WO2012142684A1 - Method for constructing an attenuated mutant strain of pathogenic bacteria, vaccine, vaccine vector and use of said vaccine - Google Patents

Method for constructing an attenuated mutant strain of pathogenic bacteria, vaccine, vaccine vector and use of said vaccine Download PDF

Info

Publication number
WO2012142684A1
WO2012142684A1 PCT/BR2012/000059 BR2012000059W WO2012142684A1 WO 2012142684 A1 WO2012142684 A1 WO 2012142684A1 BR 2012000059 W BR2012000059 W BR 2012000059W WO 2012142684 A1 WO2012142684 A1 WO 2012142684A1
Authority
WO
WIPO (PCT)
Prior art keywords
process according
vaccine
gene
spp
recombination
Prior art date
Application number
PCT/BR2012/000059
Other languages
French (fr)
Portuguese (pt)
Inventor
Marcelo Brocchi
Luciane Benedita Duarte PIVETTA
Original Assignee
Universidade Estadual De Campinas- Unicamp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Universidade Estadual De Campinas- Unicamp filed Critical Universidade Estadual De Campinas- Unicamp
Publication of WO2012142684A1 publication Critical patent/WO2012142684A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
    • C12N1/36—Adaptation or attenuation of cells
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/02—Bacterial antigens
    • A61K39/025—Enterobacteriales, e.g. Enterobacter
    • A61K39/0275—Salmonella
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/04—Antibacterial agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • C07K14/255—Salmonella (G)
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
    • A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
    • A61K2039/522—Bacterial cells; Fungal cells; Protozoal cells avirulent or attenuated
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Patent Descriptive Report for: "Process for the attenuated lineage building process of a pathogenic bacterium, vaccine, vaccine vector and use of said vaccine".
  • the present invention relates to a process of producing attenuated mutant strains capable of promoting immunization to vaccine vectors and vaccines for the treatment of salmonellosis and their use in combating such infection.
  • mutants are null for HU hupA and hupB genes and have been tested for attenuation of virulence and ability to elicit effective and protective immune response against salmonellosis.
  • the genus Salmonella sp belongs to the Enterobacteriaceae family and is made up of gram-negative, facultative anaerobic bacilli usually flagellated (Mastroeni and Maskell, 2006).
  • the serological classification of this bacterium is based on the identification of somatic (O), flagellar (H) and capsular (Vi) antigens, the latter when present.
  • S. enterica S. bongori. THE S. enteric species is subdivided into 7 subgroups, and the great majority of pathogenic serovegions for humans are included in subgroup I (Boyd et al. 1996).
  • Pathogenic S. enteric serovarities can cause infections in mammals with varying degrees of severity, from gastroenteritis located in the intestinal mucosa to severe systemic infections, depending on the bacterial serovarity and type of host involved (B ⁇ umler et al., 1998).
  • S. enterica Typhi is the causative agent of typhoid fever, a serious systemic infection in man (Guzman et al., 2006).
  • S. enterica Choleraesuis causes severe systemic infections, especially in pigs, although it can also cause infections in humans (Mastroeni and Maskell, 2006; Salyers and Whitt, 2002).
  • Enteric Salmonella Dublin is a serovarity associated mainly with cattle. Like S. enterica Thyphi in humans, serovar Dublin is invasive and can cause gastroenteritis and septicemia in these animals (Mastroeni and Maskell, 2006).
  • enterica Typhimurium and Enteritidis are common causes of gastroenteritis in humans, but may also be associated with extra-intestinal infections (Mastroeni and Maskell, 2006).
  • S. enterica Typhimurium and Enteritidis cause a type of infection very similar to human typhoid fever.
  • BALB / c mice are used as the murine model of systemic S. enteric infection.
  • Salmonellosis is one of the most common infectious diseases in both humans and animals.
  • S. enteric infection begins with ingestion of contaminated water or foods, particularly poultry and pork foods. These microorganisms are facultative intracellular pathogens and, once ingested, have the ability to adhere to and invade intestinal mucosal cells, preferably M cells (Jones et al., 1994). Once the intestinal mucosa is exceeded, S. enterica invades, persists and proliferates within endothelial reticulum cell vacuoles and can thus reach different organs and tissues of the host, causing systemic infection (Salyer and Whitt, 2002).
  • the average infective dose (DI5 0) of S. enterica capable of producing clinical or subclinical infections in humans is between 10 5 -10 10 ingested organisms.
  • the infectious process is localized to the ileum, colon, and mesenteric lymph nodes after ingestion of contaminated food, with symptoms such as diarrhea, vomiting, and abdominal pain appearing (reviewed by Darwin and Miller, 1999).
  • Most cases of gastroenteritis occur in children under 10 years of age, and the symptoms tend to be more severe in this group and the infection may become systemic.
  • S. enterica An important barrier encountered by S. enterica in the infectious process following its passage through the intestinal epithelium is the submucosa macrophages (Mastroeni and Maskell, 2006; Salyers and Whitt, 2002). Macrophages detect and internalize the bacterial pathogen in order to eliminate it from the host.
  • S. enteric serovarieties capable of causing systemic infection, invade macrophages and then activate virulence mechanisms that allow evasion of phagocyte microbicidal functions, allowing survival and replication in the intracellular environment (Mastroeni and Maskell, 2006; Salyers and Hitt, 2002; Alpuche-Aranda, et al., 1994). Migration of infected macrophages to other organs of the phagocytic monocytic system facilitates the spread of the bacteria into the host.
  • MALT mucosal associated lymphoid tissue
  • the first live attenuated vaccine developed against typhoid fever is the S. enteral Typhi Ty21a strain. This strain was obtained by chemical mutagenesis of the Ty2 parental lineage (Germanier and Furer, 1983). This oral vaccine is safe, but because of its great attenuation, it requires several doses to induce immunity, which is often short-lived (Guzman et al., 2006; Strugnell and Wijburg, 2006).
  • enteral AaroA, AaroC, AaroD strains deficient in the aromatic amino acid biosynthetic pathway (Tacket et al., 1997), Acya Accrp mutants, unable to express adenylate cyclase and the cAMP receptor (Curtiss and Kelly, 1987 ; Tacket et al., 1997), phoP-phoQ mutants (Hohmann et al., 1996) among others, were constructed and demonstrated to be immunogenic despite attenuation of virulence.
  • S. enterica an excellent carrier of antigens to cells of the immune system.
  • attenuated S. enteric strains can be genetically engineered to express heterologous antigens by constructing multifactorial vaccine strains. Different antigens derived from other bacteria, viruses, fungi, parasites and even ⁇ Mammalian Cells were expressed in vaccine strains of S. enterica.
  • strains were able to induce protective immune response not only against salmonellosis but also against the heterologous antigen donor organism (Cheminay and Hensel, 2007; Kwon et al., 2007; Loessner et al., 2007; Mahoney et al., 2007; Atkins et al., 2006).
  • An A fundamental feature of such strains is, besides being unlikely to reverse attenuation, the ability to express the heterologous antigen stably and in sufficient quantities to induce the immune system.
  • Bacterial nucleoid and target genes hupA and hupB
  • Bacteria contain proteins that make up the bacterial nucleoid ("nucleoid-associates proteins", Nap) together with chromosomal DNA. Unlike eukaryotic histones, bacterial proteins do not appear to form nucleosome-like complexes with DNA (Thanbichler et al., 2005). Within this group are 12 proteins and the most studied are HU, FIS, IHF, HNS and DPS (Dorman, 2009; Dorman and Kane, 2009; Cróin ⁇ n and Dorman et al, 2007; Dorman et al., 2006; Drlica and Rouviere-Yaniv, 1987).
  • HU is a heterodimeric protein encoded by two genes, namely hupA and hupB. This protein does not appear to recognize any specific DNA binding sequence, but has great affinity for supercoiled or distorted DNA structure regions (Pinson et al., 1999). Swinger et al. (2004) demonstrated that this protein is capable of inducing and stabilizing bends from different angles in DNA. Some studies suggest that HU participates in DNA repair by recombination (Swinger et al., 2004).
  • the Salmonella hupA gene was compared to the E.coli hupA gene by cloning and sequencing, which revealed that the HUa subunits of these bacteria are identical and that sequences outside the ORFs are highly conserved (Higgins & Hillyard, 1988).
  • hupB gene has been described as a negative modulator in hilA expression, which is a crucial gene in the expression of invasive Salmonella phenotype (Fahlen et al., 2000).
  • hupB has been described as a negative modulator in hilA expression, which is a crucial gene in the expression of invasive Salmonella phenotype (Fahlen et al., 2000).
  • hupB has a positive action on hilA regulation (Schechter et al., 2003).
  • Datsenko and Wanner described the construction and use of a bacteriophage ⁇ -based system for the construction of mutant strains of enteric bacteria.
  • This system is composed of accessory plasmids, the plasmid pkD3 being used in the construction of PCR recombination cassettes (Datsenko and Wanner. 2000).
  • said PI 0006291-0 relates only to attenuation promoted by deletion of another gene, that is, the recA gene.
  • 7,045,122 also concerns only the attenuation promoted by deletion of a gene, that is, the recA gene.
  • US Patent Document 2004/101531 describes vaccines and immunogenic compositions that use live attenuated pathogenic bacteria, such as Salmonella, to deliver ectopic antigens to the mucosal immune system of vertebrate animals. Attenuated pathogenic bacteria are prepared to secrete the antigen into the bacteria's periplasmic space or into the bacteria.
  • the use of live attenuated bacterial strains as a vaccine has historically been associated with the induction of effective and persistent immune response.
  • the vaccine vector consists of a bacterium that expresses antigens (proteins) from other species of microorganisms obtained by the recombinant DNA method. When presented to the host (target organism) immune system, these microorganisms stimulate the production of antibodies against the disease of interest without causing serious symptoms or damage to the host.
  • the present invention will provide significant advantages over the immunization processes based on gene silencing of HU, enabling an increase of its performance and presenting a more favorable cost / benefit ratio.
  • the present invention relates in a first aspect to the construction of S. enteral null mutants for the HU (Heat Unstable Protein) encoding genes (hupA and / or hupB) in order to develop attenuated but virulence lines. cause transient infection and effectively induce the immune system, constituting potential vaccine strains.
  • HU Heat Unstable Protein
  • An object of the present invention is an attenuated bacterium comprising at least one mutated HU coding gene in a pathogenic bacterium.
  • the present invention also relates to an attenuated bacterial-based vaccine comprising at least one mutant HU encoding gene in a pathogenic bacterium capable of inducing and stimulating an immune response. in the vertebrate host.
  • Figure 1 is a 1% agarose gel showing the PCR generated recombination cassette using the hupA-f and hupA-r primers;
  • Figures 2a and 2b are a 1% agarose gel showing the PCR amplification product of the cat gene present in ST662AhupA: cat and ST662AhupB: cat, with primers hupADTlf and hupADTlr and hupBDTf and hupBDTr, respectively;
  • Figure 3 is a 1% agarose gel demonstrating cat gene excision of the ST662AhupA: cat and ST662AhupB: cat strains for the construction of the double ST662AhupA ⁇ hupB mutant;
  • Figure 4 is a 1% agarose gel demonstrating PCR amplification products of the hupA and hupB gene regions, respectively;
  • Figure 5 is a schematic showing the deletion of the hupA and hupB genes and the position of the detection primers, represented as arrows.
  • Figure 1 is a 1% Agarose Gel with the PCR generated fragment corresponding to the hupA gene recombination cassette for the construction of the mutant strain. From left to right, samples refer to the Molecular Weight Marker 1 kb DNA ladder (Fermentas); negative control and the hupA gene recombination cassette, about 1200 bp, comprising the cat gene and flanking regions composed of FRT (FLP Recognition Targets) sites and regions adjacent to the target genes.
  • FRT FLP Recognition Targets
  • Figures 2a and 2b is a construction of the S. enteral mutants AhupA and AhupB. 1% agarose gel with PCR products using hupAD and hupBOT (detection primers) respectively to confirm mutagenesis.
  • the positive control corresponds to the wild line 662ST, with amplification of the intact gene and regions flanking machines, generating a fragment of 396 bp for hupA and 371 bp for hupB, while the mutants have a bandwidth of approximately 1.2 kb, equivalent to the cat gene and flanking regions.
  • MPM Molecular Weight Marker 1 kb DNA ladder (Fermentas); CN: Negative Control (without DNA); CP: Positive Control (wild line genomic DNA).
  • Figure 3 shows the elimination of the chloramphenicol resistance cassette in S. entérica mutants ⁇ and AhupB, demonstrating the "scars" of about 100 bp, corresponding also to the FRT sites.
  • the hupAO 1 primers were used for AhupA mutant strains and hupBOT primers for AhupB mutants.
  • MPM Molecular Weight Marker 1 kb DNA ladder (Fermentas); CN - Negative Control; CmR - cat.
  • Figure 4 is a 1% agarose gel demonstrating PCR products for hupA and hupB flanking regions, respectively. From left to right: Molecular Weight Marker 1 kb DNA ladder (Fermentas); Negative control; Positive control for hupA, consisting of genomic DNA from the wild line 662ST, with fragment referring to the intact hupA gene (important to note that in this case the hupADT2 primers were used, generating a 702 bp fragment for hupA); Lineage 662STA.hupA, with fragment amplified by hupAD 2 primers, referring to the cat gene and flanking regions; Mutant double line 662STAhupAAhupB, amplified by hupADT2 primers; Positive control, consisting of genomic DNA from the wild line 662ST, with fragment referring to the intact hupB gene; 662STAhupB strain, with fragment amplified by hupBOT primers, referring to the cat gene and flanking regions
  • FIG. 5 is a schematic diagram showing the construction steps of the AhupA and AhupB mutant strains and position of the hupAOT and hupBOT detection primers, represented as arrows. Initially the target gene is intact, shown in white. Subsequently, the target gene is replaced by the cat gene (chloramphenicol acetyl transferase), also shown in white. In the last stage, the chloramphenicol antibiotic resistance gene is eliminated, leaving only one "scar” composed of FRT (hatched region) sites.
  • cat gene chloramphenicol acetyl transferase
  • Pathogenic bacteria are bacteria capable of causing disease and / or death in their hosts.
  • pathogenic bacteria include, without limitation, gram negative bacteria, in particular members of the Enterobacteriaceae, Vibrionaceae, Francisellaceae,
  • Legionallales, Pseudomonadacea or Pasteurellaceae including the genera Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., And Vibrio spp.
  • pathogenic bacteria of the present invention are chosen from species having in their genome at least one HU encoding gene, preferably, but not exclusively, S. enterica serovar Typhimurium (662ST).
  • the HU coding gene of the present invention is a DNA sequence having at least 80% homology to at least one sequence chosen from hupA or hupB, which are chosen from species having at least one coding gene in their genome.
  • HU preferably, but not exclusively, S. enterica serovar Typhimurium (662ST).
  • Attenuated bacteria is understood to be a pathogenic bacterium having at least one mutated HU coding gene.
  • stressing is meant a process of deletion of a particular sequence of the genome of a bacterium. In particular, silencing was provided by a recombination cassette.
  • the recombination cassette according to the present invention is a cassette comprising at least one sequence capable of silencing at least one HU encoding gene in a pathogenic bacterium.
  • the recombination cassette consists of primers, which have 2 continuous parts, the first being a sequence of approximately 40 bases homologous to the target gene and the second approximately 20 bases homologous to a region present in the plasmids to be used.
  • the homology regions with the HU coding gene were selected from the sequence of the Genome S. enteral project database (NC_003197) (Washington University, St. Louis, USA) and chosen so that they were close to the initiation codons. and gene termination.
  • the recombination cassette further comprises accessory genes, such as antibiotic resistance genes.
  • the bacterial recombination process of the present invention is a process based on the recombination Red.
  • the bacteriophage ⁇ XRed recombination system includes 3 genes: ⁇ , ⁇ and exo (present in plasmid pKD46), which encode the proteins Gam, Bet and Exo respectively.
  • Accessory plasmids contain antibiotic resistance genes (Km R or Cm R ) flanked by FRP (FLP recombinase recognition targets) sites, forming the recombination module. Thus, these plasmids are used in the creation of the recombination cassette.
  • sequences of approximately 40 bp homologous to the target gene are generated at the ends of this module by PCR.
  • the recombination cassette is the module flanked by sequences homologous to the target gene.
  • plasmid p D46 is transformed by electroporation into the host lineage and transformants undergo electroporation with the recombination cassette.
  • the expression of the ⁇ , ⁇ and exo genes inhibits the degradation of the linear strand of DNA, allowing the recombination of the cassette.
  • This recombination follows DNA homology conferred by flanking sequences such that recombination will involve homologous sequences.
  • the recombinants are then selected using the resistance tags carried by the recombination module.
  • Such constructs allow subsequent removal of the resistance cassette by FLP recombinase expressed by a plasmid gene, in this case the plasmid pCP20.
  • FLP recombinase expressed by a plasmid gene, in this case the plasmid pCP20.
  • the transformation process of the present invention comprises the steps of:
  • the selected samples were stored in glycerol 2.5 M, according to the protocol described by Sambrook and Russell (2001) and incorporated herein by reference in its entirety.
  • the susceptibility of the selected strains was tested for the antibiotics ampicillin, kanamycin, chloramphenicol, streptomycin and tetracycline. For this, the microdilution method was used.
  • MIC Minimum Inhibitory Concentration
  • mutagenesis of the hupA and hupB genes was obtained by the ⁇ Red system as described by Datsenko and anner (2000) and incorporated herein in its entirety by reference. This system consists of the strains and plasmids shown in Table 1.
  • Table 1 Bacterial strains with their respective plasmids belonging to the ⁇ Red system.
  • BW25113 / pKD46 strain was seeded on LB agar medium containing ampicillin (100ug / ml); BW25141 / pKD3 and BT340 / pCP20 were seeded on LB agar medium containing ampicillin (100ug / mL) and chloramphenicol (25 ⁇ g / mL).
  • the incubation temperature used was 30 ° C, since such plasmids contain thermosensitive origin of replication. After extraction, they were subjected to 0.8% agarose gel electrophoresis according to the protocol of Sambrook and Russell (2001), incorporated herein by reference in its entirety.
  • the primers for this methodology are composed of 2 continuous parts, the first one being a sequence of approximately 40 bases homologous to the target gene and the second 20 bases homologous to a region present in plasmid pKD3.
  • the region used to amplify the sequence contained in the plasmid was selected using the Primer 3 program (http: // frodo. Wi .mit. Edu / cgi-bin / primer3 / primer3_www. Cgi), based on the plasmid sequence pKD3 (AY048742) (Datsenko and Wanner, 2001).
  • the hupA-f, hupA-r, hupB-f, and hupB-r primers, described in Table 2 were designed.
  • the primers described above were used for amplification of a region of plasmid pKD3. Reactions were performed in a final volume of 50 ⁇ l containing 20 pmol of each primer, 20 to 30 ng of plasmid DNA, 1 ⁇ M of each dNTP, 2U Taq DNA polymerase and 2 mM MgCl 2 in appropriate buffer provided with the enzyme.
  • plasmid DNA was denatured by heating at 94 ° C for 2 minutes, and amplification performed in 30 cycles consisting of the following steps: (1) denaturation at 94 ° C for 30 seconds; (2) "ringing" at 56 ° C for 30 seconds; (3) extension at 72 ° C for 1 minute and 30 seconds. A final extension was performed for 5 minutes.
  • the PCR product was analyzed by 1% agarose gel electrophoresis (Sambrook and Russell, 2001).
  • the hupA-f, hupA-r, hupB-f and hupB-r primers were used to amplify an approximately 1.2 Kbp region (Figure 1) of plasmid pKD3.
  • the amplified region was used to compose the recombination cassette with the hupA and hupB genes, respectively.
  • the PCR generated recombination cassette using the hupA-f and hupA-r primers is shown in Figure 1.
  • Double mutant AhupAAhupB sequenced with hupADT2f primer Double mutant AhupAAhupB sequenced with hupADT2f primer:
  • sequence is longer, because at the hupA gene site was inserted the cat gene and flanking plasmid regions ( ⁇ 1.2 kb).
  • sequence corresponding to the flanking region of the Salmonella hupA gene is highlighted, which is shortly thereafter interrupted by sequences present in plasmid pKD3, corresponding to PI and cat.
  • the strokes symbolize unidentified bases in sequencing.
  • Double mutant ⁇ hupAAhupB sequenced with hupADT2r primer (complementary and inverted sequence):
  • Plasmid alignment regions correspond to a region of the cat gene
  • Transformation of the selected strains with plasmid pKD46 was performed by electroporation following the protocol described in Ausubel et al. (2007), incorporated herein by reference in its entirety.
  • Electroporator Bio Rad. Gene Pulser Electroporator
  • the presence of the plasmid was evaluated by analysis of the plasmid profile by agarose gel electrophoresis.
  • the selected strains were stored in glycerol 2.5 M according to protocol proposed by Sambrook and Russell (2001).
  • Competent cells were prepared from a pre-inoculum with 5 ml ampicillin-containing LB medium (100 pg / ml), which was incubated overnight at 30 ° C. From this culture 0.5 ml were inoculated in 50 ml LB medium with the same antibiotic and 1mM L-arabinose (Sigma), used as inducer of ⁇ , ⁇ , and exo gene expression, and this new culture was grown at 30 °. C under agitation (150 rpm) until it reaches ⁇ . ⁇ of 0.7. The flasks were cooled in an ice bath for 15 minutes, the cultures were centrifuged for 10 minutes at 5000 g (4 ° C).
  • the precipitate was resuspended in 4 mL sterile deionized water previously cooled to 4 ° C and centrifuged again under the same conditions. This wash step was repeated three times using 10% glycerol and the pellet formed after the last wash was resuspended at 400 L and distributed in 90 ⁇ L aliquots by the protocol of Sambrook and Russell (2001) and incorporated herein by reference. in its entirety.
  • Three tubes were selected containing the aliquots to which 10 ⁇ L of the PCR product was added; These were placed on ice for 1 minute.
  • the electroporator has been set to 1.5 KV, 25 ⁇ iF and 200 ohms and The samples were electroporated and collected in SOC medium, where they were incubated at 37 ° C for 1 hour and then plated on LB-agar medium with chloramphenicol (25 g / mL). Cultures were incubated overnight at 37 ° C. From the grown colonies, some were selected for PCR confirmation, being named 662ST ⁇ hupACm R and 662STAhupBCm R. The selected colonies were stored in 2.5 M glycerol according to protocol proposed by Sambrook and Russell (2001), and incorporated herein by reference in their entirety. Then plasmid pKD46 was cured.
  • competent cells prepared from 662STAhupACm R and 662STAhupSCm R strains and plasmid pCP20 were used. Electroporation was performed as previously described and the transformants were selected on ampicillin LB-agar plates (100 ⁇ g / mL). The plates were incubated overnight at 30 ° C. Some of the grown colonies were selected for PCR confirmation and named 662STàhupA and 662STAhupB. These strains were stored in 2.5M glycerol as previously described by Sambrook and Russell (2001) and incorporated herein by reference in their entirety. Detection and characterization of hupA and hupB mutations by PCR
  • a pair of primers internal to this gene were designed based on the sequence of plasmid pKD3 (AY048742) (Datsenko and Wanner, 2001) and constituent of the recombination cassette. These were designed with the Primer 3 software (http: 111rodo. I .mit. Edu / cgi-bin / primer3 / primer3_www. Cgi). Primers are shown in Table 3.
  • Reactions were performed in 50 ⁇ l final volume containing 20 pmol of each primer, 20 to 30 ng of genomic DNA of each transformant, 1mM of each dNTP, 2U of Taq DNA polymerase and 2 mM of MgCl 2 in appropriate buffer provided with the enzyme.
  • genomic DNA was denatured by heating at 94 ° C for 2 minutes and amplification performed in 35 cycles consisting of the following steps: (1) denaturation at 94 ° C for 30 seconds; (2) "ringing" at 55 ° C for 30 seconds; (3) extension at 72 ° C for 1 minute. A final extension was performed for 5 minutes.
  • the PCR product was analyzed by 1% agarose gel electrophoresis using the protocol described by Sambrook and Russell (2001), incorporated herein by reference in its entirety.
  • the donor recombinant bacterium was grown in 3 ml LB without antibiotic overnight at 37 ° C. The next day, a 100 ⁇ 1 aliquot of phage was added to 900 ⁇ fresh LB, reaching a density of approximately 10 9 CFU / mL. This 1 ml aliquot was added to the cultured pre-inoculum with a bacterial density of approximately 10 9 CFU / mL.
  • the culture was then re-grown in the greenhouse at 37 ° C overnight. That same day, the 662ST wild strain was also grown in 3 ml of LB in the greenhouse at 37 ° C overnight. As a control, the bacteriophage was plated on LB Agar for bacterial contamination.
  • the culture with donor bacteria and phage was centrifuged at 5000 g for 10 minutes at 4 ° C to allow the bacteria to settle away from the phage.
  • the supernatant was carefully filtered and stored in a new container. As a control the supernatant was streaked on LB Agar to verify that there was no trace of bacteria.
  • phage and receptor wild bacteria were mixed, following the following proportions: 10 ⁇ phage + 100 ⁇ bacteria; 50 ⁇ phage + 100 ⁇ bacteria; 50 ⁇ of phage + 50 ⁇ of bacteria and 10 ⁇ of phage + 50 ⁇ of bacteria.
  • Containers containing phage and bacteria were incubated at 37 ° C for 20 minutes for adsorption. After this period, aliquots were plated on LB Agar with chloramphenicol for selection of transduced bacteria.
  • Recombinant strains were inoculated in 5 ml LB medium and incubated at 37 ° C overnight. The next day, 500 ⁇ ] _. from the pre-inoculum was added to 50 ml 1% LB glucose medium and the new culture incubated at 37 ° C under shaking (150 rpm), aliquots were taken every hour for five hours and serial dilutions were plated in triplicate over LB -agar for next day accounting.
  • 662ST, 662STAhupA, 662STAhupB and 662STbhupAàhupB strains were grown in LB medium at 37 ° C overnight. In day Next, 0.5 mL of these cultures were inoculated into 50 mL of 1% LB-glucose medium and incubated at 37 ° C with shaking (150rpm) until they reached the desired titer. Cells were pelleted by centrifugation (5000g for 5 min) and washed in the same volume of saline phosphate buffer (PBS, pH 7.4). This step was repeated a second time and the pellet resuspended in PBS (same initial volume).
  • PBS saline phosphate buffer
  • Serial dilutions were prepared in PBS and used to infect 6 to 8 week old female BALB / c mice. Dilutions were plated on LB-agar medium for CFU determination. The oral inoculum was performed using a model IC800 gavage needle (INSIGHT, Ribeir ⁇ o Preto-SP, Brazil).
  • the amount of inoculated bacteria varied according to each group, from 10 2 to 10 9 CFU / mL, using three mice per dilution. Animals were followed for 30 days after inoculum administration.
  • the ability to elicit immune response against S. enteric was tested at two times: In the first, the animals were immunized with a single dose of S. enteric and challenged 28 days after it.
  • CFU dose used was 10 8 for the double mutant strain, a dose established from previous trials. Animals were challenged with 10 7 CFU doses of ST662 strain.
  • mice were used.
  • BALB / c females 6 to 8 weeks old per group.
  • the animals were followed for 30 days after challenge and evaluated for their survival.
  • mice with single dose immunization all animals survived the challenge with the wild strain while the single immunization group showed an 85% rate after 30 days of experiment. Placebo animals inoculated with PBS died between days 5 and 10 after being challenged with wild lines. Some variations in the survival rate of mice with single dose immunization were observed between different experiments.
  • the present invention enables the use of a live vaccine vector for the development of vaccines against salmonellosis and other diseases having their own immunogenic properties, since the developed attenuated strains may be employed in the delivery of heterologous antigens to the immune system. of the host.
  • the present invention enables use as a live vaccine to induce protection against salmonellosis; potential use as a multifactorial vaccine vector, ie attenuated strains may express antigens from other diseases; beyond use in cancer therapy.
  • Enteric salmonella has been used as a biological agent in the treatment of some types of solid tumors. This is because this bacterium presents tropism for tumor masses. Treatment of different tumors with S. enteric has resulted in a decrease or even disappearance of the tumor mass. However, for this type of employment, lineage must be attenuated. Thus, the developed mutant strains of the present invention have the potential to be used in tumor therapy. However, specific studies are needed to verify this potential and to indicate other modifications in S. enterica strains that may be necessary.
  • the double mutant strain (662S AhupAAhupB) still has the added advantage of a lower probability of reversal of attenuation to pathogenicity levels of the wild strain, since two genes were knocked out. This advantage is not present in single mutated strains, as reacquisition of the lost gene could restore the total virulence of the strand.
  • the present invention has use as a live vaccine to induce protection against salmonellosis or as potential use as a multifactorial vaccine vector, i.e. attenuated may express antigens from other pathogens.
  • the present invention may be used in cancer therapy.
  • Salihonella enterica has been used as a biological agent in the treatment of some types of solid tumors. This is because this bacterium presents tropism for tumor masses. Treatment of different tumors with S. enteric has resulted in a decrease or even disappearance of the tumor mass. However, for this type of employment, lineage must be attenuated. Thus, the developed mutant strains of the present invention have the potential to be used in tumor therapy.
  • Salmonella from pathogenesis to therapeutics. J Bacteriol. 189: 1489-95.
  • Salmonella typhimurium deletion mutants lacking adenylate cyclase and cyclic AMP receptor protein are avirulent and immunogenic. Infect Immun. 55: 3035-43.
  • IHF integration host factor
  • phoP / phoQ-deleted Salmonella typhi (Ty800) is a safe and immunogenic single-dose typhoid fever vaccine in volunteers. J Infect Dis. 173: 1408-14.
  • Salmonella. typhimurium initiates murine infection by penetrating and destroying ephitelial specialists M cells of the Peyer's patches. J. Exp. Med. 180: 15-23.

Abstract

The present invention discloses a new alternative for preventing salmonellosis, using mutants capable of promoting host immunisation. In particular, these mutants are null for the HU hupA and/or hupB genes, and were tested for virulence attenuation and ability to trigger an effective immune response protecting against salmonellosis, in particular murine salmonellosis, with promising results. In addition, the present invention is aimed at a method for producing this attenuated strain capable of promoting immunisation, at vaccine vectors and vaccines for the treatment of salmonellosis, and at the use thereof for combatting this infection and possibly other diseases, in the case of multifactorial vectors.

Description

Relatório Descritivo de Patente de Invenção para: "PROCESSO DE CONSTRUÇÃO DE LINHAGEM ATENUADA MUTANTE DE UMA BACTÉRIA PATOGÊNICA, VACINA, VETOR VACINAL E USO DA REFERIDA VACINA" . Patent Descriptive Report for: "Process for the attenuated lineage building process of a pathogenic bacterium, vaccine, vaccine vector and use of said vaccine".
Campo da Invenção Field of the Invention
A presente invenção se refere a um processo de produção de linhagens mutantes atenuadas, capazes de promover imunização, a vetores vacinais e vacinas para o tratamento de salmonelose e a seu uso no combate a tal infecção. Especificamente, tais mutantes são nulos para os genes hupA e hupB de HU e foram testados quanto a atenuação da virulência e capacidade de desencadear resposta imune efetiva e protetora contra a salmonelose.  The present invention relates to a process of producing attenuated mutant strains capable of promoting immunization to vaccine vectors and vaccines for the treatment of salmonellosis and their use in combating such infection. Specifically, such mutants are null for HU hupA and hupB genes and have been tested for attenuation of virulence and ability to elicit effective and protective immune response against salmonellosis.
Fundamentos e Antecedentes da Invenção Background and Background of the Invention
Sal onella Salt onella
O género Salmonella sp pertence à família Enterobacteriaceae e é formado por bacilos gram-negativos, anaeróbios facultativos e geralmente flagelados (Mastroeni e Maskell, 2006) . A classificação sorológica dessa bactéria fundamenta-se na identificação de antígenos somáticos (O) , flagelares (H) e capsulares (Vi) , este último quando presente .  The genus Salmonella sp belongs to the Enterobacteriaceae family and is made up of gram-negative, facultative anaerobic bacilli usually flagellated (Mastroeni and Maskell, 2006). The serological classification of this bacterium is based on the identification of somatic (O), flagellar (H) and capsular (Vi) antigens, the latter when present.
Estudos de hibridação de DNA sugerem a existência de duas espécies de Salmonella: S. entérica e S. bongori. A espécie S. entérica é subdividida em 7 subgrupos, sendo que a grande maioria das sorovariedades patogênicas para o homem está incluída no subgrupo I (Boyd et al. 1996). DNA hybridization studies suggest the existence of two Salmonella species: S. enterica and S. bongori. THE S. enteric species is subdivided into 7 subgroups, and the great majority of pathogenic serovegions for humans are included in subgroup I (Boyd et al. 1996).
As sorovariedades de S. entérica patogênicas podem causar, em mamíferos, infecções com diferentes graus de gravidade, desde gastroenterites localizadas na mucosa intestinal até infecções sistémicas graves, dependendo da sorovariedade bacteriana e do tipo de hospedeiro envolvido (Bãumler et al., 1998).  Pathogenic S. enteric serovarities can cause infections in mammals with varying degrees of severity, from gastroenteritis located in the intestinal mucosa to severe systemic infections, depending on the bacterial serovarity and type of host involved (Bãumler et al., 1998).
S. entérica Typhi é o agente causador da febre tifóide, uma infecção sistémica grave no homem (Guzman et al.,2006). S. entérica Choleraesuis causa infecções sistémicas graves, principalmente em suínos, embora também possa causar infecções em humanos (Mastroeni e Maskell, 2006; Salyers e Whitt, 2002) . Salmonella entérica Dublin é uma sorovariedade associada principalmente a bovinos. Como S. entérica Thyphi em humanos, a sorovariedade Dublin é invasiva e pode causar gastroenterites e septicemia nesses animais (Mastroeni e Maskell, 2006) . S. entérica Typhimurium e Enteritidis são causas comuns de gastroenterites em humanos, mas também podem estar associadas a infecções extra-intestinais (Mastroeni e Maskell, 2006) . Em camundongos, S. entérica Typhimurium e Enteritidis causam um tipo de infecção muito semelhante à febre tifóide humana. Desta forma, camundongos BALB/c são utilizados como o modelo murino de infecção sistémica por S. entérica . S. enterica Typhi is the causative agent of typhoid fever, a serious systemic infection in man (Guzman et al., 2006). S. enterica Choleraesuis causes severe systemic infections, especially in pigs, although it can also cause infections in humans (Mastroeni and Maskell, 2006; Salyers and Whitt, 2002). Enteric Salmonella Dublin is a serovarity associated mainly with cattle. Like S. enterica Thyphi in humans, serovar Dublin is invasive and can cause gastroenteritis and septicemia in these animals (Mastroeni and Maskell, 2006). S. enterica Typhimurium and Enteritidis are common causes of gastroenteritis in humans, but may also be associated with extra-intestinal infections (Mastroeni and Maskell, 2006). In mice, S. enterica Typhimurium and Enteritidis cause a type of infection very similar to human typhoid fever. Thus, BALB / c mice are used as the murine model of systemic S. enteric infection.
Salmonelose e doença Salmonellosis and disease
A salmonelose é uma das doenças infecciosas mais frequentes tanto em humanos quanto em outros animais. A infecção por S. entérica inicia-se com a ingestão de água ou alimentos contaminados, particularmente alimentos derivados de aves e suínos. Estes microrganismos são patógenos intracelulares facultativos e, uma vez ingeridos, apresentam a capacidade de aderir e invadir células da mucosa intestinal, preferencialmente células M (Jones et al., 1994) . Uma vez ultrapassada a mucosa intestinal, S. entérica invade, persiste e prolifera no interior de vacúolos de células do sistema retículo endotelial podendo assim, alcançar diferentes órgãos e tecidos do hospedeiro, causando infecção sistémica (Salyer e Whitt, 2002) . Estas infecções representam, ainda hoje, um grave problema de saúde pública, devido sua alta incidência e gravidade, principalmente em áreas subdesenvolvidas do mundo, onde as condições de higiene e saneamento básico são ainda precárias (Woc-Colburn e Bobak, 2009; Boyle et al . , 2007; Coburn et al. 2007; Figueroa-Ochoa e Verdugo-Rodrigues, 2005; Graham, 2002) . No Brasil a salmonelose é um problema sério de saúde pública especialmente em regiões mais pobres (Fernandes et al. 2006, Ghilardi et al., 2006). Salmonellosis is one of the most common infectious diseases in both humans and animals. S. enteric infection begins with ingestion of contaminated water or foods, particularly poultry and pork foods. These microorganisms are facultative intracellular pathogens and, once ingested, have the ability to adhere to and invade intestinal mucosal cells, preferably M cells (Jones et al., 1994). Once the intestinal mucosa is exceeded, S. enterica invades, persists and proliferates within endothelial reticulum cell vacuoles and can thus reach different organs and tissues of the host, causing systemic infection (Salyer and Whitt, 2002). These infections still represent a serious public health problem due to their high incidence and severity, especially in underdeveloped areas of the world, where hygiene and basic sanitation conditions are still precarious (Woc-Colburn and Bobak, 2009; Boyle et al. al., 2007; Coburn et al. 2007; Figueroa-Ochoa and Verdugo-Rodrigues, 2005; Graham, 2002). In Brazil salmonellosis is a serious public health problem especially in poorer regions (Fernandes et al. 2006, Ghilardi et al., 2006).
A dose infectante média (DI50) de S. entérica capaz de produzir infecções clinicas ou subclinicas em humanos está entre 105-1010 organismos ingeridos. O processo infeccioso é localizado no íleo, cólon e linfonodos mesentéricos após a ingestão de alimento contaminado, com o aparecimento de sintomas tais como diarréia, vómito e dores abdominais (revisado por Darwin e Miller, 1999) . A maioria dos casos de gastroenterites ocorre em crianças com menos de 10 anos de idade, e os sintomas tendem a ser mais severos neste grupo, podendo a infecção tornar-se sistémica. The average infective dose (DI5 0) of S. enterica capable of producing clinical or subclinical infections in humans is between 10 5 -10 10 ingested organisms. The infectious process is localized to the ileum, colon, and mesenteric lymph nodes after ingestion of contaminated food, with symptoms such as diarrhea, vomiting, and abdominal pain appearing (reviewed by Darwin and Miller, 1999). Most cases of gastroenteritis occur in children under 10 years of age, and the symptoms tend to be more severe in this group and the infection may become systemic.
Uma importante barreira encontrada por S. entérica no processo infeccioso, após sua passagem pelo epitélio intestinal, são os macrófagos da submucosa (Mastroeni e Maskell, 2006; Salyers e Whitt, 2002) . Os macrófagos detectam e internalizam o patógeno bacteriano a fim de eliminá-lo do hospedeiro.  An important barrier encountered by S. enterica in the infectious process following its passage through the intestinal epithelium is the submucosa macrophages (Mastroeni and Maskell, 2006; Salyers and Whitt, 2002). Macrophages detect and internalize the bacterial pathogen in order to eliminate it from the host.
As sorovariedades de S. entérica , capazes de causar infecção sistémica, invadem os macrófagos e então ativam mecanismos de virulência que permitem a evasão das funções microbicidas do fagócito, permitindo a sobrevivência e replicação no ambiente intracelular (Mastroeni e Maskell, 2006; Salyers e hitt, 2002; Alpuche-Aranda, et al., 1994) . A migração de macrófagos infectados para outros órgãos do sistema monocitico fagocitário facilita a disseminação da bactéria no hospedeiro. S. enteric serovarieties, capable of causing systemic infection, invade macrophages and then activate virulence mechanisms that allow evasion of phagocyte microbicidal functions, allowing survival and replication in the intracellular environment (Mastroeni and Maskell, 2006; Salyers and Hitt, 2002; Alpuche-Aranda, et al., 1994). Migration of infected macrophages to other organs of the phagocytic monocytic system facilitates the spread of the bacteria into the host.
Salmonella e Vacinas Salmonella and Vaccines
A busca por uma vacina efetiva contra a febre tifóide compõe um importante capitulo na história da Microbiologia. Várias estratégias e formulações vacinais foram testadas tais como bacterianas, vacinas de subunidades e linhagens vivas atenuadas (revisado por Bueno et al . , 2009; Galen et al . , 2009; Guzman et al., 2006) . O antigeno capsular Vi purificado, livre ou conjugado com proteínas carreadoras é imunogênico quando administrado por via intramuscular ou subcutânea e tem se mostrado eficaz em alguns estudos The search for an effective typhoid vaccine is an important chapter in the history of microbiology. Various vaccine strategies and formulations have been tested such as bacterial, subunit vaccines, and live attenuated strains (reviewed by Bueno et al., 2009; Galen et al., 2009; Guzman et al., 2006). Purified free or conjugated carrier protein Vi capsular antigen is immunogenic when administered intramuscularly or subcutaneously and has been shown to be effective in some studies.
(Guzman et al., 2006; Strugnell e Wijburg, 2006) . Contudo, devido a suas características e modo de administração, é incapaz de induzir o sistema imune ao nível de mucosa(Guzman et al., 2006; Strugnell and Wijburg, 2006). However, due to its characteristics and mode of administration, it is unable to induce the mucosal immune system
(MALT, do inglês mucosal associated lymphoíd tissue) . Desta maneira, esforços foram canalizados no desenvolvimento de vacinas constituídas por linhagens vivas atenuadas, ideais para induzir resposta imune ao nível do MALT. (MALT, mucosal associated lymphoid tissue). Thus, efforts were directed to the development of live attenuated vaccines, ideal for inducing MALT immune response.
A primeira vacina viva atenuada desenvolvida contra a febre tifóide é composta pela linhagem S. entérica Typhi Ty21a. Esta linhagem foi obtida por mutagênese química da linhagem parental Ty2 (Germanier e Furer, 1983) . Esta vacina oral é segura, mas devido a sua grande atenuação, requer várias doses para induzir imunidade, que frequentemente é de curta duração (Guzman et al., 2006; Strugnell e Wijburg, 2006) . The first live attenuated vaccine developed against typhoid fever is the S. enteral Typhi Ty21a strain. This strain was obtained by chemical mutagenesis of the Ty2 parental lineage (Germanier and Furer, 1983). This oral vaccine is safe, but because of its great attenuation, it requires several doses to induce immunity, which is often short-lived (Guzman et al., 2006; Strugnell and Wijburg, 2006).
Os resultados alcançados com a linhagem Ty21a levaram vários grupos a construírem novas linhagens vacinais de S. entérica, contendo deleções em genes alvo específicos que atenuaram a virulência. Adicionalmente, essas linhagens apresentam uma característica fundamental para vacinas vivas, a estabilidade da atenuação, uma vez que a mesma foi alcançada por deleção de um ou mais genes (revisado por Guzman et al., 2006). Esses mutantes foram construídos inicialmente em S. entérica Typhimurium, devido à disponibilidade do modelo murino de infecção, sendo as mutações promissoras transferidas para linhagens de S. entérica Typhi, muitas vezes a própria Ty2 (revisado por Guzman et al., 2006). Sendo assim, linhagens ÁaroA, AaroC, AaroD de S. entérica, deficientes na via biossintética dos aminoácidos aromáticos (Tacket et al., 1997), mutantes Acya Ácrp, incapazes de expressar adenilato ciclase e o receptor para cAMP (Curtiss e Kelly, 1987; Tacket et al., 1997), mutantes phoP-phoQ (Hohmann et al., 1996) entre outros, foram construídos e demonstraram-se imunogênicos, apesar da atenuação da virulência. No entanto, com frequência, testes em voluntários humanos indicaram a ocorrência de bacteremia e/ou a necessidade de várias doses para a indução de imunidade (Guzman et al., 2006; Strugnell e Wijburg, 2006). De fato, diversos estudos têm demonstrado o desafio de se ajustar o grau de atenuação da linhagem vacinai para, de um lado, não comprometer a resposta imune e de outro, ser livre de efeitos colaterais. Results achieved with the Ty21a strain led several groups to construct new S. enteral vaccine strains, containing deletions in specific target genes that attenuated virulence. Additionally, these strains present a fundamental characteristic for live vaccines, the attenuation stability, since it was achieved by deletion of one or more genes (reviewed by Guzman et al., 2006). These mutants were initially constructed in S. enterica Typhimurium due to the availability of the murine model of infection, and promising mutations were transferred to S. enteric Typhi strains, often Ty2 itself (reviewed by Guzman et al., 2006). Thus, S. enteral AaroA, AaroC, AaroD strains, deficient in the aromatic amino acid biosynthetic pathway (Tacket et al., 1997), Acya Accrp mutants, unable to express adenylate cyclase and the cAMP receptor (Curtiss and Kelly, 1987 ; Tacket et al., 1997), phoP-phoQ mutants (Hohmann et al., 1996) among others, were constructed and demonstrated to be immunogenic despite attenuation of virulence. Frequently, however, tests on human volunteers have indicated the occurrence of bacteremia and / or the need for multiple doses to induce immunity (Guzman et al., 2006; Strugnell and Wijburg, 2006). Indeed, several studies have shown the challenge of adjusting the degree of attenuation of the vaccine strain so as not to compromise the immune response and free of side effects.
A capacidade de invadir, sobreviver e proliferar no interior de macrófagos, polimorfonucleares e células dendríticas, aliada à disponibilidade de mutantes atenuados fazem de S. entérica um excelente carreador de antígenos a células do sistema imune. Assim, linhagens atenuadas de S. entérica podem ser manipuladas geneticamente de tal forma a expressar antígenos heterólogos, construindo-se linhagens vacinais multifatoriais . Diferentes antígenos derivados de outras bactérias, vírus, fungos, parasitas e mesmo de células■ de mamífero foram expressos em linhagens vacinais de S. entérica . Estas linhagens foram capazes de induzir resposta imune protetora não somente contra a salmonelose, mas também contra o organismo doador do antígeno heterólogo (Cheminay e Hensel, 2007; Kwon et al., 2007; Loessner et al., 2007; Mahoney et al., 2007; Atkins et al., 2006). Uma característica fundamental de tais linhagens é, além de ser muito improvável a reversão da atenuação, a capacidade de expressar o antígeno heterólogo de forma estável e em quantidades suficientes para induzir o sistema imune. The ability to invade, survive and proliferate within macrophages, polymorphonuclear cells and dendritic cells, coupled with the availability of attenuated mutants make S. enterica an excellent carrier of antigens to cells of the immune system. Thus, attenuated S. enteric strains can be genetically engineered to express heterologous antigens by constructing multifactorial vaccine strains. Different antigens derived from other bacteria, viruses, fungi, parasites and even ■ Mammalian Cells were expressed in vaccine strains of S. enterica. These strains were able to induce protective immune response not only against salmonellosis but also against the heterologous antigen donor organism (Cheminay and Hensel, 2007; Kwon et al., 2007; Loessner et al., 2007; Mahoney et al., 2007; Atkins et al., 2006). An A fundamental feature of such strains is, besides being unlikely to reverse attenuation, the ability to express the heterologous antigen stably and in sufficient quantities to induce the immune system.
No início, a clonagem e expressão de antígenos em S. entérica eram alcançadas através da utilização de plasmídeos carregando genes de resistência a antibióticos Initially, S. enteral cloning and expression of antigens were achieved through the use of plasmids carrying antibiotic resistance genes.
(Cárdenas e Clements, 1992) . Alguns estudos demonstraram, no entanto, que na ausência de pressões seletivas, tais plasmídeos eram instáveis e, portanto, perdidos após poucos ciclos de replicação in vivo (Cárdenas e Clements, 1992; Dunstan et al . , 2003) ou até mesmo durante o cultivo in vitro (Everest et al., 1995). (Cárdenas and Clements, 1992). However, some studies have shown that in the absence of selective pressures, such plasmids were unstable and therefore lost after a few in vivo replication cycles (Cárdenas and Clements, 1992; Dunstan et al., 2003) or even during cultivation. in vitro (Everest et al., 1995).
Para resolver tais problemas, estratégias como a utilização de promotores induzidos in vivo no controle de expressão do antígeno (Cheminay e Hensel, 2007; Marshall et al., 2000), construção de sistemas letais balanceados To solve such problems, strategies such as using in vivo induced promoters to control antigen expression (Cheminay and Hensel, 2007; Marshall et al., 2000), building balanced lethal systems.
(Curtiss et al., 1990; Everest et al., 1995) ou a integração do gene heterólogo no cromossomo de S. entérica(Curtiss et al., 1990; Everest et al., 1995) or the integration of the heterologous gene into the S. enteral chromosome.
(Hone et al., 1988; Strugnell et al., 1990; Everest et al., 1995) foram descritos. (Hone et al., 1988; Strugnell et al., 1990; Everest et al., 1995) have been described.
O nucleóide bacteriano e os genes-alvo: hupA e hupB  Bacterial nucleoid and target genes: hupA and hupB
Bactérias contêm proteínas que compõem o nucleóide bacteriano ("nucleoid-associates proteins", Nap) juntamente com o DNA cromossômico . Diferente das histonas de eucariotos, as proteínas bacterianas parecem não formar com o DNA complexos análogos aos nucleossomas (Thanbichler et al . , 2005). Dentro deste grupo encontram-se 12 proteínas sendo que as mais estudadas são HU, FIS, IHF, HNS e DPS (Dorman, 2009; Dorman e Kane, 2009; Cróinín e Dorman et al, 2007; Dorman et al., 2006; Drlica e Rouviere-Yaniv, 1987). Bacteria contain proteins that make up the bacterial nucleoid ("nucleoid-associates proteins", Nap) together with chromosomal DNA. Unlike eukaryotic histones, bacterial proteins do not appear to form nucleosome-like complexes with DNA (Thanbichler et al., 2005). Within this group are 12 proteins and the most studied are HU, FIS, IHF, HNS and DPS (Dorman, 2009; Dorman and Kane, 2009; Cróinín and Dorman et al, 2007; Dorman et al., 2006; Drlica and Rouviere-Yaniv, 1987).
HU é uma proteína heterodímérica codificada por dois genes, sendo eles hupA e hupB. Esta proteína parece não reconhecer nenhuma sequência específica para a ligação ao DNA, mas apresenta grande afinidade a regiões supercoiled ou que apresentem distorções na estrutura do DNA (Pinson et al., 1999). Swinger et al. (2004) demonstraram que essa proteína é capaz de induzir e estabilizar curvaturas de diferentes ângulos no DNA. Alguns estudos sugerem que HU participe do reparo do DNA por recombinação (Swinger et al., 2004) .  HU is a heterodimeric protein encoded by two genes, namely hupA and hupB. This protein does not appear to recognize any specific DNA binding sequence, but has great affinity for supercoiled or distorted DNA structure regions (Pinson et al., 1999). Swinger et al. (2004) demonstrated that this protein is capable of inducing and stabilizing bends from different angles in DNA. Some studies suggest that HU participates in DNA repair by recombination (Swinger et al., 2004).
Há poucos dados na literatura sobre a proteína HU e Salmonella especificamente (Mangan et al., 2011), embora haja mais relatos entre essa proteína e Escherichia coli. Ainda assim, os estudos descritos focaram-se no funcionamento da proteína demonstrando a regulação de fatores de patogenicidade, mas não investigaram a possível atenuação promovida pela deleção dos genes hupA ou hupB e a indução de proteção no modelo murino. There are few data in the literature on the protein HU and Salmonella specifically (Mangan et al., 2011), although there are more reports between this protein and Escherichia coli. Nevertheless, the studies described focused on protein functioning demonstrating the regulation of pathogenicity factors, but did not investigate the possible attenuation promoted by the deletion of hupA or hupB genes and protection induction in the murine model.
O gene hupA de Salmonella foi comparado ao gene hupA de E.coli por clonagem e sequenciamento, o que revelou que as subunidades HUa dessas bactérias são idênticas e que as sequências fora das ORFs são altamente conservadas (Higgins & Hillyard, 1988) .  The Salmonella hupA gene was compared to the E.coli hupA gene by cloning and sequencing, which revealed that the HUa subunits of these bacteria are identical and that sequences outside the ORFs are highly conserved (Higgins & Hillyard, 1988).
Esses estudos revelam que a proteína HU afeta processos celulares como compactação do DNA, replicação, recombinação, regulação gênica, além de participar no crescimento termo sensível, adaptação na fase estacionária de crescimento, lisogenia e transposição do bacteriófago Mu e é capaz de se ligar inespecificamente ao DNA (Bi et al . , 2009) . Em S. entérica HU coordena a expressão de genes envolvidos no metabolismo central e virulência (Mangan et al., 2011) .  These studies reveal that HU protein affects cellular processes such as DNA compaction, replication, recombination, gene regulation, as well as participating in thermosensitive growth, stationary growth phase adaptation, lysogenesis and transposition of Mu bacteriophage and is capable of non-specific binding. to DNA (Bi et al., 2009). In S. enterica HU coordinates the expression of genes involved in central metabolism and virulence (Mangan et al., 2011).
O gene hupB já foi descrito como sendo um modulador negativo na expressão de hilA, que é um gene crucial na expressão do fenótipo invasivo de Salmonella (Fahlen et al., 2000) . No entanto, há controvérsias sobre a ação de hupB, pois estudos posteriores realizados por outro grupo de pesquisa apontaram que esse gene tem uma ação positiva na regulação de hilA (Schechter et al., 2003).  The hupB gene has been described as a negative modulator in hilA expression, which is a crucial gene in the expression of invasive Salmonella phenotype (Fahlen et al., 2000). However, there is controversy about the action of hupB, since further studies by another research group have shown that this gene has a positive action on hilA regulation (Schechter et al., 2003).
Berger et al. (2009) construíram um duplo mutante áhupAAhupB de E.coli para verificar as alterações na estrutura genômica promovida pela ausência da proteína HU. Por esse estudo, foi possível observar que a ausência de HU provoca um rearranjo espacial no padrão de transcrição, causando uma perturbação da homeostase topológica que é compensada por uma maior acessibilidade de sítios de DNA pela topoisomerase . Berger et al. (2009) built a double mutant E. coli áhupAAhupB to verify changes in the genomic structure promoted by the absence of the HU protein. From this study, it was observed that the absence of HU causes a spatial rearrangement in the transcription pattern, causing a disturbance of topological homeostasis that is compensated by a greater accessibility of DNA sites by topoisomerase.
O sistema de recombinação λ Red The Red Recombination System
Em bactérias entéricas, a obtenção de recombinantes utilizando moléculas lineares de DNA é um evento altamente raro, devido à instabilidade da molécula de DNA linear, que uma vez no interior da célula é rapidamente degradada pela atividade de nucleases do sistema de recombinação RecBCD. Para contornar esta dificuldade, um sistema baseado no uso da maquinaria de recombinação do bacteriófago λ (o sistema Red) foi proposto.  In enteric bacteria, obtaining recombinants using linear DNA molecules is a highly rare event due to the instability of the linear DNA molecule, which once inside the cell is rapidly degraded by nuclease activity of the RecBCD recombination system. To overcome this difficulty, a system based on the use of bacteriophage recombination machinery (the Red system) has been proposed.
Datsenko e Wanner (2000) descreveram a construção e o emprego, de um sistema baseado no bacteriófago λ para a construção de linhagens mutantes de bactérias entéricas. Este sistema é composto por plasmídeos acessórios, sendo o plasmídeo pkD3 utilizado na construção de cassetes de recombinação por PCR (Datsenko e Wanner. 2000) .  Datsenko and Wanner (2000) described the construction and use of a bacteriophage λ-based system for the construction of mutant strains of enteric bacteria. This system is composed of accessory plasmids, the plasmid pkD3 being used in the construction of PCR recombination cassettes (Datsenko and Wanner. 2000).
Durante a busca de anterioridade, o documento US 2004/101531 reivindica a deleção dos genes cya e crp de Salmonella . Embora a estratégia da presente invenção tenha sido similar, a deleção ocorreu em outros genes, hupA e hupB, o que conferiu atenuação da bactéria e consequente aplicação da mesma como vetor vacinai. Portanto, nota-se que uma estratégia de imunização baseada no silenciamento gênico de HU não foi descrita nem sequer sugerida pelo referido documento. During the prior search, US document 2004/101531 claims the deletion of the Salmonella cya and crp genes. Although the strategy of the present invention was similar, deletion occurred in other genes, hupA and hupB, which conferred attenuation of the bacteria and consequent application of it as a vaccine vector. Therefore, it should be noted that an immunization strategy based on gene silencing of HU was not described or even suggested by this document.
O pedido de patente brasileiro PI 0006291-0, depositado em 27 de dezembro de 2000 em nome de Intervet International B.V. e intitulado: "Bactéria do Género Salmonella , Vacina para a Proteção de Animais contra a Salmonelose, Uso de uma Bactériar e, Processo para a Preparação de uma Vacina", se refere a bactérias de Salmonella para uso como uma vacina. A invenção também diz respeito a vacinas com base nas ditas bactérias, que são úteis para a prevenção da patogênese microbiana. Além disso, o referido documento diz respeito ao uso de tais bactérias ou à fabricação de tais vacinas. Brazilian patent application PI 0006291-0, filed December 27, 2000, on behalf of Intervet International BV, entitled: "Salmonella Genus Bacterium, Vaccine for the Protection of Animals against Salmonellosis, Use of an e r Bacteria, Process for the Preparation of a Vaccine "refers to Salmonella bacteria for use as a vaccine. The invention also relates to vaccines based on said bacteria which are useful for the prevention of microbial pathogenesis. Furthermore, said document relates to the use of such bacteria or the manufacture of such vaccines.
Como pode ser observado, o referido documento PI 0006291-0 diz respeito somente à atenuação promovida pela deleção de outro gene, isto é, o gene recA.  As can be seen, said PI 0006291-0 relates only to attenuation promoted by deletion of another gene, that is, the recA gene.
A patente americana US 7,045,122, depositada em 15 de novembro de 2001, em nome de AKZO NOBEL N.V e intitulada: "Salmonella Vaccine" refere-se a cepas vivas atenuadas de Salmonella compreendendo uma primeira mutação atenuante, que não são capazes de produzir RecA funcional. A invenção também relata que estas bactérias são para uso em vacinas. US Patent 7,045,122, filed November 15, 2001, in the name of AKZO NOBEL NV, entitled: "Salmonella Vaccine" refers to live attenuated Salmonella strains comprising a first attenuating mutation, which are not capable of producing functional RecA. The invention also reports that these bacteria are for use in vaccines.
Como pode ser observado, o referido documento US As can be seen, said US document
7,045,122 também diz respeito somente a atenuação promovida pela deleção de um gene, isto é, o gene recA. 7,045,122 also concerns only the attenuation promoted by deletion of a gene, that is, the recA gene.
O pedido de patente internacional WO/2010/096888 , depositado em 25 de fevereiro de 2010, em nome de Universidade Estadual de Campinas - UNICAMP e intitulado: "Vacinas Compreendendo Linhagens Atenuadas, Processo de Construção de Linhagens Atenuadas, Vetores Vacinais e seu Uso no Tratamento da Salmonelose" revela uma nova alternativa para a prevenção de salmonelose, a partir de mutantes capazes de promover imunização do hospedeiro. Em especial tais mutantes são nulos para os genes himA e himD de IHF e foram testados quanto a atenuação da virulência e capacidade de desencadear resposta imune efetiva e protetora contra a salmonelose, em especial a salmonelose murina.  International patent application WO / 2010/096888, filed on February 25, 2010, on behalf of the State University of Campinas - UNICAMP entitled: "Vaccines Comprising Attenuated Bloodlines, Process of Building Attenuated Bloodlines, Vaccine Vectors and Their Use in the Salmonellosis Treatment "reveals a new alternative for the prevention of salmonellosis from mutants capable of promoting host immunization. In particular such mutants are null for the IHF himA and himD genes and have been tested for attenuation of virulence and ability to elicit effective and protective immune response against salmonellosis, in particular murine salmonellosis.
Como pode ser observado, no referido documento WO/2010/096888 a atenuação é promovida pela deleção dos genes ihfA ou ihfB.  As can be seen, in said WO / 2010/096888 attenuation is promoted by deletion of the ihfA or ihfB genes.
O documento de patente americano US 2004/101531 descreve vacinas e composições imunogênicas que utilizam bactérias patogênicas vivas atenuadas, tal como Salmonella, para distribuir antigenos ectópicos para o sistema imune da mucosa dos animais vertebrados. As bactérias patogênicas atenuadas são preparadas para secretar o antigeno para o espaço periplasmico das bactérias ou para dentro das bactérias . US Patent Document 2004/101531 describes vaccines and immunogenic compositions that use live attenuated pathogenic bacteria, such as Salmonella, to deliver ectopic antigens to the mucosal immune system of vertebrate animals. Attenuated pathogenic bacteria are prepared to secrete the antigen into the bacteria's periplasmic space or into the bacteria.
Como pode ser observado, no referido documento US 2004/101531 é descrito a deleção dos genes cya e crp de Salmonella .  As can be seen, in said US 2004/101531 deletion of the Salmonella cya and crp genes is described.
O emprego de linhagens bacterianas vivas atenuadas como vacina está historicamente associado à indução de resposta imunológica efetiva e persistente. O vetor vacinai é constituído por uma bactéria que expressa antigenos (proteínas) de outras espécies de microorganismos obtidos através do método de DNA recombinante . Quando apresentados ao sistema imune do hospedeiro (organismo alvo) estes microorganismos estimulam a produção de anticorpos contra a doença de interesse, sem que ela cause sintomas ou danos graves ao hospedeiro.  The use of live attenuated bacterial strains as a vaccine has historically been associated with the induction of effective and persistent immune response. The vaccine vector consists of a bacterium that expresses antigens (proteins) from other species of microorganisms obtained by the recombinant DNA method. When presented to the host (target organism) immune system, these microorganisms stimulate the production of antibodies against the disease of interest without causing serious symptoms or damage to the host.
Embora estudos venham demonstrando estratégias de imunização baseada no silenciamento gênico, em nenhum dos casos foi revelado e nem sequer sugerido um processo que permita uma estratégia de imunização baseada no silenciamento gênico de HU. Although studies have shown gene silencing-based immunization strategies, in neither case has a process been revealed or even suggested to allow for a gene-based immunization strategy. gene silencing of HU.
É sabido que mutações atenuadoras diferentes conferem propriedades biológicas, como imunogenicidade, diferentes. Sumário da Invenção  Different attenuating mutations are known to confer different biological properties, such as immunogenicity. Summary of the Invention
Para solucionar os problemas acima mencionados, a presente invenção propiciará vantagens significativas em relação aos processos de imunização baseada no silenciamento gênico de HU, possibilitando um aumento do seu desempenho e apresentando uma relação custo/beneficio mais favorável.  To solve the aforementioned problems, the present invention will provide significant advantages over the immunization processes based on gene silencing of HU, enabling an increase of its performance and presenting a more favorable cost / benefit ratio.
A presente invenção se refere em um primeiro aspecto, a construção de mutantes nulos de S. entérica para os genes (hupA e/ou hupB) codificadores de HU (Heat Unstable Protein) com o intuito de desenvolver linhagens atenuadas quanto a virulência, mas capazes de causar infecção transitória e induzir o sistema imune de forma efetiva, constituindo-se em potenciais linhagens vacinais.  The present invention relates in a first aspect to the construction of S. enteral null mutants for the HU (Heat Unstable Protein) encoding genes (hupA and / or hupB) in order to develop attenuated but virulence lines. cause transient infection and effectively induce the immune system, constituting potential vaccine strains.
É um objeto da presente invenção uma bactéria atenuada compreendendo pelo menos um gene codificador de HU silenciado em uma bactéria patogênica.  An object of the present invention is an attenuated bacterium comprising at least one mutated HU coding gene in a pathogenic bacterium.
A presente invenção refere-se também a uma vacina baseada em bactérias atenuadas compreendendo pelo menos um gene codificador de HU silenciado em uma bactéria patogênica, capaz de induzir e estimular uma resposta imune no hospedeiro vertebrado. The present invention also relates to an attenuated bacterial-based vaccine comprising at least one mutant HU encoding gene in a pathogenic bacterium capable of inducing and stimulating an immune response. in the vertebrate host.
Breve Descrição dos Desenhos Brief Description of the Drawings
A estrutura e operação da presente invenção, juntamente com vantagens adicionais da mesma podem ser mais bem entendidas mediante referência aos desenhos em anexo e a seguinte descrição:  The structure and operation of the present invention, together with further advantages thereof may be better understood by reference to the accompanying drawings and the following description:
A Figura 1 é um gel de agarose 1% mostrando o cassete de recombinação gerado por PCR utilizando os primers hupA-f e hupA-r;  Figure 1 is a 1% agarose gel showing the PCR generated recombination cassette using the hupA-f and hupA-r primers;
A Figura 2a e 2b é um gel de agarose 1% mostrando o produto de amplificação por PCR do gene cat presente em ST662AhupA: cat e ST662AhupB: cat, com os iniciadores hupADTlf e hupADTlr e hupBDTf e hupBDTr, respectivamente;  Figures 2a and 2b are a 1% agarose gel showing the PCR amplification product of the cat gene present in ST662AhupA: cat and ST662AhupB: cat, with primers hupADTlf and hupADTlr and hupBDTf and hupBDTr, respectively;
A Figura 3 é um gel de agarose 1% demonstrando a excisão do gene cat das linhagens ST662AhupA: cat e ST662AhupB: cat para a construção do duplo mutante ST662AhupAÂhupB;  Figure 3 is a 1% agarose gel demonstrating cat gene excision of the ST662AhupA: cat and ST662AhupB: cat strains for the construction of the double ST662AhupAÂhupB mutant;
A Figura 4 é um gel de agarose 1% demonstrando os produtos de amplificação por PCR das regiões referentes aos genes hupA e hupB, respectivamente;  Figure 4 is a 1% agarose gel demonstrating PCR amplification products of the hupA and hupB gene regions, respectively;
A Figura 5 é um esquema demonstrando a deleção dos genes hupA e hupB e a posição dos iniciadores de detecção, representados como setas. Descrição Detalhada da Invenção Figure 5 is a schematic showing the deletion of the hupA and hupB genes and the position of the detection primers, represented as arrows. Detailed Description of the Invention
Embora a presente invenção possa ser suscetivel a diferentes modalidades, é mostrada nos desenhos e na seguinte discussão detalhada, uma modalidade preferida com o entendimento de que a presente modalidade deve ser considerada uma exemplificação dos princípios da invenção e não pretende limitar a presente invenção ao que foi ilustrado e descrito aqui.  While the present invention may be susceptible to different embodiments, it is shown in the drawings and the following detailed discussion, a preferred embodiment with the understanding that the present embodiment is to be considered an exemplification of the principles of the invention and is not intended to limit the present invention to what has been illustrated and described here.
A Figura 1 é um Gel de agarose 1% com o fragmento gerado por PCR, correspondente ao cassete de recombinação do gene hupA para a construção da linhagem mutante . Da esquerda para a direita, as amostras referem-se ao Marcador de Peso Molecular 1 kb DNA ladder (Fermentas) ; controle negativo e o cassete de recombinação do gene hupA, com cerca de 1200 pb, compreendendo o gene cat e regiões flanqueadoras compostas por sítios FRT (FLP Recognition Targets) e regiões adjacentes aos gene-alvo.  Figure 1 is a 1% Agarose Gel with the PCR generated fragment corresponding to the hupA gene recombination cassette for the construction of the mutant strain. From left to right, samples refer to the Molecular Weight Marker 1 kb DNA ladder (Fermentas); negative control and the hupA gene recombination cassette, about 1200 bp, comprising the cat gene and flanking regions composed of FRT (FLP Recognition Targets) sites and regions adjacent to the target genes.
As Figuras 2a e 2b é uma construção dos mutantes AhupA e AhupB de S. entérica . Gel de agarose 1% com os produtos de PCR utilizando-se respectivamente os primers hupAD e hupBOT (primers de detecção) para confirmação da mutagênese. O controle positivo corresponde à linhagem selvagem 662ST, com amplificação do gene íntegro e regiões flanqueadoras , gerando fragmento de 396 pb para hupA e 371 pb para hupB, enquanto os mutantes apresentam .banda de aproximadamente 1.2 kb, equivalente ao gene cat e regiões flanqueadoras . MPM: Marcador de Peso Molecular 1 kb DNA ladder (Fermentas) ; CN: Controle Negativo (sem DNA) ; CP: Controle Positivo (DNA genômico da linhagem selvagem) . Figures 2a and 2b is a construction of the S. enteral mutants AhupA and AhupB. 1% agarose gel with PCR products using hupAD and hupBOT (detection primers) respectively to confirm mutagenesis. The positive control corresponds to the wild line 662ST, with amplification of the intact gene and regions flanking machines, generating a fragment of 396 bp for hupA and 371 bp for hupB, while the mutants have a bandwidth of approximately 1.2 kb, equivalent to the cat gene and flanking regions. MPM: Molecular Weight Marker 1 kb DNA ladder (Fermentas); CN: Negative Control (without DNA); CP: Positive Control (wild line genomic DNA).
A Figura 3 . mostra a eliminação do cassete de resistência ao cloranfenicol em mutantes ΔηιιρΑ e AhupB de S. entérica, demonstrando as "cicatrizes" de cerca de 100 pb, correspondentes também aos sítios FRT. Foram utilizados os primers hupAO l para as linhagens mutantes AhupA e hupBOT para os mutantes AhupB. MPM - Marcador de peso molecular 1 kb DNA ladder (Fermentas) ; CN - Controle negativo; CmR - linhagens portadoras do gene cat.  Figure 3. shows the elimination of the chloramphenicol resistance cassette in S. entérica mutants ΔηιιρΑ and AhupB, demonstrating the "scars" of about 100 bp, corresponding also to the FRT sites. The hupAO 1 primers were used for AhupA mutant strains and hupBOT primers for AhupB mutants. MPM - Molecular Weight Marker 1 kb DNA ladder (Fermentas); CN - Negative Control; CmR - cat.
A Figura 4 é um gel de agarose 1% demonstrando os produtos de PCR para regiões flanqueadoras ao gene hupA e hupB, respectivamente. Da esquerda para a direita: Marcador de peso molecular 1 kb DNA ladder (Fermentas) ; Controle negativo; Controle positivo para hupA, composto por DNA genômico da linhagem selvagem 662ST, com fragmento referente ao gene íntegro hupA (importante salientar que neste caso os iniciadores hupADT2 foram utilizados, gerando fragmento de 702 pb para hupA) ; Linhagem 662STA.hupA, com fragmento amplificado pelos primers hupAD 2, referente ao gene cat e regiões flanqueadoras; Linhagem duplo mutante 662STAhupAAhupB, amplificado pelos primers hupADT2 ; Controle positivo, composto pelo DNA genômico da linhagem selvagem 662ST, com fragmento referente ao gene íntegro hupB; Linhagem 662STAhupB, com fragmento amplificado pelos primers hupBOT, referente ao gene cat e regiões flanqueadoras ; Linhagem duplo mutante 662STAhupAAhupB, amplificado pelos primers hupBOT. Figure 4 is a 1% agarose gel demonstrating PCR products for hupA and hupB flanking regions, respectively. From left to right: Molecular Weight Marker 1 kb DNA ladder (Fermentas); Negative control; Positive control for hupA, consisting of genomic DNA from the wild line 662ST, with fragment referring to the intact hupA gene (important to note that in this case the hupADT2 primers were used, generating a 702 bp fragment for hupA); Lineage 662STA.hupA, with fragment amplified by hupAD 2 primers, referring to the cat gene and flanking regions; Mutant double line 662STAhupAAhupB, amplified by hupADT2 primers; Positive control, consisting of genomic DNA from the wild line 662ST, with fragment referring to the intact hupB gene; 662STAhupB strain, with fragment amplified by hupBOT primers, referring to the cat gene and flanking regions; Mutant double line 662STAhupAAhupB, amplified by hupBOT primers.
A Figura 5 é um esquema demonstrativo das etapas de construção das linhagens mutantes AhupA e AhupB e posição dos primers de detecção hupAOT e hupBOT, representados como setas. Inicialmente o gene-alvo está íntegro, demonstrado em branco. Posteriormente, o gene-alvo é substituído pelo gene cat (cloranphenicol acetyl transferase) , também demonstrado em branco. Na última etapa, o gene de resistência ao antibiótico cloranfenicol é eliminado, restando apenas uma "cicatriz" composta por sítios FRT (região hachurada) .  Figure 5 is a schematic diagram showing the construction steps of the AhupA and AhupB mutant strains and position of the hupAOT and hupBOT detection primers, represented as arrows. Initially the target gene is intact, shown in white. Subsequently, the target gene is replaced by the cat gene (chloramphenicol acetyl transferase), also shown in white. In the last stage, the chloramphenicol antibiotic resistance gene is eliminated, leaving only one "scar" composed of FRT (hatched region) sites.
Modalidade Preferencial da Invenção Preferred Mode of the Invention
Bactéria Patogênica Pathogenic bacteria
As bactérias patogênicas de acordo com a presente invenção são bactérias capazes de provocar doenças e/ou morte em seus hospedeiros. Exemplos de bactérias patogênicas incluem, sem limitações, bactérias gram negativas, em especial membros das famílias Enterobacteriaceae, Vibrionaceae, Francisellaceae,Pathogenic bacteria according to the present invention are bacteria capable of causing disease and / or death in their hosts. Examples of pathogenic bacteria include, without limitation, gram negative bacteria, in particular members of the Enterobacteriaceae, Vibrionaceae, Francisellaceae,
Legionallales, Pseudomonadacea ou Pasteurellaceae, incluindo os géneros Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., e Vibrio spp. Legionallales, Pseudomonadacea or Pasteurellaceae, including the genera Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., And Vibrio spp.
Em especial, bactérias patogênicas da presente invenção são escolhidas dentre as espécies que possuem em seu genoma pelo menos um gene codificador de HU, preferencialmente, mas não exclusivamente, S. entérica sorovar Typhimurium (662ST) .  In particular, pathogenic bacteria of the present invention are chosen from species having in their genome at least one HU encoding gene, preferably, but not exclusively, S. enterica serovar Typhimurium (662ST).
Gene codificador de HU Gene HU Encoder
O gene codificador de HU da presente invenção é uma sequência de DNA que apresenta homologia de pelo menos 80% com pelo menos uma sequência escolhida dentre hupA ou hupB, as quais são escolhidas dentre as espécies que possuem em seu genoma pelo menos um gene codificador de HU, preferencialmente, mas não exclusivamente, S. entérica sorovar Typhimurium (662ST).  The HU coding gene of the present invention is a DNA sequence having at least 80% homology to at least one sequence chosen from hupA or hupB, which are chosen from species having at least one coding gene in their genome. HU, preferably, but not exclusively, S. enterica serovar Typhimurium (662ST).
Bactéria Atenuada Attenuated Bacterium
Para efeitos da presente invenção, entende-se como bactéria atenuada uma bactéria patogênica que possui pelo menos um gene codificador de HU silenciado. Por "silenciamento" entende-se um processo de deleção de determinada sequência do genoma de uma bactéria. Em especial, o silenciamento foi proporcionado por um cassete de recombinação. For the purposes of the present invention, attenuated bacteria is understood to be a pathogenic bacterium having at least one mutated HU coding gene. By "silencing" is meant a process of deletion of a particular sequence of the genome of a bacterium. In particular, silencing was provided by a recombination cassette.
Cassete de recombinação Recombination Cassette
O cassete de recombinação, de acordo com a presente invenção, é um cassete compreendendo pelo menos uma sequência capaz de silenciar pelo menos um gene codificador de HU em uma bactéria patogênica.  The recombination cassette according to the present invention is a cassette comprising at least one sequence capable of silencing at least one HU encoding gene in a pathogenic bacterium.
0 cassete de recombinação é composto por iniciadores, que possuem 2 partes continuas, sendo a primeira uma sequência de aproximadamente 40 bases homólogas ao gene alvo e a segunda aproximadamente 20 bases homólogas a uma região presente nos plasmideos a serem utilizados.  The recombination cassette consists of primers, which have 2 continuous parts, the first being a sequence of approximately 40 bases homologous to the target gene and the second approximately 20 bases homologous to a region present in the plasmids to be used.
As regiões de homologia com o gene codificador de HU foram selecionadas a partir da sequência do banco de dados do projeto Genoma S. entérica (NC_003197) (Washington University, St. Louis, USA) e escolhidas de modo que fossem próximas aos códons de iniciação e terminação do gene.  The homology regions with the HU coding gene were selected from the sequence of the Genome S. enteral project database (NC_003197) (Washington University, St. Louis, USA) and chosen so that they were close to the initiation codons. and gene termination.
O cassete de recombinação compreende ainda genes acessórios, como genes de resistência a antibióticos.  The recombination cassette further comprises accessory genes, such as antibiotic resistance genes.
Processo de Transformação e Recombinação Transformation and Recombination Process
O processo de recombinação das bactérias da presente invenção é um processo que se baseia no sistema de recombinação Red. O sistema de recombinação XRed do bacteriófago λ inclui 3 genes: γ, β e exo (presentes no plasmideo pKD46) , que codificam respectivamente as proteínas Gam, Bet e Exo. The bacterial recombination process of the present invention is a process based on the recombination Red. The bacteriophage λ XRed recombination system includes 3 genes: γ, β and exo (present in plasmid pKD46), which encode the proteins Gam, Bet and Exo respectively.
Gam inibe o sistema ExoV do hospedeiro, enquanto Bet e Exo promovem a recombinação de fragmentos lineares no DNA alvo .  Gam inhibits the host ExoV system, while Bet and Exo promote the recombination of linear fragments into the target DNA.
Os plasmídeos acessórios contêm genes de resistência a antibióticos (KmR ou CmR) flanqueados por sítios FRT (FLP recombinase recognition targets) , formando o módulo de recombinação. Assim, estes plasmídeos são utilizados na criação do cassete de recombinação. Accessory plasmids contain antibiotic resistance genes (Km R or Cm R ) flanked by FRP (FLP recombinase recognition targets) sites, forming the recombination module. Thus, these plasmids are used in the creation of the recombination cassette.
Para a geração do cassete de recombinação, sequências de aproximadamente 40 pb homólogas ao gene alvo são geradas nas extremidades desse módulo por PCR. Assim, o cassete de recombinação é o módulo flanqueado por sequências homólogas ao gene alvo.  For generation of the recombination cassette, sequences of approximately 40 bp homologous to the target gene are generated at the ends of this module by PCR. Thus, the recombination cassette is the module flanked by sequences homologous to the target gene.
Para a geração de mutantes, o plasmideo p D46 é transformado por eletroporação na linhagem hospedeira e os transformantes são submetidos à eletroporação com o cassete de recombinação. A expressão dos genes γ, β e exo inibe a degradação da fita linear de DNA, permitindo a recombinação do cassete. Esta recombinação obedece à homologia de DNA conferida pelas sequências flanqueadoras , de tal forma que a recombinação envolverá sequências homólogas. For generation of mutants, plasmid p D46 is transformed by electroporation into the host lineage and transformants undergo electroporation with the recombination cassette. The expression of the γ, β and exo genes inhibits the degradation of the linear strand of DNA, allowing the recombination of the cassette. This recombination follows DNA homology conferred by flanking sequences such that recombination will involve homologous sequences.
Os recombinantes são então selecionados utilizando-se as marcas de resistências carreadas pelo módulo de recombinação. Essas construções permitem uma subsequente remoção do cassete de resistência pela FLP recombinase expressa por um gene plasmidial, no caso o plasmideo pCP20. Desta forma, é possível construir deleções ou inserções de genes em bactérias entéricas, utilizando fragmentos de DNA lineares, gerados por PCR.  The recombinants are then selected using the resistance tags carried by the recombination module. Such constructs allow subsequent removal of the resistance cassette by FLP recombinase expressed by a plasmid gene, in this case the plasmid pCP20. Thus, it is possible to construct deletions or insertions of genes in enteric bacteria using PCR-generated linear DNA fragments.
. Em especial, o processo de transformação da presente invenção compreende as etapas de:  . In particular, the transformation process of the present invention comprises the steps of:
a) expressão das proteínas Gam, Bet e Exo do bacteriófago λ presentes no plasmideo pKD46, promovendo a recombinação de fragmentos lineares no DNA alvo; e  a) expression of bacteriophage λ Gam, Bet and Exo proteins present in plasmid pKD46, promoting recombination of linear fragments into target DNA; and
b) troca alélica do gene codificador de HU pelo cassete de recombinação compreendendo um gene acessório; c) eliminação do gene acessório presente no cassete de recombinação .  b) allelic exchange of the HU encoding gene by the recombination cassette comprising an accessory gene; c) deletion of the accessory gene present in the recombination cassette.
Linhagens bacterianas selecionadas para mutagênese  Bacterial strains selected for mutagenesis
Para este estudo foi selecionada uma linhagem selvagem virulenta de S. entérica, da sorovariedade Typhimurium (662ST) .  For this study, a virulent S. enteral wild strain of the Typhimurium serovarity (662ST) was selected.
As amostras selecionadas foram estocadas em glicerol 2,5 M, segundo protocolo descrito por Sambrook e Russell (2001) e incorporado aqui, por referência, em sua totalidade . The selected samples were stored in glycerol 2.5 M, according to the protocol described by Sambrook and Russell (2001) and incorporated herein by reference in its entirety.
Teste de sensibilidade das linhagens de S. entérica Typhimurium a antibióticos  Sensitivity test of S. enteral Typhimurium strains to antibiotics
A susceptibilidade das linhagens selecionadas foi testada para os antibióticos ampicilina, canamicina, cloramphenicol , estreptomicina e tetraciclina . Para isso, foi utilizado o método de microdiluição .  The susceptibility of the selected strains was tested for the antibiotics ampicillin, kanamycin, chloramphenicol, streptomycin and tetracycline. For this, the microdilution method was used.
Neste teste foi possível observar uma Concentração Inibitória Mínima (MIC) inferior a 10ug/mL para os antibióticos ampicilina, cloranfenicol, estreptomicina e tetraciclina e MIC num intervalo de 10-25 g/mL para canamicina. Este teste indicou que plasmídeos com marcas de resistência a ampicilina e ao cloranfenicol podem ser utilizados .  In this test it was possible to observe a Minimum Inhibitory Concentration (MIC) of less than 10ug / ml for the antibiotics ampicillin, chloramphenicol, streptomycin and tetracycline and MIC in a range of 10-25 g / ml for kanamycin. This test indicated that plasmids bearing ampicillin and chloramphenicol resistance markers could be used.
Sistema utilizado para mutagênese  System used for mutagenesis
A mutagênese dos genes hupA e hupB foi obtida pelo sistema λ Red conforme descrito por Datsenko e anner (2000) e incorporada aqui, em sua totalidade, por referência. Este sistema é constituído das linhagens e plasmídeos demonstrados na Tabela 1.  The mutagenesis of the hupA and hupB genes was obtained by the λ Red system as described by Datsenko and anner (2000) and incorporated herein in its entirety by reference. This system consists of the strains and plasmids shown in Table 1.
Tabela 1 - Linhagens bacterianas com seus respectivos plasmídeos pertencentes ao sistema λ Red. Table 1 - Bacterial strains with their respective plasmids belonging to the λ Red system.
Figure imgf000027_0001
Figure imgf000027_0001
Extração e purificação de plasmídeos  Plasmid Extraction and Purification
Do estoque à -80°C foi retirada uma amostra de cada cepa contendo os plasmideos. A linhagem BW25113/pKD46 foi semeada em meio LB ágar contendo ampicilina (100ug/mL) ; BW25141/pKD3 e BT340/pCP20 foram semeadas em meio LB ágar contendo ampicilina (100ug/mL) e cloranfenicol (25μg/mL) . From stock at -80 ° C one sample was taken from each strain containing the plasmids. BW25113 / pKD46 strain was seeded on LB agar medium containing ampicillin (100ug / ml); BW25141 / pKD3 and BT340 / pCP20 were seeded on LB agar medium containing ampicillin (100ug / mL) and chloramphenicol (25μg / mL).
Para extração e purificação dos plasmideos pKD46 e pCP20, a temperatura de incubação utilizada foi 30° C, uma vez que tais plasmideos contêm origem de replicação termo- sensivel. Após a extração, os mesmos foram submetidos à eletroforese em gel de agarose 0,8% segundo o protocolo de Sambrook e Russell (2001) , incorporada aqui, por referência, em sua totalidade.  For extraction and purification of plasmids pKD46 and pCP20, the incubation temperature used was 30 ° C, since such plasmids contain thermosensitive origin of replication. After extraction, they were subjected to 0.8% agarose gel electrophoresis according to the protocol of Sambrook and Russell (2001), incorporated herein by reference in its entirety.
Iniciadores utilizados para gerar os cassetes de recombinação Primers used to generate the recombination cassettes
Os iniciadores para essa metodologia são compostos de 2 partes continuas, sendo a primeira uma sequência de aproximadamente 40 bases homólogas ao gene alvo e a segunda 20 bases homólogas a uma região presente no plasmideo pKD3. The primers for this methodology are composed of 2 continuous parts, the first one being a sequence of approximately 40 bases homologous to the target gene and the second 20 bases homologous to a region present in plasmid pKD3.
A região utilizada para amplificar a sequência contida no plasmideo foi selecionada através do programa Primer 3 (http : //frodo . wi .mit . edu/cgi-bin/primer3/primer3_www . cgi) , baseado na sequência do plasmideo pKD3 (AY048742) (Datsenko e Wanner, 2001) . Desse modo, foram desenhados os iniciadores hupA-f , hupA-r , hupB-f e hupB-r, descritos na Tabela 2.  The region used to amplify the sequence contained in the plasmid was selected using the Primer 3 program (http: // frodo. Wi .mit. Edu / cgi-bin / primer3 / primer3_www. Cgi), based on the plasmid sequence pKD3 (AY048742) (Datsenko and Wanner, 2001). Thus, the hupA-f, hupA-r, hupB-f, and hupB-r primers, described in Table 2, were designed.
Tabela 2. Iniciadores utilizados na construção do cassete de recombinação  Table 2. Primers used in the construction of the recombination cassette
Figure imgf000028_0001
Figure imgf000028_0001
Construção do cassete de recombinação por PCR  PCR Recombination Cassette Construction
Para a construção do cassete de recombinação foram utilizados os iniciadores descritos anteriormente, para a amplificação de uma região do plasmideo pKD3. As reações foram realizadas em volume final de 50 iL contendo 20 pmol de cada iniciador, 20 a 30 ng de DNA plasmidial, lmM de cada dNTP, 2U de Taq DNA polimerase e 2 mM de MgCl2 em tampão apropriado provido com a enzima. For the construction of the recombination cassette the primers described above were used for amplification of a region of plasmid pKD3. Reactions were performed in a final volume of 50 µl containing 20 pmol of each primer, 20 to 30 ng of plasmid DNA, 1 µM of each dNTP, 2U Taq DNA polymerase and 2 mM MgCl 2 in appropriate buffer provided with the enzyme.
Para a reação de PCR, o DNA plasmidial foi desnaturado por aquecimento a 94° C por 2 minutos, e a amplificação realizada em 30 ciclos constituída dos seguintes passos: (1) denaturação a 94° C por 30 segundos; (2) "anelamento" a 56° C por 30 segundos; (3) extensão a 72° C por 1 minuto e 30 segundos. Procedeu-se uma extensão final por 5 minutos. O produto da PCR foi analisado por eletroforese em gel de agarose 1% (Sambrook e Russell, 2001) .  For the PCR reaction, plasmid DNA was denatured by heating at 94 ° C for 2 minutes, and amplification performed in 30 cycles consisting of the following steps: (1) denaturation at 94 ° C for 30 seconds; (2) "ringing" at 56 ° C for 30 seconds; (3) extension at 72 ° C for 1 minute and 30 seconds. A final extension was performed for 5 minutes. The PCR product was analyzed by 1% agarose gel electrophoresis (Sambrook and Russell, 2001).
Assim, os primers hupA-f, hupA-r, hupB-f e hupB-r foram utilizados para amplificar uma região de aproximadamente 1,2 Kbp (Figura 1) do plasmídeo pKD3. A região amplificada foi utilizada para compor o cassete de recombinação com os genes hupA e hupB, respectivamente. Para fins ilustrativos, demonstra-se na figura 1 o cassete de recombinação gerado por PCR utilizando os primers hupA-f e hupA-r.  Thus, the hupA-f, hupA-r, hupB-f and hupB-r primers were used to amplify an approximately 1.2 Kbp region (Figure 1) of plasmid pKD3. The amplified region was used to compose the recombination cassette with the hupA and hupB genes, respectively. For illustrative purposes, the PCR generated recombination cassette using the hupA-f and hupA-r primers is shown in Figure 1.
Sequenciamento de nucleotideos  Nucleotide Sequencing
O sequenciamento de nucleotideos foi realizado conforme protocolos padrões. Os resultados são apresentados abaixo.  Nucleotide sequencing was performed according to standard protocols. The results are presented below.
Sobreposição do sequenciamento do duplo mutante AhupAAhupB com os primers hupBDT "forward" e "reverse": TCGTACTTCGAAGGATTCAGGTGCGATATAAATTATAAAGAGGAAGAGAAGAGTGAATA AAGTGTAGGC GGAGC GC TCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGA Overlapping AhupAAhupB double mutant sequencing with hupBDT "forward" and "reverse" primers: TCGTACTTCGAAGGATTCAGGTGCGATATAAATTATAAAGAGGAAGAGAAGAGTGAATA AAGTGTAGGC GGAGC GC TCGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGA
ArAGGAACTAAGGAGGATATTCATATGGCGGTAAACTAAGCGTGATCCCCTCGGGGGAT GTGACAAAGTACAAGGGCGCATCAAC (SEQ IP No. 1) ArAGGAACTAAGGAGGATATTCATATGGCGGTAAACTAAGCGTGATCCCCTCGGGGGAT GTGACAAAGTACAAGGGCGCATCAAC (SEQ IP No. 1)
A sobreposição das bases sequenciadas a partir dos primers hupBDT f e r (sublinhados) condizem a regiões flanqueadoras do gene hupB, não mais existente na linhagem duplo recombinante AhupAAhupB, conforme confirmado pela presença de uma cicatriz do plasmidio pKD3 no lugar desse gene (Box cinza) .  Overlapping of the bases sequenced from the hupBDT f and r primers (underlined) match the flanking regions of the hupB gene no longer existing in the double recombinant AhupAAhupB lineage, as confirmed by the presence of a scar of plasmid pKD3 in place of that gene (Box gray).
Duplo mutante AhupAAhupB sequenciado com primer hupADT2f: Double mutant AhupAAhupB sequenced with hupADT2f primer:
GGCTCAGGGCAGACCTGCGCGAGGCTGGCGAGAGCA-TATCGGTATAAATTTTCAGCAA TGACACCAGAAAACGTGATTTACGTCTGATTTGTCGTGCCATAAGGCTTCCCTTATGCC CCCCGTCTGGTCTACATTTGGGAGGC-AAAAAAAGTGGCTATCGGTGCGTGTATGCAGG AGAGTGCTTTTCTGGCATTTCC-TCGCACTC-ATGCTTAGCAAGCGATAAACACATTGT AAGGATAACTTATGAACAAGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTC A GAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCT GCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCA CAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATA ATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAAT CAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAAC CCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTG TAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTT GCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCT TTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAGATG-GAATAA-GC CG-ATAAACTTGTGCTTATTTTTCTTTACGTCTTAAAAGGCGTATATCA (SEQ ID No. 2) Neste caso a sequência é maior, pois no local do gene hupA foi inserido o gene cat e regiões plasmidiais flanqueadoras (~1,2 kb) . No box cinza, está destacada a sequência correspondente à região flanqueadora ao gene hupA de Salmonella, que logo em seguida é interrompida por sequências presentes no plasmidio pKD3, correspondentes ao PI e ao gene cat. Os traços simbolizam bases não identificadas no sequenciamento . GGCTCAGGGCAGACCTGCGCGAGGCTGGCGAGAGCA-TATCGGTATAAATTTTCAGCAA TGACACCAGAAAACGTGATTTACGTCTGATTTGTCGTGCCATAAGGCTTCCCTTATGCC CCCCGTCTGGTCTACATTTGGGAGGC-AAAAAAAGTGGCTATCGGTGCGTGTATGCAGG AGAGTGCTTTTCTGGCATTTCC-TCGCACTC-ATGCTTAGCAAGCGATAAACACATTGT AAGGATAACTTATGAACAAGGTGTAGGCTGGAGCTGCTTCGAAGTTCCTATACTTTC The GAGAATAGGAACTTCGGAATAGGAACTTCATTTAAATGGCGCGCCTTACGCCCCGCCCT GCCACTCATCGCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCA CAAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCTTGCGTATA ATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCATATTGGCCACGTTTAAAT CAAAACTGGTGAAACTCACCCAGGGATTGGCTGAGACGAAAAACATATTCTCAATAAAC CCTTTAGGGAAATAGGCCAGGTTTTCACCGTAACACGCCACATCTTGCGAATATATGTG TAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTT GCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCGTCT TTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAGATG GAATAA-GC-GC-ATAAACTTGTGCTTATTTTTCTTTACGTCTTAAAAGGCGTATATCA (SEQ ID No. 2) In this case the sequence is longer, because at the hupA gene site was inserted the cat gene and flanking plasmid regions (~ 1.2 kb). In the gray box, the sequence corresponding to the flanking region of the Salmonella hupA gene is highlighted, which is shortly thereafter interrupted by sequences present in plasmid pKD3, corresponding to PI and cat. The strokes symbolize unidentified bases in sequencing.
Duplo mutante ÁhupAAhupB sequenciado com o primer hupADT2r (sequência complementar e invertida) :  Double mutant ÁhupAAhupB sequenced with hupADT2r primer (complementary and inverted sequence):
CAAACCCTTTAGG-AAATAGGCCAGGTTT-CACCGTAACACG—ACATCTTGCGAATAT ATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTC AGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCAC CGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGA ATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAAT GTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCC ATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGA TCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTC GCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCT GCGAAGTGATCTTCTGTC-CAGGTAGGCGCGCCGAAGTTCCTATAC (SEQ ID No 3) .  CAAACCCTTTAGG-AAATAGGCCAGGTTT-CACCGTAACACG-ACATCTTGCGAATAT ATGTGTAGAAACTGCCGGAAATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTC AGTTTGCTCATGGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCAC CGTCTTTCATTGCCATACGTAATTCCGGATGAGCATTCATCAGGCGGGCAAGAATGTGA ATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCTTTAAAAAGGCCGTAAT ATCCAGCTGAACGGTCTGGTTATAGGTACATTGAGCAACTGACTGAAATGCCTCAAAAT GTTCTTTACGATGCCATTGGGATATATCAACGGTGGTATATCCAGTGATTTTTTTCTCC ATTTTAGCTTCCTTAGCTCCTGAAAATCTCGACAACTCAAAAAATACGCCCGGTAGTGA TCTTATTTCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTTTC GCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGATTTATTTATTCT GCGAAGTGATCTTCTGTC-CAGGTAGGCGCGCCGAAGTTCCTATAC (SEQ ID NO 3).
Nesse sequenciamento foram detectadas apenas bases referentes ao plasmidio pKD3, já que o inicio e o final da sequência apresentaram baixa qualidade no eletroferograma e por isso foram desconsideradas. As regiões de alinhamento com o plasmidio correspondem a uma região do gene catIn this sequencing only bases referring to plasmid pKD3 were detected, since the beginning and the end of the sequence presented poor quality in the electropherogram and were therefore disregarded. Plasmid alignment regions correspond to a region of the cat gene
(nucleotideos 263 a 993 do plasmidio) . (nucleotides 263 to 993 of the plasmid).
Transformação das linhagens de S. entérica Typhimurium com o plasmídeo pKD46 Transformation of S. enteral Typhimurium strains with plasmid pKD46
A transformação das linhagens selecionadas com o plasmídeo pKD46 foi realizada por eletroporação, seguindo protocolo descrito em Ausubel et al. (2007), incorporado aqui, por referência, em sua totalidade.  Transformation of the selected strains with plasmid pKD46 was performed by electroporation following the protocol described in Ausubel et al. (2007), incorporated herein by reference in its entirety.
O eletroporador (Eletroporador Bio Rad. Gene Pulser The Electroporator (Bio Rad. Gene Pulser Electroporator
II, Hercules - CA, USA) foi ajustado para 1,5 KV, 25 \iF eII, Hercules - CA, USA) was adjusted to 1.5 KV, 25 µF and
200 ohms e cubetas de 0,1 cm foram utilizadas. As amostras foram eletroporadas então incubadas por 1 hora em meio SOC. Posteriormente as culturas foram plaqueadas em meio LB ágar provido de ampicilina (100 g/mL) e incubadas -à 30°C durante a noite. 200 ohms and 0.1 cm cuvettes were used. The samples were electroporated then incubated for 1 hour in SOC medium. Subsequently the cultures were plated on ampicillin-containing LB agar medium (100 g / ml) and incubated at 30 ° C overnight.
A presença do plasmídeo foi avaliada pela análise do perfil plasmidial por eletroforese em gel de agarose. As linhagens selecionadas foram estocadas em glicerol 2,5 M segundo protocolo proposto por Sambrook e Russell (2001) . The presence of the plasmid was evaluated by analysis of the plasmid profile by agarose gel electrophoresis. The selected strains were stored in glycerol 2.5 M according to protocol proposed by Sambrook and Russell (2001).
Troca alélica dos genes hupA e hupB pelo cassete de recombinação Allelic exchange of hupA and hupB genes by the recombination cassette
Para a etapa de recombinação gênica foi utilizada a linhagem 662ST/pKD46, como descrito anteriormente, e o cassete de recombinação gerado por PCR. For the gene recombination step we used the strain 662ST / pKD46, as described above, and the PCR-generated recombination cassette.
O preparo das células competentes foi feito partindo- se de um pré-inóculo com 5 mL de meio LB provido de ampicilina (100 pg/mL) , que foi incubado durante a noite à 30 °C. Desta cultura 0,5 mL foram inoculados em 50 mL de meio LB com o mesmo antibiótico e lmM de L-arabinose (Sigma) , usado como indutor da expressão dos genes γ, β, e exo, sendo esta nova cultura crescida à 30 °C sob agitação (150 rpm) até atingir ϋ.Οεοο de 0,7. Os frascos foram resfriados em banho de gelo por 15 minutos e as culturas foram centrifugadas por 10 minutos à 5000 g (4o C) . O precipitado foi ressuspendido em 4 mL de água deionizada esterilizada previamente resfriada a 4 °C e centrifugado novamente nas mesmas condições. Esta etapa de lavagem foi repetida três vezes utilizando-se glicerol 10% e o sedimento formado após a última lavagem foi ressuspendido em 400 L e distribuído em alíquotas de 90 μL pelo protocolo de Sambrook e Russell (2001) e incorporado aqui, por referência, em sua totalidade. Competent cells were prepared from a pre-inoculum with 5 ml ampicillin-containing LB medium (100 pg / ml), which was incubated overnight at 30 ° C. From this culture 0.5 ml were inoculated in 50 ml LB medium with the same antibiotic and 1mM L-arabinose (Sigma), used as inducer of γ, β, and exo gene expression, and this new culture was grown at 30 °. C under agitation (150 rpm) until it reaches ϋ.Οεοο of 0.7. The flasks were cooled in an ice bath for 15 minutes, the cultures were centrifuged for 10 minutes at 5000 g (4 ° C). The precipitate was resuspended in 4 mL sterile deionized water previously cooled to 4 ° C and centrifuged again under the same conditions. This wash step was repeated three times using 10% glycerol and the pellet formed after the last wash was resuspended at 400 L and distributed in 90 μL aliquots by the protocol of Sambrook and Russell (2001) and incorporated herein by reference. in its entirety.
Foram selecionados três tubos contendo as alíquotas aos quais foram adicionados 10 μL do produto gerado pela PCR; esses foram colocados em gelo por 1 minuto. O eletroporador foi ajustado para 1,5 KV, 25 \iF e 200 ohms e as amostras eletroporadas e recolhidas em meio SOC, onde foram incubadas à 37° C por 1 hora e depois plaqueadas em meio LB-ágar com cloranfenicol (25 g/mL) . As culturas foram incubadas durante a noite à 37 °C. Das colónias crescidas, foram selecionadas algumas para a confirmação por PCR, sendo denominadas 662STÁhupACmR e 662STAhupBCmR . As colónias selecionadas foram estocadas em glicerol 2,5 M segundo protocolo proposto por Sambrook e Russell (2001) , e incorporado aqui, por referência, em sua totalidade. Em seguida, o plasmidio pKD46 foi curado. Three tubes were selected containing the aliquots to which 10 μL of the PCR product was added; These were placed on ice for 1 minute. The electroporator has been set to 1.5 KV, 25 \ iF and 200 ohms and The samples were electroporated and collected in SOC medium, where they were incubated at 37 ° C for 1 hour and then plated on LB-agar medium with chloramphenicol (25 g / mL). Cultures were incubated overnight at 37 ° C. From the grown colonies, some were selected for PCR confirmation, being named 662STÁhupACm R and 662STAhupBCm R. The selected colonies were stored in 2.5 M glycerol according to protocol proposed by Sambrook and Russell (2001), and incorporated herein by reference in their entirety. Then plasmid pKD46 was cured.
Eliminação do gene cat de resistência ao antibiótico  Elimination of antibiotic resistance cat gene
Para a eliminação do gene de resistência ao antibiótico, foram utilizadas células competentes preparadas das linhagens 662STAhupACmR e 662STAhupSCmR e o plasmideo pCP20. A eletroporação foi feita conforme descrito anteriormente e os transformantes foram selecionados em placas de LB-ágar com ampicilina (100 μg/mL) . As placas foram incubadas durante a noite à 30 ° C. Algumas das colónias crescidas foram selecionadas para confirmação por PCR e denominadas 662STàhupA e 662STAhupB. Estas linhagens foram estocadas em glicerol 2,5M como descrito anteriormente por Sambrook e Russell (2001) e incorporado aqui, por referência, em sua totalidade. Detecção e caracterização das mutações em hupA e hupB por PCR For elimination of the antibiotic resistance gene, competent cells prepared from 662STAhupACm R and 662STAhupSCm R strains and plasmid pCP20 were used. Electroporation was performed as previously described and the transformants were selected on ampicillin LB-agar plates (100 μg / mL). The plates were incubated overnight at 30 ° C. Some of the grown colonies were selected for PCR confirmation and named 662STàhupA and 662STAhupB. These strains were stored in 2.5M glycerol as previously described by Sambrook and Russell (2001) and incorporated herein by reference in their entirety. Detection and characterization of hupA and hupB mutations by PCR
Detecção do gene cat  Cat gene detection
O gene cat (chloramphenicol acetyl transferase) nos mutantes de S. entérica foi inicialmente detectado por PCR. Foi desenhado um par de iniciadores internos a este gene, tendo-se como base a seguência do plasmideo pKD3 (AY048742) (Datsenko e Wanner, 2001) e constituinte do cassete de recombinação. Estes foram desenhados com o software Primer 3 (http : 111rodo . i .mit . edu/cgi-bin/primer3/primer3_www . cgi) . Os iniciadores estão demonstrados na Tabela 3.  The cat gene (chloramphenicol acetyl transferase) in S. enterica mutants was initially detected by PCR. A pair of primers internal to this gene were designed based on the sequence of plasmid pKD3 (AY048742) (Datsenko and Wanner, 2001) and constituent of the recombination cassette. These were designed with the Primer 3 software (http: 111rodo. I .mit. Edu / cgi-bin / primer3 / primer3_www. Cgi). Primers are shown in Table 3.
Tabela 3 - Sequência dos iniciadores utilizados para detecção do gene cat  Table 3 - Sequence of primers used for cat gene detection
Figure imgf000035_0001
Figure imgf000035_0001
* Estes primers já constaram de vima publicação.  * These primers have already been published.
As reações foram realizadas em volume final de 50 ]iL contendo 20 pmol de cada iniciador, 20 a 30 ng de DNA genômico de cada transformante, lmM de cada dNTP, 2U de Taq DNA polimerase e 2 mM de MgCl2 em tampão apropriado provido com a enzima. Para a reação de PCR, o DNA genômico foi desnaturado por aquecimento a 94 °C por 2 minutos e a amplificação realizada em 35 ciclos constituída dos seguintes passos: (1) denaturação a 94 °C por 30 segundos; (2) "anelamento" a 55 °C por 30 segundos; (3) extensão a 72 °C por 1 minuto. Procedeu-se uma extensão final por 5 minutos. O produto da PCR foi analisado por eletroforese em gel de agarose 1% utilizado o protocolo descrito por Sambrook e Russell (2001) , incorporado aqui, por referência, em sua totalidade. Reactions were performed in 50 µl final volume containing 20 pmol of each primer, 20 to 30 ng of genomic DNA of each transformant, 1mM of each dNTP, 2U of Taq DNA polymerase and 2 mM of MgCl 2 in appropriate buffer provided with the enzyme. For the PCR reaction, genomic DNA was denatured by heating at 94 ° C for 2 minutes and amplification performed in 35 cycles consisting of the following steps: (1) denaturation at 94 ° C for 30 seconds; (2) "ringing" at 55 ° C for 30 seconds; (3) extension at 72 ° C for 1 minute. A final extension was performed for 5 minutes. The PCR product was analyzed by 1% agarose gel electrophoresis using the protocol described by Sambrook and Russell (2001), incorporated herein by reference in its entirety.
Detecção das mutações por iniciadores externos aos genes hupA e upB  Detection of mutations by primers external to hupA and upB genes
Foram construídos dois pares de iniciadores externos aos genes hupA e um par a hupB para a detecção das mutagêneses (Tabela 4) . Esses foram desenhados com o auxílio do software Primer 3 (http://frodo.wi.mit.edu/cgi- bin/primer3/primer3_www. cgi) , baseado na sequência de S. entérica Typhimurium LT2 (NC_003197) .  Two primer pairs external to the hupA genes and one hupB pair were constructed for mutagenesis detection (Table 4). These were designed with the aid of the Primer 3 software (http://frodo.wi.mit.edu/cgi- bin / primer3 / primer3_www. Cgi), based on the S. enteral Typhimurium LT2 sequence (NC_003197).
Tabela 4 - Sequência dos iniciadores externos aos genes hupA e hupB  Table 4 - Sequence of primers external to hupA and hupB genes
Primers Sequência (5' -3') Primers Sequence (5 '-3')
upADTl-f AGTGCTTTTCTGGCATTTCC  upADTl-f AGTGCTTTTCTGGCATTTCC
(SEQ ID 4) hupJJDTl-r ACAGACAAAAGGGGCTGATG (SEQ ID 4) hupJJDTl-r ACAGACAAAAGGGGCTGATG
(SEQ ID 5) (SEQ ID 5)
hupADT2-f CGACTGCGAAGAACGTGATA hupADT2-f CGACTGCGAAGAACGTGATA
(SEQ ID 6) (SEQ ID 6)
hupADT2-r AAAGCCGCTGGCAGTAAAC hupADT2-r AAAGCCGCTGGCAGTAAAC
(SEQ ID 7) (SEQ ID 7)
hupEDT-f TCGTACTTCGAAGGATTCAGG hupEDT-f TCGTACTTCGAAGGATTCAGG
(SEQ ID 8)(SEQ ID 8)
upBDT-r GTTGATGCGCCCTTGTACTT  upBDT-r GTTGATGCGCCCTTGTACTT
(SEQ ID 9) (SEQ ID 9)
Transdução com bacteriófago P22  P22 bacteriophage transduction
A seleção de recombinantes de . S. entérica por eletroporaçao muitas vezes seleciona. linhagens contendo LPS (lipopolissacarideos) incompletos, já que estes são mais facilmente transformáveis, mas são mais sensíveis ao sistema imune e muitas vezes incapazes de estabelecer uma infecção sistémica em camundongos.  Selection of recombinants from. S. enteric by electroporation often selects. strains containing incomplete LPS (lipopolysaccharides) as they are more easily transformable but are more sensitive to the immune system and often unable to establish a systemic infection in mice.
Para realizar a transdução a bactéria recombinante doadora foi cultivada em 3 ml de LB sem antibiótico durante a noite a 37 °C. No dia seguinte, uma alíquota de 100 μ1_ do fago foi adicionada a 900 μΐ, de LB fresco, atingindo a densidade de aproximadamente IO9 UFC/mL. Essa alíquota de 1 ml foi adicionada ao pré-inóculo cultivado, com uma densidade bacteriana de aproximadamente IO9 UFC/mL. To perform the transduction the donor recombinant bacterium was grown in 3 ml LB without antibiotic overnight at 37 ° C. The next day, a 100 μ1 aliquot of phage was added to 900 μΐ fresh LB, reaching a density of approximately 10 9 CFU / mL. This 1 ml aliquot was added to the cultured pre-inoculum with a bacterial density of approximately 10 9 CFU / mL.
A cultura foi então novamente cultivada na estufa a 37 °C durante a noite. Nesse mesmo dia, a linhagem selvagem 662ST também foi cultivada em 3 ml de LB na estufa a 37 °C durante a noite. Como controle, o bacteriófago foi plaqueado em LB Ágar, para verificação de contaminação bacteriana .  The culture was then re-grown in the greenhouse at 37 ° C overnight. That same day, the 662ST wild strain was also grown in 3 ml of LB in the greenhouse at 37 ° C overnight. As a control, the bacteriophage was plated on LB Agar for bacterial contamination.
No terceiro dia, a cultura com a bactéria doadora e o fago foi centrifugada a 5000 g por 10 minutos a 4 °C, para que as bactérias sedimentassem, separando-se do fago. Para garantir o isolamento de fagos e bactérias, o sobrenadante foi cuidadosamente filtrado e armazenado em um novo recipiente. Como controle o sobrenadante foi estriado em LB Ágar para verificar se não houve resquício de bactérias.  On the third day, the culture with donor bacteria and phage was centrifuged at 5000 g for 10 minutes at 4 ° C to allow the bacteria to settle away from the phage. To insulate phage and bacteria isolation, the supernatant was carefully filtered and stored in a new container. As a control the supernatant was streaked on LB Agar to verify that there was no trace of bacteria.
Alíquotas de fagos e bactérias selvagens receptoras foram misturadas, seguindo-se as seguintes proporções: 10 μΐ de fago + 100 μΐ de bactéria; 50 μΐ de fago + 100 μΐ de bactéria; 50 μΐ de fago + 50 μΐ de bactéria e 10 μΐ de fago + 50 μΐ de bactéria. Os recipientes contendo fagos e bactérias foram incubados a 37 °C por 20 minutos para a adsorção. Após esse período, as alíquotas foram plaqueadas em LB Ágar com cloranfenicol para a seleção das bactérias transduzidas . No dia seguinte, as colónias crescidas foram repicadas para os meios seletivos SS, MacConkey com cloranfenicol e novamente para LB com cloranfenicol e novo PCR de confirmação com os primers Cmdt e hupAdt ou hupBdt foi realizado. Aliquots of phage and receptor wild bacteria were mixed, following the following proportions: 10 μΐ phage + 100 μΐ bacteria; 50 μΐ phage + 100 μΐ bacteria; 50 μΐ of phage + 50 μΐ of bacteria and 10 μΐ of phage + 50 μΐ of bacteria. Containers containing phage and bacteria were incubated at 37 ° C for 20 minutes for adsorption. After this period, aliquots were plated on LB Agar with chloramphenicol for selection of transduced bacteria. The following day, the grown colonies were picked for SS, MacConkey with chloramphenicol selective media and again for LB with chloramphenicol and new confirmatory PCR with Cmdt and hupAdt or hupBdt primers was performed.
Caracterização dos mutantes AhupA, AhupB e AhupAÁhupB de S. entérica  Characterization of mutants AhupA, AhupB and AhupAÁhupB from S. enterica
Curva de crescimento in vitro  In vitro growth curve
As linhagens recombinantes foram inoculadas em 5 mL de meio LB e incubadas à 37 °C durante a noite. No dia seguinte, 500 μ]_. do pré-inóculo foi adicionado à 50 mL de meio LB 1% glicose e a nova cultura incubada à 37 °C sob agitação (150 rpm) , sendo retiradas aliquotas a cada hora, durante cinco horas e diluições seriadas foram plaqueadas em triplicata sobre LB-ágar para contabilização no dia seguinte .  Recombinant strains were inoculated in 5 ml LB medium and incubated at 37 ° C overnight. The next day, 500 μ] _. from the pre-inoculum was added to 50 ml 1% LB glucose medium and the new culture incubated at 37 ° C under shaking (150 rpm), aliquots were taken every hour for five hours and serial dilutions were plated in triplicate over LB -agar for next day accounting.
A comparação das curvas exibidas pelas linhagens apresentou algumas diferenças no crescimento.  The comparison of the curves displayed by the strains showed some differences in growth.
Determinação da Dose Letal Média (DL50) por via oral em Camundongos Oral Lethal Dose Determination (LD 50 ) in Mice
Para determinação da DL50 por via oral, as linhagens 662ST, 662STAhupA, 662STAhupB e 662STbhupAàhupB foram cultivadas em meio LB a 37°C durante a noite. No dia seguinte, 0,5 mL dessas culturas foram inoculados em 50 mL de meio LB-glicose 1% e incubado a 37°C sob agitação (150rpm) até que atingissem o título desejado. As células foram sedimentadas por centrifugação (5000g por 5 min) e lavadas no mesmo volume de tampão salina-fosfato (PBS, pH 7,4) . Este passo foi repetido uma segunda vez e o sedimento ressuspendido em PBS (mesmo volume inicial) . Diluições seriadas foram preparadas em PBS e usadas para infectar camundongos BALB/c fêmeas com 6 a 8 semanas. As diluições foram plaqueadas em meio LB-ágar para a determinação da UFC. O inoculo via oral foi feito utilizando agulha de gavagem modelo IC800 (INSIGHT, Ribeirão Preto-SP, Brasil) . For oral LD 50 determination, 662ST, 662STAhupA, 662STAhupB and 662STbhupAàhupB strains were grown in LB medium at 37 ° C overnight. In day Next, 0.5 mL of these cultures were inoculated into 50 mL of 1% LB-glucose medium and incubated at 37 ° C with shaking (150rpm) until they reached the desired titer. Cells were pelleted by centrifugation (5000g for 5 min) and washed in the same volume of saline phosphate buffer (PBS, pH 7.4). This step was repeated a second time and the pellet resuspended in PBS (same initial volume). Serial dilutions were prepared in PBS and used to infect 6 to 8 week old female BALB / c mice. Dilutions were plated on LB-agar medium for CFU determination. The oral inoculum was performed using a model IC800 gavage needle (INSIGHT, Ribeirão Preto-SP, Brazil).
A quantidade de bactérias inoculadas variou de acordo com cada grupo, de IO2 à IO9 UFC/mL, sendo utilizados três camundongos por diluição. Os animais foram acompanhados por 30 dias após a administração do inoculo. The amount of inoculated bacteria varied according to each group, from 10 2 to 10 9 CFU / mL, using three mice per dilution. Animals were followed for 30 days after inoculum administration.
Os valores de DL5o por via oral em camundongos BALB/c foram calculados pelo método "Moving Average Interpolation" (Welkos e 0'Brien, 1994) . DL 5 the values orally in BALB / c mice were calculated by the method "Moving Average Interpolation" (Welkos and 0 'Brien, 1994).
Tabela 5 - DL50 de linhagens de S. entérica inoculadas por via oral em camundongos BALB/c Table 5 - DL 50 of S. enterica strains orally inoculated in BALB / c mice
Linhagem DL50 (CFU.mL-1) Referência DL 50 strain (CFU.mL- 1 ) Reference
662ST 1,5 x IO4 Presente invenção 662STAhupA 3,2 x 10' Presente invenção 662ST 1.5 x 10 4 Present Invention 662STAhupA 3.2 x 10 'Present Invention
662STàhupB 3,5 x 10 Presente invenção 662STàhupB 3.5 x 10 Present invention
662STAhupAÁhupB > IO8 Presente invenção662STAhupAÁhupB> IO 8 Present invention
É importante salientar que de experimento para experimento existe alguma variação nos valores de DL50, uma vez que este é um experimento que envolve várias variáveis biológicas . It is important to note that from experiment to experiment there is some variation in the LD50 values, as this is an experiment involving several biological variables.
Desafio via oral  Oral Challenge
A capacidade de desencadear resposta imune contra S. entérica foi testada em dois momentos: No primeiro, os animais foram imunizados com uma única dose de S. entérica e desafiados 28 dias após a mesma.  The ability to elicit immune response against S. enteric was tested at two times: In the first, the animals were immunized with a single dose of S. enteric and challenged 28 days after it.
Em. um segundo experimento, animais foram imunizados oralmente com duas doses da linhagem duplo mutante nos dias 0 e 14 e desafiados com a linhagem selvagem no 30° dia após a segunda dose. Os experimentos posteriores de desafio prosseguiram para a linhagem duplo mutante, já qμe esta apresentou os resultados mais promissores.  In. In a second experiment, animals were orally immunized with two doses of the double mutant strain on days 0 and 14 and challenged with the wild strain on day 30 after the second dose. Subsequent challenge experiments continued for the double mutant strain, which presented the most promising results.
A dose (UFC) utilizada foi de IO8 para a linhagem duplo mutante, dose esta estabelecida a partir dos ensaios prévios. Os animais foram desafiados com doses de IO7 CFU de linhagem ST662. The dose (CFU) used was 10 8 for the double mutant strain, a dose established from previous trials. Animals were challenged with 10 7 CFU doses of ST662 strain.
Para estes experimentos foram utilizados 7 camundongos BALB/c fêmeas com 6 a 8 semanas de idade por grupo. Os animais foram acompanhados por 30 dias após o desafio e avaliados quanto à sua sobrevivência. For these experiments 7 mice were used. BALB / c females 6 to 8 weeks old per group. The animals were followed for 30 days after challenge and evaluated for their survival.
Nas imunizações duplas com 662STÁhupAÁhupB todos os animais sobreviveram ao desafio com a linhagem selvagem enquanto que o grupo com imunização única apresentou uma taxa de 85% após 30 dias de experimento. Os animais do grupo placebo, inoculados com PBS, morreram entre o 5° e o 10° dia após serem desafiados com as linhagens selvagens. Algumas variações na taxa de sobrevivência dos camundongos com imunização dose única foram observadas entre diferentes experimentos.  In the 662STÁhupAÁhupB double immunizations all animals survived the challenge with the wild strain while the single immunization group showed an 85% rate after 30 days of experiment. Placebo animals inoculated with PBS died between days 5 and 10 after being challenged with wild lines. Some variations in the survival rate of mice with single dose immunization were observed between different experiments.
Como pode ser observada, a presente invenção possibilita o uso de um vetor vacinai vivo para o desenvolvimento de vacinas contra a salmonelose e outras doenças, com propriedades imunogênicas próprias, já que as linhagens atenuadas desenvolvidas podem ser empregadas na entrega de antigenos heterólogos ao sistema imune do hospedeiro .  As can be seen, the present invention enables the use of a live vaccine vector for the development of vaccines against salmonellosis and other diseases having their own immunogenic properties, since the developed attenuated strains may be employed in the delivery of heterologous antigens to the immune system. of the host.
Adicionalmente, a presente invenção possibilita a utilização como vacina viva para induzir proteção contra salmonelose; um potencial uso como vetor vacinai multifatorial , ou seja, as linhagens atenuadas podem expressar antigenos de outras doenças; alem da utilização na terapia contra o câncer. Additionally, the present invention enables use as a live vaccine to induce protection against salmonellosis; potential use as a multifactorial vaccine vector, ie attenuated strains may express antigens from other diseases; beyond use in cancer therapy.
Salmonella entérica vem sendo utilizada como agente biológico no tratamento de alguns tipos de tumores sólidos. Isso porque esta bactéria apresenta tropismo para massas tumorais. O tratamento de diferentes tumores com S. entérica tem resultado em diminuição ou mesmo desaparecimento da massa tumoral . No entanto, para este tipo de emprego, a linhagem deve ser atenuada. Assim, as linhagens mutantes desenvolvidas da presente invenção apresentam o potencial de serem utilizadas na terapia de tumores. No entanto, estudos específicos são necessários para verificar este potencial e indicar outras modificações nas linhagens de S. entérica que eventualmente sejam necessárias .  Enteric salmonella has been used as a biological agent in the treatment of some types of solid tumors. This is because this bacterium presents tropism for tumor masses. Treatment of different tumors with S. enteric has resulted in a decrease or even disappearance of the tumor mass. However, for this type of employment, lineage must be attenuated. Thus, the developed mutant strains of the present invention have the potential to be used in tumor therapy. However, specific studies are needed to verify this potential and to indicate other modifications in S. enterica strains that may be necessary.
A linhagem duplo mutante ( 662S AhupAAhupB) ainda apresenta a vantagem adicional de menor probabilidade de reversão da atenuação para os níveis de patogenicidade da linhagem selvagem, já que dois genes foram nocauteados. Essa vantagem não está presente em linhagens com mutação única, já que a reaquisição do gene perdido poderia recuperar a virulência total da linhagem.  The double mutant strain (662S AhupAAhupB) still has the added advantage of a lower probability of reversal of attenuation to pathogenicity levels of the wild strain, since two genes were knocked out. This advantage is not present in single mutated strains, as reacquisition of the lost gene could restore the total virulence of the strand.
A presente invenção tem utilização como vacina viva para induzir proteção contra salmonelose ou como potencial uso como vetor vacinai multifatorial, ou seja, as linhagens atenuadas podem expressar antígenos de outros patógenos.The present invention has use as a live vaccine to induce protection against salmonellosis or as potential use as a multifactorial vaccine vector, i.e. attenuated may express antigens from other pathogens.
Adicionalmente a presente invenção pode ser utilizada na terapia contra o câncer. Salihonella entérica vem sendo utilizada como agente biológico no tratamento de alguns tipos de tumores sólidos. Isso porque esta bactéria apresenta tropismo para massas tumorais. O tratamento de diferentes tumores com S. entérica tem resultado em diminuição ou mesmo desaparecimento da massa tumoral . No entanto, para este tipo de emprego, a linhagem deve ser atenuada. Assim, as linhagens mutantes desenvolvidas da presente invenção apresentam o potencial de serem utilizadas na terapia de tumores. Additionally the present invention may be used in cancer therapy. Salihonella enterica has been used as a biological agent in the treatment of some types of solid tumors. This is because this bacterium presents tropism for tumor masses. Treatment of different tumors with S. enteric has resulted in a decrease or even disappearance of the tumor mass. However, for this type of employment, lineage must be attenuated. Thus, the developed mutant strains of the present invention have the potential to be used in tumor therapy.
Assim, embora tenham sido mostradas apenas algumas modalidades da presente invenção, será entendido que várias omissões, substituições e alterações no processo de construção da linhagem atenuada de Salmonella entérica podem ser feitas por um técnico versado no assunto, sem se afastar do espirito e escopo da presente invenção.  Thus, while only a few embodiments of the present invention have been shown, it will be appreciated that various omissions, substitutions and alterations in the process of constructing the attenuated enteric Salmonella strain can be made by one of ordinary skill in the art without departing from the spirit and scope of the invention. present invention.
É expressamente previsto que todas as combinações dos elementos que desempenham a mesma função substancialmente da mesma forma para alcançar os mesmos resultados estão dentro do escopo da invenção. Substituições de elementos de uma modalidade descrita para outro são também totalmente pretendidos e contemplados. Também é preciso entender que. os desenhos não estão necessariamente em escala, mas que eles são apenas de natureza conceituai. A intenção é, portanto, ser limitada, tal como indicado pelo escopo das reivindicações anexas. Referências It is expressly provided that all combinations of elements that perform the same function in substantially the same way to achieve the same results are within the scope of the invention. Substitutions of elements from one described embodiment to another are also fully intended and contemplated. You also need to understand that. The drawings are not necessarily to scale, but that they are only of a conceptual nature. The intent is therefore to be limited as indicated by the scope of the appended claims. References
> Ali-Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A.  > Ali-Azam T, Iwata A, Nishimura A, Ueda S, Ishihama A.
1999.Growth phase-dependent variation in protein composition of the Escherichia coli nucleoid. J Bacteriol 181: 6361-70.  1999.Growth phase-dependent variation in protein composition of the Escherichia coli nucleoid. J Bacteriol 181: 6361-70.
> Alpuche-Aranda CM, Racoosin EL, Swanson JA, Miller SI.  > Alpuche-Aranda CM, Racoosin EL, Swanson JA, Miller SI.
1994. Salmonella stimulate macrophage macropinocytosis and persist within spacious phagosomes. J Exp Med. 179: 601-8.  1994. Salmonella stimulate macrophage macropinocytosis and persist within spacious phagosomes. J Exp Med. 179: 601-8.
> Atkins HS, Morton M, Griffin KF, Stokes MG, Nataro JP, Titball RW. 2006. Recombinant Salmonella vaccines for biodefence. Vaccine. 24: 2710-7.  Atkins HS, Morton M, Griffin KF, Stokes MG, Nataro JP, Titball RW. 2006. Recombinant Salmonella vaccines for biodefence. Vaccine. 24: 2710-7.
> Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. 2007. Current Protocols in Molecular Biology. John Wiley & Sons, Inc, Hoboken, NJ, USA.  > Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K. 2007. Current Protocols in Molecular Biology. John Wiley & Sons, Inc, Hoboken, NJ, USA.
> Bâumler AJ, Tsolis RM, Ficht TA, Adams LG. 1998.  > AJ Bâumler, Tsolis RM, Ficht TA, LG Adams. 1998
Evolution of host adaptation in Salmonella entérica . Infect Immun. 66:4579-87. > Berger M, Farcas A, Geertz M, et al. 2009. Coordination of genomics structure and transcription by the main bacterial nucleoid-associated protein HU. EMBO reports. ll(l):59-64. Evolution of host adaptation in enteric Salmonella. Infect Immun. 66: 4579-87. > Berger M, Farcas A, Geertz M, et al. 2009. Coordination of genomics structure and transcription by the main bacterial nucleoid-associated protein HU. EMBO reports. 11 (1): 59-64.
> Bi H, Sun L, Fukamachi T, Saito H, Kobayashi H. 2009. > Bi H, Sun L, Fukamachi T, Saito H, Kobayashi H. 2009.
HU Participates in Expression of a Specific Set of Genes Required for Growth and Survival at Acidic pH in Escheríchía coli. Curr. Microbiol .58 : 443-8.  HU Participates in Expression of a Specific Set of Genes Required for Growth and Survival at Acidic pH in Escheríchía coli. Curr. Microbiol. 58: 443-8.
> Boyd EF, Wang FS, Whittam TS, Selander RK. 1996.  > Boyd EF, Wang FS, Whittam TS, Selander RK. 1996
Molecular genetic relationships of salmonellae . Appl Molecular genetic relationships of salmonellae. Appl
Envion Microbiol. 62: 804-8. Envion Microbiol. 62: 804-8.
> Boyle EC, Bishop JL, Grassi GA, Finlay B.B. 2007.  > Boyle EC, Bishop JL, Grassi GA, Finlay B.B. 2007.
Salmonella: from pathogenesis to therapeutics . J Bacteriol. 189: 1489- 95.  Salmonella: from pathogenesis to therapeutics. J Bacteriol. 189: 1489-95.
> Bueno SM, González PA, Kalergis AM. 2009. Use of genetically modified bactéria to modulate adaptive immunity. Curr Gene Ther. 9: 171-84. > Bueno SM, Gonzalez PA, Kalergis AM. 2009. Use of genetically modified bacteria to modulate adaptive immunity. Curr Gene Ther. 9: 171-84.
Cárdenas L, Clements JD. 1992. Oral immunization using live attenuated Salmonella spp. as carriers of foreign antigens. Clin Microbiol Rev. 5: 328-42.  Cárdenas L, Clements JD. 1992. Oral immunization using live attenuated Salmonella spp. carriers of foreign antigens. Clin Microbiol Rev. 5: 328-42.
> Cheminay C, Hensel M. 2008. Rational design of Salmonella recombinant vaccines. International Journal of Medicai Microbiology. 298:87-98. > Coburn B, Grassi GA, Finlay BB. 2007. Salmonella, the host and disease: a brief revie . Immunol Cell Biol . 85: 112-8. > Cheminay C, Hensel M. 2008. Rational design of Salmonella recombinant vaccines. International Journal of Medical Microbiology. 298: 87-98. > Coburn B, Grassi GA, Finlay BB. 2007. Salmonella, the host and disease: a brief review. Immunol Cell Biol. 85: 112-8.
> Cróinín TO e Dorman CJ. 2007. Expression of the Fis protein is sustained in late-exponential- and stationary-phase cultures of Salmonella entérica serovar Typhimurium grown in the absence of aeration. Mol Microbiol 66: 237-51.  > Cróinín TO and Dorman CJ. 2007. Expression of the Fis protein is sustained in late-exponential- and stationary-phase cultures of serovar enteric Salmonella Typhimurium grown in the absence of aeration. Mol Microbiol 66: 237-51.
> Curtiss R, Galan JE, Nakayama K, Kelly SM. 1990.  > Curtiss R, Galan JE, Nakayama K, Kelly SM. nineteen ninety.
Stabilization of recombinant avirulent vaccine strains in vivo. Res Microbiol. 141: 797-805.  Stabilization of recombinant avirulent vaccine strains in vivo. Res Microbiol. 141: 797-805.
> Curtiss R, Kelly SM. 1987. Salmonella typhimurium deletion mutants lacking adenylate cyclase and cyclic AMP receptor protein are avirulent and immunogenic. Infect Immun. 55:3035-43.  > Curtiss R, Kelly SM. 1987. Salmonella typhimurium deletion mutants lacking adenylate cyclase and cyclic AMP receptor protein are avirulent and immunogenic. Infect Immun. 55: 3035-43.
> Datsenko KA, Wanner BL. 2000. One-step inactivation of chromossomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sei USA 97: 6640-5.  > Datsenko KA, Wanner BL. 2000. One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products. Proc Natl Acad Sci USA 97: 6640-5.
> Darwin KH, Miller VL. 1999. Molecular basis of the interaction of Salmonella with the intestinal mucosa. > Darwin KH, Miller VL. 1999. Molecular basis of the interaction of Salmonella with the intestinal mucosa.
Clin Microbiol Rev 12: 405- 28. Clin Microbiol Rev 12: 405-28.
> Dorman CJ. 2009. Nucleoid-associated proteins and bacterial physiology. Adv Appl Microbiol. 67: 47-64. > Dorman CJ, Kane KA. 2009. DNA bridging and antibridging : a role for bacterial nucleoid-associated proteins in regulating the expression of laterally acquired genes. FEMS Microbiol Rev. 33:5 87-92. > Dorman CJ. 2009. Nucleoid-associated proteins and bacterial physiology. Adv Appl Microbiol. 67: 47-64. > Dorman CJ, Kane KA. 2009. DNA bridging and antibridging: a role for bacterial nucleoid-associated proteins in regulating the expression of laterally acquired genes. FEMS Microbiol Rev. 33: 5 87-92.
> Dorman CJ, Danino V, Cróinín TO, Hinton JCD. 2006. The integration host factor (IHF) integrates stationary- phase and virulence gene expression in Salmonella entérica serovar Typhimurium. Mol Microbiol. 59: 1831- 47.  > Dorman CJ, Danino V, Crinoin TO, Hinton JCD. 2006. The integration host factor (IHF) integrates stationary phase and virulence gene expression in enteric Salmonella serovar Typhimurium. Mol Microbiol. 59: 1831-47.
> Drlica K, Rouviere-Yaniv J. 1987. Histonalike proteins of bactéria. Microbiol Rev. 51: 301-19.  > Drlica K, Rouviere-Yaniv J. 1987. Histonalike proteins of bacteria. Microbiol Rev. 51: 301-19.
> Dunstan SJ, Simmons CP, Strugnell RA. 2003. In vitro and in vivo stability of recombinant plasmids in a vaccine strain of Salmonella entérica var. Typhimurium. FEMS Immunol Med Microbiol. 186: 240-5. > Dunstan SJ, Simmons CP, Strugnell RA. 2003. In vitro and in vivo stability of recombinant plasmids in a vaccine strain of enteric Salmonella var. Typhimurium. FEMS Immunol Med Microbiol. 186: 240-5.
> Everest P, Frankel, G, Li J, Lund P, Chatfield S, Dougan G. 1995. Expression of LacZ from the htrA, nirB and groE promoters in a Salmonella vaccine strain: influence of growth in mammalian cells. FEMS Microbiol Lett. 37: 111-9. > Everest P, Frankel, G, Li J, Lund P, Chatfield S, Dougan G. 1995. Expression of LacZ from the htrA, nirB and groE promoters in a Salmonella vaccine strain: influence of growth in mammalian cells. FEMS Microbiol Lett. 37: 111-9.
> Fahlen TF, Mathur N, Jones BD. 2000. Identification and characterization of mutants ith increased expression of hilA, the invasion gene transcriptional activator of Salmonella typhimurium. FEMS Immunology & Medicai Microbiology. 28:25-35. Fahlen TF, Mathur N, Jones BD. 2000. Identification and characterization of mutants with increased expression of hilA, the transcriptional gene invasion activator of Salmonella typhimurium. FEMS Immunology & Medical Microbiology. 28: 25-35.
Fernandes SA, Tavechio AT, Ghilardi AC, Dias AM, Almeida IA, Melo LC. 2006. Salmonella serovars isolated from humans in Sao Paulo State, Brazil, 1996- 2003. Rev Inst Med Trop São Paulo. 48: 179-84.  Fernandes SA, Tavechio AT, Ghilardi AC, Days AM, Almeida IA, Melo LC. 2006. Salmonella serovars isolated from humans in Sao Paulo State, Brazil, 1996-2003. Rev Inst Med Trop Sao Paulo. 48: 179-84.
> Figueroa-Ochoa IM, Verdugo Rodriguez A. 2005.  > Figueroa-Ochoa IM, Verdugo Rodriguez A. 2005.
Molecular mechanism for pathogenicity of Salmonella sp. Rev Latinoam Microbiol. 47: 25-42.  Molecular mechanism for pathogenicity of Salmonella sp. Rev Latinoam Microbiol. 47: 25-42.
Germanier R, Fiirer E. 1983. Characteristics of the attenuated oral vaccine strain "S. typhi" Ty 21a. Dev Germanier R, Fiirer E. 1983. Characteristics of the attenuated oral vaccine strain "S. typhi" Ty 21a. Dev
. Biol Stand. 53: 3-7. . Biol Stand. 53: 3-7.
> Galen JE, Pasetti MF, Tennant S, Ruiz-Olvera P, Sztein MB, Levine MM. 2009. Salmonella entérica serovar Typhi live vector vaccines finally come of age. Immunol Celi Biol. 87: 400-12.  > Galen JE, Pasetti MF, Tennant S, Ruiz-Olvera P, Sztein MB, Levine MM. 2009. Serovar enteric salmonella Typhi live vector vaccines finally come of age. Immunol Celi Biol. 87: 400-12.
> Ghilardi AC, Tavechio AT, Fernandes SA. 2006.  > Ghilardi AC, Tavechio AT, Fernandes SA. 2006
Antimicrobial susceptibility, phage types, and pulsetypes of Salmonella Typhimurium, in São Paulo, Brazil. Mem Inst. Oswaldo Cruz. 101: 281-6.  Antimicrobial susceptibility, phage types, and pulsetypes of Salmonella Typhimurium, in São Paulo, Brazil. Mem Inst. Oswaldo Cruz. 101: 281-6.
> Graham SM. 2002. Salmonellosis . in children in developing and developed countries and populations . Curr Opin Infect Dis. 15: 507-12. Guzman CA, et al. 2006. Vaccines against typhoid fever. Vaccine. 24: 3804-11. > Graham SM. 2002. Salmonellosis. in children in developing and developed countries and populations. Curr Opin Infect Dis. 15: 507-12. Guzman CA, et al. 2006. Vaccines against typhoid fever. Vaccine. 24: 3804-11.
> Higgins NP, Hillyard DR. 1988. Primary Structure and Mapping of the hupA Gene of Salmonella typhimurium. Gene. 170:5751-8.  > Higgins NP, Hillyard DR. 1988. Primary Structure and Mapping of the hupA Gene of Salmonella typhimurium. Gene. 170: 5751-8.
Hofer E, dos Reis EM. 1994. Salmonella serovars in food poisoning episodes recorded in Brazil from 1982 to 1991. Rev Inst Med Trop São Paulo. 36:7-9.  Hofer E, of the Kings EM. 1994. Salmonella serovars in food poisoning episodes recorded in Brazil from 1982 to 1991. Rev Inst Med Trop São Paulo. 36: 7-9.
Hohmann EL, Oletta CA, Killeen KP, Miller SI. 1996. phoP/phoQ-deleted Salmonella typhi (Ty800) is a safe and immunogenic single-dose typhoid fever vaccine in volunteers. J Infect Dis. 173: 1408-14.  Hohmann EL, Oletta CA, Killeen KP, Miller SI. 1996. phoP / phoQ-deleted Salmonella typhi (Ty800) is a safe and immunogenic single-dose typhoid fever vaccine in volunteers. J Infect Dis. 173: 1408-14.
> Hone D, Attridge S., van den Bosch L, Hackett J. 1988.  > Hone D, Attridge S., van den Bosch L., Hackett J. 1988.
A chromosomal integration system for stabilisation of heterologous genes in Salmonella based vaccine strains. Microb Pathog. 5: 407-18.  A chromosomal integration system for stabilization of heterologous genes in Salmonella based vaccine strains. Microb Pathog. 5: 407-18.
> Jones BD, Ghori N, Falko S. 1994. Salmonella. typhimurium initiates murine infection by penetrating and destroyng specializes ephitelial M cells of the Peyer's patches. J. Exp. Med. 180: 15-23.  > Jones BD, Ghori N, Falko S. 1994. Salmonella. typhimurium initiates murine infection by penetrating and destroying ephitelial specialists M cells of the Peyer's patches. J. Exp. Med. 180: 15-23.
Kelly A, Goldberg MD, Carroll RK, Danino V, Hinton JC, Dorman CJ. 2004. A global role for Fis in the transcriptional control of metabolism and type III secretion in Salmonella entérica serovar Typhimurium. Microbiology. 150: 2037-53. Kelly A. Goldberg MD Carroll RK Danino V Hinton JC Dorman CJ. 2004. A global role for Fis in the transcriptional control of metabolism and type III secretion in Salmonella enteric serovar Typhimurium. Microbiology. 150: 2037-53.
> Kwon YM, Cox MM, Calhoun LN. 2007. Salmonella-based vaccines for infectious diseases. Expert Rev Vaccines. 6: 147-52.  > Kwon YM, Cox MM, Calhoun LN. 2007. Salmonella-based vaccines for infectious diseases. Expert Rev Vaccines. 6: 147-52.
> Loessner H, Endmann A, Leschner S, Bauer H, Zelmer A, Zur Lage S, estphal K, Weiss S. 2008. Improving live attenuated bacterial carriers for vaccination and therapy. Int J Med Microbiol. 298: 21-6.  > Loessner H, Endmann A, Leschner S, Bauer H, Zelmer A, Zur Lage S, Staph K, Weiss S. 2008. Improving live attenuated bacterial carriers for vaccination and therapy. Int J Med Microbiol. 298: 21-6.
Mahoney RT, Krattiger A, Clemens JD, Curtiss R. 2007. The introduction of new vaccines into developing countries. IV: Global Access Strategies. Vaccine. 25: 4003-11. Mangan MW, Lucchini S, O Croinin T, Fitzgerald S, Hinton JC, Dorman CJ. 2011. The nucleoid associated protein HU contrls three regulons that coordinate virulence, response to stress and general physiology in Salmonella entérica serovar Typhimurium. Microbiology. 157: 1075 - 1087.  Mahoney RT, Krattiger A, Clemens JD, Curtiss R. 2007. The introduction of new vaccines into developing countries. IV: Global Access Strategies. Vaccine. 25: 4003-11. Mangan MW, Lucchini S, Croinin T, Fitzgerald S, Hinton JC, Dorman CJ. 2011. The nucleus associated protein HU controls three regulators that coordinate virulence, stress response and general physiology in Salmonella enteric serovar Typhimurium. Microbiology. 157: 1075-1087.
> Marshall DG, Haque A, Fowler R, Del Guidice G, Dorman CJ, Douglas G, Bowe F. 2000. Use of the stationary phase inducible promoters, spv and dps, to drive heterologous antigen expression in Salmonella vaccine strains. Vaccine. 18: 1298-306. > Marshall DG, Haque A, Fowler R, Del Guidice G, Dorman CJ, Douglas G, Bowe F. 2000. Use of the inducible stationary phase promoters, spv and dps, to drive heterologous antigen expression in Salmonella vaccine strains. Vaccine. 18: 1298-306.
> Mastroeni P, Maskell D . 2006. Salmonella infections:  > Mastroeni P, Maskell D. 2006. Salmonella infections:
Clinicai, immunological and molecular aspects . Io ed, Cambridge University Press, Cambridge, UK. Clinical, immunological and molecular aspects. I ed, Cambridge University Press, Cambridge, UK.
> Pinson V, Takahashi M, Rouviere-Yaniv J. 1999.  > Pinson V, Takahashi M., Rouviere-Yaniv J. 1999.
Differential binding of the Escherichia coli HU, homodimeric forms and heterodimeric form to linear, gapped and cruciform DNA. J Mol Biol . 287: 485-97. Differential binding of the Escherichia coli HU, homodimeric forms and heterodimeric form to linear, gapped and cruciform DNA. J Mol Biol. 287: 485-97.
> Salyers AA, Whitt DD. 2002. Bacterial Pathogenesis . A Molecular Approach. 2nd ed. ASM Press, Washington, DC.> Salyers AA, Whitt DD. 2002. Bacterial Pathogenesis. The Molecular Approach. 2 nd ed. ASM Press, Washington, DC.
> Sambrook J. Russell D.W. 2001. Molecular cloning: a Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. > 2001. Sambrook J Russell DW Molecular Cloning: A Laboratory Manual, 3rd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
> Schechter LM, Jain S, Akbar S, Lee CA. 2003. The Small Nucleoid-Binding Proteins HNS, HU and Fis Affect hilA Expression in Salmonella entérica Serovar Typhimurium. American Society for Microbiology. 71:5432-5.  > Schechter LM, Jain S, Akbar S, Lee CA. 2003. The Small Nucleoid-Binding Proteins HNS, HU and Fis Affect hilA Expression in enteric Salmonella Serovar Typhimurium. American Society for Microbiology. 71: 5432-5.
> Strugnell RA, Wijburg LC. 2006. Ne er vaccines against typhoid fever and gastrointestinal salmonelloses . In: Salmonella infections: Clinicai, immunological and molecular aspects. Ed. Mastroeni P, Maskell D. Io ed, Cambridge University Press, Cambridge, UK, pp. 323-36.> Strugnell RA, Wijburg LC. 2006. No vaccines against typhoid fever and gastrointestinal salmonellosis. In: Salmonella infections: Clinical, immunological and molecular aspects. Ed. Mastroeni P, D. Maskell I ed, Cambridge University Press, Cambridge, UK, pp. 323-36.
> Strugnell RA, Maskell D, Fairweather N, Pickard D, Cockayne A, Penn C, Dougan G. 1990. Stable expression of foreign antigens from the chromosome of Salmonella typhimurium vaccine strains . Gene . 88: 57-63. > Strugnell RA, Maskell D, Fairweather N, Pickard D, Cockayne A, Penn C., Dougan G. 1990. Stable expression of foreign antigens from the chromosome of Salmonella typhimurium vaccine strains. Gene 88: 57-63.
> Swinger KK, Rice-Phoebe AR. 2004. IHF and HU: flexible architects of bent DNA. Curr Opin Struct Biol. 14: 28- 35.  > Swinger KK, Rice-Phoebe AR. 2004. IHF and HU: flexible architects of bent DNA. Curr Opin Struct Biol. 14: 28-35.
> Tacket CO, et al. 1997. Safety of live oral Salmonella typhi vaccine strains with deletions in htrA and aroC aroD and immune response in humans. Infect Immun. 65: 452-6.  > Tacket CO, et al. 1997. Safety of live oral Salmonella typhi vaccine strains with deletions in htrA and aroC aroD and immune response in humans. Infect Immun. 65: 452-6.
> Thanbichler M, Wang SC, Shapiro L. 2005. The Bacterial Nucleoid: A Highly Organized and Dynamic Structure. J Celi Biochem. 96: 506-21.  > Thanbichler M, Wang SC, Shapiro L. 2005. The Bacterial Nucleoid: A Highly Organized and Dynamic Structure. J Celi Biochem. 96: 506-21.
Wagner R. 2000. Transcription regulation in prokaryotes. 1° ed, Cambridge University Press, Cambridge, UK.  Wagner R. 2000. Transcription regulation in prokaryotes. 1st ed, Cambridge University Press, Cambridge, UK.
> Welkos S, 0'brien A. 1994. Determination of median lethal and infectious doses in animal model systems. Methods Enzymol. 235: 29-39.  Welkos S, O'Brien A. 1994. Determination of median lethal and infectious doses in animal model systems. Methods Enzymol. 235: 29-39.
Woc-Colburn L, Bobak DA. 2009. The expanding spectrum of disease due to salmonella: an international perspective. Curr Infect Dis Rep. 11: 120-4.  Woc-Colburn L. Bobak DA. 2009. The expanding spectrum of disease due to salmonella: an international perspective. Curr Infect Dis Rep. 11: 120-4.

Claims

REINVIDICAÇÕES
1. Processo de construção de linhagem atenuada mutante de uma bactéria patogênica caracterizado pelo fato de gue compreendem as seguintes etapas:  1. Process of constructing mutated attenuated lineage of a pathogenic bacterium characterized by the fact that it comprises the following steps:
a) expressão das proteínas Gam, Bet e Exo do bacteriófago λ presentes no plasmídeo pKD46, promovendo a recombinação de fragmentos lineares no DNA alvo;  a) expression of bacteriophage λ Gam, Bet and Exo proteins present in plasmid pKD46, promoting recombination of linear fragments into target DNA;
b) troca alélica do gene codificador de HU pelo cassete de recombinação compreendendo um gene acessório; e c) eliminação do gene acessório presente no cassete de recombinação .  b) allelic exchange of the HU encoding gene by the recombination cassette comprising an accessory gene; and c) deletion of the accessory gene present in the recombination cassette.
2. .Processo, de acordo com a reivindicação 1, caracterizado pelo fato de gue a bactéria patogênica é selecionado do grupo compreendido por Enterobacteriaceae, Vibrionaceae, Francisellaceae, Legionallales, Process according to Claim 1, characterized in that the pathogenic bacterium is selected from the group comprised of Enterobacteriaceae, Vibrionaceae, Francisellaceae, Legionallales,
Pseudomonadacea ou Pasteurellaceae, incluindo os géneros Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., e Vibrio spp Pseudomonadacea or Pasteurellaceae, including the genera Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., And Vibrio spp.
3. Processo, de acordo com a reivindicação 2, caracterizado pelo fato de gue a bactéria patogênica ainda ser escolhida dentre Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., e Vibrio spp.  Process according to Claim 2, characterized in that the pathogenic bacterium is still chosen from Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., And Vibrio spp.
4. Processo, de acordo com a reivindicação 3, caracterizada pelo fato de gue a bactéria patogênica é preferencialmente a bactéria S. entérica sorovar Typhimurium (ST662) . Process according to Claim 3, characterized in that the pathogenic bacterium is preferably S. enteric bacteria serovar Typhimurium (ST662).
5. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que o gene codificador de HU é uma sequência de DNA que apresenta homologia de pelo menos 80% com pelo menos uma sequência escolhida dentre hupA ou hupB.  Process according to Claim 1, characterized in that the HU-encoding gene is a DNA sequence which has at least 80% homology with at least one sequence chosen from hupA or hupB.
6. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que o cassete de recombinação, compreende pelo menos uma sequência capaz de silenciar pelo menos um gene codificador de HU em uma bactéria patogênica.  Process according to claim 1, characterized in that the recombination cassette comprises at least one sequence capable of silencing at least one HU coding gene in a pathogenic bacterium.
7. Processo, de acordo com a reivindicação 6, caracterizado pelo fato de que o cassete de recombinação é composto por iniciadores.  Process according to Claim 6, characterized in that the recombination cassette is composed of primers.
8. Processo, de acordo com a reivindicação 7, caracterizado pelo fato de que os referidos iniciadores possuem 2 (duas) partes continuas, sendo a primeira uma sequência de aproximadamente 40 bases . homólogas ao gene alvo e a segunda aproximadamente 20 bases homólogas a uma região presente nos plasmídeos a serem utilizados.  Process according to Claim 7, characterized in that said primers have 2 (two) continuous parts, the first one being a sequence of approximately 40 bases. homologous to the target gene and the second approximately 20 bases homologous to a region present in the plasmids to be used.
9. Processo, de acordo com a reivindicação 8, caracterizado pelo fato de que as regiões de homologia com o gene codificador de HU foram selecionadas a partir da sequência do banco de dados do projeto Genoma S. entérica (NC_003197) e escolhidas de modo que fossem próximas aos códons de iniciação e terminação do gene. Process according to claim 8, characterized in that the regions of homology to the HU coding gene have been selected from the sequence of the S. enteral Genome project database. (NC_003197) and chosen so that they are close to the gene initiation and termination codons.
10. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que para a geração do cassete de recombinação, sequências de aproximadamente 40 pb homólogas ao gene alvo são geradas nas extremidades desse módulo por PCR.  Process according to Claim 1, characterized in that for the generation of the recombination cassette, sequences of approximately 40 bp homologous to the target gene are generated at the ends of that module by PCR.
, ,
11. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que o cassete de recombinação é o módulo flanqueado por sequências homólogas ao gene alvo. Process according to Claim 1, characterized in that the recombination cassette is the module flanked by sequences homologous to the target gene.
12. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que os referidos genes acessórios podem ser genes de resistência a antibióticos.  Process according to claim 1, characterized in that said accessory genes may be antibiotic resistance genes.
13. Processo, de acordo com . a reivindicação 1, caracterizado pelo fato de que os antibióticos são selecionados dos grupos compreendidos por ampicilina, canamicina, cloramphenicol , estreptomicina e tetraciclina .  13. Process according to. claim 1, characterized in that the antibiotics are selected from the groups comprised of ampicillin, kanamycin, chloramphenicol, streptomycin and tetracycline.
14. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que para a geração de mutantes, o plasmideo pKD46 é transformado por eletroporação na linhagem hospedeira e os transformantes são submetidos à eletroporação com o cassete de recombinação.  Process according to claim 1, characterized in that for mutant generation, plasmid pKD46 is transformed by electroporation into the host lineage and transformants are electroporation with the recombination cassette.
15. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que a expressão dos genes γ, β e exo inibe a degradação da fita linear de DNA, permitindo a recombinação do cassete por recombinação homóloga. Process according to claim 1, characterized in that the expression of the genes γ, β and exo inhibits the degradation of the linear DNA strand, allowing cassette recombination by homologous recombination.
16. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que os recombinantes são selecionados utilizando-se as marcas de resistências carreadas pelo módulo de recombinação.  Process according to claim 1, characterized in that the recombinants are selected using the resistance marks carried by the recombination module.
17. Processo, de acordo com a reivindicação 16, caracterizado pelo fato de que a remoção do cassete de resistência é feito por uma enzima.  Process according to Claim 16, characterized in that the resistance cassette is removed by an enzyme.
18. Processo, de acordo com a reivindicação 17, caracterizado pelo fato de que a referida enzima é preferencialmente a FLP recombinase.  Process according to claim 17, characterized in that said enzyme is preferably FLP recombinase.
19. Processo, de acordo com a reivindicação 17 ou 18, caracterizado pelo fato de que a referida recombinase é expressa por um gene plasmidial.  Process according to claim 17 or 18, characterized in that said recombinase is expressed by a plasmid gene.
20. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que a transformação das linhagens selecionadas com o plasmideo foi realizada por eletroporação .  Process according to Claim 1, characterized in that the transformation of the selected strains with the plasmid was performed by electroporation.
21. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que gera uma linhagem duplo mutante .  Process according to claim 1, characterized in that it generates a double mutant lineage.
22. Processo, de acordo com a reivindicação 21, caracterizado pelo fato de que a referida linhagem duplo mutante e constituída por 662STAhupAÁhupB . Process according to claim 21, characterized in that said double lineage mutant and consisting of 662STAhupAÁhupB.
23. Processo, de acordo com a reivindicação 1 a 21, caracterizado pelo fato de que ainda apresenta uma menor probabilidade de reversão total da atenuação.  Process according to Claims 1 to 21, characterized in that it still has a lower probability of total reversal of attenuation.
24. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que o iniciador é composto por uma sequência homóloga a um gene codificador de HU.  Process according to claim 1, characterized in that the primer is composed of a sequence homologous to an HU coding gene.
25. Vetor vacinai caracterizado pelo fato de que o possui pelo menos um gene codificador de HU nocauteado e é capaz de estimular uma resposta imune contra uma infecção por uma bactéria patogênica.  25. Vaccine vector characterized in that it has at least one knockout HU coding gene and is capable of stimulating an immune response against infection by a pathogenic bacterium.
26. Vetor vacinai, de acordo com a reivindicação 26, caracterizado pelo fato da resposta imune ser humoral e/ou celular .  Vaccine vector according to claim 26, characterized in that the immune response is humoral and / or cellular.
27. Vetor vacinai, de acordo com a reivindicação 25, caracterizado pelo fato de que carrega antígenos, constituindo de linhagens vacinais multifatoriais .  Vaccine vector according to claim 25, characterized in that it carries antigens consisting of multifactorial vaccine strains.
28. Vacina conforme definida pelas reivindicações 1 a 27 caracterizada pelo fato de que compreender uma linhagem atenuada mutante de uma bactéria patogênica, onde . a atenuação corresponde à deleção de um ou ambos os genes codificadores de HU. Vaccine as defined by claims 1 to 27, characterized in that it comprises a mutated attenuated strain of a pathogenic bacterium, wherein . attenuation corresponds to the deletion of one or both of the HU coding genes.
29. Vacina, de acordo com a reivindicação 28, caracterizada pelo fato de que a bactéria patogênica é selecionada do grupo que compreende Enterobacteriaceae, Vibrionaceae, Francisellaceae, Legionallales,Vaccine according to claim 28, characterized in that the pathogenic bacterium is selected from the group comprising Enterobacteriaceae, Vibrionaceae, Francisellaceae, Legionallales,
Pseudomonadacea, Pasteurellaceae e combinações dos mesmos. Pseudomonadacea, Pasteurellaceae and combinations thereof.
30. Vacina, de acordo com as reivindicações 28 e 29, caracterizada pelo fato de que a bactéria patogênica é selecionada dentre Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., Vibrio spp e combinações das mesmas.  Vaccine according to claims 28 and 29, characterized in that the pathogenic bacterium is selected from Salmonella spp., Shigella spp., Escherichia spp., Yersinia spp., Vibrio spp and combinations thereof.
31. Vacina, de acordo com a reivindicação 30, caracterizada pelo fato de que a bactéria patogênica é preferencialmente S. entérica, sorovar Typhimurium (662ST) .  Vaccine according to claim 30, characterized in that the pathogenic bacterium is preferably S. enterica, serovar Typhimurium (662ST).
32. Vacina, de acordo com a reivindicação 28, caracterizada pelo fato de que o gene codificador de HU é uma sequência genômica que apresente homologia de pelo menos 80% com pelo menos uma sequência escolhida dentre hupA ou hupB.  Vaccine according to claim 28, characterized in that the HU-encoding gene is a genomic sequence showing at least 80% homology with at least one sequence chosen from hupA or hupB.
33. Uso da vacina conforme definido pelas reivindicações 28 a 32 caracterizado pelo fato de que é para induzir proteção contra doenças bacterianas.  Use of the vaccine as defined by claims 28 to 32 characterized in that it is to induce protection against bacterial diseases.
34. Uso, de acordo com a reivindicação 33, caracterizado pelo fato de que a referida doença bacteriana é preferencialmente salmonelose.  Use according to claim 33, characterized in that said bacterial disease is preferably salmonellosis.
35. Uso da vacina conforme definido pelas reivindicações 28 a 32 caracterizado pelo fato de ser como um potencial uso como vetor vacinai multifatorial expressando antigenos de outras doenças. Use of the vaccine as defined by claims 28 to 32 characterized in that it is as a potential use as a multifactorial vaccine vector expressing antigens from other diseases.
36. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que o duplo mutante AhupÃÁhupB com os primers hupBDT compreende a SEQ ID No. 1  A method according to claim 1, characterized in that the double mutant AhupAhupB with the hupBDT primers comprises SEQ ID No. 1.
37. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que o duplo mutante àhupAAhupB sequenciado com primer hupADT2f compreende a SEQ ID No. 2.  A method according to claim 1, characterized in that the hupAAhupB double mutant sequenced with hupADT2f primer comprises SEQ ID No. 2.
38. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que o duplo mutante ÁhupAAhupB sequenciado com o primer hupADT2r compreende a SEQ ID No. 3.  Process according to claim 1, characterized in that the double mutant ÁhupAAhupB sequenced with the hupADT2r primer comprises SEQ ID No. 3.
39. Processo, de acordo com a reivindicação 1, caracterizado pelo fato de que a sequência dos iniciadores externos aos genes hupA e hupB compreende as SEQ ID Nos 4, 5, 6, 7, 8 e 9.  A process according to claim 1, characterized in that the sequence of primers external to the hupA and hupB genes comprises SEQ ID Nos. 4, 5, 6, 7, 8 and 9.
PCT/BR2012/000059 2011-04-19 2012-03-07 Method for constructing an attenuated mutant strain of pathogenic bacteria, vaccine, vaccine vector and use of said vaccine WO2012142684A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
BRPI1102019-9 2011-04-19
BRPI1102019-9A BRPI1102019A2 (en) 2011-04-19 2011-04-19 construction process of mutant attenuated lineage of a pathogenic bacterium, vaccine, vaccine vector and use of said vaccine

Publications (1)

Publication Number Publication Date
WO2012142684A1 true WO2012142684A1 (en) 2012-10-26

Family

ID=47040985

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/BR2012/000059 WO2012142684A1 (en) 2011-04-19 2012-03-07 Method for constructing an attenuated mutant strain of pathogenic bacteria, vaccine, vaccine vector and use of said vaccine

Country Status (2)

Country Link
BR (1) BRPI1102019A2 (en)
WO (1) WO2012142684A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016113322A1 (en) * 2015-01-14 2016-07-21 Centre National De La Recherche Scientifique Genetically modified vibrio cholerae strains and uses thereof

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
BR102014030638B1 (en) * 2014-12-08 2022-12-06 Universidade Estadual De Campinas - Unicamp USE OF SALMONELLA ENTEICA TYPHIMURIUM LINE TO PREPARE VACCINE AGAINST SALMONELLOSIS

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998002523A1 (en) * 1996-07-17 1998-01-22 The Minister Of Agriculture Fisheries And Food In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain And Northern Ireland Vaccine preparations
WO2004056973A2 (en) * 2002-12-19 2004-07-08 E.I. Du Pont De Nemours And Company Method for chromosomal engineering
WO2012009774A2 (en) * 2010-07-22 2012-01-26 Hanna Ebert Seixas Recombinant microorganisms, methods for preparing vaccine strains, antigens, and vector vaccine compositions of same, uses thereof, and related antibodies, diagnostic kit, and treatment and/or prophylactic methods

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1998002523A1 (en) * 1996-07-17 1998-01-22 The Minister Of Agriculture Fisheries And Food In Her Britannic Majesty's Government Of The United Kingdom Of Great Britain And Northern Ireland Vaccine preparations
WO2004056973A2 (en) * 2002-12-19 2004-07-08 E.I. Du Pont De Nemours And Company Method for chromosomal engineering
WO2012009774A2 (en) * 2010-07-22 2012-01-26 Hanna Ebert Seixas Recombinant microorganisms, methods for preparing vaccine strains, antigens, and vector vaccine compositions of same, uses thereof, and related antibodies, diagnostic kit, and treatment and/or prophylactic methods

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
DATSENKO K.A. ET AL.: "One-step inactivation of chromosomal genes in Escherichia coli K-12 using PCR products", PNAS, 2000 *
LAYTON S.L.: "Development and evaluation of a novel low cost Salmonella vectored vaccine against viral and bacterial pathogens (Campylobacter)", DISSERTATIONS AND ABSTRACTS INTERNATIONAL, vol. 7101B, 2009, pages 212 *
MANGAN ET AL.: "Nucleoid-associated protein HU controls three regulons that coordinate virulence, response to stress and general physiology in Salmonella enterica serovar Typhimurium", MICROBIOLOGY, vol. 157, 2011, pages 1075 - 1087 *
POTEETE A: "What makes the bacteriophage lambda ed system useful for genetic engineering: molecular mechanism and biological function", FEMS MICROBIOLOGY LETTERS, vol. 201, 2001, pages 9 - 14, XP002992386 *
REYNOLDS M.M.: "Identification of novel virulence genes of Salmonella enterica using an Array based analysis of cystrons under selection", DISSERTATIONS AND ABSTRACTS INTERNATIONAL, vol. 7108B, 2010, pages 4610 *
TURNER ET AL.: "Identification of Salmonella typhimurium genes required for colonization of the chicken alimentary tract and for virulence in newly hatched chicks", INFECTION AND IMMUNIT, vol. 66, 1998, pages 2099 - 2106, XP002172457 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016113322A1 (en) * 2015-01-14 2016-07-21 Centre National De La Recherche Scientifique Genetically modified vibrio cholerae strains and uses thereof

Also Published As

Publication number Publication date
BRPI1102019A2 (en) 2013-06-25

Similar Documents

Publication Publication Date Title
US8889121B2 (en) Bacterium comprising a regulated rfaH nucleic acid
La Ragione et al. Efficacy of a live attenuated Escherichia coli O78∶ K80 vaccine in chickens and turkeys
JP2020019801A (en) Attenuated live vaccines
US11788056B2 (en) Induction of protective immunity against antigens
CA2372553C (en) Attenuated microorganisms for the treatment of infection
US11766475B2 (en) Food safety vaccine to control Salmonella enterica and reduce Campylobacter in poultry
US9309493B2 (en) Salmonella enterica presenting C. jejuni N-glycan or derivatives thereof
Choi et al. Generation of two auxotrophic genes knock-out Edwardsiella tarda and assessment of its potential as a combined vaccine in olive flounder (Paralichthys olivaceus)
EP2032687B1 (en) Salmonella enterica strains of reduced pathogenicity, method for their preparation and uses thereof
CN111182920B (en) Induction of protective immunity against antigens
WO2012142684A1 (en) Method for constructing an attenuated mutant strain of pathogenic bacteria, vaccine, vaccine vector and use of said vaccine
Zhao et al. Regulated delayed attenuation enhances the immunogenicity and protection provided by recombinant Salmonella enterica serovar Typhimurium vaccines expressing serovar Choleraesuis O-polysaccharides
BRPI0902944A2 (en) vaccines comprising attenuated strains, process of attenuated strains construction, vaccine vectors and their use in the treatment of salmonellosis
JP4705573B2 (en) Live attenuated bacterial vaccine
KR101774863B1 (en) Salmonella enteritidis mutant strains hid2092 and hid2114 and pharmaceutical composition using the same
KR20150143005A (en) rfaH mutated Salmonella typhimurium and a composition for food poisoning prevention using the same
WO2015021147A1 (en) Acid-resistant, attenuated microbial vector for improved oral delivery of multiple targeted antigens
BR132015007038E2 (en) process of building mutated attenuated lineage of a pathogenic bacterium, vaccine, vaccine vector and use of said vaccine
KR20140053475A (en) Rfah mutated salmonella typhimurium and a composition for food poisoning prevention using the same

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 12774436

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 12774436

Country of ref document: EP

Kind code of ref document: A1