WO2016107933A2

WO2016107933A2 - Materials and methods for the treatment of cancers

Info

Publication number: WO2016107933A2
Application number: PCT/EP2016/050037
Authority: WO
Inventors: Nigel Heaton; Varuna ALUVIHARE
Original assignee: Kings College Hospital, Nhs Foundation Trust
Priority date: 2015-01-02
Filing date: 2016-01-04
Publication date: 2016-07-07
Also published as: WO2016107933A3

Abstract

The invention provides agents which are capable of manipulating endogenous miRNAs present in cancer cells or modulating the levels of miRNAs in cancer cells such that the behaviour and growth of the cancer can be modified. The invention provides a method of treating cancer using a combination of miRNA-152 inhibition and miRNA 150 expression based on experimental data showing this combination leading to complete growth inhibition of multi-lineage cancers in vivo.

Description

Materials and Methods for the Treatment of Cancers Field of the Invention

The invention concerns materials and methods for treating cancer in a subject. Particularly, but not exclusively, the invention provides agents which are capable of manipulating endogenous miRNAs present in cancer cells or modulating the levels of miRNAs in cancer cells such that the behaviour and growth of the cancer can be modified.

Background of the Invention

Regenerative competence is highly species- and tissue-specific¹. Regulated cell proliferation is an effector mechanism of

regeneration, whilst dysregulated cell proliferation is a feature of cancer². Robust cell cycle checkpoints in higher eukaryotes may, as well as preventing cancer, limit regenerative capacity to organs like the liver³. Regeneration encompasses replacement of whole complex body parts or tissue however and cell proliferation is one component contributing to regenerative competence.

Although regenerative competence does not consistently correlate with organism complexity, in higher mammals this ability is restricted and the liver retains an unusual capacity amongst solid organs to regenerate⁵. Restricted regeneration in mammals has been partly attributed to the inability of fully differentiated, long- lived cells to enter cell cycle. Furthermore, robust cell cycle inhibitory pathways that control cancer development may restrict or promote regeneration in different setting^6,7. In a number of animal models, ubiquitous cell cycle promoters and inhibitors have been shown to augment or block regeneration respectively^8,9.

MiRNAs are non-coding RNAs of between 18 and 25 bases in length that occur within cells. They play an important role in regulating expression of various genes in vivo. One of the two strands of the mature miRNA forms a complex with the protein called an RNA induced suppressor complex (RISC) and binds mRNA of a target gene having a complementary sequence to thereby suppress the expression of the target gene.

The inventors have previously identified specific and distinct miRNAs that appear to regulate successful and failed human liver regeneration⁴. In agreement with data from animal models, this data indicated that down-regulation of a network of key miRNAs is important in determining regenerative outcome^10,11.

In particular the inventors identified miRNA-152 as down-regulated in failed liver generation cases. They further showed that reduced expression of miRNA-152 lead to increased expression of DNA methyltransferase I (DN Tl) which in turn leads to global DNA hypermethylation and aberrant gene expression resulting in inhibition of proliferation and regeneration⁴.

This finding is in part supported work carried out by Huang et al (Hepatology 2010; 52:60-70) . Huang et al investigated the role of miRNA-152 in hepatitis B virus (HBV) related hepatocellular carcinoma (HCC) . They showed that miRNA-152 was frequently down- regulated in HBV-related HCC tissue in comparison with adjacent non-cancerous tissue. They also showed that this was inversely correlated to DNMTl mRNA expression in HBV-related HCC which in turn lead to an increase in global DNA methylation. They concluded that miRNA-152 has a tumor suppressive role in HBV-related HCC based on the fact that their results suggested enhanced expression of miRNA-152 could reverse the malignant phenotypes of HCC cell lines. Accordingly, the authors proposed the use of miRNA-152 as a tumor suppressor in the treatment of HBV-related HCC.

Summary of the Invention

Following their work on liver regeneration, the inventors

hypothesised that those miRNAs that appeared to be regulators of cell regeneration may have a role in modifying tumor behaviour. In particular, the inventors decided to investigate whether those miRNAs e.g. miRNA-152 , miRNA-23a, miRNA-150 , miRNA-663 and miRNA- 503, which influenced failed or successful liver regeneration, i.e. were associated with a lack of cell proliferation, may likewise have a role in increasing or decreasing tumor cell proliferation.

Surprisingly, the inventors found that miRNAs associated with the regulation of human regeneration can radically alter cancer phenotype . More specifically, the inventors found that inhibition of miRNAs -503, -150, -663 and -23a, associated with successful liver regeneration, enhanced tumor proliferation in hepatocyte and non- hepatocyte derived cancers in vitro. They further found that miRNAs -23a and -503, alone or in combination, enhances tumor proliferation in hepatocyte and non-hepatocyte derived cancers in vitro, driving more aggressive tumor behaviour and de- differentiation in vivo.

Further, in contrast to the findings of Huang et al (Hepatology 2010; 52:60-70), the inventors found that inhibition of miRNA-152 (which is down-regulated during failed regeneration) caused growth inhibition of tumors in vitro and in vivo with reduced expression of a number of genes already known to be associated with cell proliferation and cancer, through site-specific methylation. The inventors further found that the combination of miRNA-152 inhibition and miRNA 150 expression led to complete growth

inhibition of multi-lineage cancers in vivo. These results indicate that regulation of regeneration and tumor aggressiveness are concordant and provide for the first time a novel treatment strategy for human cancers based on regulatory inhibitors of regeneration.

Accordingly, at its most general, the present invention provides materials and methods for the treatment of cancer by mimicking regulatory inhibitors of cellular regeneration. The inventors have shown that by modifying the levels of key miRNAs associated with successful and failed tissue regeneration,

corresponding alteration in the behaviour of tumor growth and de- differentiation can be seen both in vivo and in vitro. In

particular the inventors show that modification in expression levels of miRNAs -503, -23a, -150, -663 and -152 (up- or down- regulation) in cancer cells dramatically alters tumor growth and provides new opportunities for treating cancers, studying tumor behaviour, identification of drug targets, screening potential therapeutic agents and providing cancer models for research purposes .

Because miRNAs use their target genes to achieve their regulatory function, the inventors have also looked at changes in expression levels of other components in the miRNA signalling pathway and/or associated with cell proliferation. The inventors have observed that when miRNA-152 is down-regulated, i.e. using a miRNA-152 inhibitor, there is an increase in expression of cell cycle inhibitor p21 and Proxl along with a corresponding decrease in expression of CM2 and cyclin Dl .

However, the protein DMNTl showed the most significant alteration in expression levels in the presence of a miRNA-152 inhibitor. As DMNTl is known to cause hypermethylation the inventors looked at other changes in DNA methylation in the presence of miRNA-152 inhibitors. This resulted in the observation that tumors expressing miRNA-152 inhibitors (causing down-regulation of miRNA-152) have distinct methylation profiles when compared to tumors not

expressing the miRNA-152 inhibitor.

The inventors have further investigated whether site-specific hypermethylation induced by miRNA-152 down-regulation is linked to specific changes in gene expression in cancer in vivo. This investigation led to the identification of three genes, namely, Small nuclear ribonucleoprotein polypeptide N (SNRPN), WNK3 and Family with sequence similarity 3B (FAM3B) that demonstrated concordant CpG methylation and significantly reduced expression levels .

In addition, the inventors have surprisingly found that modulating the levels of the miRNA molecules in combination has a dramatically different effect than the effect seen when levels are modulated individually. For example, increasing the level of miRNA-150 in combination with a decrease in level of miRNA-152 has a

significantly greater effect than seen for each miRNAs alone (see Fig. 11) .

Accordingly, this new found knowledge into the regulatory function of specific miRNAs in tumor cells provides alternative materials and methods for treating cancers. Further, the identification of new targets within cancer cells allows screening assays to be developed for new therapeutic agents for the treatment of cancer. The manipulation of the specific miRNAs in tumor cells to alter the growth or behaviour of tumors provides an exciting opportunity for building tumor animal models for testing existing and new

therapeutic agents and combinations of such agents.

In a first aspect, the invention provides a method of treating cancer in a subject comprising administering an agent to said subject that is capable of modulating the level of an miRNA in said cancer cells or modulating a component of the signalling pathway for said miRNA, wherein said miRNA is selected from miRNA-152, miRNA-23a, miRNA-150, miRNA- 663 and miRNA-503 or combination thereof . In a preferred embodiment, the agent is capable of up-regulating

(i.e. increasing levels of) miRNA-23a, miRNA-150, miRNA-663 and/or miRNA-503. The agent may be a nucleic acid molecule, a protein, peptide, a peptide mimetic or any small molecule. The agent may be capable of increasing expression levels of the miRNA, or it may mimic the biological activity of the miRNA. Where the cancer cell expresses low levels of the miRNA or does not express the endogenous miRNA, the agent may be an exogenous version of the miRNA or a nucleic acid sequence encoding the miRNA molecule.

Further, the agent may be a nucleic acid molecule mimicking the miRNA in its stem loop form (pre-miRNA double-stranded form) . In one embodiment, the method may involve administering miRNA-23a, miRNA-150 , miRNA- 663 or miRNA-503, individually or a combination of two or more, or mimetics thereof in their biologically active form.

In a further embodiment, the agent is capable of down-regulating (i.e. decreasing levels of) miRNA-152 or altering the expression level or biological activity of a component in the miRNA-152 signalling pathway. Down-regulating miRNA-152 may involve

preventing the endogenous miRNA-152 from being expressed,

inhibiting the biological activity of the endogenous miRNA-152, e.g. by use of a complementary sequence which binds to the miRNA- 152 molecule, or by blocking binding of the endogenous miRNA-152 to its target mRNA, e.g. by use of a blocking agent such as a

complementary nucleic acid sequence, and antibody or fragment thereof, or a small molecule. Agents for down-regulating miRNAs are described in more detail below.

The method may include administering a plurality of agents which independently are able to modulate the level of miRNAs -23a, -503, -150, -663 and/or -152. In a preferred embodiment, a plurality of agents are administered, wherein at least one agent is capable of up-regulating miRNA-23a, miRNA-503, miRNA-663 or miRNA-150

(preferably miRNA-150) and wherein at least one agent is capable of down-regulating miRNA-152. The plurality of agents may be

administered simultaneously or sequentially at separate intervals. When administered simultaneously, the agents may be incorporated into a single pharmaceutical composition or into separate

compositions. As separate compositions, they may be administered via different routes but still as a combination therapy. For example, therapeutically effective amounts of the agents may each be administered on a different schedule. A first agent may be administered before the second agent as long as the time between the two administrations falls within a therapeutically effective interval, i.e. within the period beginning when the first agents is administered and ending at the limit of the beneficial effect in the treatment of the combination of the first and second agent.

The inventors have identified various components of the miRNA-152 signalling pathway which show altered expression levels in the presence of an miRNA-152 inhibitor. Such components include DNMTl, SNRPN, WNK3, FAM3B, p21, Proxl, MCM2 and cyclin Dl .

Accordingly, the first aspect of the invention further provides a method of treating cancer in a subject, said method comprising inhibiting miRNA-152 activity in said cancer. More preferably, the method comprises administering to a subject in need thereof an agent capable of modulating the miRNA-152 signalling pathway, wherein said agent is selected from the group consisting of

(i) an inhibitor of miRNA-152;

(ii) an agent capable of increasing expression of DNMTl;

(iii) DNMTl;

(iv) an inhibitor of SNRPN, WNK3, FAM3B; and

(v) a combination of two more selected from (i) to (iv) .

In this embodiment of the invention, the agent may inhibit

expression of the endogenous miRNA or interfere with its biological activity. Examples of such agents include antisense nucleic acid molecules (DNA or RNA) , siRNA molecule, small molecules or

antibodies or fragments thereof.

Preferably the inhibitors of the miRNA are anti-miRNAs which specifically inhibit endogenous miRNAs . Anti-miRNAs are single stranded nucleic acid molecules designed to specifically bind to and inhibit endogenous miRNA molecules. They have a nucleic acid sequence complementary to the sequence of the target miRNA. These anti-miRNAs may be introduced into cells using standard methods such as transfection (e.g. using vectors, such as viral vectors) or electroporation similar to that used for siRNAs . Known methods for inhibiting miRNA molecules include the use of modified anti-miRNA oligonucleotides (sometimes referred to as "antagomirs" or "blockmirs") . Different types of these modified molecules have been shown to inhibit specific endogenous miRNAs in vitro and in vivo. Examples include the modification of 2-OH residues of the ribose by 2'-0-methyl (2'-) Me), 2 ' -O-methoxyethyl (2'- OE) and locked nucleic acid (LNA) . Inhibition of miRNA function by anti-miRNA oligonucleotides is reviewed in Stenvang et al Silence 2012, 3:1, the contents of which are incorporated herein by reference.

Blockmirs are designed to bind an mRNA sequence that serves as binding site for the target miRNA by having a complementary sequence. It is believed that by blocking the binding of miRNA, degradation of the target mRNA by RISC is prevented. Therefore, the blockmir would act as an agonist for the mRNA target of the miRNA.

Accordingly in an embodiment of the invention, the inhibitor of miRNA-152 may be selected from

(i) antisense nucleic acid sequence capable of binding to miRNA-152;

(ii) siRNA molecule, mimic thereof, or precursor of both, capable of binding to miRNA-152 or a miRNA-152 target mRNA molecule;

(iii) a modified miRNA-152 molecule;

(iv) a nucleic acid molecule capable of binding to a miRNA-

152 target mRNA;

(v) an antibody or fragment thereof capable of binding to and/or blocking the activity of a miRNA-152.

An effective agent for down-regulating a miRNA is an indigestible RNA molecule which comprises a sequence with is complementary to the target miRNA molecule. These complementary RNA molecules are often called decoy RNAs or TuD RNAs (tough decoy RNAs) . See

Haraguchi et al (Nucleic Acids Research, 2009, 1-13), the contents of which are incorporated herein by reference. These decoy RNAs are preferably expressed by viral vectors such as lentiviral vectors in the cell and transported into the cytoplasm after transcription by RNA polymerase III.

In one embodiment, the miRNA inhibitor is an HIV-derived disabled lentiviral miRNA expression vector which expresses a miRNA

inhibitor construct which binds to its target miRNA, e.g. miRNA-152 thereby preventing it from subsequent gene regulation.

In a preferred embodiment of this first aspect of the invention, the method includes the use of first agent being an inhibitor of miRNA-152 in combination with a second agent being an inducer of miRNA-150, miRNA-150, a mimic of miRNA-150 or a precursor of said miRNA-150 or mimic thereof.

In certain embodiments, the agent (s) may be administered to the subject in combination with known chemotherapeutic therapeutics such as alkylating agents (e.g. chlorambucil, ifosfamide,

temozolomide) , antimetabolites (e.g. Capecitabine, Cytarabine, Gemcitabine, Pemetrexate) , Anti-tumor antibiotics (e.g.

Daunorubicin, Doxorubicin), Topoisomerase inhibitors (e.g.

topotecan, irinotecan) , Mitotic inhibitors (e.g. paclitaxel, ixabepilone, vinblastine, Vincristine), Corticosteroids (e.g.

Prednisolone, dexamethasone) and others such as cisplatin,

cyclophosphamide, Doxorubicin, imatinib, and bexarotene. In particular, the agent may be administered to the subject with known liver therapeutics such as Sorafenib (Bayer and Onyx

Pharmaceuticals) , Sunitinib (Pfizer) , Erlotinib (Roche) ,

Bevacizumab (Avastin - Roche) .

In a further preferred embodiment, the agent may be administered in combination with a biological chemotherapeutic. For example, including, but not limited to, immunotherapeutic agents (monoclonal and polyclonal antibodies or fragments thereof) or nucleic acid molecules (DNA, RNA, cDNA, mRNA, siRNA, miRNA) which can target the cancer cells directly. These are also referred to as targeted cancer therapies because they interfere with specific molecules involved in cancer cell growth and survival. This is a different approach to traditional chemotherapeutic which target rapidly dividing cells more generally.

It is envisaged that the therapeutic agent of the invention may be administered in combination (simultaneously or sequentially) with biological therapeutic including, but not limited to, monoclonal antibodies which usually target a membrane bound antigen (examples include Vemurafenib, trastuzumab (Herceptin™) , imatinib mesylate, Sorafenib (Nexavar™) , sunitinib (Sutent™) ) , and small-molecule compounds which usually bind intracellular targets. These may be hormone therapies, signal transduction inhibitors, gene expression modulator, apoptosis inducer, angiogenesis inhibitor,

immunotherapies and toxin delivery systems, examples of which will be known to the person skilled in the art.

The cancer to be treated is preferably a solid tumor, but could be any tumor including, but not limited to, liver cancer (e.g. HCC) , breast cancer, lung cancer, prostate cancer, colon cancer, stomach cancer, bladder cancer, lymphoma (non-Hodgkin and Hodgkin) , leukemia, bowel cancer, Bone cancer, Brain tumor (e.g.

astrocytomas) , cervical cancer, ovarian cancer, testicular cancer, Glioma, melanoma, myeloma, neuroblastoma, pancreatic cancer, thyroid cancer, sarcoma, squamous cell carcinoma, other forms of skin cancer, kidney cancer (renal cell carcinoma) . In a preferred embodiment, the cancer is liver cancer, such as HCC.

The subject is preferably a human subject.

In accordance with this first aspect of the invention, there is also provide an agent as described above for use in a method of treating cancer in a subject wherein said agent is capable of modulating the level of an miRNA in said cancer cells or modulating a component of the signalling pathway for said miRNA, wherein said miRNA is selected from miRNA-152 , miRNA-23a, miRNA-150 , miRNA-663 and miRNA-503.

The agent may be for use in a method of treating cancer in a subject in combination with one or more other chemotherapeutic or biological agents, such as those listed above.

In a further embodiment of the first aspect of the invention, there is provided a method for treating cancer in a subject by enhancing the growth of a tumor present in a subject by administering to said subject an agent capable of inhibiting the expression of one or more miRNA molecules selected from MiRNA-23a, miRNA-150, miRNA-663 and/or miRNA-503. It is recognised in the art that rapid growth of a tumor can result in spontaneous regression owing to lack of tumor blood supply, hypovasculation, intratumoral bleeding and/or hemorrhagic necrosis. Further, rapid growth of tumors makes them more susceptible to chemotherapeutic agents. Accordingly, it is preferable that the agents capable of inhibiting the expression of one or more miRNA molecules selected from iRNA-23a, miRNA-150, miRNA-663 and/or miRNA-503, are administered in combination with one or more other chemotherapeutic or biological therapeutics, such as those listed above.

In a second aspect of the invention, there is provided a

pharmaceutical composition comprising an agent, as described above capable of modulating a miRNA or a component of the miRNA

signalling pathway, said miRNA being selected from the group consisting of miRNA-23a, miRNA-503, miRNA-150, miRNA-663 and miRNA- 152, or a combination thereof. Preferably, the pharmaceutical composition is for treating cancer in a subject.

The agent may be an inhibitor capable of down-regulating the endogenous miRNA, or an inducer capable of up-regulating the endogenous miRNA. Where the agent is an inducer of the miRNA, it may be a nucleic acid molecule expressing the miRNA, e.g. miRNA- 23a, -503, -150 and/or -663, or it may be a compound capable of blocking an endogenous inhibitor of the miRNA, thereby preventing its elimination and extending its half-life within the cell.

In a preferred embodiment, the agent is a nucleic acid expressing miRNA-23a, -503, -150 and/or -663, which may be introduced into the cancer cell by methods well-known in the art such as

transformation, transduction, induction etc. The nucleic acid molecule may be introduced into the cell using an expression vector such as viral vectors, in particular lentiviral vectors. The sequence and sequence structure of miRNAs -23a, -503, -152, -150, and -663 are well-known in the art (see also Figs. 5 to 9) and the person skilled in the art is capable of developing expression vectors which may be used to express said miRNA molecules within the cell so as to up-regulate the miRNA molecule, or to express a complementary version of the miRNA molecule so as to down-regulate the miRNA molecule within the cell. Such inhibitory sequences are referred to in the art as miRNA-152i, for example.

A nucleic sequence (e.g. DNA) that codes for a miRNA gene may be longer than the miRNA. This DNA sequence includes the miRNA sequence and an approximate reverse complement. When this DNA sequence is transcribed into a single-stranded RNA molecule, the miRNA sequence and its reverse-complement base pair to form a partially double stranded RNA segment.

In an alternative embodiment, the miRNA molecule may be synthesised exogenously (outside of the cell, in vitro) and introduced directly into the cancer cell . Preferably the miRNA molecule comprises a partial sequence of miRNA-23a, -503, -152, -150, or -663, see for example Figs 5 to 9 which is capable of binding to, and silencing its target mRNA sequence. Modified nucleotide bases may be used in addition to the naturally occurring bases, as these may confer advantageous properties on the miRNA molecules containing them. For example, modified bases may increase the stability of the miRNA molecule, thereby reducing the amount required for silencing the miRNA target mRNA molecules. The term "modified nucleotide base" encompasses a change in the base itself, e.g. by substitution, deletion or addition, or by replacing the base with a covalently modified base or sugar, such as nucleotides having sugars which are covalently attached to low molecular weight organic groups other than a hydroxyl group at the 3' position and other than a phosphate group at the 5' position.

Accordingly, the second aspect of the invention includes miRNA molecules selected from miRNA-23a, -503, -150 and/or -663, or nucleic acid sequences expressing said miRNA molecules, for use in a method of treating cancer in a subject, by administering said miRNA molecules (or nucleic acid sequences expressing said miRNA molecules) to the subject, thereby allowing the miRNA molecules to be introduced into the cancer cells.

In a further embodiment of this aspect, the agent is an inhibitor of miRNA-152 (miRNA-152i) or a modulator (e.g. an inhibitor or inducer) of the expression or activity of a component in the miRNA- 152 signalling pathway.

In a preferred embodiment of this aspect of the invention, the pharmaceutical composition comprises a plurality of agents capable of modulating a combination of two or more miRNA molecules or components of the miRNA signalling pathway, said miRNA molecules being selected from miRNA-23a, miRNA-503, miRNA-150, miRNA- 663 and miRNA-152. Preferably the pharmaceutical composition comprises a first agent capable of modulating (e.g. down-regulating) the expression level of miRNA-152 (e.g. miRNA-152i) and a second agent capable of modulating (e.g. up-regulating) the expression level of miRNA-150. The agents may be provided in a single pharmaceutical composition or in different pharmaceutical compositions intended for use in combination.

In a third aspect of the invention, there is provided a method of preparing a pharmaceutical composition according to the second aspect. The method may comprise admixing the therapeutic agent with a pharmaceutical acceptable carrier.

The pharmaceutical composition of the invention may be in solid or liquid form, such as tablets capsules, powders, syrups, aerosols, solutions, formulations, suspensions or emulsions. Formulations for oral administration may be in solid form or aqueous solution or suspension. The aqueous solution or suspension may be made up from powder or granular forms. The therapeutic agents of the invention may be mixed with adjuvants well known in the art such as water, polyethylene glycol, propylene glycol, ethanol, various oils and/or various buffers.

In certain embodiments, the therapeutic agents are mixed with carriers that will prevent the compound from rapid elimination or degradation in vivo. Such carriers include controlled release formulations including various biocompatible polymers .

The pharmaceutical composition of the invention may also include delivery systems which deliver the therapeutic agent to the target cells, e.g. cancer cells. Suitable carriers include

pharmaceutically acceptable lipids and polymers, and combinations thereof. For example, the composition may have the form of liposomes, lipid vesicles, lipid complexes or polymer complexes.

In a preferred embodiment, the therapeutic agents of the invention may be included in a lipid vesicle delivery system. Liposomes are a spherical vesicles comprising a phospholipid bilayer that may be used as agents to deliver materials such as drugs or genetic material. Liposomes can be composed of naturally-derived

phospholipids with mixed lipid chains (egg

phosphatidylethanolamine) or of pure components like DOPE

(dioleolylphosphatidylethanolamine) . The synthesis and use of liposomes is now well established in the art. Liposomes are generally created by sonication of phospholipids in a suitable medium such as water. Low shear rates create multilamellar liposomes having multi-layered structures. Continued high-shear sonication tends to form smaller unilamellar liposomes.

Lipid complexes (or "lipoplexes" ) and polymer complexes

("polyplexes") typically contain positively charged lipids or polymers which interact with the negatively charged

oligonucleotides to form complexes.

The cationic polymers or lipids may also interact with negatively charged molecules at the surface of the target cells. By suitable choice of lipids and head groups, the complexes can be tailored to facilitate fusion with the plasma membrane of the target cell or with a selected internal membrane (such as the endosomal membrane or nuclear membrane) to facilitate delivery of the oligonucleotide cargo (e.g. miRNA) to the appropriate sub-cellular compartment. Gene delivery by lipoplexes and polyplexes is reviewed, for example, by Tros de Ilarduya et al. in Eur. J. Pharm. Sci. 40 (2010) 159-170.

Neutral lipid emulsions may also be used to form particulate complexes with miRNAs having diameters of the order of nanometers.

Research has also been able to enable liposomes to avoid detection by the immune system, for example by coating the lipsomes with polyethylene glycol (PEG) . It is also possible to incorporate species in liposomes, such as the therapeutic agents of the invention to help to target them to a delivery site, e.g. in cells or in vivo.

Appropriate lipids may be selected by the skilled person depending on the application, cargo (e.g. miRNA) and the target cell. Single lipids may be used, or, more commonly, combinations of lipids.

Suitable lipids are described, for example, in WO2011/088309 and references cited therein, and include: - neutral lipids and phospholipids, such as sphingomyelin, phosphatidylcholine, phosphatidylethanolamine , phosphatidylserine, phosphatidylinositol , phosphatidic acid, palmitoyloleoyl

phosphatdylcholine , lysophosphatidylcholine ,

lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, dilinoleoylphosphatidylcholine, phosphatidylcholine (PC), 1,2- Dioleoyl-sn-glycero-3-phosphocholine (DOPC) , lecithin,

phosphatidylethanolamine (PE), lysolecithin,

lysophosphatidylethanolamine, sphinogomyelin (SM) , cardiolipin, phosphosphatidic acid, 1, 2-Distearoyl-sn-glycero-3-phosphocholine (DSPC) , 1 , 2-Dipalmitoyl-sn-glycero-3-phosphoethanolamine (DPPE) , 1- Palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) , 1,2- Dilauroyl-sn-glycero-3-phosphocholine (DLPC) , 1, 2-Dimyristoyl-sn- glycero-3-phosphocholine (DMPC) , 1 , 2-Dipalmitoyl-sn-glycero-3- phosphocholine (DPPC) , 1 , 2-Dimyristoyl-sn-glycero-3- phosphoethanolamine (DMPE) , 1, 2-Dioleoyl-sn-glycero-3- phosphoethanolamine (DOPE) , dipalmitoloeoyl-PE, diphytanoyl-PE, DSPE, dielaidoyl-PE, dilinoleoyl-SM, and dilinoleoyl-PE;

- sterols, e.g. cholesterol

- polymer-modified lipids, e.g. polyethylene glycol (PEG) modified lipids, including PEG-modified phosphatidylethanolamine and phosphatidic acid, PEG-ceramide conjugates, PEG-modified

dialkylamines and PEG-modified 1 , 2-diacyloxypropan-3-amines .

Particularly suitable are PEG-modified diacylglycerols and

dialkylglycerols, e.g. PEG-didimyristoyl glycerol (PEG-DMG) PEG- distyryl glycerol (PEG-DSG) and PEG-carbamoyl-1 , 2- dimyristyloxypropylamine (PEG-cDMA) ;

- cationic lipids, such as N, N-dioleyl-N, N-dimethylammonium chloride ("DODAC") ; N- (2 , 3-dioleylox ) propyl-N, N-N-triethylammonium chloride ("DOTMA"); N, N-distearyl-N, N-dimethy1ammoniurabromide ( "DDAB" ) ; N- ( 2 , 3-dioleoyloxy) propyl ) -N, N, N-trimethylammonium chloride ("DOTAP") 1 , 2-Dioleyloxy-3-trimethylaminopropane chloride salt ("DOTAP.C1") ; 3β-(Ν-(Ν',Ν' -dimethylaminoethane) - carbamoyl) cholesterol ("DC-Choi") ,

N- (1- (2 , 3-dioleyloxy) propyl ) -N-2- ( sperminecarboxamido) ethyl ) -N, - dimethylammonium trifluoracetate ("DOSPA"), dioctadecylamidoglycyl carboxyspermine ("DOGS"), 1, 2-dileoyl-sn-3-phosphoethanolamine

("DOPE"), 1, 2-dioleoyl-3-dimethylammonium propane ( "DODAP" ) , N,N- dimethyl-2, 3-dioleyloxy) propylamine ("DODMA"), N-(l,2- dimyristyloxyprop-3-yl ) -N, N-dimethyl-N-hydroxyethyl ammonium bromide ("DMRIE"), 1 , 2-dilinoleyloxy-3-dimethylaminopropane

(DLinDMA) 1 , 2-Dilinoleoyl-3-dimethylaminopropane (DLinDAP) , 1-

Linoleoyl-2-linoeyloxy-3-dimethylaminopropane ( DLin-2-DMAP) , 1,2- Dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP) , 1,2- Dilinoleylthio-3-dimethylaminopropane (DLin-S-DMA) , and 2,2- Dilinoleyl-4-10 dimethylaminomethyl- [ 1 , 3 ] -dioxolane (DLin-K-DMA) . Commercial preparations of cationic lipids include Lipofectin™ (comprising DOTMA and DOPE, available from Gibco/BRL) , and

Lipofectamine™ (comprising DOSPA and DOPE, available from

Gibco/BRL) . - anionic lipids including phosphatidylglycerol , cardiolipin, diacylphosphatidylserine , diacylphosphatidic acid, N-dodecanoyl phosphatidylethanoloamine , N-succinyl phosphatidylethanolamine, N- glutaryl phosphatidylethanolamine and lysylphosphatidylglycerol. WO/0071096 describes different formulations, such as a

DOTAP : cholesterol or cholesterol derivative formulation that can effectively be used for oligonucleotide delivery.

A commercially available composition capable of achieving good delivery of miRNA is the neutral lipid emulsion MaxSuppressor in vivo RNALancerll (BIOO Scientific, Austin, TX) which consists of 1 , 2-dioleoyl-sn-glycero-3-phosphocholine, squalene oil, polysorbate 20 and an antioxidant. In complex with synthetic miRNAs, it forms nanoparticles in the nanometer diameter range. Suitable polymers include histones and protamines (and other DNA- binding proteins), poly (ethyleneimine) (PEI), cationic dendrimers such as polyamidoamine (PAMAM) dendrimers, 2-dimethyl (aminoethyl) methacrylate (pDMAEM) , poly (L-lysine) (PLL) , carbohydrate-based polymers such as chitosan, etc.. See Tros de Ilarduya et al . in Eur. J. Pharm. Sci . 40 (2010) 159-17 for a review.

Proteins and peptides such as atellocollagen can also be used.

Atellocollagen is a water soluble form of collagen produced by protease treatment, in particular pepsin-treated type I collagen from calf dermis.

Cyclodextrins may also be of use for delivery.

The use of nanoparticles as delivery agents for materials

associated with or bound to the nanoparticles is known in the art. Some types of nanoparticle comprises a core, often of metal and/or semiconductor atoms, to which ligands of one or more different types may be linked, including, for example, one or more of the agents of the present invention, or indeed miRNA molecules

themselves, see for example WO02/32404, WO2005/10816 and

WO2005/116226. Other types of nanoparticle may be formed from materials such as liposomes. In some instances, the nanoparticles may be derivatised or conjugated to other ligands may be present to provide the nanoparticles with different properties or functions. In some embodiments, the nanoparticles may be quantum dots, that is nanocrystals of semiconducting materials which have the striking chemical and physical properties that differ markedly from those of the bulk solid (see H. Gleiter, Adv. Mater. 1992, 4, 474-481) . Now that their quantum size effects are understood, fundamental and applied research on these systems has become increasingly popular. An interesting application is the use of nanocrystals as

luminescent labels for biological systems, see for example Brucher et al, Science 1998, 281, 2013-2016, Chan & Nie, Science, 1998, 281, 2016-2018, Mattousi et al, J. Am. Chem. Soc . , 2000, 122, 12142-12150, and A. P. Alivisatos, Pure Appl . Chem. 2000, 72, 3-9. The quantum dots have several advantages over conventional fluorescent dyes: quantum dots emit light at a variety of precise wavelengths depending on their size and have long luminescent lifetimes .

Liposomes have advanced over the years to include remote drug loading, extrusion for homogeneous size, long-circulating

(PEGylated) liposomes, triggered release liposomes, liposomes containing nucleic acid polymers, ligand-targeted liposomes and liposomes containing combinations of drugs. Liposomes or lipidic nanoparticles (LNPs) may be used to deliver the anti-cancer agents of the invention to the disease site. Solid lipid nanoparticles may also be used to deliver the therapeutic agents of the invention to the disease site.

Carrier molecules may also carry targeting agents capable of binding to the surface of the target cell. For example, the targeting agent may be a specific binding partner, capable of binding specifically to a molecule expressed on the surface of a target cell. Suitable binding partners include antibodies and the like, directed against cell surface molecules, or ligands or receptors for such cell surface molecules .

The term "specific binding pair" is used to describe a pair of molecules comprising a specific binding member (sbm) and a binding partner (bp) therefor which have particular specificity for each other and which in normal conditions bind to each other in

preference to binding to other molecules. Examples of specific binding pairs are antibodies and their cognate epitopes/antigens , ligands (such as hormones, etc.) and receptors, avidin/streptavidin and biotin, lectins and carbohydrates, and complementary nucleotide sequences .

It is well known that fragments of a whole antibody can perform the function of binding antigens. Examples of functional binding fragments are (i) the Fab fragment consisting of VL, VH, CL and CHI domains; (ii) the Fd fragment consisting of the VH and CHl domains; (iii) the Fv fragment consisting of the VL and VH domains of a single antibody; (iv) the dAb fragment (Ward, E.S. et al . , Nature 341, 544-546 (1989) ) which consists of a VH domain; (v) isolated CDR regions; (vi) F(ab')2 fragments, a bivalent fragment comprising two linked Fab fragments (vii) single chain Fv molecules (scFv) , wherein a VH domain and a VL domain are linked by a peptide linker which allows the two domains to associate to form an antigen binding site (Bird et al, Science, 242, 423-426, 1988; Huston et al, PNAS USA, 85, 5879-5883, 1988); (viii) bispecific single chain Fv dimers (PCT/US92/09965) and (ix) "diabodies", multivalent or multispecific fragments constructed by gene fusion (WO94/13804; P. Holliger et al Proc. Natl. Acad. Sci. USA 90 6444-6448, 1993) . As antibodies can be modified in a number of ways, the term

"antibody" should therefore be construed as covering any specific binding substance having a binding domain with the required specificity. Thus, this term covers the antibody fragments described above, as well as derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising an immunoglobulin binding domain, whether natural or synthetic.

Chimeric molecules comprising an immunoglobulin binding domain, or equivalent, fused to another polypeptide are therefore included. Cloning and expression of chimeric antibodies are described in EP- A-0120694 and EP-A-0125023.

Alternatives to antibodies are increasingly available. So-called "affinity proteins" or "engineered protein scaffolds" can routinely be tailored for affinity against a particular target. They are typically based on a non-immunoglobulin scaffold protein with a conformationally stable or rigid core, which has been modified to have affinity for the target. Modification may include replacement of one or more surface residues, and/or insertion of one or more residues at the surface of the scaffold protein. For example, a peptide with affinity for the target may be inserted into a surface loop of the scaffold protein or may replace part or all of a surface loop of the scaffold protein. Suitable scaffolds and their engineered equivalents include:

- BPTI, LAC-DI, ITI-D2 (Kunitz domain scaffolds) ;

- ETI-II, AGRP (Knottin) ;

- thioredoxin (peptide aptamer) ;

- Fn3 (AdNectin) ;

- lipocalin (BBP) (Anticalin) ;

- ankyrin repeat (DARPin) ;

- Z domain of protein A (Affibody) ;

- gamma-B-crystallin/ubiquitin (Affilin) ;

- LDLR-A-domain (Avimer) .

See, for example, Gebauer, M and Skerra, A, Current Op. Chem. Biol. 2009, 13: 245-255, and Friedman, M and Stahl, S, Biotechnol. Appl . Biochem. (2009) 53: 1-29, and references cited therein.

The pharmaceutical composition of the invention is formulated depending on its intended route of administration, e.g. parenteral

(intravenous, intradermal, subcutaneous, oral (inhalation), transdermal, transmucosal and rectal administration) . The

composition therefore may be prepared by admixing with one or more of the following components: a diluent (e.g. water), saline solutions, fixed oils, polyethylene glycols, synthetic solvents, chelating agents, and buffers. Other ingredients may be included to alter pH (such as acids or bases) or for the adjustment of tonicity

(such as salts or sugars) .

Pharmaceutically compatible binding agents, and/or adjuvants may be included in solid formulations. Solid formulations may additionally include binders such as cellulose or gelatin; excipients such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate; a glidant such as colloidal silicon dioxide; a sweetener and/or a flavouring agent. The pharmaceutical composition of the invention is preferably prepared in a dosage unit form for ease of administration and uniformity of dosage. Each unit preferably contains a predetermined quantity of the therapeutic agent calculated to produce the desired therapeutic effect in combination with a suitable carrier and optionally a delivery system.

The pharmaceutical composition of the invention may be provided in a container or other vessel and optionally may be accompanied with instructions for administration.

In a fourth aspect of the invention, there is provided a method of screening for therapeutic agents useful in the treatment of cancer in a subject, said method comprising the steps of contacting an miRNA selected from the group consisting of miRNA-23a, miRNA-503, miRNA-150, miRNA-663 and miRNA-152 with a test compound and determining whether the biological activity of the miRNA is altered in the presence of said compound as compared to its biological activity in the absence of said compound. The biological activity of the miRNA may be specific binding to an mRNA target molecule where the test compound prevents binding either directly (by interference with the miRNA molecule itself) or indirectly (e.g. by binding to the target mRNA molecule) . Alternatively, the biological activity of the miRNA may be

determined by measuring changes in a downstream events in the miRNA pathway, such as expression levels of a target mRNA, e.g. DNMT1. Likewise, biological activity may be altered by interfering with upstream events in miRNA biogenesis pathway thereby reducing the levels of mature miRNA. For example, the test compound may

interfere with the activity of Drosha (a class 2 RNase III enzyme) which is responsible for initiating the processing of miRNA by interacting with the RISC. Other compounds which participate in the miRNA biogenesis pathway are Pasha and Dicer and Argonaute enzymes. These may also be targets for the test compound. Preferably the screening method is carried out in vitro and the test compound is contacted with a cell, preferable a cancer cell, expressing the miRNA molecule. In a preferred embodiment, the cell is a liver cancer cell, e.g. from HepG2 cell line.

In an embodiment of this aspect of the invention, the test compound and/or the miRNA molecule may be coupled to a detectable label. The method may further use a known ligand of the miRNA (or a ligand of a component of the miRNA signalling pathway) where alteration of the biological activity of the miRNA molecule is determined by displacement of the ligand to the miRNA molecule (or component) in the presence of the test compound.

Screening methods are well known in the art. Assays may be designed where the miRNA or the test compound is fixed to a solid support.

The test compound may be a small molecule, preferably selected from polypeptide, peptide, nucleic acid molecule or other small molecule such as organic or inorganic compounds, salts, esters and other pharmaceutically acceptable forms thereof.

The method of the fourth aspect may further comprise selecting the test compound, determining its structure and providing said compound for use in treating cancer in a subject. The method may further comprise optimising the structure of the selected compound for use as a pharmaceutical and/or testing the compound for optimal pharmaceutical activity.

A test compound identified by the method of the fourth aspect may be formulated into a pharmaceutical composition for the treatment of cancer in a subject.

In a fifth aspect, there is provided a non-human animal cancer model for testing potential anti-cancer therapeutics, where said non-human animal cancer model has been treated with an agent capable of inhibiting the expression or activity of miRNA-23a, miRNA-150, miRNA-663 and/or miRNA-503. Non-human animal cancer models are well known in the art for testing potential therapeutic compounds. Non-human animal cancer models are used as they reflect the etiology and progression of the human cancer process. The inventors have determined that by treating said non-human animal cancer models with an agent which modifies miRNAs within the cancer cells, where the miRNAs are miRNA-23a, miRNA-150, miRNA-663 and/or miRNA503, the cancer cells will proliferate and grow thereby improving the environment for testing potential anti-cancer therapeutics. Accordingly, the invention provides a method for improving the screening potential of a non-human animal cancer model by treating said non-human animal with an agent capable of modifying the expression levels or activity of an miRNA, wherein said miRNA is miRNA-23a, miRNA-150, miRNA-663 and/or miRNA-503.

The invention further provides a non-human animal cancer model for testing the anti-cancer therapeutic potential of candidate

compounds, wherein said animal model has been treated with an agent capable of inhibiting the expression or activity of miRNA-23a, miRNA-150, miRNA-663 and/or miRNA-503.

The non-human animal model may be a mammalian laboratory animal species such as a rodent (e.g. mouse, rat, hamster), rabbit, cat, dog, pig or non-human primate.

The cancer cells may have been induced genetically (e.g. switching off tumor suppressor genes, switching on oncogenes and/or altering the animal genome to carry a mutation) or chemically (exposure to carcinogens) . Preferably the cancer cells may be introduced, e.g. sub-cutaneously, into the non-human animal model and allowed to proliferate. These are known as xenograft tumors. Preferably cells from a human cancer cell line are injected into the animal. In accordance with the invention the cells may be transduced with an agent inhibiting the activity of the miRNAs, for example a nucleic acid encoding an antisense sequence or decoy sequence which can be expressed in the cells allowing greater proliferation of the tumor. Numerous murine models have been developed to study human cancer. These models are used to investigate the factors involved in the development of the cancer but also to examine the response to therapy including therapeutic agents . The most common model is the human tumor xenograft where human tumor cells are transplanted (usually under the skin) into immunocompromised mice so that the cells are not rejected. Such mice include SCID mice and nude mice. An alternative non-human animal cancer model is a genetically engineered animal model. The genetic profile of the animal is modified such that one or more genes involved in transformation or malignancy are mutated, deleted or over-expressed. The result is tumor formation. In both of these examples, the invention will allow such non-human animal models to be improved by increasing the proliferation and growth of the tumor.

Aspects and embodiments of the present invention will now be illustrated, by way of example, with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text as incorporated herein by reference.

Figures

Figure 1 : Regeneration associated miRNA induce cell cycle in liver- and non-liver-derived cancers in vitro associated with expression of cell cycle inducers .

a: Fluorescence images of HepG2 cells transduced with scrambled control vector; miRNA-503 inhibitor and miRNA-23a inhibitor (i) ; Flow cytometry profiles showing transduced HepG2 cells compared to untransduced (■) cells. All constructs co-expressed m-Cherry; bar ( I 1 ) represents the proportion of positively transduced cells

(ii) ; Flow cytometry dot plots showing EdU incorporation in HepG2

(iii) HUH7 (iv) and in6 (v) cells. EdU positive cells represent proliferating cells.

b: qPCR showing expression of MC -2, cycline Dl, p21and Proxl, using RNA template from HepG2 cells transduced with scrambled vector (i) , miRNA- 23a inhibitor (ii) and miRNA-503 inhibitor (iii) , RNA extracted from Hepatocytes served as control (iv) , expression levels were normalized to scrambled control vector. qPCR data are representative of three different experiments. qPCR data on HUH7 and Min6 transduced cells are not shown.

Figure 2 Regeneration associated miRNA increased tumor aggression in vivo associated altered gene expression profiles .

a: Xenograft tumours generated by injecting 5xl0⁶ transduced cells with Scrambled vector, miRNA-503 inhibitor and miRNA- 23a inhibitor into both flanks of nude mice. Photos taken at day 20 from

developed tumours (i) live in-vivo imaging using Ll-Corimage machine showing m-Cherry expression in tumours (ii) .

b: Tumour Volume measurement: tumour volume calculated from the recorded successive tumours using calipers to measure the longest and shortest tumour diameters. The volume calculated as: d_a x d ²= Volume xlOOO ( d_a and d are the two tumor diameters in cm

respectively. Volume: *p≤0.05; **p<0.01; ***p≤0.001; p-values are relative to scrambled vector (i) , Xenograft tumour weights measured in nude mice at 20 days after injecting transduced cells expressing scrambled vector, mi-RNA -503 inhibitor and miRNA- 23a inhibitor tumour weight expressed in mg. Weight: *p≤0.05; ***p≤0.001; p- values are relative to scrambled vector; SE=standard error (ii) . c: Ki67 expression comparing ratio of Ki67 positive cells per 100 cells obtained from tumor tissues transduced with scrambled vector, miRNA-503 inhibitor or miRNA- 23a inhibitor.

d: gene expression profiles in xenograft tumours expressing scrambled vector, miRNA-503i or miRNA-23ai, using Affymetrix Gene 2 array. PCA (principle component analysis) shows complete

segregation of control vector-expressing tumors from tumors expressing miRNA-503i and miRNA-23ai whicg are closely related (i) ; the cladogram shown above heatmap demonstrates degree of

relatedness between samples by cDNA expression where line-length inversely correlates with similarity and heat map of cluster analysis showing cDNA expression for all 3 tumor groups (ii) . Figure 3: Inhibition of miRNA-152 prevented cell proliferation in cancer cell lines under selection

a: Fluorescence images of samples transduced with scrambled or miRNA-152 inhibitor in HepG2 cells (i) , Flow cytometry profiles showing transduced HepG2 cells compared to untransduced (■) cells,

All constructs co-expressed m-Cherry; bar ( j [ ) represents the proportion of positively transduced cells (ii) , Flow cytometry dot plots showing EdU incorporation in HepG2 cells transduced with scrambled or miRNA-152 inhibitor (iii) - b: qPCR showing expression of MCM-2 (i), cycline Dl (ii),

Proxl(iii) and p21 (iv) using RNA extracted from HepG2 cells transduced with miRNA-152 inhibitor or scrambled vector, RNA extracted from Hepatocytes served as control, expression levels were normalized to scrambled control vector. qPCR data are representative of three different experiments.

c: Comparing expression of DNMT1 using qPCR, in cells transduced and sorted with scrambled vector, miRNA -152 inhibitor or miRNA- 23ai. RNA from Kidney (positive control) and primary hepatocytes used as an additional control. DNMT1 expression is significantly elevated in cells expressing miRNA -152 inhibitor.

d: Methylation array: analysis of the total CpG methylation in cells transduced with scrambled or miRNA-152 inhibitor. The datasets are equivalent, overlapping and not skewed (3%

difference); box and whisker plot (i) , principle component analysis (PCA) of the degree of methylation at each CpG in the two datasets shows that the samples group by condition (ii) .

Figure 4

a: Xenograft tumours generated by injecting 5x10° transduced cells with scrambled vector or miRNA-152 inhibitor into both flanks of nude mice. Photos taken at day 30 of tumour development (i), live in-vivo imaging using Ll-Cor in-vivo image machine showing m-Cherry expression (ii) .

b: Tumour volume in mices injected with scrambled or miRNA 152 inhibitor. Tumour volume is calculated from the recorded

successive tumours using callipers to measure the longest and shortest tumour diameters. Volume was calculated as previously described (i) , Xenograft Tumor weights measured in nude mice 30 days after injecting transduced cells expressing scrambled vector or mi RNA-152 inhibitor as previously described (ii) .

c: Comparing gene expression using Affymetrix gene2 array in RNA extracted from xenograft tumours transduced with scrambled or miRNA-152 inhibitor. PCA shows complete segregation of 2 groups indicating differentially expressed genes within each group (i) , the cladogram shown above heatmap demonstrates degree of

relatedness and differences between samples by miRNA expression; line-length inversely with similarity (ii)

d: Expression of SNRPN, WNK3 , and FAM3B genes using qPCR,

expression levels of these genes are down-regulated as methylation level increases when comparing samples transduced with scrambled or miRNA -152 inhibitor. RNA from HUH7 cells served as additional control .

Figure 5

A: The stem-loop structure of pre-miRNA-152 ; B: The stem-loop sequence of pre-miRNA-152 ; C: the mature sequence of miRNA-152

Figure 6

A: The stem-loop structure of pre-miRNA-23a; B: The stem-loop sequence of pre-miRNA-23a; and C: The two mature sequences of human miRNA-23a (hsa-miRNA-23a-5p and hsa-miRNA-23a-3p ) .

Figure 7

A: The stem-loop structure of pre-miRNA-503 ; B: The stem-loop sequence of pre-miRNA-503; and C: The two mature sequences of human miRNA-503 (hsa-miRNA-503-5p and hsa-miRNA-503-3p ) .

Figure 8

A: The stem-loop structure of pre-miRNA-150 ; B: The stem-loop sequence of pre-miRNA-150 ; and C: The mature sequence of human miRNA-150 (hsa-miRNA-150-5p) . Figure 9

A: The stem-loop structure of pre-miRNA-663a and b; B: The stem- loop sequence of pre-miRNA-663a and b; and C: The mature sequence of human miRNA-663a and b (hsa-miRNA-663 ) .

Figure 10

i) Flow cytometry profiles showing transduced HepG2 cells (□) compared to untransduced (■) cells. HepG2 cells were infected with: (A) scrambled control vector; (B) miRNA 150 inhibitor or (C) miRNA

663 inhibitor, all constructs co-expressed mCherry; bar ( | 1 ) represents the proportion of positively transduced cells. (ii) Fluorescence images of samples A-C. (iii) Flow cytometry profiles showing EdU incorporation in transduced cells from A-C, EdU positive cells (□) represent proliferating cells. Results are representative of three independent experiments.

Figure 11

GeneGo ontogenic pathway analysis in tumours expressing miRNA-503i or miRNA-23ai, compared with tumours expressing control scrambled vector .

Figure 12

A) HepG2 cells transfected with miRNA constructs and selected then

5x106 cell inj ected/each side. B) Tumor Volume measurements for each contruct or combination per key:

C: Scrambled

G: miRNA 23a inhibitor

E: miRNA 503 inhibitor

H: miRNA 152 inhibitor

B: miRNA 150 expression clone

Figure 13

Inhibition of miRNAs induced cell proliferation in HepG2 cancer cell line under selection.

a: Fluorescence images of HepG2 cells transfected with scrambled control vector; miRNA-503 inhibitor , miRNA-23a inhibitor and miRNA23a/503 double inhibitor (i) , Flow cytometry profiles showing transfected HepG2 cells compared to untransfected (■) cells, all constructs co-expressed m-Cherry; bar (I 1) represents the proportion of positively transfected cells (ii) , Flow cytometry dot plots showing EdU incorporation in HepG2 cells transfected with scrambled and inhibitory constructs, EdU positive cells represent proliferating cells (iii) .

b: qPCR showing expression of MCM-2, cycline Dl, p21 and Proxl in (i) scrambled, (ii) miRNA503i, (iii) miRNA23ai, (iv) miRNA503i/23ai and (v) HepG2 cells. Expression levels were normalized to scrambled control vector.

Figure 14

a: Xenograft tumors generated by injecting 5xl0⁶ transfected cells with scrambled vector, miRNA-503i, miRNA23ai and miRNA

23ai/503i double inhibition vector into flanks of nude mice. Photos taken at day 15 from developed tumours (i) , tissue imaging using fluorescence microscope showing m-Cherry expression in tumours (ii) . b: Tumour Volume measurement: tumour volume calculated from the recorded successive tumours using callipers to measure the longest and shortest tumour diameters. The volume calculated as: (d_a x db²)/2 = Volume (d_a and d are the two tumour diameters in mm respectively. Volume: *p≤0.05; **p≤0.01; ***p≤0.001; p-values are relative to scrambled vector; SE=standard error; (i), Xenograft Tumor weights measured in nude mice at the end of experiment, Weight: *p≤0.05; **p≤0.01; p-values are relative to scrambled vector; SE + standard error (ii) .

Figure 15

Expression of miRNA -152 inhibitor, miRNA-150 and miRNA 150/152i double vector prevented cell proliferation in HepG2 cancer cell line under selection.

a: Fluorescence images of samples transfected with scrambled, miRNA-152 inhibitor, miRNA 150 and miRNA 150/152i in HepG2 cells (i) , Flow cytometry profiles showing transduced HepG2 cells compared to untransduced (■} cells. All constructs co-expressed m-Cherry or GFP; bar (I 1) represents the proportion of positively transfected cells (ii) , Flow cytometry dot plots showing EdU incorporation in HepG2 cells transfected with scrambled, miRNA -152i, miRNA 150 and miRNA 150/152i

b: Comparing Expression of MCM-2, p21, Proxl and cycline Dl using qPCR. RNA extracted from HepG2 cells transfected with scrambled vector (i) miRNA -152 inhibitor (ii), miRNA 150 clone (iii) and miRNA 150/152i (iv), HepG2 cells (v) used as control. Expression levels were normalized to scrambled control vector. qPCR data are

representative of three different experiments (i) .

ii: qPCR analysis of SNRPN, WNK3, and FAM3B genes, comparing samples transfected with scrambled (i) , miRNA -152 inhibitor (ii), miRNA 150 (iii) and miRNA 150/152i (iv) , HepG2 cells (v) used as control, (ii) qPCR evaluation of DNMT1 expression in HepG2 cells transfected with miRNA constructs. Kidney RNA used as positive control (iii) .

Figure 16

a: Xenograft tumors generated by injecting 5xl0⁶ transfected HepG2 cells with scrambled vector, miRNA -152 inhibitor, miRNA 150 clone and miRNA 150/1521 into flanks of nude mice.

Photos taken at the end of experiment (i) , tissue imaging using florescence microscope showing M-Cherry expression (ii) .

b: Tumor volume calculated from the recorded successive tumors using callipers to measure the longest and shortest tumor

diameters. The volume calculated as: (d_a x db²) /2 = Volume (d_a and db are the two tumour diameters in mm respectively), Volume ^*p≤0.05;

**p≤0.01; p-values are relative to scrambled vector; SE=standard error; (i) , Xenograft Tumor weights measured in nude mice at the end of experiment, Weight: *p≤0.05; **p≤0.01; p-values are relative to scrambled vector; SE=standard error (ii) .

Figure 17

Different form of showing WNK, FAM3 and SNRPN qPCR

Figure 18 Inhibition of miRNAs induced cell proliferation in RKO colon cancer cell lines under selection.

a: Fluorescence images of RKO cells transfected with scrambled control vector; miRNA -503 inhibitor, miRNA -23a inhibitor and miRNA23ai/503i double inhibitor (i) . Flow cytometry profiles showing transfected RKO compare to untransfected (■) cells (ii) .

All constructs co-expressed m-Cherry, bar (1 1) represents the proportion of positively transduced cells (ii) . Flow cytometry dot plots showing EdU incorporation in RKO cells transfected with scrambled, miRNA -23ai, miRNA 503i and miRNA 23ai/503i (iii) .

b: qPCR showing expression of MCM-2, cycline Dl, p21 and Proxl using RNA template from RKO cells transfected with (i) scrambled, (ii) miRNA23i, (iii) miRNA503i, (iv) miRNA23ai/503i , RNA from RKO cell lines served as control (V) . Expression levels were normalized to scrambled control vector.

Figure 19

a: Xenograft tumors generated by injecting 5xl0⁶ transfected cells with scrambled vector, miRNA -503 inhibitor, miRNA23a inhibitor and miRNA-23a/503 inhibitor into flanks of nude mice.

Photos taken at day 15 from developed tumours (ii) , tissue imaging using florescence microscope showing M-Cherry expression in tumours (ii) , in vivo imaging using IVIS in vivo imaging machine (iii) .

b: Tumor Volume measurement: tumor volume calculated from the recorded successive tumors using callipers to measure the longest and shortest tumor diameters. The volume calculated as : (d_a x do²) /2 = Volume, (d_a and d are the two tumour diameters in mm respectively), Volume: *p≤0.05; **p≤0.01; ***p≤0.001; p-values are relative to scrambled vector; SE=standard error; (i) Xenograft Tumor weights measured in nude mice at the end of experiment,

Weight: *p≤0.05; **p≤0.01; p-values are relative to scrambled vector; SE=standard error (ii) .

Figure 20

a: Expression of miRNA -152i, 150 and 150/152i prevented cell proliferation in RKO cancer cell lines under selection. (i) Fluorescence images of samples transfected with scrambled, miRNA-152 inhibitor, miRNA 150 clone and miRNA 150/152i double vector in RKO cells (ii) , Flow cytometry profiles showing

transfected transfected RKO cells compared to untransduced (Ί 1) cells . All constructs co-expressed m-Cherry or GFP; bar (■) represents the proportion of positively transfected cells, (iii) , Flow cytometry dot plots showing EdU incorporation in RKO cells transfected with scrambled, miRNA -152i, 150 and 150/152i.

b: Comparing Expression of MCM-2, p21, Proxl and

cycline Dl using qPCR, RNA extracted from RKO cells

transfected with scrambled vector (i) miRNA -152 inhibitor (ii), 150 clone (iii) and 150/152i double vector (iv) . Expression levels were normalized to scrambled control vector. RNA from RKO cell lines served as control for validation (V) . qPCR data are representative of three different experiments.

Figure 21

a: Xenograft tumors generated by injecting 5xl0⁶ transfected cells with scrambled vector, miRNA-152 inhibitor, miRNA 150 clone and miRNA 150/152i double vector into flanks of nude mice. Photos taken at the end of experiment (i) , tissue imaging using flurosence machine showing m-Cherry expression (ii) .

b: Tumor volume calculated from the recorded successive tumors using callipers to measure the longest and shortest tumour

diameters. The volume calculated as: (d_a x d_b ²) 12 = Volume (d_a and dt are the two tumor diameters in mm respectively) .

Volume: *p≤0.05; **p≤0.01; p-values are relative to scrambled vector; SE=standard error, (i) Xenograft Tumor weights measured in nude mice at the end of experiment (ii) , Weight: *p≤0.05; **p≤0.01; p-values are relative to scrambled vector; SE=standard error (ii) . (i) Xenograft Tumor weights measured in nude mice at the end of experiment (ii) .

c: qPCR showing differential expression of WNK, FAM3, and SNRPN in control (i), miRNA 152i (ii), miRNA 150 (iii), miRNA 152i/150 (iv) and RKO cell lines (V) . d: qPCR evaluation of DNMT1 expression in RKO cells transfected with miRNA constructs .

Figure 22

Different form of showing WNK, FAM3 and SNRPN qPCR Figure 23

A miArrest™ inhibitor vector (pEZX-AM02, Genecopoeia™, US) used for miRNA-152 , miRNA-503 and miRNA-23a containing an M-Cherry reporter gene, a puromycin selectable marker and a U6 promoter. B OmicsLink™ miRNA expression clone (PEZX-MR04, Genecopoeia™, US) was used to express miR-150 stem loop precursor, and contained GFP reporter gene, a puromycin selectable marker and CMV promoter.

Detailed Description

MicroRNAs (miRNAs) are a class of small naturally occurring non- coding RNAs (18-25 nucleotides) that regulate gene expression. The genes encoding microRNAs are much longer than the processed mature microRNAs. These genes can reside in either an exon or an intron of non-coding transcripts, or can be found in introns of protein- coding genes. Other microRNAs are clustered in the genome with an expression pattern that suggests transcription as polycistronic primary transcripts.

MicroRNAs are transcribed by RNA polymerase II as large RNA precursors called primary miRNAs (pri-miRNAs) . These pri-miRNAs can vary in length from several hundred to several thousand nucleotides and can encode for one or more microRNAs. These pri-miRNAs undergo nuclear cleavage by the microprocessor complex in which Drosha, an RNA II endonuclease and the double-stranded RNA binding protein DGCR8 (or Pascha) produce a 60-70 nucleotide long intermediate precursor microRNA (pre-miRNA) that has a stem-loop-like structure (see Figure 5) . The intermediate precursor is transported to the cytoplasm where it is further processed by Dicer, an RNase III endonuclease, to generate a mature microRNA duplex, which has 18-25 nucleotide length. From this mature microRNA duplex, only one strand is incorporated into the RNA-induced silencing complex (RISC) .

The RNA-induced silencing complex (RISC) is a ribonucleoprotein complex responsible for the miRNA-mediated negative regulation of gene expression. The RISC complex consists of the Argonaute proteins family members and of some accessory factors. Regulation of gene expression by RISC is mediated through interaction of the microRNAs with the Argonaute protein, which in turn guides the RISC complex to the target mRNAs and most favourably to the 3'- untranslated region. A microRNA can either inhibit translation or induce degradation of its target mRNAs and this depends primarily on the overall degree of complementary between the sequence of the microRNA and mRNAs. It is thought that the 7-8 nucleotides at the 5' - end of the microRNA is important in this interaction. This region is called the 'seed region', and must be exactly

complementary to the target mRNAs. The rest of the microRNA sequence can be partially or fully complementary to the sequence of the target mRNAs. It is further believed that the more

complementary the sequence between microRNA and the target mRNA is, the more likely the mRNA will be degraded. When there is no perfect complementation between microRNA and the target mRNAs-, then this leads to translation inhibition of mRNAs (Jackson et al 2007, Sci STKE 23:243-249) .

In all aspects of the invention, the term "modulator" refers to an agent which is capable of modulating the level of miRNA or a component of its biological pathway. Thus, a modulator may be an inducer of the miRNA molecule or component, or it may be an inhibitor of the miRNA molecule or component. Where the modulator is an inducer of the miRNA molecule, it may up-regulate expression of the miRNA molecule by increasing the levels at which the miRNA molecule is expressed or by preventing its elimination within the cell, e.g. by blocking an endogenous inhibitor. Further, the modulator may introduce the miRNA molecule into the cell where there is no endogenous miRNA molecules in the cells or where the endogenous miRNA levels are so low as to be insignificant. Thus, the modulator may cause endogenous miRNA to be expressed, or it introduce, or cause to be expressed, exogenous miRNA within the cell. Accordingly, the modulator may be a miRNA molecule for introduction into the cell.

Where the modulator is an inhibitor of the miRNA molecule, it may down-regulate the expression of the miRNA molecule or it may induce or up-regulate an endogenous inhibitor of the miRNA molecule. The inhibitor may be a compound which eliminates or substantially reduces the expression or activity of the miRNA, e.g. miRNA-152, or a component in the miRNA signalling pathway. By "substantially", it is contemplated that a reduction of at least 20%, 30%, 40%, 50% or 60% in expression or activity is achieved. The inhibitor may be an antisense DNA or RNA polynucleotide, an siRNA or an antibody or fragment thereof. In certain embodiments the inhibitors of miRNAs are anti-miRNAs which specifically inhibit endogenous miRNAs. Anti- miRNAs are single stranded nucleic acids designed to specifically bind to and inhibit endogenous miRNA molecules. Anti-miRNAs have nucleic acid sequences which specifically bind to the sequence of the target miRNA. Preferably these nucleic acid sequences are at least 75%, 80%, 85%, 95% identical to the complementary sequence of the target miRNA. In a preferred embodiment the anti-miRNA

comprises a sequence having 100% identity with the target miRNA, e.g. miRNA-152 (see Figure 5), miRNA-23a, miRNA-503, miRNA- 663 or miRNA-150 (see Figure 6, 7, 8 and 9) . In a preferred embodiment, the anti-miRNA molecule has 100% identity with the seed region of the miRNA molecule, more preferably 100% identity with the 7 or 8 nucleotides at the 5' -end of the miRNA molecule. The remaining sequence may have an identity of at least 75%, 80%, 85%, 95%, or 100%.

These inhibitors can be introduced into cells using transfection or electroporation parameters similar to those used for siRNAs. Use of the anti-miRNA enables down-regulation of miRNA activity. Many anti-miRNAs are commercially available such as synthetic miRNA inhibitors or lentiviral miRNA inhibitors (Haraguchi et al, Nucleic Acids Research 2009; 37) . Lentiviral miRNA inhibitors allow potent inhibition of desired mRNA and provide an efficient delivery of the inhibitor into a wide variety of cell types including cancer cells. Lentiviral miRNA inhibitors also allow long-term inhibition thereby avoiding repeat transfections or allowing a longer duration between transfections .

The lentiviral vector preferably comprises a miRNA inhibitor cassette which allows the miRNA inhibitor to be expressed following genomic integration of the lentiviral transfer vector into the host-cell post transduction. Expression of the miRNA inhibitor may be under the control of a promoter such as the hU6 promoter. miRNA inhibitors work by competitively binding specific endogenous miRNAs (e.g. miRNA-152) and preventing them from regulating their

endogenous targets .

Nucleic acid sequences encoding miRNAs (i.e. miRNA-152, miRNA-23a, miRNA- 150 , miRNA-663 and/or miRNA-503) or their complementary sequence, have many applications according to the present

invention. They may be used as therapeutic agents for treating cancer, e.g. a nucleic acid encoding the complementary sequence of miRNA-152, or the nucleic acid sequence encoding miRNA-23a, miRNA- 503, miRNA-150, or miRNA-663. They further be used to as

hybridisation probes, as oligomers for techniques such as PCR, for use in the generation of antisense DNA or RNA, their chemical analogs and so on.

These nucleic acid sequences may be included within cloning vectors such as plasmids, cosmids, lambda phage, phagemids etc.

The nucleic acid sequences may be prepared by methods already known to the skilled person. This may include aspects of synthetic chemistry. The nucleic acid sequence may then be inserted into a DNA vector and consequently a host cell using techniques well known in the art. These vectors and host cells for further embodiments of the invention and may be used in the treatment of cancer in a subject. Expression vectors which may be used in accordance with the invention include those derived from retroviruses,

adenoviruses, herpes or vaccinia virus, or from various bacterial plasmids . In a preferred embodiment, the expression vector is a lentiviral vector.

The inventors have taken the miRNA expression changes determined in liver regeneration studies and recapitulated these changes in tumors in order to investigate their effect on tumor behaviour. The inventor found that those changes in expression levels associated with successful regeneration drive more aggressive tumor behaviour. Conversely those expression levels linked to failed regeneration can inhibit tumor growth both in vitro and in vivo.

More specifically, the inventors investigated the influence of the miRNAs -150 -503, -663 and -23a, which they observed to be

downregulated during liver regeneration, on tumor behaviour in vitro. They transduced the model human liver cancer cell line HepG2 with lentiviral vectors interfering with the function of miRNA-503 (miRNA-503i) and -23a (miRNA-23ai) . Homogeneous and high expressing transduced populations were obtained under selection, as confirmed by flow cytometry and immunofluorescence (Figure 1). Proliferation was assessed using EdU ( 5-ethynyl-2 ^' -deoxyuridine ) incorporated during DNA synthesis and compared to proliferation in cells transduced with a scrambled control vector. In contrast to a proliferation index of 25.6% in cells transduced with control vector, cells expressing miRNA-503i and miRNA-23ai demonstrated a proliferation index of 69.6% and 74.3% respectively, representing a proliferation increase of approximately 300% over 5 hours. The inventors also observed changes in expression of minichromosome maintenance gene 2 (MCM2) and Cylcin Dl, both robust markers of cell cycle progression¹². In contrast expression of cell cycle inhibitors p21 and Proxl was reduced¹³. In order to investigate whether the observed differences in proliferative rate were cell type specific the inventors transduced HuH, another hepatocellular carcinoma cell line, with miRNA-503i and miRNA-23ai. Here, proliferation increased from 26% for control vector transduced cells to 45.7% and 52.9% respectively for cells expressing miRNA- 503i and miRNA-23ai. MCM2 expression was again consistent with increased proliferation but in contrast to HepG2, the expression levels of the cell cycle inhibitors p21 and Proxl were also increased. The inventors further tested whether their observations were restricted to cells derived from hepatocellular lineage by transducing the human pancreatic islet cell derived cancer cell line Min6. They observed that background proliferation of 42.4% increased to 84.5% and 87.2% for miRNA-503i and miRNA-23ai

expressing cells respectively. This was accompanied by increased expression of C 2 and reduced expression of p21/Proxl. Inhibitors of miRNA-150 and miRNA-663 (miRNA-150i and miRNA-663i), that were also downregulated in liver regeneration, caused comparable increases in cell proliferation in HepG2 cells in vitro (Figure 11) -

The inventors next investigated whether the changes in

proliferative rate they observed in vitro were associated with more aggressive tumor behaviour in vivo using a heterotopic xenograft model. Nude mice were injected in both flanks with pure populations of HuH cells expressing control vector, miRNA-503i or miRNA-23ai. These were assessed from time of injection for growth kinetics using tumor volume measurement and final tumor weight at the termination of the experiment (day 20) . The inventors observed a clear distinction in rate of growth between cells expressing control vector and those expressing miRNA-503i or miRNA-23ai as early as day 5 and this difference became more accentuated at later time points. Furthermore, at later time points a difference emerged between cells expressing miRNA-503i and miRNA-23ai, with the former consistently demonstrating more aggressive growth characteristics . The final tumor weight at day 20 corroborated the volumetric data, showing clear segregation between cells expressing control vector and those expressing miRNA-503i or miRNA-23ai. They also

corroborated differential growth between cells expressing miRNA- 503i and miRNA-23ai. At experiment termination the tumors were explanted and analysed by histology and immunohistochemistry . Ki67 immunostaining and quantification for proliferative index again confirmed significantly increased proliferation in tumors

expressing miRNA-503i or miRNA-23ai when compared to those

expressing controlled vector (P < 0.001).

In order to further delineate changes in gene expression induced by expression of miRNA-503i and miRNA-23ai, Affymetrix Human Gene 2.0 ST microarray based cDNA expression analysis was carried out.

Changes in cDNA expression were characterised using cluster analysis and PCA, which confirmed that tumors expressing miRNA-503i or miRNA-23ai had gene expression profiles that were distinct from tumor cells expressing control vector. The cladogram demonstrates that these profiles also shared more commonality with each other than with the gene expression profile in tumor cells expressing control vector. Analysis of this differential gene expression through GeneGo ontogenic pathway analysis revealed a preponderance of statistically significant pathways regulating cell cycle, cytoskeletal remodelling, cell adhesion and epithelial-mesenchymal transition in tumors expressing miRNA-503i and miRNA-23ai¹⁴ (Figure 12) .

The inventors had previously described key miRNA that appear to regulate failed liver regeneration. Amongst these, down regulation of miRNA 152 was notable and this miRNA, through regulation of DNA methyltransferase 1 (DNMT 1) is known to cause hypermethylation, aberrant gene expression and cell cycle inhibition¹¹⁵. The inventors therefore transduced HuH cells with lentiviral vector interfering with the function of miRNA-152 (miRNA-152 i ) and established stable expression through selection. When compared to cells expressing control vector that demonstrated a background proliferation rate of 26% over 5 hours, cells expressing miRNA-152i showed a

proliferation rate of 7.1% over the same period. Furthermore, these cells showed increased expression of the cell cycle inhibitors p21 and Prox 1, in association with reduced expression of MCM2 and Cylcin Dl, when compared to primary hepatocytes and cells expressing control vector. In addition, whilst cells expressing miRNA-152i demonstrated high-level gene expression of the key target gene DNMT1, this was not observed in HUH cells not

expressing miRNA-152i, cells expressing control vector, primary hepatocytes and those expressing miRNA-23ai. The inventors next investigated whether the miRNA-152i driven changes in DNMT1 expression they observed altered DNA methylation using Illumina Infinium Human Methylation 450K arrays. Analysis of global

methylation revealed that mean methylation at all CpG sites for tumors expressing control vector was 52%, compared to 48.5% for tumors expressing miRNA-152i. However, more detailed analysis revealed significant and site specific increased methylation in cells expressing miRNA-152i (Figure 3) . PCA analysis confirmed that tumors expressing miRNA-152i had distinct methylation profiles when compared to tumors expressing control vector.

In order to investigate whether these in vitro observations led to changes in tumor behaviour in vivo, the inventors used the

heterotopic xenograft model described previously. Here the

inventors observed that cells expressing miRNA-152i showed a significant impairment in tumor growth by volumetric measurement and tumor weight. In the majority of experiments the injected cell failed to grow up to 30 days post-injection. Gene expression analysis comparing tumors expressing control vector and miRNA-152i demonstrated significant differential gene expression by cluster analysis and PCA. The inventors therefore investigated whether the site-specific hypermethylation induced by miRNA-152i they

identified in vitro could be correlated with specific changes in gene expression from the same cancers in vivo. The inventors identified 3 genes, Small nuclear ribonucleoprotein polypeptide N (SNRPN) , WNK3 and Family with sequence similarity 3B (FAM3B) that demonstrated concordant CpG methylation and significantly reduced expression by gene array. The inventors confirmed reduced

expression of these 3 genes by quantitative PCR (Figure 4d) . The inventors determined that regulation of human liver regeneration requires coordinated changes in expression of multiple miRNA. Furthermore, on testing individual miRNA in different human cancer cell lines, the inventors observed cell line dependent incomplete inhibition of cell proliferation in vitro. The inventors therefore developed lentiviral vectors capable of co-expressing combinations of miRNA associated with regeneration. Expression of miRNA-503i or miRNA-23ai individually in HepG2 (See Figure 13) , led to a modest increase in cell cycle progression in vitro when compared to control vector, associated with increased expression of cell cyclin Dl and CM2. Co-expression of miRNA-503i and miRNA-23ai in the same cells led to a >100% increase in cell cycle in HepG2 (see Figure 13) . This was corroborated in vivo when adoptive transfer led to a significant increase in rate of tumor growth and tumor weight in tumors co-expressing miRNA-503i and miRNA-23ai (See Figure 14) . Expression miRNA-152i or miRNA-150 individually did not lead to a significant reduction in cell proliferation (see Figure 15) . However, co-expression led to a more significant inhibition of proliferation. This was associated with augmented inhibition cell cycle genes and increased expression of cell cycle inhibitors (see Figure 15) . Furthermore, whilst HepG2 cells expressing miRNA-152i or miRNA-150 alone showed reduced but partial tumor growth

inhibition in vivo, co-expression of miRNA-1521 and miRNA-150 led to complete inhibition of growth (see Figure 16) . The inventors confirmed that the targeted inhibition of expression SNRPN, WNK3 and FAM3B was restricted to the activity of miRNA-152i alone, or in combination (see Figure 17) . Given the enhanced tumor modulatory activity of co-expressed miRNA-503i/miRNA-23ai or miRNA-152 i/miRNA- 150 in a tumor cell line characterized by more aggressive tumor biology that Huh7, The inventors tested the effect of the co- expression of miRNA-503i and miRNA-23ai in a human colon cancer cell line RKO (see Figure 18) . In vitro cell proliferation was again augmented by co-expression of miRNA-503i and miRNA-23ai, when compared to expression of either miRNA alone. This was accompanied by increased expression of cell cyclin Dl and MCM2 and reduced expression Proxl and p21. Combined miRNA expression again led to a significant enhancement of tumor growth by volume and weight in vivo (see Figure 19) . Co-expression of miRNA-152i and miRNA-150 led to augmented inhibition of cell proliferation in vitro (see figure 20) and enhanced the tumor growth inhibition demonstrated by either miRNA alone, leading to complete abolition of tumor growth in vivo (see Figure 21) .

The inventors' findings indicate that key regulators of human liver regeneration can alter tumor behaviour in liver and non-liver derived cancer cell lines. These observations raise the possibility that regenerative drive confers a more generalised rather than tissue-specific cancer risk. Although our data pertain to

hepatocyte-derived tumors, it is noteworthy that regeneration- linked stem cell proliferative drive correlates with cancer propensity. miRNA regulators of liver regeneration induced large scale gene expression changes that regulate biological pathways associated with tumor behaviour and furthermore, enhanced tumor aggressiveness in vivo. In addition, the inventors' findings demonstrate that inhibition of miRNA-152 can inhibit tumor growth in vitro and in vivo. Some reports indicate down-regulation of expression of the miRNA-148/152 in some gastrointestinal cancers¹⁵. The contrast with the findings disclosed herein may reflect the specific dosage effect of miRNA-152 expression in the inventors' experiments or the impact of cell lineage. The tumor inhibitory capacity of miRNA-152, was linked to site-specific methylation of key target genes through increased expression of DNMTl. The inventors observed methylation-induced changes in expression of three genes associated with cell proliferation and cancer. The WNK family of kinases have been associated with cell cycle progression, metastasis and metabolic adaptation in tumor cells¹'. The FAM3 family have been associated with hepatic metabolic regulation and tumor formation/metastasis^18,19. SNRPN is linked to Prader-Willi syndrome and is involved in pre-RNA processing and splicing²⁰.

Targeted inhibition of expression of SNRPN, WNK3 and/or FAM3B genes may constitute a potential novel therapeutic strategy for HCC and more generally for other cancers. The inventor's finding that co-expression of miRNA augmented the tumor modulatory effect of pro- or anti-regenerative miRNA is compatible with their previous observation of concerted, rather than individual changes in expression of miRNA during regeneration. The more pleotropic inhibitory activity of the co-expression miRNA- 152i and miRNA-150 in cancer cells with more aggressive tumor biology and of non-hepatic lineage indicates that this combination will have a more general anti-cancer applicability.

Given the concordance of regenerative regulation and tumor

behaviour, the inventors' findings may help explain in part why regenerative capacity is so restricted in higher eukaryotes .

Furthermore, they may explain the global health burden and high incidence of cancers that arise in the liver, where regenerative competence is preserved²¹. Clinical data indicate potentially deleterious effects of liver regeneration, induced by therapeutic interventions such as live-donor liver transplantation and liver resection, on tumor biology and outcomes in the context of primary liver cancer²² and metastatic tumors²³. The inventors' findings may provide a mechanistic basis of these clinical observations.

Cancers can also arise in other organs with poor regenerative capacity due to facilitatory changes in tumorigenic- or tumor suppressor-pathways. It is possible that they also do so by subverting dormant regenerative pathways. Finally, the findings provided herein highlight a novel avenue of anti-cancer therapy, by targeting miRNA regulators that inhibit regeneration. These agents have the potential not only to prevent tumor growth in vivo, but may also alter tumor responsiveness to existing treatment

modalities .

MATERIALS AND METHODS In vivo animal experiments Cell lines and culture

HuH-7, a well differentiated hepatocyte derived cellular carcinoma cell line, HepG2 (a liver hepatocellular carcinoma cell line) and RKO (a poorly differentiated colon carcinoma cell line), were maintained in Modified Eagle's medium (MEM) supplemented with 10% heat inactivated fetal bovine serum and an antibiotic/antifungal solution. Cell cultures were maintained at 37°C under 5% CC¾. All cell culture materials were purchased from Gibco BRL, UK. Cells preserved in conditioned growth medium supplemented with 10% (v/v) DMSO and stored in the liquid nitrogen vapor phase .

Pathogen Testing

All HUH7 cells were independently tested against any mouse

pathogens including mycoplasma before in vivo experiment (Mouse Essential PCR panel, Charles River, USA) .

Animals

6-8 weeks-old female BALB/c nu-/nu- mice (Harlan animals), (20-25g) were selected as recipients for the transduced cells. The mice were maintained in filter-cages under specific pathogen-free conditions in the Comparative Biology Centre at King' s College London, in accordance with the Home Office guidelines for Animal Scientific Procedures UK.

Tumor formation assay

HUH7 cells transduced with lentiviruses expressing inhibitors of miRNA of interest or scrambled vector were harvested and

resuspended to 50 ^χ 10⁶/ml with PBS. Xenograft tumours generated by subcutaneous injection with a 25-gauge needle into the both lower flanks of mice with 5 ^χ 10⁶ HUH7 cells suspended in ΙΟΟμΙ PBS. The cells were kept on ice during the time between harvest and

injection. 3 mice injected for each different construct and one mice kept as control without any injection. All animal experiments carried out at triplicates and repeated 3 times.

Tumor Volume measurement The tumor volume calculated from the recorded successive tumor volumes using callipers to measure the longest and shortest tumour diameters. The volume calculated as: d_a x d_t,² = Volume (d_a and d_b are the two tumour diameters respectively) . Tumours measured and recorded twice a week. No tumour allowed to progress beyond 15mm in any diameter. When the tumours has reached a maximum volume of 1000mm³ and no longer than 15 mm in any diameter or day 21 (if less than 1000 mm3) the animals sacrificed by scheduled 1 method. An incision made in the skin over the subcutaneous tumour and the tumour tissue removed by blunt dissection and all tumours weight measured by digital scale. A total of 200ml of blood was taken by cardiac puncture for biochemistry analysis.

BrdU (Bromodeoxyuridine) Assay

To determine the viability and proliferative status of the infected areas in the tumours, Mice were injected with 1ml

concentrated BrdU per lOOmg body weight ( Invitrogen, cat no: 00- 0103) in day 21 and 2 hours later the animals were sacrificed to determine the number of DNA replicating cells in the HUH7 tumours. DNA incorporated BrdU detected by a three-step immunoperoxidase staining with the anti-BrdU monoclonal antibody.

Sample processing for Human Gene 2.0 ST arrays

Total RNA was extracted using Trizol reagent (Invitrogen, UK) from xenograft tumour tissues and quality and integrity were assessed using ribosomal RNA band analysis on a 2100 Bioanalyser and RNA 6000 Nano LabChips (Agilent, UK) . 75ng of total RNA was reverse transcribed and amplified into cDNA using NuGEN' s Pico WT-Ovation labeling kit, following the manufacturer' s protocols (NuGEN Inc, CA, USA) . The Exon conversion module (NuGEN Inc, CA, USA) was used to synthesize a sense orientation copy from the amplified cDNA, and the Biotin module for biotin-labelling . NuGEN' s recommendations were followed for hybridization to Affymetrix Human Gene 2.0 ST arrays (Affymetrix, CA, USA) and subsequent processing using standard hybridization, washing and staining reagents

(Hybridisation Wash Stain (HWS) kit. Scanned array images (DAT and CEL files) were generated using Affymetrix' s AGCC software, and analyzed using their Expression Console package, which generates normalized, background-corrected probeset-summarized signals for each gene on the array. The standard gene-level RMA workflow was used to achieve this data output. Control probeset data was removed from the main dataset prior to data analysis, through the deletion of rows containing information for various 'normgene' probesets.

Data analysis

The filtered data table was formatted as a ' .gedata' tab-delimited text file and imported into Qlucore's Omics Explorer 2.1 software for analysis. The software, which utilizes a visual, Principal Components Analysis (PCA) approach to display the relationships between samples and genes, allowed the selection of differentially expressed genes using standard statistical techniques. A simple 1- way ANOVA was employed to filter genes which were differentially regulated across the different sample groups (xenograft tumours in nude mices injected with cells transduced with inhibitors of miRNA 152, 23a, 503 or scrambled vector), using the p-value slide bar to create the various statistical cut-off gene lists for the different comparisons of interest. Gene lists (containing all regulated genes) were displayed as heat maps to show gene expression patterns within the list, and sub-lists of interest were selected on the basis of specific expression patterns. Ingenuity Systems Analysis.

HIV-derived disabled lentiviral miRNA expression vectors

LentiviralmiArrest inhibitor vectors (pEZX-A 04 , Genecopoeia) for miRNA 152, miRNA 503 and miRNA 23a containing mCherry reporter gene, puromycin selectable marker and 06 promoter were made. miRNA inhibitor constructs bind specifically to their target miRNA to block miRNA gene regulation, resulting in the up-regulation of specific miRNA target genes. The miRNA inhibitor scrambled control clone for pEZX-AM04 expressing mcherry and puromycin was used as a control .

HIV lentiviral vector production and processing Transient transfection of BL15 cells produced VSV-G pseudotypes after transfection with pCMVAR8.91, pMD.Gand the pEZX-AM04 miArrest inhibitor vector with a ratio of 7 : 3.5: 9.5

respectively, using Calcium Phosphate co-recipitation . After 24 h BL15 cells were washed four times in serum-free DMEM and cultured for 24h in serum free DMEM. The vectors were calcium phosphate concentrated as described previously, and 47 ml of lentivirus was reduced to a pellet to which 900μ1 of modified solubilisation buffer was added (lOOmM EDTA, 50mM NaCl, 0.2% BSA, pH 6.5), giving a final volume of 1.1 ml. The final solution was added to 5 x 10⁸ pelleted, prewashed (2 x 400μ1 HBSS + 0.1% BSA) streptavidin superparamagnetic particles (Promega) and incubated for 18h under constant agitation. Particles were then washed, and resuspended in HBSS + 0.1% BSA. The concentrated preparations were then used for infecting their target cell lines.

Fluorescence-activated cell sorting (FACS) of transduced cells

72h post infection, transduced cells were sorted into positively- and negatively-transduced populations using a BD FACS Aria Cell Sorter. mCherry expression was detected with the Yellow/Green (560nm) laser, 600nm long pass mirror and 610/20 filter; Pacific blue expression was detected with the Violet (405nm) laser, 450/50 filter. Flow cytometry data was analyzed using FlowJo version 7.6.5.

Analysis of puromycin expression by RT-PCR

RT-PCR was performed using the PCR Enzyme Selection Kit

(Invitrogen) . Primers were purchased from Eurofins MWG Operon.

Forward sequence: ttcgccgactacccc; reverse sequence:

tagaaggggaggttgc .

Gene expression analysis by qPCR

MCM2, p21, cyclin Dl and Proxl expression was analyzed using

TaqMan® Gene Expression Assays (Applied Biosystems). Expression levels were normalized to a scrambled control vector and data was expressed as mean +/- s.d. The Student's t-test was used to determine significance. P values < 0.05 were considered significant. DNMTl expression was analyzed using TaqMan® Gene Expression Assays (Applied Biosystems) and expression levels were normalized to a control cDNA obtained from liver tissue. cDNA from a kidney tissue served as positive control. Also FAM3B, SNRPN and WNK3 expression was analyzed using TaqMan® Gene Expression Assays (Applied Biosystems) . Expression levels were normalized to scrambled control vector.

EdU cell proliferation assay

Cell lines: HuH-7 and HerpG2 (human hepatocyte derived cellular carcinoma cell lines) was maintained in Modified Eagle's medium (MEM) supplemented with 10% heat inactivated fetal bovine serum and an antibiotic/antifungal solution. Min6 (mouse Insulinoma) cells were maintained in RPMI medium with the same supplements . Cell cultures were maintained at 37°C under 5% CO₂. All cell culture materials were purchased from Gibco BRL.

Cell proliferation was analyzed using the Click-iT® EdU Pacific Blue™ Flow Cytometry Assay Kit (Invitrogen) . HUH-7 , HepG2 and Min6 cells were seeded in six-well plates and infected with 50 μΐ (MOI of 10) of miRNA/puromycin-expressing lentiviral vectors. Cells were cultured at 37°C, 5% C0₂and the cell culture media was replaced after 24 hours with medium containing 4μg/ml puromycin. After 3 days all uninfected cells had died, generating colonies of stable cells in culture. Puromycin selection pressure was maintained for another week with daily fresh medium containing puromycin. After one week, colonies were picked using an inverted fluorescence microscope with a Gilson pipette and yellow tip. Colonies were expanded by transferring to a 24-well plate containing maintenance dose of puromycin

. 90-95% confluent cells were

transferred into a single well of a six-well plate and kept in maintenance dose of puromycin. Cells were maintained in culture for another four days, after which they were treated with 10μΜ EdU for 5 h. EdU incorporation was detected according to the

manufacturer's instructions. Immuno-histocheitiis ry

The tissue samples were formalin fixed and paraffin embedded. The cell morphology was initially assessed with haemotoxylin & eosin stain. A further assessment of morphological and functional phenotype was performed by immunohistotochemistry using antibodies against, human hepatocyte antigen (Hep Par-1, Dako, dilution

1:200), Glypican 3, Sigma, dilution 1:100, BrdU, Abeam dilution 1:100 and Ki67, Dako, dilution 1:25) . The immunostains were carried out using an automatic immunostainer (Bond Max, Leica Microsystems, Wetzlar, Germany) including the nuclear counter-staining. Sections were mounted in DPX mountant . The sections were examined by a liver histopathologist (AQ) who was blind to the status of each sample in terms of xenograft injection. Tumour cells, mitotic figures and nuclei staining for Ki67 and BrdU were counted using a Glasgow cell counting graticule, Datasights Limited, Enfield , using the method described by Going JJ (Counting cells made easier, Histopathology 2006; 49 (3) : 309-11) . For each sample, 10 fields were randomly selected at 400x magnification for the mitotic count. Each field was marked and the ki67 and BrdU count was repeated in the same area in the sections used for immunohistochemistry . Glypican and Hep-Par-1 expression were assessed using a semi-quantitative scale, as follows: 0= No staining; 1= Very focal staining observed after careful examination at high magnification; 2= focal staining spotted at low magnification; 3= staining easily spotted at low magnification, but minority of cells tumour cells staining; 4= majority of tumour cells staining; 5= virtually all tumour cells staining with no negative tumour cells present.

Methylation array

Genomic DNA extraction

DNA was extracted using Trizol reagent (Invitrogen, UK) and quality and quantity were assessed by agarose gel electrophoresis and NanoDrop 2000c Spectrophotometer (Thermo Scientific) . Bisulphite conversion of genomic DNA and Genome-wide methylation analysis

500ng of genomic DNA was treated with sodium bisulphite using Zymo EZ DNA methylation kit (Zymo Research Irvine Ca) and tested for conversion by PCR using primers specific for bisulphite modified DNA. Genome-wide DNA methylation was assayed using the Illumina Infinium Human Methylation 450K beadchip and raw data signals were obtained using GenomeSudio software. Data was exported for further analysis using Partek Genomics Suite (Partek Inc., St Louis, Mo) from which principal component analysis was determined.

In vitro miRNA delivery

Cells were harvested with TrypLE™ Select (IX) , pelleted by centrifugation, washed once with PBS and then resuspended to 2x10^s cells/ml in DMEM. One milliliter of cell suspension was added to each well of 24-well plate (FalconBD Biosciences, Oxford, UK). The plates were left at 37° C in 5% CO? overnight to reach 90%

confluence. Lipofectamine 2000 ((Life Technologies, UK) was added to each well of plate at a lipofectamine to DNA ratio of 2.5:1. Plasmid DNA was used in a concentration of 5μg /ml for delivery. The cells were washed twice with PBS and 0.5 ml of DNA- Lipofectamine complexes were added. The transfected cells were incubated for 4 hours at 37° C and then 0.5 ml of DMEM containing Glutamine was added to each well. The DNA-Lipofectamine complexes were removed after 24 hour and DMEM with selection antibiotic was added . miRNA expression plasmids

miArrest™ inhibitor vectors (pEZX-AM02, Genecopoeia™, US) for miRNA-152 , miRNA-503 and miRNA-23a contained an M-Cherry reporter gene, a puromycin selectable marker and a U6 promoter (see Figure 23) . miRNA inhibitor constructs bind specifically to their target miRNA to block miRNA gene regulation, resulting in the up- regulation of specific miRNA target genes. The miRNA inhibitor scrambled control clone for pEZX-AM02 expressing M-Cherry and puromycin was used as a control. OmicsLink™ miRNA expression clone (PEZX-MR04) was used to express miR-150 stem loop precursor, and contained GFP reporter gene, a puromycin selectable marker and CMV promoter (see Figure 23) .

miRNA 23ai/503i double expression vector was created by tandem cloning of has-mir-503 inhibitor immediately after hsa-mir-23a inhibitory sequences in the backbone of pEZX-A 02 that contains puromycin selection marker and M-cherry reporter gene.

BamHI and EcoRI restriction enzymes used to digest the plasmid pEZX- AM02/503i to release the miRNA 503i, then DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs, UK) used to fill the 5' overhangs to generate a blunt ends. The pEZX-AM02/23ai was digested with EcoRI and then 5' overhangs was filled with DNA Polymerase I to make blunt ends, then the plasmid treated with

Alkaline Phosphatase, Calf Intestinal (CIP) (New England Biolabs, UK) to dephosphorylate the plasmid and prevents religation of linearized plasmid DNA. The blunt ended miRNA503i fragment ligated to miRNA-23ai linearized plasmid by using T4 DNA ligase (New

England Biolabs, UK) . Several clones were selected and the direction of cloning was confirmed by functional qPCR assay looking for miRNAs inhibitory effects in control cell lines. miRNA inhibitory sequences transcribed inside the cell nucleus from vector through Pol III promoter (U6) . The inhibitory RNA containing the sense and antisense sequences from target gene connected by a loop is transported from the nucleus into the cytoplasm where Dicer processes them into small RNAs .

miRNA 150/152i double expression plasmid was created by

inserting has-mir-150 precursor immediately after miRNA-152 inhibitory sequences in a backbone of pEZX-AM02 containing U6 promoter, puromycin selection marker and M-Cherry reporter gene. The miRNA precursor containing mir-150 stem loop was removed from pMIR plasmid (ViGene Biosciences Inc usa) , by Ascl and Notl restriction enzymes and the resulted fragment was blunted using DNA Polymerase I, Large (Klenow) Fragment (New England Biolabs, UK) . The pEZX-AM02/152i plasmid digested with EcoRI and blunted using DNA Polymerase I and dephosphorylated by the CIP to prevent religation of linearized plasmid. The blunted miRNA 150 precursor then ligated to linear pEZX-AM02 /152i and clones were selected and the direction of cloning was confirmed by functional qPCR assay looking for miRNA 152 inhibitory effects and over expression of miRNA 150 in control cell lines.

Both miRNA 152 inhibitory sequence and miRNA 150 precursor will be driven by U6 promoter and once inside the cell will be processed by Dicers into their small inhibitory and mimics RNAs respectively.

Constructs and Sequences

All sequences are from "miRBase database" that is a searchable database of published miRNA sequences and annotation (mirbase.org) and all constructs are from genecopoeia (ww . genecopoeia . com)

1. Inhibitor Cat no: HmiR-AN0210-AM04

Mature miRNA name : hsa-miR-150-5p

Stem Loop (Precursor miRNA)

hsa-mir-150 MI0000479

CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGGCCUGGGG GACAGGGACCUGGGGAC

Mature sequence

hsa-miR-150-5p MIMAT0000451

UCUCCCAACCCUUGUACCAGUG

2. Expression Clone Cat no: HmiR0306-MR03

Mature miRNA name : hsa-mir-150 Mature sequence

hsa-miR-150 MIMAT0000451 UCUCCCAACCCUUGUACCAGUG

3. Inhibitor Cat no: HmiR-AN0774-AM04

Mature miRNA name: hsa-mir-663a Stem Loop (Precursor miRNA)

hsa-mir-663a MI0003672

CCUUCCGGCGUCCCAGGCGGGGCGCCGCGGGACCGCCCUCGUGUCUGUGGCGGUGGGAUCCCGCGGC CGUGUUUUCCUGGUGGCCCGGCCAUG

Mature sequence

hsa-miR-663a MIMAT0003326

AGGCGGGGCGCCGCGGGACCGC . Inhibitor Cat no: HmiR-AN0550-AM04

Mature miRNA name: hsa-mir-503-5p

Stem Loop (Precursor miRNA)

Hsa-mir-503 MI0003188

Ugcccuagcagcgggaacaguucugcagugagcgaucggugcucugggguauuguuuccgcugccag ggua Mature Sequence

hsa-miR-503-5p MIMAT0002874

UAGCAGCGGGAACAGUUCUGCAG 5. Expression Clone Cat no: HmiR-0313-MR03

Mature miRNA name : hsa-mir-520e Stem Loop (Precursor miRNA)

hsa-mir-520b MI0003155 CCCUCUACAGGGAAGCGCUUUCUGUUGUCUGAAAGAAAAGAAAGUGCUUCCUUUUAGAGGG

Mature sequence

hsa-miR-520b ΜΪΜΑΤ0002843 AAAGUGCUUCCUUUUAGAGGG

6^ Inhibitor Cat no: HmiR-AN0344-AM04

Mature miRNA name : hsa-mir-23a Stem Loop (Precursor miRNA)

hsa-mir-23a MI0000079

GGCCGGCUGGGGUUCCUGGGGAUGGGAUUUGCUUCCUGUCACAAAUCACAUUGCCAGGGAUUUCCAA CCGACC

Mature sequence

hsa-miR-23a-5p MIMAT0004496

GGGGUUCCUGGGGAUGGGAUUU

7_. Inhibitor Cat no: HmiR-AN0213-AM04

Mature miRNA name: hsa-mir-152-3p

Stem Loop (Precursor miRNA)

hsa-mir-152 MI0000462 ugucccccccggcccagguucugugauacacuccgacucgggcucuggagcagucagugcaugacag aacuugggcccggaaggacc Mature sequence

hsa-miR-152-3p MIMAT0000438 UCAGUGCAUGACAGAACUUGG

8^ Sequence Cat no: HmiR0445-MR04, pEZX-MR04

Mature miRNA name: Hsa-mi -512 Clone

Stem Loop (Precursor miRNA)

Homo sapiens miR-512 MI0003141 gguacuucucagucuguggcacucagccuugagggcacuuucuggugccagaaugaaagugcuguca uagcugagguccaaugacugaggcgagcacc

Mature sequence

hsa-miR-512-3p MIMAT0002823

AAGUGCUGUCAUAGCUGAGGUC

SL Sequence Cat no: HmiR0207-MR04 , pEZX-MR04

Mature miRNA: Hsa-miR-624 Clone

Stem Loop (Precursor miRNA)

Hsa-mir-624 MI0003638 augcuguuucaagguaguaccaguaccuuguguucaguggaaccaagguaaacacaagguauuggua uuaccuugagauagcauuacaccuaagug

Mature sequence

hsa-miR-624-3p MIMAT0004807

CACAAGGUAUUGGUAUUACCU References

1. Simon, A. Regenerative biology: On with their heads. Nature 500, 32-33 (2013) .

2. Sanchez Alvarado, A. Cellular hyperproliferation and cancer as evolutionary variables. Curr Biol 22, R772-778 (2012).

3. Willenbring, H. , et al. Loss of p21 permits carcinogenesis from chronically damaged liver and kidney epithelial cells despite unchecked apoptosis. Cancer Cell 14, 59-67 (2008) .

4. Salehi , S., et al . Human liver regeneration is characterized by the coordinated expression of distinct microRNA governing cell cycle fate. American journal of transplantation: official journal of the American Society of Transplantation and the American Society of Transplant Surgeons 13, 1282-1295 (2013) .

5. Forbes, S.J. & Rosenthal, N. Preparing the ground for tissue regeneration: from mechanism to therapy. Nat Med 20, 857-869 (2014) .

6. Buitrago-Molina, L.E., et al . The degree of liver injury

determines the role of p21 in liver regeneration and

hepatocarcinogenesis in mice. Hepatology 58, 1143-1152 (2013).

7. Marhenke, S., et al . p21 promotes sustained liver regeneration and hepatocarcinogenesis in chronic cholestatic liver injury. Gut 63, 1501-1512 (2014) .

8. Fausto, N. , Campbell, J.S. & Riehle, K.J. Liver regeneration.

J Hepatol 57, 692-694 (2012) .

9. Riehle, K.J., Dan, Y.Y., Campbell, J.S. & Fausto, N. New

concepts in liver regeneration. Journal of gastroenterology and hepatology 26 Suppl 1, 203-212 (2011) .

10. Shu, J., et al. Genomewide microRNA down-regulation as a

negative feedback mechanism in the early phases of liver regeneration. Hepatology 54, 609-619 (2011) .

11. Song, G. , et al . MicroRNAs control hepatocyte proliferation during liver regeneration. Hepatology 51, 1735-1743 (2010) .

12. Marshall, A., et al. Relation between hepatocyte Gl arrest, impaired hepatic regeneration, and fibrosis in chronic hepatitis C virus infection. Gastroenterology 128, 33-42

(2005) .

Foskolou, I. P., Stellas, D., Rozani , I., Lavigne, M.D. & Politis, P.K. Proxl suppresses the proliferation of

neuroblastoma cells via a dual action in p27-Kipl and Cdc25A. Oncogene 32, 947-960 (2013) .

Gao, F. , Liang, B. , Reddy, S.T., Farias-Eisner, R. & Sti, X. Role of inflammation-associated microenvironment in

tumorigenesis and metastasis. Current cancer drug targets 14, 30-45 (2014) .

Xu, Q. , et al. A regulatory circuit of miR-148a/152 and DNMTl in modulating cell transformation and tumor angiogenesis through IGF-IR and IRS1. Journal of molecular cell biology 5, 3-13 (2013) .

Chen, Y. , Song, Y.X. & Wang, Z.N. The microRNA-148/152 family: multi-faceted players. Mol Cancer 12, 43 (2013) .

M6niz, S. & Jordan, P. Emerging roles for NK kinases in cancer. Cellular and molecular life sciences: CMLS 67, 1265- 1276 (2010) .

Waerner, T., et al . ILEI : a cytokine essential for EMT, tumor formation, and late events in metastasis in epithelial cells . Cancer Cell 10, 227-239 (2006) .

Yang, J. & Guan, Y. Family with sequence similarity 3 gene family and nonalcoholic fatty liver disease. Journal of gastroenterology and hepatology 28 Suppl 1, 105-111 (2013) . Glenn, C.C. , et al . Gene structure, DNA methylation, and imprinted expression of the human SNRPN gene. American journal of human genetics 58, 335-346 (1996) .

Bosetti, C, Turati, F. & La Vecchia, C. Hepatocellular carcinoma epidemiology . Best practice & research. Clinical gastroenterology 28, 753-770 (2014) .

Man, K. , et al. The significance of acute phase small-for- size graft injury on tumor growth and invasiveness after liver transplantation. Annals of surgery 247, 1049-1057 (2008) . Lim, C. , et al. Tumour progression and liver regeneration— insights from animal models. Nature reviews. Gastroenterology & hepatology 10, 452-462 (2013) .

Claims

1. A method of treating cancer in a subject comprising

administering an agent to said subject that is capable of modulating the level of an miRNA in said cancer cells, or modulating a component of the signalling pathway of said miRNA, wherein said miRNA is selected from the group

consisting of miRNA-152 , miRNA-23a, miRNA-503 , miRNA-150 , miRNA-663 or a combination thereof.

2. A method according to claim 1 wherein the agent is capable of up-regulating .miRNA-23a, mi-RNA-503, miRNA-150, miRNA-663 or a combination thereof.

3. A method according to claim 1 wherein the agent is capable of down-regulating miRNA-152.

4. A method according to claim 1 wherein a combination of agents are administered to said subject, wherein a first agent is capable of up-regulating miRNA-150 and a second agent is capable of down-regulating miRNA-152.

5. A method according to claim 4 wherein the first agent is an inducer of miRNA-150 and the second agent is an inhibitor or miRNA-152.

6. A method according to any one of the preceding claims wherein the agent is selected from the group consisting of nucleic acid molecule, protein, peptide, peptide mimetic and small molecule .

7. A method according to claim 6 wherein the agent is a nucleic acid molecule encoding an miRNA molecule selected from miRNA- 23a, miRNA-503, miRNA-150, miRNA-663 and miRNA-152.

8. A method according to claim 6 wherein the agent is a nucleic acid molecule having a sequence complementary to the nucleic acid sequence of an miRNA molecule selected from miRNA-23a, miRNA-503, miRNA-150 , miRNA- 663 and miRNA-152.

9. A method according to any one of the preceding claims wherein the component of the signalling pathway is selected from the group consisting of DNMT1, SNRPN, WNK3, FAM3B, p21, Proxl, MCM2 and cyclin Dl .

10. A Method according to any one of the preceding claims comprising administering to said subject an agent capable of modulating miRNA-152 signalling pathway, wherein said agent is selected from the group consisting of

(i) an inhibitor of miRNA-152

(ii) an agent capable of increasing expression of DNMT1;

(iii) DNMT1;

(iv) an inhibitor of SNRPN, WNK3, FAM3B; and

(v) a combination of any two or more of (i) to (iv) .

11. A method according to claim 10 further comprising an

agent being an inducer of miRNA-150.

12. A method according to claim 11 wherein said agent is a nucleic acid molecule encoding miRNA-152.

13. A method according to any one of claims 10 to 12 wherein the inhibitor of miRNA-152 is selected from

(i) antisense nucleic acid sequence capable of binding to miRNA-152;

(ii) siRNA molecule capable of binding to miRNA-152 or an miRNA-152 target mRNA molecule;

(iii) a modified miRNA-152 molecule;

(iv) a nucleic acid molecule capable of binding to an miRNA-152 target mRNA; (v) an antibody or fragment thereof, capable of binding to and/or inhibiting miRNA-152.

14. A method according to claim 10 wherein the miRNA-152

inhibitor is a lentiviral vector expressing a nucleic acid sequence capable of binding to endogenous miRNA-152.

15. A method according to any one of the preceding claims wherein the agent is administered to the subject via a lipid vesicle delivery system.

16. A method according to any one of the preceding claims wherein the cancer is a solid tumor.

17. A method according to claim 5 wherein the cancer is

selected from liver cancer (e.g. HCC) , breast cancer, lung cancer, prostate cancer, colon cancer, stomach cancer, bladder cancer, lymphoma (non-Hodgkin and Hodgkin) , leukemia, bowel cancer, Bone cancer, Brain tumor (e.g. astrocytomas), cervical cancer, ovarian cancer, testicular cancer, Glioma, melanoma, myeloma, neuroblastoma, pancreatic cancer, thyroid cancer, sarcoma, squamous cell carcinoma, other forms of skin cancer, kidney cancer (renal cell carcinoma) liver cancer, breast cancer, lung cancer, prostate cancer, colon cancer, and stomach cancer.

18. A method according to claim 6 wherein the cancer is

liver cancer.

19. A modulator of an miRNA molecule or its signalling

pathway for use in a method of treating cancer, wherein said miRNA molecule is miRNA-23a, miRNA-503, miRNA-150. miRNA-152 or a combination thereof.

20. A modulator according to claim 19 selected from the group consisting of

(i) an inhibitor of miRNA-152;

(ii) an agent capable of increasing expression of DNMT1;

(iii) DNMT1; and

(iv) an inhibitor of SNRPN, WNK3, FAM3B.

21. A modulator according to claim 20 for use in method of treating cancer wherein the modulator is an inhibitor of miRNA-152.

22. A modulator according to claim 21 for use in a method of treating cancer wherein the inhibitor of miRNA-152 is selected from the group

(i) antisense nucleic acid sequence capable of binding to miRNA-152 ;

(ii) siRNA molecule capable of binding to miRNA-152 or a

miRNA-152 target mRNA molecule;

(iii) a modified miRNA-152 molecule;

(iv) a nucleic acid molecule capable of binding to a miRNA- 152 target mRNA;

(v) an antibody or fragment thereof capable of binding to and/or inhibiting miRNA-152.

23. A modulator according to claim 22 wherein the miRNA-152 inhibitor is a lentiviral vector expressing a nucleic acid sequence capable of binding to endogenous miRNA-152.

24. A pharmaceutical composition comprising a modulator of miRNA molecule or its signalling pathway and a

pharmaceutically acceptable carrier for treating cancer in a subject, wherein said miRNA molecule is miRNA-23a, miRNA-503, miRNA-150, miRNA-152, miRNA- 663 or a combination thereof.

25. A pharmaceutical composition according to claim 24 comprising an inhibitor of miRNA-152 and an inducer or miRNA- 150.

26. A pharmaceutical composition according to claim 24

wherein the modulator is selected from the group consisting of

(i) an inhibitor of miRNA-152;

(ii) an agent capable of increasing expression of DNMT1;

(iii) DNMT1; and

(iv) an inhibitor of SNRPN, WNK3 , FAM3B.

27. A pharmaceutical composition according to claim 26

wherein the modulator is an inhibitor of miRNA-152.

28. A pharmaceutical composition according to claim 27

wherein the inhibitor of miRNA-152 is selected from the group

(i) antisense nucleic acid sequence capable of binding to miRNA-152 ;

(ii) siRNA molecule capable of binding to miRNA-152 or a

miRNA-152 target mRNA molecule;

(iii) a modified miRNA-152 molecule;

(iv) a nucleic acid molecule capable of binding to a miRNA-

152 target mRNA;

29. A pharmaceutical composition according to any one of

claims 24 to 28 wherein the modulator is associated with or bound to a delivery agent.

30. A pharmaceutical composition according to claim 29

wherein the delivery agent is a lipid delivery system or a nanoparticle .

31. A method of preparing a pharmaceutical composition for treating cancer in a subject, said method comprising admixing a modulator according to any one of claims 19 to 23 and a pharmaceutically acceptable carrier.

32. A method according to claim 31 wherein the modulator is selected from the group consisting of

(i) an inhibitor of miRNA-152;

(ii) an inducer of miRNA-150

(iii) an agent capable of increasing expression of DNMT1;

(iv) DNMT1; and

(v) an inhibitor of SNRPN, WNK3, FAM3B;

(vi) a combination of any two or more of (i) to (v) .

33. A method according to claim 32 wherein the

pharmaceutical composition comprises an inhibitor of miRNA-152 and an inducer of miRNA-150.

34. A method according to claim 32 or claim 33 wherein the inhibitor of miRNA-152 is selected from the group consisting of

(i) antisense nucleic acid sequence capable of binding to miRNA-152;

(ii) siRNA molecule capable of binding to miRNA-152 or a

miRNA-152 target mRNA molecule;

(iii) a modified miRNA-152 molecule;

(iv) a nucleic acid molecule capable of binding to a miRNA-

152 target mRNA.

35. A method according to any one of claims 31 to 34 further comprising including the pharmaceutical composition within a lipid vesicle delivery system.

36. A method according to any one of claims 31 to 34 wherein the modulator is associated with or bound to a delivery agent selected from liposomes or nanoparticles .

37. A method for identifying compounds useful in the treatment of cancer, said method comprising contacting a candidate compound with a cell and determining whether the signalling pathway of an miRNA molecule is altered in the presence of said compound as compared to the signalling pathway in the absence of said compound, wherein the miRNA molecule is selected from miRNA-23a, miRNA-503, miRNA-150, miRNA-152, miRNA-663 or a combination thereof.

38. A method according to claim 37 wherein the miRNA-152 signalling pathway includes down-regulation of miRNA-152.

39. A method according to claim 37 wherein the miRNA-152 signalling pathway includes altered expression of one or more proteins selected from the group consisting of DNMT1, SNRPN, WNK3 and FAM3B.

40. A method according to any one of claims 37 to 39 wherein the method further comprises contacting the cell with ligand which binds the miRNA molecule or the miRNA target mRNA binding site and determining whether the candidate compound displaces the binding of said ligand.

41. A method according to claim 40 wherein the ligand is a nucleic acid sequence capable of specifically binding to the miRNA molecule or miRNA target mRNA binding site.

42. A method according to claim 41 wherein the ligand is a nucleic acid sequence capable of specifically binding to and miRNA-152 target mRNA binding site.

43. A method according to claim 42 wherein the miRNA-152 target mRNA binding site is present on mRNA encoding DNMTl.

44. A method according to any one of claims 37 to 43 wherein the cell is a cancer cell.

A method according to claim 44 wherein the cell liver cancer cell.

A method according to any one of claims 37 to 45 further comprising selecting the test compound, optionally determining its structure, and providing said compound for use in treating cancer .