WO2016113322A1 - Genetically modified vibrio cholerae strains and uses thereof - Google Patents

Abstract

The invention relates to a genetically modified Vibrio cholerae strain comprising i) a mutation suppressing the phage replication activity of Uvr D, ii) a mutation preventing the expression of functional HupA and HupB, and/or iii) a mutation preventing the expression of functional hupB, wherein when the strain comprises a mutation preventing the expression of functional HupB, the V. cholera strain preferably also expresses an RstR polypeptide and further comprises a distinct mutation consisting of an attRS deletion, a knockout mutation in rstA and/or a knockout mutation in rstB. Compositions comprising such a strain are also herein described as well as their uses typically for the prevention or treatment of a subject against a Vibrio cholerae infection.

Description

GENETICALLY MODIFIED VIBRIO CHOLERAE STRAINS AND USES THEREOF

FIELD OF THE INVENTION

The invention relates to the field of medicine, in particular prevention and treatment of cholera. The invention more particularly relates to a genetically modified Vibrio cholerae strain comprising i) a mutation suppressing the phage replication activity of UvrD, ii) a mutation preventing the expression of functional HupA (HUa) and HupB (ΗΙΙβ), and/or iii) a mutation preventing the expression of functional HupB, wherein when the strain comprises a mutation preventing the expression of functional HupB, the V. cholerae strain preferably also expresses an RstR polypeptide and further comprises a distinct mutation consisting of an attRS deletion, a knockout mutation in rstA and/or a knockout mutation in rstB.

The strain is resistant to infection by any filamentous phage expressing a HUH endonuclease selected from the Repjrans protein family (PF02486), in particular a phage selected from CTX(|), VGJ(|), VEJ(|) and any variant or combination thereof. Compositions comprising such a strain are also herein described as well as their uses typically for the prevention or treatment of a subject against a Vibrio cholerae infection.

BACKGROUND

Cholera remains a major health problem in many part of the developing world, with an estimation of 2.8 million cases and 100 000 to 200 000 deaths each year [1]. In 2011, recognizing that cholera was not sufficiently addressed despite its prevalence in epidemic forms in both endemic and non endemic areas, the World Health Assembly called for a comprehensive approach to cholera control, including the development of oral cholera vaccines (http://www.who.int/wer).

The agent of the cholera, the Gram-negative Vibrio cholerae bacterium, is found in briny waters all over the world [2] . However, most V. cholerae strains are not pathogenic or only cause local outbreaks of gastroenteritis. Pathogenicity depends on the acquisition of several virulence factors, of which the cholera toxin (CT) and the toxin-coregulated pilus (TCP) are considered the most significant. CT causes a voluminous watery diarrhoea, which is responsible for the high rate of death associated with cholera and its epidemic propagation [3], while TCP is required for colonization of the small intestine [4] . The most promising live attenuated V. cholerae vaccine strains have been obtained by the deletion of one or both of the cholera toxin genes, ctxAB [5-8]. However, ctxAB are encoded in the genome of a lysogenic filamentous phage, CTX(|) [9]. Constant and rapid emergence of strains harbouring new ctxAB and/or new CTX(|) variants in environmental and clinical isolates suggest that CTX(|) infection events are frequent [10-12]. This raised safety concerns about the use of ctxAB- V. cholerae cells in a vaccine since they could promote the apparition of cholera symptoms in previously asymptomatic individuals and participate in the spreading of (ϋΤΧφ in the environment when re -infected in the intestinal track (Figure 1A).

(ϋΤΧφ depends on TCP and the TolQRA cell division proteins to infect V. cholerae [9,13] (Figure IB, (1)). Once delivered in the cytoplasm of the cell, the circular single-stranded DNA (ssDNA) genome of the phage can be converted into a double stranded DNA (dsDNA) replicative form by the host machinery, which permits genome amplification by rolling-circle replication (RCR) and the production of new phage particles [14,15] (Figure IB, (2), (3) and (4)). RCR depends on a single phage-encoded protein, RstA (Figure IB). The rest of the process is driven by the host machinery [16]. RstA is an HUH endonuclease [17]. It creates a 5'-phosphotyrosine intermediate and a free 3'-OH at a specific cleavage site of the replicative form of CTX(|), ori(+), to prime replication (Figure IB). RstA production is under the control of the host SOS response [18] (Figure IB, (5)) and of a phage-encoded repressor, RstR [16] (Figure 1C). In addition to phage particle production, RCR participates in the vertical transmission of ctxAB in the lineage of infected cells (Figure IB). However, vertical transmission is also assured by the integration of CTX(|) into the genome of its host [9] (Figure IB). CTX(|) exploits a chromosomally encoded site-specific recombination (Xer) machinery for integration [19,20] (Figure IB). The Xer machinery normally serves to resolve dimers of the circular chromosomes by the addition of a crossover at a specific site, dif [21,22]. In V. cholerae, as in most bacteria, it consists of two tyrosine recombinases, XerC and XerD. The attachment site of the phage, attPCTX, consists in the stem of a hairpin of its single stranded DNA genome [23,24] (Figure IB). XerC catalyzes the formation of a Holliday Junction (HJ) between attPCTX and the dif site of one or the other of the two circular chromosomes of V. cholerae [23,24] (Figure IB, (6)). Replication converts the HJ intermediate into product [23-25]. The process is facilitated by EndoIII, a host- encoded base excision repair enzyme, which inhibits XerC catalysis once the HJ has been formed [25] (Figure IB, (7)). Nevertheless, the integration of non-replicative forms of CTX(|) is inefficient [25]. In contrast, the integration of replicative forms is very efficient and almost always leads to multiple tandem insertions, which suggests that it occurs after several rounds of amplification of the phage genome by RCR [25,26] (Figure IB). Multiple tandem insertions are permitted because a functional dif site is re-created on the right side of the prophage [20] (Figure IB). Tandem insertions are crucial for the life cycle of CTX(|) because dsDNA conversion masks the Xer recombination site on the left side of the prophage, which impedes excision [23] (Figure IB). Production of new free copies of the phage genome then depends on a process analogous to RCR between tandem prophage copies [15] (Figure IB, (8)).

The importance of RCR in the life cycle of CTX(|) makes it an attractive target to limit the risks for vaccine cells to re-acquire ctxAB and participate in their dispersion in the environment. Indeed, to inventor's knowledge, the best vaccine cell protection strategy proposed to date was based on the observation that production of RstR from a resident CTX(|) prophage provided immunity against secondary infections by blocking initial rounds of RCR [27] (Figure 1C). However, this strategy has several limitations. First, several (ϋΤΧφ variants exist that harbour different RstR repressors and cross- immunity is not assured among them [28] (Figure 1C). Second, (ϋΤΧφ interacts with other Integrative Mobile Element exploiting Xer (IMEX). Two of them, the RSI satellite phage and fs2, harbour an anti-repressor, RstC [29,30] (Figure 1C). Third, hybrid phage formation between (ϋΤΧφ and other IMEXs, such a νθΐφ, can circumvent both the requirement for TCP expression and repressor immunity [31-34] (Figure 1C). Finally, tandem (ϋΤΧφ genomes can be transduced by lytic phages, such as CP-T1 [35].

Host factors implicated in the replication of the E. coli filamentous phages are either essential, such as DNA polymerase III, or crucial to the proliferation of the cells, such as the Rep helicase [14,26]. However, marked differences in the life cycles of (ϋΤΧφ and of the proto-typical filamentous phages of enterobacteriaceae, including its ability to integrate into the genome of its host, the control exerted by the host SOS response on RstA production [18] (Figure IB) and the requirement for a host-encoded protein for (ϋΤΧφ particle secretion [36] (Figure IB), suggested that it might not be so for (ϋΤΧφ. Inventors screened for non-essential host factors involved in (ϋΤΧφ replication and found that the histone-like protein HU [37] was essential for (ϋΤΧφ replication because it was necessary for RstA to introduce a nick in the phage genome at ori(+). They further found that in place of Rep, (ϋΤΧφ exploited UvrD, a DNA helicase mainly involved in DNA repair [38]. Finally, they found that HU and UvrD were implicated in the replication of other Vibrio filamentous phages, such a νθΐφ. SUMMARY OF THE INVENTION

Inventors herein describe for the first time a genetically modified Vibrio cholerae strain resistant to infection by a filamentous phage expressing a HUH endonuclease selected from the Rep trans protein family (PF02486) such as a lysogenic filamentous phage selected from (ϋΤΧφ, νθ φ, νΕ φ and any variant or combination thereof, in particular a genetically modified Vibrio cholerae strain resistant to infection by (ϋΤΧφ and any variant thereof.

The genetically modified Vibrio cholerae strain comprises i) a mutation suppressing the phage replication activity of UvrD, ii) a mutation preventing the expression of functional HupA and HupB, and/or iii) a mutation preventing the expression of functional HupB. When the strain comprises a mutation preventing the expression of functional HupB, the V. cholera strain advantageously also expresses an RstR polypeptide and/or comprises a distinct mutation consisting of an attRS deletion, a knockout mutation in rstA and/or a knockout mutation in rstB.

Herein described are strains for use as a pharmaceutical agent or as an adjuvant. These strains are typically for use for immunizing a subject. These strains are also typically for use in a composition, preferably a vaccine composition.

A particular composition is an immunogenic composition for use for the immunization of a subject against Vibrio cholerae, said composition comprising a genetically modified Vibrio cholerae strain as herein described, optionally together with (into association with) a pharmaceutically acceptable carrier and/or any delivery system designed to deliver said strain in a viable state to the intestinal tract.

Also described are methods for the prevention or treatment of cholera or symptoms thereof in a subject, comprising administering to said subject an immunogenically effective dose of a strain or composition according to the invention, as well as kits for implementing such methods.

DETAILED DESCRIPTION

The Vibrio cholerae bacterium is the agent of cholera. The cholera toxin production, which is responsible for the deadly diarrhea associated with cholera epidemics, is allowed by the expression of the cholera toxin genes, which are harboured in the genome of an integrated filamentous phage, CTX(|).

One of the major strategies to prevent Cholera epidemics in endemic and non-endemic regions of the world is the development of oral vaccines based on live attenuated Vibrio cholerae strains. The most promising of these strains have been obtained by deletion of the cholera toxin genes. However, vaccine cells can re-acquire these genes if they are re-infected by ΟΤΧφ or by hybrid phages between ΟΤΧφ and other vibrio phages, which raised safety concerns about their use.

Based on these observations, inventors have developed and herein describe new attenuated Vibrio cholera vaccine strains which are safe, i.e. which are not at risk of promoting the apparition of cholera symptoms in previously asymptomatic individuals or of participating in the spreading of ΟΤΧφ in the environment, contrary to imperfect oral vaccines based on live attenuated Vibrio cholerae strains available before date.

More specifically, inventors herein describe the identification of non-essential host factors implicated in ΟΤΧφ replication. They found that the histone-like HU protein and the UvrD helicase were both absolutely required for the replication of ΟΤΧφ. They further found that they were also essential for the replication of νθ φ, a representative member of a family of phages that can form hybrids with ΟΤΧφ. Accordingly, they demonstrated that the disruption of the two subunits of HU and/or of UvrD prevented infection of the cells by ΟΤΧφ and νθΤφ. In addition, they showed that it prevented the cells from producing ΟΤΧφ particles. Taken together, these results demonstrate that HU- and/or UvrD- cells can be efficiently used to develop safe live attenuated Vibrio cholera vaccine strains.

Inventors herein provide stable genetically modified (mutant) Vibrio cholerae strains and stable compositions/formulations comprising such strains producing sustained and efficient immune response (protection) in vivo against cholera. This means that when use as a vaccine these strains are expected to confer substantially close to 100% efficacy in humans against subsequent infection with a V. cholerae strain whatever the strain's serotype or biotype. A "stable" composition or formulation is one in which the biologically active material (the strain) therein essentially retains its physical stability, chemical stability, and/or biological activity upon storage. Stability can be measured at a selected temperature and humidity conditions for a selected time period. Trend analysis can be used to estimate an expected shelf life before a material has actually been in storage for that time period. For live bacteria, for example, stability may be defined as the time it takes to lose 1 log of CFU/g dry formulation under predefined conditions of temperature, humidity and time period.

The strains and compositions of the invention are far safer than vaccine strains available to date since, contrary to the last, they are resistant to infection by filamentous phage expressing a HUH endonuclease selected from the Rep trans protein family (PF02486) such as a lysogenic filamentous phage selected from (ϋΤΧφ, VGJ(|), VEJ(|) and any variant or combination thereof, in particular resistant to infection by (ϋΤΧφ and any variant thereof.

The herein described genetically modified strains comprise i) a mutation suppressing phage replication activity of UvrD, ii) a mutation preventing the expression of functional HupA (HUa) and HupB (Ηυβ), and/or iii) a mutation preventing the expression of functional HupB. When the strain comprises a mutation preventing the expression of functional HupB, the V. cholera strain preferably also expresses an RstR polypeptide and further comprises a distinct mutation consisting of an attRS deletion, a knockout mutation in rstA and/or a knockout mutation in rstB.

In the context of the invention:

- the hupA nucleic acid sequence consists in or is substantially identical to SEQ ID NO: l and the hupB nucleic acid sequence consists in or is substantially identical to SEQ ID NO:2. hupA (also herein identified as VC0273) and hupB (also herein identified as VC1919) respectively encodes HUa and Ηυβ, the two subunits of the histone-like HU protein expressed in V. cholerae;

- the uvrd nucleic acid sequence consists in or is substantially identical to SEQ ID NO:3 (also herein identified as VC0190). uvrd encodes the V. cholerae UvrD helicase.

- the rstR nucleic acid sequence consists in or is substantially identical to SEQ ID NO:4 (also herein identified as rstR N16961) or SEQ ID NO:5 (also herein identified as rstR 0395). The RstR polypeptide represses RstA, increases resistance to (ϋΤΧφ transduction and/or reduces (ϋΤΧφ transduction. By "(ϋΤΧφ transduction" is meant the ability of the (ϋΤΧφ to enter a V. cholerae bacterium and be retained therein, either as an extrachromosomal plasmid, or as exogenous DNA integrated into the V. cholerae genome. It will be understood that the RstR of the invention may be isolated from any filamentous phage that may be present in a V. cholerae cell. A preferred RstR polypeptide sequence consists in, or is substantially identical, to a sequence selected from SEQ ID NO: 4, SEQ ID NO: 5, any mutant thereof and any combination thereof.

- By "genomic attRS insertion site" or "attRS" (SEQ ID NO:6) is meant a site in the genome of V. cholerae, which allows the integration of (ϋΤΧφ. - the rstA nucleic acid sequence consists in or is substantially identical to SEQ ID NO:7. rstA is an open reading frame (ORF) which is required in V. cholerae for (ϋΤΧφ replication.

- the rstB nucleic acid sequence consists in or is substantially identical to SEQ ID NO:8. rstB is an open reading frame (ORF) which is required for (ϋΤΧφ integration into the V. cholerae genome.

By "substantially identical" is meant a polypeptide or nucleic acid molecule exhibiting at least 50%, preferably 85%, more preferably 90%, and most preferably 95% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). For polypeptides, the length of comparison sequences will generally be at least 16 amino acids, preferably at least 20 amino acids, more preferably at least 25 amino acids, and most preferably 35 amino acids. For nucleic acids, the length of comparison sequences will generally be at least 50 nucleotides, preferably at least 60 nucleotides, more preferably at least 75 nucleotides, and most preferably 110 nucleotides. Preferably, such a sequence is at least 20%, 40%, 50%, 60%, 70%, more preferably 80%, and most preferably 90% or even 95% identical at the amino acid level or nucleic acid level to the sequence used for comparison.

Sequence identity is typically measured using sequence analysis software with the default parameters specified therein (e.g., Sequence Analysis Software Package of the Genetics Computer Group, University of Wisconsin Biotechnology Center, 1710 University Avenue, Madison, WI 53705, BLAST, or PILEUP/PRETTYBOX programs). These software programs match identical or similar sequences by assigning degrees of identity to various substitutions, deletions, and/or other modifications. Conservative substitutions typically include substitutions within the following groups: glycine, alanine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.

Within the context of the invention, a genetically modified Vibrio cholerae strain is either a natural variant strain which, contrary to the wildtype strain, has the property of resisting to infection by filamentous phage expressing a HUH endonuclease selected from the Rep trans protein family (PF02486), or a recombinant strain having an artificially (e.g. recombinantly) engineered genome exhibiting said property.

The recombinant strain may be prepared starting from any known Vibrio cholerae strain, such as strains available from collections such as ATCC, CNCM, etc. or libraries, or may be cloned from their publicly available genomic sequences. Further Vibrio cholerae strains may also be isolated from infected animals and used to prepare genetically modified Vibrio cholerae strain of the invention. Examples of Vibrio cholerae strains are provided in the experimental part. As explained previously, the genetically modified Vibrio cholerae strain comprises at least one mutation in a gene selected from uvrD, hupA and hupB, as herein above identified under options i), ii) and iii), and possibly a mutation in the attRS gene under option (iii). The mutation is typically a (partial or total) gene deletion or a knock-out mutation. Preferred deletions are uvrD deletion and/or hupA and hupB deletion, optionally together with an attRS deletion.

By "uvrD deletion" is meant a live V. cholerae strain that does not express UvrD and that, as a consequence, cannot replicate (ϋΤΧφ.

By "hupA deletion" is meant a live V. cholerae strain that does not express HupA.

By "hupB deletion" is meant a live V. cholerae strain that does not express HupB.

By "hupA and hupB deletion" is meant a live V. cholerae strain that neither express HupA nor HupB and that, as a consequence, cannot replicate (ϋΤΧφ.

By "attRS deletion" is meant a live V. cholerae strain that cannot revert or otherwise regain the capacity to produce cholera toxin by integration of CTX at the attRS sites as a result of deletion of all copies of the attRS sequence(s). A V. cholerae strain carrying even a single copy of the attRS sequence can efficiently acquire a new copy of the CTX element through DNA transfer.

Methods of making attRS deletions and parental vaccine strains containing these mutations are described in Mekalanos, J. J., U.S. Patent No. 5,631,010, issued May 20, 1997, incorporated herein by reference.

The knock-out mutation is an alteration in the nucleic acid sequence that reduces the biological activity of the polypeptide normally encoded therefrom by at least 80% relative to the unmutated gene, for example 100%. When it concerns uvrd the knock-out mutation at least suppresses a phage replication activity of UvrD, preferably the activity of UvrD allowing the replication of any filamentous phage expressing a HUH endonuclease selected from the Rep trans protein family (PF02486), preferably the CTX phage (CTX(|)) replication activity.

The knock-out mutation may, without limitation, be a deletion, an insertion, a frameshift mutation, for example a frameshift mutation that creates a stop codon, or a missense mutation.

Site-directed mutagenesis (SDM) is one of the methods of preference used to generate mutated genes in the context of the present invention. There are many techniques of SDM now known to the man of skill in the art, including oligonucleotide -directed mutagenesis using PCR as set out, for example by Sambrook et al., (1989) or using commercially available kits.

In a particular genetically modified Vibrio cholerae strain, the mutation is a knock-out mutation of uvrD affecting (preferably suppressing) only the replication activity of UvrD but conserving any other activity thereof such as its catalytic activity.

Genetically modified Vibrio cholerae strains of the invention optionally include additional mutations introduced to improve their safety and/or immunogenicity. Such additional mutations include, but are not limited to a deletion or knockout mutation of MshA (SEQ ID NO: 9). By "mshA deletion" is meant a live V. cholerae strain that does not express MshA and by "mshA knockout mutation" is meant a live V. cholerae strain that does not express a functional MshA. Herein described are examples of method of preparing the above described V. cholerae strains.

A particular method involves introducing a plasmid into a wild type V. cholerae which contains a fragment of V. cholerae DNA containing a mutation as previously described in the uvrD, hupA and/or hupB sequences. The V. cholerae DNA fragment present in the plasmid is capable of recombining with wild type V. cholerae DNA inside the organism to generate the mutant strain. The plasmid can be introduced using conjugation as described in Philippe N et al. [Philippe N, Alcaraz JP, Coursange E, Geiselmann J, Schneider D (2004) Improvement of pCVD442, a suicide plasmid for gene allele exchange in bacteria. Plasmid 51(3): 246-255]. Another method involves the direct use of fragment of V. cholerae DNA containing a mutation as previously described in the uvrD, hupA and/or hupB sequences and natural transformation as described in Marvig RL et al. [Marvig RL, Blokesch M (2010) Natural transformation of Vibrio cholerae as a tool-optimizing the procedure. BMC Microbiol 10: 155].

Appropriate methods of producing V. cholerae strains comprising a mutation consisting of an attRS deletion, a knockout mutation in rstA and/or a knockout mutation in rstB are described in W099/28442 which is incorporated herein by reference.

In a particular aspect, the Vibrio cholerae strain is for use as a pharmaceutical agent, for example as a live vaccine.

The terms "pharmaceutical agent" refers to any agent capable of preventing, of reducing the symptoms or of treating a V. cholerae infection, typically cholera.

The terms "Viability" and "live vaccine" with regard to the genetically modified strain of the invention refer to the ability for the bacteria to form a colony (CFU or Colony Forming Unit) on a nutrient media appropriate for the growth of the bacteria.

In another particular aspect, the Vibrio cholerae strain is for use as an adjuvant, for example as an adjuvant vaccine. The term "adjuvant" designates a product capable of enhancing effectiveness of an already immunogenic composition.

In a further particular aspect, the Vibrio cholerae strain is for use in a composition, for example in a pharmaceutical composition, typically in an immunogenic composition, for example in a therapeutic or prophylactic composition, preferably in a (live) vaccine composition (vaccine).

The term "vaccine" as used herein includes any composition, which may be used to cause, stimulate or amplify an immune response or immunological protection in an animal, typically a mammal, preferably a human being against a pathogen. Particular examples of vaccines of the invention are composition able to cause or stimulate or amplify immunity against V. cholerae.

The term "immunization" includes the process of delivering an immunogen to a subject. Immunization may, for example, enable a continuing high level of antibody and/or cellular response in which T- lymphocytes can kill or suppress the pathogen in the immunized subject, which is directed against a pathogen or antigen to which the subject has been previously exposed.

In the context of the invention, the subject is an animal such as a mammal (for example an herbivore or a human being), a bird, or a fish. The subject may also be a crustacean such as shrimp or a mollusc such as oyster and mussel. A preferred mammal is a human being. Strains and/or compositions of the invention are preferably administered to a subject suffering or at risk of suffering of cholera. Desirably, the vaccine is administered to a subject who has not yet been exposed to Vibrio cholerae.

The herein described strains may be used alone or in combination with other genetically modified strains, viruses or antigens to generate improved therapeutic or prophylactic compositions, typically improved vaccines. The invention is particularly suited to produce human vaccines, particularly for vaccinating a human being against Vibrio cholerae infection, typically against cholera.

Compositions of the invention comprise an immunologically effective amount of a strain as described above optionally in association with a pharmaceutically acceptable vehicle or carrier and/or any delivery system designed to deliver said strain in a viable state to the intestinal tract of the subject. A typical composition is an immunogenic composition for use for the immunization of a subject against Vibrio cholerae infection, typically against cholera, comprising a genetically modified Vibrio cholerae strain as herein described, optionally in association with a pharmaceutically acceptable carrier and/or any delivery system designed to deliver said strain in a viable state to the intestinal tract.

In practice, the exact amount required for an immunologically effective amount/dose may vary from subject to subject depending on factors such as the age and general condition of the subject, the nature of the formulation and the mode of administration. Appropriate "effective amount" may be determined by one of ordinary skill in the art using only routine experimentation. For instance, methods are known in the art for determining or titrating suitable dosages of a vaccine to find minimal effective dosages based on the weight of the non-human animal subject, concentration of the vaccine and other typical factors. In a typical embodiment, the composition comprises a Vibrio cholerae strain unitary dose of between 10⁵ and 10¹² CFU/ml (colony-forming units per milliliter), typically 10⁶ CFU/ml, for liquids, and their equivalent expressed in CFU/g (colony-forming units per gram) for solids. The dosage of the vaccine, concentration of components therein and timing of administering the vaccine, which elicit a suitable immune response, can be determined by methods such as antibody titrations of sera, e.g., by ELISA and/or seroneutralization assay analysis and/or by vaccination challenge evaluation.

Vaccines may comprise other ingredients, known per se by one of ordinary skill in the art, such as pharmaceutically acceptable carrier or excipient, adjuvant, freeze drying stabilizer, diluent, wetting or emulsifying agent, pH buffering agent such as acetates, citrates or phosphates, chelating agent such as ethylenediaminetetraacetic acid, gelling or viscosity enhancing additives, agent for the adjustment of tonicity such as sodium chloride or dextrose, or preservative, depending on the route of administration.

"Pharmaceutically acceptable carriers" for therapeutic use are well known in the pharmaceutical art, and are described, for example, in Remington 's Pharmaceutical Sciences, Mack Publishing Co. (A.R. Gennaro edit. 1985). Examples of pharmaceutically acceptable carriers, excipients or diluents include, but are not limited to demineralised or distilled water; saline solution; vegetable based oils such as peanut oil, arachis oil, safflower oil, olive oil, cottonseed oil, maize oil, sesame oil, or coconut oil; silicone oils, including polysiloxanes, such as methyl polysiloxane, phenyl polysiloxane and methylphenyl polysolpoxane; volatile silicones; mineral oils such as light liquid paraffin oil, or heavy liquid paraffin oil; squalene; cellulose derivatives such as methyl cellulose, ethyl cellulose, carboxymethylcellulose, carboxymethylcellulose sodium salt, or hydroxypropyl methylcellulose; lower alkanols, for example ethanol or iso- propanol; lower aralkanols; lower poly alky lene glycols or lower alkylene glycols, for example polyethylene glycol, polypropylene glycol, ethylene glycol, propylene glycol, 1 ,3- butylene glycol or glycerin; fatty acid esters such as isopropyl palmitate, isopropyl myristate or ethyl oleate; polyvinylpyrrolidone; agar; carrageenan; gum tragacanth or gum acacia, and petroleum jelly. Typically, the carrier or carriers will form from 10% to 99.9% by weight of the composition and may be buffered by conventional methods using reagents known in the art, such as sodium hydrogen phosphate, sodium dihydrogen phosphate, potassium hydrogen phosphate, potassium dihydrogen phosphate, a mixture thereof, and the like.

Examples of adjuvants include, but are not limited to:

(1) non-toxic mutants of heat labile toxin protein or pertussis toxin protein, such as described, for example in Tsuji et al, (1990); Harford et al., (1989) and Roberts et al., (1995);

(2) oil-in-water emulsion formulations with or without other specific immunostimulating agents such as muramyl peptides [for example N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N- acetyl-normuramyl-l-alanyl-d-isoglutamine (nor-MDP) , N-acetylmuramyl- 1 -alanyl-d-isoglutaminyl- 1 - alanine-2-(r-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (MTP-PE), etc.]; bacterial cell wall components such as formulations described in PCT Publ. No. WO 90/14837, including but not limited to MF59 (containing 5% Squalene, 0.5% Tween 80, and 0.5% Span 85 (optionally containing various amounts of MTP-PE, although not required) formulated into submicron particles using a microfluidizer such as Model HOY microfluidizer (Microfluidics, Newton, MA)); SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-blocked polymer L121, and thr-MDP (see below) either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion; Ribi TM adjuvant system (RAS), (Ribi Immunochem, Hamilton, MT) containing 2% Squalene, 0.2% Tween 80; and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (Detox TM );

(3) saponin adjuvants, such as Stimulon TM (Cambridge Bioscience, Worcester, MA) may be used or particles generated therefrom such as ISCOMs (immunostimulating complexes);

(4) Complete Freunds Adjuvant (CFA) and Incomplete Freunds Adjuvant (IF A);

(5) cytokines, such as interleukins (e.g., IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e.g., gamma interferon), macrophage colony stimulating factor (M-CSF), tumor necrosis factor (TNF), etc; and

(6) other substances that act as immunostimulating agents to enhance the effectiveness of the composition.

Examples of freeze-drying stabilizer may be for example carbohydrates such as sorbitol, mannitol, starch, sucrose, dextran or glucose, proteins such as albumin or casein, and derivatives thereof. The route of administration can be oral, sublingual, nasal, rectal, via mucosal administration, via a parenteral route (intradermal, intramuscular, subcutaneous, intravenous, or intraperitoneal). The vaccine of the invention can be conveniently administered orally, intranasally, transdermally, parenterally, rectally, etc. The parenteral route of administration includes, but is not limited to, intramuscular, intravenous, intraperitoneal routes and the like. In preferred embodiments, the pharmaceutical composition of the invention is administered orally.

The composition of the invention may be a solid formulation, in particular an oral delivery system, such as tablet, pill, capsule, granules, sachet of microgranules, powder, or a liquid formulation such as an aqueous solution, water-in-oil or oil-in-water emulsion, syrup, an elixir, or a preparation for enteral, parenteral, subcutaneous, intradermal, intramuscular or intravenous administration (e.g., injectable administration) such as sterile suspension or emulsion. Such formulations are known in the art and are typically prepared by mixture of the strain as pharmaceutical agent and other typical additives as described previously in the appropriate carrier or solvent systems. The compositions provided herein are preferably in any form which allows for the composition to be administered to a patient by the oral route. In a particular embodiment, the pharmaceutical composition is formulated so as to allow the active ingredients contained therein to be bioavailable at the intestinal site targeted upon administration of the composition to a subject.

For oral administration, an excipient and/or binder may be present. Examples are sucrose, kaolin, glycerin, starch dextrins, sodium alginate, carboxymethylcellulose and ethyl cellulose. Coloring and/or flavoring agents may be present. A coating shell may be employed, applying common membranes used for microencapsulation and suitable for the microencapsulation of live bacteria include biodegradable synthetic "polymers" such as polylactide, poly gly colic acid, and polyanhydride. Established "polymers" for live encapsulation and enzyme encapsulation include alginate -polylysine- alginate (APA), alginate-polymethylene-co-guanidine-alginate (A-PMCG-A), hydroymethylacrylate- methyl methacrylate (HEMA-MMA), Multilayered HEMA-MMA-MAA, poly aery lonitrilevinylchloride (PAN-PVC), acrylonitrile/sodium methallylsulfonate (AN-69), polyethylene glycol/poly pentamethylcyclopentasiloxane/polydimethylsiloxane (PEG/PD5/PDMS), poly N,N- dimethyl acrylamide (PDMAAm), Siliceous encapsulates and cellulose sulphate/sodium alginate/polymethylene-co-guanidine (CS/ A/PMC G). Other materials that are useful include, without limitation, cellulose acetate phthalate, calcium alginate and k-carrageenan-Locust bean gum gel beads, gellan-xanthan beads, poly(lactide-co-glycolides), carrageenan, starch poly-anhydrides, starch polymethacrylates, polyamino acids, enteric coating polymers.

The composition of the invention is preferably formulated to resist digestion into the stomach in order for the active ingredients contained therein to be bioavailable at the site targeted upon administration of the composition to a patient, or in other words in order for the live genetically modified strain to reach the intestinal tract, in particular the small intestine.

In a particular embodiment, the strain or composition comprising the strain is encapsulated by a coating which is substantially insoluble at a pH of less than a range of between about 7.0 to about 8.0 and soluble in the pH range of about 7.0 to about 8.0. Thanks to such a formulation, the strain is not released until the pH is about 7 and there is essentially no loss of the strain through the digestive tract until the delivery systems reaches the small intestine.

Preferably, the coating comprises one or more compositions selected from the group consisting of poly(dl-lactide-co-glycolide, chitosan (Chi) stabilized with PVA (poly-vinylic alcohol), a lipid, an alginate, carboxymethylethylcellulose (CMEC), cellulose acetate trimellitiate (CAT), hydroxypropylmethyl cellulose phthalate (HPMCP), hydroxypropylmethyl cellulose, ethyl cellulose, color con, food glaze and mixtures of hydroxypropylmethyl cellulose and ethyl cellulose, polyvinyl acetate phthalate (PVAP), cellulose acetate phthalate (CAP), shellac, copolymers of methacrylic acid and ethyl acrylate, and copolymers of methacrylic acid and ethyl acrylate to which a monomer of methylacrylate has been added during polymerization.

In another particular embodiment, the strain or composition comprising the strain is encapsulated with a biodegradable first capsule that is coated with a first enteric coating solubilizing in a pH of about 6.2 to about 6.5, and with a second capsule sized to include the coated first capsule. The second capsule typically comprises a biodegradable material and is coated with a second enteric coating that solubilizes in a pH of about 7 to 8. This second capsule releases the first capsule in the ileum and once released the first capsule is solubilized in the proximal colon at a pH of about 6.2 to about 6.5 with the release of the desirable strain or composition according to the invention. The second enteric coating is advantageously substantially insoluble at a pH of less than a range of between about 7.0 to about 8.0 and soluble in the pH range of about 7.0 to about 8.0.

The first and second enteric coatings typically comprise one or more compositions selected from the group consisting of copolymers of methacrylic acid and ethyl acrylate, and copolymers of methacrylic acid and ethyl acrylate to which a monomer of methylacrylate has been added during polymerization.

Compositions that will be administered to a patient take the form of one or more dosage units, where for example, a tablet may be a single dosage unit, and a container of one or more compounds of the invention in oral form may hold a plurality of dosage units. The vaccines of the invention can be administered via different protocol, for example as single doses or in repeated doses. The vaccines of the invention can be administered alone, or can be administered simultaneously or administered sequentially with one or more further compositions, such as for example other immunogenic or vaccine compositions. Where the compositions are administered at different times the administrations may be separate from one another or overlapping in time.

Strains of the invention and compositions comprising said strains can be co-administered with other therapeutic agents or drugs, foods, nutrients, vitamins, other beneficial substances, prebiotics that release in the distal small intestine at pH values between 7.0 and 8.0 in an amount sufficient to alleviate V. cholerae infection in a subject. Preferably, at least two coating are used to cover a tablet or capsule like form comprising the strain of the invention, wherein the outside coating is degraded in a pH environment of 5 to 6 and the inside coating is degraded in a pH environment of about 7 thereby dropping the strain in the intestinal tract, typically in the ileum area. In certain embodiments, microencapsulated live V. cholerae strains of the invention and formulations thereof are administered in conjunction with one or more antibiotic. The dosage formulation is preferably designed in these embodiments to completely separate the antibiotic from the bacteria, and testing is conducted to verify complete separation on a long term basis. Suitable antibiotics include, but are not limited to tetracycline, ciproflaxine, doxycycline, co-trimoxazole, ampicillin, kanamycin, streptomycin and trimethoprim-sulfamethoxazole.

The present invention also relates to methods of immunizing or inducing an immune response in a subject, typically to methods of preventing or treating Vibrio cholerae infection, Vibrio cholerae infection associated disease, cholera or symptoms thereof (typically diarrhea, nausea, vomiting, and dehydration) in a subject, comprising administering to said subject an immunogenically effective dose of a strain or composition, typically immunogenic composition, according to the invention as described above.

A further aspect of the invention relates to methods of treating and/or preventing a Vibrio cholerae infection associated disease in a non-human animal subject, and to methods of immunizing or vaccinating a non-human animal subject, such as herbivore, bird, fish, crustacean or mollusc, typically a population thereof, against a Vibrio cholerae infection, comprising administering to said subject a genetically modified strain or composition as defined above. Preferably, a non-human animal subject is protected to an extent in which one to all of the adverse physiological symptoms or effects of Vibrio cholerae infections are significantly reduced, ameliorated or totally prevented.

In one embodiment, the compositions of the invention are administered to a non-human animal susceptible to or otherwise at risk for Vibrio cholerae infection to enhance the subject own immune response capabilities.

The present invention also provides a container comprising an immunologically effective amount a strain or composition, typically vaccine, as described above.

The invention further provides kits, for example vaccination/immunization kits, comprising an optionally sterile container comprising an immunologically effective amount of the Vibrio cholerae strain or composition of the invention, means for administering said strain or composition to a subject, in particular a human being, and optionally an instruction manual including information for the administration of the immunologically effective amount the composition for treating and/or preventing infectious disease.

Another kit further comprises a rehydration solution, preferably a rehydration solution enriched with electrolytes.

The invention is particularly suited for the treatment (preventive or curative) of Vibrio cholerae infection and associated diseases, typically cholera.

Further aspects and advantages of the invention shall be disclosed in the following experimental section and figures, which illustrates the claimed invention.

LEGENDS OF THE FIGURES

Figure 1. Vaccine strains can re-acquire the capacity to produce the cholera toxin through their re-infection. (A) Scheme of the re -infection of a vaccine strain by (ϋΤΧφ in the intestinal track. The vaccine strain is depicted in blue and the pathogenic strain in red. Red points depict (ϋΤΧφ particles. (B) Schematic diagram showing key steps in the life cycle of (ϋΤΧφ. (ϋΤΧφ infection requires the host- encoded toxin co-regulated pilus (TCP) and TolQRA proteins (1). After its release in the cytoplasm of its host, (ϋΤΧφ ssDNA is converted into a dsDNA by the host machineries (2). Rolling circle replication (RCR) of the phage depends on a single phage-encoded protein, RstA, and on the host machinery (3). New (ϋΤΧφ particle secretion depends on the host outer membrane protein EpsD (4). RstA production is under the control of the SOS response (5). Integration of (ϋΤΧφ depends on the host Xer machinery (6) and the accessory protein EndoIII (7). A process akin to RCR permits the production of free copies of CTXφ ssDNA when the phage genome is integrated in tandem (8). (C) Scheme of the mechanism of action of phage immunity and its limitations for the protection of cholera vaccine strains. RstR production from a resident cholera vaccine genome represses RstA production and therefore provides immunity against secondary infections by a phage harbouring the same immunity region (CTXl). RSI satellite phage-encoded RstC anti-repressor counteracts the activity of the resident RstR. Classical CTXφ (CTX^cl) and other variants of CTXφ (CTX2) contain a heterologous immunity regions with is not recognized by El Tor RstR. Hybrid CTX-VGJ phages escape RstR immunity by using the νθ φ RCR module.

Figure 2. Screen for host factors implicated in CTX<|) replication. (A) Scheme of the conjugation of the pSC101-RS2 hybrid into a lacLw.difl reporter strain. (B) Schematic representation of the colonies obtained in different genetic backgrounds. /: relative frequency of formation of each type of depicted colony; (i): colony formed upon direct integration; (ii): colony obtained after RCR amplification of the phage DNA; (Hi): colony obtained when host factors implicated in integration are disrupted; (iv): colony obtained when host factors implicated in RCR are disrupted. (C) Scheme of the VC1919 region. Open triangles indicate the position of insertion of the transposon that impeded pSC101-RS2 RCR.

Figure 3. HU is essential for CTX<|) replication. (A) Relative colony-forming ability after conjugation with a replicative form of RS2 in the indicated strains. After 3 h of conjugation, serial dilutions were plated on chloramphenicol and incubated overnight at 42°C (left) and 37°C (right). Relative colony forming units (cfu) correspond to the ratio of the number of colonies obtained in the indicated strain over the mean number of colonies obtained in AxerC cells. Results are shown in a logarithmic scale and represent the mean and standard deviation of 3 independent experiments. The detection limit of the experiment is indicated by a dotted line. (B) Colonies obtained at 37°C were re- streaked on plate and incubated overnight at 42°C (Left) and 37°C (Right).

Figure 4. Impaired replication of CTX<|) in AhupB cells. (A) Q-PCR analysis of the number ssDNA and dsDNA copies of RS2 in the indicated strains. The analysis was performed on the total DNA of cells that were grown under selection pressure at 30°C to an OD₆₀o_nm of 0.3. Data represent the mean of two independent experiments. The detection limit of the experiment is indicated by a dotted line. (B) Phage maintenance was measured in the indicated strains after 5 h of growth in LB without selection. (C) Relative efficient of RS2 integration in lacLwdifl, lacLwdifl AhupA and lacLw.difl AhupB cells. Integration was monitored after overnight growth in LB at 37°C. Data represents the mean and standard deviation of 3 independent experiments. (D) Relative efficiency of integration of a non-replicative vector harbouring the attP of (ϋΤΧφ delivered by conjugation in lacLw.dif, lacLw.dif AhupA, lacLwdifl AhupB, lacLwdifl AhupAB cells. Integration was monitored directly after conjugation. Data represents the mean and standard deviation of 3 independent experiments. (E) Relative production of (ϋΤΧφ particles by AhupB AxerC cells. AxerC recipient cells were incubated for 20' in the filtered supernatant AxerC and AhupB AxerC donor cells harbouring pCTX-Kn. Data represents the mean and standard deviation of 3 independent experiments. The detection limit of the experiment is indicated by a dotted line.

Figure 5. Replication of CTX<|) depends on UvrD. (A) Relative colony-forming ability after conjugation with RS2 in the indicated strains. After 3 h of conjugation serial dilutions were plated on chloramphenicol and incubated overnight at 37°C. Relative colony forming units (cfu) correspond to the ratio of the number of colonies obtained in the indicated strain over the mean number of colonies obtained in AxerC cells. Results are shown in a logarithmic scale and represent the mean and standard deviation of 3 independent experiments. The detection limit of the experiment is indicated by a dotted line. (B) Complementation assay of AxerC AuvrD cells with a pBAD vector carrying the V. cholerae uvrD gene (pBAD-wvrD). RS2 was conjugated into AxerC and AxerC AuvrD cells harbouring pBAD or pBAD-wvrD and plated on LB supplemented with ampicillin, chloramphenicol and 0.2% of arabinose. Plates were incubated overnight at 37°C. (C) Relative colony-forming ability of lacLw.difl, lacLw.dif Arep and lacLw.dif AuvrD cells after 3 h of conjugation with RS2. Serial dilutions were plated on chloramphenicol and incubated overnight at 37°C. Relative colony forming units (cfu) correspond to the ratio of the number of colonies obtained in the indicated strain over the mean number of colonies obtained in AxerC cells. Results are shown in a logarithmic scale and represent the mean and standard deviation of 3 independent experiments. The detection limit of the experiment is indicated by a dotted line. (D) Phenotype of colonies obtained after RS2 integration in lacLw.dif (Top) and lacLw.dif AuvrD (Bottom) cells.

Figure 6. Cleavage of CTX<|) ori(+) by RstA depends on HU. (A) Scheme depicting the primer extension assay used to monitor RstA cleavage. Red arrows in opposite direction depict potential loops in the ori( + ) region. The rstR gene, the Notl site and the location of the primer used in the primer extension are shown. (B) RstA activity in the indicated strains. Top left. Electrophoresis of the products was performed with a 6% polyacrylamide/8M urea gel. Lane 1-4: dideoxy sequence ladder. Top right: schematic representation of ori( + ) loop 2. Bottom: relative intensity of the primer extension profiles. Black triangle: position of the nick. (C) Schematic representing the formation of a dsDNA break when replication forks originating from ori¹⁰¹ encounter a nick created by RstA. Black and red stars depict Rep^TS and RstA proteins, respectively. (D) Relative colony-forming ability after conjugation. Column 1-3: pSC101-RS2 was conjugated in the indicated strains to AxerC, AxerC AhupAB, AxerC AuvrD, and AxerC AhupAB AuvrD cells, respectively; Column 5: pSC101-RS2 ArstA was conjugated in AxerC cells. After 3 h of conjugation, serial dilutions were plated on spectinomycin and incubated overnight at 30°C. Relative colony forming units (cfu) correspond to the ratio of the number of colonies obtained in the indicated strain over the mean number of colonies obtained in AxerC cells. Results are shown in a logarithmic scale and represent the mean and standard deviation of 3 independent experiments. The detection limit of the experiment is indicated by a dotted line. (E) Q- PCR analysis of the number of pSC101-RS2 ssDNA and dsDNA copies in AxerC, AxerC AhupAB and AxerC AhupAB AuvrD cells, and of ArstA pSC101-RS2 ssDNA and dsDNA in AxerC cells. The analysis was performed on the total DNA of cells that were grown under selective pressure at 30°C to an OD₆oonm of 0.3. Data represent the mean of two independent experiments.

Figure 7. HU and UvrD in RCR of other V. cholerae IMEXs. (A) Relative colony-forming ability of R6K-VGJ in the indicated strains. (B) Relative colony-forming ability of R6K-TLC in the indicated strains. Relative colony forming units (cfu) correspond to the ratio of the number of colonies obtained in the indicated strain over the mean number of colonies obtained in AxerC cells. Results are shown in a logarithmic scale and represent the mean and standard deviation of 3 independent experiments. The detection limit of the experiment is indicated by a dotted line.

Figure 8. Equal production of HUoc and HUP at 37°C and 42°C. Western blot analysis of His- tagged HUoc and Ηυβ. V. cholerae containing a His-tagged version of HUoc or Ηυβ was growth to an OD₆₀onm of 0.5. The cell lysates were loaded onto an SDS-PAGE gel. Proteins were transferred to a PVDF membrane and blocked with 5% milk in TBST for 1 hour. The membrane was probed with a 4x-His antibody.

Figure 9. HUoc and HUP bind DNA with equivalent affinity. In vitro HUoc and Ηυβ binding assay on RS2 DNA. Black triangles depict increasing concentration of HU (1.5 ng, 7.5 ng, 15 ng, 75 ng, 150 ng, 750 ng, 1500 ng) in each lane.

Figure 10. Ectopic production of HUoc or HUP restores RS2 propagation in AhupAB cells.

Complementation assay of AhupAB cells with a pUC18 vector carrying the V. cholerae hup A gene (pUC-hupA) or hupB gene (pUC-hupB). RS2 was conjugated into AxerC AhupAB + pUC18, AxerC AhupAB + pUC-hupA and AxerC AhupAB + pUC-hupB and then streaked on plate supplemented with ampicillin and chloramphenicol. Plates were incubated overnight at 37°C.

Figure 11. Deletion of the rep gene led to a severe growth defect in V. cholerae. Growth curve of wild type, AuvrD and Arep V. cholerae cells. The strains were grown in rich media LB at 37°C and the OD₆oonm of each culture were measured over the course of time.

Figure 12. V cholerae uvrD is under the control of the SOS response. (A) Top: Scheme of the E. coli and V. cholerae uvrD promoter regions. The angled arrows depict the uvrD transcription start sites. Red boxes show LexA binding sites. Green boxes show predicted -35 and -10 core promoter elements. Bottom: Comparison of the sequence of E. coli and V. cholerae putative LexA binding sites in uvrD promoter. The mutated LexA binding site of V. cholerae is shown. (B) UV sensitivity of AuvrD cells. Cells were grown overnight on plates and then re-suspended in minimal media M9 for UV irradiation. Top: Control without UV exposition. Bottom: Cells irradiated up to UV doses of 25 J/m². (C) β-gal activity (Miller units) of strains harbouring a lac-gene transcriptional fusion to wild type or mutated uvrD promoters. Top: MV57 and MV57 ArecA. Bottom; MV47 and MV47 lexA^ind. Figure 13. hupB deletion limit ΟΤΧφ horizontal transmission. (A) Relative susceptibility to ΟΤΧφ infection. Donor: AxerC + CTX-Kn; Recipients: AxerC, AxerC difl::E\ Tor RS2, AxerC i/i/i.vClassical RS2 and AxerC AhupB. (B) Relative ability of (ϋΤΧφ production. Donors: AxerC + CTX-Kn, AxerC difl::El Tor RS2 + CTX-Kn, AxerC difl: .-Classical RS2 + CTX-Kn and AxerC AhupB + CTX-Kn .Donor strain was growth on LB media 5 hours. Filtered supernatant containing CTX-Kn particles was mixed the recipients strains which was growth in AKI media. After infection the strains were plated on LB supplemented with Kn. The number of CFU are shown in a logarithmic scale and represent the mean and standard deviation of 3 independent experiments.

EXAMPLES

Inventors herein describe the identification of non-essential host factors implicated in CTXφ replication.

Rolling-circle replication (RCR) is central to the life cycle of CTXφ because amplification of the phage genome permits its efficient integration into the genome and its packaging into new viral particles. A single phage-encoded HUH endonuclease initiates RCR of the proto-typical filamentous phages of enterobacteriaceae by introducing a nick at a specific position of the double stranded DNA form of the phage genome. The rest of the process is driven by host factors that are either essential or crucial for the replication of the host genome, such as the Rep SF1 helicase.

In contrast, inventors herein demonstrate that the histone-like HU protein of V. cholerae and the UvrD helicase were both absolutely required for the replication of CTXφ. The histone-like HU protein of V. cholerae is in particular necessary for the introduction of a nick by the HUH endonuclease of CTXφ. They further show that CTXφ RCR depends on a SF1 helicase normally implicated in DNA repair, UvrD, rather than Rep. In addition to CTXφ, they show that νθ φ, a representative member of a second family of vibrio integrative filamentous phages that can form hybrids with CTXφ, requires UvrD and HU for RCR while TLCφ, a satellite phage depends on Rep and is independent from HU. Accordingly, they demonstrated that the disruption of the two subunits of HU and/or of UvrD prevented infection of the cells by CTXφ and νθ φ. In addition, they showed that it prevented the cells from producing CTXφ particles. Taken together, these results demonstrate that HU- and/or UvrD- cells are usable to develop safe live attenuated cholera vaccine.

Screening strategy

Inventors developed a colorimetric assay to monitor IMEX integration events in V. cholerae [24]. In brief, the dif site of the largest of the two chromosomes harboured by the V. cholerae N16961 El Tor strain, difl, was inserted in the coding region of the Escherichia coli lacZ gene in such a manner as not to perturb β-galactosidase production. The lacZ::difl allele was inserted in place of the normal difl site of a N16961 El Tor strain in which the endogenous lacZ gene was deleted (Figure 2A). This strain forms blue colonies on X-gal media. However, 100% of the colonies obtained after the delivery of a truncated form of the El Tor variant of (ϋΤΧφ, RS2, which is fully functional in replication and integration, were white or contained large white sectors around a blue star shaped centre on X-gal plates (Figure 2B, panel (i) and (ii)). Inventors previously used this property to search for nonessential host factors implicated in the integration of (ϋΤΧφ by transposition mutagenesis (Figure 2B, panel (iii), [25]. During the course of this first screen, they noted that fully white colonies represented a very limited fraction of the total colonies, confirming the importance of ssDNA amplification by RCR for the integration process (Figure 2B, panel (i)). It suggested that the assay could be used in a second screen to identify non-essential host factors involved in RCR (Figure 2B, panel (iv)). To this end, they cloned RS2 on a pSClOl plasmid that harboured a spectinomycin resistance gene and that could be delivered by conjugation (Figure 2A). By using a temperature-sensitive version of the pSClOl origin of replication, they could distinguish if the absence of integration was due to the disruption of host factors implicated in RCR or in the integration process (Figure 2B, panel (iii) and (iv)). As a control, they verified that conjugation of the pSC101-RS2 hybrid in AxerC cells yielded fully blue colonies at 30°C and 42°C. They also verified that disruption of RstA, which abolishes RCR, led to fully blue colonies at 30°C that couldn't grow at 42 °C.

Inventors implemented the screen in two independent mariner transposition libraries of the lacZ::difl reporter strain. Conjugants were selected on plates supplemented with spectinomycin and X-gal at 30°C. They screened over 40 000 clones, which allowed us to identify 6 fully blue clones that were thermo-sensitive. All of them carried a transposon insertion in the VC1919 ORF of the V. cholerae genome (Figure 2C). Sequence analysis revealed that they corresponded to at least three independent transposition insertion events (Figure 2C).

HU is essential for ΟΤΧφ replication

In E. coli, HU is composed of two subunits, HUoc and ΗΙΙβ, which are encoded by hupA and hupB, respectively [37]. The major form of HU is a heterodimer of HUoc and Ηυβ, but HUoc homo-dimers and Ηυβ homo-dimers are also formed. VC1919 encodes for a homolog of the β subunit of E. coli HU, Ηυβ. A homolog of the a subunit of E. coli HU, HUa, is encoded by VC0273. Inventors engineered His-tag versions of the two gene products under their native promoters and showed that they were produced at the same level at 37°C and 42°C (Figure 8). They purified the recombinant proteins and showed that they bound DNA with similar affinities (Figure 9). These results suggested that VC0273 and VC1919 were the V. cholerae orthologs of E. coli hup A and hupB.

To confirm the results of their screen, they delivered a version of RS2 marked with a chloramphenicol resistance gene in a AhupB AxerC strain by conjugation. Because of the absence of XerC, RS2 cannot integrate in this strain and vertical transmission of chloramphenicol resistance to daughter cells entirely depends on RS2 RCR. In agreement with the results of their screen, no colonies were obtained on selection plates at 42°C (Figure 3A). Colonies were obtained at 37°C (Figure 3A), but they failed to propagate when re-streaked at 42°C (Figure 3B). To further determine the potential role of HU in (ϋΤΧφ replication, they engineered a AhupA AxerC strain and a AhupAB AxerC strain. The deletion of hupA did not affect the maintenance of RS2 at 37°C and 42°C (Figure 3A and 3B). However, no colonies were obtained when RS2 was delivered in the AhupAB AxerC strain whether at 42°C or 37°C (Figure 3 A and 3B). Ectopic production of HUa or Ηυβ in AhupAB AxerC cells restored colony formation at 37°C, excluding any polar effect of the two deletions (Figure 10). Taken together, these results suggested that HU was essential for (ϋΤΧφ replication, that HUa homo-dimers were sufficient to maintain the RF of the (ϋΤΧφ genome at 37°C but that Ηυβ homo-dimers and/or Ηυαβ hetero- dimers were absolutely required at 42°C.

The single deletion of hupB is sufficient to limit ΟΤΧφ vertical and horizontal transmission

In order to gain a quantitative measure of the importance of HUa and Ηυβ in the (ϋΤΧφ replication process, inventors used quantitative PCR to monitor the number of RS2 ssDNA and dsDNA copies per genome equivalent in AhupA AxerC and AhupB AxerC cells that were grown under selection pressure at 37°C. The deletion of hupA had no visible effect on the relative number of RS2 copies, whether ssDNA or dsDNA (Figure 4A). In contrast, the deletion of hupB induced a 40% reduction in the number of RS2 copies per genome (Figure 4A). As the total number of RS2 copies per genome equivalent was now lower than 1, they suspected that the deletion of hupB would increase the instability of RS2 at 37°C even though it did not compromise colony formation on selection plates at this temperature. Indeed, a 100-fold reduction in the number of colony forming units was observed in AhupB AxerC cells compared to AhupA AxerC or AxerC cells after 5 hours of growth without selection pressure (Figure 4B). Because it limited the number of copies of the ssDNA (ϋΤΧφ genome, they further suspected that the deletion of hupB would also prevent RS2 integration. They observed a 5-fold reduction in the integration efficiency of RS2 in AhupB lacZr. dijl cells compared to lacZr. dijl cells (Figure 4C). A weaker, yet significant, decrease in RS2 integration was also observed in AhupA lacZr. dijl cells (Figure 4C). No decrease in the frequency of integration of a non-replicative plasmid harbouring attP^CTX was observed in AhupA, AhupB and AhupAB, excluding any participation of HU in the integration process per se (Figure 4D). Finally, they suspected that the deletion of hupB might also prevent the production of phage particles by limiting the amount of ssDNA available for packaging. Indeed, a 1000-fold less phage particles were produced in AhupB AxerC cells than in AxerC cells (Figure 4E). Taken together, these results suggested that the deletion of hupB could by itself limit (ϋΤΧφ vertical transmission via lysogenic conversion and limit horizontal transmission via the production of new viral particles.

ΟΤΧφ relies on UvrD for RCR

RCR of the proto-typical filamentous phages of E. coli depends on Rep, a helicase that is implicated in the replication of their host genome [39]. The E. coli Rep protein is not essential but its deletion leads to a severe growth defect [40,41]. The genome of V. cholerae encodes for a homolog of E. coli Rep. Inventors found that it was not essential but that its deletion led to a severe growth defect, suggesting functional homology with E. coli Rep (Figure 11). However, the deletion of V. cholerae Rep impeded neither the maintenance of RS2 in AxerC cells (Figure 5A) nor its integration (Figure 5B), suggesting that it was not implicated in (ϋΤΧφ RCR.

Some RCR plasmids of Gram+ bacteria replicate in E. coli using the UvrD DNA helicase [42] . The E. coli UvrD protein plays essential roles in methyl-directed mismatch repair and nucleotide excision repair of DNA [43]. It is also involved in clearing and restarting stalled replication forks [44-46]. It is under the control of two promoters: one is constitutive while the other is governed by LexA, which leads to a 3 to 6-fold overproduction of UvrD during SOS [47,48] (Figure 12A). E. coli UvrD is not essential and its deletion does not affect cell proliferation under normal growth conditions. The genome of V. cholerae encodes a homolog of E. coli UvrD. Its deletion did not affect cell proliferation (Figure 11) but made them hyper sensitive to UV (Figure 12B). Inspection of the upstream region of the gene suggested the presence of two promoters, with a putative /exA-binding site overlapping the - 10 box of one of them (Figure 12A). Correspondingly, introduction of a non-cleavable allele of lexA led to a 3-fold decrease in the expression of the gene (Figure 12C) while disruption of RecA or of the lexA box increased its expression (Figure 12D). Taken together, these results suggested that this gene was the functional homologue of E. coli uvrD and inventors wondered if its product was involved in CTX(|) RCR. Consistent with this view, deletion of V. cholerae uvrD impeded the maintenance of RS2 in AxerC cells (Figure 5A). Ectopic production of V. cholerae UvrD under an arabinose promoter on a plasmid restored colony formation, excluding any polar effect of the deletion (Figure 5B). The deletion of V. cholerae uvrD also led to over a 1000-fold drop in the frequency of integration of RS2 in XerC⁺ cells (Figure 5C). The few colonies that were obtained were fully white or only displayed a pinpoint blue dot at their centre, further indicating that integration occurred immediately after entry into the cell (Figure 5D). Taken together, these results suggested that CTX(|) relied on the UvrD helicase for RCR.

Nicking of ori(+) depends on HU

There are three different steps in RCR: (i) addition of a nick at ori(+) to prime replication; (ii) displacement of the old (+) ssDNA copy of the genome and synthesis of a new one; (iii) termination of replication and re-circularization of the old (+) ssDNA genome copy. HU could be involved in any of these steps. By definition, UvrD was expected to be only involved in the second step. To investigate whether HU and UvrD were involved in the first step of RCR, total genomic DNA was extracted from V. cholerae cells 3 hours after conjugation of RS2 and the presence of a nick at ori( + ) was revealed by primer extension (Figure 6A and B). In wild-type cells, they observed a strong signal consistent with the introduction of a nick between the guanine and the thymine bases of the apical loop of the second hairpin of CTX(|) ori( + ) (Figure 6B). The position of the observed nick fitted with previous genetic analysis of the cleavage position of RstA [49]. Nick formation was entirely suppressed when HU was deleted, suggesting that HU was essential for the activity of RstA (Figure 6B). In contrast, the deletion of UvrD did not affect nick formation, suggesting that UvrD was not implicated in RCR initiation. One concern regarding to involvement of UvrD in RCR is that inventors did not recover any transposition event in the uvrD gene even though it is not essential in V. cholerae. However, they found that pSC101-RS2 is not able to propagate in AuvrD AxerC V. cholerae cells even at the permissive temperature (Figure 6D). They then hypothesized that replication forks originating from the pSClOl origin would generate fatal double strand breaks when they reached a nicked ori(+), which could explain why the pSC101-RS2 hybrid failed to propagate in AuvrD AxerC cells (Figure 6C). In agreement with this hypothesis, deletion of HU or inactivation of RstA restored the propagation of the pSC101-RS2 hybrid in AuvrD AxerC cells (Figure 6D). There was little or no production of RS2 ssDNA in such cells, further illustrating the importance of HU for RCR (Figure 6E).

Role of HU and UvrD in the RCR of other V. cholerae phages

Ecological interactions between CTX(|) and several other filamentous phages and their satellites drives the continuous and rapid emergence of new epidemic variants of V. cholerae [20,22] . Foremost among the phages implicated in those interactions are RSI, which encodes for an anti-repressor [30,50], VGJ(|), which participates in the horizontal spreading of CTX(|) via the formation of CTX-VGJ(|) hybrids [31,32], and TLC(|), which is almost always found integrated before CTX(|) prophages in clinical isolates and which can lead to their excision [51-53]. Inventors could predict that RSI depended on HU and UvrD for replication, because it is essentially identical to RS2. To determine if VGJ(|) and TLCJ(|) might also depend on HU and UvrD, they conjugated a R6K suicide vector harbouring the replicative region of VGJ(|) (R6K-VGJ) and a R6K suicide vector harbouring the replicative region of the satellite phage TLC(|) (R6K-TLC) in AxerC cells in which hupA, hupB, uvrD or rep were disrupted (Figure 7). No colonies were obtained when R6K-VGJ was conjugated in hup A or hupB mutants, suggesting that the Ηυαβ heterodimer was vital to VGJ(|) RCR (Figure 7). R6K-VGJ also failed to be propagated in AuvrD cells, suggesting that UvrD was required for VGJ(|) RCR (Figure 7). In contrast, AhupAB cells and AuvrD cells seemed to fully support TLC(|) replication (Figure 7). Finally, R6K-TLC was not maintained in Arep AxerC cells, suggesting that TLC(|) RCR depended on Rep (Figure 7). Discussion

Inventors developed a strategy to identify non-essential V. cholerae host factors involved in CTX(|) replication. They thus found that contrary to the proto-typical filamentous phages so far studied, the histone-like HU protein was absolutely necessary for RstA to prime RCR of the phage genome (Figure 2, 3 and 6). In addition, they showed that CTX(|) exploited UvrD, a helicase normally implicated in DNA repair, rather than Rep, the helicase normally associated to replication (Figure 5). Finally, they showed that a member of another family of vibrio filamentous phages, VGJ(|), also exploited HU and UvrD for RCR, demonstrating that (ϋΤΧφ is not an exception (Figure 7).

A role for HU in RCR

HU is a major component of the bacterial nucleoid, which binds dsDNA without any apparent specificity and with a low affinity but which recognizes with a higher affinity defined DNA structures and repair intermediates [54-56]. In E. coli, HU is involved in the initiation of chromosome replication [57-59] . However, it is not essential for survival: IHF, a protein belonging to the same family of DNA -binding proteins, can substitute for it initiation of replication at oriC [60]. Likewise, deletion of hupAB does not compromise cell viability in V. cholerae, possibly because its genome encode for a homolog of IHF.

As far as inventors know, no reports exist on the implication of HU in the life circle of any other filamentous phages than CTX(|) and VGJ(|). HU was shown to be essential for replication of Mini-F and Mini-P plasmids [61]. However, these plasmids replicate by a theta system. In this case, HU bind to the origin without sequence-specificity and help to melt the origin to initiate replication [62]. Interestingly, it was observed in Salmonella typhimurium that replication of a Mini-F plasmid was strongly affected in a AhiipB mutant, totally deficient in a AhiipAB double mutant, but only mildly affected in a AhiipA mutant [63]. This is remarkably similar to what inventors have observed in the case of CTX(|) and a similar role of HU in the initiation of replication should not be discarded. More interestingly, however, it was reported that HU played an essential role in the replication of pKYM, a plasmid from the Gram^" bacterium Shigella sonei [64]. A shared characteristic of proto-typical filamentous phages and of most RCR plasmids is a very simple (+) origin of replication: Ff coliphages contain an approximately 36bp replication origin [65] ; the Gram⁺ pC194 and pT181 plasmids harbour a small 55bp and 70bp origin, respectively [66,67] . None of these mobile elements require accessory proteins for the initiator protein nicking activity. In contrast, pKYM and CTX(|) (+) origins of replication are more complex. The (+) origin of replication of pKYM is 173bp long. It contains a core region corresponding to the RepK initiator binding-site and a downstream enhancer region. HU was shown to specifically recognize this enhancer region and assist in the binding of RepK [64] . CTX(|) ori(+) is 167bp long and contains several inverted repeat sequences upstream and downstream of the RstA cleavage site with the potential to form stem-loops [49]. It is therefore possible that HU helps CTX(|) replication by helping the binding of RstA and/or promoting its endonuclease activity. A weaker binding affinity and/or tighter control of the VGJ(|) HUH endonuclease might explain why the two HU subunits are absolutely essential for this phage. Future biochemical work will need to clarify the exact mechanism of action of HU on RstA activity.

Implication of UvrD in RCR

Rep and UvrD are members of the SFl family of helicases and share approximately 40% similarity [68] . They both unwind DNA in the 3' - 5' direction [69,70] . Despite the structural and functional similarities between Rep and UvrD, the physiological roles of the two helicases are well distinct. Rep is constitutively expressed in E. coli, where it is implicated in chromosome replication: it directly interacts with the replicative helicase DnaB and helps remove nucleoproteins complex in front of replication forks [71,72]. Rep is also implicated in the restart of stalled replication forks [73]. As a result, a Arep E. coli mutants display a 50-60% reduction in their replication rate [40,41]. Nevertheless, Rep is not essential. On the contrary, UvrD is overexpressed during the SOS response in E. coli and its role seems to be mainly limited to DNA repair: its activity is involved in MutHLS- dependent mismatch DNA repair [74] and Uvr ABC-dependent nucleotide excision repair [75]. UvrD also helps dismantle RecA filaments from ssDNA, which prevents unwanted recombination [76]. Finally, UvrD can promote the movement of the replisome along protein-bound DNA and participate in the restart of replication forks [72]. Nevertheless, its deletion does not directly affect replication fork progression in E. coli [71]. Consistent with its role in replication fork progression, Rep was shown to be critical for phage RCR in E. coli, including φΧ174 and the Ff family of filamentous phages [39] . In contrast, inventors found that CTX(|) and VGJ(|) both exploited UvrD for RCR. As far as they know, this is the first time that UvrD has been shown to participate in the replication of a phage genome. A single SFl helicase, PcrA, is encoded in the genome of Gram+ bacteria instead of Rep and UvrD. RCR of plasmids from Gram+ bacteria relies on PcrA. However, some of them can replicate in E. coli using UvrD [42]. In addition, UvrD was shown to be implicated in the RCR of pKYM [77]. Together, these results suggest that RCR depends on an activity common to Rep and UvrD, raising the question as to why these two helicases are not interchangeable, similarly to PcrA and UvrD. Without wishing to be bound by a particular theory, inventors believe that exploitation of UvrD or Rep could be determined by the ability of the initiator protein to directly interact with one or the other of the two accessories helicase. In agreement with this hypothesis, the initiator protein of CTX(|) and VGJ(|) share structural similarities with the initiator protein of the Gram+ plasmids that exploit UvrD to replicate in E. coli (pfam02486). In contrast, the initiator protein of TLC(|) shares sequence and structural similarities with the initiator protein of the E. coli proto-typical filamentous phages (pfam05144 and pfam05155).

Considerations for the biosafety of live- attenuated vaccine cells

The possibility for ctxAB^' V. cholerae cells to be re-infected by CTX(|) raised safety concerns about their use in a live attenuated vaccine (Figure 1A). Several possibilities exist to limit the risk of re- acquisition of the genes and their further spreading. A simple way to block the delivery of the genome of CTX(|) could be to delete the production of its receptors at the cell surface, TCP and TolQRA. However, TCP is essential for intestinal colonization and hence immunogenicity [4] . TolQRA is part of the cell division machinery and is critical for the outer membrane stability of Gram^" bacteria and their resistance to extra-cytoplasmic stress [78-82]. A simple way to limit further spreading of CTX(|) particles could be to block their secretion by deleting EspD [36]. However, EspD appears to be essential in V. cholerae [36]. As a result, the only valid vaccine cell protection strategy proposed to date was based on the constitutive expression of RstR repressors, with each repressor providing immunity against secondary infections by phages encoding the same repressor [27] (Figure 13 A). However, this strategy is limited to known (ϋΤΧφ repressor variants. In addition, it can be circumvented by the production of anti-repressors, by hybrid phage formation and by general transduction of the genome of (ϋΤΧφ by lytic phages. Finally, production of RstR does not affect the efficiency of the RCR process once it has been established, which permits production of new phage particles and further spreading of (ϋΤΧφ (Figure 13B). Thus, it was imperative to search for new comprehensive strategies to prevent the re-acquisition and the environmental spreading of ctxAB. Here, inventors showed that the deletion of hupB impedes ctxAB re-acquisition by CTX-VG^ hybrid infection and dramatically reduces (ϋΤΧφ production when its genome has been acquired by other horizontal transfer mechanisms (Figure 13B). They demonstrate that the deletion of hupB considerably increases the safety of RstR-producing vaccine cells. Moreover, they found that HU and UvrD were both essential for (ϋΤΧφ and νθ φ replication, that their deletion compromised the ability of (ϋΤΧφ to integrate into the genome of its host and blocked the secretion of (ϋΤΧφ particles. HU is not essential for the proliferation of V. cholerae. Therefore, the deletion of hup A and hupB is a second promising strategy for the development of safe live attenuated cholera vaccines. UvrD participates in DNA mismatch repair, many genes of which have been shown to be important for colon colonization [83]. However, in the case the deletion of uvrD affects colon colonization, mutating it in such a way as to compromise its role in RCR without affecting its DNA repair activities offers a third strategy for the development of safe live attenuated cholera vaccines.

Materials and methods

Strains, plasmids and oligonucleotides

Strains, plasmids and oligonucleotides used in this study are described in Table 1, 2 and 3, respectively.

Table 1. Strains used in this study

Strains Genotipe/phenotipes References

N16061 V. cholerae 01 El Tor strain, Str Heidelberg et al.,

Nature, 2000

EMV01 N16061 lacZEc::difl, hapA This study

EMV02 EMV01 hupA::Kmr This study

EMV03 EMV01 hupB::Zeor This study

EMV04 EMV01 hupA::Kmr hupB::Zeor This study

EMV05 EMV01 xerC::rifr This study

EMV06 EMV02 xerC::rifr This study

EMV07 EMV03 xerC::rifr This study

EMV08 EMV04 xerC::rifr This study EMV18 EMV01 uvrD::zeor This study

EMV22 EM V01 rep::zeor This study

EMV37 EMV18 xerC::rifr This study

EMV38 EMV22 xerC::rifr This study

EMV68 EMV01 difl ::pBS66 xerC::rifr This study

EMV69 EMV01 difl ::pBS22 xerC::rifr This study

All V. cholerae strains were constructed by natural transformation. Engineered strains were confirmed by PCR and sequencing. Bacterial strains were grown on Luria-Bertani (LB) agar. Antibiotics were used at the following concentrations: ampicillin (Amp), 100 μg/mL; spectinomycin (Sp), 100 μg/mL; chloramphenicol (Cm), 34 μg/mL for E. coli and 3 μg/mL for V. cholerae; kanamycin (Kn), 50 μg/mL; Zeocin (Zeo), 100 μg/mL for E. coli and 1 μg/mL for V. cholerae and rifampicin (Rif), 100 μg/mL for E. coli and 2 μg/mL for V. cholerae. 0.2% arabinose was used to induce UvrD production from the pBAD24 vector.

Table 2. Plasmids used in this study

Description References pSW23T pSW23::oriTRP4; oriVR6Ky; Cmr Demarre et al. Res

Microbiol. 2005

pBS22 pSW23T harboring the replication and integration Das et al., PNAS, 2010

machinery RS2 of the CTX classical phage of V.

cholerae 569B strain; Cmr

pBS66 pSW23T harboring the replication and integration Das et al., PNAS, 2011

machinery RS2 of the CTX El Tor phage of V.

cholerae N 16061 strain; Cmr

pBS73 pSW23T harboring the replication and integration This study

machinery of VGJ phage; Cmr

pBS90 pSW23T harboring the replication and integration Midonet et al, PNAS, machinery of TLC satellite phage; Cmr 2014

pSW-Short- AttP from CTX El Tor phage cloned into pSW23T Val et al, Mol Cell, 2005

CT

pMEV245 pDS132 carrying an arr2 cassette flanked by the Das et al., PNAS, 2010

upstream and downstream region of V. cholerae xerC;

Cmr ,Rifr

pFX524 pSClOl with a repAts; Ampr This study pEMOl l pFX524 harboring the replication and integration This study machinery RS2 of the CTX El Tor phage of V.

cholerae N16061 strain; Cmr, Specr

pEM017 pEMOl l digested EcoRV, Pmll and circularized to This study delete RstA

pEM019 pUC18 harboring hupB gene flanked by the upstream This study and downstream regions

pEM020 pUC18 harboring hup A gene flanked by the upstream This study and downstream regions

pEM021 pUC18 carrying an Zeor cassette flanked by This study the upstream and downstream regions of

hupB; Apr

pEM022 pUC18 carrying an Kmr cassette flanked by This study the upstream and downstream regions of

hup A; Apr

pEM029 pUC18 harboring uvrD gene flanked by the upstream This study and downstream regions

pEM037 pUC18 carrying an Zeor cassette flanked by This study the upstream and downstream regions of

uvrD; Apr

pEM039 pUC18 harboring rep gene flanked by the upstream This study and downstream regions

pEM044 pUC18 carrying an zeor cassette flanked by This study the upstream and downstream regions of

uvrD; Apr

pEM062 pBAD24 harboring uvrD gene cloned in front of This study arabinose inducible promotor

Table 3. Oligonucleotides used in this study

Sequence

768 TAAAGTGGCGCTTACGCTTGG

769 GAAGCTGCGGTACAGAAGCTC

1269 GACATTCTACCAAGAGCATC

2247 TTGCGCTTTCAGTCCATCAG

2248 GTGGTCTGGAGCGCGAAATC

2251 CACGGATCCCGTCATAACTTGCGTTACTG 2252 CACG CATG CACTCGG CA ATACCGTATTAG

2249 CACCTCGAGTCACTGTGATTCCCCTTTGG

2250 CACAGATCTCTCTGAAAGACGCTTGCAAC

2253 CA CTCTA G ATC ATTTA G GTTTC CCTTCTC

2254 CACGTCGACAGACGCGATCAAGTAATTGC

2425 TCACG GTACCTG CGTG G CAG CTTCTATCTC

2426 TCACTCTAGATTGGCTGCTTACCACGTCTG

2427 TCACGGATCCTTGAGACCGTCGAGCAATAG

2441 TCACGAATTCTCAACCGGATTGGCGGTCAC

2442 TCACTCTAGAAACCCACGACAACCGGAATC

2443 TCACAG ATCTCCG CTTCATCTTGTCTTG G G

2690 ACCCTACTCCCTCAATTTG G

2444 TCACAG ATCTCAAAG G CCAAGCG CATATCG

2701 ACACCATGGCCAGTGGCGAAGTCATGATC

2702 CACGCATGCCTTACTTACTTGTCATCGTCGTCCTTGTAGTCTCTAGACACCTTCTCTAATCTCG

2704 GTCTTCGTATGTCGCCTTGG

ARB1 GGCCACGCGTCGACTAGTACN N N N N N N N N NGATAT

ARB2 GGCCACGCGTCGACTAGTAC

ARB6 GGCCACGCGTCGACTAGTACN N N N N N N N N NACGCC

1314 GTCATCGTCATCCTTGTAATCG

846 AAATGATCACGAGATAGGGTTGAGTGTTG

Mariner transposon-mutagenesis, screening and mutant characterization

A mariner transposon-mutagenesis bank of a V. cholerae reporter strain was created as described [25]. The bank was conjugated with a spectinomycin resistant (SpecR) derivative of RS2 El Tor containing a thermosensitive (TS) origin of replication (pSC101-RS2). Individual colonies were selected on X- Gal, IPTG and spectinomycin plates after 48 h of growth at 30°C. Fully blue colonies were selected and re-streaked in parallel at 30°C and 42°C. TS clones were cured from pSC101-RS2 by overnight growth in the absence of antibiotic and their phenotype was corroborated by re-conjugation with the same plasmid. The insertion was mapped by direct sequencing of the DNA flanking the point of insertion of the mariner transposons, which was amplified by arbitrary-random PCR [84].

Conjugation assay.

E. coli β2163 meso-diaminopimelic acid (DAP) auxotroph donors and V. cholerae recipients were grown to 0.3 at OD₆₀o_nm- Bacteria were pelleted by centrifugation, re-suspended in 50 μΕ and mixed at a 1 : 10 ratio, dropped onto sterile filter paper on top of an LB-agar plate supplemented with DAP and incubated for 3 h. Conjugants were selected for the plasmid antibiotic resistance and DAP prototrophy. To monitor integration, conjugants were spread on plates containing X-gal and incubated at 37°C overnight. Conjugants carrying a TS origin of replication were re-covered at 30°C.

Assay of ΟΤΧφ infection efficiency and phage production

Strains harbouring kanamycin-marked (ϋΤΧφ were used as donors. Eighty microliters of filtered supernatant containing CTX-Kn particles was mixed with 20 μΐ of recipients strains that had been grown in AKI media to induce TCP expression [85]. The mix was incubated 20 min at 37°C to allow infection and then plated on LB to determine the number of potential recipients and LB supplemented with kanamycin to determine the number of infected cells. The frequency of infection was determined by the ration of Kn^R cells and the total number of recipients.

Q-PCR analysis

Total DNA was purified using the GenElute^tm Bacterial Genomic DNA Kit from Sigma. Samples were analysed using a LightCycler FastStart DNA masterSYBR Green I system from Roche. Reactions were run in triplicate using a LightCycler 480 instrument (Roche). Primer 2690 and 2704, which amplify a specific 150 bp fragment inside rstA gene, were used for phage DNA quantification. Data were normalized with the bacterial chromosome using primers 768 and 769, which amplify a 150 bp fragment within the matP gene. For single strand DNA quantification, total DNA was digested 3 hours with Seal to remove phage dsDNA. There is a cleavage site for Seal within the phage fragment used for the analysis. Relative copy number of ssDNA was calculated as follows: 2 x _eiCp_dⁱgested^c_P_chromosom^ ^ _wni_{cn e} represents the amplification efficiency of the primers pairs used. A factor of 2 was used to normalize the ssDNA of the phage with the dsDNA of the chromosome. The analysis was run out in parallel without prior digestion, which permitted to calculate the relative copy number of dsDNA as follows: (_{e i} ^cP-™^dig-^ted_e₁ ^cP-^di8^ested)/e₂ ^Cp-^chromosome.

SDS-page and western blot

Bacterial lysates were electrophoresed on 12% SDS-page gel. HUoc or ΗΙΙβ with a C-terminal 6xHis tag were analysed by western blot with a primary anti-4His mouse monoclonal antibody (Invitrogen) and a secondary anti-mouse IgG antibody coupled to peroxidase (Pierce). ECL Western Blotting Substrate (Pierce) was used to detect the reaction on a LAS-3000 Luminescent Analyser (Fujifilm). Sequencing gel and nick detection

For nick detection, pBS66 was conjugated to the strain of interest and then total DNA was purified directly from the conjugation assay. After digestion with Notl, inventors performed a primer extension reaction using as a primer the 1269 oligonucleotide that had been labelled with γ-[32Ρ] ATP. The sequence ladder was prepared using pBS66 purified from E. coli, in which CTX(|) does not replicate, and the fmol DNA Cycle Sequencing System (Promega). REFERENCES

I. Ali M, Lopez AL, You YA, Kim YE, Sah B, et al. (2012) The global burden of cholera. Bull World Health Organ 90: 209-218A. doi: 10.2471/BLT.11.093427.

2. Sack DA, Sack RB, Nair GB, Siddique A (2004) Cholera. The Lancet 363: 223-233. doi: 10.1016/S0140-6736(03)15328-7.

3. Kaper JB, Morris JG, Levine MM (1995) Cholera. Clin Microbiol Rev 8: 48-86.

4. Herrington DA, Hall RH, Losonsky G, Mekalanos JJ, Taylor RK, et al. (1988) Toxin, toxin- coregulated pili, and the toxR regulon are essential for Vibrio cholerae pathogenesis in humans. J Exp Med 168: 1487-1492. doi:10.1084/jem.l68.4.1487.

5. Mekalanos JJ, Swartz DJ, Pearson GD, Harford N, Groyne F, et al. (1983) Cholera toxin genes: nucleotide sequence, deletion analysis and vaccine development. Nature 306: 551-557.

6. Kaper JB, Lockman H, Baldini MM, Levine MM (1984) Recombinant nontoxinogenic Vibrio cholerae strains as attenuated cholera vaccine candidates. Nature 308: 655-658.

7. Valle E, Ledon T, Cedre B, Campos J, Valmaseda T, et al. (2000) Construction and Characterization of a Nonproliferative El Tor Cholera Vaccine Candidate Derived from Strain 638. Infect Immun 68: 6411-6418. doi: 10.1128/IAI.68.11.6411-6418.2000.

8. Liang W, Wang S, Yu F, Zhang L, Qi G, et al. (2003) Construction and Evaluation of a Safe, Live, Oral Vibrio cholerae Vaccine Candidate, IEM108. Infect Immun 71 : 5498-5504. doi: 10.1128/IAI.71.10.5498-5504.2003.

9. Waldor MK, Mekalanos JJ (1996) Lysogenic conversion by a filamentous phage encoding cholera toxin. Science 272: 1910-1914.

10. Mutreja A, Kim DW, Thomson NR, Connor TR, Lee JH, et al. (2011) Evidence for multiple waves of global transmission in the seventh cholera pandemic. Nature 477: 462-465. doi:naturel0392 [pii] 10.1038/nature 10392.

I I. Chun J, Grim CJ, Hasan NA, Lee JH, Choi SY, et al. (2009) Comparative genomics reveals mechanism for short-term and long-term clonal transitions in pandemic Vibrio cholerae. Proc Natl Acad Sci U A 106: 15442-15447. doi:0907787106 [pii] 10.1073/pnas.0907787106.

12. Kim EJ, Lee D, Moon SH, Lee CH, Kim SJ, et al. (2014) Molecular Insights Into the Evolutionary Pathway of Vibrio cholerae 01 Atypical El Tor Variants. PLoS Pathog 10: el004384. doi: 10.1371/journal.ppat.l004384.

13. Heilpern AJ, Waldor MK (2000) CTXcp Infection of Vibrio cholerae Requires the tolQRA Gene Products. J Bacteriol 182: 1739-1747. doi: 10.1128/JB.182.6.1739-1747.2000.

14. Khan SA (2005) Plasmid rolling-circle replication: highlights of two decades of research. Plasmid 53: 126-136.

15. Moyer KE, Kimsey HH, Waldor MK (2001) Evidence for a rolling-circle mechanism of phage DNA synthesis from both replicative and integrated forms of CTXphi. Mol Microbiol 41 : 311-323. 16. Waldor MK, Rubin EJ, Pearson GDN, Kimsey H, Mekalanos JJ (1997) Regulation, replication, and integration functions of the Vibrio cholerae CTXcp are encoded by region RS2. Mol Microbiol 24: 917-926. doi: 10.1046/j. l365-2958.1997.3911758.x.

17. Chandler M, Cruz F de la, Dyda F, Hickman AB, Moncalian G, et al. (2013) Breaking and joining single-stranded DNA: the HUH endonuclease superfamily. Nat Rev Microbiol 11. Available: http://www.readcube.com/articles/10.1038/nrmicro3067. Accessed 23 October 2014.

18. Quinones M, Kimsey HH, Waldor MK (2005) LexA cleavage is required for CTX prophage induction. Mol Cell 17: 291-300.

19. Huber KE, Waldor MK (2002) Filamentous phage integration requires the host recombinases XerC and XerD. Nature 417: 656-659.

20. Das B, Martinez E, Midonet C, Barre F-X (2013) Integrative mobile elements exploiting Xer recombination. Trends Microbiol 21: 23-30. doi:10.1016/j.tim.2012.10.003.

21. Val M-E, Kennedy SP, El Karoui M, Bonne L, Chevalier F, et al. (2008) FtsK-dependent dimer resolution on multiple chromosomes in the pathogen Vibrio cholerae. PLoS Genet 4. doi: 10.1371/journal.pgen.l000201.

22. Midonet C, Barre F-X (n.d.) Xer Site Specific Recombination: Promoting vertical and horizontal transmission of genetic information. Mobile DNA III. Waschington: Nancy Craig.

23. Val M-E, Bouvier M, Campos J, Sherratt D, Cornet F, et al. (2005) The Single-Stranded Genome of Phage CTX Is the Form Used for Integration into the Genome of Vibrio cholerae. Mol Cell 19: 559-566. doi: 10.1016/j.molcel.2005.07.002.

24. Das B, Bischerour J, Val M-E, Barre F-X (2010) Molecular keys of the tropism of integration of the cholera toxin phage. Proc Natl Acad Sci 107: 4377-4382. doi: 10.1073/pnas.0910212107.

25. Bischerour J, Spangenberg C, Barre F-X (2012) Holliday junction affinity of the base excision repair factor Endo III contributes to cholera toxin phage integration. EMBO J 31 : 3757-3767. doi: 10.1038/emboj.2012.219.

26. Rakonjac J, Bennett NJ, Spagnuolo J, Gagic D, Russel M (2011) Filamentous bacteriophage: biology, phage display and nanotechnology applications. Curr Issues Mol Biol 13: 51-76.

27. Kimsey HH, Waldor MK (1998) CTXcp immunity: Application in the development of cholera vaccines. Proc Natl Acad Sci 95: 7035-7039.

28. Raychoudhuri A, Patra T, Ghosh K, Ramamurthy T, Nandy RK, et al. (2009) Classical ctxB in Vibrio cholerae 01, Kolkata, India. Emerg Infect Dis 15: 131-132.

29. Nguyen DT, Nguyen BM, Tran HH, Ngo TC, Le TH, et al. (2008) Filamentous vibriophage fs2 encoding the rstC gene integrates into the same chromosomal region as the CTX phage [corrected]. FEMS Microbiol Lett 284: 225-230. doi:FML1200 [pii] 10.1111/j.l574-6968.2008.01200.x.

30. Davis BM, Kimsey HH, Kane AV, Waldor MK (2002) A satellite phage-encoded antirepressor induces repressor aggregation and cholera toxin gene transfer. Embo J 21 : 4240-4249. 31. Campos J, Martinez E, Marrero K, Silva Y, Rodriguez BL, et al. (2003) Novel Type of Specialized Transduction for CTXcp or Its Satellite Phage RSI Mediated by Filamentous Phage VGJcp in Vibrio cholerae. J Bacteriol 185: 7231-7240. doi: 10.1128/JB.185.24.7231-7240.2003.

32. Das B, Bischerour J, Barre F-X (2011) VGJ(j> integration and excision mechanisms contribute to the genetic diversity of Vibrio cholerae epidemic strains. Proc Natl Acad Sci 108: 2516-2521. doi: 10.1073/pnas.l017061108.

33. Campos J, Martinez E, Izquierdo Y, Fando R (2010) VEJcp, a novel filamentous phage of Vibrio cholerae able to transduce the cholera toxin genes. Microbiology 156: 108-115. doi: 10.1099/mic.0.032235-0.

34. Campos J, Martinez E, Suzarte E, Rodriguez BL, Marrero K, et al. (2003) VGJcp, a Novel Filamentous Phage of Vibrio cholerae, Integrates into the Same Chromosomal Site as CTXcp. J

Bacteriol 185: 5685-5696. doi:10.1128/JB.185.19.5685-5696.2003.

35. Udden SM, Zahid MS, Biswas K, Ahmad QS, Cravioto A, et al. (2008) Acquisition of classical CTX prophage from Vibrio cholerae 0141 by El Tor strains aided by lytic phages and chitin- induced competence. Proc Natl Acad Sci U A 105: 11951-11956. doi:0805560105 [pii] 10.1073/pnas.0805560105.

36. Davis BM, Lawson EH, Sandkvist M, Ali A, Sozhamannan S, et al. (2000) Convergence of the Secretory Pathways for Cholera Toxin and the Filamentous Phage, CTX(|). Science 288: 333-335. doi: 10.1126/science.288.5464.333.

37. Grove A (2011) Functional evolution of bacterial histone-like HU proteins. Curr Issues Mol Biol 13: 1-12.

38. Dillingham MS (2011) Superfamily I helicases as modular components of DNA-processing machines. Biochem Soc Trans 39: 413^123. doi: 10.1042/BST0390413.

39. Takahashi s, Hours C, Iwaya M, Lane H E D, Denhardt D T (n.d.) The Escherichia Coli Rep Gene in the Single-Stranded DNA Phages. Denhardt, D.T., Dressier, D.H., and Ray, D.S. (eds). Cold Spring Harbour, NY: Cold Spring Harbour Laboratory Press, pp. 393-400.

40. Colasanti J, Denhardt DT (1987) The Escherichia coli rep mutation. X. Consequences of increased and decreased Rep protein levels. Mol Gen Genet MGG 209: 382-390.

41. Lane HE, Denhardt DT (1975) The rep mutation. IV. Slower movement of replication forks in Escherichia coli rep strains. J Mol Biol 97: 99-112.

42. Bruand C, Ehrlich SD (2000) UvrD-dependent replication of rolling-circle plasmids in Escherichia coli. Mol Microbiol 35: 204-210. doi: 10.1046/j. l365-2958.2000.01700.x.

43. Caron PR, Kushner SR, Grossman L (1985) Involvement of helicase II (uvrD gene product) and DNA polymerase I in excision mediated by the uvrABC protein complex. Proc Natl Acad Sci 82: 4925^1929.

44. Bidnenko V, Lestini R, Michel B (2006) The Escherichia coli UvrD helicase is essential for Tus removal during recombination-dependent replication restart from Ter sites. Mol Microbiol 62: 382-396. doi: 10.1111/j.1365-2958.2006.05382.X. 45. Flores M-J, Sanchez N, Michel B (2005) A fork-clearing role for UvrD. Mol Microbiol 57: 1664-1675. doi: 10.1111/j.l365-2958.2005.04753.x.

46. Lestini R, Michel B (2007) UvrD controls the access of recombination proteins to blocked replication forks. EMBO J 26: 3804-3814. doi: 10.1038/sj.emboj.7601804.

47. Arthur HM, Eastlake PB (1983) Transcriptional control of the uvrD gene of Escherichia coli. Gene 25: 309-316.

48. Finch P, Emmerson PT (1983) Nucleotide sequence of the regulatory region of the uvrD gene of Escherichia coli. Gene 25: 317-323.

49. Moyer KE, Kimsey HH, Waldor MK (2001) Evidence for a rolling-circle mechanism of phage DNA synthesis from both replicative and integrated forms of CTXcp. Mol Microbiol 41 : 311-323. doi: 10.1046/j. l365-2958.2001.02517.x.

50. Kamruzzaman M, Robins WP, Bari SMN, Nahar S, Mekalanos JJ, et al. (2014) RSI Satellite Phage Promotes Diversity of Toxigenic Vibrio cholerae by Driving CTX Prophage Loss and Elimination of Lysogenic Immunity. Infect Immun 82: 3636-3643. doi: 10.1128/IAI.01699-14.

51. Midonet C, Das B, Paly E, Barre F-X (2014) XerD-mediated FtsK-independent integration of TLC(|) into the Vibrio cholerae genome. Proc Natl Acad Sci: 201404047. doi : 10.1073/pnas .1404047111.

52. Hassan F, Kamruzzaman M, Mekalanos JJ, Faruque SM (2010) Satellite phage TLCphi enables toxigenic conversion by CTX phage through dif site alteration. Nature 467: 982-985. doi:nature09469 [pii] 10.1038/nature09469.

53. Rubin EJ, Lin W, Mekalanos JJ, Waldor MK (1998) Replication and integration of a Vibrio cholerae cryptic plasmid linked to the CTX prophage. Mol Microbiol 28: 1247-1254.

54. Castaing B, Zelwer C, Laval J, Boiteux S (1995) HU Protein of Escherichia coli Binds Specifically to DNA That Contains Single-strand Breaks or Gaps. J Biol Chem 270: 10291-10296. doi: 10.1074/jbc.270.17.10291.

55. Kamashev D, Rouviere-Yaniv J (2000) The histone-like protein HU binds specifically to DNA recombination and repair intermediates. EMBO J 19: 6527-6535. doi: 10.1093/emboj/19.23.6527.

56. Rouviere-Yaniv J, Gros F (1975) Characterization of a novel, low-molecular-weight DNA- binding protein from Escherichia coli. Proc Natl Acad Sci U S A 72: 3428-3432.

57. Ogawa T, Wada M, Kano Y, Imamoto F, Okazaki T (1989) DNA replication in Escherichia coli mutants that lack protein HU. J Bacteriol 171 : 5672-5679.

58. Kano Y, Ogawa T, Ogura T, Hiraga S, Okazaki T, et al. (1991) Participation of the histone- like protein HU and of IHF in minichromosomal maintenance in Escherichia coli. Gene 103: 25-30.

59. Dixon NE, Kornberg A (1984) Protein HU in the enzymatic replication of the chromosomal origin of Escherichia coli. Proc Natl Acad Sci U S A 81 : 424-428.

60. Bramhill D, Kornberg A (1988) Duplex opening by dnaA protein at novel sequences in initiation of replication at the origin of the E. coli chromosome. Cell 52: 743-755. doi: 10.1016/0092- 8674(88)90412-6.

61. Ogura T, Niki H, Kano Y, Imamoto F, Hiraga S (1990) Maintenance of plasmids in HU and IHF mutants of Escherichia coli. Mol Gen Genet MGG 220: 197-203.

62. Wada M, Kohno K, Imamoto F, Kano Y (1988) Participation of hup gene product in ori2- dependent replication of fertility plasmid F. Gene 70: 393-397.

63. Hillyard DR, Edlund M, Hughes KT, Marsh M, Higgins NP (1990) Subunit-specific phenotypes of Salmonella typhimurium HU mutants. J Bacteriol 172: 5402-5407.

64. Yasukawa H, Ozaki E, Nakahama K, Masamune Y (1997) HU protein binding to the replication origin of the rolling-circle plasmid pKYM enhances DNA replication. Mol Gen Genet MGG 254: 548-554.

65. Rasched I, Oberer E (1986) Ff coliphages: structural and functional relationships. Microbiol Rev 50: 401.

66. Gros MF, te Riele H, Ehrlich SD (1989) Replication origin of a single-stranded DNA plasmid pC194. EMBO J 8: 2711-2716.

67. Novick RP (1989) Staphylococcal Plasmids and their Replication. Annu Rev Microbiol 43: 537-563. doi: 10.1146/annurev.mi.43.100189.002541.

68. Lohman TM, Bjornson KP (1996) Mechanisms of Helicase-Catalyzed DNA Unwinding. Annu Rev Biochem 65: 169-214. doi:10.1146/annurev.bi.65.070196.001125.

69. Yarranton GT, Gefter ML (1979) Enzyme -catalyzed DNA unwinding: Studies on Escherichia coli rep protein. Proc Natl Acad Sci U S A 76: 1658-1662.

70. Matson SW (1986) Escherichia coli helicase II (urvD gene product) translocates unidirectionally in a 3' to 5' direction. J Biol Chem 261 : 10169-10175.

71. Guy CP, Atkinson J, Gupta MK, Mahdi AA, Gwynn EJ, et al. (2009) Rep provides a second motor at the replisome to promote duplication of protein-bound DNA. Mol Cell 36: 654-666. doi: 10.1016/j.molcel.2009.11.009.

72. Boubakri H, de Septenville AL, Viguera E, Michel B (2010) The helicases DinG, Rep and UvrD cooperate to promote replication across transcription units in vivo. EMBO J 29: 145-157. doi: 10.1038/emboj.2009.308.

73. Michel B, Ehrlich SD, Uzest M (1997) DNA double-strand breaks caused by replication arrest. EMB O J 16 : 430-438.

74. Iyer RR, Pluciennik A, Burdett V, Modrich PL (2006) DNA Mismatch Repair: Functions and Mechanisms. Chem Rev 106: 302-323. doi: 10.1021/cr0404794.

75. Reardon JT, Sancar A (2005) Nucleotide Excision Repair. In: Kivie Moldave, editor. Progress in Nucleic Acid Research and Molecular Biology. Academic Press, Vol. Volume 79. pp. 183-235. Available: http://www.sciencedirect.com/science/article/pii/S0079660304790042. Accessed 3 December 2014.

76. Veaute X, Delmas S, Selva M, Jeusset J, Le Cam E, et al. (2005) UvrD helicase, unlike Rep helicase, dismantles RecA nucleoprotein filaments in Escherichia coli. EMBO J 24: 180-189. doi: 10.1038/sj.emboj.7600485.

77. Yasukawa H, Hase T, Sakai A, Masamune Y (1991) Rolling-circle replication of the plasmid pKYM isolated from a gram-negative bacterium. Proc Natl Acad Sci U S A 88: 10282-10286.

78. Dubuisson J-F, Vianney A, Hugouvieux-Cotte-Pattat N, Lazzaroni JC (2005) Tol-Pal proteins are critical cell envelope components of Erwinia chrysanthemi affecting cell morphology and virulence. Microbiology 151 : 3337-3347. doi: 10.1099/mic.0.28237-0.

79. Gerding MA, Ogata Y, Pecora ND, Niki H, De Boer PAJ (2007) The trans-envelope Tol-Pal complex is part of the cell division machinery and required for proper outer-membrane invagination during cell constriction in E. coli. Mol Microbiol 63: 1008-1025. doi: 10.1111/j.1365- 2958.2006.05571.x.

80. Vines ED, Marolda CL, Balachandran A, Valvano MA (2005) Defective O-Antigen Polymerization in tolA and pal Mutants of Escherichia coli in Response to Extracytoplasmic Stress. J Bacteriol 187: 3359-3368. doi:10.1128/JB.187.10.3359-3368.2005.

81. Llamas MA, Ramos JL, Rodriguez-Herva JJ (2000) Mutations in Each of the tol Genes ofPseudomonas putida Reveal that They Are Critical for Maintenance of Outer Membrane Stability. J Bacteriol 182: 4764-4772. doi:10.1128/JB.182.17.4764-4772.2000.

82. Prouty AM, Velkinburgh JCV, Gunn JS (2002) Salmonella enterica Serovar Typhimurium Resistance to Bile: Identification and Characterization of the tolQRA Cluster. J Bacteriol 184: 1270- 1276. doi: 10.1128/JB.184.5.1270-1276.2002.

83. Davies BW, Bogard RW, Dupes NM, Gerstenfeld TAI, Simmons LA, et al. (2011) DNA Damage and Reactive Nitrogen Species are Barriers to Vibrio cholerae Colonization of the Infant Mouse Intestine. PLoS Pathog 7. Available: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3040672/. Accessed 16 December 2014.

84. O'Toole GA, Kolter R (1998) Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: a genetic analysis. Mol Microbiol 28: 449-461.

85. Iwanaga M, Yamamoto K, Higa N, Ichinose Y, Nakasone N, et al. (1986) Culture conditions for stimulating cholera toxin production by Vibrio cholerae 01 El Tor. Microbiol Immunol 30: 1075- 1083.

Claims

1. A genetically modified Vibrio cholerae strain comprising i) a mutation suppressing the phage replication activity of UvrD, ii) a mutation preventing the expression of functional HupA (HUa) and HupB (ΗΙΙβ), and/or iii) a mutation preventing the expression of functional HupB, wherein when the strain comprises a mutation preventing the expression of functional HupB, the V. cholera strain preferably also expresses an RstR polypeptide and further comprises a distinct mutation consisting of an attRS deletion, a knockout mutation in rstA and/or a knockout mutation in rstB.

2. The strain according to claim 1, wherein the mutation is a gene deletion or a knock-out mutation.

3. The strain according to claim 2, wherein the mutation is UvrD deletion and/or hup A and hupB deletion.

4. The strain according to claim 2, wherein the mutation is a knock-out mutation of UvrD.

5. The strain according to anyone of claims 1 to 4 for use as a pharmaceutical agent.

6. The strain according to anyone of claims 1 to 4 for use as an adjuvant.

7. The strain according to anyone of claims 1 to 4 for use in a vaccine composition.

8. An immunogenic composition for use for the immunization of a subject against Vibrio cholerae infection comprising a genetically modified Vibrio cholerae strain according to anyone of claims 1 to 7, optionally together with a pharmaceutically acceptable carrier and/or any delivery system designed to deliver said strain in a viable state to the intestinal tract.

9. The immunogenic composition according to claim 8, wherein said immunogenic composition is a live vaccine.

10. Kit comprising an immunologically effective amount of the Vibrio cholerae strain according to anyone of claims 1 to 4 or a composition according to claim 8 or 9, and means for administering said strain or composition to a subject.