WO2016116398A1 - A novel vaccine against the middle east respiratory syndrome coronavirus (mers-cov) - Google Patents

A novel vaccine against the middle east respiratory syndrome coronavirus (mers-cov) Download PDF

Info

Publication number
WO2016116398A1
WO2016116398A1 PCT/EP2016/050888 EP2016050888W WO2016116398A1 WO 2016116398 A1 WO2016116398 A1 WO 2016116398A1 EP 2016050888 W EP2016050888 W EP 2016050888W WO 2016116398 A1 WO2016116398 A1 WO 2016116398A1
Authority
WO
WIPO (PCT)
Prior art keywords
mers
cov
immunogenic
protein
vector
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/EP2016/050888
Other languages
French (fr)
Inventor
Gerd Sutter
Fei Song
Robert Fux
Asisa Volz
Stephan Becker
Markus Eickmann
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Ludwig Maximilians Universitaet Muenchen LMU
Philipps Universitaet Marburg
Original Assignee
Ludwig Maximilians Universitaet Muenchen LMU
Philipps Universitaet Marburg
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Ludwig Maximilians Universitaet Muenchen LMU, Philipps Universitaet Marburg filed Critical Ludwig Maximilians Universitaet Muenchen LMU
Publication of WO2016116398A1 publication Critical patent/WO2016116398A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/12Viral antigens
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/51Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/53DNA (RNA) vaccination
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20022New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011Details
    • C12N2770/20011Coronaviridae
    • C12N2770/20034Use of virus or viral component as vaccine, e.g. live-attenuated or inactivated virus, VLP, viral protein
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2799/00Uses of viruses
    • C12N2799/02Uses of viruses as vector
    • C12N2799/021Uses of viruses as vector for the expression of a heterologous nucleic acid
    • C12N2799/023Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a poxvirus

Definitions

  • the present invention relates to the Middle East Respiratory Syndrome Coronavirus (MERS- CoV) N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine.
  • the present invention further relates to an immunogenic composition comprising the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof.
  • the present invention relates to a vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, for use as a vaccine as well as a method of inducing a protective immune response against MERS-CoV.
  • a number of documents including patent applications and manufacturer's manuals is cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
  • Middle East Respiratory Syndrome is a viral respiratory illness first reported in Saudi Arabia in 2012 accompanied by fever, cough, and shortness of breath. Most infections were geographically linked to the Middle East, i.e., Jordan, Saudi Arabia, Qatar, and the United Arab Emirates, but cases also occurred in the United Kingdom, Germany, France, and Italy. In the same year, the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) emerged as the causative agent of the infection in humans. At present, human cases of MERS-CoV infections continue to be reported. The virus is thought to persist in animal reservoirs, in particular in dromedary camels, and to cause sporadic zoonotic infections followed by intra- familial or health-care-related transmissions.
  • the present invention relates to the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine.
  • MERS-CoV Middle East Respiratory Syndrome Coronavirus
  • MERS-CoV Middle East Respiratory Syndrome Coronavirus
  • MERS-CoV is also abbreviated herein as MERS-CoV and is a group IV ((+)ssRNA) virus of the genus betacoronavirus following the nomenclature of the Coronavirus Study group (de Groot 2013).
  • This virus was first described as human coronavirus EMC in 2012 by Zaki et al. (2012), Bermingham et al. (2012), van Boheemen ef al. (2012) as well as Muller et al. 2012.
  • the complete genome of the human betacoronavirus 2c EMC/2012 has been deposited under the GenBank accession number JX869059.2.
  • the "MERS-CoV N nucleocapsid protein”, also referred to herein as “MERS-CoV N protein”, is a protein of 413 amino acids length that shares a high homology with the N protein of other coronaviruses.
  • the primary role of CoV N protein is the packaging of the genomic viral genome into long, flexible, helical ribonucleoprotein (RNP) complexes, the so-called nucleocapsids or capsids.
  • the nucleocapsid protects the genome and ensures its timely replication and reliable transmission.
  • studies have indicated that the N proteins of coronavirus also participate in the replication and transcription of viral RNA and interfere with the cell cycle processes of the host cells. Accordingly, CoV N proteins localize to the cytoplasm as well as to the nucleolus of the virus.
  • the N nucleocapsid protein has been described e.g. in Masters & Perlman pressureCoronaviridae", p. 825-858, Fields Virology, 6th Edition 2013, Knipe DM, Howley PM Eds, Lippincott Williams & Wilkins, Philadelphia or in McBride et al. 2014.
  • the N protein of the human betacoronavirus 2c EMC/2012 is represented by the GenBank accession number AFS88943.1 and is also shown in SEQ ID NO:1.
  • embodiments wherein the MERS-CoV N protein (or fragment thereof) is present or used in the context of the whole MERS-CoV, i.e. in combination with all other components that make up this virus, are excluded.
  • immunogenic fragment refers to a fragment of the MERS-CoV N nucleocapsid protein that maintains the ability of the full length MERS-CoV N nucleocapsid protein to elicit an immunogenic reaction i.e. its ability to stimulate the immune system of a subject, such as e.g. a human subject, to recognize it as foreign, destroy it, and subsequently enable the immune system to protect the subject against the disease for which the vaccine has been developed. It is well known in the art that immunogenic protein may be cleaved to yield fragments which retain or essentially retain the immunogenic activity of the full length protein.
  • Such cleavage may include the removal of a given number of N- and/or C-terminal amino acids, or the removal of a number of internal (non-terminal) amino acids.
  • Said number of amino acids to be removed from the termini and/or internal regions may for example be one, two, three, four, five, six, seven, eight, nine, ten, 15, 20, 25, 30, 40, 50 or more than 50.
  • the fragment has a length of at least 6 amino acids, more preferably at least 7 amino acids, such as at least 8 amino acids, at least 9 amino acids, at least 10 amino acids, at least 11 amino acids, at least 12 amino acids, at least 13 amino acids, at least 14 amino acids, and most preferably at least 15 amino acids.
  • Means and methods for determining whether the immunogenic activity is retained are well known in the art and include e.g. experimental means such as the systematic generation of deletion mutants and their assessment in assays for immunogenic activity.
  • an immunogenic reaction of the fragment to be tested can be analysed by standard and routine techniques, e.g. by administering (e.g. via i.v. injection) the fragment of interest to a mammal such as a mouse and analysing the response of immunogenic biood cells and/or factors (e.g. interleukins) after an appropriate time for an immune reaction to occur. This can for example be done by applying serum from the animals inoculated with the fragment to a peptide array comprising the complete antigen.
  • serum from the animals inoculated with the fragment to a peptide array comprising the complete antigen.
  • the immunogenic activity of a fragment of the MERS-CoV N nucleocapsid protein is essentially retained if at least 60% of the immunogenic activity of the full length MERS-CoV N nucleocapsid protein is retained.
  • at least 75% or more preferably at least 80% of the immunogenic activity of the full length MERS-CoV N nucleocapsid protein is retained.
  • at least 90% such as at least 95%, even more preferred at least 98% such as at least 99% of the immunogenic activity of the full length MERS-CoV N nucleocapsid protein is retained.
  • immunogenic activity is fully, i.e. to 100%, retained.
  • fragments having an increased immunogenic activity compared to the full length MERS-CoV N nucleocapsid protein i.e. more than 100% activity.
  • the method to determine whether these percentages of immunogenic activity are retained is by measuring the induction of MERS CoV neutralising antibody titers in serum after immunisation, as shown in the appended examples using mice.
  • a direct comparison of the immunogenic activity of such a fragment can be achieved by carrying out the same experiment using a full length MERS-CoV N nucleocapsid protein as well as the fragment of interest.
  • standard values for the full length MERS-CoV N nucleocapsid protein may generated in advance and stored for comparison, thereby rendering the parallel comparison unnecessary if the same experimental conditions are observed.
  • the MERS-CoV N nucleocapsid protein or an immunogenic fragment thereof can be expressed recombinantly by methods known in the art, e.g. by expressing a vector encoding the MERS-CoV N nucleocapsid protein or the fragment thereof in a suitable host and purifying the expressed MERS-CoV N nucleocapsid protein or the fragment thereof.
  • the host is a unicellular organism such as a prokaryote, a mammalian or insect cell, the person skilled in the art can revert to a variety of culture conditions.
  • the produced protein is harvested from the culture medium, lysates of the cultured organisms or from isolated (biological) membranes by established techniques.
  • the host may be a cell which is part of or derived from a part of the organism, for example said host cell may be the harvestable part of a plant.
  • a preferred method involves the recombinant production of proteins in hosts as indicated above.
  • nucleic acid sequences comprising a polynucleotide encoding the MERS-CoV N nucleocapsid protein or a fragment thereof can be synthesized in vitro by gene synthesis or PCR and inserted into an expression vector. Subsequently a suitable host may be transformed with the expression vector. Thereafter, the host is cultured to produce the desired polypeptide(s), which is/are isolated and purified.
  • Suitable cell-free expression systems for use in accordance with the present invention include rabbit reticulocyte lysate, wheat germ extractj canine pancreatic microsomal membranes, E. coli S30 extract, and coupled transcription/translation systems such as the TNT-system (Promega). These systems allow the expression of recombinant polypeptides upon the addition of cloning vectors, DNA fragments, or RNA sequences containing coding regions and appropriate promoter elements.
  • the protein or fragments of the invention may be produced synthetically, e.g.
  • Synthetic protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using the Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer, Foster City CA) in accordance with the instructions provided by the manufacturer. Various fragments may be chemically synthesized separately and combined using chemical methods to produce the full length molecule. As indicated above, chemical synthesis, such as the solid phase procedure described by Houghton Proc. Natl. Acad. Sci.
  • protein or fragments of the protein of the invention may be produced semi-synthetically, for example by a combination of recombinant and synthetic production.
  • Protein isolation and purification can be achieved by any one of several known techniques; for example and without limitation, ion exchange chromatography, gel filtration chromatography and affinity chromatography, high pressure liquid chromatography (HPLC), reversed phase HPLC, and preparative disc gel electrophoresis.
  • Protein isolation/purification techniques may require modification of the proteins of the present invention using conventional methods. For example, a histidine tag can be added to the protein to allow purification on a nickel column. Other modifications may cause higher or lower activity, permit higher levels of protein production, or simplify purification of the protein.
  • nucleic acid molecule also referred to as nucleic acid sequence herein, includes DNA, such as cDNA or genomic DNA, and RNA. It is understood that the term “RNA” as used herein comprises all forms of RNA including mRNA, tRNA and rRNA. Both, single-strand as well as double-strand nucleic acid molecules are encompassed by this term. Further included are nucleic acid mimicking molecules known in the art such as synthetic or semi-synthetic derivatives of DNA or RNA and mixed polymers, both sense and antisense strands.
  • nucleic acid mimicking molecules or nucleic acid derivatives include phosphorothioate nucleic acid, phosphoramidate nucleic acid, 2'-0-methoxyethyl ribonucleic acid, morpholino nucleic acid, hexitol nucleic acid (HNA) and locked nucleic acid (LNA) (see Braasch and Corey (2001 ) Chem Biol. 8, 1 ).
  • LNA is an RNA derivative in which the ribose ring is constrained by a methylene linkage between the 2'-oxygen and the 4'-carbon. They may contain additional non-natural or derivatised nucleotide bases, as will be readily appreciated by those skilled in the art.
  • the nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or a fragment thereof can be combined, preferably in a vector, with additional elements, such as e.g. regulatory elements. Regulatory elements are required to ensure expression of the encoded protein after incorporation thereof in the host cell(s) of the organism to be vaccinated, to thereby synthesize the antigen. Regulatory elements are also required to ensure replication of the nucleic acid molecule in particular in those cases where the newly introduced nucleic acid molecule is present as an extra-chromosomal sequence or where regulation via endogenous regulatory elements is not ensured.
  • Non-limiting examples of regulatory elements include an origin of replication, a promoter as well as terminating sequences.
  • Additional regulatory elements may include translational enhancers and translation initiation codons, Shine- Dalgarno boxes or internal ribosomal entry sites or signal sequences capable of directing the expressed fusion protein to a specific cellular compartment.
  • translational enhancers and translation initiation codons Shine- Dalgarno boxes or internal ribosomal entry sites or signal sequences capable of directing the expressed fusion protein to a specific cellular compartment.
  • the promoter initiates transcription of the nucleic acid molecule and can be used to control the level of gene expression, while the terminator sequence ends transcription.
  • the promoter should be highly active. It is further preferred that the promoter is a native and conserved promoter that is independent of inducing systems, such as e.g. IPTG or arabinose.
  • Non-limiting examples of promoters include the natural vaccinia virus promoters P7.5 or P11 , the synthetic vaccinia virus early-late promoters sP (Chakrabarti et al. Biotechniques 1997, 23:1094), PmH5 (Wyatt et al. Vaccine 1996 14:1451 ), sPII (Wyatt et al.
  • the promoter is the synthetic vaccinia virus promoter PmH5 employed in the appended examples.
  • Non-limiting examples for regulatory elements ensuring transcription termination include the vaccina virus TTTTTNT early termination signal, the SV40-poly-A site or the tk-poly-A site or the SV40, lacZ polyadenylation signals, downstream of the polynucleotide.
  • the vector is a virus, plasmid, cosmid or bacteriophage.
  • the nucleic acid molecule of the present invention may be inserted into any one of several commercially available vectors. Suitable expression vectors which comprise the described regulatory elements are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc/CMV, pcDNAI , pcDNA3, pSFV1 (In-Vitrogene). Most preferably, the vector is a virus as described in more detail herein below.
  • the nucleic acid sequences inserted in the vector can e.g. be synthesized by standard chemical synthesis methods, or isolated from natural sources or produced semi-synthetically, i.e. by combining chemical synthesis and isolation from natural sources.
  • Ligation of the coding sequences to transcriptional regulatory elements and/or to other amino acid encoding sequences can be carried out using established methods, such as restriction digests, ligations and molecular cloning.
  • Vector modification techniques belong to the standard techniques in the field of molecular biology and, thus, belong to the scientific knowledge of the skilled person.
  • vacun is defined in accordance with the pertinent art and relates to a composition that induces or enhances the protective immunity of an individual to a particular disease caused by a pathogen. Without wishing to be bound by theory, it is believed that a protective immunity arises from the generation of neutralizing antibodies, or from the activation of cytotoxic cells of the immune system, or both.
  • the vaccine comprises as an immunogenic antigen a part of the pathogen causing said disease or a nucleic acid molecule encoding this immunogenic antigen.
  • the immunogenic antigen is the MERS-CoV N nucleocapsid protein, or an immunogenic fragment thereof (or a mixture of the full length MERS-CoV N nucleocapsid protein with (a) fragment(s) thereof) and the pathogen is MERS-CoV, which causes the Middle East Respiratory Syndrome.
  • the vaccine is for use in preventing, alleviating and/or treating Middle East Respiratory Syndrome.
  • the vaccine is for use in preventing Middle East Respiratory Syndrome.
  • the vaccine may be in any formulation for vaccines known in the art, such as for example mucosal vaccines, vaccines for intramuscular injection or vaccines for subcutaneous or intradermal injection as well as vaccines for inhalation, such as e.g. as aerosols.
  • vaccine formulations are well known in the art.
  • the vaccine may be in liquid, aerosolic, or solid form and may be, inter alia, in the form of (a) solution(s), (a) spray(s), (a) powder(s) or (a) tablet(s) or paste(s).
  • MERS-CoV N nucleocapsid protein is recognised by MERS-CoV-specific antibodies in macaque serum, obtained from an MERS-CoV infected cynomolgous macaque.
  • MERS-CoV genome contains 301 19 nucleotides, and encodes four major structural proteins, the spike (S) protein, envelope (E) protein and membrane (M) protein, as well as the nucieocapsid (N) protein (van Boheemen et al., 2012).
  • the spike (S) protein has previously been shown to be an important component of a candidate vaccine (Song ef al., 2013) and the co-delivery of several membrane/envelope proteins (i.e. E or M proteins) was found to elicit higher levels of target virus specific immune responses or to elicit better protective capacity (Wyatt, 1996; Stittelaar 2000).
  • E or M proteins membrane/envelope proteins
  • the now identified role of the N protein comes as a surprise, as previous studies indicated that N proteins of coronaviruses participate in the replication and transcription of viral RNA and interfere with the cell cycle processes of the host cells.
  • the MERS-CoV N nucieocapsid protein is present only at the inside of the virus and inside of the infected cells and, accordingly, would not be expected to be able to trigger a protective immunogenic response of the infected host.
  • novel recombinant viruses of Modified Vaccinia virus Ankara (MVA) stably containing gene sequences encoding the full-length MERS-CoV proteins S and N were constructed.
  • the recombinant MVA viruses amplified to high titers in chicken embryo fibroblasts but failed to grow in human Hela and HaCat cells suggesting their suitability for vaccine development.
  • Vera cells infected with MVA-MERS-SN co-produced an about 210-kDa MERS-CoV S glycoprotein and an about 45 kDa MERS-CoV N nucieocapsid protein.
  • the N protein was much more prominently recognized than the S protein showing a high level of antigenicity of the MERS-CoV N protein. More importantly, intramuscular vaccination of BALB/c mice with MVA-MERS-SN confirmed the particular immunogenicity of the recombinant N protein. Vaccination raised high levels of serum antibodies that reacted with the authentic N protein of MERS-CoV.
  • MVA-MERS-SN immunization elicited serum antibodies that neutralized a MERS-CoV in vitro infection more efficiently compared to antibodies induced by vaccination with a recombinant MVA vaccine delivering the S protein only (MVA-MERS-S). Since MVA-MERS-S and MVA- MERS-SN are based on the identical clonal isolate the improved immunogenicity of MVA- MERS-SN is directly related to the presence of MERS-CoV N in the composition.
  • the present invention further relates to an immunogenic composition
  • an immunogenic composition comprising the MERS- CoV N nucieocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucieocapsid protein and/or the immunogenic fragment thereof.
  • immunogenic composition relates to a composition capable of eliciting an immunogenic reaction in mammals, preferably in mouse, rat and/or human, most preferably in human.
  • the person skilled in the art can determine immunogenic reactions by standard and routine techniques, as detailed herein above with regard to the determination of an immunogenic activity of proteins or fragments thereof.
  • composition relates to a composition which comprises at least one of the compounds of the invention.
  • the composition of the present invention may, optionally and additionally, comprise further compounds such as e.g. a pharmaceutically acceptable carrier or further molecules capable of altering the characteristics of the compounds of the invention thereby, for example, stabilizing, delaying, modulating and/or activating their function. Non-limiting examples of such compounds are described further below.
  • the composition does not comprise (or consist of) the whole MERS-CoV, i.e. the MERS-CoV N protein in combination with all other components that make up this virus.
  • compositions according to the present invention can be formulated by well known conventional methods.
  • the composition may be in solid, liquid or gaseous form and may be, inter alia, in the form of (a) powder(s), (a) tablet(s), (a) solution(s) or (an) aerosol(s).
  • compositions can be administered to a subject at a suitable dose.
  • the dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. The effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgement of the ordinary clinician or physician. For example, if the MERS-CoV N protein is the sole immunogenic compound, the effective amount administered per dose will be in the range of about 1 g kg to 10 mg kg of patient body weight, although, as noted above, this will be subject to therapeutic discretion.
  • this dose is at least 0.01 mg kg, and most preferably for humans between about 0.01 and 1 mg kg.
  • the particular amounts, as well as the corresponding adjustments in case more than one compound is to be administered, may be determined by conventional tests which are well known to the person skilled in the art.
  • Administration may be once as a single dose or as repeat administrations, such as e.g. a primary immunisation and subsequent boost immunisations.
  • the interval time and amount of boost immunisations required can be determined by the skilled person without further ado.
  • the administration comprises a primary immunisation and at least one boost immunisation. More preferably, the boost immunisation is repeated at least twice. Even more preferably, the boost immunisation is repeated weekly, monthly or yearly.
  • the compositions of the invention may be administered orally, intradermally, subcutaneously, intramuscularly, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or
  • the immunogenic composition is a vaccine, as defined herein above.
  • this embodiment of the present invention preferably relates to a composition comprising the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine.
  • the composition further comprises at least one additional compound selected from the group consisting of immunogenic compounds, adjuvants, pharmaceutically acceptable carriers, stabilisers and/or preservatives.
  • At least one encompasses also at least two, such as at least three, at least four or at least five or more, such as at least ten. It will be appreciated by the skilled person that this term further encompasses exactly one, exactly two, exactly three, exactly four, exactly five or exactly ten.
  • An immunogenic compound can be any compound, or mixtures of compounds, capable of eliciting an immunogenic reaction, as defined herein above.
  • the immunogenic compound is an immunogenic MERS-CoV protein, or a fragment thereof.
  • immunogenic MERS-CoV proteins include the S protein, the E protein and M protein as well as the proteins 3, 4a, 4b and 5.
  • S protein GenBank: AFS88936.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence
  • E protein GenBank: AFS88941.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence
  • the proteins 3 GenBank: AFS88937.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence
  • 4a GenBank: AFS88938.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence
  • 4b GenBank: AFS88939.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence
  • 5 GenBank: AFS88940.2 for amino acid sequence and GenBank: JX
  • the MERS-CoV N nucleocapsid protein and an immunogenic fragment thereof are not encompassed by this definition of additional compounds present in the composition of the invention.
  • the immunogenic compound is not the MERS-CoV N nucleocapsid protein and is not an immunogenic fragment thereof.
  • adjuvant relates to one or more compounds that enhance the recipient's immune response to a vaccine. Adjuvants are often added to promote an earlier, more potent response, and/or more persistent immune response to the vaccine, which often allows for a lower vaccine dosage.
  • adjuvants include e.g. aluminium hydroxide and aluminium phosphate, the organic compound Squalene but also compounds such as e.g. ligands of the Toll-like receptors, QS21 , aluminium hydroxide derivates, oil immersions, Lipid A and it's derivates (e.g.
  • MPL monophosphoryl lipid A
  • CpG motives poly l:C dsRNA
  • MDP Muramyldipeptid
  • FCA Freund's Complete Adjuvant
  • FFA Freund's incomplete Adjuvant
  • FIA Freund's incomplete Adjuvant
  • MF59C MF59C
  • the adjuvants are ligands of the Toll-like receptors (TLR), such as e.g. dsRNA for TLR3, unmethylated CpG oligodesoxynucleotides for TLR9 or flagellin for TLR5.
  • TLR Toll-like receptors
  • the additional immunogenic compound and/or adjuvant can be admixed thereto by conventional means.
  • an adjuvant such as e.g.
  • CpG oligodesoxynucleotides or poly l:C dsRNA, or a mixture of both can be directly admixed with the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or with a vector expressing same.
  • Such approaches are known in the art and have been described, e.g. in Berchtold ei a/. 2009.
  • the additional immunogenic compound or adjuvant can be admixed thereto by conventional means, either as described above, or as (a) separate nucleic acid molecule(s) encoding said additional immunogenic compound or adjuvant.
  • the nucleic acid sequence comprising the nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof may additionally also comprise the nucleic acid molecule(s) encoding said additional immunogenic compound and/or adjuvant.
  • a dsRNA ligand can be encoded on the same vector as the MERS-CoV N antigen, such as e.g. described by Scallan et al. 2012.
  • MERS-CoV N antigen such as e.g. described by Scallan et al. 2012.
  • a further example has been described by Arimilli er al. 2008, who showed that intracellular expression of the TLR5 ligand flagellin by paramyxovirus simian virus 5 (SV5) acts as an adjuvant that enhances the activation of SV5-infected dendritic cells.
  • SV5 paramyxovirus simian virus 5
  • pharmaceutically acceptable carrier relates to non-toxic excipients, including e.g. solid, semisolid or liquid fillers, diluents, binding agents, lubricants, various types of wetting agents, encapsulating material or formulation auxiliaries of any type.
  • suitable pharmaceutically acceptable carriers include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions, organic solvents including DMSO etc.
  • Stabilisers are employed to prevent alterations of the vaccine when exposed to e.g. heat, light, acidity or humidity.
  • Non-limiting examples of often used stabilisers include monosodium glutamate (MSG) and 2-phenoxyethanol.
  • Preservatives are typically added to prevent serious adverse side effects such as infection with bacteria or viruses grown in the vaccine during production or storage.
  • preservatives include antibiotics, formaldehyde, phenoxyethanol or thiomersal, which are usually added to vials of vaccine that contain more than one dose to prevent contamination and growth of potentially harmful bacteria/viruses.
  • compositions comprising such pharmaceutically acceptable carriers, stabilisers and/or preservatives can be formulated by well known conventional methods.
  • the present invention further relates to a vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, for use as a vaccine.
  • the vector has to be a vector suitable for expression of the nucleic acid molecule in the host cell(s), i.e. after application of the vector as the vaccine.
  • the vector comprises a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, as also discussed herein above.
  • the vector comprises said nucleic acid molecule "in expressible form", i.e. in a form that enables the expression of the respective expression product encoded by said nucleic acid molecule. Expression of a nucleic acid molecule can be ensured, for example, by employing regulatory elements, as discussed herein above.
  • the vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof does not comprise the entire MERS-CoV genome, such that the vector does not comprise or represent a whole MERS-CoV.
  • the vector is a virus.
  • viruses include vaccinia viruses, avipoxviruses, adenoviruses, alphaviruses, rhabdoviruses, herpesviruses, influenza viruses, polio viruses, arboviruses, astroviruses, bacteriophages, enteroviruses, gastroenteritis viruses, hantaviruses, coxsackie viruses, hepatitis A viruses, hepatitis B viruses, hepatitis C viruses, norwalk viruses, chordopoxyiridae (i.e., 5 orthopoxviruses), NYVAC, ALVAC, ALVAC(2), fowlpox, reoviruses, rhinoviruses, rotaviruses, retroviruses, baculoviridae, caliciviridae, caulimoviridae, coronaviridae, filoviridae, fla
  • the virus is not MERS-CoV.
  • the vector is selected from the group consisting of vaccinia virus, avipoxvirus, adenovirus, alphavirus, rhabdovirus, and herpesvirus.
  • Vaccinia virus (VACV or W) is a large, complex, enveloped virus belonging to the orthopoxvirus genus in the poxvirus family. It has a linear, double-stranded DNA genome approximately 190 kbp in length, which encodes for ⁇ 250 genes. Vaccinia virus is best known for its role as a vaccine that eradicated the smallpox disease, making it the first human disease to be successfully eradicated by science.
  • Non-limiting examples of vaccinia virus strains to be used as vectors include the modified vaccinia virus Ankara (MVA), as well as Lister/Elstree, Dryvax, New York City Board of Health, EM63, ACAM2000, LC16m8, NYVAC, Tiantan, Western Reserve, Copenhagen or Connaught Laboratories. All these vaccinia strains are well known and described in the art.
  • Avipoxviruses are members of the Poxviridae family, a family of viruses which cause the victim organism to have pox lesions as a symptom. Members of the avipoxvirus genus infect specifically birds and are unable to complete their replication cycle in non-avian species.
  • Non-limiting examples of avipoxviruses include the canarypox virus, as well as fowlpox virus, turkeypox virus, falconpox virus and others. Avipoxviruses are well known and described in the art. Preferably, the avipoxvirus is the canarypox virus.
  • Adenoviruses are medium-sized (90-100 nm), non-enveloped icosahedral viruses composed of a nucleocapsid and a double-stranded linear DNA genome (group I (dsDNA)). Adenoviruses are for example responsible for respiratory diseases, conjunctivitis as well as gastroenteritis. Adenoviruses are commonly used as vectors to administer targeted therapy, for example in the form of recombinant DNA or protein.
  • Non-limiting examples of adenoviruses include human adenoviruses (hAd) such as hAd5 or hAd35, chimpanzee adenoviruses (ChAd) such as ChAd3, ChAd63, and rhesus monkey adenoviruses. All these adenoviruses are well known and described in the art.
  • Alphaviruses belong to the group IV Togaviridae family of viruses, which have a positive sense, single-stranded RNA genome. They are able to infect various vertebrates such as humans, rodents, fish, birds, and larger mammals such as horses as well as invertebrates. Alphavirus particles are enveloped and have a diameter of about 70 nm.
  • alphaviruses include the Semliki Forest virus, as well as Ross River virus, Sindbis virus and Venezuelan equine encephalitis virus, all of which have been used to develop viral vectors for gene delivery.
  • Alphaviruses or alphavirus replicons to be used as vectors are well known and described in the art.
  • the alphavirus is the Semliki Forest virus.
  • Rhabdoviruses are viruses belonging to the family Rhabdoviridae and infect a broad range of hosts throughout the animal and plant kingdoms. Animal rhabdoviruses infect insects, fish, and mammals, including humans. Rhabdoviruses carry their genetic material in the form of negative-sense single-stranded RNA and typically carry genes for five proteins: large protein (L), glycoprotein (G), nucleoprotein (N), phosphoprotein (P), and matrix protein (M). Several genera of rhabdoviruses are known, including viruses of the genera Ephemerovirus, Lyssavirus, Novirhabdovirus, and Vesiculovirus. E.g.
  • the rhabdovirus is the vesicular stomatitis virus strain Indiana, also often referred to as the vesicular stomatitis virus.
  • Herpesviruses belong to a large family of DNA viruses composed of relatively large double- stranded, linear DNA genomes encoding 100-200 genes encased within an icosahedral protein cage (i.e. the capsid) which is wrapped in a protein layer called the tegument containing both viral proteins and viral mRNAs and an envelope, which is a lipid bilayer membrane.
  • herpes simplex virus-1 HSV-1
  • herpes simplex virus-2 HSV-2
  • Varicella zoster virus VZV
  • Epstein-Barr virus EBV
  • Cytomegalovirus CMV
  • Kaposi's sarcoma-associated herpesvirus KSHV
  • the herpesvirus is Cytomegalovirus (CMV).
  • the vector is a vaccinia virus.
  • the vaccinia virus is a modified vaccinia virus Ankara (MVA).
  • MVA modified vaccinia virus Ankara
  • Modified vaccinia virus Ankara is a highly attenuated strain of vaccinia virus that was created by passaging vaccinia virus several hundred times in chicken embryo fibroblasts (CEF), thereby achieving growth selection.
  • MVA shows a characteristic replication defect in mammalian cells (Mayr and Munz 1964; Meyer et al. 1991 ; Sutter and Moss 1992) and, thus, serves as one of the most advanced recombinant poxvirus vectors in preclinical research and human clinical trials for developing new vaccines against infectious disease and cancer (Gilbert 2013; Kremer ef a/. 2012; Volz and Sutter 2013).
  • Means and methods for introducing the nucleic acid molecule in accordance with the invention into a MVA are well known in the art and have been described e.g. in Drexler et al. 2000; Staib et al. 2004; or Kremer et al. 2012 as well as in the appended examples.
  • the nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or immunogenic fragment thereof is introduced into the MVA genome at an intergenic site and under transcriptional control of the vaccinia virus early/late promoter PmH5. More preferably, the nucleic acid molecule is introduced into the MVA genome at intergenic site 069R-070L (genes MVA-069 and MVA-070 as specified in GenBank: AY603355.1 ), as shown in the appended examples.
  • the vector further comprises one or more nucleic acid molecules encoding a compound selected from the group consisting of additional immunogenic compounds and adjuvants.
  • the immunogenic compounds and adjuvants have to be encoded by a nucleic acid molecule in order to be comprised by the vector of the invention.
  • the MERS-CoV N nucleocapsid protein comprises or consists of the amino acid sequence of SEQ ID NO:1 or a functional variant thereof.
  • the term "functional variant”, as used herein, relates to a MERS-CoV N nucleocapsid protein differing in its amino acid sequence from the sequence of SEQ ID NO:1 but retaining or essentially retaining the immunogenic activity of the MERS-CoV N nucleocapsid protein consisting of SEQ ID NO:1.
  • Means and methods for measuring the immunogenic activity of a functional variant of the MERS-CoV N nucleocapsid protein have been detailed herein above with regard to fragments of the MERS-CoV N nucleocapsid protein.
  • the amino acid sequence of the functional variant has at least 85% sequence identity to the amino acid sequence of SEQ ID NO:1 , more preferably at least 90%, such as for example at least 95%, mores preferably 97%, even more preferably at least 98% and most preferably at least 99% sequence identity to the amino acid sequence of SEQ ID NO:1.
  • the term "% sequence identity" describes the number of matches ("hits") of identical amino acids of two or more aligned amino acid sequences as compared to the number of amino acids making up the overall length of the amino acid sequences (or the overall compared part thereof).
  • hits the number of matches of identical amino acids of two or more aligned amino acid sequences as compared to the number of amino acids making up the overall length of the amino acid sequences (or the overall compared part thereof).
  • using an alignment for two or more sequences the percentage of amino acids that are the same or similar may be determined, when the sequences are compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or when manually aligned and visually inspected.
  • NCBI BLAST algorithm is preferably employed in accordance with this invention.
  • the BLASTP program for amino acid sequences uses as default a word length (W) of 3, and an expectation (E) of 10.
  • the cited "% sequence identity with SEQ ID NO:1" is over the entire length of SEQ ID NO:1.
  • additional amino acids extend over the specific sequence either at the N-terminal end or the C-terminal end or both.
  • no more than 500 additional amino acids are present at the N- terminal end and no more than 500 additional amino acids are present at the C-terminal end.
  • no more than 400 such as no more than 300, more preferably no more than 200, such as no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 40, no more than 30, no more than 20 and even more preferably no more than 10 additional amino acids are independently present at either one or both of the N- or C-terminal end. Most preferably, no more than 5 additional amino acids are independently present at either one or both of the N- or C-terminal end.
  • the MERS-CoV N nucleocapsid protein having these additional amino acids retains or essentially retains the immunogenic activity of the MERS-CoV N nucleocapsid protein consisting of the sequence of SEQ ID NO:1 , as defined herein above.
  • the MERS-CoV N nucleocapsid protein in accordance with the present invention is a protein comprising or consisting of the sequence of SEQ ID NO:1. Even more preferably, the MERS-CoV N nucleocapsid protein is a protein consisting of the sequence of SEQ ID NO:1.
  • the MERS-CoV N nucleocapsid protein consisting of the amino acid sequence of SEQ ID NO:1 corresponds to the MERS-CoV N nucleocapsid protein employed in the examples described herein below.
  • said MERS-CoV N nucleocapsid protein is encoded by the nucleic acid sequence shown in SEQ ID NO:2.
  • further nucleic acid sequences are also suitable to encode the amino acid sequence of SEQ ID NO:1. This is due to the degeneracy of the genetic code and the fact that certain host cells may show an improved translation of the desired MERS-CoV N nucleocapsid protein if the encoding nucleic acid sequence is codon optimised for the translational machinery of these particular host cells.
  • the immunogenic fragment of the MERS- CoV N nucleocapsid protein has a length of at least 6 amino acids, as described herein above. In an even more preferred embodiment, the immunogenic fragment of the MERS-CoV N nucleocapsid protein has a length of between 12 and 18 amino acids.
  • the additional immunogenic compound is the MERS-CoV S spike protein and/or an immunogenic fragment thereof.
  • the MERS-CoV S spike protein is a characteristic structural component of the MERS-CoV virion membrane that forms large protruding spikes on the surface of the virus. Its S1 domain mediates binding to dipeptidyl-peptidase 4, which serves as the host cell receptor of MERS- CoV.
  • the MERS-CoV S spike protein is considered a key component of vaccines against coronavirus infection and has recently been shown to be an important component of a candidate vaccine (Song et a/., 2013).
  • immunogenic fragment as provided herein above with regard to the MERS-CoV N protein applies mutatis mutandis to the immunogenic fragment of the MERS-CoV S spike protein.
  • preferred embodiments with regard to e.g. the length of such fragments, methods of determining whether an immunogenic activity is retained and percentages of retained immunogenic activity provided herein above with regard to the MERS-CoV N protein also apply to this immunogenic fragment of the MERS-CoV S spike protein.
  • MVA-MERS-S S protein only
  • MERS-CoV N gene sequences in the composition surprisingly provides an improved immunogenicity as compared to the use of MERS-CoV S spike protein alone.
  • Possible mechanisms underlying this function may be the preferred recognition of MVA-MERS-S+N infected and antigen producing cells by professional antigen presenting cells such as macrophages or dendritic cells, the induction of cytokine responses and/or the improved attraction of immune cells to the site of MVA-MERS- S+N inoculation.
  • the MERS-CoV S spike protein comprises or consists of the amino acid sequence of SEQ ID NO:3 or a functional variant thereof. All of the definitions and preferred embodiments provided herein above apply mutatis mutandis to this embodiment.
  • the MERS-CoV S spike protein consisting of the amino acid sequence of SEQ ID NO:3 corresponds to the MERS-CoV S spike protein employed in the examples described herein below.
  • said MERS-CoV S spike protein is encoded by the nucleic acid sequence shown in SEQ ID NO:4.
  • nucleic acid sequences are also suitable to encode the amino acid sequence of SEQ ID NO:3 and all these nucleic acid sequences are also encompassed herein for use in generating the MERS-CoV S spike protein in accordance with the present invention.
  • the immunogenic fragment of the MERS-CoV S spike protein is the receptor binding domain (RBD) or parts thereof. Most preferably, the immunogenic fragment of the MERS-CoV S spike protein is the receptor binding domain (RBD). This receptor binding domain (RBD) of the MERS-CoV S spike protein is represented by amino acid residues 358 to 588 of the amino acid sequence of SEQ ID NO:3.
  • the present invention further relates to a method of inducing a protective immune response against MERS-CoV, the method comprising administering the immunogenic composition or the vector of the invention to a subject in need thereof.
  • the term "inducing a protective immune response” refers to an activation of the host's immune system to be able to prevent or to respond to a MERS-CoV infection.
  • a vaccination against MERS-CoV is achieved as detailed herein above.
  • the skilled person knows that the effective amount that needs to be administered to an individual in order to induce a protective immune response will, inter alia, depend on the individual to be treated. Such effective amounts can be determined by the skilled person without further ado.
  • each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from.
  • a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I
  • the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C,
  • FIG. 1 Construction of the recombinant virus MVA- E S-S+N. A schematic representation of the genome of MVA-MERS-S is shown on the top. The locations of the major natural deletion sites I to VI are indicated by arrow heads. MVA-MERS-S carries an expression cassette for the MERS-CoV S protein (MERS-S) inserted at the site of the natural deletion site III of the MVA genome.
  • MERS-CoV S protein MERS-CoV S protein
  • Synthetic gene sequences encoding the full-length MERS-CoV N protein were placed under transcriptional control of the synthetic vaccinia virus promoter PmH5 and flanked by MVA DNA sequences (flankl , flank2) to precisely target the insertion of the heterologous sequences to the intergenic site 069R/070L of the MVA-MERS-S genome.
  • the MVA vector piasmid pMERS-N contained gene sequences encoding the green fluorescent protein (GFP) as marker and the short repetitive sequence del derived from the flankl sequence.
  • GFP green fluorescent protein
  • MVA-MERS-S+N was generated by homologous recombination following transfection of vector piasmid DNA (pMERS-N) and co- infection with the clonal recombinant virus MVA-MVA-MERS-S. Double recombinant viruses were isolated in plaque purification passages on chicken embryo fibroblasts through screening for transient coproduction of GFP. The marker gene was removed by intragenomic homologous recombination between the del sequences to yield the final vector virus MVA- MERS-S+N.
  • Figure 2 Characterization of recombinant MVA-MERS-S+N.
  • A PCR analysis of viral DNA to confirm the genetic integrity and genetic stability of final recombinant virus MVA- MERS-S+N.
  • Genomic DNA preparations of non-recombinant MVA (MVA; (1 )) or recombinant MVA-MERS-S (MERS-S; (2)) or double recombinant MVA-MERS-S+N (3) were used.
  • Oligonucleotide primer pairs served to amplify DNA fragments specific for insertions into the sites of deletion III (Del-3) or 069R/070L.
  • Example 1 Methods and Materials
  • Vero cells ATCC CCL-81 were grown in DMEM supplemented with 2mM L-glutamine 10% fetal calf serum (FCS).
  • Modified Vaccinia virus Ankara (MVA, clonal isolate F6) and recombinant MVA were propagated on primary or secondary chicken embryo fibroblasts (CEF) prepared from 1 1-day-old chicken embryos (VALO BioMedia GmbH; eggs from specified pathogen free chicken flocks).
  • CEF were grown in VP-SFM medium (Gibco) under serum free conditions.
  • MVA-MERS-S is a recombinant Modified Vaccinia virus Ankara (MVA) expressing the spike protein of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) (Song, 2013). CEF were used to titrate the infectivity of non-recombinant or recombinant MVA viruses. Titers were determined by plaque assay as described in Kremer M. et al. 2012 and values were reported in plaque forming units (PFU).
  • mice Female BALB/c mice (6 to 10 weeks old) were purchased from Charles River Laboratories (Sulzfeld, Germany). Intramuscular (i.m.) vaccinations were performed by injection of 50 ⁇ of virus suspension containing 10 pfu of MVA, MVA-MERS-S, or MVA-MERS-S+N into the left hind leg. Injections of 50 ⁇ of PBS served as further control. For experimental work mice were housed in an Isocage unit (Tecniplast, Germany) and had free access to food and water. Generation of MVA-MERS-S+N
  • N protein gene sequence (1242 bp) of MERS-CoV 2012 (GenBank accession no. JX869059), flanked by BamHI and Notl restriction sites, was generated by DNA synthesis (Invitrogen Life Technology, Germany) and modified by codon optimization (MERS-N). MERS-N was then used to generate the MVA transfer vector plasmid pMERS-N which directs the insertion of MERS-N under the transcriptional control of the vaccinia virus early/late promoter PmH5 into the intergenic site 069R-070L within the MVA genome.
  • MVA expressing both MERS-S and MERS-N was obtained by homologous recombination, as described previously (Kremer M, et al. 2012). Briefly, MVA-MERS-S+N formed in CEF monolayers (grown in 6-well tissue culture plates) infected with MVA-MERS-S (at moi 0.01 pfu) and transfected with 1 DNA/well of plasmid pMERS-N. After 48 hours cultures from transfection/infection were harvested, freeze-thawed twice and used for reinfection of 6-well CEF monolayers in Iog10 dilutions.
  • CEF cells were infected with wild type or recombinant MVA (MVA, MVA-MERS-S or MVA- MERS-S+N, MOI 1 ). After 24h, total DNA was extracted with QIAamp DNA Mini Kit (QIAGEN, Germany). Elimination of wild-type MVA and correct insertion of the gene of interest within the MVA genome were controlled using PCR and two different primer sets for amplification of DNA fragments specifying (i) the deletion III site including the S gene, and (ii) the 069R/070L intergenic insertion site including the N gene.
  • Monolayers of Vera cells were separately infected with MVA, MVA-MERS-N, MVA-MERS-S or MVA-MERS-S+N. After 24 hours, cells were harvested and cell lysates were prepared for analysis by SDS-PAGE and immunoblotting using MERS-CoV specific polyclonal antibodies. Polyclonal antibodies from an MERS CoV infected cynomolgous macaque were used at 1 :1000 dilution as MERS-CoV antigen specific antibodies. Lysates from Vero cells infected with single recombinant viruses MVA-MERS-S and MVA-MERS-N or infected with non-recombinant MVA served as controls.
  • genomic viral DNA from MVA-MERS-S+N confirmed the precisely targeted and stable insertion of recombinant S and N gene sequences, the proper removal of the marker gene gfp, and the absence of genomic DNA from non-recombinant MVA or from single recombinant virus MVA-MERS-S ( Figure 2A).
  • MVA-MERS-S+N allowed for co-synthesis of the MERS-CoV target antigens S and N.
  • Western blot analysis of protein lysates from MVA-MERS-S+N infected cells clearly revealed the production of the about 210- kDa S protein and the about 45-kDa N protein upon infection with MVA-MERS-S+N ( Figure 2B).
  • mice were vaccinated by a single intramuscular inoculations of 10 8 plaque-forming-units of each virus in physiological saline.
  • Vaccine preparations with non-recombinant MVA or saline only served as controls.
  • the capacity of MVA-MERS-S+N to induce higher levels of MERS- CoV neutralizing antibodies suggests that the co-delivery of the N antigen also enhances the immunogenicity of the MERS-S antigen.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Virology (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Immunology (AREA)
  • Genetics & Genomics (AREA)
  • Mycology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present invention relates to the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine. The present invention further relates to an immunogenic composition comprising the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof. Furthermore, the present invention relates to a vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, for use as a vaccine as well as a method of inducing a protective immune response against MERS-CoV.

Description

A Novel Vaccine against the Middle East Respiratory Syndrome Coronavirus
(MERS-CoV)
The present invention relates to the Middle East Respiratory Syndrome Coronavirus (MERS- CoV) N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine. The present invention further relates to an immunogenic composition comprising the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof. Furthermore, the present invention relates to a vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, for use as a vaccine as well as a method of inducing a protective immune response against MERS-CoV. In this specification, a number of documents including patent applications and manufacturer's manuals is cited. The disclosure of these documents, while not considered relevant for the patentability of this invention, is herewith incorporated by reference in its entirety. More specifically, all referenced documents are incorporated by reference to the same extent as if each individual document was specifically and individually indicated to be incorporated by reference.
Middle East Respiratory Syndrome (MERS) is a viral respiratory illness first reported in Saudi Arabia in 2012 accompanied by fever, cough, and shortness of breath. Most infections were geographically linked to the Middle East, i.e., Jordan, Saudi Arabia, Qatar, and the United Arab Emirates, but cases also occurred in the United Kingdom, Germany, France, and Italy. In the same year, the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) emerged as the causative agent of the infection in humans. At present, human cases of MERS-CoV infections continue to be reported. The virus is thought to persist in animal reservoirs, in particular in dromedary camels, and to cause sporadic zoonotic infections followed by intra- familial or health-care-related transmissions. However, further details on the epidemiology of MERS-CoV infection remain unclear. As of 14 Nov 2014, the global tally of reports by local health authorities worldwide on cases of MERS-CoV was 941 , including 375 deaths (case fatality rate >39 per cent). Treatment of the disease is currently attempted via administration of interferon to reduce viral replication in vitro, or via inhibition of the viral protease. However, so far no medication has been proven to treat MERS-CoV, and treatment is mostly based upon the patient's medical condition.
An alternative approach for the treatment of such virally caused diseases is the development of vaccines to protect from an infection. In this regard, Song et al. 2013 reported the efficient induction of virus-neutralising antibodies against MERS-CoV based on the MERS-CoV spike (S) protein, a characteristic structural component of the virion membrane that forms large protruding spikes on the surface of the virus. Additionally, experimental vaccines also targeting the MERS-CoV S antigen and based on recombinant protein, nanoparticles or an adenovirus vector have been described recently (Ma et al. Vaccine 2014 32:2100-2108; Coleman et al. Vaccine 2014 32:3169-3174; Kim et al. Vaccine 2014 32: 5975-5982). However, despite the fact that a lot of effort is currently being invested into methods of providing treatments, and in particular vaccines, for MERS-CoV, there is still a need to provide additional or improved approaches against this virus.
This need is addressed by the provision of the embodiments characterised in the claims.
Accordingly, the present invention relates to the Middle East Respiratory Syndrome Coronavirus (MERS-CoV) N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine.
The term "Middle East Respiratory Syndrome Coronavirus" is also abbreviated herein as MERS-CoV and is a group IV ((+)ssRNA) virus of the genus betacoronavirus following the nomenclature of the Coronavirus Study group (de Groot 2013). This virus was first described as human coronavirus EMC in 2012 by Zaki et al. (2012), Bermingham et al. (2012), van Boheemen ef al. (2012) as well as Muller et al. 2012. The complete genome of the human betacoronavirus 2c EMC/2012 has been deposited under the GenBank accession number JX869059.2. In addition, the World Health Organization (WHO) maintains a website (see the World Wide Web at who.int/csr/disease/ coronavirus_infections/en/) reporting on the newest developments and information regarding this virus. The "MERS-CoV N nucleocapsid protein", also referred to herein as "MERS-CoV N protein", is a protein of 413 amino acids length that shares a high homology with the N protein of other coronaviruses. The primary role of CoV N protein is the packaging of the genomic viral genome into long, flexible, helical ribonucleoprotein (RNP) complexes, the so-called nucleocapsids or capsids. The nucleocapsid protects the genome and ensures its timely replication and reliable transmission. In addition, studies have indicated that the N proteins of coronavirus also participate in the replication and transcription of viral RNA and interfere with the cell cycle processes of the host cells. Accordingly, CoV N proteins localize to the cytoplasm as well as to the nucleolus of the virus. The N nucleocapsid protein has been described e.g. in Masters & Perlman„Coronaviridae", p. 825-858, Fields Virology, 6th Edition 2013, Knipe DM, Howley PM Eds, Lippincott Williams & Wilkins, Philadelphia or in McBride et al. 2014. The N protein of the human betacoronavirus 2c EMC/2012 is represented by the GenBank accession number AFS88943.1 and is also shown in SEQ ID NO:1. In accordance with the present invention, embodiments wherein the MERS-CoV N protein (or fragment thereof) is present or used in the context of the whole MERS-CoV, i.e. in combination with all other components that make up this virus, are excluded.
The term "immunogenic fragment", as used herein, refers to a fragment of the MERS-CoV N nucleocapsid protein that maintains the ability of the full length MERS-CoV N nucleocapsid protein to elicit an immunogenic reaction i.e. its ability to stimulate the immune system of a subject, such as e.g. a human subject, to recognize it as foreign, destroy it, and subsequently enable the immune system to protect the subject against the disease for which the vaccine has been developed. It is well known in the art that immunogenic protein may be cleaved to yield fragments which retain or essentially retain the immunogenic activity of the full length protein. Such cleavage may include the removal of a given number of N- and/or C-terminal amino acids, or the removal of a number of internal (non-terminal) amino acids. Said number of amino acids to be removed from the termini and/or internal regions may for example be one, two, three, four, five, six, seven, eight, nine, ten, 15, 20, 25, 30, 40, 50 or more than 50. Preferably, the fragment has a length of at least 6 amino acids, more preferably at least 7 amino acids, such as at least 8 amino acids, at least 9 amino acids, at least 10 amino acids, at least 11 amino acids, at least 12 amino acids, at least 13 amino acids, at least 14 amino acids, and most preferably at least 15 amino acids.
Means and methods for determining whether the immunogenic activity is retained are well known in the art and include e.g. experimental means such as the systematic generation of deletion mutants and their assessment in assays for immunogenic activity. For example, an immunogenic reaction of the fragment to be tested can be analysed by standard and routine techniques, e.g. by administering (e.g. via i.v. injection) the fragment of interest to a mammal such as a mouse and analysing the response of immunogenic biood cells and/or factors (e.g. interleukins) after an appropriate time for an immune reaction to occur. This can for example be done by applying serum from the animals inoculated with the fragment to a peptide array comprising the complete antigen. These and other means and methods for determining whether the immunogenic activity is retained are known to the skilled person and have been described in the art.
In accordance with the present invention, the immunogenic activity of a fragment of the MERS-CoV N nucleocapsid protein is essentially retained if at least 60% of the immunogenic activity of the full length MERS-CoV N nucleocapsid protein is retained. Preferably, at least 75% or more preferably at least 80% of the immunogenic activity of the full length MERS-CoV N nucleocapsid protein is retained. More preferred is that at least 90% such as at least 95%, even more preferred at least 98% such as at least 99% of the immunogenic activity of the full length MERS-CoV N nucleocapsid protein is retained. Most preferred is that immunogenic activity is fully, i.e. to 100%, retained. Also in accordance with the invention are fragments having an increased immunogenic activity compared to the full length MERS-CoV N nucleocapsid protein, i.e. more than 100% activity. Preferably, the method to determine whether these percentages of immunogenic activity are retained is by measuring the induction of MERS CoV neutralising antibody titers in serum after immunisation, as shown in the appended examples using mice. A direct comparison of the immunogenic activity of such a fragment can be achieved by carrying out the same experiment using a full length MERS-CoV N nucleocapsid protein as well as the fragment of interest. However, it will be appreciated that standard values for the full length MERS-CoV N nucleocapsid protein may generated in advance and stored for comparison, thereby rendering the parallel comparison unnecessary if the same experimental conditions are observed.
It is also envisaged in accordance with the present invention that a mixture of the full length MERS-CoV N nucleocapsid protein with (a) fragment(s) thereof is employed.
The MERS-CoV N nucleocapsid protein or an immunogenic fragment thereof can be expressed recombinantly by methods known in the art, e.g. by expressing a vector encoding the MERS-CoV N nucleocapsid protein or the fragment thereof in a suitable host and purifying the expressed MERS-CoV N nucleocapsid protein or the fragment thereof.
A large number of suitable methods exist in the art to produce proteins or peptides in appropriate hosts. If the host is a unicellular organism such as a prokaryote, a mammalian or insect cell, the person skilled in the art can revert to a variety of culture conditions. Conveniently, the produced protein is harvested from the culture medium, lysates of the cultured organisms or from isolated (biological) membranes by established techniques. In the case of a multi-cellular organism, the host may be a cell which is part of or derived from a part of the organism, for example said host cell may be the harvestable part of a plant. A preferred method involves the recombinant production of proteins in hosts as indicated above. For example, nucleic acid sequences comprising a polynucleotide encoding the MERS-CoV N nucleocapsid protein or a fragment thereof can be synthesized in vitro by gene synthesis or PCR and inserted into an expression vector. Subsequently a suitable host may be transformed with the expression vector. Thereafter, the host is cultured to produce the desired polypeptide(s), which is/are isolated and purified.
An alternative method for producing the MERS-CoV N nucleocapsid protein or a fragment thereof is in vitro translation of mRNA. Suitable cell-free expression systems for use in accordance with the present invention include rabbit reticulocyte lysate, wheat germ extractj canine pancreatic microsomal membranes, E. coli S30 extract, and coupled transcription/translation systems such as the TNT-system (Promega). These systems allow the expression of recombinant polypeptides upon the addition of cloning vectors, DNA fragments, or RNA sequences containing coding regions and appropriate promoter elements. In addition to recombinant production, the protein or fragments of the invention may be produced synthetically, e.g. by direct peptide synthesis using solid-phase techniques (cf Stewart et al. (1969) Solid Phase Peptide Synthesis; Freeman Co, San Francisco; Merrifield, J. Am. Chem. Soc. 85 (1963), 2149-2154). Synthetic protein synthesis may be performed using manual techniques or by automation. Automated synthesis may be achieved, for example, using the Applied Biosystems 431 A Peptide Synthesizer (Perkin Elmer, Foster City CA) in accordance with the instructions provided by the manufacturer. Various fragments may be chemically synthesized separately and combined using chemical methods to produce the full length molecule. As indicated above, chemical synthesis, such as the solid phase procedure described by Houghton Proc. Natl. Acad. Sci. USA (82) (1985), 5131-5135, can be used. Furthermore, the protein or fragments of the protein of the invention may be produced semi-synthetically, for example by a combination of recombinant and synthetic production. Protein isolation and purification can be achieved by any one of several known techniques; for example and without limitation, ion exchange chromatography, gel filtration chromatography and affinity chromatography, high pressure liquid chromatography (HPLC), reversed phase HPLC, and preparative disc gel electrophoresis. Protein isolation/purification techniques may require modification of the proteins of the present invention using conventional methods. For example, a histidine tag can be added to the protein to allow purification on a nickel column. Other modifications may cause higher or lower activity, permit higher levels of protein production, or simplify purification of the protein.
In accordance with the present invention, the term "nucleic acid molecule", also referred to as nucleic acid sequence herein, includes DNA, such as cDNA or genomic DNA, and RNA. It is understood that the term "RNA" as used herein comprises all forms of RNA including mRNA, tRNA and rRNA. Both, single-strand as well as double-strand nucleic acid molecules are encompassed by this term. Further included are nucleic acid mimicking molecules known in the art such as synthetic or semi-synthetic derivatives of DNA or RNA and mixed polymers, both sense and antisense strands. Such nucleic acid mimicking molecules or nucleic acid derivatives according to the invention include phosphorothioate nucleic acid, phosphoramidate nucleic acid, 2'-0-methoxyethyl ribonucleic acid, morpholino nucleic acid, hexitol nucleic acid (HNA) and locked nucleic acid (LNA) (see Braasch and Corey (2001 ) Chem Biol. 8, 1 ). LNA is an RNA derivative in which the ribose ring is constrained by a methylene linkage between the 2'-oxygen and the 4'-carbon. They may contain additional non-natural or derivatised nucleotide bases, as will be readily appreciated by those skilled in the art.
The nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or a fragment thereof can be combined, preferably in a vector, with additional elements, such as e.g. regulatory elements. Regulatory elements are required to ensure expression of the encoded protein after incorporation thereof in the host cell(s) of the organism to be vaccinated, to thereby synthesize the antigen. Regulatory elements are also required to ensure replication of the nucleic acid molecule in particular in those cases where the newly introduced nucleic acid molecule is present as an extra-chromosomal sequence or where regulation via endogenous regulatory elements is not ensured. Non-limiting examples of regulatory elements include an origin of replication, a promoter as well as terminating sequences. Additional regulatory elements may include translational enhancers and translation initiation codons, Shine- Dalgarno boxes or internal ribosomal entry sites or signal sequences capable of directing the expressed fusion protein to a specific cellular compartment. When the newly introduced nucleic acid molecule is carried by a poxvirus DNA genome, replication is also possible without the presence of an origin of replication.
The promoter initiates transcription of the nucleic acid molecule and can be used to control the level of gene expression, while the terminator sequence ends transcription. Preferably, the promoter should be highly active. It is further preferred that the promoter is a native and conserved promoter that is independent of inducing systems, such as e.g. IPTG or arabinose. Non-limiting examples of promoters include the natural vaccinia virus promoters P7.5 or P11 , the synthetic vaccinia virus early-late promoters sP (Chakrabarti et al. Biotechniques 1997, 23:1094), PmH5 (Wyatt et al. Vaccine 1996 14:1451 ), sPII (Wyatt et al. AIDS Res Hum Retroviruses. 2004 Jun;20(6):645-53), the cytomegalovirus (CMV) promoter, SV40-promoter, RSV-promoter (Rous sarcoma virus), the CAG promoter, the gai10 promoter, human elongation factor 1a-promoter, CMV early enhancer or the SV40-enhancer. Most preferably, the promoter is the synthetic vaccinia virus promoter PmH5 employed in the appended examples.
Non-limiting examples for regulatory elements ensuring transcription termination include the vaccina virus TTTTTNT early termination signal, the SV40-poly-A site or the tk-poly-A site or the SV40, lacZ polyadenylation signals, downstream of the polynucleotide.
Preferably, the vector is a virus, plasmid, cosmid or bacteriophage. The nucleic acid molecule of the present invention may be inserted into any one of several commercially available vectors. Suitable expression vectors which comprise the described regulatory elements are known in the art such as Okayama-Berg cDNA expression vector pcDV1 (Pharmacia), pRc/CMV, pcDNAI , pcDNA3, pSFV1 (In-Vitrogene). Most preferably, the vector is a virus as described in more detail herein below.
The nucleic acid sequences inserted in the vector can e.g. be synthesized by standard chemical synthesis methods, or isolated from natural sources or produced semi-synthetically, i.e. by combining chemical synthesis and isolation from natural sources. Ligation of the coding sequences to transcriptional regulatory elements and/or to other amino acid encoding sequences can be carried out using established methods, such as restriction digests, ligations and molecular cloning. Vector modification techniques belong to the standard techniques in the field of molecular biology and, thus, belong to the scientific knowledge of the skilled person.
The term "vaccine", as used herein, is defined in accordance with the pertinent art and relates to a composition that induces or enhances the protective immunity of an individual to a particular disease caused by a pathogen. Without wishing to be bound by theory, it is believed that a protective immunity arises from the generation of neutralizing antibodies, or from the activation of cytotoxic cells of the immune system, or both.
In order to induce or enhance a protective immunity, the vaccine comprises as an immunogenic antigen a part of the pathogen causing said disease or a nucleic acid molecule encoding this immunogenic antigen. In the present case, the immunogenic antigen is the MERS-CoV N nucleocapsid protein, or an immunogenic fragment thereof (or a mixture of the full length MERS-CoV N nucleocapsid protein with (a) fragment(s) thereof) and the pathogen is MERS-CoV, which causes the Middle East Respiratory Syndrome. Upon contact with the immunogenic antigen, the immune system of the individual is triggered to recognise the immunogenic antigen as foreign and to destroy it. The immune system subsequently remembers the contact with this immunogenic antigen, so that at a later contact with the disease-causing pathogen an easy and efficient recognition and destruction of the pathogen is ensured.
Accordingly, in a preferred embodiment of the present invention, the vaccine is for use in preventing, alleviating and/or treating Middle East Respiratory Syndrome. Preferably, the vaccine is for use in preventing Middle East Respiratory Syndrome. In accordance with the present invention, the vaccine may be in any formulation for vaccines known in the art, such as for example mucosal vaccines, vaccines for intramuscular injection or vaccines for subcutaneous or intradermal injection as well as vaccines for inhalation, such as e.g. as aerosols. Such vaccine formulations are well known in the art. Accordingly, the vaccine may be in liquid, aerosolic, or solid form and may be, inter alia, in the form of (a) solution(s), (a) spray(s), (a) powder(s) or (a) tablet(s) or paste(s).
In accordance with the present invention, it was surprisingly found that the MERS-CoV N nucleocapsid protein is recognised by MERS-CoV-specific antibodies in macaque serum, obtained from an MERS-CoV infected cynomolgous macaque. These findings indicate a particular immunogenicity of the MERS-CoV N nucleocapsid. The MERS-CoV genome contains 301 19 nucleotides, and encodes four major structural proteins, the spike (S) protein, envelope (E) protein and membrane (M) protein, as well as the nucieocapsid (N) protein (van Boheemen et al., 2012). The spike (S) protein has previously been shown to be an important component of a candidate vaccine (Song ef al., 2013) and the co-delivery of several membrane/envelope proteins (i.e. E or M proteins) was found to elicit higher levels of target virus specific immune responses or to elicit better protective capacity (Wyatt, 1996; Stittelaar 2000). However, the now identified role of the N protein comes as a surprise, as previous studies indicated that N proteins of coronaviruses participate in the replication and transcription of viral RNA and interfere with the cell cycle processes of the host cells. As such, the MERS-CoV N nucieocapsid protein is present only at the inside of the virus and inside of the infected cells and, accordingly, would not be expected to be able to trigger a protective immunogenic response of the infected host.
As is shown in the appended examples, novel recombinant viruses of Modified Vaccinia virus Ankara (MVA) stably containing gene sequences encoding the full-length MERS-CoV proteins S and N were constructed. The recombinant MVA viruses amplified to high titers in chicken embryo fibroblasts but failed to grow in human Hela and HaCat cells suggesting their suitability for vaccine development. Vera cells infected with MVA-MERS-SN co-produced an about 210-kDa MERS-CoV S glycoprotein and an about 45 kDa MERS-CoV N nucieocapsid protein. When comparing the detection of both recombinant antigens by serum antibodies raised in MERS-CoV infected macaques, the N protein was much more prominently recognized than the S protein showing a high level of antigenicity of the MERS-CoV N protein. More importantly, intramuscular vaccination of BALB/c mice with MVA-MERS-SN confirmed the particular immunogenicity of the recombinant N protein. Vaccination raised high levels of serum antibodies that reacted with the authentic N protein of MERS-CoV. Moreover, MVA-MERS-SN immunization elicited serum antibodies that neutralized a MERS-CoV in vitro infection more efficiently compared to antibodies induced by vaccination with a recombinant MVA vaccine delivering the S protein only (MVA-MERS-S). Since MVA-MERS-S and MVA- MERS-SN are based on the identical clonal isolate the improved immunogenicity of MVA- MERS-SN is directly related to the presence of MERS-CoV N in the composition.
The present invention further relates to an immunogenic composition comprising the MERS- CoV N nucieocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucieocapsid protein and/or the immunogenic fragment thereof. The term "immunogenic composition", as used herein, relates to a composition capable of eliciting an immunogenic reaction in mammals, preferably in mouse, rat and/or human, most preferably in human. The person skilled in the art can determine immunogenic reactions by standard and routine techniques, as detailed herein above with regard to the determination of an immunogenic activity of proteins or fragments thereof.
In accordance with the present invention, the term "composition" relates to a composition which comprises at least one of the compounds of the invention. The composition of the present invention may, optionally and additionally, comprise further compounds such as e.g. a pharmaceutically acceptable carrier or further molecules capable of altering the characteristics of the compounds of the invention thereby, for example, stabilizing, delaying, modulating and/or activating their function. Non-limiting examples of such compounds are described further below. In accordance with the present invention, the composition does not comprise (or consist of) the whole MERS-CoV, i.e. the MERS-CoV N protein in combination with all other components that make up this virus.
Compositions according to the present invention can be formulated by well known conventional methods. The composition may be in solid, liquid or gaseous form and may be, inter alia, in the form of (a) powder(s), (a) tablet(s), (a) solution(s) or (an) aerosol(s).
These compositions can be administered to a subject at a suitable dose. The dosage regimen will be determined by the attending physician and clinical factors. As is well known in the medical arts, dosages for any one patient depends upon many factors, including the patient's size, body surface area, age, the particular compound to be administered, sex, time and route of administration, general health, and other drugs being administered concurrently. The effective amount for a given situation will readily be determined by routine experimentation and is within the skills and judgement of the ordinary clinician or physician. For example, if the MERS-CoV N protein is the sole immunogenic compound, the effective amount administered per dose will be in the range of about 1 g kg to 10 mg kg of patient body weight, although, as noted above, this will be subject to therapeutic discretion. More preferably, this dose is at least 0.01 mg kg, and most preferably for humans between about 0.01 and 1 mg kg. The particular amounts, as well as the corresponding adjustments in case more than one compound is to be administered, may be determined by conventional tests which are well known to the person skilled in the art. Administration may be once as a single dose or as repeat administrations, such as e.g. a primary immunisation and subsequent boost immunisations. The interval time and amount of boost immunisations required can be determined by the skilled person without further ado. Preferably, the administration comprises a primary immunisation and at least one boost immunisation. More preferably, the boost immunisation is repeated at least twice. Even more preferably, the boost immunisation is repeated weekly, monthly or yearly. The compositions of the invention may be administered orally, intradermally, subcutaneously, intramuscularly, intraperitoneally, topically (as by powders, ointments, drops or transdermal patch), bucally, or as an oral or nasal spray.
The term "comprising", as used throughout the present invention, denotes that further components can be included in addition to the specifically recited components, with the proviso that the sum of all these components does not represent or make up the whole MERS-CoV. However, this term also encompasses that the claimed subject-matter consists of exactly the recited components.
All other definitions and preferred embodiments provided herein above with regard to the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof for use as a vaccine apply mutatis mutandis also to this immunogenic composition of the invention.
Preferably, the immunogenic composition is a vaccine, as defined herein above. In other words, this embodiment of the present invention preferably relates to a composition comprising the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine.
In a preferred embodiment of the immunogenic composition of the invention, the composition further comprises at least one additional compound selected from the group consisting of immunogenic compounds, adjuvants, pharmaceutically acceptable carriers, stabilisers and/or preservatives.
The term "at least one", as used herein, encompasses also at least two, such as at least three, at least four or at least five or more, such as at least ten. It will be appreciated by the skilled person that this term further encompasses exactly one, exactly two, exactly three, exactly four, exactly five or exactly ten.
An immunogenic compound can be any compound, or mixtures of compounds, capable of eliciting an immunogenic reaction, as defined herein above. Preferably, the immunogenic compound is an immunogenic MERS-CoV protein, or a fragment thereof. As discussed herein above, immunogenic MERS-CoV proteins include the S protein, the E protein and M protein as well as the proteins 3, 4a, 4b and 5. These proteins are well known in the art and their amino acid and nucleic acid sequences have been recorded under the following database accession numbers: S protein (GenBank: AFS88936.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence), the E protein (GenBank: AFS88941.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence) and M protein GenBank: AFS88942.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence) as well as the proteins 3 (GenBank: AFS88937.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence), 4a (GenBank: AFS88938.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence), 4b (GenBank: AFS88939.1 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence) and 5 (GenBank: AFS88940.2 for amino acid sequence and GenBank: JX869059.2 for nucleic acid sequence). In addition, the amino acid sequences of these proteins are represented by SEQ ID NOs: 3 and 9 to 14.
It will be appreciated that the MERS-CoV N nucleocapsid protein and an immunogenic fragment thereof are not encompassed by this definition of additional compounds present in the composition of the invention. In other words, in those cases where the composition further comprises an additional compound and said additional compounds is an immunogenic compound, the immunogenic compound is not the MERS-CoV N nucleocapsid protein and is not an immunogenic fragment thereof.
The term "adjuvant", as used herein, relates to one or more compounds that enhance the recipient's immune response to a vaccine. Adjuvants are often added to promote an earlier, more potent response, and/or more persistent immune response to the vaccine, which often allows for a lower vaccine dosage. Non-limiting examples of adjuvants include e.g. aluminium hydroxide and aluminium phosphate, the organic compound Squalene but also compounds such as e.g. ligands of the Toll-like receptors, QS21 , aluminium hydroxide derivates, oil immersions, Lipid A and it's derivates (e.g. monophosphoryl lipid A (MPL), CpG motives, poly l:C dsRNA, Muramyldipeptid (MDP), Freund's Complete Adjuvant (FCA, for non-human use only), Freund's incomplete Adjuvant (FIA, for non-human use only) or MF59C. Such adjuvants are well known in the art.
Preferably, the adjuvants are ligands of the Toll-like receptors (TLR), such as e.g. dsRNA for TLR3, unmethylated CpG oligodesoxynucleotides for TLR9 or flagellin for TLR5. In those cases where the immunogenic composition of the present invention comprises the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, the additional immunogenic compound and/or adjuvant can be admixed thereto by conventional means. For example, an adjuvant such as e.g. CpG oligodesoxynucleotides or poly l:C dsRNA, or a mixture of both, can be directly admixed with the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or with a vector expressing same. Such approaches are known in the art and have been described, e.g. in Berchtold ei a/. 2009.
In those cases where the immunogenic composition of the present invention comprises a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, the additional immunogenic compound or adjuvant can be admixed thereto by conventional means, either as described above, or as (a) separate nucleic acid molecule(s) encoding said additional immunogenic compound or adjuvant. Alternatively, the nucleic acid sequence comprising the nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof may additionally also comprise the nucleic acid molecule(s) encoding said additional immunogenic compound and/or adjuvant. For example, a dsRNA ligand can be encoded on the same vector as the MERS-CoV N antigen, such as e.g. described by Scallan et al. 2012. A further example has been described by Arimilli er al. 2008, who showed that intracellular expression of the TLR5 ligand flagellin by paramyxovirus simian virus 5 (SV5) acts as an adjuvant that enhances the activation of SV5-infected dendritic cells.
The term "pharmaceutically acceptable carrier" relates to non-toxic excipients, including e.g. solid, semisolid or liquid fillers, diluents, binding agents, lubricants, various types of wetting agents, encapsulating material or formulation auxiliaries of any type. Examples of suitable pharmaceutically acceptable carriers are well known in the art and include phosphate buffered saline solutions, water, emulsions, such as oil/water emulsions, various types of wetting agents, sterile solutions, organic solvents including DMSO etc.
Stabilisers are employed to prevent alterations of the vaccine when exposed to e.g. heat, light, acidity or humidity. Non-limiting examples of often used stabilisers include monosodium glutamate (MSG) and 2-phenoxyethanol.
Preservatives are typically added to prevent serious adverse side effects such as infection with bacteria or viruses grown in the vaccine during production or storage. Non-limiting examples of preservatives include antibiotics, formaldehyde, phenoxyethanol or thiomersal, which are usually added to vials of vaccine that contain more than one dose to prevent contamination and growth of potentially harmful bacteria/viruses.
Compositions comprising such pharmaceutically acceptable carriers, stabilisers and/or preservatives can be formulated by well known conventional methods.
The present invention further relates to a vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, for use as a vaccine.
Suitable vectors for nucleic acid expression have been described herein above. The vector has to be a vector suitable for expression of the nucleic acid molecule in the host cell(s), i.e. after application of the vector as the vaccine. To this end, the vector comprises a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, as also discussed herein above. Moreover, the vector comprises said nucleic acid molecule "in expressible form", i.e. in a form that enables the expression of the respective expression product encoded by said nucleic acid molecule. Expression of a nucleic acid molecule can be ensured, for example, by employing regulatory elements, as discussed herein above.
In accordance with the present invention, the vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof does not comprise the entire MERS-CoV genome, such that the vector does not comprise or represent a whole MERS-CoV.
In a preferred embodiment of the vector of the invention, the vector is a virus.
The term "virus" as used herein is well known in the art. Non-limiting examples of viruses include vaccinia viruses, avipoxviruses, adenoviruses, alphaviruses, rhabdoviruses, herpesviruses, influenza viruses, polio viruses, arboviruses, astroviruses, bacteriophages, enteroviruses, gastroenteritis viruses, hantaviruses, coxsackie viruses, hepatitis A viruses, hepatitis B viruses, hepatitis C viruses, norwalk viruses, chordopoxyiridae (i.e., 5 orthopoxviruses), NYVAC, ALVAC, ALVAC(2), fowlpox, reoviruses, rhinoviruses, rotaviruses, retroviruses, baculoviridae, caliciviridae, caulimoviridae, coronaviridae, filoviridae, flaviviridae, hepadnaviridae, nodaviridae, orthomyxoviridae, paramyxoviridae, papovaviridae, parvoviridae, phycodnaviridae, picornaviridae, and togaviridae, and modified viruses originating therefrom. Other viruses are known and described in the art. In accordance with the present invention, the virus is not MERS-CoV. In a further preferred embodiment of the vector of the invention, the vector is selected from the group consisting of vaccinia virus, avipoxvirus, adenovirus, alphavirus, rhabdovirus, and herpesvirus.
Vaccinia virus (VACV or W) is a large, complex, enveloped virus belonging to the orthopoxvirus genus in the poxvirus family. It has a linear, double-stranded DNA genome approximately 190 kbp in length, which encodes for ~ 250 genes. Vaccinia virus is best known for its role as a vaccine that eradicated the smallpox disease, making it the first human disease to be successfully eradicated by science. Non-limiting examples of vaccinia virus strains to be used as vectors include the modified vaccinia virus Ankara (MVA), as well as Lister/Elstree, Dryvax, New York City Board of Health, EM63, ACAM2000, LC16m8, NYVAC, Tiantan, Western Reserve, Copenhagen or Connaught Laboratories. All these vaccinia strains are well known and described in the art. Avipoxviruses are members of the Poxviridae family, a family of viruses which cause the victim organism to have pox lesions as a symptom. Members of the avipoxvirus genus infect specifically birds and are unable to complete their replication cycle in non-avian species.
Non-limiting examples of avipoxviruses include the canarypox virus, as well as fowlpox virus, turkeypox virus, falconpox virus and others. Avipoxviruses are well known and described in the art. Preferably, the avipoxvirus is the canarypox virus.
Adenoviruses are medium-sized (90-100 nm), non-enveloped icosahedral viruses composed of a nucleocapsid and a double-stranded linear DNA genome (group I (dsDNA)). Adenoviruses are for example responsible for respiratory diseases, conjunctivitis as well as gastroenteritis. Adenoviruses are commonly used as vectors to administer targeted therapy, for example in the form of recombinant DNA or protein.
Non-limiting examples of adenoviruses include human adenoviruses (hAd) such as hAd5 or hAd35, chimpanzee adenoviruses (ChAd) such as ChAd3, ChAd63, and rhesus monkey adenoviruses. All these adenoviruses are well known and described in the art.
Alphaviruses belong to the group IV Togaviridae family of viruses, which have a positive sense, single-stranded RNA genome. They are able to infect various vertebrates such as humans, rodents, fish, birds, and larger mammals such as horses as well as invertebrates. Alphavirus particles are enveloped and have a diameter of about 70 nm.
Non-limiting examples of alphaviruses include the Semliki Forest virus, as well as Ross River virus, Sindbis virus and Venezuelan equine encephalitis virus, all of which have been used to develop viral vectors for gene delivery. Alphaviruses or alphavirus replicons to be used as vectors are well known and described in the art. Preferably, the alphavirus is the Semliki Forest virus.
Rhabdoviruses are viruses belonging to the family Rhabdoviridae and infect a broad range of hosts throughout the animal and plant kingdoms. Animal rhabdoviruses infect insects, fish, and mammals, including humans. Rhabdoviruses carry their genetic material in the form of negative-sense single-stranded RNA and typically carry genes for five proteins: large protein (L), glycoprotein (G), nucleoprotein (N), phosphoprotein (P), and matrix protein (M). Several genera of rhabdoviruses are known, including viruses of the genera Ephemerovirus, Lyssavirus, Novirhabdovirus, and Vesiculovirus. E.g. lyssaviruses and vesiculoviruses are developed as vectors and well known and described in the art. Preferably, the rhabdovirus is the vesicular stomatitis virus strain Indiana, also often referred to as the vesicular stomatitis virus.
Herpesviruses belong to a large family of DNA viruses composed of relatively large double- stranded, linear DNA genomes encoding 100-200 genes encased within an icosahedral protein cage (i.e. the capsid) which is wrapped in a protein layer called the tegument containing both viral proteins and viral mRNAs and an envelope, which is a lipid bilayer membrane.
Several subfamilies and genera of herpesviruses are presently known, of which herpes simplex virus-1 (HSV-1 ), herpes simplex virus-2 (HSV-2), Varicella zoster virus (VZV), Epstein-Barr virus (EBV), Cytomegalovirus (CMV) and Kaposi's sarcoma-associated herpesvirus (KSHV) are presently known as herpesviruses causing disease in humans. These herpesviruses are well known and described in the art. Preferably, the herpesvirus is Cytomegalovirus (CMV).
In a more preferred embodiment of the vector of the invention, the vector is a vaccinia virus.
In an even more preferred embodiment, the vaccinia virus is a modified vaccinia virus Ankara (MVA).
Modified vaccinia virus Ankara (MVA) is a highly attenuated strain of vaccinia virus that was created by passaging vaccinia virus several hundred times in chicken embryo fibroblasts (CEF), thereby achieving growth selection. MVA shows a characteristic replication defect in mammalian cells (Mayr and Munz 1964; Meyer et al. 1991 ; Sutter and Moss 1992) and, thus, serves as one of the most advanced recombinant poxvirus vectors in preclinical research and human clinical trials for developing new vaccines against infectious disease and cancer (Gilbert 2013; Kremer ef a/. 2012; Volz and Sutter 2013).
Means and methods for introducing the nucleic acid molecule in accordance with the invention into a MVA are well known in the art and have been described e.g. in Drexler et al. 2000; Staib et al. 2004; or Kremer et al. 2012 as well as in the appended examples.
Preferably, the nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or immunogenic fragment thereof is introduced into the MVA genome at an intergenic site and under transcriptional control of the vaccinia virus early/late promoter PmH5. More preferably, the nucleic acid molecule is introduced into the MVA genome at intergenic site 069R-070L (genes MVA-069 and MVA-070 as specified in GenBank: AY603355.1 ), as shown in the appended examples.
In another preferred embodiment of the vector of the invention, the vector further comprises one or more nucleic acid molecules encoding a compound selected from the group consisting of additional immunogenic compounds and adjuvants.
It will be appreciated that with regard to this preferred embodiment, the immunogenic compounds and adjuvants have to be encoded by a nucleic acid molecule in order to be comprised by the vector of the invention. The definitions provided herein above with regard to additional immunogenic compounds and adjuvants, as well as nucleic acid molecule encoding same, apply mutatis mutandis also to this preferred embodiment.
In a further preferred embodiment of the invention, the MERS-CoV N nucleocapsid protein comprises or consists of the amino acid sequence of SEQ ID NO:1 or a functional variant thereof.
The term "functional variant", as used herein, relates to a MERS-CoV N nucleocapsid protein differing in its amino acid sequence from the sequence of SEQ ID NO:1 but retaining or essentially retaining the immunogenic activity of the MERS-CoV N nucleocapsid protein consisting of SEQ ID NO:1. Means and methods for measuring the immunogenic activity of a functional variant of the MERS-CoV N nucleocapsid protein have been detailed herein above with regard to fragments of the MERS-CoV N nucleocapsid protein. The same definitions and preferred embodiments, including the percentage of immunogenic activity that is considered to fall under the terms "retained or essentially retained immunogenic activity" apply mutatis mutandis to functional variants of the MERS-CoV N nucleocapsid proteins having additional amino acids. Preferably, the amino acid sequence of the functional variant has at least 85% sequence identity to the amino acid sequence of SEQ ID NO:1 , more preferably at least 90%, such as for example at least 95%, mores preferably 97%, even more preferably at least 98% and most preferably at least 99% sequence identity to the amino acid sequence of SEQ ID NO:1.
In accordance with the present invention, the term "% sequence identity" describes the number of matches ("hits") of identical amino acids of two or more aligned amino acid sequences as compared to the number of amino acids making up the overall length of the amino acid sequences (or the overall compared part thereof). In other terms, using an alignment, for two or more sequences the percentage of amino acids that are the same or similar may be determined, when the sequences are compared and aligned for maximum correspondence over a window of comparison, or over a designated region as measured using a sequence comparison algorithm as known in the art, or when manually aligned and visually inspected. Those having skill in the art know how to determine percent sequence identity between sequences using, for example, algorithms such as those based on the NCBI BLAST algorithm, CLUSTAL W computer program or FASTA, as known in the art. The NCBI BLAST algorithm is preferably employed in accordance with this invention. The BLASTP program for amino acid sequences uses as default a word length (W) of 3, and an expectation (E) of 10. The BLOSUM62 scoring matrix uses alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands.
Preferably, the cited "% sequence identity with SEQ ID NO:1" is over the entire length of SEQ ID NO:1. In those embodiments where the MERS-CoV N nucleocapsid protein comprises (rather than consists of) the sequence of SEQ ID NO:1 or a functional variant thereof, additional amino acids extend over the specific sequence either at the N-terminal end or the C-terminal end or both. Preferably, no more than 500 additional amino acids are present at the N- terminal end and no more than 500 additional amino acids are present at the C-terminal end. More preferably no more than 400, such as no more than 300, more preferably no more than 200, such as no more than 100, no more than 90, no more than 80, no more than 70, no more than 60, no more than 50, no more than 40, no more than 30, no more than 20 and even more preferably no more than 10 additional amino acids are independently present at either one or both of the N- or C-terminal end. Most preferably, no more than 5 additional amino acids are independently present at either one or both of the N- or C-terminal end. In those cases where such additional amino acids are comprised in the MERS-CoV N nucleocapsid protein, it is preferred that the MERS-CoV N nucleocapsid protein having these additional amino acids retains or essentially retains the immunogenic activity of the MERS-CoV N nucleocapsid protein consisting of the sequence of SEQ ID NO:1 , as defined herein above.
Preferably, the MERS-CoV N nucleocapsid protein in accordance with the present invention is a protein comprising or consisting of the sequence of SEQ ID NO:1. Even more preferably, the MERS-CoV N nucleocapsid protein is a protein consisting of the sequence of SEQ ID NO:1.
The MERS-CoV N nucleocapsid protein consisting of the amino acid sequence of SEQ ID NO:1 corresponds to the MERS-CoV N nucleocapsid protein employed in the examples described herein below. Preferably, said MERS-CoV N nucleocapsid protein is encoded by the nucleic acid sequence shown in SEQ ID NO:2. However, it will be appreciated that further nucleic acid sequences are also suitable to encode the amino acid sequence of SEQ ID NO:1. This is due to the degeneracy of the genetic code and the fact that certain host cells may show an improved translation of the desired MERS-CoV N nucleocapsid protein if the encoding nucleic acid sequence is codon optimised for the translational machinery of these particular host cells. All these nucleic acid sequences are also encompassed herein for use in generating the MERS-CoV N nucleocapsid protein in accordance with the present invention. In another preferred embodiment of the invention, the immunogenic fragment of the MERS- CoV N nucleocapsid protein has a length of at least 6 amino acids, as described herein above. In an even more preferred embodiment, the immunogenic fragment of the MERS-CoV N nucleocapsid protein has a length of between 12 and 18 amino acids.
In another preferred embodiment of the immunogenic composition or the vector of the invention, the additional immunogenic compound is the MERS-CoV S spike protein and/or an immunogenic fragment thereof.
The MERS-CoV S spike protein is a characteristic structural component of the MERS-CoV virion membrane that forms large protruding spikes on the surface of the virus. Its S1 domain mediates binding to dipeptidyl-peptidase 4, which serves as the host cell receptor of MERS- CoV. The MERS-CoV S spike protein is considered a key component of vaccines against coronavirus infection and has recently been shown to be an important component of a candidate vaccine (Song et a/., 2013).
The definition of the term "immunogenic fragment" as provided herein above with regard to the MERS-CoV N protein applies mutatis mutandis to the immunogenic fragment of the MERS-CoV S spike protein. Moreover, the preferred embodiments with regard to e.g. the length of such fragments, methods of determining whether an immunogenic activity is retained and percentages of retained immunogenic activity provided herein above with regard to the MERS-CoV N protein also apply to this immunogenic fragment of the MERS-CoV S spike protein.
As shown in the appended examples, intramuscular vaccination of BALB/c mice using a recombinant MVA virus stably containing gene sequences encoding the full-length MERS- CoV proteins S and N elicited serum antibodies that neutralized a MERS-CoV in vitro infection more efficiently compared to antibodies induced by vaccination with a recombinant MVA vaccine delivering the S protein only (MVA-MERS-S). At present, it is not known how the N protein - which is believed to be present only at the inside of the virus and inside of the infected cells - triggers an immunogenic response of the infected host. Nonetheless, the present findings clearly show that the additional presence of the MERS-CoV N gene sequences in the composition surprisingly provides an improved immunogenicity as compared to the use of MERS-CoV S spike protein alone. Possible mechanisms underlying this function may be the preferred recognition of MVA-MERS-S+N infected and antigen producing cells by professional antigen presenting cells such as macrophages or dendritic cells, the induction of cytokine responses and/or the improved attraction of immune cells to the site of MVA-MERS- S+N inoculation.
In a more preferred embodiment of the immunogenic composition or the vector of the invention the MERS-CoV S spike protein comprises or consists of the amino acid sequence of SEQ ID NO:3 or a functional variant thereof. All of the definitions and preferred embodiments provided herein above apply mutatis mutandis to this embodiment.
The MERS-CoV S spike protein consisting of the amino acid sequence of SEQ ID NO:3 corresponds to the MERS-CoV S spike protein employed in the examples described herein below. Preferably, said MERS-CoV S spike protein is encoded by the nucleic acid sequence shown in SEQ ID NO:4. However, it will be appreciated that further nucleic acid sequences are also suitable to encode the amino acid sequence of SEQ ID NO:3 and all these nucleic acid sequences are also encompassed herein for use in generating the MERS-CoV S spike protein in accordance with the present invention.
In an even more preferred embodiment, the immunogenic fragment of the MERS-CoV S spike protein is the receptor binding domain (RBD) or parts thereof. Most preferably, the immunogenic fragment of the MERS-CoV S spike protein is the receptor binding domain (RBD). This receptor binding domain (RBD) of the MERS-CoV S spike protein is represented by amino acid residues 358 to 588 of the amino acid sequence of SEQ ID NO:3.
The present invention further relates to a method of inducing a protective immune response against MERS-CoV, the method comprising administering the immunogenic composition or the vector of the invention to a subject in need thereof.
In accordance with the present invention, the term "inducing a protective immune response" refers to an activation of the host's immune system to be able to prevent or to respond to a MERS-CoV infection. By administering the immunogenic composition or the vector of the invention to a subject, a vaccination against MERS-CoV is achieved as detailed herein above. As also detailed above, the skilled person knows that the effective amount that needs to be administered to an individual in order to induce a protective immune response will, inter alia, depend on the individual to be treated. Such effective amounts can be determined by the skilled person without further ado.
Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In case of conflict, the patent specification, including definitions, will prevail. All the sequences accessible through the Database Accession numbers cited herein are within the scope of the present invention irrespective of whether the entry of the respective Accession No. is completely identical to the sequence displayed by the corresponding SEQ ID NO due to potential future updates in the database. Thus, this is to account for future corrections and modifications in the entries of GenBank, which might occur due to the continuing progress of science.
As regards the embodiments characterised in this specification, in particular in the claims, it is intended that each embodiment mentioned in a dependent claim is combined with each embodiment of each claim (independent or dependent) said dependent claim depends from. For example, in case of an independent claim 1 reciting 3 alternatives A, B and C, a dependent claim 2 reciting 3 alternatives D, E and F and a claim 3 depending from claims 1 and 2 and reciting 3 alternatives G, H and I, it is to be understood that the specification unambiguously discloses embodiments corresponding to combinations A, D, G; A, D, H; A, D, I; A, E, G; A, E, H; A, E, I; A, F, G; A, F, H; A, F, I; B, D, G; B, D, H; B, D, I; B, E, G; B, E, H; B, E, I; B, F, G; B, F, H; B, F, I; C, D, G; C, D, H; C, D, I; C, E, G; C, E, H; C, E, I; C, F, G; C, F, H; C, F, I, unless specifically mentioned otherwise.
Similarly, and also in those cases where independent and/or dependent claims do not recite alternatives, it is understood that if dependent claims refer back to a plurality of preceding claims, any combination of subject-matter covered thereby is considered to be explicitly disclosed. For example, in case of an independent claim 1 , a dependent claim 2 referring back to claim 1 , and a dependent claim 3 referring back to both claims 2 and 1 , it follows that the combination of the subject-matter of claims 3 and 1 is clearly and unambiguously disclosed as is the combination of the subject-matter of claims 3, 2 and 1 . In case a further dependent claim 4 is present which refers to any one of claims 1 to 3, it follows that the combination of the subject-matter of claims 4 and 1 , of claims 4, 2 and 1 , of claims 4, 3 and 1 , as well as of claims 4, 3, 2 and 1 is clearly and unambiguously disclosed.
The above considerations apply mutatis mutandis to all appended claims. To give a non- limiting example, the combination of claims 8, 7 and 6 is clearly and unambiguously envisaged in view of the claim structure. The same applies for example to the combination of claims 8 and 4, etc..
The figures show:
Figure 1 : Construction of the recombinant virus MVA- E S-S+N. A schematic representation of the genome of MVA-MERS-S is shown on the top. The locations of the major natural deletion sites I to VI are indicated by arrow heads. MVA-MERS-S carries an expression cassette for the MERS-CoV S protein (MERS-S) inserted at the site of the natural deletion site III of the MVA genome. Synthetic gene sequences encoding the full-length MERS-CoV N protein (MERS-N) were placed under transcriptional control of the synthetic vaccinia virus promoter PmH5 and flanked by MVA DNA sequences (flankl , flank2) to precisely target the insertion of the heterologous sequences to the intergenic site 069R/070L of the MVA-MERS-S genome. In addition, the MVA vector piasmid pMERS-N contained gene sequences encoding the green fluorescent protein (GFP) as marker and the short repetitive sequence del derived from the flankl sequence. MVA-MERS-S+N was generated by homologous recombination following transfection of vector piasmid DNA (pMERS-N) and co- infection with the clonal recombinant virus MVA-MVA-MERS-S. Double recombinant viruses were isolated in plaque purification passages on chicken embryo fibroblasts through screening for transient coproduction of GFP. The marker gene was removed by intragenomic homologous recombination between the del sequences to yield the final vector virus MVA- MERS-S+N. Figure 2: Characterization of recombinant MVA-MERS-S+N. (A) PCR analysis of viral DNA to confirm the genetic integrity and genetic stability of final recombinant virus MVA- MERS-S+N. Genomic DNA preparations of non-recombinant MVA (MVA; (1 )) or recombinant MVA-MERS-S (MERS-S; (2)) or double recombinant MVA-MERS-S+N (3) were used. Oligonucleotide primer pairs served to amplify DNA fragments specific for insertions into the sites of deletion III (Del-3) or 069R/070L. The PCR products obtained with MVA-MERS-S+N (3) template DNA confirm the precisely targeted insertion of recombinant S and N gene sequences, the proper removal of the marker gene gfp, and the absence of genomic DNA from non-recombinant MVA or single recombinant MVA-MERS-S. (B) Western blot analysis of protein lysates from infected Vero cells with MERS-CoV specific polyclonal antibodies reveals the co-synthesis of the about 210-kDa S protein (*) and the about 45-kDa N protein (**) upon infection with MVA-MERS-S+N (4). Lysates from Vero cells infected with single recombinant viruses MVA-MERS-S (MERS-S, (2)) and MVA-MERS-N (3) or infected with non-recombinant MVA (1 ) served as controls. Figure 3: Enhanced immunogenicity of MVA-MERS-S+N. Sera from BALB/c mice vaccinated with MVA-MERS-S+N demonstrate higher activities to neutralize MERS-CoV in tissue culture infections as compared to sera from vaccinated with single recombinant virus MVA-MERS-S. Mice vaccinated with non-recombinant MVA or saline served as controls and showed no neutralization activity (data not shown). All vaccines were given as a single intramuscular inoculation of 108 plaque-forming-units of virus in physiological saline.
The examples illustrate the invention: Example 1 : Methods and Materials
Cells and virus
Vero cells (ATCC CCL-81 ) were grown in DMEM supplemented with 2mM L-glutamine 10% fetal calf serum (FCS). Modified Vaccinia virus Ankara (MVA, clonal isolate F6) and recombinant MVA were propagated on primary or secondary chicken embryo fibroblasts (CEF) prepared from 1 1-day-old chicken embryos (VALO BioMedia GmbH; eggs from specified pathogen free chicken flocks). CEF were grown in VP-SFM medium (Gibco) under serum free conditions. MVA-MERS-S is a recombinant Modified Vaccinia virus Ankara (MVA) expressing the spike protein of Middle East Respiratory Syndrome Coronavirus (MERS-CoV) (Song, 2013). CEF were used to titrate the infectivity of non-recombinant or recombinant MVA viruses. Titers were determined by plaque assay as described in Kremer M. et al. 2012 and values were reported in plaque forming units (PFU).
Mice.
Female BALB/c mice (6 to 10 weeks old) were purchased from Charles River Laboratories (Sulzfeld, Germany). Intramuscular (i.m.) vaccinations were performed by injection of 50μΙ of virus suspension containing 10 pfu of MVA, MVA-MERS-S, or MVA-MERS-S+N into the left hind leg. Injections of 50μΙ of PBS served as further control. For experimental work mice were housed in an Isocage unit (Tecniplast, Germany) and had free access to food and water. Generation of MVA-MERS-S+N
The full length nucleocapsid (N) protein gene sequence (1242 bp) of MERS-CoV 2012 (GenBank accession no. JX869059), flanked by BamHI and Notl restriction sites, was generated by DNA synthesis (Invitrogen Life Technology, Germany) and modified by codon optimization (MERS-N). MERS-N was then used to generate the MVA transfer vector plasmid pMERS-N which directs the insertion of MERS-N under the transcriptional control of the vaccinia virus early/late promoter PmH5 into the intergenic site 069R-070L within the MVA genome.
MVA expressing both MERS-S and MERS-N (MVA-MERS-S+N) was obtained by homologous recombination, as described previously (Kremer M, et al. 2012). Briefly, MVA-MERS-S+N formed in CEF monolayers (grown in 6-well tissue culture plates) infected with MVA-MERS-S (at moi 0.01 pfu) and transfected with 1 DNA/well of plasmid pMERS-N. After 48 hours cultures from transfection/infection were harvested, freeze-thawed twice and used for reinfection of 6-well CEF monolayers in Iog10 dilutions. Co-expression of the fluorescent marker protein GFP (under control of the vaccinia virus late promoter P11 ) was used to isolate clonal recombinant viruses MVA-MERS-S+N by screening for fluorescent cell foci during repetitive plaque purification. Virus stocks and vaccine preparations were amplified on CEF cells grown under serum free conditions. Characterization of recombinant MVA
CEF cells were infected with wild type or recombinant MVA (MVA, MVA-MERS-S or MVA- MERS-S+N, MOI 1 ). After 24h, total DNA was extracted with QIAamp DNA Mini Kit (QIAGEN, Germany). Elimination of wild-type MVA and correct insertion of the gene of interest within the MVA genome were controlled using PCR and two different primer sets for amplification of DNA fragments specifying (i) the deletion III site including the S gene, and (ii) the 069R/070L intergenic insertion site including the N gene. Primers used were (i) MVA_Del3-F (5'- GATGAGTGTAGATGCTGTTATTTTG (SEQ ID NO:5)) and MVA_Del3-R (5 - G CAG CTAAAAG AATAATG G AATTG (SEQ ID NO:6)), (ii) MVA_069R (5 - ATTCTCGCTGAGGAG TTGG (SEQ ID NO: 7)) and MVA_070L (5 - GTCGTGTCTACAAAAGGAG (SEQ ID NO:8)). The synthesis of S and N proteins upon infection with MVA-MERS-S+N was assessed by Western blotting. Monolayers of Vera cells were separately infected with MVA, MVA-MERS-N, MVA-MERS-S or MVA-MERS-S+N. After 24 hours, cells were harvested and cell lysates were prepared for analysis by SDS-PAGE and immunoblotting using MERS-CoV specific polyclonal antibodies. Polyclonal antibodies from an MERS CoV infected cynomolgous macaque were used at 1 :1000 dilution as MERS-CoV antigen specific antibodies. Lysates from Vero cells infected with single recombinant viruses MVA-MERS-S and MVA-MERS-N or infected with non-recombinant MVA served as controls.
Results
The analysis of genomic viral DNA from MVA-MERS-S+N confirmed the precisely targeted and stable insertion of recombinant S and N gene sequences, the proper removal of the marker gene gfp, and the absence of genomic DNA from non-recombinant MVA or from single recombinant virus MVA-MERS-S (Figure 2A). Importantly, MVA-MERS-S+N allowed for co-synthesis of the MERS-CoV target antigens S and N. Western blot analysis of protein lysates from MVA-MERS-S+N infected cells clearly revealed the production of the about 210- kDa S protein and the about 45-kDa N protein upon infection with MVA-MERS-S+N (Figure 2B). Both recombinant proteins are expressed in MVA-MERS-S+N by the identical viral promoter (PmH5) for transcription regulation and therefore to quantitatively very comparable levels. Surprisingly, the MERS-CoV specific antibodies in the macaque serum preferentially recognize the N antigen. This data suggests that this MERS-CoV antigen is highly immunogenic because large amounts of N antigen-specific antibodies were apparently elicited upon infection. Moreover, sera from BALB/c mice vaccinated with MVA-MERS-S+N demonstrate higher activities to neutralize MERS-CoV in tissue culture infections as compared to sera from vaccinated with single recombinant virus MVA-MERS-S (Figure 3). Briefly, groups of mice (n=3) were vaccinated by a single intramuscular inoculations of 108 plaque-forming-units of each virus in physiological saline. Vaccine preparations with non-recombinant MVA or saline only served as controls. The capacity of MVA-MERS-S+N to induce higher levels of MERS- CoV neutralizing antibodies suggests that the co-delivery of the N antigen also enhances the immunogenicity of the MERS-S antigen. Further references
Arimilli D, Johnson JB, Clark KM, Graff AH, Alexander-Miller MA, Mizel SB, and Parks GD.
2008. Engineered Expression of the TLR5 Ligand Flagellin Enhances Paramyxovirus Activation of Human Dendritic Cell Function. J. Virol. 82(22): 10975. DOI: 10.1128/JVI.01288-08.
Berchtold C, Panthel K, Jellbauer S, Kohn B, Roider E, Partilla M, Heesemann J, Endres S, Bourquin C and Russmann H. 2009. Superior Protective Immunity against Murine Listeriosis by Combined Vaccination with CpG DNA and Recombinant Salmonella enterica Serovar Typhimurium. Infect. Immun. 77(12):5501. DOI: 10.1128/IAI.00700-09.
Bermingham A, Brown MA, Aarons E, Tong C, Langrish C, Hoschler K, Brown K, Galiano M, Myers R, Pebody RG, Green HK, Boddington NL, Gopal R, Price N, Newsholme W, Drosten C, Fouchier RA, Zambon M. 2012. Severe respiratory illness caused by a novel coronavirus, in a patient transferred to United Kingdom from the Middle East. Euro Surveill. 17: pii_20290.
Coleman CM, Liu YV, Mu H, Taylor JK, Massare M, Flyer DC, Glenn GM, Smith GE, Frieman MB. 2014. Purified coronavirus spike protein nanoparticles induce coronavirus neutralizing antibodies in mice. Vaccine 32:3169-3174; de Groot RJ, Baker SC, Baric RS, Brown CS, Drosten C, Enjuanes L, Fouchier RA, Galiano M, Gorbalenya AE, Memish ZA, Perlman S, Poon LL, Snijder EJ, Stephens GM, Woo PC, Zaki AM, Zambon M, Ziebuhr J. Middle East respiratory syndrome coronavirus (MERS- CoV): announcement of the Coronavirus Study Group. J Virol. 2013 Jul;87(14):7790-2. doi: 10.1128/JVI.01244-13. Epub 2013 May 15
Drexler I, Heller K, Ohlmann M, Erfle V, Sutter G. Recombinant Vaccinia Virus MVA for Generation and Analysis of T Cell Responses Against Tumor Associated Antigens. Methods Mol Med. 2000;35:57-73;
Gilbert SC. 2013. Clinical development of modified vaccinia virus Ankara vaccines. Vaccine 31 :4241-4246.
Kim E, Okada K, Kenniston T, Raj VS, AIHajri MM, Farag EA, AIHajri F, Osterhaus AD, Haagmans BL, Gambotto A. 2014. Immunogenicity of an adenoviral-based Middle East Respiratory Syndrome coronavirus vaccine in BALB/c mice. Vaccine 32: 5975-5982 Kremer M, Volz A, Kreijtz JCM, Fux R, Lehmann M, Sutter G. 2012. Easy and efficient protocols for working with recombinant vaccinia virus MVA. Methods Mol. Biol. 890:59-92.
Ma C, Li Y, Wang L, Zhao G, Tao X, Tseng CT, Zhou Y, Du L, Jiang S. 2014. Intranasal vaccination with recombinant receptor-binding domain of MERS-CoV spike protein induces much stronger local mucosal immune responses than subcutaneous immunization: Implication for designing novel mucosal MERS vaccines. Vaccine 32:2100-2108;
Masters & Perlman„Coronaviridae", p. 825-858, Fields Virology, 6th Edition 2013, Knipe DM, Howley PM Eds, Lippincott Williams & Wilkins, Philadelphia.
Mayr A, Munz E. 1964. Veranderung von Vaccinevirus durch Dauerpassagen in Huhnerembryofibroblastenkulturen. Zentralbl. Bakteriol. B. 195: 24-35. McBride R, van Zyl M, Fielding BC. The coronavirus nucleocapsid is a multifunctional protein. Viruses. 2014 Aug 7;6(8):2991-3018. doi: 10.3390Λ/6082991.
Meyer H, Sutter G, Mayr A. 1991. Mapping of deletions in the genome of the highly attenuated vaccinia virusMVAand their influence on virulence. J. Gen. Virol. 72:1031-1038.
Muller MA, Raj VS, Muth D, Meyer B, Kallies S, Smits SL, Woliny R, Bestebroer TM, Specht S, Suliman T, Zimmermann K, Binger T, Eckerle I, Tschapka M, Zaki AM, Osterhaus AD, Fouchier RA, Haagmans BL, Drosten C. Human coronavirus EMC does not require the SARS-coronavirus receptor and maintains broad replicative capability in mammalian cell lines. MBio. 2012 Dec 11 ;3(6). pii: e00515-12. doi: 10.1128/mBio.00515-12.
Song F, Fux R, Provacia LB, Volz A, Eickmann M, Becker S, Osterhaus ADME, Haagmans BL, Sutter G. J. Virol. 2013. Middle East Respiratory Syndrome Coronavirus Spike Protein Delivered by Modified Vaccinia Virus Ankara Efficiently Induces Virus-Neutralizing Antibodies J Virol. 87 (21 ): 11950-11954
Stitteiaar KJ, Wyatt LS, de Swart RL, Vos HW, Groen J, van Amerongen G, van Binnendijk RS, Rozenblatt S, Moss B, Osterhaus AD. 2000. Protective immunity in macaques vaccinated with a modified vaccinia virus Ankara-based measles virus vaccine in the presence of passively acquired antibodies. J Virol. May;74(9):4236-43.
Scallana CD, Tingleya DW, Lindblooma JD, Toomeyb JS, and Tuckera SN. 2013. An Adenovirus-Based Vaccine with a Double-Stranded RNA Adjuvant Protects Mice and Ferrets against H5N1 Avian Influenza in Oral Delivery Models. Clin Vaccine Immunol. January vol. 20(1 ): 85-94.
Staib C, Drexler I, Sutter G. Construction and isolation of recombinant MVA. Methods Mol Biol. 2004;269:77-100; Sutter G, Moss B. 1992. Nonreplicating vaccinia vector efficiently expresses recombinant genes. Proc. Natl. Acad. Sci. U. S. A. 89:10847-10851. van Boheemen S, de Graaf M, Lauber C, Bestebroer TM, Raj VS, Zaki AM, Osterhaus AD, Haagmans BL, Gorbalenya AE, Snijder EJ, Fouchier RA. 2012. Genomic characterization of a newly discovered coronavirus associated with acute respiratory distress syndrome in humans. mBio 3(6):e00473-12. doi:10.1128/mBio.00473-12.
Volz A, Sutter G. 2013. Protective efficacy of modified vaccinia virus Ankara in preclinical studies. Vaccine 31 :4235-4240.
Wyatt LS, Shors ST, Murphy BR, Moss B. Development of a replication-deficient recombinant vaccinia virus vaccine effective against parainfluenza virus 3 infection in an animal model. Vaccine. 1996 Oct; 14(15): 1451 -8 Zaki AM, van Boheemen S, Bestebroer TM, Osterhaus AD, Fouchier RAM. 2012. Isolation of a novel coronavirus from a man with pneumonia in Saudi Arabia. N. Engl. J. Med. 367:1814-1820.

Claims

Middle East Respiratory Syndrome Coronavirus (MERS-CoV) N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof, for use as a vaccine.
An immunogenic composition comprising the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, or a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or the immunogenic fragment thereof.
The immunogenic composition of claim 2, wherein the composition further comprises at least one additional compound selected from the group consisting of immunogenic compounds, adjuvants, and pharmaceutically acceptable carriers, stabilisers and/or preservatives.
A vector comprising a nucleic acid molecule encoding the MERS-CoV N nucleocapsid protein and/or an immunogenic fragment thereof, for use as a vaccine.
The vector of claim 4, wherein the vector is selected from the group consisting of vaccinia virus, avipoxvirus, adenovirus, alphavirus, rhabdovirus, and herpesvirus.
The vector of claim 5, wherein the vector is a vaccinia virus.
The vaccinia virus of claim 6, wherein the vaccinia virus is a modified vaccinia virus Ankara (UNA).
The vector of any one of claims 4 to 7, wherein the vector further comprises at least one additional nucleic acid molecule encoding a compound selected from the group consisting of immunogenic compounds and adjuvants.
The MERS-CoV N nucleocapsid protein, and/or the immunogenic fragment thereof, or the nucleic acid molecule of claim 1 , or the immunogenic composition of claim 2 or 3, or the vector of any one of claims 4 to 8, wherein the MERS-CoV N nucleocapsid protein comprises or consists of the amino acid sequence of SEQ ID NO:1 or a functional variant thereof.
10. The MERS-CoV N nucleocapsid protein, and/or the immunogenic fragment thereof, or the nucleic acid molecule of claim 1 , or the immunogenic composition of claim 2 or 3 or 9, or the vector of any one of claims 4 to 9, wherein the immunogenic fragment of the MERS-CoV N nucleocapsid protein has a length of at least 6 amino acids.
11. The MERS-CoV N nucleocapsid protein, and/or immunogenic fragment thereof, or the nucleic acid molecule, or the immunogenic composition, or the vector of claim 10, wherein the immunogenic fragment of the MERS-CoV N nucleocapsid protein has a length of between 12 and 18 amino acids.
12. The immunogenic composition of claim 2, 3 or 9 to 11 or the vector of any one of claims 4 to 11 , wherein the additional immunogenic compound is the MERS-CoV S spike protein and/or an immunogenic fragment thereof.
13. The immunogenic composition or the vector of claim 12, wherein the MERS-CoV S spike protein comprises or consists of the amino acid sequence of SEQ ID NO:3 or a functional variant thereof.
14. A method of inducing a protective immune response against MERS-CoV, the method comprising administering the immunogenic composition of claim 2 or 3 or 9 to 13, or the vector of any one of claims 4 to 13 to a subject in need thereof.
PCT/EP2016/050888 2015-01-19 2016-01-18 A novel vaccine against the middle east respiratory syndrome coronavirus (mers-cov) Ceased WO2016116398A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP15151594.7 2015-01-19
EP15151594.7A EP3045181B1 (en) 2015-01-19 2015-01-19 A novel vaccine against the middle east respiratory syndrome coronavirus (MERS-CoV)

Publications (1)

Publication Number Publication Date
WO2016116398A1 true WO2016116398A1 (en) 2016-07-28

Family

ID=52345149

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2016/050888 Ceased WO2016116398A1 (en) 2015-01-19 2016-01-18 A novel vaccine against the middle east respiratory syndrome coronavirus (mers-cov)

Country Status (2)

Country Link
EP (1) EP3045181B1 (en)
WO (1) WO2016116398A1 (en)

Cited By (17)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20190119391A (en) * 2018-04-12 2019-10-22 한국생명공학연구원 WHOLE PROTEIN GENE OF MERS-CoV NUCLEOPROTEIN AND VACCINE COMPOSITION FOR PREVENTING INFECTION OF MERS-CoV COMPRISING THE SAME
CN112321688A (en) * 2021-01-06 2021-02-05 广东华南疫苗股份有限公司 Stable coronavirus recombinant protein dimer and its expression vector
WO2021000968A3 (en) * 2020-02-23 2021-02-18 广州恩宝生物医药科技有限公司 Adenovirus carrier vaccine used for preventing sars-cov-2 infection
WO2021179371A1 (en) * 2020-03-10 2021-09-16 河北精硕生物科技有限公司 Novel coronavirus n-s dominant epitope fusion protein, preparation method therefor and application thereof, expression protein, microorganism, application thereof and kit
EP3928789A1 (en) * 2020-06-24 2021-12-29 Consejo Superior de Investigaciones Científicas (CSIC) Mva-based vaccine against covid-19 expressing sars-cov-2 antigens
WO2021260065A1 (en) * 2020-06-24 2021-12-30 Consejo Superior De Investigaciones Científicas (Csic) Mva-based vaccine against covid-19 expressing sars-cov-2 antigens
WO2022003719A2 (en) 2020-07-03 2022-01-06 Indian Institute Of Science POLYPEPTIDE FRAGMENTS, IMMUNOGENIC COMPOSITION AGAINST SARS-CoV-2, AND IMPLEMENTATIONS THEREOF
CN114829608A (en) * 2020-11-20 2022-07-29 北京震旦鼎泰生物科技有限公司 Fusion gene, recombinant novel coronavirus high-efficiency immune DNA vaccine, and construction method and application thereof
CN115552011A (en) * 2020-03-11 2022-12-30 免疫生物公司 COVID-19 treatment and methods
JP2023515582A (en) * 2020-02-26 2023-04-13 トニックス ファーマ リミテッド A recombinant poxvirus-based vaccine against the SARS-CoV-2 virus
CN116234815A (en) * 2020-06-18 2023-06-06 高端疫苗生物制剂股份有限公司 Anti-new coronavirus immune composition
JP2023526073A (en) * 2020-05-17 2023-06-20 シティ・オブ・ホープ Synthetic modified vaccinia Ankara (sMVA)-based coronavirus vaccine
US12285481B2 (en) 2020-03-11 2025-04-29 Nantcell, Inc. Methods for the treatment of COVID-19 comprising administering replication-defective adenoviruses encoding the SARS-CoV-2 spike glycoprotein and modified nucleocapsid protein
US12285480B2 (en) 2020-03-11 2025-04-29 Nantcell, Inc. Method of inducing immunity against SARS-CoV-2 using spike and nucleocapsid-ETSD immunogens delivered by RNA and replication-defective adenoviruses
US12290558B2 (en) 2020-03-11 2025-05-06 Immunitybio, Inc. SARS-CoV-2 vaccines comprising human adenovirus vectors encoding spike and nucleocapsid-ETSD immunogens
US12529699B2 (en) 2020-04-17 2026-01-20 Regeneron Pharmaceuticals, Inc Detection assays for coronavirus neutralizing antibodies
US12577589B2 (en) 2020-02-14 2026-03-17 Geovax, Inc. Vaccines and uses thereof to induce an immune response to SARS-CoV2

Families Citing this family (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2019535311A (en) 2016-11-02 2019-12-12 デイビッド エバンス, Synthetic chimeric poxvirus
WO2019066389A1 (en) * 2017-09-26 2019-04-04 한국생명공학연구원 Nc fusion protein comprising n-terminal domain fragment and c-terminal domain fragment of nucleocapsid protein of mers coronavirus, and kit for diagnosing mers coronavirus infection by using same
EP3788142A4 (en) 2018-05-02 2022-04-27 Tonix Pharma Holdings Limited SYNTHETIC CHIMERIC VACCINIA VIRUS
CN110616198B (en) * 2018-06-19 2021-02-19 清华大学 A novel coronavirus vaccine based on chimpanzee adenovirus type 68 and MERS-CoV full-length membrane protein
US20230226170A1 (en) * 2020-05-12 2023-07-20 Greffex, Inc. Engineering coronavirus spike proteins as vaccine antigens, their design and uses
US20230241202A1 (en) * 2020-05-29 2023-08-03 University Of Pittsburgh - Of The Commonwealth System Of Higher Education Adenovirus-Based SARS-CoV-2 Vaccine
AU2021309238A1 (en) * 2020-07-17 2023-02-23 Geneone Life Science, Inc. Vaccine composition for preventing severe acute respiratory syndrome coronavirus 2 infection
US20230270844A1 (en) * 2020-07-22 2023-08-31 Greffex, Inc. Multivalent beta-coronavirus vaccines, their designs and uses

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014045254A2 (en) * 2012-09-23 2014-03-27 Erasmus University Medical Center Rotterdam Human betacoronavirus lineage c and identification of n-terminal dipeptidyl peptidase as its virus receptor

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2015081155A1 (en) * 2013-11-29 2015-06-04 The Trustees Of The University Of Pennsylvania Mers-cov vaccine

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014045254A2 (en) * 2012-09-23 2014-03-27 Erasmus University Medical Center Rotterdam Human betacoronavirus lineage c and identification of n-terminal dipeptidyl peptidase as its virus receptor

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
"Human betacoronavirus 2c EMC/2012, complete genome, GeneBank accession number JX869059", EMBL, 20 November 2012 (2012-11-20), XP002727344 *
ARWEN ALTENBURG ET AL: "Modified Vaccinia Virus Ankara (MVA) as Production Platform for Vaccines against Influenza and Other Viral Respiratory Diseases", VIRUSES, vol. 6, no. 7, 17 July 2014 (2014-07-17), pages 2735 - 2761, XP055200206, DOI: 10.3390/v6072735 *
ASISA VOLZ ET AL: "Protective Efficacy of Recombinant Modified Vaccinia Virus Ankara Delivering Middle East Respiratory Syndrome Coronavirus Spike Glycoprotein", JOURNAL OF VIROLOGY., vol. 89, no. 16, 27 May 2015 (2015-05-27), US, pages 8651 - 8656, XP055257600, ISSN: 0022-538X, DOI: 10.1128/JVI.00614-15 *
F. SONG ET AL: "Middle East Respiratory Syndrome Coronavirus Spike Protein Delivered by Modified Vaccinia Virus Ankara Efficiently Induces Virus-Neutralizing Antibodies", JOURNAL OF VIROLOGY, vol. 87, no. 21, 1 November 2013 (2013-11-01), pages 11950 - 11954, XP055157123, ISSN: 0022-538X, DOI: 10.1128/JVI.01672-13 *
RACHEL L. GRAHAM ET AL: "A decade after SARS: strategies for controlling emerging coronaviruses", NATURE REVIEWS MICROBIOLOGY, vol. 11, no. 12, 11 November 2013 (2013-11-11), pages 836 - 848, XP055200225, ISSN: 1740-1526, DOI: 10.1038/nrmicro3143 *
RUTH MCBRIDE ET AL: "The Coronavirus Nucleocapsid Is a Multifunctional Protein", VIRUSES, vol. 6, no. 8, 7 August 2014 (2014-08-07), pages 2991 - 3018, XP055200197, DOI: 10.3390/v6082991 *
S. VAN BOHEEMEN ET AL: "Genomic Characterization of a Newly Discovered Coronavirus Associated with Acute Respiratory Distress Syndrome in Humans", MBIO, vol. 3, no. 6, 20 November 2012 (2012-11-20), pages e00473 - 12, XP055128733, ISSN: 2150-7511, DOI: 10.1128/mBio.00473-12 *

Cited By (23)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR102047072B1 (en) * 2018-04-12 2019-11-20 한국생명공학연구원 WHOLE PROTEIN GENE OF MERS-CoV NUCLEOPROTEIN AND VACCINE COMPOSITION FOR PREVENTING INFECTION OF MERS-CoV COMPRISING THE SAME
KR20190119391A (en) * 2018-04-12 2019-10-22 한국생명공학연구원 WHOLE PROTEIN GENE OF MERS-CoV NUCLEOPROTEIN AND VACCINE COMPOSITION FOR PREVENTING INFECTION OF MERS-CoV COMPRISING THE SAME
US12577589B2 (en) 2020-02-14 2026-03-17 Geovax, Inc. Vaccines and uses thereof to induce an immune response to SARS-CoV2
WO2021000968A3 (en) * 2020-02-23 2021-02-18 广州恩宝生物医药科技有限公司 Adenovirus carrier vaccine used for preventing sars-cov-2 infection
JP2023515582A (en) * 2020-02-26 2023-04-13 トニックス ファーマ リミテッド A recombinant poxvirus-based vaccine against the SARS-CoV-2 virus
WO2021179371A1 (en) * 2020-03-10 2021-09-16 河北精硕生物科技有限公司 Novel coronavirus n-s dominant epitope fusion protein, preparation method therefor and application thereof, expression protein, microorganism, application thereof and kit
CN115552011B (en) * 2020-03-11 2025-03-18 南特细胞公司 COVID-19 treatment and its methods
US12285481B2 (en) 2020-03-11 2025-04-29 Nantcell, Inc. Methods for the treatment of COVID-19 comprising administering replication-defective adenoviruses encoding the SARS-CoV-2 spike glycoprotein and modified nucleocapsid protein
CN115552011A (en) * 2020-03-11 2022-12-30 免疫生物公司 COVID-19 treatment and methods
US12290558B2 (en) 2020-03-11 2025-05-06 Immunitybio, Inc. SARS-CoV-2 vaccines comprising human adenovirus vectors encoding spike and nucleocapsid-ETSD immunogens
US12285480B2 (en) 2020-03-11 2025-04-29 Nantcell, Inc. Method of inducing immunity against SARS-CoV-2 using spike and nucleocapsid-ETSD immunogens delivered by RNA and replication-defective adenoviruses
US12529699B2 (en) 2020-04-17 2026-01-20 Regeneron Pharmaceuticals, Inc Detection assays for coronavirus neutralizing antibodies
US12584146B2 (en) 2020-05-17 2026-03-24 City Of Hope Synthetic modified vaccinia Ankara (SMVA) based coronavirus vaccines
JP7788403B2 (en) 2020-05-17 2025-12-18 シティ・オブ・ホープ Synthetic modified vaccinia ankara (sMVA)-based coronavirus vaccine
JP2023526073A (en) * 2020-05-17 2023-06-20 シティ・オブ・ホープ Synthetic modified vaccinia Ankara (sMVA)-based coronavirus vaccine
CN116348132A (en) * 2020-05-17 2023-06-27 希望之城 Coronavirus vaccine based on synthetic modified vaccinia Ankara (SMVA)
CN116234815A (en) * 2020-06-18 2023-06-06 高端疫苗生物制剂股份有限公司 Anti-new coronavirus immune composition
EP3928789A1 (en) * 2020-06-24 2021-12-29 Consejo Superior de Investigaciones Científicas (CSIC) Mva-based vaccine against covid-19 expressing sars-cov-2 antigens
WO2021260065A1 (en) * 2020-06-24 2021-12-30 Consejo Superior De Investigaciones Científicas (Csic) Mva-based vaccine against covid-19 expressing sars-cov-2 antigens
WO2022003719A2 (en) 2020-07-03 2022-01-06 Indian Institute Of Science POLYPEPTIDE FRAGMENTS, IMMUNOGENIC COMPOSITION AGAINST SARS-CoV-2, AND IMPLEMENTATIONS THEREOF
CN114829608B (en) * 2020-11-20 2023-11-24 北京震旦鼎泰生物科技有限公司 Fusion gene, recombinant novel coronavirus efficient immune DNA vaccine, construction method and application thereof
CN114829608A (en) * 2020-11-20 2022-07-29 北京震旦鼎泰生物科技有限公司 Fusion gene, recombinant novel coronavirus high-efficiency immune DNA vaccine, and construction method and application thereof
CN112321688A (en) * 2021-01-06 2021-02-05 广东华南疫苗股份有限公司 Stable coronavirus recombinant protein dimer and its expression vector

Also Published As

Publication number Publication date
EP3045181A1 (en) 2016-07-20
EP3045181B1 (en) 2018-11-14

Similar Documents

Publication Publication Date Title
EP3045181B1 (en) A novel vaccine against the middle east respiratory syndrome coronavirus (MERS-CoV)
CN113666990B (en) A T cell vaccine immunogen inducing broad-spectrum anti-coronavirus and its application
JP5933565B2 (en) Recombinant modified vaccinia virus Ankara influenza vaccine
Zheng et al. Construction and immunogenicity of a recombinant fowlpox virus containing the capsid and 3C protease coding regions of foot-and-mouth disease virus
TW201713358A (en) Recombinant viral vector containing PRRSV microprotein, preparation method and use thereof
Vijaysri et al. Vaccinia viruses with mutations in the E3L gene as potential replication-competent, attenuated vaccines: intra-nasal vaccination
Weyer et al. Generation and evaluation of a recombinant modified vaccinia virus Ankara vaccine for rabies
EP3307309A1 (en) Recombinant modified vaccinia virus ankara (mva) foot and mouth disease virus (fmdv) vaccine
KR20230010663A (en) Recombinant vaccine against COVID-19 based on a paramyxovirus viral vector
KR20230022206A (en) Recombinant Modified Vaccinia Virus Ankara (MVA) Vaccine Against Coronavirus Disease
CA2583147C (en) Chimeric vectors
US6942855B2 (en) Viral vectors having reduced virulence
CN114375199A (en) African Swine Fever Vaccine
Zeshan et al. Protective immune responses induced by in ovo immunization with recombinant adenoviruses expressing spike (S1) glycoprotein of infectious bronchitis virus fused/co-administered with granulocyte-macrophage colony stimulating factor
WO2025044919A2 (en) New dev vectors
WO2025044922A2 (en) Vectored dev avian influenza h9 vaccines
WO2007115385A2 (en) Transfer plasmidic vector and recombinant canarypox virus
KR102332656B1 (en) Recombinant Newcastle Disease Virus vector including H9 hemaglutinin and recombinant virus made therefrom
US10081796B2 (en) Neutralization-resistant CDV mutants and viral vectors
Tiwari et al. Advances and applications of vectored vaccines in animal diseases
WO2025044920A2 (en) New dev vectors for avian vaccines
CN105586319B (en) Replicative vaccinia virus vector AIDS vaccine
Li et al. Deletion of multiple genes induces virulence reduction of vaccinia virus Tiantan strain
RU2819672C2 (en) African swine fever vaccine
WO2007102140A2 (en) A semliki forest virus replication competent vector with enhanced biosafety

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 16700969

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 16700969

Country of ref document: EP

Kind code of ref document: A1