclide selected from the group consisting of 103m Rh, 103 Ru, 105 Rh, 105 Ru, 107 Hg, 109 Pd, 109 Pt, m Ag, m In, 113m In, 119 Sb, U C, 121m Te, 122m Te, 125 I, 125m Te, 126 I, 131 I, 133 I, 13 N, 142 Pr, 143 Pr, 149 Pm, 152 Dy, 153 Sm, 15 0, 16 1Ho, 161 Tb, 165 Tm, 166 Dy, 166 Ho, 167 Tm, 168 Tm, 169 Er, 169 Yb, 177 Lu, 186 Re, 188 Re, 189m Os, 189 Re, 192 Ir, 194 Ir, 197 Pt, 198 Au, 199 Au, 201 T1, 203 Hg, 211 At, 211 Bi, 211 Pb, 212 Bi, 212 Pb, 213 Bi
  • the therapeutic agent may be an enzyme selected from the group consisting of malate dehydrogenase, staphylococcal nuclease, delta- V-steroid isomerase, yeast alcohol
  • dehydrogenase alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, beta- galactosidase, ribonuclease, urease, catalase, glucose-6-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.
  • An immunomodulator of use may be selected from the group consisting of a cytokine, a stem cell growth factor, a lymphotoxin, a hematopoietic factor, a colony stimulating factor (CSF), an interferon (IFN), erythropoietin, thrombopoietin and combinations thereof.
  • exemplary immunomodulators may include IL-1, IL-2, IL-3, IL-6, IL-10, IL-12, IL-18, IL- 21, interferon-a, interferon- ⁇ , interferon- ⁇ , G-CSF, GM-CSF, and mixtures thereof.
  • anti-angiogenic agents may include angiostatin, endostatin, baculostatin, canstatin, maspin, anti-VEGF binding molecules, anti-placental growth factor binding molecules, or anti-vascular growth factor binding molecules.
  • the antibody or fragment may comprise one or more chelating moieties, such as NOTA, DOTA, DTP A, TETA, Tscg-Cys, or Tsca-Cys.
  • the chelating moiety may form a complex with a therapeutic or diagnostic cation, such as Group II, Group III, Group IV, Group V, transition, lanthanide or actinide metal cations, Tc, Re, Bi, Cu, As, Ag, Au, At, or Pb.
  • the antibody or fragment thereof may be a human, chimeric, or humanized antibody or fragment thereof.
  • a humanized antibody or fragment thereof may comprise the complementarity-determining regions (CDRs) of a murine antibody and the constant and framework (FR) region sequences of a human antibody, which may be substituted with at least one amino acid from corresponding FRs of a murine antibody.
  • a chimeric antibody or fragment thereof may include the light and heavy chain variable regions of a murine antibody, attached to human antibody constant regions.
  • the antibody or fragment thereof may include human constant regions of IgGl, IgG2a, IgG3, or IgG4.
  • Exemplary known antibodies that may be used in combination with anti-CD20/CD74 include, but are not limited to, hRl (anti-IGF-lR), hPAM4 (anti-mucin), hA19 (anti-CD 19), hIMMU31 (anti-AFP), hLL2 (anti-CD22), hMu-9 (anti-CSAp), hL243 (anti-HLA-DR), hMN-14 (anti-CEACAM5), hMN-15 (anti-CEACAM6), 29H2 (anti-CEACAMl,
  • hRS7 anti-EGP-1
  • hMN-3 anti-CEACAM6
  • Cancer Immunol Immunother 2005, 54: 187-207 Reports on tumor associated antigens include Mizukami et al., (2005, Nature Med. 11 :992-97); Hatfield et al., (2005, Curr. Cancer Drug Targets 5:229- 48); Vallbohmer et al. (2005, J. Clin. Oncol. 23 :3536-44); and Ren et al. (2005, Ann. Surg. 242:55-63).
  • the combination of anti-CD74 and anti-CD20 antibodies or fragments thereof may comprise a DOCK-AND-LOCK® (DNL®) construct (see, e.g., U.S. Patent Nos. 7,521,056; 7,527,787; 7,534,866; 7,550, 143; 7,666,400; 7,858,070; 7,871,622; 7,901,680; 7,906, 118 and 7,906, 121, the Examples section of each of which is incorporated herein by reference.)
  • DNL® technique takes advantage of the specific, high-affinity binding interaction between a dimerization and docking domain (DDD) sequence from the regulatory subunit of human cAMP-dependent protein kinase (PKA), such as human PKA RIa, Rip, Rlla or RIip, and an anchor domain (AD) sequence from any of a variety of AKAP proteins.
  • DDD dimerization and docking domain
  • PKA cAMP-dependent protein kinase
  • Rip
  • the DDD and AD peptides may be attached to any protein, peptide or other molecule. Because the DDD sequences spontaneously dimerize and bind to the AD sequence, the DNL® technique allows the formation of complexes between any selected molecules that may be attached to DDD or AD sequences.
  • the standard DNL® complex comprises a trimer with two DDD-linked molecules attached to one AD-linked molecule, variations in complex structure allow the formation of dimers, trimers, tetramers, pentamers, hexamers and other multimers.
  • the DNL® complex may comprise two or more antibodies, antibody fragments or fusion proteins which bind to the same antigenic determinant or to two or more different antigens.
  • the DNL® complex may also comprise one or more other effectors, such as a cytokine, toxin or PEG moiety.
  • hexavalent DNL® constructs comprise an IgG molecule covalently attached to two copies of an AD moiety, which binds to four Fab fragments, each covalently attached to a DDD moiety.
  • FIG. 1A Kaplan-Meier curve demonstrating the progression free survival (PFS) in patients receiving combined veltuzumab and milatuzumab.
  • PFS progression free survival
  • FIG. IB Kaplan-Meier curve demonstrating the overall survival in patients receiving combined veltuzumab and milatuzumab. Overall survival (OS) was determined from the start of treatment to death from any cause. Patients who were still alive were censored at the date of last follow-up. Survival curves were estimated using the method of Kaplan-Meier.
  • HAHA human anti -veltuzumab antibodies
  • FIG. 4A Direct cytotoxicity induced by anti-CD20/CD74 HexAbs in NHL cell lines as determined by the MTS assay. JeKo-1, Granta-519, Mino, and Raji (5 x 10 4 cells per well in 48-well plate) treated with indicated concentrations of antibodies for 4 days.
  • FIG. 4B Direct cytotoxicity induced by anti-CD20/CD74 HexAbs in NHL cell lines as determined by the MTS assay. Effect of monospecific 20-(20)-(20) on JeKo-1, Granta-519 and Mino; bispecific 20-(22)-(22) on JeKo-1; and monospecific 74-(74)-(74) on Raji.
  • FIG. 4C Direct cytotoxicity induced by anti-CD20/CD74 HexAbs in NHL cell lines as determined by the MTS assay. Dose-response curves showing partial inhibition of 20-(74)-(74) and 74-(20)-(20) in JeKo-1 by excess hA20 or hLLl (10 ⁇ ).
  • FIG. 5A Induction of apoptosis by anti-CD20/CD74 HexAbs.
  • JeKo-1 cells (2 x 10 5 cells per well in 6-well plate) were treated with 10 nM of indicated antibodies for 48 h followed by annexin staining analysis.
  • the two bispecific anti-CD20/CD74 HexAbs induced statistically significant apoptosis in JeKo-1 cells compared to cells treated or not treated with parental antibodies, alone or combined (P ⁇ 0.033).
  • FIG. 5B Induction of apoptosis by anti-CD20/CD74 HexAbs.
  • the two anti-CD20/CD74 HexAbs induced statistically significant early apoptosis in MCL (P ⁇ 0.008) and CLL (P ⁇ 0.03) compared to the untreated controls.
  • One of the patient samples (CLL 216) did not respond to any treatment.
  • FIG. 5C Induction of apoptosis by anti-CD20/CD74 HexAbs.
  • the two anti-CD20/CD74 HexAbs induced statistically significant early apoptosis in MCL (P ⁇ 0.008) and CLL (P ⁇ 0.03) compared to the untreated controls.
  • One of the patient samples (CLL 216) did not respond to any treatment.
  • FIG. 5D Induction of apoptosis by anti-CD20/CD74 HexAbs. Both anti- CD20/CD74 HexAbs induced changes in mitochondrial membrane potential (upper panel) and generated ROS (lower panel) in Granta-519.
  • FIG. 6A Correlation of homotypic adhesion, actin reorganization, and lysosomal involvement to cell death evoked by the bispecific anti-CD20/CD74 HexAbs. Apoptosis induced by HexAbs was reduced significantly (P ⁇ 0.025) in Jeko-1 with 2 ⁇ of
  • CsD cytochalasin D
  • FIG. 6B Correlation of homotypic adhesion, actin reorganization, and lysosomal involvement to cell death evoked by the bispecific anti-CD20/CD74 HexAbs. Lysosomal V ATPase inhibitors, concanamycin A (Con A) and bafilomycin Al (Bfal), inhibited the apoptosis induced by HexAbs in JeKo-1 cells.
  • FIG. 7A Activity of HexAbs in human blood ex vivo. 20-(74)-(74) and 74-(20)- (20), tested at 10 and 25 nM in JeKo-1 (upper panel) and normal B cells (lower panel).
  • JeKo-1 cells were analyzed as CD19+ events in the monocyte gate.
  • B cells were analyzed as CD 19+ events in the lymphocyte gate. Error bars represent SD.
  • FIG. 7B Activity of HexAbs in human blood ex vivo. 20-(74)-(74) tested at 0 1, 0 5 and 1 nM in Jeko-1 (upper panel) and normal B cells (lower panel). The effect of the indicated antibodies on the growth of spiked JeKo-1 cells in whole blood from a healthy volunteer was determined after 48 h. JeKo-1 cells were analyzed as CD19+ events in the monocyte gate. B cells were analyzed as CD 19+ events in the lymphocyte gate. Error bars represent SD
  • FIG. 7C Activity of HexAbs in human blood ex vivo. 74-(20)-(20) tested at 0 1, 0 5 and 1 nM in JeKo-1 (upper panel) and normal B cells (lower panel). The effect of the indicated antibodies on the growth of spiked JeKo-1 cells in whole blood from a healthy volunteer was determined after 48 h. JeKo-1 cells were analyzed as CD19+ events in the monocyte gate. B cells were analyzed as CD 19+ events in the lymphocyte gate. Error bars represent SD.
  • FIG. 8 Therapeutic efficacy of HexAbs in disseminated JeKo-1 xenograft model.
  • mice Seven groups of 8 mice (8-wk-old female SCID mice) each were inoculated i.v. with JeKo-1 (2.5 x 10 7 cells per animal). After 7 days, three different does (i.e., 370 ⁇ g, 37 ⁇ g and 3.7 ⁇ g) of both HexAbs were administered via i.p. injections twice a week for two weeks. Control mice received saline injections. 74-(20)-(20) and 20-(74)-(74), at the 370 ⁇ g dose level, resulted in 30% and 60% increases in median survival compared to saline controls, respectively.
  • JeKo-1 2.5 x 10 7 cells per animal
  • FIG. 10 Anti-CD74 antibody (milatuzumab) increases the cytotoxicity of rituximab.
  • the Figure shows the percent of untreated control values in MTT cytotoxicity assays. Cells were incubated with the antibodies for 4 days in the presence of goat anti- human IgG as a crosslinker. The Figure shows several lines of NHL (left side), CLL (center) and ALL (right side) cell lines.
  • FIG. 11 Anti-CD74 antibody (milatuzumab) increases the cytotoxicity of fludarabine.
  • the Figure shows the percent of untreated control values in MTS cytotoxicity assays. Cells were incubated with fludarabine and milatuzumab for 4 days in the presence of goat anti-human IgG as a crosslinker. The Figure shows the effects on NHL (left side) and CLL (right side) cell lines.
  • an “antibody” refers to a full-length (i.e., naturally occurring or formed by normal immunoglobulin gene fragment recombinatorial processes) immunoglobulin molecule (e.g., an IgG antibody).
  • an "antibody fragment” is a portion of an antibody such as F(ab') 2 , F(ab) 2 , Fab', Fab, Fv, scFv, single domain antibodies (DABs or VHHs) and the like, including half-molecules of IgG4 (van der Neut Kolfschoten et al., 2007, Science 317: 1554-1557). Regardless of structure, an antibody fragment binds with the same antigen that is recognized by the intact antibody. For example, an anti-CD22 antibody fragment binds with an epitope of CD22.
  • antibody fragment also includes isolated fragments consisting of the variable regions, such as the "Fv” fragments consisting of the variable regions of the heavy and light chains, recombinant single chain polypeptide molecules in which light and heavy chain variable regions are connected by a peptide linker ("scFv proteins”), and minimal recognition units consisting of the amino acid residues that mimic the hypervariable region.
  • Fv variable regions
  • scFv proteins peptide linker
  • a "chimeric antibody” is a recombinant protein that contains the variable domains including the complementarity determining regions (CDRs) of an antibody derived from one species, preferably a rodent antibody, while the constant domains of the antibody molecule are derived from those of a human antibody.
  • the constant domains of the chimeric antibody may be derived from that of other species, such as a cat or dog.
  • a “humanized antibody” is a recombinant protein in which the CDRs from an antibody from one species; e.g., a rodent antibody, are transferred from the heavy and light variable chains of the rodent antibody into human heavy and light variable domains, including human framework region (FR) sequences. The constant domains of the antibody molecule are derived from those of a human antibody.
  • a "human antibody” is an antibody obtained from transgenic mice that have been genetically engineered to produce specific human antibodies in response to antigenic challenge. In this technique, elements of the human heavy and light chain locus are introduced into strains of mice derived from embryonic stem cell lines that contain targeted disruptions of the endogenous heavy chain and light chain loci.
  • the transgenic mice can synthesize human antibodies specific for human antigens, and the mice can be used to produce human antibody-secreting hybridomas. Methods for obtaining human antibodies from transgenic mice are described by Green et al., Nature Genet. 7: 13 (1994), Lonberg et al., Nature 368:856 (1994), and Taylor et al., Int. Immun. 6:579 (1994).
  • a fully human antibody also can be constructed by genetic or chromosomal transfection methods, as well as phage display technology, all of which are known in the art.
  • antibody variable domain genes are cloned in-frame into either a major or minor coat protein gene of a filamentous bacteriophage, and displayed as functional antibody fragments on the surface of the phage particle. Because the filamentous particle contains a single-stranded DNA copy of the phage genome, selections based on the functional properties of the antibody also result in selection of the gene encoding the antibody exhibiting those properties. In this way, the phage mimics some of the properties of the B cell.
  • Phage display can be performed in a variety of formats, for their review, see, e.g. Johnson and Chiswell, Current Opinion in Structural Biology 3 :5564-571 (1993). Human antibodies may also be generated by in vitro activated B cells. (See, U.S. Pat. Nos. 5,567,610 and 5,229,275).
  • a "therapeutic agent” is an atom, molecule, or compound that is useful in the treatment of a disease.
  • therapeutic agents include but are not limited to antibodies, antibody fragments, drugs, cytokine or chemokine inhibitors, pro-apoptotic agents, tyrosine kinase inhibitors, toxins, enzymes, nucleases, hormones, immunomodulators, antisense oligonucleotides, siRNA, RNAi, chelators, boron compounds, photoactive agents, dyes and radioisotopes.
  • a "diagnostic agent” is an atom, molecule, or compound that is useful in diagnosing a disease.
  • useful diagnostic agents include, but are not limited to, radioisotopes, dyes, contrast agents, fluorescent compounds or molecules and enhancing agents (e.g., paramagnetic ions).
  • the diagnostic agents are selected from the group consisting of radioisotopes, enhancing agents, and fluorescent compounds.
  • An "immunoconjugate” is a conjugate of an antibody with an atom, molecule, or a higher-ordered structure (e.g., with a liposome), a therapeutic agent, or a diagnostic agent.
  • a “naked antibody” is generally an entire antibody that is not conjugated to a therapeutic agent. This is so because the Fc portion of the antibody molecule provides effector functions, such as complement fixation and ADCC (antibody dependent cell cytotoxicity) that set mechanisms into action that may result in cell lysis. However, it is possible that the Fc portion is not required for therapeutic function, with other mechanisms, such as apoptosis, coming into play. Naked antibodies include both polyclonal and monoclonal antibodies, as well as certain recombinant antibodies, such as chimeric, humanized or human antibodies.
  • antibody fusion protein is a recombinantly produced antigen-binding molecule in which an antibody or antibody fragment is linked to another protein or peptide, such as the same or different antibody or antibody fragment or a DDD or AD peptide (of the DOCK-AND-LOCK® complexes described below).
  • the fusion protein may comprise a single antibody component, a multivalent or multispecific combination of different antibody components or multiple copies of the same antibody component.
  • the fusion protein may additionally comprise an antibody or an antibody fragment and a therapeutic agent. Examples of therapeutic agents suitable for such fusion proteins include immunomodulators and toxins.
  • One preferred toxin comprises a ribonuclease (RNase), preferably a recombinant RNase.
  • a “multispecific antibody” is an antibody that can bind simultaneously to at least two targets that are of different structure, e.g., two different antigens, two different epitopes on the same antigen, or a hapten and/or an antigen or epitope.
  • a “multivalent antibody” is an antibody that can bind simultaneously to at least two targets that are of the same or different structure. Valency indicates how many binding arms or sites the antibody has to a single antigen or epitope; i.e., monovalent, bivalent, trivalent or multivalent. The multivalency of the antibody means that it can take advantage of multiple interactions in binding to an antigen, thus increasing the avidity of binding to the antigen.
  • Specificity indicates how many antigens or epitopes an antibody is able to bind; i.e., monospecific, bispecific, trispecific, multispecific.
  • a natural antibody e.g., an IgG
  • Multispecific, multivalent antibodies are constructs that have more than one binding site of different specificity.
  • bispecific antibody is an antibody that can bind simultaneously to two targets which are of different structure.
  • Bispecific antibodies bsAb
  • bispecific antibody fragments bsFab
  • bsAb bispecific antibodies
  • bsFab bispecific antibody fragments
  • a variety of bispecific antibodies can be produced using molecular engineering. Included herein are bispecific antibodies that target a cancer-associated antigen and also an
  • immunotherapeutic T cell such as CD3-T cells.
  • direct cytotoxicity refers to the ability of an agent to inhibit the proliferation or induce the apoptosis of a cell grown in an optimized culture medium in which only the agent and the cell are present.
  • compositions, formulations and methods described herein may include monoclonal antibodies.
  • Rodent monoclonal antibodies to specific antigens may be obtained by methods known to those skilled in the art. (See, e.g., Kohler and Milstein, Nature 256: 495 (1975), and Coligan et al. (eds ), CURRENT PROTOCOLS IN IMMUNOLOGY, VOL. 1, pages 2.5.1-2.6.7 (John Wiley & Sons 1991)).
  • General techniques for cloning murine immunoglobulin variable domains have been disclosed, for example, by the publication of Orlandi et al., Proc. Nat'l Acad. Sci. USA 86: 3833 (1989).
  • a chimeric antibody is a recombinant protein that contains the variable domains including the CDRs derived from one species of animal, such as a rodent antibody, while the remainder of the antibody molecule; i.e., the constant domains, is derived from a human antibody.
  • Techniques for constructing chimeric antibodies are well known to those of skill in the art. As an example, Leung et al., Hybridoma 13 :469 (1994), disclose how they produced an LL2 chimera by combining DNA sequences encoding the V k and V H domains of LL2 monoclonal antibody, an anti-CD22 antibody, with respective human and IgGi constant region domains. This publication also provides the nucleotide sequences of the LL2 light and heavy chain variable regions, V k and V 3 ⁇ 4 respectively.
  • a chimeric monoclonal antibody can be humanized by replacing the sequences of the murine FR in the variable domains of the chimeric antibody with one or more different human FR.
  • mouse CDRs are transferred from heavy and light variable chains of the mouse immunoglobulin into the corresponding variable domains of a human antibody.
  • additional modification might be required in order to restore the original affinity of the murine antibody. This can be accomplished by the replacement of one or more some human residues in the FR regions with their murine counterparts to obtain an antibody that possesses good binding affinity to its epitope.
  • a fully human antibody can be obtained from a transgenic non -human animal.
  • a transgenic non -human animal See, e.g., Mendez et al., Nature Genetics, 15: 146-156, 1997; U.S. Pat. No. 5,633,425.
  • Methods for producing fully human antibodies using either combinatorial approaches or transgenic animals transformed with human immunoglobulin loci are known in the art ⁇ e.g., Mancini et al., 2004, New Microbiol. 27:315-28; Conrad and Scheller, 2005, Comb. Chem. High
  • the phage display technique may be used to generate human antibodies ⁇ e.g., Dantas-Barbosa et al., 2005, Genet. Mol. Res. 4: 126-40, incorporated herein by reference).
  • Human antibodies may be generated from normal humans or from humans that exhibit a particular disease state, such as cancer (Dantas-Barbosa et al., 2005).
  • the advantage to constructing human antibodies from a diseased individual is that the circulating antibody repertoire may be biased towards antibodies against disease-associated antigens.
  • Fab fragment antigen binding protein
  • RNAs were converted to cDNAs and used to make Fab cDNA libraries using specific primers against the heavy and light chain immunoglobulin sequences (Marks et al., 1991, J. Mol. Biol. 222:581-97).
  • Library construction was performed according to Andris-Widhopf et al. (2000, In: Phage Display Laboratory Manual, Barbas et al. (eds), I s edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY pp. 9.1 to 9.22, incorporated herein by reference).
  • Fab fragments were digested with restriction endonucleases and inserted into the bacteriophage genome to make the phage display library.
  • libraries may be screened by standard phage display methods. The skilled artisan will realize that this technique is exemplary only and any known method for making and screening human antibodies or antibody fragments by phage display may be utilized.
  • transgenic animals that have been genetically engineered to produce human antibodies may be used to generate antibodies against essentially any immunogenic target, using standard immunization protocols as discussed above.
  • Methods for obtaining human antibodies from transgenic mice are described by Green et al., Nature Genet. 7: 13 (1994), Lonberg et al., Nature 368:856 (1994), and Taylor et al., Int. Immun. 6:579 (1994).
  • a non-limiting example of such a system is the XenoMouse® (e.g., Green et al., 1999, J. Immunol. Methods 231 : 11-23, incorporated herein by reference) from Abgenix (Fremont, CA).
  • the mouse antibody genes have been inactivated and replaced by functional human antibody genes, while the remainder of the mouse immune system remains intact.
  • the XENOMOUSE® was transformed with germline-configured YACs (yeast artificial chromosomes) that contained portions of the human IgH and Ig kappa loci, including the majority of the variable region sequences, along accessory genes and regulatory sequences.
  • the human variable region repertoire may be used to generate antibody producing B cells, which may be processed into hybridomas by known techniques.
  • a XENOMOUSE® immunized with a target antigen will produce human antibodies by the normal immune response, which may be harvested and/or produced by standard techniques discussed above. A variety of are available, each of which is capable of producing a different class of antibody.
  • Transgenically produced human antibodies have been shown to have therapeutic potential, while retaining the pharmacokinetic properties of normal human antibodies (Green et al., 1999).
  • the skilled artisan will realize that the claimed compositions and methods are not limited to use of the XENOMOUSE® system but may utilize any transgenic animal that has been genetically engineered to produce human antibodies.
  • VK variable light chain
  • the V genes of an antibody from a cell that expresses a murine antibody can be cloned by PCR amplification and sequenced.
  • the cloned V L and V H genes can be expressed in cell culture as a chimeric Ab as described by Orlandi et al, (Proc. Natl. Acad. Sci., USA, 86: 3833 (1989)).
  • a humanized antibody can then be designed and constructed as described by Leung et al. (Mol. Immunol, 32: 1413 (1995)).
  • cDNA can be prepared from any known hybridoma line or transfected cell line producing a murine antibody by general molecular cloning techniques (Sambrook et al., Molecular Cloning, A laboratory manual, 2 nd Ed (1989)).
  • the VK sequence for the antibody may be amplified using the primers VK1BACK and VK1FOR (Orlandi et al, 1989) or the extended primer set described by Leung et al. (BioTechniques, 15: 286 (1993)).
  • V H sequences can be amplified using the primer pair VH1BACK/VH1FOR (Orlandi et al, 1989) or the primers annealing to the constant region of murine IgG described by Leung et al. (Hybridoma, 13 :469 (1994)).
  • Humanized V genes can be constructed by a combination of long oligonucleotide template syntheses and PCR amplification as described by Leung et al. (Mol. Immunol, 32: 1413 (1995)).
  • PCR products for VK can be subcloned into a staging vector, such as a pBR327-based staging vector, VKpBR, that contains an Ig promoter, a signal peptide sequence and convenient restriction sites.
  • PCR products for V H can be subcloned into a similar staging vector, such as the pBluescript-based VHpBS.
  • Expression cassettes containing the VK and V H sequences together with the promoter and signal peptide sequences can be excised from VKpBR and VHpBS and ligated into appropriate expression vectors, such as pKh and pGlg, respectively (Leung et al., Hybridoma, 13:469 (1994)).
  • the expression vectors can be co-transfected into an appropriate cell and supernatant fluids monitored for production of a chimeric, humanized or human antibody.
  • the VK and V H expression cassettes can be excised and subcloned into a single expression vector, such as pdHL2, as described by Gillies et al. (J. Immunol. Methods 125: 191 (1989) and also shown in Losman et al., Cancer, 80:2660 (1997)).
  • expression vectors may be transfected into host cells that have been pre-adapted for transfection, growth and expression in serum-free medium.
  • Exemplary cell lines that may be used include the Sp/EEE, Sp/ESF and Sp/ESF-X cell lines (see, e.g., U.S. Patent Nos. 7,531,327; 7,537,930 and 7,608,425; the Examples section of each of which is incorporated herein by reference). These exemplary cell lines are based on the Sp2/0 myeloma cell line, transfected with a mutant Bcl-EEE gene, exposed to methotrexate to amplify transfected gene sequences and pre-adapted to serum-free cell line for protein expression.
  • Immunogenicity of therapeutic antibodies is associated with increased risk of infusion reactions and decreased duration of therapeutic response (Baert et al., 2003, N Engl J Med 348:602-08).
  • the extent to which therapeutic antibodies induce an immune response in the host may be determined in part by the allotype of the antibody (Stickler et al., 2011, Genes and Immunity 12:213-21).
  • Antibody allotype is related to amino acid sequence variations at specific locations in the constant region sequences of the antibody.
  • the allotypes of IgG antibodies containing a heavy chain ⁇ -type constant region are designated as Gm allotypes (1976, J Immunol 117: 1056-59).
  • Glml For the common IgGl human antibodies, the most prevalent allotype is Glml (Stickler et al., 2011, Genes and Immunity 12:213-21). However, the Glm3 allotype also occurs frequently in Caucasians ⁇ Id). It has been reported that Glml antibodies contain allotypic sequences that tend to induce an immune response when administered to non-Glml (nGlml) recipients, such as Glm3 patients ⁇ Id). Non-Glml allotype antibodies are not as immunogenic when administered to Glml patients ⁇ Id).
  • the human Glml allotype comprises the amino acids aspartic acid at Kabat position 356 and leucine at Kabat position 358 in the CH3 sequence of the heavy chain IgGl .
  • the nGlml allotype comprises the amino acids glutamic acid at Kabat position 356 and methionine at Kabat position 358.
  • Both Glml and nGlml allotypes comprise a glutamic acid residue at Kabat position 357 and the allotypes are sometimes referred to as DEL and EEM allotypes.
  • a non- limiting example of the heavy chain constant region sequences for Glml and nGlml allotype antibodies is shown for the exemplary antibodies rituximab (SEQ ID NO: 14) and veltuzumab (SEQ ID NO: 13).
  • veltuzumab and rituximab are, respectively, humanized and chimeric IgGl antibodies against CD20, of use for therapy of a wide variety of
  • Table 1 compares the allotype sequences of rituximab vs. veltuzumab.
  • rituximab (Glml7,l) is a DEL allotype IgGl, with an additional sequence variation at Kabat position 214 (heavy chain CHI) of lysine in rituximab vs. arginine in veltuzumab.
  • veltuzumab is less immunogenic in subjects than rituximab (see, e.g., Morchhauser et al., 2009, J Clin Oncol 27:3346-53; Goldenberg et al., 2009, Blood 113 : 1062-70; Robak & Robak, 2011, BioDrugs 25 : 13-25), an effect that has been attributed to the difference between humanized and chimeric antibodies.
  • the difference in allotypes between the EEM and DEL allotypes likely also accounts for the lower immunogenicity of veltuzumab.
  • the allotype of the antibody In order to reduce the immunogenicity of therapeutic antibodies in individuals of nGlml genotype, it is desirable to select the allotype of the antibody to correspond to the Glm3 allotype, characterized by arginine at Kabat 214, and the nGlml,2 null-allotype, characterized by glutamic acid at Kabat position 356, methionine at Kabat position 358 and alanine at Kabat position 431. Surprisingly, it was found that repeated subcutaneous administration of Glm3 antibodies over a long period of time did not result in a significant immune response.
  • the human IgG4 heavy chain in common with the Glm3 allotype has arginine at Kabat 214, glutamic acid at Kabat 356, methionine at Kabat 359 and alanine at Kabat 431. Since immunogenicity appears to relate at least in part to the residues at those locations, use of the human IgG4 heavy chain constant region sequence for therapeutic antibodies is also a preferred embodiment. Combinations of Glm3 IgGl antibodies with IgG4 antibodies may also be of use for therapeutic administration.
  • the claimed methods and compositions may utilize any of a variety of antibodies known in the art.
  • therapeutic use of anti-CD74/CD20 antibodies may be supplemented with one or more antibodies against other tumor-associated antigens.
  • Antibodies of use may be commercially obtained from a number of known sources.
  • a variety of antibody secreting hybridoma lines are available from the American Type Culture Collection (ATCC, Manassas, VA).
  • a large number of antibodies against various disease targets, including but not limited to tumor-associated antigens, have been deposited at the ATCC and/or have published variable region sequences and are available for use in the claimed methods and compositions. See, e.g., U.S. Patent Nos. 7,312,318;
  • antibody sequences or antibody-secreting hybridomas against almost any disease-associated antigen may be obtained by a simple search of the ATCC, NCBI and/or USPTO databases for antibodies against a selected disease-associated target of interest.
  • the antigen binding domains of the cloned antibodies may be amplified, excised, ligated into an expression vector, transfected into an adapted host cell and used for protein production, using standard techniques well known in the art (see, e.g., U.S. Patent Nos. 7,531,327; 7,537,930; 7,608,425 and 7,785,880, the Examples section of each of which is incorporated herein by reference).
  • Antibodies of use may bind to various known antigens expressed in B cells, including but not limited to BCL-1, BCL-2, BCL-6, CDla, CD2, CD5, CD10, CD1 lb, CD1 lc, CD13, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD34, CD38, CD40, CD40L, CD41a, CD43, CD45, CD47, CD55, CD56, CCD57, CD59, CD64, CD71, CD79a, CD79b, CD 138, CXCR4, FMC-7 and HLA-DR.
  • BCL-1 BCL-2, BCL-6, CDla, CD2, CD5, CD10, CD1 lb, CD1 lc, CD13, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD34, CD38, CD40, CD40L, CD41a, CD43, CD45, CD47, CD55, CD56, CCD57, CD
  • antibodies that may be of use for therapy of cancer within the scope of the claimed methods and compositions include, but are not limited to, LLl (anti-CD74), LL2 and RFB4 (anti-CD22), hL243 (anti -HLA-DR), alemtuzumab (anti-CD52), gemtuzumab (anti- CD33), ibritumomab (anti-CD20), rituximab (anti-CD20), tositumomab (anti-CD20), and GA101 (anti-CD20; obinutuzumab).
  • Such antibodies are known in the art (e.g., U.S. Patent Nos. 5,686,072; 5,874,540; 6, 107,090; 6,183,744; 6,306,393; 6,653, 104; 6,730.300;
  • Antibody fragments which recognize specific epitopes can be generated by known techniques.
  • the antibody fragments are antigen binding portions of an antibody, such as F(ab) 2 , Fab', Fab, Fv, scFv and the like.
  • Other antibody fragments include, but are not limited to: the F(ab') 2 fragments which can be produced by pepsin digestion of the antibody molecule and the Fab' fragments, which can be generated by reducing disulfide bridges of the F(ab') 2 fragments.
  • Fab' expression libraries can be constructed (Huse et al., 1989, Science, 246: 1274-1281) to allow rapid and easy identification of monoclonal Fab' fragments with the desired specificity.
  • the antibody fragment may be a fragment that is not an scFv fragment.
  • a single chain Fv molecule comprises a VL domain and a VH domain.
  • the VL and VH domains associate to form a target binding site. These two domains are further covalently linked by a peptide linker (L).
  • L peptide linker
  • An antibody fragment can be prepared by known methods, for example, as disclosed by Goldenberg, U.S. Pat. Nos. 4,036,945 and 4,331,647 and references contained therein. Also, see Nisonoff et al., Arch Biochem. Biophys. 89: 230 (1960); Porter, Biochem. J. 73 : 119 (1959), Edelman et al., in METHODS IN ENZYMOLOGY VOL.1, page 422 (Academic Press 1967), and Coligan at pages 2.8.1-2.8.10 and 2.10.-2.10.4.
  • a single complementarity-determining region is a segment of the variable region of an antibody that is complementary in structure to the epitope to which the antibody binds and is more variable than the rest of the variable region. Accordingly, a CDR is sometimes referred to as hypervariable region.
  • a variable region comprises three CDRs.
  • CDR peptides can be obtained by constructing genes encoding the CDR of an antibody of interest. Such genes are prepared, for example, by using the polymerase chain reaction to synthesize the variable region from RNA of antibody-producing cells.
  • Another form of an antibody fragment is a single-domain antibody (dAb), sometimes referred to as a single chain antibody.
  • dAb single-domain antibody
  • the sequences of antibodies may be varied to optimize the physiological characteristics of the conjugates, such as the half-life in serum.
  • Methods of substituting amino acid sequences in proteins are widely known in the art, such as by site-directed mutagenesis (e.g. Sambrook et al., Molecular Cloning, A laboratory manual, 2 nd Ed, 1989).
  • the variation may involve the addition or removal of one or more glycosylation sites in the Fc sequence (e.g., U.S. Patent No. 6,254,868, the Examples section of which is incorporated herein by reference).
  • specific amino acid substitutions in the Fc sequence may be made (e.g., Hornick et al., 2000, J Nucl Med 41 :355-62; Hinton et al., 2006, J Immunol 176:346-56; Petkova et al. 2006, Int Immunol 18: 1759-69; U.S. Patent No.
  • Methods for producing bispecific antibodies include engineered recombinant antibodies which have additional cysteine residues so that they crosslink more strongly than the more common immunoglobulin isotypes. (See, e.g., FitzGerald et al, Protein Eng.
  • bispecific antibodies can be produced using molecular engineering.
  • the bispecific antibody may consist of, for example, an scFv with a single binding site for one antigen and a Fab fragment with a single binding site for a second antigen.
  • the bispecific antibody may consist of, for example, an IgG with two binding sites for one antigen and two scFv with two binding sites for a second antigen.
  • multispecific and/or multivalent antibodies may be produced as DOCK-AND- LOCK® (DNL®) complexes as described below.
  • an anti-CD74 and anti-CD20 antibody or fragment may be administered to a patient as part of a combination of antibodies.
  • Bispecific antibodies are preferred to administration of combinations of separate antibodies, due to cost and
  • the combination may be utilized.
  • the antibodies may bind to different epitopes of the same antigen or to different antigens.
  • the antigens are selected from the group consisting of BCL-1, BCL-2, BCL-6, CDla, CD2, CD5, CD10, CDl lb, CDl lc, CD13, CD14, CD15, CD19, CD20, CD21, CD22, CD23, CD25, CD34, CD38, CD40, CD40L, CD41a, CD43, CD45, CD47, CD55, CD56, CCD57, CD59, CD64, CD71, CD79a, CD79b, CD 138, CXCR4, FMC-7 and HLA-DR.
  • a bivalent or multivalent antibody is formed as a DOCK- AND-LOCK® (DNL®) complex (see, e.g., U.S. Patent Nos. 7,521,056; 7,527,787;
  • the technique takes advantage of the specific and high- affinity binding interactions that occur between a dimerization and docking domain (DDD) sequence of the regulatory (R) subunits of cAMP-dependent protein kinase (PKA) and an anchor domain (AD) sequence derived from any of a variety of AKAP proteins (Baillie et al., FEBS Letters. 2005; 579: 3264. Wong and Scott, Nat. Rev. Mol. Cell Biol. 2004; 5: 959).
  • DDD and AD peptides may be attached to any protein, peptide or other molecule.
  • the technique allows the formation of complexes between any selected molecules that may be attached to DDD or AD sequences.
  • the standard DNL® complex comprises a trimer with two DDD-linked molecules attached to one AD-linked molecule
  • variations in complex structure allow the formation of dimers, trimers, tetramers, pentamers, hexamers and other multimers.
  • the DNL® complex may comprise two or more antibodies, antibody fragments or fusion proteins which bind to the same antigenic determinant or to two or more different antigens.
  • the DNL® complex may also comprise one or more other effectors, such as proteins, peptides, immunomodulators, cytokines, interleukins, interferons, binding proteins, peptide ligands, carrier proteins, toxins, ribonucleases such as onconase, inhibitory oligonucleotides such as siRNA, antigens or xenoantigens, polymers such as PEG, enzymes, therapeutic agents, hormones, cytotoxic agents, anti-angiogenic agents, pro-apoptotic agents or any other molecule or aggregate.
  • effectors such as proteins, peptides, immunomodulators, cytokines, interleukins, interferons, binding proteins, peptide ligands, carrier proteins, toxins, ribonucleases such as onconase, inhibitory oligonucleotides such as siRNA, antigens or xenoantigens, polymers such as PEG, enzymes, therapeutic agents, hormones,
  • PKA which plays a central role in one of the best studied signal transduction pathways triggered by the binding of the second messenger cAMP to the R subunits, was first isolated from rabbit skeletal muscle in 1968 (Walsh et al., J. Biol. Chem. 1968;243 :3763).
  • the structure of the holoenzyme consists of two catalytic subunits held in an inactive form by the R subunits (Taylor, J. Biol. Chem. 1989;264:8443). Isozymes of PKA are found with two types of R subunits (RI and RII), and each type has a and ⁇ isoforms (Scott, Pharmacol. Ther. 1991;50: 123).
  • the four isoforms of PKA regulatory subunits are RIa, Ri , Rlla and RIi .
  • the R subunits have been isolated only as stable dimers and the dimerization domain has been shown to consist of the first 44 amino-terminal residues of Rlla or RIip (Newlon et al., Nat. Struct. Biol. 1999; 6:222).
  • similar portions of the amino acid sequences of other regulatory subunits are involved in dimerization and docking, each located at or near the N-terminal end of the regulatory subunit. Binding of cAMP to the R subunits leads to the release of active catalytic subunits for a broad spectrum of
  • AKAP microtubule-associated protein-2
  • the amino acid sequences of the AD are quite varied among individual AKAPs, with the binding affinities reported for RII dimers ranging from 2 to 90 nM (Alto et al, Proc. Natl. Acad. Sci. USA. 2003; 100:4445). AKAPs will only bind to dimeric R subunits.
  • the AD binds to a hydrophobic surface formed by the 23 amino-terminal residues (Colledge and Scott, Trends Cell Biol. 1999; 6:216).
  • the dimerization domain and AKAP binding domain of human Rlla are both located within the same N-terminal 44 amino acid sequence (Newlon et al, Nat. Struct. Biol. 1999;6:222; Newlon et al, EMBO J. 2001;20: 1651), which is termed the DDD herein.
  • Entity B is constructed by linking an AD sequence to a precursor of B, resulting in a second component hereafter referred to as b.
  • the dimeric motif of DDD contained in a 2 will create a docking site for binding to the AD sequence contained in b, thus facilitating a ready association of a 2 and b to form a binary, trimeric complex composed of a 2 b.
  • This binding event is made irreversible with a subsequent reaction to covalently secure the two entities via disulfide bridges, which occurs very efficiently based on the principle of effective local concentration because the initial binding interactions should bring the reactive thiol groups placed onto both the DDD and AD into proximity (Chmura et al., Proc. Natl. Acad. Sci. USA. 2001;98:8480) to ligate site-specifically.
  • linkers, adaptor modules and precursors a wide variety of DNL® constructs of different stoichiometry may be produced and used (see, e.g., U.S. Nos. 7,550, 143; 7,521,056;
  • fusion proteins A variety of methods are known for making fusion proteins, including nucleic acid synthesis, hybridization and/or amplification to produce a synthetic double-stranded nucleic acid encoding a fusion protein of interest.
  • double-stranded nucleic acids may be inserted into expression vectors for fusion protein production by standard molecular biology techniques (see, e.g. Sambrook et al., Molecular Cloning, A laboratory manual, 2 nd Ed, 1989).
  • the AD and/or DDD moiety may be attached to either the N- terminal or C-terminal end of an effector protein or peptide.
  • site of attachment of an AD or DDD moiety to an effector moiety may vary, depending on the chemical nature of the effector moiety and the part(s) of the effector moiety involved in its physiological activity.
  • Site-specific attachment of a variety of effector moieties may be performed using techniques known in the art, such as the use of bivalent cross-linking reagents and/or other chemical conjugation techniques.
  • AD or DDD sequences may be utilized. Exemplary DDD and AD sequences are provided below.
  • DDDl and DDD2 are based on the DDD sequence of the human Rlla isoform of protein kinase A.
  • the DDD and AD moieties may be based on the DDD sequence of the human RIa form of protein kinase A and a corresponding AKAP sequence, as exemplified in DDD3, DDD3C and AD3 below.
  • AD and/or DDD moieties may be utilized in construction of the DNL® complexes.
  • Rlla DDD sequence is the basis of DDDl and DDD2 disclosed above.
  • the four human PKA DDD sequences are shown below.
  • the DDD sequence represents residues 1-44 of Rlla, 1-44 of RIip, 12-61 of RIa and 13-66 of Rip. (Note that the sequence of DDD 1 is modified slightly from the human PKA Rlla DDD moiety.)
  • DDD moiety sequences are shown in SEQ ID NO:27 to SEQ ID NO:46 below.
  • the skilled artisan will realize that an almost unlimited number of alternative species within the genus of DDD moieties can be constructed by standard techniques, for example using a commercial peptide synthesizer or well known site-directed mutagenesis techniques.
  • the effect of the amino acid substitutions on AD moiety binding may also be readily determined by standard binding assays, for example as disclosed in Alto et al. (2003, Proc Natl Acad Sci USA 100:4445-50).
  • Alto et al. performed a bioinformatic analysis of the AD sequence of various AKAP proteins to design an RII selective AD sequence called AKAP-IS (SEQ ID NO: 17), with a binding constant for DDD of 0.4 nM.
  • the AKAP-IS sequence was designed as a peptide antagonist of AKAP binding to PKA. Residues in the AKAP-IS sequence where substitutions tended to decrease binding to DDD are underlined in SEQ ID NO: 17 below.
  • AD1 SEQ ID NO: 15
  • Table 3 shows potential conservative amino acid substitutions in the sequence of AKAP-IS (AD1, SEQ ID NO: 17), similar to that shown for DDD1 (SEQ ID NO: 15) in Table 2 above.
  • the SuperAKAP-IS sequence may be substituted for the AKAP-IS AD moiety sequence to prepare DNL® constructs.
  • Other alternative sequences that might be substituted for the AKAP-IS AD sequence are shown in SEQ ID NO:67-69. Substitutions relative to the AKAP-IS sequence are underlined. It is anticipated that, as with the AD2 sequence shown in SEQ ID NO: 18, the AD moiety may also include the additional N-terminal residues cysteine and glycine and C-terminal residues glycine and cysteine.
  • Figure 2 of Gold et al. disclosed additional DDD-binding sequences from a variety of AKAP proteins, shown below.
  • LAWKIAKMIVSDVMQQ (SEQ ID NO: 79)
  • AKAPlO-pep NTDEAQEELAWKIAKMIVSDIMQQA (SEQ ID NO: 96)
  • AKAP12-pep NGILELETK S SKL VQNIIQT AVDQF (SEQ ID NO:98)
  • AKAP14-pep TQDKNYEDELTQVALALVEDVINYA (SEQ ID NO: 99)
  • Carr et al. (2001, J Biol Chem 276: 17332-38) examined the degree of sequence homology between different AKAP -binding DDD sequences from human and non-human proteins and identified residues in the DDD sequences that appeared to be the most highly conserved among different DDD moieties. These are indicated below by underlining with reference to the human PKA Rlla DDD sequence of SEQ ID NO: 15. Residues that were particularly conserved are further indicated by italics. The residues overlap with, but are not identical to those suggested by Kinderman et al. (2006) to be important for binding to AKAP proteins.
  • DNL® constructs may be formed using alternatively constructed antibodies or antibody fragments, in which an AD moiety may be attached at the C-terminal end of the kappa light chain (C k ), instead of the C-terminal end of the Fc on the heavy chain.
  • the alternatively formed DNL® constructs may be prepared as disclosed in Provisional U.S. Patent Application Serial Nos. 61/654,310, filed June 1, 2012, 61/662,086, filed June 20, 2012, 61/673,553, filed July 19, 2012, and 61/682,531, filed August 13, 2012, the entire text of each incorporated herein by reference.
  • the light chain conjugated DNL® constructs exhibit enhanced Fc-effector function activity in vitro and improved pharmacokinetics, stability and anti -lymphoma activity in vivo (Rossi et al., 2013, Bioconjug Chem 24:63-71).
  • C k -conjugated DNL® constructs may be prepared as disclosed in Provisional U.S. Patent Application Serial Nos. 61/654,310, 61/662,086, 61/673,553, and 61/682,531. Briefly, C k -AD2-IgG, was generated by recombinant engineering, whereby the AD2 peptide was fused to the C-terminal end of the kappa light chain. Because the natural C-terminus of C K is a cysteine residue, which forms a disulfide bridge to C H I, a 16-amino acid residue "hinge" linker was used to space the AD2 from the C K -V H 1 disulfide bridge.
  • the mammalian expression vectors for C k -AD2-IgG-veltuzumab and C k -AD2-IgG-epratuzumab were constructed using the pdHL2 vector, which was used previously for expression of the homologous C H 3-AD2-IgG modules.
  • a 2208-bp nucleotide sequence was synthesized comprising the pdHL2 vector sequence ranging from the Bam HI restriction site within the V K /C K intron to the Xho I restriction site 3 ' of the C k intron, with the insertion of the coding sequence for the hinge linker (EFPKPSTPPGSSGGAP, SEQ ID NO: 102) and AD2, in frame at the 3 'end of the coding sequence for C K .
  • This synthetic sequence was inserted into the IgG-pdHL2 expression vectors for veltuzumab and epratuzumab via Bam HI and Xho I restriction sites.
  • C k -AD2-IgG-veltuzumab and C k -AD2-IgG- epratuzumab were produced by stably-transfected production clones in batch roller bottle culture, and purified from the supernatant fluid in a single step using Mab Select (GE).
  • C k -AD2-IgG-epratuzumab was conjugated with C H 1-DDD2- Fab -veltuzumab, a Fab-based module derived from veltuzumab, to generate the bsHexAb 22*-(20)-(20), where the 22* indicates the C k -AD2 module of epratuzumab and each (20) symbolizes a stabilized dimer of veltuzumab Fab.
  • C k -AD2-IgG-veltuzumab was conjugated with IFNa2b-DDD2, a module of IFNa2b with a DDD2 peptide fused at its C-terminal end, to generate 20*-2b, which comprises veltuzumab with a dimeric IFNa2b fused to each light chain.
  • the properties of 20*-2b were compared with those of 20-2b, which is the homologous Fc-IgG-IFNa.
  • Each of the bsHexAbs and IgG-IFNa were isolated from the DNL® reaction mixture by MabSelect affinity chromatography.
  • the disclosed methods and compositions may involve production and use of proteins or peptides with one or more substituted amino acid residues.
  • the DDD and/or AD sequences used to make DNL® constructs may be modified as discussed above.
  • amino acid substitutions typically involve the replacement of an amino acid with another amino acid of relatively similar properties (i.e., conservative amino acid substitutions).
  • conservative amino acid substitutions The properties of the various amino acids and effect of amino acid substitution on protein structure and function have been the subject of extensive study and knowledge in the art.
  • the hydropathic index of amino acids may be considered (Kyte & Doolittle, 1982, J. Mol. Biol., 157: 105-132).
  • the relative hydropathic character of the amino acid contributes to the secondary structure of the resultant protein, which in turn defines the interaction of the protein with other molecules.
  • Each amino acid has been assigned a hydropathic index on the basis of its hydrophobicity and charge characteristics (Kyte & Doolittle, 1982), these are: isoleucine (+4.5); valine (+4.2); leucine (+3.8); phenylalanine (+2.8); cysteine/cystine (+2.5); methionine (+1.9); alanine (+1.8); glycine (-0.4); threonine (- 0.7); serine (-0.8); tryptophan (-0.9); tyrosine (-1.3); proline (-1.6); histidine (-3.2); glutamate (-3.5); glutamine (-3.5); aspartate (-3.5); asparagine (-3.5); lysine (-3.9); and arginine (-4.5).
  • the use of amino acids whose hydropathic indices are within ⁇ 2 is preferred, within ⁇ 1 are more preferred, and within ⁇ 0.5 are even more preferred.
  • Amino acid substitution may also take into account the hydrophilicity of the amino acid residue (e.g., U.S. Pat. No. 4,554, 101). Hydrophilicity values have been assigned to amino acid residues: arginine (+3.0); lysine (+3.0); aspartate (+3.0); glutamate (+3.0); serine (+0.3); asparagine (+0.2); glutamine (+0.2); glycine (0); threonine (-0.4); proline (-0.5 .+-.1); alanine (-0.5); histidine (-0.5); cysteine (-1.0); methionine (-1.3); valine (-1.5); leucine (-1.8); isoleucine (-1.8); tyrosine (-2.3); phenylalanine (-2.5); tryptophan (-3.4). Replacement of amino acids with others of similar hydrophilicity is preferred.
  • amino acid side chain For example, it would generally not be preferred to replace an amino acid with a compact side chain, such as glycine or serine, with an amino acid with a bulky side chain, e.g., tryptophan or tyrosine.
  • a compact side chain such as glycine or serine
  • an amino acid with a bulky side chain e.g., tryptophan or tyrosine.
  • tryptophan or tyrosine The effect of various amino acid residues on protein secondary structure is also a
  • arginine and lysine glutamate and aspartate; serine and threonine; glutamine and asparagine; and valine, leucine and isoleucine.
  • amino acid substitutions include whether or not the residue is located in the interior of a protein or is solvent exposed.
  • conservative substitutions would include: Asp and Asn; Ser and Thr; Ser and Ala; Thr and Ala; Ala and Gly; Ile and Val; Val and Leu; Leu and Ile; Leu and Met; Phe and Tyr; Tyr and Trp.
  • conservative substitutions would include: Asp and Asn; Asp and Glu; Glu and Gin; Glu and Ala; Gly and Asn; Ala and Pro; Ala and Gly; Ala and Ser; Ala and Lys; Ser and Thr; Lys and Arg; Val and Leu; Leu and Ile; Ile and Val; Phe and Tyr. ⁇ Id).
  • amino acid substitutions In determining amino acid substitutions, one may also consider the existence of intermolecular or intramolecular bonds, such as formation of ionic bonds (salt bridges) between positively charged residues (e.g., His, Arg, Lys) and negatively charged residues (e.g., Asp, Glu) or disulfide bonds between nearby cysteine residues.
  • ionic bonds salt bridges
  • positively charged residues e.g., His, Arg, Lys
  • negatively charged residues e.g., Asp, Glu
  • disulfide bonds between nearby cysteine residues.
  • Bispecific or multispecific antibodies may be utilized in pre-targeting techniques.
  • Pre- targeting is a multistep process originally developed to resolve the slow blood clearance of directly targeting antibodies, which contributes to undesirable toxicity to normal tissues such as bone marrow.
  • a radionuclide or other therapeutic agent is attached to a small delivery molecule (targetable construct) that is cleared within minutes from the blood.
  • a pre-targeting bispecific or multispecific antibody, which has binding sites for the targetable construct as well as a target antigen, is administered first, free antibody is allowed to clear from circulation and then the targetable construct is administered.
  • a pre-targeting method of treating or diagnosing a disease or disorder in a subject may be provided by: (1) administering to the subject a bispecific antibody or antibody fragment; (2) optionally administering to the subject a clearing composition, and allowing the composition to clear the antibody from circulation; and (3) administering to the subject the targetable construct, containing one or more chelated or chemically bound therapeutic or diagnostic agents.
  • targetable construct peptides labeled with one or more therapeutic or diagnostic agents for use in pre-targeting may be selected to bind to a bispecific antibody with one or more binding sites for a targetable construct peptide and one or more binding sites for a target antigen associated with a disease or condition.
  • Bispecific antibodies may be used in a pretargeting technique wherein the antibody may be administered first to a subject. Sufficient time may be allowed for the bispecific antibody to bind to a target antigen and for unbound antibody to clear from circulation. Then a targetable construct, such as a labeled peptide, may be administered to the subject and allowed to bind to the bispecific antibody and localize at the diseased cell or tissue.
  • Such targetable constructs can be of diverse structure and are selected not only for the availability of an antibody or fragment that binds with high affinity to the targetable construct, but also for rapid in vivo clearance when used within the pre-targeting method and bispecific antibodies (bsAb) or multispecific antibodies.
  • Hydrophobic agents are best at eliciting strong immune responses, whereas hydrophilic agents are preferred for rapid in vivo clearance.
  • hydrophilic chelating agents to offset the inherent hydrophobicity of many organic moieties.
  • sub-units of the targetable construct may be chosen which have opposite solution properties, for example, peptides, which contain amino acids, some of which are hydrophobic and some of which are hydrophilic.
  • Peptides having as few as two amino acid residues, preferably two to ten residues, may be used and may also be coupled to other moieties, such as chelating agents.
  • the linker should be a low molecular weight conjugate, preferably having a molecular weight of less than 50,000 daltons, and advantageously less than about 20,000 daltons, 10,000 daltons or 5,000 daltons.
  • the targetable construct peptide will have four or more residues, such as the peptide DOTA-Phe-Lys(HSG)-Tyr-Lys(HSG)- H 2 (SEQ ID NO: 103), wherein DOTA is 1,4,7, 10-tetraazacyclododecanel, 4,7, 10-tetraacetic acid and HSG is the histamine succinyl glycyl group.
  • DOTA may be replaced by NOTA (1,4,7-triaza- cyclononane-l,4,7-triacetic acid), TETA ( -bromoacetamido-benzyl- tetraethylaminetetraacetic acid), NETA ([2-(4,7-biscarboxymethyl[l,4,7]triazacyclononan-l- yl-ethyl]-2-carbonylmethyl-amino]acetic acid), NODA (l,4,7-triazacylononane-l,4-diacetate) or other known chelating moieties.
  • Chelating moieties may be used, for example, to bind to a therapeutic and or diagnostic radionuclide, paramagnetic ion or contrast agent, such as Al-
  • the targetable construct may also comprise unnatural amino acids, e.g., D-amino acids, in the backbone structure to increase the stability of the peptide in vivo.
  • unnatural amino acids e.g., D-amino acids
  • other backbone structures such as those constructed from non-natural amino acids or peptoids may be used.
  • the peptides used as targetable constructs are conveniently synthesized on an automated peptide synthesizer using a solid-phase support and standard techniques of repetitive orthogonal deprotection and coupling. Free amino groups in the peptide, that are to be used later for conjugation of chelating moieties or other agents, are advantageously blocked with standard protecting groups such as a Boc group, while N-terminal residues may be acetylated to increase serum stability.
  • protecting groups are well known to the skilled artisan. See Greene and Wuts Protective Groups in Organic Synthesis, 1999 (John Wiley and Sons, N.Y.).
  • the peptides are prepared for later use within the bispecific antibody system, they are advantageously cleaved from the resins to generate the corresponding C- terminal amides, in order to inhibit in vivo carboxypeptidase activity.
  • Exemplary methods of peptide synthesis are disclosed in the Examples below.
  • the antibody will contain a first binding site for an antigen produced by or associated with a target tissue and a second binding site for a hapten on the targetable construct.
  • haptens include, but are not limited to, HSG and In-DTPA. Antibodies raised to the HSG hapten are known (e.g.
  • a therapeutic or diagnostic agent may be covalently attached to an antibody or antibody fragment to form an immunoconjugate.
  • the immunoconjugate is to be administered in concentrated form by subcutaneous, intramuscular or transdermal delivery, the skilled artisan will realize that only non-cytotoxic agents may be conjugated to the antibody.
  • a second antibody or fragment thereof is administered by a different route, such as intravenously, either before, simultaneously with or after the subcutaneous, intramuscular or transdermal delivery, then the type of diagnostic or therapeutic agent that may be conjugated to the second antibody or fragment thereof is not so limited, and may comprise any diagnostic or therapeutic agent known in the art, including cytotoxic agents.
  • a diagnostic and/or therapeutic agent may be attached to an antibody or fragment thereof via a carrier moiety.
  • Carrier moieties may be attached, for example to reduced SH groups and/or to carbohydrate side chains.
  • a carrier moiety can be attached at the hinge region of a reduced antibody component via disulfide bond formation.
  • such agents can be attached using a heterobifunctional cross-linker, such as N- succinyl 3-(2-pyridyldithio)propionate (SPDP). Yu et al, Int. J. Cancer 56: 244 (1994). General techniques for such conjugation are well-known in the art.
  • the carrier moiety can be conjugated via a carbohydrate moiety in the Fc region of the antibody.
  • the Fc region may be absent if the antibody component of the immunoconjugate is an antibody fragment. However, it is possible to introduce a carbohydrate moiety into the light chain variable region of a full length antibody or antibody fragment. See, for example, Leung et al, J. Immunol. 154: 5919 (1995); U.S. Patent Nos. 5,443,953 and 6,254,868, the
  • the engineered carbohydrate moiety is used to attach the therapeutic or diagnostic agent.
  • click chemistry reaction An alternative method for attaching carrier moieties to a targeting molecule involves use of click chemistry reactions.
  • the click chemistry approach was originally conceived as a method to rapidly generate complex substances by joining small subunits together in a modular fashion.
  • Various forms of click chemistry reaction are known in the art, such as the Huisgen 1,3-dipolar cycloaddition copper catalyzed reaction (Tornoe et al., 2002, J Organic Chem 67:3057-64), which is often referred to as the "click reaction.”
  • Other alternatives include cycloaddition reactions such as the Diels- Alder, nucleophilic substitution reactions (especially to small strained rings like epoxy and aziridine compounds), carbonyl chemistry formation of urea compounds and reactions involving carbon-carbon double bonds, such as alkynes in thiol
  • the azide alkyne Huisgen cycloaddition reaction uses a copper catalyst in the presence of a reducing agent to catalyze the reaction of a terminal alkyne group attached to a first molecule.
  • a second molecule comprising an azide moiety
  • the azide reacts with the activated alkyne to form a 1,4-disubstituted 1,2,3-triazole.
  • the copper catalyzed reaction occurs at room temperature and is sufficiently specific that purification of the reaction product is often not required.
  • a copper-free click reaction has been proposed for covalent modification of biomolecules.
  • the copper- free reaction uses ring strain in place of the copper catalyst to promote a [3 + 2] azide-alkyne cycloaddition reaction ⁇ Id.).
  • cyclooctyne is an 8-carbon ring structure comprising an internal alkyne bond.
  • the closed ring structure induces a substantial bond angle deformation of the acetylene, which is highly reactive with azide groups to form a triazole.
  • cyclooctyne derivatives may be used for copper-free click reactions ⁇ Id.).
  • Agard et al. (2004, J Am Chem Soc 126: 15046-47) demonstrated that a recombinant glycoprotein expressed in CHO cells in the presence of peracetylated N- azidoacetylmannosamine resulted in the bioincorporation of the corresponding N-azidoacetyl sialic acid in the carbohydrates of the glycoprotein.
  • the azido-derivatized glycoprotein reacted specifically with a biotinylated cyclooctyne to form a biotinylated glycoprotein, while control glycoprotein without the azido moiety remained unlabeled ⁇ Id.).
  • TCO-labeled CC49 antibody was administered to mice bearing colon cancer xenografts, followed 1 day later by injection of lu In-labeled tetrazine probe ⁇ Id).
  • the landscaped antibodies were subsequently reacted with agents comprising a ketone-reactive moiety, such as hydrazide, hydrazine, hydroxylamino or thiosemicarbazide groups, to form a labeled targeting molecule.
  • agents attached to the landscaped antibodies included chelating agents like DTP A, large drug molecules such as doxorubicin-dextran, and acyl-hydrazide containing peptides.
  • the landscaping technique is not limited to producing antibodies comprising ketone moieties, but may be used instead to introduce a click chemistry reactive group, such as a nitrone, an azide or a cyclooctyne, onto an antibody or other biological molecule.
  • Reactive targeting molecule may be formed either by either chemical conjugation or by biological incorporation.
  • the targeting molecule such as an antibody or antibody fragment, may be activated with an azido moiety, a substituted cyclooctyne or alkyne group, or a nitrone moiety.
  • the targeting molecule comprises an azido or nitrone group
  • the corresponding targetable construct will comprise a substituted cyclooctyne or alkyne group, and vice versa.
  • Such activated molecules may be made by metabolic incorporation in living cells, as discussed above.
  • the antibodies or fragments thereof may be used in combination with one or more therapeutic and/or diagnostic agents.
  • the agent is attached to an antibody or fragment thereof to be administered by subcutaneous, intramuscular or transdermal administration, then only non-cytotoxic agents are contemplated.
  • Non-cytotoxic agents may include, without limitation, immunomodulators, cytokines (and their inhibitors), chemokines (and their inhibitors), tyrosine kinase inhibitors, growth factors, hormones and certain enzymes (i.e., those that do not induce local necrosis), or their inhibitors.
  • cytotoxic agents may be utilized.
  • An agent may be administered as an immunoconjugate with a second antibody or fragment thereof, or may be administered as a free agent. The following discussion applies to both cytotoxic and non- cytotoxic agents.
  • Therapeutic agents may be selected from the group consisting of a radionuclide, an immunomodulator, an anti-angiogenic agent, a cytokine, a chemokine, a growth factor, a hormone, a drug, a prodrug, an enzyme, an oligonucleotide, a pro-apoptotic agent, an interference RNA, a photoactive therapeutic agent, a tyrosine kinase inhibitor, a Bruton kinase inhibitor, a sphingosine inhibitor, a cytotoxic agent, which may be a chemotherapeutic agent or a toxin, and a combination thereof.
  • the drugs of use may possess a pharmaceutical property selected from the group consisting of antimitotic, antikinase, alkylating, antimetabolite, antibiotic, alkaloid, anti-angiogenic, pro-apoptotic agents, and combinations thereof.
  • Exemplary drugs may include, but are not limited to, 5-fluorouracil, aplidin, azaribine, anastrozole, anthracyclines, bendamustine, bleomycin, bortezomib, biyostatin-1, busulfan, calicheamycin, camptothecin, carboplatin, 10-hydroxycamptothecin, carmustine, celecoxib, chlorambucil, cisplatinum, Cox-2 inhibitors, irinotecan (CPT-11), SN-38, carboplatin, cladribine, camptothecans, cyclophosphamide, cytarabine, dacarbazine, docetaxel, dactinomycin, daunorubicin, doxorubicin, 2-pyrrolinodoxorubicine (2P-DOX), pro-2P-DOX, cyano-morpholino doxorubicin, doxorubicin glucuron
  • gemcitabine hydroxyurea, idarubicin, ifosfamide, L-asparaginase, lenolidamide, leucovorin, lomustine, mechlorethamine, melphalan, mercaptopurine, 6-mercaptopurine, methotrexate, mitoxantrone, mithramycin, mitomycin, mitotane, navelbine, nitrosourea, plicomycin, procarbazine, paclitaxel, pentostatin, PSI-341, raloxifene, semustine, streptozocin, tamoxifen, paclitaxel, temazolomide (an aqueous form of DTIC), transplatinum, thalidomide, thioguanine, thiotepa, teniposide, topotecan, uracil mustard, vinorelbine, vinblastine, vincristine and vinca alkaloids.
  • Toxins may include ricin, abrin, alpha toxin, saporin, ribonuclease (RNase), e.g., onconase, DNase I, Staphylococcal enterotoxin-A, pokeweed antiviral protein, gelonin, diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin.
  • RNase ribonuclease
  • Immunomodulators may be selected from a cytokine, a stem cell growth factor, a lymphotoxin, a hematopoietic factor, a colony stimulating factor (CSF), an interferon (IFN), erythropoietin, thrombopoietin and a combination thereof. Specifically useful are
  • lymphotoxins such as tumor necrosis factor (TNF), hematopoietic factors, such as interleukin (IL), colony stimulating factor, such as granulocyte-colony stimulating factor (G-CSF) or granulocyte macrophage-colony stimulating factor (GM-CSF), interferon, such as interferons-a, - ⁇ , - ⁇ or - ⁇ , and stem cell growth factor, such as that designated "SI factor”.
  • growth hormones such as human growth hormone, N- methionyl human growth hormone, and bovine growth hormone; parathyroid hormone;
  • thyroxine insulin; proinsulin; relaxin; prorelaxin; glycoprotein hormones such as follicle stimulating hormone (FSH), thyroid stimulating hormone (TSH), and luteinizing hormone (LH); hepatic growth factor; prostaglandin, fibroblast growth factor; prolactin; placental lactogen, OB protein; tumor necrosis factor-a and - B; mullerian-inhibiting substance; mouse gonadotropin-associated peptide; inhibin; activin; vascular endothelial growth factor;
  • FSH follicle stimulating hormone
  • TSH thyroid stimulating hormone
  • LH luteinizing hormone
  • thrombopoietin TPO
  • nerve growth factors such as NGF-B; platelet-growth factor; transforming growth factors (TGFs) such as TGF- a and TGF- B; insulin-like growth factor-I and -II; erythropoietin (EPO); osteoinductive factors; interferons such as interferon-a, - ⁇ , - ⁇ and - ⁇ ; colony stimulating factors (CSFs) such as macrophage-CSF (M-CSF); interleukins (ILs) such as IL-1, IL-la, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12; IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-21, IL-23, IL-25, LIF, kit-ligand or FLT-3, angiostatin, thrombospond
  • Chemokines of use include RANTES, MCAF, MlPl-alpha, MIPl-Beta and IP-10.
  • Radioactive isotopes include, but are not limited to- 11 ⁇ , 177 Lu, 212 Bi, 213 Bi, 211 At, 62 Cu, 67 Cu, 90 Y, 125 I, 131 1, 32 P, 33 P, 47 Sc, lu Ag, 67 Ga, 142 Pr, 153 Sm, 161 Tb, 166 Dy, 166 Ho, 186 Re, 188 Re, 189 Re, 212 Pb, 223 Ra, 225 Ac, 227 Th, 59 Fe, 75 Se, 77 As, 89 Sr, 99 Mo, 105 Rh, 109 Pd, 143 Pr, 149 Pm, 169 Er, 194 Ir, 198 Au, 199 Au, and 211 Pb.
  • the therapeutic radionuclide preferably has a decay-energy in the range of 20 to 6,000 keV, preferably in the ranges 60 to 200 keV for an Auger emitter, 100-2,500 keV for a beta emitter, and 4,000-6,000 keV for an alpha emitter.
  • Maximum decay energies of useful beta-particle-emitting nuclides are preferably 20- 5,000 keV, more preferably 100-4,000 keV, and most preferably 500-2,500 keV. Also preferred are radionuclides that substantially decay with Auger-emitting particles.
  • beta-particle-emitting nuclides are preferably ⁇ 1,000 keV, more preferably ⁇ 100 keV, and most preferably ⁇ 70 keV. Also preferred are radionuclides that substantially decay with generation of alpha-particles.
  • Such radionuclides include, but are not limited to: Dy-152, At-211, Bi-212, Ra-223, Rn-219, Po-215, Bi-211, Ac-225, Fr-221, At-217, Bi-213, Th-227 and Fm-255. Decay energies of useful alpha- particle-emitting radionuclides are preferably 2,000-10,000 keV, more preferably 3,000- 8,000 keV, and most preferably 4,000-7,000 keV.
  • Additional potential radioisotopes of use include U C, 13 N, 15 0, 75 Br, 198 Au, 224 Ac, 126 I, 133 I, 77 Br, 113m In, 95 Ru, 97 Ru, 103 Ru, 105 Ru, 107 Hg, 203 Hg, 121m Te, 122m Te, 125m Te, 165 Tm, 167 Tm, 168 Tm, 197 Pt, 109 Pd, 105 Rh, 142 Pr, 143 Pr, 161 Tb, 166 Ho, 199 Au, 57 Co, 58 Co, 51 Cr, 59 Fe, 75 Se, 201 T1, 225 Ac, 227 Th, 76 Br, 169 Yb, and the like.
  • tyrosine kinase inhibitors include, but are not limited to canertinib, dasatinib, erlotinib, gefitinib, imatinib, lapatinib, leflunomide, nilotinib, pazopanib, semaxinib, sorafenib, sunitinib, sutent and vatalanib.
  • a specific class of tyrosine kinase inhibitor is the Bruton tyrosine kinase inhibitor.
  • Bruton tyrosine kinase (Btk) has a well- defined role in B-cell development.
  • Bruton kinase inhibitors include, but are not limited to, PCI- 32765 (ibrutinib), PCI-45292, GDC-0834, LFM-A13 and RN486.
  • Therapeutic agents may include a photoactive agent or dye.
  • Fluorescent compositions such as fluorochrome, and other chromogens, or dyes, such as porphyrins sensitive to visible light, have been used to detect and to treat lesions by directing the suitable light to the lesion. In therapy, this has been termed photoradiation, phototherapy, or photodynamic therapy. See Jori et al. (eds ), PHOTODYNAMIC THERAPY OF TUMORS AND OTHER DISEASES (Libreria Progetto 1985); van den Bergh, Chem. Britain (1986), 22:430. Moreover, monoclonal antibodies have been coupled with photoactivated dyes for achieving
  • Corticosteroid hormones can increase the effectiveness of other chemotherapy agents, and consequently, they are frequently used in combination treatments.
  • Prednisone and dexamethasone are examples of corticosteroid hormones. .
  • anti-angiogenic agents such as angiostatin, baculostatin, canstatin, maspin, anti-placenta growth factor (P1GF) peptides and antibodies, anti-vascular growth factor antibodies (such as anti-VEGF and anti-PlGF), anti-Flk-1 antibodies, anti-Flt-1 antibodies and peptides, anti-Kras antibodies, anti-cMET antibodies, anti-MIF (macrophage migration-inhibitory factor) antibodies, laminin peptides, fibronectin peptides, plasminogen activator inhibitors, tissue metalloproteinase inhibitors, interferons, interleukin-12, IP-10, Gro- ⁇ , thrombospondin, 2-methoxyoestradiol, proliferin-related protein,
  • carboxiamidotriazole CM101, Marimastat, pentosan poly sulphate, angiopoietin-2, interferon-alpha, interferon-lambda, herbimycin A, PNU145156E, 16K prolactin fragment, Linomide, thalidomide, pentoxifylline, genistein, TNP-470, endostatin, paclitaxel, accutin, angiostatin, cidofovir, vincristine, bleomycin, AGM-1470, platelet factor 4 or minocycline may be of use.
  • the therapeutic agent may comprise an oligonucleotide, such as a siRNA.
  • a siRNA an oligonucleotide
  • the skilled artisan will realize that any siRNA or interference RNA species may be attached to an antibody or fragment thereof for delivery to a targeted tissue. Many siRNA species against a wide variety of targets are known in the art, and any such known siRNA may be utilized in the claimed methods and compositions.
  • siRNA species of potential use include those specific for IKK-gamma (U.S. Patent 7,022,828); VEGF, Flt-1 and Flk-l/KDR (U.S. Patent 7, 148,342); Bcl2 and EGFR (U.S. Patent 7,541,453); CDC20 (U.S. Patent 7,550,572); transducin (beta)-like 3 (U.S. Patent 7,576, 196); KRAS (U.S. Patent 7,576,197); carbonic anhydrase II (U.S. Patent 7,579,457); complement component 3 (U.S.
  • Patent 7,582,746 interleukin-1 receptor-associated kinase 4 (IRAK4) (U.S. Patent 7,592,443); survivin (U.S. Patent 7,608,7070); superoxide dismutase 1 (U.S. Patent 7,632,938); MET proto-oncogene (U.S. Patent
  • amyloid beta precursor protein U.S. Patent 7,635,771
  • IGF-1R U.S. Patent 7,638,621
  • ICAM1 U.S. Patent 7,642,349
  • complement factor B U.S. Patent 7,696,344
  • p53 7,781,575)
  • apolipoprotein B 7,795,421
  • siRNA species are available from known commercial sources, such as Sigma-Aldrich (St Louis, MO), Invitrogen (Carlsbad, CA), Santa Cruz Biotechnology (Santa Cruz, CA), Ambion (Austin, TX), Dharmacon (Thermo Scientific, Lafayette, CO), Promega (Madison, WI), Minis Bio (Madison, WI) and Qiagen (Valencia, CA), among many others.
  • Other publicly available sources of siRNA species include the siRNAdb database at the Swedish Bioinformatics Centre, the MIT/ICBP siRNA Database, the RNAi Consortium shRNA Library at the Broad Institute, and the Probe database at NCBI.
  • siRNA species there are 30,852 siRNA species in the NCBI Probe database.
  • the skilled artisan will realize that for any gene of interest, either a siRNA species has already been designed, or one may readily be designed using publicly available software tools. Any such siRNA species may be delivered using the subject DNL complexes.
  • siRNA species known in the art are listed in Table 6. Although siRNA is delivered as a double-stranded molecule, for simplicity only the sense strand sequences are shown in Table 6.
  • Apolipoprotein E AAGGTGGAGCAAGCGGTGGAG SEQIDNO:115
  • Apolipoprotein E AAGGAGTTGAAGGCCGACAAA SEQIDNO:116
  • IGFBP3 AAUCAUCAUCAAGAAAGGGCA SEQIDNO:120
  • CEACAM1 AACCTTCTGGAACCCGCCCAC SEQIDNO:129
  • Table 6 represents a very small sampling of the total number of siRNA species known in the art, and that any such known siRNA may be utilized in the claimed methods and compositions.
  • Diagnostic agents are preferably selected from the group consisting of a radionuclide, a radiological contrast agent, a paramagnetic ion, a metal, a fluorescent label, a
  • diagnostic agents may include a radionuclide such as F, Fe, In, m In, 177 Lu, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 90 Y, 89 Zr, 94m Tc, 94 Tc, 99m Tc, 120 I, 123 I, 124 I, 125 I, 131 I, 154"158 Gd, 32 P, U C, 13 N, 15 0, 186 Re, 188 Re, 51 Mn, 52m Mn, 55 Co, 72 As, 75 Br, 76 Br, 82m Rb, 83 Sr, or other gamma-, beta-, or positron-emitters.
  • a radionuclide such as F, Fe, In, m In, 177 Lu, 52 Fe, 62 Cu, 64 Cu, 67 Cu, 67 Ga, 68 Ga, 86 Y, 90 Y, 89 Zr, 94m Tc, 94 Tc, 99m Tc, 120
  • Paramagnetic ions of use may include chromium (III), manganese (II), iron (III), iron (II), cobalt (II), nickel (II), copper (II), neodymium (III), samarium (III), ytterbium (III), gadolinium (III), vanadium (II), terbium (III), dysprosium (III), holmium (III) or erbium (III).
  • Metal contrast agents may include lanthanum (III), gold (III), lead (II) or bismuth (III).
  • Ultrasound contrast agents may comprise liposomes, such as gas filled liposomes.
  • Radiopaque diagnostic agents may be selected from compounds, barium compounds, gallium compounds, and thallium compounds.
  • a wide variety of fluorescent labels are known in the art, including but not limited to fluorescein isothiocyanate, rhodamine, phycoerytherin, phycocyanin, allophycocyanin, o-phthaldehyde and fluorescamine.
  • Chemiluminescent labels of use may include luminol, isoluminol, an aromatic acridinium ester, an imidazole, an acridinium salt or an oxalate ester.
  • compositions that include one or more pharmaceutically suitable excipients, surfactants, polyols, buffers, salts, amino acids, or additional ingredients, or some combination of these.
  • active ingredients i.e., the labeled molecules
  • pharmaceutically suitable excipients Sterile phosphate-buffered saline is one example of a pharmaceutically suitable excipient.
  • Other suitable excipients are well known to those in the art.
  • compositions described herein are parenteral injection, more preferably by subcutaneous, intramuscular or transdermal delivery.
  • parenteral administration include intravenous, intraarterial, intralymphatic, intrathecal, intraocular, intracerebral, or intracavitary injection.
  • the compositions will be formulated in a unit dosage injectable form such as a solution, suspension or emulsion, in association with a pharmaceutically acceptable excipient.
  • excipients are inherently nontoxic and nontherapeutic. Examples of such excipients are saline, Ringer's solution, dextrose solution and Hanks' solution.
  • Nonaqueous excipients such as fixed oils and ethyl oleate may also be used.
  • An alternative excipient is 5% dextrose in saline.
  • the excipient may contain minor amounts of additives such as substances that enhance isotonicity and chemical stability, including buffers and preservatives.
  • compositions comprising antibodies can be used for subcutaneous, intramuscular or transdermal administration.
  • Compositions can be presented in unit dosage form, e.g., in ampoules or in multi-dose containers, with an added preservative.
  • Compositions can also take such forms as suspensions, solutions or emulsions in oily or aqueous vehicles, and can contain formulatory agents such as suspending, stabilizing and/or dispersing agents.
  • the compositions can be in powder form for constitution with a suitable vehicle, e.g., sterile pyrogen-free water, before use.
  • compositions may be administered in solution.
  • the formulation thereof should be in a solution having a suitable pharmaceutically acceptable buffer such as phosphate, TRIS (hydroxymethyl) aminomethane-HCl or citrate and the like. Buffer concentrations should be in the range of 1 to 100 mM.
  • the formulated solution may also contain a salt, such as sodium chloride or potassium chloride in a concentration of 50 to 150 mM.
  • An effective amount of a stabilizing agent such as mannitol, trehalose, sorbitol, glycerol, albumin, a globulin, a detergent, a gelatin, a protamine or a salt of protamine may also be included.
  • the dosage of an administered antibody for humans will vary depending upon such factors as the patient's age, weight, height, sex, general medical condition and previous medical history. Typically, it is desirable to provide the recipient with a dosage of antibody that is in the range of from about 1 mg to 600 mg as a single infusion or single or multiple injections, although a lower or higher dosage also may be administered. Typically, it is desirable to provide the recipient with a dosage that is in the range of from about 50 mg per square meter (m 2 ) of body surface area or 70 to 85 mg of the antibody for the typical adult, although a lower or higher dosage also may be administered.
  • Examples of dosages of antibodies that may be administered to a human subject are 1 to 1,000 mg, more preferably 1 to 70 mg, most preferably 1 to 20 mg, although higher or lower doses may be used. Dosages may be repeated as needed, for example, once per week for 4-10 weeks, preferably once per week for 8 weeks, and more preferably, once per week for 4 weeks. It may also be given less frequently, such as every other week for several months, or more frequently, such as twice weekly or by continuous infusion.
  • the antibody may be administered by transdermal delivery.
  • transdermal delivery may utilize a delivery device such as the 3M hollow Microstructured Transdermal System (hMTS) for antibody based therapeutics.
  • the hMTS device comprises a 1 cm 2 microneedle array consisting of 18 hollow microneedles that are 950 microns in length, which penetrate approximately 600-700 microns into the dermal layer of the skin where there is a high density of lymphatic channels.
  • a spring-loaded device forces the antibody composition from a fluid reservoir through the microneedles for delivery to the subject. Only transient erythema and edema at the injection site are observed (Burton et al., 201 1, Pharm Res 28:31-40). The hMTS device is not perceived as a needle injector, resulting in improved patient compliance.
  • transdermal delivery of peptides and proteins may be achieved by (1) coadministering with a synthetic peptide comprising the amino acid sequence of ACSSSPSKHCG (SEQ ID NO: 136) as reported by Chen et al. (Nat Biotechnol 2006;24: 455-460) and Carmichael et al. (Pain 2010; 149:316-324); (2) coadministering with arginine- rich intracellular delivery peptides as reported by Wang et al. (BBRC 2006;346: 758-767); (3) coadminstering with either AT1002 (FCIGRLCG, SEQ ID NO: 137) or Tat
  • GRKKRRNRRRCG SEQ ID NO: 138
  • Uchida et al. Chem Pharm Bull 201 1 ;59: 196
  • (4) using an adhesive transdermal patch as reported by Jurynczyk et al (Ann Neurol 2010;68:593-601).
  • transdermal delivery of negatively charged drugs may be facilitated by combining with the positively charged, pore-forming magainin peptide as reported by Kim et al. (Int J Pharm 2008;362:20-28).
  • the volume of administration is preferably limited to 3 ml or less, more preferably 2 ml or less, more preferably 1 ml or less.
  • concentrated antibody formulations allowing low volume subcutaneous, intramuscular or transdermal administration is preferred to the use of more dilute antibody formulations that require specialized devices and ingredients (e.g., hyaluronidase) for subcutaneous administration of larger volumes of fluid, such as 10 ml or more.
  • the subcutaneous, intramuscular or transdermal delivery may be administered as a single administration to one skin site or alternatively may be repeated one or more times, or even given to more than one skin site in one therapeutic dosing session.
  • the more concentrated the formulation the lower the volume injected and the fewer injections will be needed for each therapeutic dosing.
  • the anti-CD74/CD20 antibodies or fragments thereof are of use for therapy of B-cell malignancies, such as NHL.
  • cancers include, but are not limited to, lymphoma, leukemia and lymphoid malignancies.
  • the antibodies or fragments thereof are of use to treat hematopoietic cancers.
  • the term "cancer" includes primary malignant cells or tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original malignancy or tumor) and secondary malignant cells or tumors (e.g., those arising from metastasis, the migration of malignant cells or tumor cells to secondary sites that are different from the site of the original tumor).
  • cancers or malignancies include, but are not limited to: acute childhood lymphoblastic leukemia, acute lymphoblastic leukemia, acute lymphocytic leukemia, acute myeloid leukemia, adult acute lymphocytic leukemia, adult acute myeloid leukemia, adult Hodgkin's disease, adult Hodgkin's lymphoma, adult lymphocytic leukemia, adult non-Hodgkin's lymphoma, AIDS-related lymphoma, AIDS-related malignancies, central nervous system (primary) lymphoma, central nervous system lymphoma, childhood acute lymphoblastic leukemia, childhood acute myeloid leukemia, childhood Hodgkin's disease, childhood Hodgkin's lymphoma, childhood lymphoblastic leukemia, childhood non- Hodgkin's lymphoma, chronic lymphocytic leukemia, chronic myelogenous leukemia, cutaneous T-cell lymphoma, hairy
  • the methods and compositions described and claimed herein may be used to detect or treat malignant or premalignant conditions. Such uses are indicated in conditions known or suspected of preceding progression to neoplasia or cancer, in particular, where non-neoplastic cell growth consisting of hyperplasia, metaplasia, or most particularly, dysplasia has occurred (for review of such abnormal growth conditions, see Robbins and Angell, Basic Pathology, 2d Ed., W. B. Saunders Co., Philadelphia, pp. 68-79 (1976)).
  • Additional hyperproliferative diseases, disorders, and/or conditions include, but are not limited to, progression, and/or metastases of malignancies and related disorders such as leukemia (including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promyelocytic, myelomonocytic, monocytic, and erythroleukemia) and chronic leukemias (e.g., chronic myelocytic (granulocytic) leukemia and chronic lymphocytic leukemia)), polycythemia vera, lymphomas (e.g., Hodgkin's disease and non-Hodgkin's disease), multiple myeloma, and Waldenstrom's macroglobulinemia.
  • leukemia including acute leukemias (e.g., acute lymphocytic leukemia, acute myelocytic leukemia (including myeloblastic, promye
  • Exemplary autoimmune diseases include acute idiopathic thrombocytopenic purpura, chronic immune thrombocytopenia, dermatomyositis, Sydenham's chorea, myasthenia gravis, systemic lupus erythematosus, lupus nephritis, rheumatic fever, polyglandular syndromes, bullous pemphigoid, pemphigus vulgaris, juvenile diabetes mellitus, Henoch-Schonlein purpura, post-streptococcal nephritis, erythema nodosum, Takayasu's arteritis, ANCA- associated vasculitides, Addison's disease, rheumatoid arthritis, multiple sclerosis, sarcoidosis, ulcerative colitis, erythema multiforme, IgA nephropathy, polyarteritis nodosa, ankylosing spond
  • kits containing components suitable for treating diseased tissue in a patient.
  • Exemplary kits may contain at least one anti-CD20 antibody or fragment thereof and at least one anti-CD74 antibody or fragment thereof, as described herein.
  • a device capable of delivering the kit components by injection for example, a syringe for subcutaneous injection, may be included.
  • a delivery device such as hollow microneedle delivery device may be included in the kit.
  • Exemplary transdermal delivery devices are known in the art, such as 3M's hollow
  • hMTS Microstructured Transdermal System
  • the kit components may be packaged together or separated into two or more containers.
  • the containers may be vials that contain sterile, lyophilized formulations of a composition that are suitable for reconstitution.
  • a kit may also contain one or more buffers suitable for reconstitution and/or dilution of other reagents.
  • the antibody or fragment may be delivered and stored as a liquid formulation.
  • Other containers that may be used include, but are not limited to, a pouch, tray, box, tube, or the like. Kit components may be packaged and maintained sterilely within the containers. Another component that can be included is instructions to a person using a kit for its use.
  • Example 1 Combination therapy of relapsed/refractory NHL with anti-CD74 and anti-CD20 antibodies
  • milatuzumab at the same doses as during induction on days 1 and 4 of weeks 12, 20, 28, and 36.
  • Dose limiting toxicity (DLT) was defined during weeks 1-4. Although not defined as a DLT, 3 of the first 6 patients enrolled at dose levels 1-2, had grade 3 infusion reactions with milatuzumab. The study was amended to drop milatuzumab dosing on day 1 of weeks 2-4, 12, 20, 28, and 36 and to add 20 mg dexamethasone immediately prior to and 10 mg post each dose of milatuzumab. Enrollment resumed with 3 additional patients at dose levels 1 and 2. Dose escalation reached dose level 3 and was followed by a phase II study which enrolled a total of 17 patients.
  • DLT Dose limiting toxicity
  • results A total of 35 patients enrolled on the study with follicular lymphoma (46%), diffuse large B-cell lymphoma (23%), mantle cell lymphoma (17%), lymphoplasmacytic lymphoma (9%), and marginal zone lymphoma (6%). Median age was 63 (range 39-82), median number of prior therapies was 3 (range 1-10), and 63% of patients were rituximab refractory. No dose limiting toxicities were observed in the phase I study. Related grade 3-4 toxicities included lymphopenia (31%), leukopenia (9%), neutropenia (1 1%)), anemia (3%), infusion reactions (14%), hyperglycemia (6%), fatigue (3%), and atrial tachycardia (3%).
  • Milatuzumab is a humanized anti-CD74 monoclonal antibody which has shown activity against several NHL cell lines in vitro.
  • CD74 is a transmembrane protein which associates with MCH class II a and ⁇ chains and is expressed on normal monocytes, macrophages, dendritic cells, and malignant B-cells, including 90% of B-cell NHL, chronic lymphocytic leukemia, and multiple myeloma specimens (Stein et al., 2007, Clin Cancer Res 13 :5556s-63s).
  • CD74 serves as a chaperone for MHC class II molecules, functions in B-cell survival pathways, and activates syk, phophatidylinositol 3 -kinase, AKT, and nuclear factor (NF)-KB with resultant transcription of anti-apoptotic genes including bcl- xl (Stein et al., 2007, Clin Cancer Res 13 : 5556s-63s).
  • milatuzumab appears to selectively target malignant B-cells, with minimal impact on the viability of normal NEC, T, dendritic, or B-cells (Chen et al., 2009, ASH Annual Meeting Abstracts, 114:2744 (Abstr); Hertlein et al., 2009, ASH Annual Meeting Abstracts, 114:721 (Abstr).
  • Veltuzumab is a fully humanized anti-CD20 antibody. Elimination of the murine components of the antibody was postulated to favorably alter pharmacokinetics and toxicity profiles through the reduction of human anti-chimeric antibody responses and an increase in the serum Tl/2 to permit extended dosing intervals, limit infusion reactions, allow use of smaller doses, and ultimately improve efficacy (Stein et al., 2004, Clin Cancer Res 10:2868- 78). In vitro, veltuzumab appears similar to rituximab with similar antigen-binding specificity, binding avidity, and dissociation.
  • veltuzumab Induction of apoptosis, ADCC, and complement mediated cytotoxicity (CDC) appear similar between veltuzumab and rituximab (Stein et al., 2004, Clin Cancer Res 10:2868-78). However, in vivo in 3 different NHL SCID mouse models, veltuzumab significantly improves survival compared to rituximab with repetitive dosing (Goldenberg et al., 2009, Blood 113 : 1062-70).
  • This improved efficacy may be due in part to a single amino acid change in the complementarity determining region, CDR3-VH, of veltuzumab compared to rituximab that contributes to a lower off-rate of veltuzumab in preclinical models (Goldenberg et al., 2009, Blood 113 : 1062-70).
  • CDR3-VH complementarity determining region
  • the fully humanized anti-CD20 antibody veltuzumab was utilized instead of rituximab due to the lower potential risk of infusion reactions with the humanized antibody, greater single efficacy with veltuzumab compared to rituximab in a NHL SCID mouse model (Goldenberg et al., 2009, Blood 113 : 1062-70), and encouraging clinical efficacy with single agent veltuzumab in patients with a variety of NHL subtypes who have previously received rituximab (Morschhauser et al., J Clin Oncol 27:3346-53; Alinari et al., 2011, Blood 118:6893-903), as most enrolling patients were anticipated to be heavily pretreated with rituximab.
  • dual monoclonal antibody therapy include favorable toxicity profiles which permit frequent dosing and maintenance treatment, particularly in heavily pre-treated or older patients; potentially increased efficacy when compared to single agent regimens; and the ability to overcome resistance mechanisms that develop in the setting of single agent therapy.
  • lymphoplasmacytic lymphoma follicular lymphoma, diffuse large B-cell lymphoma, transformed lymphoma, and mantle cell lymphoma by the World Health Organization criteria.
  • Patients were required to have relapsed or refractory disease after at least one prior therapy.
  • Prior rituximab was permitted under the following conditions: patients who were rituximab-refractory, defined as having less than a partial response to the previous rituximab- containing regimen were eligible at any time, and patients who were rituximab-sensitive, defined as having a complete response or partial response to the last rituximab-containing regimen, were eligible at least three months after the last infusion of rituximab.
  • Additional inclusion criteria were age >18 years, Eastern Cooperative Oncology Group (ECOG) performance status ⁇ 2, an absolute neutrophil count > 1000/uL, platelets > 75,000/uL, total bilirubin ⁇ 2.0 times the institutional upper limit of normal, AST(SGOT)/ALT(SGPT) ⁇ 2.5 times the institutional upper limit of normal, and creatinine ⁇ 2.0 mg/dL.
  • Patients who had relapsed after stem cell transplant were eligible for this trial.
  • Patients with diffuse large B-cell lymphoma were eligible provided they had undergone or were not candidates for autologous stem cell transplant.
  • Exclusion criteria included HIV infection, hepatitis B, central nervous system involvement with lymphoma, a history of human anti-globulin antibodies, active secondary malignancies, and pregnant or nursing women.
  • Study Design The phase I study was conducted utilizing a standard cohorts of 3 dose escalation schema with three to six patients treated at each dose level to determine the dose limiting toxicity (DLT) and maximum tolerated dose (MTD) of the combination.
  • the MTD was defined as that dose beneath the dose at which 2 or more of 6 patients experienced DLT.
  • a phase II study designed to determine the overall response rate for the combination followed the phase I study at the recommended phase II dose.
  • veltuzumab received veltuzumab at 200 mg/m 2 weekly combined with escalating doses of milatuzumab at 8, 16, and 20 mg/kg for four weeks of induction therapy.
  • week 1 of induction therapy patients received veltuzumab alone on day 1 and milatuzumab alone on day 2 to prevent overlapping infusion reactions.
  • veltuzumab was given first on day 1 followed by milatuzumab on days 1 and 4.
  • Patients without progressive disease or unacceptable toxicity following induction therapy were eligible to receive extended induction, which consisted of veltuzumab on day 1 and milatuzumab on days 1 and 4 of weeks 12, 20, 28, and 36.
  • Dose limiting toxicity was defined as any of the following: treatment delays > 14 days, any grade 3-4 non- hematologic toxicity with the exception of infusion reactions, grade 4 febrile neutropenia, grade 3 febrile neutropenia or infection with fever or infection that failed to resolve within 7 days, and grade 4 neutropenia or thrombocytopenia persisting > 7 days.
  • Toxicity and Response - Toxicity were graded according to NCI Common Toxicity Criteria for Adverse Events v. 3.0 and classified as either unrelated, unlikely, possibly, probably, or definitely related to study treatment. Response was assessed by CT scans during weeks 5, 10, 24, 40 and then every 4 months until disease progression or for a maximum 2 years. Combined PET/CT was performed at weeks 5 and 40. Patients removed from study for unacceptable adverse events were followed until resolution of any treatment-related abnormalities or changes that warranted additional follow-up.
  • PK Pharmacokinetics
  • veltuzumab PK Blood samples for veltuzumab PK were collected at the following time points: pre- and post-infusion on day 1 of weeks 1, 2, 4, 12 and 36. One additional veltuzumab blood sample was also collected each of weeks 5 through 10 (post 4 th infusion). Blood samples for milatuzumab PK were collected at the following time points: pre- and post-infusion on day 2 of week 1 and day 1 of weeks 2, 4, 12 and 36. Additional samples were collected days 3 through 6 of week 1 (post 1 st infusion). Serum veltuzumab and milatuzumab levels were determined by using enzyme-linked immunosorbent assay (ELISA) performed by the Study Sponsor.
  • ELISA enzyme-linked immunosorbent assay
  • Concentration-time data were analyzed using WinNonlin 6.3 (Pharsight, Mountain View, CA).
  • Standard non-compartmental analyses (NCA) were performed with concentration-time data from the 1 st infusion of milatuzumab (20 mg/kg cohort) and 4 th dose of veltuzumab. NCA was unable to be performed for the 8 mg/kg and 16 mg/kg milatuzumab cohorts due to sparse data points in the terminal phase.
  • Veltuzumab data was also analyzed using one-compartment PK model.
  • HAHA human anti- veltuzumab antibodies and human anti-milatuzumab antibodies
  • phase I dose escalation study was to determine the DLT, MTD, and toxicity profile of the combination of veltuzumab and milatuzumab in relapsed and refractory NHL.
  • the phase I study was followed by a phase II study at the recommended phase II dose.
  • the primary endpoint for the phase II study was overall objective response rate, defined as the proportion of patients demonstrating a complete or partial response to treatment per International response criteria (Cheson et al., 2007, J Clin Oncol 25:579-86; Kimby et al., 2006, Clin Lymphoma Myeloma 6:380-83).
  • PFS Progression free survival
  • OS Overall survival
  • Atrial Tachycardia 0 1 (3) 0 1 (3)
  • Infusion reactions were common, but were generally grade 1-2. Only one patient experienced a grade 3 infusion reaction to milatuzumab after the amendment which occurred on week 28 of extended induction. The patient did not require hospitalization and responded to interventions, but was taken off of study therapy. Hematologic toxicity consisted of grade 3-4 lymphopenia (31%), grade 3 leukopenia (9%), grade 3 neutropenia (11%), and grade 3 anemia (3%). One patient discontinued study therapy for grade 3 neutropenia which occurred on week 20 and was considered likely related to study therapy. A bone marrow biopsy was performed and demonstrated no evidence of NHL or myelodysplasia. The neutropenia resolved by week 23. Infectious complications were all grade 1-2 and included an upper respiratory infection, shingles, sinusitis, pneumonia, a urinary tract infection, and thrush. Common grade non-hematologic toxicities in both the phase I and II studies included nausea, diarrhea, and fatigue.
  • Milatuzumab is currently being evaluated in a phase I study in combination with standard graft-versus-host disease prophylaxis for patients undergoing allogeneic stem cell transplant for B-cell malignancies, due to its ability to selectively reduce CD74 expressing myeloid dendritic cells (NCT01663766) (Chen et al., 2013, Biol Blood Marrow Transplant 19:28-39).
  • lymphoma MCL
  • other lymphoma/leukemia lines as well as primary patient tumor
  • the two HexAbs also displayed different potencies in depleting lymphoma cells from whole blood ex vivo, and significantly extended the survival of nude mice bearing MCL xenografts.
  • Mantle cell lymphoma is an aggressive subtype of B-cell non-Hodgkin lymphoma (NHL) generally having a poor prognosis.
  • NHL B-cell non-Hodgkin lymphoma
  • MAbs Monoclonal antibodies (MAbs), exemplified by rituximab, are among the treatment options for MCL (Weigert et al., 2009, Leuk Lymphoma 50: 1937-1950; Zhou et al., 2007, Am J Hematol 83 : 144-149) and have shown encouraging results in MCL (Lenz et al., 2005, J Clin Oncol 23 : 1984- 1992; Sachanas et al., 2011, Leuk Lymphoma 52:387-93).
  • resistance to rituximab therapy remains a problem (Lim et al., 201 1, Blood July 18, Epub ahead of print) and more effective methods of treatment for MCL are needed.
  • combination antibody therapy can be accomplished with a bispecific antibody (bsAb) to avoid the need for administering two different antibodies sequentially, which is time-consuming, expensive, and inconvenient.
  • bsAb bispecific antibody
  • a bsAb may serve to recruit effector cells or effector molecules to target cells, or it may improve the target selectivity by concurrent ligation of two different antigens expressed on the same cell, wherein a multivalent bsAb should also enhance its functional affinity, resulting in increased retention on the bound cells and, likely, a higher potency.
  • DOCK-A D-LOCK® (DNL®) method, described above, is a platform technology that combines genetic engineering with site-specific conjugation to enable self-assembly of two modular components only with each other, resulting in a covalent structure of defined composition with retained bioactivity.
  • DNL® mono- and bi-specific HexAbs, each comprising a pair of stabilized dimers of Fab linked to a full IgG, thus conferring six Fab-arms and a common Fc entity.
  • each is assigned a code of X-(Y)-(Y), where X and Y are specific numbers given to differentiate the antibodies, and a designated number enclosed in a parenthesis representing the antibody as a Fab.
  • 20-(74)-(74) designates the bispecific HexAb comprising a divalent anti-CD20 IgG of veltuzumab (also referred to as hA20) and a pair of stabilized dimers of Fab derived from
  • LYSOTRACKER® Red DND-99, CM-H 2 DCF-DA, DAPI, ALEXA FLUOR® phalloidin, and acridine orange were bought from Invitrogen (Carlsbad, CA).
  • MTS Solution Cell Proliferation assay
  • PHOSPHOSAFETM buffer, latrunculin B, cytochalasin D, bafilomycin Al and concanamycin A were procured from EMD chemicals
  • MAGIC REDTM Cathepsin B assay kit was purchased from ImmunoChemistry Technologies (Bloomington, MN). All other chemicals were purchased from Sigma (St. Louis, MO). [0215] Cell culture - Malignant cell lines were cultured at 37° C in 5% C0 2 in RPMI 1640 medium supplemented with 10 % heat-inactivated fetal bovine serum, 2 mM L-glutamine, 200 U/ml penicillin and 100 ⁇ g/ml streptomycin. Cells from CLL and MCL patients were collected from whole blood by Ficoll-Hypaque separation and grown in RPMI media as described for the cell lines.
  • Cell proliferation assay - Cells were seeded in 48-well plates (5 x 10 4 cells per well) and incubated with each test article at a final concentration of 0.006 to 100 nM for 4 days. The number of viable cells was then determined using the MTS assay per the manufacturer's protocol, plotted as percent of the untreated, and analyzed by Prism software.
  • Effector function assays - ADCC was performed as described previously (Rossi et al., 2008, Cancer Res 68:8384-8392), using JeKo-1 as the target cell and freshly isolated peripheral blood mononuclear cells as the effector cells.
  • To perform CDC cells were seeded in black 96-well plates at 5 x 10 4 cells in 50 ⁇ per well and incubated with serial dilutions (concentration range 3.3 x 10 "8 to 2.6 x 10 "10 M) of test articles in the presence of human complement (1/20 final dilution, Quidel Corp., San Diego, CA) for 2 h at 37°C and 5% C0 2 . Viable cells were then quantified using the MTS assay. Controls included cells treated with 0.25% Triton X-100 (100% lysis) and cells treated with complement alone (background).
  • Annexin V binding assay - Cells in 6-well plates (2 x 10 5 cells per well) were treated with each test article at 10 nM for 24 to 48 h, washed, resuspended in 100 ⁇ of annexin- binding buffer (10 mM HEPES, 140 mM NaCl and 2.5 mM CaCl 2 in PBS), stained with 5 ⁇ of Annexin V- ALEXA FLUOR® 488 conjugate for 20 min, then with 1 ⁇ g/ml of propidium iodide (PI) in 400 ⁇ of annexin binding buffer, and analyzed by flow cytometry (FACSCALIBUR®, Becton Dickinson, San Jose, CA). Cells stained positive with annexin V (including both Pi-negative and Pi-positive) were counted as apoptotic populations. When required, cells were pretreated with the indicated inhibitors for 2 h before adding the test article.
  • annexin- binding buffer 10 mM HEPES,
  • Nuclear extracts - JeKo-1 cells (6 x 10 6 cells in 6 ml) were treated with each test article at 10 nM for 72 h. Cells were collected and cytosolic and nuclear extracts were obtained as described (Marcho et al., 2001, Methods Enzymol 333 :73-87). Equal amounts of nuclear and cytosolic proteins (10 ⁇ g) were separated on SDS-PAGE and analyzed for NF- ⁇ protein p65, Brg-1 and ⁇ -actin, with the latter two serving as loading controls for nuclear and cytosolic proteins, respectively.
  • JeKo-1 cells were treated with select antibodies (10 nM) for 48 h, fixed with 4% paraformaldehyde, permeabilized with 0.1 % tritonX- 100, costained with MAGIC REDTM Cathepsin B and DAPI, and examined under a fluorescence microscope.
  • JeKo-1 and B cells from whole blood - JeKo-1 cells (5 ⁇ 10 4 ) were mixed with heparinized whole blood (150 ⁇ ) from healthy volunteers and incubated with varying concentrations of each test article for 2 d at 37°C and 5% C0 2 . After lysing the red blood cells and washing, the remaining cells were stained with FITC-anti-CD19, PE-anti-CD14 or allophycocyanin (APC)-conjugated mouse IgGi isotype control, and analyzed by flow cytometry. JeKo-1 cells and monocytes were identified in the monocyte gate as CD19 + and CD14 + populations, respectively. Normal B cells are CD19 + in the lymphocyte gate.
  • mice Female 8-week-old SCID mice (Taconic Farms; Germantown, NY) were used. Seven different treatment groups of eight mice each were inoculated i.v. with JeKo-1 (2.5 x 10 7 cells). After seven days, one group received 370 ⁇ g of 20-(74)-(74) i.p. twice weekly for two weeks. A second group received 74-(20)-(20) with the same dose and schedule. Two lower doses (37 ⁇ g and 3.7 ⁇ g) also were examined for each HexAb with the same schedule and injection route. The control group received saline. The mice were observed daily for signs of distress or paralysis, weighed weekly, and killed humanely when they developed hind-limb paralysis, became moribund, or lost more than 20% of initial body weight.
  • FIG. 4A Additional results shown in FIG. 4B revealed that the anti-proliferative activity of the monospecific 74-(74)-(74) and 20-(20)- (20) HexAbs, as well as the bispecific anti-CD20/CD22 HexAb, 20-(22)-(22), paralleled that of combined hLLl and hA20 in JeKo-1, and thus was considerably lower in activity than the bispecific anti-CD20/CD74 HexAbs.
  • EC 50 values (nM), as determined by the MTS assay, is provided in Table 14.
  • DNL® constructs comprising anti-CD74 and anti- CD20 antibodies or fragments thereof were substantially more effective at treating mantle cell lymphoma than anti-CD20/anti-CD22 DNL constmcts or either parental antibody administered alone or together.
  • MM lines (WAC, MEC-1), 2 ALL lines (REH-1, MN60), and 5 MM lines ((CAG, RPMI8226, KMSl 1, KMS12-BM, KMS12-PE), were all greater than 100 nM.
  • MM lines hLLl, hA20, hLLl
  • ADCC antibody-dependent cellular cytotoxicity
  • Apoptosis The ability of 20-(74)-(74) and 74-(20)-(20) to induce apoptosis was evaluated by flow cytometry using the Annexin V binding assay.
  • both bispecific anti-CD20/CD74 HexAbs at 10 nM showed a statistically significant (P ⁇ 0.033) increase of 10-15% in Annexin V- positive cells over the various controls (FIG. 5A), which included untreated cells, cells treated with either parental antibody, and cells treated with both parental antibodies combined.
  • Statistically significant increases of 10 to 25% in annexin V-positive cells were also observed for all four MCL patient samples (P ⁇ 0.008; FIG.
  • KMS-1 1 a CD20-negative multiple myeloma line expressing a high level of CD74
  • tositumomab murine anti-human CD20 IgG 2b
  • tositumomab murine anti-human CD20 IgG 2b
  • parental antibodies in the presence of a crosslinking antibody (Table 15).
  • JeKo-1 and KMS- 1 1 cells (2 x 10 6 /mL) were incubated with the indicated treatments for 2 and 24 h at 37° C. The values (%) shown were the mean from three different fields.
  • KMS-1 1 is a multiple myeloma cell line with low CD20 expression and high CD74. nd, not determined.
  • 74-(20)-(20) at 0.1 to 1 nM depleted 10% or less of normal B cells (FIG. 7C, lower panel). It is noted that the ability of 20-(74)-(74) to deplete either JeKo-1 or normal B cells from whole blood is comparable, not superior, to that of hA20 or the combination of hA20 and hLLl .
  • mice treated with 20-(74)-(74) at 370 ⁇ g were more effective than the two lower doses (RO.0143). However, there were no significant differences between mice treated with 20-(74)-(74) and 74-(20)-(20) at the same dose.
  • CD74 is the cell surface form of the HLA class II-associated invariant chain, which plays a key role as a chaperone protein in antigen presentation by HLA-DR to Th cells (Weenink & Gautam, 1997, Immunol Cell Biol 75:69-81).
  • CD74 mediates macrophage migration inhibitory factor (MIF)-induced signal transduction as its cognate membrane receptor (Leng et al., 2003, J Exp Med 197: 1467-1476), resulting in activation of ERK1/2 and protection from p53-dependent apoptosis in a process that requires CD44 as a signaling component and involves PKA and c-Src (Shi et al., 2006, Immunity 25:595-606).
  • MIF macrophage migration inhibitory factor
  • CD74-ICD intracellular domain of CD74 released from intramembrane proteolysis in the endocytic compartments can activate F- ⁇ to induce B-cell maturation (Becker-Herman et al., 2005, Mol Biol Cell 16:5061-5069), and this activity is further enhanced by stimulating CD74 with an agonistic antibody or MIF, either of which augments CD74-ICD release, increases Bcl-xL expression, and elevates the phosphorylation of both Akt and Syk (Starlets, 2006, Blood 107:4807-4816).
  • next-generation anti-CD20 MAbs include human and humanized forms, with some claiming enhanced potency by antibody reengineering (Pawluczkowycz et al., 2009, J Immunol 183 :749-758; Mossner et al., 2010, Blood 1 15 :4393-4402).
  • CD20 is a well-validated therapeutic target and despite more than 10 years of clinical use of rituximab and an expansive preclinical literature on the use of anti-CD20 MAbs in lymphoma models in vitro and in vivo, how rituximab or other anti-CD20 MAbs kill lymphoma cells is still being debated (Glennie et al., 2007, Mol Immunol 44:3823-3837) among the three principal mechanisms proposed, CDC, ADCC, and direct toxicity induced by signaling.
  • 20/CD74 HexAbs were capable of manifesting direct in vitro cytotoxicity in 3 MCL, 2 NHL, and 2 CLL cell lines, as well as inducing a significantly higher number of annexin V-positive cells in primary tumor samples from MCL and CLL patients, compared to untreated controls.
  • bispecific anti-CD20/CD74 HexAbs as represented by 20-(74)-(74) and 74- (20)-(20), were successfully generated and their potential for therapy of MCL evaluated and demonstrated in preclinical studies.
  • the key findings are as follows. (1) Effective inhibition of proliferation requires juxtaposing CD20 and CD74 in close proximity. (2) The observed direct in vitro cytotoxicity is accompanied by extensive homotypic adhesion, relocation of actin to the cell- cell junction, notable lysosomal enlargement, release of cathespin B into the cytosol, loss of mitochondria membrane potential, generation of ROS, deactivation of the PI3K/Akt signaling pathway, as well as rapid and sustained activation of ERK and INK MAPKs.
  • Homotypic adhesion can be a first indicator for determining whether a certain antibody or combination of antibodies will display toxicity against antigen-expressing hematological cells.
  • Both 20-(74)-(74) and 74-(20)-(20) will be of use in additional B-cell malignancies, in particular CLL, and in autoimmune disease. These compounds constitute a new therapeutic class of anticancer antibodies.
  • Milatuzumab humanized anti-CD74 monoclonal antibody
  • CLL and NHL Berkova et al., 2010, Expert Opin Invest Drugs 19: 141-49.
  • CD74 the MHC class-II chaperone molecule
  • CD74 also functions as the cellular receptor for the proinflammatory cytokine, macrophage migration-inhibitory factor, and initiates a signaling cascade resulting in proliferation and survival (e.g., Leng et al., 2003, J Exp Med 197: 1467-76).
  • milatuzumab demonstrates therapeutic activity against various B-cell malignancies when used alone (Berkova et al., 2010, Expert Opin Invest Drugs 19: 141-49), and the therapeutic efficacies of bortezomib, doxorubicin, and dexamethasone are enhanced in multiple myeloma cell lines when given combined with milatuzumab (Stein et al., 2009, Clin Cancer Res 15:2808-17).
  • Milatuzumab acts through distinct mechanisms from rituximab, and exhibits different expression and sensitivity profiles.
  • Rituximab-resistant cell lines were generated from the Raji parental cell lines by exposing cells to an escalating dose of rituximab (0.1 to 128 ⁇ g/ml), either without human serum (Raji 2R) or in the presence of human serum (Raji4RH).
  • rituximab 0.1 to 128 ⁇ g/ml
  • Raji 2R human serum
  • Raji4RH human serum
  • Milatuzumab and other antagonistic anti-CD74 antibodies can significantly add to the efficacy of currently approved therapies, such as fludarabine and rituximab, for B cell diseases, including NHL, CLL and ALL.

Landscapes

  • Health & Medical Sciences (AREA)
  • Immunology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne des méthodes de traitement d'un lymphome non Hodgkinien récidivant/résistant au moyen d'une polythérapie avec un anticorps ou fragment anti-CD20 et un anticorps ou un fragment anti-CD74. Dans des modes de réalisation préférés, la combinaison d'anticorps est administrée avec au moins un autre agent thérapeutique. La combinaison est efficace pour traiter le LNH indolent qui est résistant à ou récidivant par rapport à au moins une thérapie contre le LNH, comprenant mais ne se limitant pas au LNH résistant au rituximab. La combinaison d'anticorps peut être administrée à des sujets humains selon des dosages et des posologies spécifiques, qui sont efficaces pour traiter la maladie mais ne provoquent pas de toxicité limitant la dose.
PCT/US2016/012854 2015-01-23 2016-01-11 Polythérapie avec des anticorps anti-cd74 et anti-cd20 chez des patients atteints d'un lymphome b non-hodgkinien réfractaire et récidivant WO2016118353A1 (fr)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA2970738A CA2970738A1 (fr) 2015-01-23 2016-01-11 Polytherapie avec des anticorps anti-cd74 et anti-cd20 chez des patients atteints d'un lymphome b non-hodgkinien refractaire et recidivant
EP16740510.9A EP3247395A1 (fr) 2015-01-23 2016-01-11 Polythérapie avec des anticorps anti-cd74 et anti-cd20 chez des patients atteints d'un lymphome b non-hodgkinien réfractaire et récidivant

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201562106995P 2015-01-23 2015-01-23
US62/106,995 2015-01-23

Publications (1)

Publication Number Publication Date
WO2016118353A1 true WO2016118353A1 (fr) 2016-07-28

Family

ID=56417592

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2016/012854 WO2016118353A1 (fr) 2015-01-23 2016-01-11 Polythérapie avec des anticorps anti-cd74 et anti-cd20 chez des patients atteints d'un lymphome b non-hodgkinien réfractaire et récidivant

Country Status (3)

Country Link
EP (1) EP3247395A1 (fr)
CA (1) CA2970738A1 (fr)
WO (1) WO2016118353A1 (fr)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001010462A1 (fr) * 1999-08-11 2001-02-15 Idec Pharmaceuticals Corporation Traitement pour patients atteint d'un lymphome different de la maladie de hodgkins et qui touche la moelle osseuse, avec des anticorps anti-cd20
US7534427B2 (en) * 2002-12-31 2009-05-19 Immunomedics, Inc. Immunotherapy of B cell malignancies and autoimmune diseases using unconjugated antibodies and conjugated antibodies and antibody combinations and fusion proteins
US20130295005A1 (en) * 2005-04-06 2013-11-07 Ibc Pharmaceuticals, Inc. Combination Therapy With Anti-CD74 Antibodies Provides Enhanced Toxicity to Malignancies, Autoimmune Disease and Other Diseases
US8846002B2 (en) * 1999-05-10 2014-09-30 The Ohio State University Anti-CD74 immunoconjugates and methods of use

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8846002B2 (en) * 1999-05-10 2014-09-30 The Ohio State University Anti-CD74 immunoconjugates and methods of use
WO2001010462A1 (fr) * 1999-08-11 2001-02-15 Idec Pharmaceuticals Corporation Traitement pour patients atteint d'un lymphome different de la maladie de hodgkins et qui touche la moelle osseuse, avec des anticorps anti-cd20
US7534427B2 (en) * 2002-12-31 2009-05-19 Immunomedics, Inc. Immunotherapy of B cell malignancies and autoimmune diseases using unconjugated antibodies and conjugated antibodies and antibody combinations and fusion proteins
US20130295005A1 (en) * 2005-04-06 2013-11-07 Ibc Pharmaceuticals, Inc. Combination Therapy With Anti-CD74 Antibodies Provides Enhanced Toxicity to Malignancies, Autoimmune Disease and Other Diseases

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
CHRISTIAN ET AL.: "The combination of milatuzumab, a humanized anti- CD 74 antibody, and veltuzumab, a humanized anti- CD 20 antibody, demonstrates activity in patients with relapsed and refractory B- cell non-Hodgkin lymphoma", BRITISH JOUMAL OF HAEMATOLOGY, vol. 169, no. 5, 7 April 2015 (2015-04-07), pages 701 - 710, XP055468495 *
STEIN ET AL.: "Antiproliferative activity of a humanized anti- CD 74 monoclonal antibody, hLL1, on B- cell malignancies", BLOOD, vol. 104, no. 12, 5 August 2004 (2004-08-05), pages 3705 - 3711., XP055171287 *

Also Published As

Publication number Publication date
CA2970738A1 (fr) 2016-07-28
EP3247395A1 (fr) 2017-11-29

Similar Documents

Publication Publication Date Title
US9944703B2 (en) Humanized anti-CD22 antibody
US9359443B2 (en) Combination therapy with anti-CD74 and anti-CD20 antibodies provides enhanced toxicity to B-cell diseases
US9475883B2 (en) Therapeutic use of anti-CD22 antibodies for inducing trogocytosis
JP6361039B2 (ja) 疾患に対する免疫反応を誘導するための併用療法
US20160251444A1 (en) Therapeutic use of anti-cd22 antibodies for inducing trogocytosis
US20160296648A1 (en) Y-90-labeled anti-cd22 antibody (epratuzumab tetraxetan) in refractory/relapsed adult cd22+ b-cell acute lymphoblastic leukemia
US20140056917A1 (en) FTY720 Increases CD74 Expression and Sensitizes Cancer Cells to Anti-CD74 Antibody-Mediated Cell Death
US20160304611A1 (en) Combination therapy for treating adult patients with relapsed/refractory cd22+ b-cell acute lymphoblastic leukemia
US20160120976A1 (en) Combination therapy with anti-cd74 and anti-cd20 antibodies in patients with relapsed and refractory b-cell non-hodgkin's lymphoma
EP2605788B1 (fr) Polythérapie avec des anticorps anti-cd74 procurant une toxicité amplifiée pour les malignités, les maladies auto-immunes et d'autres maladies
EP3247395A1 (fr) Polythérapie avec des anticorps anti-cd74 et anti-cd20 chez des patients atteints d'un lymphome b non-hodgkinien réfractaire et récidivant
GOLDENBERG et al. Patent 2970738 Summary

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16740510

Country of ref document: EP

Kind code of ref document: A1

ENP Entry into the national phase

Ref document number: 2970738

Country of ref document: CA

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2016740510

Country of ref document: EP