WO2016098079A2 - Compositions and methods for antibodies targeting bmp6 - Google Patents
Compositions and methods for antibodies targeting bmp6 Download PDFInfo
- Publication number
- WO2016098079A2 WO2016098079A2 PCT/IB2015/059797 IB2015059797W WO2016098079A2 WO 2016098079 A2 WO2016098079 A2 WO 2016098079A2 IB 2015059797 W IB2015059797 W IB 2015059797W WO 2016098079 A2 WO2016098079 A2 WO 2016098079A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- antibody
- antigen
- binding fragment
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/22—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- A61K38/18—Growth factors; Growth regulators
- A61K38/1816—Erythropoietin [EPO]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P7/00—Drugs for disorders of the blood or the extracellular fluid
- A61P7/06—Antianaemics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K2300/00—Mixtures or combinations of active ingredients, wherein at least one active ingredient is fully defined in groups A61K31/00 - A61K41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/21—Immunoglobulins specific features characterized by taxonomic origin from primates, e.g. man
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
- C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/33—Crossreactivity, e.g. for species or epitope, or lack of said crossreactivity
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/40—Immunoglobulins specific features characterized by post-translational modification
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/55—Fab or Fab'
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/565—Complementarity determining region [CDR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
- C07K2317/567—Framework region [FR]
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
- C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
- C07K2317/622—Single chain antibody (scFv)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
Definitions
- the present invention relates to antibodies and antigen-binding fragments thereof to human BMP6 and compositions and methods of use thereof.
- Anemia is prevalent in patients with chronic kidney disease (CKD) and is associated with lower quality of life and higher risk of adverse outcomes, including cardiovascular disease and death.
- CKD chronic kidney disease
- ESA erythropoiesis-stimulating agents
- Hepcidin-lowering agents may therefore be an effective strategy for ameliorating ESA-refractory anemia in this patient population and in other forms of anemia of chronic disease (ACD) characterized by iron restriction.
- the present invention provides isolated BMP6-binding molecules (e.g., BMP6-binding antibodies or antigen-binding fragments thereof), pharmaceutical compositions comprising such molecules, methods of making such molecules and compositions, and methods of use thereof in lowering hepcidin levels and in treating anemia.
- isolated BMP6-binding molecules e.g., BMP6-binding antibodies or antigen-binding fragments thereof
- pharmaceutical compositions comprising such molecules, methods of making such molecules and compositions, and methods of use thereof in lowering hepcidin levels and in treating anemia.
- the invention provides an isolated antibody or antigen-binding fragment thereof to BMP6 comprising any 1, 2, 3, 4, 5, or 6 CDRs of any of the antibodies in Table 1.
- the invention provides an isolated antibody or antigen-binding fragment thereof to BMP6 comprising the 6 CDRs of Antibody 3, as described in Table 1.
- the invention provides an isolated antibody or antigen-binding fragment thereof to BMP6 comprising the 6 CDRs of Antibody 5, as described in Table 1.
- the invention provides an isolated antibody or antigen-binding fragment thereof to BMP6 comprising the 6 CDRs of Antibody 6, as described in Table 1.
- the invention provides an isolated antibody or antigen-binding fragment thereof to BMP6 comprising the 6 CDRs of Antibody 7, as described in Table 1.
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof that binds human BMP6 and comprises:
- VH heavy chain variable domain sequence of SEQ ID NO: 15;
- the isolated antibody or antigen -binding fragment thereof that binds human BMP6 comprises a VH sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the VH sequences described above.
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- VL light chain variable domain sequence of SEQ ID NO: 25;
- the isolated antibody or antigen -binding fragment thereof that binds human BMP6 comprises a VL sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the VL sequences described above.
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof that binds human BMP6 comprises a VH sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the VH sequences described above, and comprises a VL sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the VL sequences described above.
- the VH and VL are derived from the same antibody listed in Table 1.
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen -binding fragment thereof that binds human BMP6 comprises a heavy chain sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the heavy chain sequences described above.
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises:
- the isolated antibody or antigen-binding fragment thereof that binds human BMP6 comprises a light chain sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the light chain sequences described above.
- the isolated antibody or antigen-binding fragment thereof binds human BMP6 and comprises a heavy chain and a light chain wherein:
- the isolated antibody or antigen-binding fragment thereof that binds human BMP6 comprises a heavy chain sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the heavy chain sequences described above, and comprises a light chain sequence having at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity, but less than 100% sequence identity to one of the light chain sequences described above.
- the heavy chain and light chain are derived from the same antibody listed in Table 1.
- the isolated monoclonal antibody or antigen- binding fragment thereof specifically binds to BMP6 and comprises at least one complementarity determining (CDR) sequence identical to any one or more of:
- the isolated antibodies or antigen -binding fragments thereof specifically bind to BMP6, wherein said antibodies comprise at least one heavy chain CDR sequence selected from the group consisting of:
- the isolated antibodies or antigen-binding fragments thereof specifically bind to BMP6, wherein said antibodies comprise at least one light chain CDR sequence selected from the group consisting of:
- the isolated antibody or antigen binding fragment thereof is monoclonal.
- the present invention provides isolated antibodies or antigen-binding fragments thereof that specifically bind to BMP6, wherein said antibody has an affinity constant (K A ) of at least about 1 X 10 7 M “1 , 10 8 M “1 , 10 9 M “1 , 10 10 M “1 , or 10 11 NT 1 .
- the present invention provides isolated antibodies or antigen-binding fragments thereof that specifically bind to BMP6, wherein said antibody has an affinity constant (K A ) of at least 1 X 10 7 M “1 , 10 8 M “1 , 10 9 M “1 , 10 10 M “1 , or 10 11 NT 1 .
- the isolated antibody or antigen-binding fragment thereof specifically binds to BMP6, wherein said antibody or antigen-binding fragment thereof binds to BMP6 with a Kd of no more than about 1 nM or no more than about 0.1 nM. In one embodiment of the present invention, the isolated antibody or antigen-binding fragment thereof specifically binds to BMP6, wherein said antibody or antigen-binding fragment thereof binds to BMP6 with a Kd of no more than 1 nM or no more than 0.1 nM. In one embodiment of the present invention, the isolated antibody or antigen-binding fragment thereof specifically binds to BMP6, wherein said antibody or antigen-binding fragment thereof binds to BMP6 with a Kd ⁇
- the Kd is as measured by Biacore.
- the isolated antibody or antigen-binding fragment thereof specifically binds to BMP6, and inhibits BMP6 activity.
- the isolated antibody or antigen-binding fragment thereof specifically binds to BMP6, and cross competes with (cross-blocks) an antibody described in Table 1 below. In one embodiment of the present invention, the isolated antibodies or antigen-binding fragments thereof bind to the same BMP6 epitope of, cross-compete with an antibody described in Table 1 below.
- the isolated antibodies or antigen-binding fragments thereof have at least about a 100-, 500- or 1000-fold greater affinity for human BMP6, than to any of: human BMP2, human BMP5 or human BMP7. In one embodiment of the present invention, the isolated antibodies or antigen-binding fragments thereof has at least a 100-, 500- or 1000-fold greater affinity for human BMP6, than to any of: human BMP2, human BMP5 or human BMP7. In embodiments, the specificity for BMP6 is as measured by ELISA.
- the isolated antibodies or antigen-binding fragments thereof has at least about a 100-, 500- or 1000-fold greater affinity for human BMP6, than to human BMP2. In one embodiment of the present invention, the isolated antibodies or antigen-binding fragments thereof has at least a 100-, 500- or 1000-fold greater affinity for human BMP6, than to human BMP2. In embodiments, the specificity for BMP6 is as measured by ELISA.
- the isolated antibodies or antigen-binding fragments thereof has at least about a 100-, 500- or 1000-fold greater affinity for human BMP6, than to human BMP5. In one embodiment of the present invention, the isolated antibodies or antigen-binding fragments thereof has at least a 100-, 500- or 1000-fold greater affinity for human BMP6, than to human BMP5. In embodiments, the specificity for BMP6 is as measured by ELISA.
- the isolated antibodies or antigen-binding fragments thereof has at least about a 100-, 500- or 1000-fold greater affinity for human BMP6, than to human BMP7. In one embodiment of the present invention, the isolated antibodies or antigen-binding fragments thereof has at least a 100-, 500- or 1000-fold greater affinity for human BMP6, than to human BMP7. In embodiments, the specificity for BMP6 is as measured by ELISA.
- the antibody or antigen-binding fragment thereof has no detectable binding to human BMP2 or BMP5 (e.g., in an ELISA).
- the antibody or antigen-binding fragment thereof has no detectable activity against human BMP2 (e.g., in an ELISA).
- the antibody or antigen-binding fragment thereof has no detectable activity against human BMP5 (e.g., in an ELISA).
- the antibodies and antigen-binding fragments thereof of the invention that specifically bind to BMP6 are isolated monoclonal antibodies. In one embodiment, the antibodies and antigen-binding fragments thereof of the invention that specifically bind to
- BMP6 are isolated human monoclonal antibodies.
- the antibodies and antigen-binding fragments thereof of the invention that specifically bind to BMP6 are humanized monoclonal antibodies.
- the antibodies and antigen-binding fragments thereof of the invention that specifically bind to BMP6 are isolated chimeric antibodies.
- the antibodies and antigen-binding fragments thereof of the invention comprise a human heavy chain constant region and a human light chain constant region.
- the isolated antibody or antigen-binding fragment thereof that specifically binds to BMP6 is a single chain antibody.
- the isolated antibody or antigen-binding fragment thereof that specifically binds to BMP6 is a Fab fragment.
- the isolated antibody or antigen-binding fragment thereof that specifically binds to BMP6 is a scFv.
- the antibodies of the invention are an IgM or IgG.
- the IgG is an IgGl, IgG2, IgG3, or IgG4. In one embodiment, the IgG is an IgGl.
- the isolated antibodies or antigen-binding fragments thereof comprise a framework in which amino acids have been substituted into the antibody framework from the respective human VH or VL germline sequences.
- the isolated antibody or antigen-binding fragment thereof is a component of an immunoconjugate.
- the isolated antibody or antigen-binding fragment thereof is a component of an immunoconjugate.
- immunoconjugate can comprise the isolated antibody or antigen-binding fragment thereof and any of the following, as non -limiting examples: an enzyme, toxin, hormone, growth factor, or drug.
- the isolated antibody or antigen-binding fragment thereof has altered effector function through mutation of the Fc region.
- the antibody or antigen-binding fragment thereof cross-blocks an antibody or isolated antigen-binding fragment thereof listed in Table 1.
- the isolated antibody or antigen-binding fragment thereof inhibits BMP6-induced hepcidin expression in liver cells (e.g., liver cell lines and/or primary human liver cells in vitro). In one embodiment of the present invention, the isolated antibody or antigen-binding fragment thereof inhibits BMP6-induced hepcidin expression in liver cells (e.g., liver cell lines and/or primary human liver cells in vitro) by at least about 50%. For example, the isolated antibody or antigen-binding fragment thereof inhibits BMP6-induced hepcidin expression in liver cells by at least about 50, 60, 70, 80, 90 or 100%.
- Hepcidin expression can be measured, as non-limiting examples, by measuring the amount of Hepcidin mRNA or protein levels.
- the isolated antibody or antigen-binding fragment thereof inhibits BMP6-induced hepcidin expression in liver cells (e.g., liver cell lines and/or primary human liver cells in vitro) by at least 50%.
- the isolated antibody or antigen -binding fragment thereof inhibits BMP6-induced hepcidin expression in liver cells by at least 50, 60, 70, 80, 90 or 100%.
- Hepcidin expression can be measured, as non-limiting examples, by measuring the amount of Hepcidin mRNA or protein levels.
- the isolated antibody or antigen-binding fragment thereof reduces the activity of human BMP6 in vitro. In one embodiment of the present invention, the isolated antibody or antigen-binding fragment thereof reduces the activity of human BMP6 in vitro, as measured in a HEP3B-BRE-Luc reporter gene assay.
- the invention provides an isolated antibody or antigen binding fragment thereof, which specifically binds BMP6, and which binds an epitope of human BMP6 comprising the sequence QTLVHLMNPEYVPKP (SEQ ID NO: 92, or amino acids 88 to 102 of SEQ ID NO: 89).
- the invention provides an isolated antibody or antigen binding fragment thereof, which specifically binds BMP6, and which binds an epitope of human BMP6 consisting of the sequence QTLVHLMNPEYVPKP (SEQ ID NO: 92, or amino acids 88 to 102 of SEQ ID NO: 89).
- the isolated antibody or antigen-binding fragment thereof has at least about 100-fold greater affinity for a human BMP6 epitope consisting of sequence QTLVHLMNPEYVPKP (SEQ ID NO: 92, or amino acids 88 to 102 of SEQ ID NO: 89) than to (a) a human BMP7 epitope consisting of sequence QTLVHFINPETVPKP (SEQ ID NO: 93, or amino acids 88 to 102 of SEQ ID NO: 90) or (b) a human BMP5 epitope consisting of sequence QTLVHLMFPDHVPKP (SEQ ID NO: 94, or amino acids 87 to 101 of SEQ ID NO: 91).
- the isolated antibody or antigen-binding fragment thereof has at least 100-fold greater affinity for a human BMP6 epitope consisting of sequence QTLVHLMNPEYVPKP (SEQ ID NO: 92, or amino acids 88 to 102 of SEQ ID NO: 89) than to (a) a human BMP7 epitope consisting of sequence QTLVHFINPETVPKP (SEQ ID NO: 93, or amino acids 88 to 102 of SEQ ID NO: 90) or (b) a human BMP5 epitope consisting of sequence QTLVHLMFPDHVPKP (SEQ ID NO: 94, or amino acids 87 to 101 of SEQ ID NO: 91).
- Such an isolated antibody or antigen-binding fragment thereof can comprise, as non-limiting example: (a) the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 69, 70 and 71, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 79, 80 and 81, respectively or (b) the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 72, 73 and 74, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 82, 83 and 84, respectively.
- the isolated antibody or antigen- binding fragment thereof comprises the VH sequence of SEQ ID NO: 75; and the VL sequence of SEQ ID NO: 85.
- the affinity is as measured by Biacore.
- the isolated antibody or antigen-binding fragment thereof has at least about 500-fold greater affinity for a human BMP6 epitope consisting of sequence QTLVHLMNPEYVPKP (SEQ ID NO: 92, or amino acids 88 to 102 of SEQ ID NO: 89) than to (a) a human BMP7 epitope consisting of sequence QTLVHFINPETVPKP (SEQ ID NO: 93, or amino acids 88 to 102 of SEQ ID NO: 90) or (b) a human BMP5 epitope consisting of sequence QTLVHLMFPDHVPKP (SEQ ID NO: 94, or amino acids 87 to 101 of SEQ ID NO: 91).
- Such an isolated antibody or antigen-binding fragment thereof can comprise, as non-limiting examples: (a) the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 69, 70 and 71, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 79, 80 and 81, respectively or (b) the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 72, 73 and 74, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 82, 83 and 84, respectively.
- the isolated antibody or antigen-binding fragment thereof comprises the VH sequence of SEQ ID NO: 75; and the VL sequence of SEQ ID NO: 85.
- the affinity is as measured by Biacore.
- the invention provides a composition, e.g., a pharmaceutical composition, comprising an isolated antibody or antigen-binding fragment thereof of any of the previous aspects or embodiments.
- the composition further comprises a pharmaceutically acceptable carrier. [00135] In one embodiment, the composition further comprises an additional therapeutic agent.
- the additional therapeutic agent reduces the activity of BMP6.
- the additional therapeutic agent is a siRNA, antibody or antigen-binding fragment thereof or small molecule.
- the additional therapeutic agent is selected from the group consisting of: erythropoiesis stimulating agent (ESA) and iron (e.g., supplemental dietary iron or IV iron).
- ESA erythropoiesis stimulating agent
- iron e.g., supplemental dietary iron or IV iron
- the additional therapeutic agent is erythropoiesis stimulating agent (ESA), for example EPO.
- ESA erythropoiesis stimulating agent
- the isolated antibody or antigen-binding fragment thereof described in Table 1 can be administered to a patient in need thereof in conjunction with a therapeutic method or procedure, such as described herein or known in the art.
- the isolated antibody or antigen-binding fragment thereof described in Table lean be administered before, after or coincident with a method or procedure.
- the therapeutic method or procedure is a blood transfusion. In one embodiment, the therapeutic method or procedure is dialysis. In one embodiment, the therapeutic method or procedure administration of an ESA, for example, EPO. In one embodiment, the therapeutic method or procedure is administration of iron, for example, IV iron. In one embodiment, the therapeutic method or procedure administration of an ESA, for example, EPO, and administration of iron, for example, IV iron. In one embodiment, the therapeutic method or procedure is a combination of any of the foregoing.
- the present invention includes a nucleic acid (polynucleotide) encoding any of the antibodies or antigen -binding fragments thereof described herein.
- the present invention provides a nucleic acid which encodes an isolated antibody or antigen- binding fragment thereof described in Table 1 comprising any one or more of:
- the present invention provides a nucleic acid (polynucleotide) which encodes an isolated antibody or antigen -binding fragment thereof described in Table 1 comprising an amino acid sequence comprising a sequence selected from the group consisting of:
- the present invention provides a nucleic acid (polynucleotide) which encodes an isolated antibody or antigen -binding fragment thereof described in Table 1 comprising an amino acid sequence having at least 90%, 95%, 96%, 97%, 98% or 99% sequence identity to a sequence selected from the group consisting of:
- the present invention provides a nucleic acid (polynucleotide) which encodes an isolated antibody or antigen -binding fragment thereof described in Table 1, wherein the nucleic acid comprises a sequence selected from the group consisting of:
- the present invention also provides a vector comprising such nucleic acids or polynucleotides.
- the present invention also provides a host cell comprising such nucleic acids or polynucleotides.
- the host cell is a Chinese hamster ovary (CHO) cell.
- the isolated host cells comprise a vector comprising such nucleic acids or polynucleotides.
- the present invention provides an isolated host cell comprising (1) a recombinant nucleic acid segment encoding a heavy chain of the antibodies of the invention, and (2) a second recombinant nucleic acid segment encoding a light chain of the antibodies of the invention; wherein said DNA segments are respectively operably linked to a first and a second promoter, and are capable of being expressed in said host cell.
- the isolated host cells comprises a recombinant DNA segment encoding a heavy chain, and a light chain of the antibodies of the invention, respectively, wherein said DNA segment is operably linked to a promoter, and is capable of being expressed in said host cells.
- the host cells are non-human mammalian cell line.
- the antibody or antigen-binding fragment thereof is a human monoclonal antibody, or an antigen- binding fragment thereof.
- the present invention provides the use of an antibody or antigen-binding fragment thereof to BMP6, a polynucleotide, a vector, or a host cell, as described herein, in the manufacture of a medicament.
- the present invention provides an antibody or antigen-binding fragment thereof, as described herein, for use as a medicament.
- the present invention provides an antibody or antigen-binding fragment thereof, as described herein, for use in a therapy.
- the present invention provides an antibody or antigen-binding fragment thereof, as described herein, for use in treating anemia, for example, anemia of chronic disease.
- the chronic disease is chronic kidney disease.
- the chronic disease is cancer.
- the chronic disease is inflammation.
- the patient with anemia has been or is being treated with an erythropoiesis stimulating agent (ESA), for example erythropoietin (EPO).
- ESA erythropoiesis stimulating agent
- EPO erythropoietin
- the present invention provides for methods of using the antibodies and antigen-binding fragments thereof, and compositions comprising such antibodies and antigen- binding fragments thereof, as described herein.
- the invention provides a method of reducing the activity or level of Hepcidin in a patient in need thereof, the method comprising the step of administering to the patient an antibody or antigen-binding fragment thereof to BMP6 as described herein.
- the activity or level of Hepicidin is reduced by at least 50%.
- the patient has anemia.
- the anemia is anemia of chronic disease (ACD), for example, anemia of chronic kidney disease (CKD), anemia of cancer, or anemia of inflammation.
- the anemia is erythropoiesis stimulating agent (ESA) resistant anemia, or iron-restricted anemia.
- the present invention provides a method of treating anemia in a patient in need thereof, the method comprising the step of administering to the patient an antibody or antigen-binding fragment thereof described herein.
- the anemia is anemia of chronic disease (ACD), for example, anemia of chronic kidney disease (CKD), anemia of cancer, or anemia of inflammation.
- the anemia is erythropoiesis stimulating agent (ESA) resistant anemia, or iron-restricted anemia.
- ESA erythropoiesis stimulating agent
- ESA erythropoiesis stimulating agent
- EPO erythropoietin
- the anemia is EPO-hyporesponsive anemia.
- the anemia is iron-restricted anemia.
- the patient is a chronic hemodialysis patient.
- the present invention provides a method of inhibiting BMP6 in a patient in need thereof, wherein the method comprises the step of administering to the patient an effective amount of a composition comprising an antibody or an antigen-binding fragment thereof of the invention.
- the patient has anemia.
- the anemia is anemia of chronic disease (ACD), for example, anemia of chronic kidney disease (CKD), anemia of cancer, or anemia of inflammation.
- the anemia is erythropoiesis stimulating agent (ESA) resistant anemia, or iron-restricted anemia.
- the patient is being or has been treated with an erythropoiesis stimulating agent (ESA), for example, erythropoietin (EPO).
- ESA erythropoiesis stimulating agent
- EPO erythropoietin
- the anemia is EPO-hyporesponsive anemia.
- the anemia is iron-restricted anemia.
- the patient is a chronic hemodialysis patient.
- the present invention also provides a method of reducing the activity of BMP6 in a cell, comprising the step of contacting the cell with an antibody or antigen-binding fragment thereof of the invention.
- the present invention further provides a method of increasing serum iron levels, transferrin saturation (TSAT), reticulocyte hemoglobin content (CHr), reticulocyte count, red blood cell count, hemoglobin, and/or hematocrit in a patient in need thereof, comprising the step of administering to the patient an effective amount of the antibody, or antigen-binding fragment thereof, of the invention.
- TSAT transferrin saturation
- CHr reticulocyte hemoglobin content
- reticulocyte count red blood cell count
- hemoglobin hemoglobin
- hematocrit reticulocyte count
- the present invention further provides a method of increasing or maintaining hemoglobin level in a patient, the method comprising administering to the patient an antibody or antigen- binding fragment thereof described herein.
- the patient has anemia.
- the anemia is anemia of chronic disease (A CD), for example, anemia of chronic kidney disease (CKD), anemia of cancer, or anemia of inflammation.
- the anemia is erythropoiesis stimulating agent (ESA) resistant anemia, or iron-restricted anemia.
- ESA erythropoiesis stimulating agent
- ESA erythropoiesis stimulating agent
- EPO erythropoietin
- the anemia is EPO-hyporesponsive anemia. In embodiments, the anemia is iron-restricted anemia. In embodiments, the patient is a chronic hemodialysis patient. In embodiments, the method further comprises reducing the patient's iron dose requirement, reducing the patient's EPO dose requirement, or reducing both the patient's iron dose requirement and the patient's EPO dose requirement, relative to said EPO dose requirement and/or iron dose requirement in the absence of treatment with the antibody or antigen-binding fragment described herein. In embodiments, the hemoglobin level is increased or maintained to a level at least about 10.0, at least about 11.0, or at least about 12.0 g/dL. In embodiments, the hemoglobin level is increased or maintained to a level at least 10.0, at least 11.0, or at least 12.0 g/dL.
- the step of administering to the patient an antibody or antigen-binding fragment thereof described herein comprises the step of
- composition that includes the antibody or antigen-binding fragment thereof described herein.
- the antibody or antigen-binding fragment thereof may be administered at a dose of 0.001 to 0.1 mg/kg, for example, at a dose of 0.001 mg/kg, 0.0016 mg/kg, 0.0025 mg/kg, 0.0040 mg/kg, 0.0063 mg/kg, 0.01 mg/kg, 0.016 mg/kg, 0.025 mg/kg, 0.040 mg/kg, 0.063 mg/kg, or 0.1 mg/kg.
- the antibody or antigen-binding fragment thereof may be administered at a dose of about 0.001 to about 0.1 mg/kg, for example, at a dose of about 0.001 mg/kg, about 0.0016 mg/kg, about 0.0025 mg/kg, about 0.0040 mg/kg, about 0.0063 mg/kg, about 0.01 mg/kg, about 0.016 mg/kg, about 0.025 mg/kg, about 0.040 mg/kg, about 0.063 mg/kg, or about 0.1 mg/kg.
- the antibody or antigen-binding fragment thereof is administered intravenously. In embodiments, the antibody or antigen-binding fragment thereof is administered subcutaneously. In embodiments, the antibody or antigen-binding fragment thereof is administered by infusion over a period of about 30 to about 60 minutes.
- the present invention provides an antibody or antigen-binding fragment thereof to BMP6 comprising a CDR listed in Table 1.
- the present invention provides an antibody or antigen-binding fragment thereof to BMP6 listed in Table 1.
- the present invention provides an isolated polynucleotide encoding an antibody or antigen-binding fragment thereof to BMP6 comprising a CDR listed in Table 1.
- a polynucleotide or nucleic acid is isolated.
- the antibody or antigen-binding fragment thereof is isolated.
- BMP6 means the protein Bone Morphogenetic Protein 6 (BMP6) or a gene or nucleic acid encoding BMP6. Hahn et al. 1992 Genomics 14: 759-62; Sauermann et al. 1993 J. Neurosci. Res. 33: 142-7; NCBI Gene ID: 654. BMP6 is also known as: BMP-6; VGR; VGR1; External IDs: OMIM: 112266 MGI: 88182; HomoloGene: 1300; GeneCards: BMP6 Gene. Orthologs: Species: Human: Entrez: 654; Ensembl: ENSG00000153162; UniProt:
- BMP2 means the protein Bone Morphogenetic Protein 2 (BMP2) or a gene or nucleic acid encoding BMP2.
- BMP2 is also known as: BDA2; and BMP2A; External IDs OMIM: 112261 MGI: 88177 HomoloGene: 926 GeneCards: BMP2 Gene.
- an antibody antigen-binding fragment thereof which binds to BMP2 binds to BMP2 protein.
- BMP5 means the protein Bone Morphogenetic Protein 5 (BMP5) or a gene or nucleic acid encoding BMP5.
- BMP5 is also known as: MGC34244; External IDs OMIM: 112265 MGI: 88181 HomoloGene: 22412 GeneCards: BMP5 Gene. Species: Human; Entrez: 653; Ensembl: ENSG00000112175; UniProt: P22003; RefSeq (mRNA): NM_021073; RefSeq (protein): NP 066551; Location (UCSC): Chr 6: 55.62 - 55.74 Mb.
- an antibody antigen-binding fragment thereof which binds to BMP5 binds to BMP5 protein.
- BMP7 means the protein Bone Morphogenetic Protein 7 (BMP7) or a gene or nucleic acid encoding BMP7.
- BMP7 is also known as: osteogenic protein- 1; OP-1; External IDs OMIM: 112267 MGI: 103302 HomoloGene: 20410 GeneCards: BMP7 Gene. Species: Human; Entrez: 655; Ensembl: ENSGOOOOOlOl 144; UniProt: P18075; RefSeq (mRNA): NM_001719; RefSeq (protein): NP_001710; Location (UCSC): Chr 20: 55.74 - 55.84 Mb.
- Hepcidin means the gene Hepcidin or the protein Hepcidin, a peptide hormone.
- Hepcidin is also known as: HAMP (Hepcidin anti-microbial protein or peptide); HEPC; HFE2B; LEAP1 (LEAP-1); PLTR; OMIM: 606464; HomoloGene: 81623; GeneCards: HAMP Gene; Entrez 57817; Ensembl ENSG00000105697; UniProt P81172; RefSeq (mRNA) NM_021175; RefSeq (protein) NP 066998; Location (UCSC) Chr 19: 35.77 - 35.78 Mb. Krause et al. FEBS Lett. 480: 147-150; and Pigeon et al. 2001 J. Biol. Chem.
- Anemia means a decrease in the number of red blood cells, or a decrease in the amount of hemoglobin or iron in the blood, with a decreased ability of the blood to carry oxygen.
- Anemia can be diagnosed using any method known in the art, including, as a non-limiting example, in men based on a hemoglobin of less than about 130 to 140 g L (13 to 14 g/dL) and in women, less than about 120 to 130 g/L (12 to 13 g/dL). Janz et al. 2013 Emerg. Med. Pract. 15 : 1-15; and Smith 2010 Am. J. Man. Care 16 Supp. S59-66.
- BMP6 antibody As used herein, the terms "BMP6 antibody,” “anti-human BMP6 antibody,” “BMP6- binding antibody”, “BMP6 antagonist antibody” and the like (and antigen-binding fragments thereof) include antibodies (and antigen-binding fragments thereof) which bind to the protein BMP6.
- antibody includes whole antibodies and any antigen-binding fragment (i.e., "antigen-binding portion") or single chains thereof.
- a naturally occurring "antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
- Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
- the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
- Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region.
- the light chain constant region is comprised of one domain, CL.
- the VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
- CDR complementarity determining regions
- FR framework regions
- Each VH and VL is composed of three CDRs and four FRs arranged from amino-terminus to carboxy -terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.
- the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
- antigen binding fragment refers to one or more fragments of an intact antibody that retain the ability to specifically bind to a given antigen (e.g., BMP6).
- Antigen binding functions of an antibody can be performed by fragments of an intact antibody.
- binding fragments encompassed within the term "antigen binding portion" of an antibody include a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F (ab) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; an Fd fragment consisting of the VH and CHI domains; an Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a single domain antibody (dAb) fragment (Ward et al, 1989 Nature 341 :544-546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
- Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
- F (ab) 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
- an Fd fragment consisting of the VH and CHI domains
- the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by an artificial peptide linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al., 1988 Science 242:423-426; and Huston et al., 1988 Proc. Natl. Acad. Sci. 85:5879-5883).
- Such single chain antibodies include one or more "antigen binding portions" of an antibody. These antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
- Antigen binding portions can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, 2005, Nature Biotechnology, 23, 9, 1126-1136).
- Antigen binding portions of antibodies can be grafted into scaffolds based on polypeptides such as Fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide
- Antigen binding portions can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CHl-VH-CHl) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., 1995 Protein Eng. 8
- Affinity refers to the strength of interaction between antibody and antigen at single antigenic sites. Within each antigenic site, the variable region of the antibody “arm” interacts through weak non-covalent forces with antigen at numerous sites; the more interactions, the stronger the affinity.
- the term "Avidity” refers to an informative measure of the overall stability or strength of the antibody-antigen complex. It is controlled by three major factors: antibody epitope affinity; the valency of both the antigen and antibody; and the structural arrangement of the interacting parts. Ultimately these factors define the specificity of the antibody, that is, the likelihood that the particular antibody is binding to a precise antigen epitope.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine.
- Amino acid analogs refer to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an alpha carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid.
- Amino acid mimetics refers to chemical compounds that have a structure that is different from the general chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.
- binding specificity refers to the ability of an individual antibody combining site to react with only one antigenic determinant.
- the combining site of the antibody is located in the Fab portion of the molecule and is constructed from the hypervariable regions of the heavy and light chains. Binding affinity of an antibody is the strength of the reaction between a single antigenic determinant and a single combining site on the antibody. It is the sum of the attractive and repulsive forces operating between the antigenic determinant and the combining site of the antibody.
- Specific binding between two entities means a binding with an equilibrium constant (KA or K A ) of at least 1 X 10 7 M “1 , 10 8 M “1 , 10 9 M “1 , 10 10 M “1 , or 10 11 NT 1 .
- the phrase “specifically (or selectively) binds" to an antibody refers to a binding reaction that is determinative of the presence of a cognate antigen (e.g., a human BMP6 protein) in a heterogeneous population of proteins and other biologies.
- an BMP6-binding antibody of the invention typically also has a dissociation rate constant (Kd or KD or K D ) of about 1 X 10 "2 s “1 , 1 X 10 "3 s “1 , or lower, and binds to BMP6 with an affinity that is at least two-fold greater than its affinity for binding to a non-specific antigen (e.g., BMP2, BMP5 or BMP7).
- Kd or KD or K D dissociation rate constant
- Specific binding between two entities means a binding with an equilibrium constant (KA) (kon/koff) of at least 10 2 M _1 , at least 5 X 10 2 M _1 , at least at least 5 X 10 3 M _1 , at least 10 4 M- lat least 5 X at least 5 X 10 6 M " at least 10 7 ⁇ _1 , at least 5 X 10 7 ⁇ _1 , at least 10 8 ⁇ _1 , at least 5 X 10 8 ⁇ _1 , at least 10 9 ⁇ _1 , at least 5 X at least 5 X KFlvT 1 , at least lO ⁇ M "1 , at least 5 X lO ⁇ M "1 , at least 10 13 M _1 , at least 5 X 10 13 M "1 , at least 10 14 M _1 , at least 5 X
- chimeric antibody is an antibody molecule (or antigen-binding fragment thereof) in which (a) the constant region, or a portion thereof, is altered, replaced or exchanged so that the antigen binding site (variable region) is linked to a constant region of a different or altered class, effector function and/or species, or an entirely different molecule which confers new properties to the chimeric antibody, e.g., an enzyme, toxin, hormone, growth factor, drug, etc.; or (b) the variable region, or a portion thereof, is altered, replaced or exchanged with a variable region having a different or altered antigen specificity.
- a mouse antibody can be modified by replacing its constant region with the constant region from a human immunoglobulin. Due to the replacement with a human constant region, the chimeric antibody can retain its specificity in recognizing the antigen while having reduced antigenicity in human as compared to the original mouse antibody.
- conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For instance, the codons GCA, GCC, GCG and GCU all encode the amino acid alanine. Thus, at every position where an alanine is specified by a codon, the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
- TGG which is ordinarily the only codon for tryptophan
- conservatively modified variants include individual substitutions, deletions or additions to a polypeptide sequence which result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
- the following eight groups contain amino acids that are conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
- the term "conservative sequence modifications” are used to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence.
- blocks refers to stopping or preventing an interaction or a process, e.g., stopping ligand-dependent or ligand-independent signaling.
- the term "recognize” as used herein refers to an antibody antigen-binding fragment thereof that finds and interacts (e.g., binds) with its conformational epitope.
- cross-block means the ability of an antibody or other binding agent to interfere with the binding of other antibodies or binding agents to BMP6 in a standard competitive binding assay.
- the ability or extent to which an antibody or other binding agent is able to interfere with the binding of another antibody or binding molecule to BMP6, and therefore whether it can be said to cross-block according to the invention, can be determined using standard competition binding assays.
- One suitable assay involves the use of the Biacore technology (e.g. by using the BIAcore 3000 instrument (Biacore, Uppsala, Sweden)), which can measure the extent of interactions using surface plasmon resonance technology.
- Another assay for measuring cross- blocking uses an ELISA-based approach.
- the term "neutralizes” means that an antibody, upon binding to its target, reduces the activity, level or stability of the target; e.g., a BMP6 antibody, upon binding to BMP6 neutralizes BMP6 by at least partially reducing an activity, level or stability of BMP6, such as signaling or its role in hepcidin levels and anemia.
- epitope means a protein determinant capable of specific binding to an antibody.
- Epitopes usually consist of chemically active surface groupings of molecules such as amino acids or sugar side chains and usually have specific three dimensional structural characteristics, as well as specific charge characteristics. Conformational and nonconformational epitopes are distinguished in that the binding to the former but not the latter is lost in the presence of denaturing solvents.
- epitopic determinants includes any protein determinant capable of specific binding to an immunoglobulin or otherwise interacting with a molecule.
- Epitopic determinants generally consist of chemically active surface groupings of molecules such as amino acids BMP6or carbohydrate or sugar side chains and can have specific three-dimensional structural
- An epitope may be "linear" or
- linear epitope refers to an epitope with all of the points of interaction between the protein and the interacting molecule (such as an antibody) occur linearally along the primary amino acid sequence of the protein (continuous).
- high affinity for an IgG antibody refers to an antibody having a KD of 10 "8 M or less, 10 "9 M or less, or 10 "10 M, or 10 "11 M or less for a target antigen, e.g., BMP6.
- high affinity binding can vary for other antibody isotypes.
- “high affinity” binding for an IgM isotype refers to an antibody having a KD of 10 "7 M or less, or 10 "8 M or less.
- human antibody (or antigen-binding fragment thereof), as used herein, is intended to include antibodies (and antigen-binding fragments thereof) having variable regions in which both the framework and CDR regions are derived from sequences of human origin.
- the constant region also is derived from such human sequences, e.g., human germline sequences, or mutated versions of human germline sequences.
- the human antibodies and antigen-binding fragments thereof of the invention may include amino acid residues not encoded by human sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
- monoclonal antibody or “monoclonal antibody composition” (or antigen- binding fragment thereof) as used herein refers to polypeptides, including antibodies, antibody fragments, bispecific antibodies, etc. that have substantially identical to amino acid sequence or are derived from the same genetic source. This term also includes preparations of antibody molecules of single molecular composition.
- a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
- human monoclonal antibody refers to antibodies (and antigen-binding fragments thereof) displaying a single binding specificity which have variable regions in which both the framework and CDR regions are derived from human sequences.
- the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic nonhuman animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
- recombinant human antibody includes all human antibodies (and antigen-binding fragments thereof) that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene, sequences to other DNA sequences.
- recombinant means such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectom
- Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences.
- such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
- a "humanized” antibody is an antibody (or antigen-binding fragment thereof) that retains the reactivity of a non-human antibody while being less immunogenic in humans. This can be achieved, for instance, by retaining the non-human CDR regions and replacing the remaining parts of the antibody with their human counterparts (i.e., the constant region as well as the framework portions of the variable region). See, e.g., Morrison et al, Proc. Natl. Acad. Sci. USA, 81 :6851-6855, 1984; Morrison and Oi, Adv.
- nucleic acids or polypeptide sequences refer to two or more sequences or subsequences that are the same. Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same (i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
- the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
- the identity exists over a region that is at least 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well known in the art.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, J. Mol. Biol.
- BLAST and BLAST 2.0 algorithms Two examples of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et al., Nuc. Acids Res. 25:3389-3402, 1977; and Altschul et al, J. Mol. Biol. 215:403- 410, 1990, respectively.
- Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al., supra).
- initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them.
- the word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always >0) and N (penalty score for mismatching residues; always ⁇ 0). For amino acid sequences, a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-5787, 1993).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P (N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P (N) the smallest sum probability
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01, and most preferably less than about 0.001.
- the percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl. Biosci., 4: 11-17, 1988) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
- the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (J. Mol, Biol.
- nucleic acid sequences or polypeptides are substantially identical is that the polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
- a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
- Another indication that two nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below.
- Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
- isolated antibody refers to an antibody (or antigen-binding fragment thereof) that is substantially free of other antibodies having different antigenic specificities (e.g., an isolated antibody that specifically binds BMP6 is substantially free of antibodies that specifically bind antigens other than BMP6). Moreover, an isolated antibody may be substantially free of other cellular material and/or chemicals.
- isotype refers to the antibody class (e.g., IgM, IgE, IgG such as IgGl or IgG4) that is provided by the heavy chain constant region genes. Isotype also includes modified versions of one of these classes, where modifications have been made to after the Fc function, for example, to enhance or reduce effector functions or binding to Fc receptors.
- Kassoc or “Ka” or “KA” or “K A”
- Kdis or “Kd,” as used herein, is intended to refer to the dissociation rate of a particular antibody-antigen interaction
- K D is intended to refer to the dissociation constant, which is obtained from the ratio of Kd to Ka (i.e. Kd Ka) and is expressed as a molar concentration (M).
- K D values for antibodies can be determined using methods well established in the art. A method for determining the K D of an antibody is by using surface plasmon resonance, or using a biosensor system such as a Biacore® system.
- monoclonal antibody (or antigen-binding fragment thereof) or “monoclonal antibody (or antigen-binding fragment thereof) composition” as used herein refer to a preparation of an antibody molecule (or antigen-binding fragment thereof) of single molecular composition.
- a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
- nucleic acid is used herein interchangeably with the term “polynucleotide” and refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
- the term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non- naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral- methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).
- nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081, 1991; Ohtsuka et al., J. Biol. Chem. 260:2605-2608, 1985; and Rossolini et al, Mol. Cell. Probes 8:91-98, 1994).
- operably linked refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence.
- a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
- promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis-acting.
- some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
- the term, "optimized" means that a nucleotide sequence has been altered to encode an amino acid sequence using codons that are preferred in the production cell or organism, generally a eukaryotic cell, for example, a cell of Pichia, a Chinese Hamster Ovary cell (CHO) or a human cell.
- the optimized nucleotide sequence is engineered to retain completely or as much as possible the amino acid sequence originally encoded by the starting nucleotide sequence, which is also known as the "parental" sequence.
- the optimized sequences herein have been engineered to have codons that are preferred in mammalian cells. However, optimized expression of these sequences in other eukaryotic cells or prokaryotic cells is also envisioned herein.
- the amino acid sequences encoded by optimized nucleotide sequences are also referred to as optimized.
- polypeptide and "protein” are used interchangeably herein to refer to a polymer of amino acid residues.
- the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Unless otherwise indicated, a particular polypeptide sequence also implicitly encompasses conservatively modified variants thereof.
- recombinant human antibody includes all human antibodies (and antigen-binding fragments thereof) that are prepared, expressed, created or isolated by recombinant means, such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene, sequences to other DNA sequences.
- recombinant means such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectom
- Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline immunoglobulin sequences.
- such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the VH and VL regions of the recombinant antibodies are sequences that, while derived from and related to human germline VH and VL sequences, may not naturally exist within the human antibody germline repertoire in vivo.
- recombinant host cell refers to a cell into which a recombinant expression vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject cell but to the progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or
- subject includes human and non-human animals.
- Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dog, cow, chickens, amphibians, and reptiles. Except when noted, the terms “patient” or “subject” are used herein interchangeably.
- treating includes the administration of compositions or antibodies to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease (e.g., anemia), alleviating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder.
- Treatment may be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease.
- vector is intended to refer to a polynucleotide molecule capable of transporting another polynucleotide to which it has been linked.
- vector is a polynucleotide molecule capable of transporting another polynucleotide to which it has been linked.
- Plasmid which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated.
- a viral vector Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome.
- Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors having a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) can be integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome.
- certain vectors are capable of directing the expression of genes to which they are operatively linked.
- recombinant expression vectors Such vectors are referred to herein as "recombinant expression vectors” (or simply, “expression vectors”).
- expression vectors of utility in recombinant DNA techniques are often in the form of plasmids.
- plasmid and vector may be used interchangeably as the plasmid is the most commonly used form of vector.
- the invention is intended to include such other forms of expression vectors, such as viral vectors (e.g., replication defective retroviruses, adenoviruses and adeno -associated viruses), which serve equivalent functions.
- hematocrit or “haematocrit”, as used herein, is also known as a packed cell volume (PCV) or erythrocyte volume fraction (EVF) and is the volume (%) of red blood cells in blood. This is normally about 45% for men and about 50% for women. It is considered an integral part of a person's complete blood count results, along with hemoglobin concentration, white blood count, and platelet count.
- anemia refers to an abnormally low hematocrit, as opposed to polycythemia, which is an abnormally high hematocrit.
- Fig. 1A shows inhibition of BMP activity by antagonist antibodies 5, 6 and 7 in reporter gene assay. Activity against BMP2, BMP5, BMP6, and BMP7 is shown.
- Fig. IB shows an ELISA binding assay testing Antibody 7 binding to human BMP6, human BMP7, human BMP5, mouse BMP6, hBaffR, BSA and Neu.
- Ab 5 Antibody 5
- Ab 6 Antibody 6
- Ab 7 Antibody 7.
- Fig. 2 shows the pharmacodynamics profiles of single dose rat triage PK study.
- Antibodies 5, 6 and 7 were used. Serum hepcidin and iron levels were measured at lhr, 6hr, 1, 2, 4, 8, 16 days post dose (10 mg/kg, IV).
- Fig. 3 shows dose-dependent effects of a BMP6 antibody on serum biomarkers of iron metabolism.
- Top Serum hlgG concentration over time following a single IV injection of Antibody 6 at the indicated doses.
- FIG. 4 shows therapeutic treatment of BMP6 Antibody in an ESA-resistant anemia of inflammation mouse model.
- Top Experimental scheme of BA-induced ESA-resistant anemia of inflammation model.
- Bottom Erythropoiesis parameters at 13 days after BA treatment.
- HGB hemoglobin
- HCT hematocrit
- RETA reticulocyte count
- RET-HE Reticulocyte hemoglobin equivalent.
- Fig. 5 shows linear epitope mapping by HDxMS (hydrogen/deuterium exchange coupled with mass spectometry).
- the epitope of BMP6 bound by Antibody 7 is shown (residues 88-102 of human BMP6 (QTLVHLMNPEYVPKP (SEQ ID NO: 92))).
- Antibody 676 a humanized version of a commercially available BMP6 antibody, was found to bind to an epitope consisting of residues 23-35 of human BMP6 (VSSASDYNSSELK (SEQ ID NO: 95)).
- Fig. 6 shows the protocol for Part 1 of the clinical program to investigate the safety and efficacy of BMP6 antibodies.
- Fig. 7 shows the dose adjustment decision tree for the clinical program to investigate the safety and efficacy of BMP6 antibodies.
- Fig. 8 shows the protocol for Part 2 of the clinical program to investigate the safety and efficacy of BMP6 antibodies.
- Fig. 9 shows pharmacokinetics profiles of single dose Antibody 7 in male rats.
- Fig. 10 shows dose-dependent effects of Antibody 7 on serum biomarkers of iron metabolism in rats. Shown is the quantitative analysis of serum hepcidin concentration after a single Antibody 7 or control (vehicle) injection at the indicated dose. Left panel shows an expanded view of the effects in the first 24 hours after administration.
- Fig. 11 shows dependent effects of Antibody 7 on serum iron in rats. Shown is the quantitative analysis of serum iron concentration after a single Antibody 7 or control (vehicle) injection at the indicated dose. Left panel shows an expanded view of the effects in the first 24 hours after administration.
- Fig. 12 shows the concentration-time profile of single dose IV injection of Antibody 7 (3mg/kg) in cynomolgus monkeys. Plotted is total Antibody 7 concentration (both free and BMP6-bound).
- Fig. 13 shows serum hepcidin and Fe concentration in male cynomogus monkeys after a single intravenous injection of Antibody 7 at a dose of 3 mg/kg. Data from three different monkeys is shown, together with the mean.
- the present invention provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6 protein, and pharmaceutical compositions, production methods, and methods of use of such antibodies and compositions.
- the present invention provides antibodies and antigen-binding fragments thereof that specifically bind to human BMP6.
- BMP6 a secreted BMP family growth factor ligand, has been identified as a critical endogenous regulator of hepatic expression of iron metabolism hormone hepcidin. Without being bound by any particular theory, this disclosure suggests a BMP6 antagonist antibody as a hepcidin-lowering therapy is expected to benefit patients with iron-restricted anemia by overcoming resistance to Erythropoiesis Stimulating Agent (ESA), which adds substantially to the morbidity of an underlying disease and is often a predictor of adverse outcome.
- ESA Erythropoiesis Stimulating Agent
- Antibodies 5, 6 and 7 all bind with high affinity for human BMP6, with high selectivity over human BMP7, human BMP5 and human BMP2 (see Fig. 1 A). These antibodies also all demonstrate a decrease in serum hepcidin and an increase in serum iron in rats (see Fig. 2).
- the BMP6 antagonist antibodies disclosed herein represent a novel therapeutic approach to safely improve anemia with erythropoietin hypo-responsiveness. Without being bound by any particular theory, this disclosure suggests that this may occur through mobilization and availability of iron store to the demand from erythroid compartment.
- the present invention provides isolated antibodies or antigen-binding fragments thereof that bind with a 100-, 500- or 1000-fold higher affinity for human BMP6 protein, than to any of: human BMP5 or human BMP7 protein.
- Specificity to BMP6 without binding to BMP7 is important, as knock-out of BMP6 is not lethal to mice. However, knock-out mice for BMP7 die after birth with kidney, eye and bone defects. Individual knock-outs of either gene do not alter cardiogenesis, but a double knock-out of BMP6 and BMP7 demonstrated several defects and delays in the heart; embryos died to cardiac insufficiency. BMP7 is important in preventing progression of chronic heart disease associated with fibrosis.
- Antibodies provided herein are specific to BMP6 over BMP7; See, for example, Table 4 A.
- Fig. IB also shows evidence for binding specificity to human BMP6 over human BMP2, BMP5 and BMP7 proteins.
- a commercially-available BMP6 antibody from R&D Systems for example, was revealed to have strong cross-reactivity to BMP7 in a reporter gene assay, and to inhibit both BMP6 and BMP7.
- Antibodies of the invention include, but are not limited to, the human monoclonal antibodies, isolated as described, in the Examples (see Section 6 below).
- Matured antibody 7 is derived from NOV0442_VL(YGQ) Germlining PTM removal, which is derived from parental IgG hit NOV0442 (VH3 3-15, Vll le).
- Antibody 7 binds with high affinity for human BMP6 in an ELISA binding assay, with selectivity over human BMP7 of over 500-fold (i.e., an affinity to human BMP6 over 500-fold greater than to human BMP7).
- This antibody also has no detectable activity against human BMP2 or BMP5.
- the BMP6 peptide recognized by parental IgG NOV0442 and Antibody 7 is shown in Fig. 5.
- the peptide comprises amino acids QTLVHLMNPEYVPKP (SEQ ID NO: 92) of human BMP6.
- QTLVHLMNPEYVPKP SEQ ID NO: 92
- humanized mAb507 R&D Systems
- VSSASDYNSSELK (SEQ ID NO: 95) of human BMP6.
- the epitope recognized by IgG NOV0442 and Antibody 7 represents a novel BMP6 epitope.
- Antibody 7 also inhibits BMP6 binding to receptors in vitro. Binding of BMP6 to BMPR1 A is inhibited maximally 59%;
- antibody 7 a potential post-translational modification site was removed by an N51 Q mutation within LCDR2 to increase later product homogeneity.
- the antibody derived from the VFB/lambdal framework was engineered in order to match the closest human germline sequence: in VH by a V40A mutation, in VL by D1Q, I2S mutations and introduction of amino acids Y49 and G50 to repair the framework in which these 2 residues were initially missing.
- Antibodies 3, 5, 6 and 7 all show high specificity for human BMP6 protein compared to human BMP2, BMP5 or BMP7 protein.
- the epitope of all these antibodies is predicted to be the same as they are all derived from a single parental Fab before affinity maturation.
- Antibody 5 is derived from NOV0442 (VH3 3-15, VIl_le) ⁇ NOV0442_VL(YGQ) ⁇ (HCDR2 affinity maturation) ⁇ Antibody 5.
- Antibody 3 is derived from NOV0442 (VH3 3- 15,VIl_le) ⁇ NOV0442_VL(YGS) ⁇ (HCDR2 affinity maturation) ⁇ Antibody 3. Additional details regarding the generation of the antibodies described herein are provided in the Examples.
- the present invention provides antibodies that specifically bind BMP6 (e.g., human BMP6 protein), said antibodies comprising a VH domain listed in Table 1.
- the present invention also provides antibodies that specifically bind to BMP6 protein, said antibodies comprising a VH CDPv having an amino acid sequence of any one of the VH CDRs listed in Table 1.
- the invention provides antibodies that specifically bind to BMP6 protein, said antibodies comprising (or alternatively, consisting of) one, two, three, four, five or more VH CDRs having an amino acid sequence of any of the VH CDRs listed in Table 1.
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen-binding fragments thereof comprising (or alternatively, consisting of) a VH amino acid sequence listed in Table 1 , wherein no more than about 10 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen -binding fragments thereof comprising (or alternatively, consisting of) a VH amino acid sequence listed in Table 1, wherein no more than 10 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen-binding fragments thereof comprising (or alternatively, consisting of) a VH amino acid sequence listed in Table 1 , wherein no more than about 20 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen -binding fragments thereof comprising (or alternatively, consisting of) a VH amino acid sequence listed in Table 1, wherein no more than 20 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen-binding fragments thereof comprising (or alternatively, consisting of) a VL amino acid sequence listed in Table 1 , wherein no more than about 10 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen-binding fragments thereof comprising (or alternatively, consisting of) a VL amino acid sequence listed in Table 1 , wherein no more than 10 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen-binding fragments thereof comprising (or alternatively, consisting of) a VL amino acid sequence listed in Table 1 , wherein no more than about 20 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6, said antibodies or antigen-binding fragments thereof comprising (or alternatively, consisting of) a VL amino acid sequence listed in Table 1 , wherein no more than 20 amino acids in a framework sequence (for example, a sequence which is not a CDR) have been mutated (wherein a mutation is, as various non-limiting examples, an addition, substitution or deletion).
- the present invention provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6 protein, said antibodies or antigen-binding fragments thereof comprising a VL domain listed in Table 1.
- the present invention also provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6 protein, said antibodies or antigen-binding fragments thereof comprising a VL CDR having an amino acid sequence of any one of the VL CDRs listed in Table 1.
- the invention provides antibodies and antigen-binding fragments thereof that specifically bind to BMP6 protein, said antibodies or antigen-binding fragments thereof comprising (or alternatively, consisting of) one, two, three or more VL CDRs having an amino acid sequence of any of the VL CDRs listed in Table 1.
- antibodies and antigen-binding fragments thereof of the invention include amino acids that have been mutated, yet have at least 60, 70, 80, 90 or 95 percent identity in the CDR regions with the CDR regions depicted in the sequences described in Table 1. In one embodiment, it includes mutant amino acid sequences wherein no more than 1, 2, 3, 4 or 5 amino acids have been mutated in the CDR regions when compared with the CDR regions depicted in the sequence described in Table 1.
- the present invention also provides nucleic acid sequences that encode VH, VL, the full length heavy chain, and the full length light chain of the antibodies and antigen-binding fragments thereof that specifically bind to BMP6 protein.
- Such nucleic acid sequences can be optimized for expression in mammalian cells (for example, Table 1 shows example nucleic acid sequences for the heavy chain and light chain of Antibodies 3, 5, 6 and 7).
- GCGCTCCCGGTCAGAGAGTGACTATTAGCTGCAC CGGCTCTAGCTCTAATATCGGCGCTGGCTATAGC GTGCACTGGTATCAGCAGCTGCCCGGCACCGCCC CTAAGCTGCTGATCTACGGTCAGTCAGAGCGGCC TAGCGGCGTGCCCGATAGGTTTAGCGGCTCTAAG TCAGGCACTAGCGCTAGTCTGGCTATCACCGGCC TGCAGGCTGAGGACGAGGCCGACTACTACTGTCA GTCCTGGGACTCTAGTCAGACCCTGGTGGTGTTC GGCGGAGGCACTAAGCTGACCGTGCTG
- GCGCTCCCGGTCAGAGAGTGACTATTAGCTGCAC CGGCTCTAGCTCTAATATCGGCGCTGGCTATAGC GTGCACTGGTATCAGCAGCTGCCCGGCACCGCCC CTAAGCTGCTGATCTACGGTCAGTCAGAGCGGCC TAGCGGCGTGCCCGATAGGTTTAGCGGCTCTAAG TCAGGCACTAGCGCTAGTCTGGCTATCACCGGCC TGCAGGCTGAGGACGAGGCCGACTACTACTGTCA GTCCTGGGACTCTAGTCAGACCCTGGTGGTGTTC GGCGGAGGCACTAAGCTGACCGTGCTG
- GCGCTCCCGGTCAGAGAGTGACTATTAGCTGCAC CGGCTCTAGCTCTAATATCGGCGCTGGCTATAGC GTGCACTGGTATCAGCAGCTGCCCGGCACCGCCC CTAAGCTGCTGATCTACGGTCAGTCAGAGCGGCC TAGCGGCGTGCCCGATAGGTTTAGCGGCTCTAAG TCAGGCACTAGCGCTAGTCTGGCTATCACCGGCC TGCAGGCTGAGGACGAGGCCGACTACTACTGTCA GTCCTGGGACTCTAGTCAGACCCTGGTGGTGTTC GGCGGAGGCACTAAGCTGACCGTGCTG
- antibodies and antigen-binding fragments thereof of the invention include those wherein the amino acids or nucleic acids encoding the amino acids have been mutated, yet have at least 60, 70, 80, 90 or 95 percent identity to the sequences described in Table 1. In one embodiment, it include mutant amino acid sequences wherein no more than 1, 2, 3, 4 or 5 amino acids have been mutated in the variable regions when compared with the variable regions depicted in the sequence described in Table 1, while retaining substantially the same therapeutic activity.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1,
- HCDR2 and HCDR3 sequences of SEQ ID NOs: 9, 10 and 11, respectively, and the LCDR1,
- LCDR2 and LCDR3 sequences of SEQ ID NOs: 19, 20 and 21, respectively.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1,
- HCDR2 and HCDR3 sequences of SEQ ID NOs: 12, 13 and 14, respectively, and the LCDR1,
- LCDR2 and LCDR3 sequences of SEQ ID NOs: 22, 23 and 24, respectively.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1,
- HCDR2 and HCDR3 sequences of SEQ ID NOs: 29, 30 and 31, respectively, and the LCDR1,
- LCDR2 and LCDR3 sequences of SEQ ID NOs: 39, 40 and 41, respectively.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 32, 33 and 34, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 42, 43 and 44, respectively.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 49, 50 and 51, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 59, 60 and 61, respectively.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 52, 53 and 54, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 62, 63 and 64, respectively.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 69, 70 and 71, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 79, 80 and 81, respectively.
- the present invention provides an isolated antibody or antigen-binding fragment thereof, which binds human BMP6 and comprises the HCDR1, HCDR2, and HCDR3 sequences of SEQ ID NOs: 72, 73 and 74, respectively, and the LCDR1, LCDR2, and LCDR3 sequences of SEQ ID NOs: 82, 83 and 84, respectively.
- each of these antibodies can bind to BMP6, the VH, VL, full length light chain, and full length heavy chain sequences (amino acid sequences and the nucleotide sequences encoding the amino acid sequences) can be "mixed and matched" to create other BMP6-binding antibodies and antigen-binding fragments thereof of the invention.
- Such "mixed and matched" BMP6- binding antibodies can be tested using the binding assays known in the art (e.g., ELISAs, and other assays described in the Example section). When these chains are mixed and matched, a VH sequence from a particular VH/VL pairing should be replaced with a structurally similar VH sequence.
- a full length heavy chain sequence from a particular full length heavy chain/full length light chain pairing should be replaced with a structurally similar full length heavy chain sequence.
- a VL sequence from a particular VH/VL pairing should be replaced with a structurally similar VL sequence.
- a full length light chain sequence from a particular full length heavy chain/full length light chain pairing should be replaced with a structurally similar full length light chain sequence.
- the present invention provides BMP6-binding antibodies that comprise the heavy chain and light chain CDRls, CDR2s and CDR3s as described in Table 1, or combinations thereof.
- the CDR regions are delineated using the Kabat system (Kabat et al. 1991 Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242), or using the Chothia system [Chothia et al. 1987 J. Mol. Biol. 196: 901-917; and Al-Lazikani et al. 1997 J. Mol. Biol. 273: 927-948].
- VH CDRl, 2 and 3 sequences and VL CDRl, 2 and 3 sequences can be "mixed and matched" (i.e., CDRs from different antibodies can be mixed and match, although each antibody must contain a VH CDRl , 2 and 3 and a VL CDRl, 2 and 3 to create other BMP6-binding binding molecules of the invention.
- Such "mixed and matched" BMP6-binding antibodies can be tested using the binding assays known in the art and those described in the Examples (e.g., ELISAs).
- VH CDR sequences When VH CDR sequences are mixed and matched, the CDRl, CDR2 and/or CDR3 sequence from a particular VH sequence should be replaced with a structurally similar CDR sequence (s).
- VL CDR sequences when VL CDR sequences are mixed and matched, the CDRl, CDR2 and/or CDR3 sequence from a particular VL sequence should be replaced with a structurally similar CDR sequence (s).
- novel VH and VL sequences can be created by mutating one or more VH and/or VL CDR region sequences with structurally similar sequences from the CDR sequences shown herein for monoclonal antibodies of the present invention.
- the present invention provides an isolated monoclonal antibody or antigen binding region thereof comprising a heavy chain variable region CDRl comprising an amino acid sequence selected from any of SEQ ID NOs: 29, 49, 69, 12, 32, 52, 72, or 9; a heavy chain variable region CDR2 comprising an amino acid sequence selected from any of SEQ ID NOs: 10, 30, 50, 70, 13, 33, 53, or 73; a heavy chain variable region CDR3 comprising an amino acid sequence selected from any of SEQ ID NOs: 11, 31, 51, 71, 14, 34, 54, or 74; a light chain variable region CDRl comprising an amino acid sequence selected from any of SEQ ID NOs: 19, 39, 59, 79, 22, 42, 62, or 82; a light chain variable region CDR2 comprising an amino acid sequence selected from any of SEQ ID NOs: 20, 40, 60, 80, 23, 43, 63, or 83; and a light chain variable region CDR3 comprising an amino acid sequence selected from any of
- an antibody that specifically binds to BMP6 is an antibody that is described in Table 1.
- a human antibody comprises heavy or light chain variable regions or full length heavy or light chains that are "the product of or "derived from” a particular germline sequence if the variable regions or full length chains of the antibody are obtained from a system that uses human germline immunoglobulin genes.
- Such systems include immunizing a transgenic mouse carrying human immunoglobulin genes with the antigen of interest or screening a human immunoglobulin gene library displayed on phage with the antigen of interest.
- a human antibody that is "the product of or "derived from” a human germline immunoglobulin sequence can be identified as such by comparing the amino acid sequence of the human antibody to the amino acid sequences of human germline immunoglobulins and selecting the human germline
- a human antibody that is "the product of or "derived from” a particular human germline immunoglobulin sequence may contain amino acid differences as compared to the germline sequence, due to, for example, naturally occurring somatic mutations or intentional introduction of site-directed mutations.
- a selected human antibody typically is at least 90% identical in amino acids sequence to an amino acid sequence encoded by a human germline immunoglobulin gene and contains amino acid residues that identify the human antibody as being human when compared to the germline
- a human antibody may be at least 60%, 70%, 80%, 90%, or at least 95%, or even at least 96%, 97%, 98%, or 99% identical in amino acid sequence to the amino acid sequence encoded by the germline immunoglobulin gene.
- a recombinant human antibody will display no more than 10 amino acid differences from the amino acid sequence encoded by the human germline immunoglobulin gene in the VH or VL framework regions.
- the human antibody may display no more than 5, or even no more than 4, 3, 2, or 1 amino acid difference from the amino acid sequence encoded by the germline immunoglobulin gene.
- the invention provides an antibody or binding fragment thereof that specifically binds to BMP6 is an antibody.
- the antibody or binding fragment thereof is described in Table 1.
- the antibody or binding fragment thereof specifically binds to BMP6 but not to other BMP proteins (such as BMP2, BMP5 or BMP7).
- BMP6 a secreted BMP family growth factor ligand, is a 30 kDa disulfide-linked homodimer in its mature active form.
- the protein is a member of the TGF-Beta superfamily. Bone morphogenetic proteins are known for their ability to induce the growth of bone and cartilage. BMP6 is able to induce all osteogenic markers in mesenchymal stem cells.
- BMPs bone morphogenetic proteins
- TGF- Beta transforming growth factor-beta
- BMPs were originally identified by an ability of demineralized bone extract to induce endochondral osteogenesis in vivo in an extraskeletal site. Based on its expression early in embryogenesis, the BMP encoded by this gene has a proposed role in early development. In addition, the fact that this BMP is closely related to BMP5 and BMP7 has led to speculation of possible bone inductive activity. An additional function of BMP6 has been identified as described in Nature Genetics April; 41 [4]:386-8.
- mice with a knock-out of BMP6 are viable and fertile, and show normal bone and cartilage development.
- BMP6 is the key regulator of hepcidin, the small peptide secreted by the liver which is the major regulator of iron metabolism in mammals. Hepcidin controls both the amount of dietary iron absorbed in the duodenum and iron released by reticuloendothelial cells. Hepcidin is upregulated by a variety of stimuli, including inflammation and iron overload, and downregulated by anemia, hypoxia, and iron deficiency.
- a BMP6 antagonist antibody as a hepcidin-lowering therapy is expected to benefit patients with iron- restricted anemia by overcoming resistance to Erythropoiesis Stimulating Agent (ESA), which adds substantially to the morbidity of an underlying disease and is often a predictor of adverse outcome.
- ESA Erythropoiesis Stimulating Agent
- BMP6 also binds to HJV co-receptor in liver and muscle cells.
- BMP6 is known to increase expression of hepcidin.
- Hepcidin is known to be a key hormone involved in iron homeostasis. High hepcidin levels are associated with iron restricted erythropoiesis in ACD.
- WO 2010/056981 disclosed that administration to mice of an antibody to BMP6 decreased hepcidin and increased iron.
- BMP6 is further described in the art, e.g.: Hahn et al. 1992 Genomics 14: 759-62;
- BMP2 like other bone morphogenetic proteins, plays an important role in the development of bone and cartilage. It is involved in the hedgehog pathway, TGF-Beta signaling pathway, and in cytokine-cytokine receptor interaction. It is also involved in cardiac cell differentiation and epithelial to mesenchymal transition. BMP2 has many essential roles, as noted by Kishimoto et al. 1997 Dev. 124: 4457; Ma et al. 2005 Dev. 132: 5601 ; Wang et al. Bone 48: 524; and Rosen 2009 Cyt. Growth Fact. Rev. 20: 475. It is thus preferable for a BMP6 antibody to not bind to BMP2.
- BMP2 is further described in, inter alia: Sampath et al. 1990 J. Biol. Chem. 265: 13198; Chen et al. 2004 Growth Factors 22: 233; Marie et al. 2002 Histol. Histopath. 17: 877; Nickel et al. 2001 J. Bone Joint Surg. 83-A Supp. 1 : S7-14; Kirsch et al. 2000 FEBS Lett. 468: 215; Kirsch et al. 2000 EMBO J. 19: 3314; Gilboa et al. 2000 Mol. Biol. Cell 11 : 1023.
- BMP5 is also a member of the TGF-Beta superfamily. Like other BMPs, it is known for its ability to induce bone and cartilage development. BMP5 is expressed in the trabecular meshwork and optic nerve head and may have a role in development and normal function. It is also expressed in lung and liver.
- BMP5 Additional information on BMP5 is known in the art, e.g., Hahn et al. 1992 Genomics 14: 759; Beck et al. 2003 BMC Neurosci. 2: 12; Celeste et al. 1991 Proc. Natl. Acad. Sci. USA 87: 9843; and Sakaue et al. 1996 Biochem. Biophys. Res. Comm. 221 : 768.
- BMP7 is also a member of the TGF-Beta superfamily. Like other members of the BMP family of proteins, it plays a key role in the transformation of mesenchymal cells into bone and cartilage. It induces the phosphorylation of SMAD1 and SMAD5, which in turn induce transcription of numerous osteogenic genes.
- mice with a knock-out of BMP6 are viable and fertile, and show normal bone and cartilage development.
- knock-out mice for BMP7 die after birth with kidney, eye and bone defects. Individual knock-outs of either gene do not alter cardiogenesis, but a double knock-out of BMP6 and BMP7 demonstrated several defects and delays in the heart; embryos died to cardiac insufficiency.
- BMP7 is important in preventing progression of chronic heart disease associated with fibrosis. Therefore, cross-reactivity of an anti-BMP6 antibody with BMP7 is not desirable.
- Hepcidin is a peptide hormone also known as HAMP (Hepcidin anti-microbial protein or peptide).
- the preproprotein (or preprohormone or preprohepcidin) (84 aa) and proprotein (or prohormone or prohepcidin) (60 aa) are processed into mature peptides of 20, 22 and 25 amino acids.
- the 25-aa peptide is secreted mainly by the liver and is considered the "master regulator" of iron metabolism.
- the 20- and 22-aa metabolites exist in the urine.
- the N-terminal region of Hepcidin is required for function; deletion of the 5 N-terminal amino acids results in loss of function.
- the active Hepcidin peptides are rich in cysteines, which form intramolecular bonds that stabilize their beta sheet structures.
- Hepcidin is mainly synthesized in the liver, with smaller amounts found to be synthesized in other tissues. Bekri et al. 2006 Gastroent. 131 : 788-96.
- the 25-aa Hepcidin peptide is secreted mainly by the liver and is considered the "master regulator" of iron metabolism. Hepcidin inhibits iron transport by binding to the iron export channel ferroportin, which is located on the basolateral surface of gut enterocytes and the plama membrane of reticuloendothelial cells (macrophages). By inhibiting ferroportin, hepcidin prevents enterocytes of the intestines from secreting iron ito the hepatic portal system, thereby functionally reducing iron absorption. The iron release from macrophages is also prevented by ferroportin inhibition; therefore, the hepcidin maintains iron homeostasis. Hepcidin activity is also partially responsible for iron sequestration seen in anemia of chronic inflammation such as inflammatory bowel disease, chronic heart failure, carcinomas, rheumatoid arthritis and renal failure.
- anemia of chronic inflammation such as inflammatory bowel disease, chronic heart failure, carcinomas, rheumatoid arthritis and
- hemochromatosis type 2B also known as juvenile hemochromatosis, a disease caused by severe iron overload that results in cardiomyopathy, cirrhosis, and endocrine failure.
- the majority of juvenile hemochromatosis cases are due to mutations in hemojuvelin, a regulator of hepcidin production.
- mice Genetically modified mice engineered to overexpress hepcidin die shortly after birth with severe iron deficiency, suggesting a central and not redundant role in iron regulation.
- the first evidence that linked hepcidin to anemia of inflammation came when researchers examined tissues from two patients with liver tumors with a severe microcytic anemia that did not respond to iron supplements. The tumor tissue overproduced hepcidin, and removing the tumors surgically cured the anemia.
- administration of the antibody or binding fragment thereof to BMP6 reduces the activity and/or level of Hepcidin and is thus useful in a treatment for anemia.
- the invention pertains to a method of reducing the activity or level of Hepcidin in a patient in need thereof, the method comprising the step of administering to the patient an antibody or antigen-binding fragment thereof to BMP6.
- the activity or level of Hepcidin is reduced by at least 50%.
- Inhibitors to Hepcidin can be used to treat a Hepcidin-related disease.
- Hepcidin-related diseases include: anemia, iron-deficient erythropoiesis, hypoferremia, impaired dietary iron uptake, iron sequestration, anemia of inflammation (AI), atherosclerosis, diabetes, and multiple neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease and Friedrich's ataxia, heart failure, chronic kidney disease, cardiorenal-anemia syndrome, infection, blood loss, hemolysis, vitamin B12 or folate deficiency, hyperparathyroidism, hemoglobinopathies and malignancies, cancer, AIDS, surgery, stunted growth, and/or hair loss.
- the subject is a dialysis patient.
- the Hepcidin-related disease is anemia and the subject is a dialysis patient. The prevalence of iron and ESA-refractory anemia is high in chronic hemodialysis population.
- Anemia includes, inter alia, anemia of chronic disease (A CD), anemia of chronic kidney disease (CKD), anemia of cancer, erythropoiesis stimulating agent (ESA) resistant anemia, and/or iron-restricted anemia.
- a CD anemia of chronic disease
- CKD chronic kidney disease
- ESA erythropoiesis stimulating agent
- Anemia of CKD is a common and early complication of chronic kidney disease.
- Anemia of cancer is caused by hematological malignancies and some solid tumors.
- this term also includes chemotherapy-induced anemia, which is anemia caused by
- chemotherapeutic agents Anemia in chronic kidney diseases can worsen diabetic neuropathy, cardiovascular disease, retinopathy and other problems. Cancer-related anemia is associated with increased risk of death.
- Some chronic diseases such as cancer, kidney disease and autoimmune disorders can lead to anemia.
- Overactive inflammatory cytokines can cause dysregulation of iron homeostasis, reduction of erythropoiesis, and a decrease in the life span of red blood cells.
- Some treatments for anemia include administration of an ESA, erythropoietin, iron (as a dietary supplement) or a blood transfusion.
- Hepcidin is a key hormone involved in iron homeostasis. High levels of hepcidin have been associated with iron restricted erythropoiesis in ACD. BMP6 is known to increase expression of hepcidin.
- the present invention provides an antibody or an antigen- binding fragment thereof comprising amino acid sequences that are homologous to the sequences described in Table 1, and said antibody binds to BMP6, and retains the desired functional properties of those antibodies described in Table 1.
- the invention provides an isolated monoclonal antibody (or a functional antigen-binding fragment thereof) comprising a heavy chain variable region and a light chain variable region, wherein the heavy chain variable region comprises an amino acid sequence that is at least 80%, at least 90%, or at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 16; 36; 56; or 76; the light chain variable region comprises an amino acid sequence that is at least 80%, at least 90%, or at least 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 26; 46; 66; or 86; the antibody specifically binds to BMP6 protein, and the antibody can inhibit red blood cell lysis in a hemolytic assay, wherein a hemolytic assay is known in the art.
- such antibodies have an IC 50 value in a hemolytic assay of 20-200 pM when using human BMP6- depleted serum that is reconstituted with 100 pM human B
- the VH and/or VL amino acid sequences may be 50%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequences set forth in Table 1. In one embodiment, the VH and/or VL amino acid sequences may be identical except an amino acid substitution in no more than 1, 2, 3, 4 or 5 amino acid position.
- An antibody having VH and VL regions having high (i.e., 80% or greater) identity to the VH and VL regions of those described in Table 1 can be obtained by mutagenesis (e.g., site-directed or PCR-mediated mutagenesis) of nucleic acid molecules encoding SEQ ID NOs: 16; 36; 56; or 76; and 26; 46; 66; or 86 respectively, followed by testing of the encoded altered antibody for retained function using the functional assays described herein.
- mutagenesis e.g., site-directed or PCR-mediated mutagenesis
- the full length heavy chain and/or full length light chain amino acid sequences may be 50% 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequences set forth in Table 1.
- An antibody having a full length heavy chain and full length light chain having high (i.e., 80% or greater) identity to the full length heavy chains of any of SEQ ID NOs: 18; 38; 58; or 78 and full length light chains of any of SEQ ID NOs: 28; 48; 68 or 88 respectively, can be obtained by mutagenesis (e.g., site-directed or PCR-mediated mutagenesis) of nucleic acid molecules encoding such polypeptides respectively, followed by testing of the encoded altered antibody for retained function using the functional assays described herein.
- mutagenesis e.g., site-directed or PCR-mediated mutagenesis
- the full length heavy chain and/or full length light chain nucleotide sequences may be 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequences set forth in Table 1.
- variable regions of heavy chain and/or light chain nucleotide sequences may be 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98% or 99% identical to the sequences set forth in Table 1.
- the percent identity between the two sequences is a function of the number of identical positions shared by the sequences (i.e., % identity equals number of identical positions/total number of positions X 100), taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
- the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm, as described in the non-limiting examples below.
- the protein sequences of the present invention can further be used as a "query sequence" to perform a search against public databases to, for example, identify related sequences.
- search can be performed using the BLAST program (version 2.0) of Altschul, et al, 1990 J. Mol. Biol. 215 :403-10.
- an antibody of the invention has a heavy chain variable region comprising CDR1, CDR2, and CDR3 sequences and a light chain variable region comprising CDR1, CDR2, and CDR3 sequences, wherein one or more of these CDR sequences have specified amino acid sequences based on the antibodies described herein or conservative modifications thereof, and wherein the antibodies retain the desired functional properties of the BMP6-binding antibodies and antigen-binding fragments thereof of the invention.
- the invention provides an isolated monoclonal antibody, or a functional antigen-binding fragment thereof, consisting of a heavy chain variable region comprising CDR1, CDR2, and CDR3 sequences and a light chain variable region comprising CDR1, CDR2, and CDR3 sequences, wherein: a heavy chain variable region CDR1 comprising an amino acid sequence selected from any of SEQ ID NOs: 29, 49, 69, 12, 32, 52, 72, or 9 or conservative variants thereof; a heavy chain variable region CDR2 comprising an amino acid sequence selected from any of SEQ ID NOs: 10, 30, 50, 70, 13, 33, 53, or 73 or conservative variants thereof; a heavy chain variable region CDR3 comprising an amino acid sequence selected from any of SEQ ID NOs: 11, 31, 51, 71, 14, 34, 54, or 74 or conservative variants thereof; a light chain variable region CDR1 comprising an amino acid sequence selected from any of SEQ ID NOs: 19, 39, 59, 79, 22, 42, 62, or 82 or
- an antibody of the invention optimized for expression in a mammalian cell has a full length heavy chain sequence and a full length light chain sequence, wherein one or more of these sequences have specified amino acid sequences based on the antibodies described herein or conservative modifications thereof, and wherein the antibodies retain the desired functional properties of the BMP6-binding antibodies and antigen-binding fragments thereof of the invention.
- the invention provides an isolated monoclonal antibody optimized for expression in a mammalian cell consisting of a full length heavy chain and a full length light chain wherein: the full length heavy chain has amino acid sequences selected from the group of SEQ ID NOs: 18; 38; 58; or 78, and conservative modifications thereof; and the full length light chain has amino acid sequences selected from the group of SEQ ID NOs: 28; 48; 68 or 88, and conservative modifications thereof; the antibody specifically binds to BMP6; and the antibody inhibits red blood cell lysis in a hemolytic assay as described herein.
- such antibodies have an IC 50 value in a hemolytic assay of 20-200 pM when using human BMP6-depleted serum that is reconstituted with 100 pM human BMP6.
- the present invention provides antibodies that bind to the same epitope as do the BMP6- binding antibodies listed in Table 1.
- the epitope bound by Antibody 7 is shown in Fig. 5.
- Additional antibodies can therefore be identified based on their ability to cross-compete (e.g., to competitively inhibit the binding of, in a statistically significant manner) with other antibodies and antigen-binding fragments thereof of the invention in BMP6 binding assays.
- the ability of a test antibody to inhibit the binding of antibodies and antigen-binding fragments thereof of the present invention to BMP6 protein demonstrates that the test antibody can compete with that antibody for binding to BMP6; such an antibody may, according to non-limiting theory, bind to the same or a related (e.g., a structurally similar or spatially proximal) epitope on the BMP6 as the antibody with which it competes.
- the antibody that binds to the same epitope on BMP6 as the antibodies and antigen-binding fragments thereof of the present invention is a human monoclonal antibody.
- Such human monoclonal antibodies can be prepared and isolated as described herein.
- a desired epitope on an antigen it is possible to generate antibodies to that epitope, e.g., using the techniques described in the present invention.
- the generation and characterization of antibodies may elucidate information about desirable epitopes. From this information, it is then possible to competitively screen antibodies for binding to the same epitope.
- An approach to achieve this is to conduct cross-competition studies to find antibodies that competitively bind with one another, e.g., the antibodies compete for binding to the antigen.
- a high throughput process for "binning" antibodies based upon their cross-competition is described in International Patent Application No. WO 2003/48731.
- An epitope can comprises those residues to which the antibody binds.
- antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
- Regions of a given polypeptide that include an epitope can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E.Morris, Ed., 1996) Humana Press, Totowa, New Jersey.
- linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports.
- Such techniques are known in the art and described in, e.g., U.S. Patent No.
- Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1.0 software program available from the Oxford Molecular Group.
- This computer program employs the Hopp/Woods method, Hopp et al., (1981) Proc. Natl. Acad. Sci USA 78:3824-3828; for determining antigenicity profiles, and the Kyte- Doolittle technique, Kyte et al., (1982) J.MoI. Biol. 157: 105-132; for hydropathy plots.
- An antibody of the invention further can be prepared using an antibody having one or more of the VH and/or VL sequences shown herein as starting material to engineer a modified antibody, which modified antibody may have altered properties from the starting antibody.
- An antibody can be engineered by modifying one or more residues within one or both variable regions (i.e., VH and/or VL), for example within one or more CDR regions and/or within one or more framework regions. Additionally or alternatively, an antibody can be engineered by modifying residues within the constant region (s), for example to alter the effector function (s) of the antibody.
- variable region engineering One type of variable region engineering that can be performed is CDR grafting.
- Antibodies interact with target antigens predominantly through amino acid residues that are located in the six heavy and light chain complementarity determining regions (CDRs). For this reason, the amino acid sequences within CDRs are more diverse between individual antibodies than sequences outside of CDRs. Because CDR sequences are responsible for most antibody- antigen interactions, it is possible to express recombinant antibodies that mimic the properties of specific naturally occurring antibodies by constructing expression vectors that include CDR sequences from the specific naturally occurring antibody grafted onto framework sequences from a different antibody with different properties (see, e.g., Riechmann, L. et al., 1998 Nature 332:323-327; Jones, P. et al, 1986 Nature 321 :522-525; Queen, C.
- Such framework sequences can be obtained from public DNA databases or published references that include germine antibody gene sequences.
- germine DNA sequences for human heavy and light chain variable region genes can be found in the "VBase" human germline sequence database (available on the Internet at www.mrc-cpe.cam.ac.uk/vbase), as well as in Kabat, E. A., et al., 1991 Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242; Tomlinson, I. M., et al., 1992 J. fol. Biol. 227:776-798; and Cox, J. P. L. et al, 1994 Eur. J Immunol. 24:827-836; the contents of each of which are expressly incorporated herein by reference.
- framework sequences for use in the antibodies and antigen-binding fragments thereof of the invention are those that are structurally similar to the framework sequences used by selected antibodies and antigen -binding fragments thereof of the invention, e.g., consensus sequences and/or framework sequences used by monoclonal antibodies of the invention.
- the VH CDR1, 2 and 3 sequences, and the VL CDR1, 2 and 3 sequences can be grafted onto framework regions that have the identical sequence as that found in the germline immunoglobulin gene from which the framework sequence derive, or the CDR sequences can be grafted onto framework regions that contain one or more mutations as compared to the germline sequences.
- variable region modification is to mutate amino acid residues within the VH and/or VL CDR1 , CDR2 and/or CDR3 regions to thereby improve one or more binding properties (e.g., affinity) of the antibody of interest, known as "affinity maturation.”
- Site-directed mutagenesis or PCR-mediated mutagenesis can be performed to introduce the mutation (s) and the effect on antibody binding, or other functional property of interest, can be evaluated in in vitro or in vivo assays as described herein and provided in the Examples.
- Conservative modifications (as discussed above) can be introduced.
- the mutations may be amino acid substitutions, additions or deletions. Moreover, typically no more than one, two, three, four or five residues within a CDR region are altered.
- a wide variety of antibody /immunoglobulin frameworks or scaffolds can be employed so long as the resulting polypeptide includes at least one binding region which specifically binds to BMP6.
- Such frameworks or scaffolds include the 5 main idiotypes of human immunoglobulins, antigen-binding fragments thereof, and include immunoglobulins of other animal species, preferably having humanized aspects. Single heavy-chain antibodies such as those identified in camelids are of particular interest in this regard. Novel frameworks, scaffolds and fragments continue to be discovered and developed by those skilled in the art.
- the invention pertains to a method of generating non-immunoglobulin based antibodies using non-immunoglobulin scaffolds onto which CDRs of the invention can be grafted.
- Known or future non-immunoglobulin frameworks and scaffolds may be employed, as long as they comprise a binding region specific for the target BMP6 protein.
- Non- immunoglobulin frameworks or scaffolds include, but are not limited to, fibronectin (Compound Therapeutics, Inc., Waltham, Mass.), ankyrin (Molecular Partners AG, Zurich, Switzerland), domain antibodies (Domantis, Ltd., Cambridge, Mass., and Ablynx nv, Zwijnaarde, Belgium), lipocalin (Pieris Proteolab AG, Freising, Germany), small modular immuno-pharmaceuticals (Trubion Pharmaceuticals Inc., Seattle, Wash.), maxybodies (Avidia, Inc., Mountain View, Calif.), Protein A (Affibody AG, Sweden), and affilin (gamma-crystallin or ubiquitin) (Scil Proteins GmbH, Halle, Germany).
- the fibronectin scaffolds are based on fibronectin type III domain (e.g., the tenth module of the fibronectin type III (10 Fn3 domain)).
- the fibronectin type III domain has 7 or 8 beta strands which are distributed between two beta sheets, which themselves pack against each other to form the core of the protein, and further containing loops (analogous to CDRs) which connect the beta strands to each other and are solvent exposed. There are at least three such loops at each edge of the beta sheet sandwich, where the edge is the boundary of the protein perpendicular to the direction of the beta strands (see U.S. Pat. No. 6,818,418).
- fibronectin-based scaffolds are not an immunoglobulin, although the overall fold is closely related to that of the smallest functional antibody fragment, the variable region of the heavy chain, which comprises the entire antigen recognition unit in camel and llama IgG. Because of this structure, the non- immunoglobulin antibody mimics antigen binding properties that are similar in nature and affinity for those of antibodies.
- These scaffolds can be used in a loop randomization and shuffling strategy in vitro that is similar to the process of affinity maturation of antibodies in vivo.
- These fibronectin-based molecules can be used as scaffolds where the loop regions of the molecule can be replaced with CDRs of the invention using standard cloning techniques.
- the ankyrin technology is based on using proteins with ankyrin derived repeat modules as scaffolds for bearing variable regions which can be used for binding to different targets.
- the ankyrin repeat module is a 33 amino acid polypeptide consisting of two anti-parallel alpha-helices and a beta-turn. Binding of the variable regions is mostly optimized by using ribosome display.
- Avimers are derived from natural A-domain containing protein such as LRP-1. These domains are used by nature for protein-protein interactions and in human over 250 proteins are structurally based on A-domains. Avimers consist of a number of different "A-domain” monomers (2-10) linked via amino acid linkers. Avimers can be created that can bind to the target antigen using the methodology described in, for example, U.S. Patent Application Publication Nos. 20040175756; 20050053973; 20050048512; and 20060008844.
- Affibody affinity ligands are small, simple proteins composed of a three-helix bundle based on the scaffold of one of the IgG-binding domains of Protein A.
- Protein A is a surface protein from the bacterium Staphylococcus aureus. This scaffold domain consists of 58 amino acids, 13 of which are randomized to generate affibody libraries with a large number of ligand variants (See e.g., U.S. Pat. No. 5,831,012).
- Affibody molecules mimic antibodies, they have a molecular weight of 6 kDa, compared to the molecular weight of antibodies, which is 150 kDa. In spite of its small size, the binding site of affibody molecules is similar to that of an antibody.
- Anticalins are products developed by the company Pieris ProteoLab AG. They are derived from lipocalins, a widespread group of small and robust proteins that are usually involved in the physiological transport or storage of chemically sensitive or insoluble compounds. Several natural lipocalins occur in human tissues or body liquids. The protein architecture is reminiscent of immunoglobulins, with hypervariable loops on top of a rigid framework. However, in contrast with antibodies or their recombinant fragments, lipocalins are composed of a single polypeptide chain with 160 to 180 amino acid residues, being just marginally bigger than a single immunoglobulin domain. The set of four loops, which makes up the binding pocket, shows pronounced structural plasticity and tolerates a variety of side chains.
- the binding site can thus be reshaped in a proprietary process in order to recognize prescribed target molecules of different shape with high affinity and specificity.
- One protein of lipocalin family the bilin-binding protein (BBP) of Pieris Brassicae has been used to develop anticalins by mutagenizing the set of four loops.
- BBP bilin-binding protein
- One example of a patent application describing anticalins is in PCT Publication No. WO 199916873.
- Affilin molecules are small non-immunoglobulin proteins which are designed for specific affinities towards proteins and small molecules.
- New affilin molecules can be very quickly selected from two libraries, each of which is based on a different human derived scaffold protein. Affilin molecules do not show any structural homology to immunoglobulin proteins.
- two affilin scaffolds are employed, one of which is gamma crystalline, a human structural eye lens protein and the other is "ubiquitin" superfamily proteins. Both human scaffolds are very small, show high temperature stability and are almost resistant to pH changes and denaturing agents. This high stability is mainly due to the expanded beta sheet structure of the proteins. Examples of gamma crystalline derived proteins are described in WO200104144 and examples of "ubiquitin-like" proteins are described in WO2004106368.
- PEM Protein epitope mimetics
- the human BMP6-binding antibodies can be generated using methods that are known in the art.
- the humaneering technology used to converting non-human antibodies into engineered human antibodies.
- U.S. Patent Publication No. 20050008625 describes an in vivo method for replacing a nonhuman antibody variable region with a human variable region in an antibody while maintaining the same or providing better binding characteristics relative to that of the nonhuman antibody. The method relies on epitope guided replacement of variable regions of a non-human reference antibody with a fully human antibody. The resulting human antibody is generally unrelated structurally to the reference nonhuman antibody, but binds to the same epitope on the same antigen as the reference antibody.
- the serial epitope-guided complementarity replacement approach is enabled by setting up a competition in cells between a "competitor” and a library of diverse hybrids of the reference antibody ("lest antibodies") for binding to limiting amounts of antigen in the presence of a reporter system which responds to the binding of test antibody to antigen.
- the competitor can be the reference antibody or derivative thereof such as a single-chain Fv fragment.
- the competitor can also be a natural or artificial ligand of the antigen which binds to the same epitope as the reference antibody.
- the only requirements of the competitor are that it binds to the same epitope as the reference antibody, and that it competes with the reference antibody for antigen binding.
- test antibodies have one antigen-binding V-region in common from the nonhuman reference antibody, and the other V- region selected at random from a diverse source such as a repertoire library of human antibodies.
- the common V-region from the reference antibody serves as a guide, positioning the test antibodies on the same epitope on the antigen, and in the same orientation, so that selection is biased toward the highest antigen-binding fidelity to the reference antibody.
- reporter system can be used to detect desired interactions between test antibodies and antigen.
- complementing reporter fragments may be linked to antigen and test antibody, respectively, so that reporter activation by fragment complementation only occurs when the test antibody binds to the antigen.
- reporter activation becomes dependent on the ability of the test antibody to compete with the competitor, which is proportional to the affinity of the test antibody for the antigen.
- Other reporter systems include the reactivator of an auto-inhibited reporter reactivation system (RAIR) as disclosed in U.S. patent application Ser. No. 10/208,730 (Publication No. 20030198971), or competitive activation system disclosed in U.S. patent application Ser. No. 10/076,845 (Publication No. 20030157579).
- RAIR auto-inhibited reporter reactivation system
- test antibodies are initially selected on the basis of their activity relative to that of the reference antibody when expressed as the test antibody.
- the result of the first round of selection is a set of "hybrid" antibodies, each of which is comprised of the same non -human V-region from the reference antibody and a human V-region from the library, and each of which binds to the same epitope on the antigen as the reference antibody.
- One of more of the hybrid antibodies selected in the first round will have an affinity for the antigen comparable to or higher than that of the reference antibody.
- the human V-regions selected in the first step are used as guide for the selection of human replacements for the remaining non-human reference antibody V-region with a diverse library of cognate human V-regions.
- the hybrid antibodies selected in the first round may also be used as competitors for the second round of selection.
- the result of the second round of selection is a set of fully human antibodies which differ structurally from the reference antibody, but which compete with the reference antibody for binding to the same antigen.
- Some of the selected human antibodies bind to the same epitope on the same antigen as the reference antibody.
- one or more binds to the same epitope with an affinity which is comparable to or higher than that of the reference antibody.
- mouse or chimeric BMP6-binding antibodies described above as the reference antibody, this method can be readily employed to generate human antibodies that bind to human BMP6 with the same binding specificity and the same or better binding affinity.
- human BMP6-binding antibodies can also be commercially obtained from companies which customarily produce human antibodies, e.g., KaloBios, Inc. (Mountain View, Calif).
- Certain IgG antibodies from this family of mammals as found in nature lack light chains, and are thus structurally distinct from the typical four chain quaternary structure having two heavy and two light chains, for antibodies from other animals. See PCT EP93/02214 (WO 94/04678 published 3 Mar. 1994).
- a region of the camelid antibody which is the small single variable domain identified as VHH can be obtained by genetic engineering to yield a small protein having high affinity for a target, resulting in a low molecular weight antibody-derived protein known as a "camelid nanobody”.
- VHH camelid antibody
- the camelid nanobody has a molecular weight approximately one-tenth that of a human IgG molecule, and the protein has a physical diameter of only a few nanometers.
- One consequence of the small size is the ability of camelid nanobodies to bind to antigenic sites that are functionally invisible to larger antibody proteins, i.e., camelid nanobodies are useful as reagents detect antigens that are otherwise cryptic using classical immunological techniques, and as possible therapeutic agents.
- a camelid nanobody can inhibit as a result of binding to a specific site in a groove or narrow cleft of a target protein, and hence can serve in a capacity that more closely resembles the function of a classical low molecular weight drug than that of a classical antibody.
- camelid nanobodies being extremely thermostable, stable to extreme pH and to proteolytic digestion, and poorly antigenic. Another consequence is that camelid nanobodies readily move from the circulatory system into tissues, and even cross the blood-brain barrier and can treat disorders that affect nervous tissue. Nanobodies can further facilitated drug transport across the blood brain barrier. See U.S. patent application 20040161738 published Aug. 19, 2004. These features combined with the low antigenicity to humans indicate great therapeutic potential. Further, these molecules can be fully expressed in prokaryotic cells such as E. coli and are expressed as fusion proteins with bacteriophage and are functional.
- a feature of the present invention is a camelid antibody or nanobody having high affinity for BMP6.
- the camelid antibody or nanobody is naturally produced in the camelid animal, i.e., is produced by the camelid following immunization with BMP6 or a peptide fragment thereof, using techniques described herein for other antibodies.
- the BMP6-binding camelid nanobody is engineered, i.e., produced by selection for example from a library of phage displaying appropriately mutagenized camelid nanobody proteins using panning procedures with BMP6 as a target as described in the examples herein.
- Engineered nanobodies can further be customized by genetic engineering to have a half life in a recipient subject of from 45 minutes to two weeks.
- the camelid antibody or nanobody is obtained by grafting the CDRs sequences of the heavy or light chain of the human antibodies of the invention into nanobody or single domain antibody framework sequences, as described for example in PCT/EP93/02214.
- the present invention features bispecific or multispecific molecules comprising an BMP6-binding antibody, or a fragment thereof, of the invention.
- An antibody of the invention, or antigen-binding regions thereof can be derivatized or linked to another functional molecule, e.g., another peptide or protein (e.g., another antibody or ligand for a receptor) to generate a bispecific molecule that binds to at least two different binding sites or target molecules.
- the antibody of the invention may in fact be derivatized or linked to more than one other functional molecule to generate multi-specific molecules that bind to more than two different binding sites and/or target molecules; such multi-specific molecules are also intended to be encompassed by the term "bispecific molecule" as used herein.
- an antibody of the invention can be functionally linked (e.g., by chemical coupling, genetic fusion, noncovalent association or otherwise) to one or more other binding molecules, such as another antibody, antibody fragment, peptide or binding mimetic, such that a bispecific molecule results.
- the present invention includes bispecific molecules comprising at least one first binding specificity for BMP6 and a second binding specificity for a second target epitope.
- the second target epitope is another epitope of BMP6 different from the first target epitope.
- the molecule can further include a third binding specificity, in addition to the first and second target epitope.
- the bispecific molecules of the invention comprise as a binding specificity at least one antibody, or an antibody fragment thereof, including, e.g., an Fab, Fab', F (ab')2, Fv, or a single chain Fv.
- the antibody may also be a light chain or heavy chain dimer, or any minimal fragment thereof such as a Fv or a single chain construct as described in Ladner et al. U.S. Pat. No. 4,946,778.
- Diabodies are bivalent, bispecific molecules in which VH and VL domains are expressed on a single polypeptide chain, connected by a linker that is too short to allow for pairing between the two domains on the same chain.
- the VH and VL domains pair with complementary domains of another chain, thereby creating two antigen binding sites (see e.g., Holliger et al., 1993 Proc. Natl. Acad. Sci. USA 90:6444-6448; Poijak et al., 1994 Structure 2: 1121-1123).
- Diabodies can be produced by expressing two polypeptide chains with either the structure VHA-VLB and VHB- VLA (VH-VL configuration), or VLA-VHB and VLB-VHA (VL-VH configuration) within the same cell. Most of them can be expressed in soluble form in bacteria.
- Single chain diabodies (scDb) are produced by connecting the two diabody-forming polypeptide chains with linker of approximately 15 amino acid residues (see Holliger and Winter, 1997 Cancer Immunol.
- scDb can be expressed in bacteria in soluble, active monomeric form (see Holliger and Winter, 1997 Cancer Immunol. Immunother., 45 (34): 128-30; Wu et al., 1996 Immunotechnology, 2 (l):21-36;
- a diabody can be fused to Fc to generate a "di-diabody" (see Lu et al., 2004 J. Biol. Chem., 279 (4):2856-65).
- antibodies which can be employed in the bispecific molecules of the invention are murine, chimeric and humanized monoclonal antibodies.
- the bispecific molecules of the present invention can be prepared by conjugating the constituent binding specificities, using methods known in the art. For example, each binding specificity of the bispecific molecule can be generated separately and then conjugated to one another. When the binding specificities are proteins or peptides, a variety of coupling or cross- linking agents can be used for covalent conjugation.
- cross-linking agents examples include protein A, carbodiimide, N-succinimidyl-5-acetyl-thioacetate (SATA), 5,5'-dithiobis (2- nitrobenzoic acid) (DTNB), o-phenylenedimaleimide (oPDM), N-succinimidyl-3- (2- pyridyldithio)propionate (SPDP), and sulfosuccinimidyl 4- (N-maleimidomethyl)cyclohaxane-l- carboxylate (sulfo-SMCC) (see e.g., Karpovsky et al, 1984 J. Exp. Med.
- Conjugating agents are SATA and sulfo-SMCC, both available from Pierce Chemical Co. (Rockford, 111.).
- the binding specificities are antibodies, they can be conjugated by sulfhydryl bonding of the C-terminus hinge regions of the two heavy chains.
- the hinge region is modified to contain an odd number of sulfhydryl residues, for example one, prior to conjugation.
- both binding specificities can be encoded in the same vector and expressed and assembled in the same host cell.
- This method is particularly useful where the bispecific molecule is a mAb X mAb, mAb X Fab, Fab X F (ab')2 or ligand X Fab fusion protein.
- a bispecific molecule of the invention can be a single chain molecule comprising one single chain antibody and a binding determinant, or a single chain bispecific molecule comprising two binding determinants. Bispecific molecules may comprise at least two single chain molecules. Methods for preparing bispecific molecules are described for example in U.S. Pat. No. 5,260,203; U.S. Pat. No. 5,455,030; U.S. Pat. No.
- Binding of the bispecific molecules to their specific targets can be confirmed by, for example, enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (REA), FACS analysis, bioassay (e.g., growth inhibition), or Western Blot assay.
- ELISA enzyme-linked immunosorbent assay
- REA radioimmunoassay
- FACS FACS analysis
- bioassay e.g., growth inhibition
- Western Blot assay Western Blot assay.
- Each of these assays generally detects the presence of protein-antibody complexes of particular interest by employing a labeled reagent (e.g., an antibody) specific for the complex of interest.
- the present invention provides multivalent compounds comprising at least two identical or different antigen-binding portions of the antibodies and antigen-binding fragments thereof of the invention binding to BMP6.
- the antigen-binding portions can be linked together via protein fusion or covalent or non covalent linkage. Alternatively, methods of linkage has been described for the bispecific molecules.
- Tetravalent compounds can be obtained for example by cross-linking antibodies and antigen-binding fragments thereof of the invention with an antibody or antigen-binding fragment that binds to the constant regions of the antibodies and antigen-binding fragments thereof of the invention, for example the Fc or hinge region.
- Trimerizing domain are described for example in Borean patent EP 1 012 280B1.
- Pentamerizing modules are described for example in PCT/EP97/05897.
- the present invention provides for antibodies that specifically bind to BMP6 which have an extended half-life in vivo.
- polyethyleneglycol PEG
- PEG polyethyleneglycol
- PSA polysialic acid
- HES hydroxyethyl starch
- albumin-binding ligands and carbohydrate shields
- genetic fusion to proteins binding to serum proteins such as albumin, IgG, FcRn, and transferring
- other binding moieties that bind to serum proteins, such as nanobodies, Fabs, DARPins, avimers, affibodies, and anticalins
- genetic fusion to rPEG, albumin, domain of albumin, albumin-binding proteins, and Fc or by incorporation into nancarriers, slow release formulations, or medical devices.
- inert polymer molecules such as high molecular weight PEG can be attached to the antibodies or a fragment thereof with or without a multifunctional linker either through site-specific conjugation of the PEG to the N- or C-terminus of the antibodies or via epsilon-amino groups present on lysine residues.
- the antibody, antigen-binding fragment thereof typically is reacted with
- polyethylene glycol such as a reactive ester or aldehyde derivative of PEG, under conditions in which one or more PEG groups become attached to the antibody or antibody fragment.
- the pegylation can be carried out by an acylation reaction or an alkylation reaction with a reactive PEG molecule (or an analogous reactive water-soluble polymer).
- the term "polyethylene glycol” is intended to encompass any of the forms of PEG that have been used to derivatize other proteins, such as mono (Cl-ClO)alkoxy- or aryloxy -poly ethylene glycol or polyethylene glycol-maleimide.
- the antibody to be pegylated is an aglycosylated antibody.
- Linear or branched polymer derivatization that results in minimal loss of biological activity will be used.
- the degree of conjugation can be closely monitored by SDS- PAGE and mass spectrometry to ensure proper conjugation of PEG molecules to the antibodies.
- Unreacted PEG can be separated from antibody-PEG conjugates by size-exclusion or by ion- exchange chromatography.
- PEG-derivatized antibodies can be tested for binding activity as well as for in vivo efficacy using methods well-known to those of skill in the art, for example, by immunoassays described herein. Methods for pegylating proteins are known in the art and can be applied to the antibodies and antigen-binding fragments thereof of the invention. See for example, EP 0 154 316 by Nishimura et al. and EP 0 401 384 by Ishikawa et al.
- modified pegylation technologies include reconstituting chemically orthogonal directed engineering technology (ReCODE PEG), which incorporates chemically specified side chains into biosynthetic proteins via a reconstituted system that includes tRNA synthetase and tRNA.
- ReCODE PEG chemically orthogonal directed engineering technology
- This technology enables incorporation of more than 30 new amino acids into biosynthetic proteins in E. coli, yeast, and mammalian cells.
- the tRNA incorporates a normative amino acid any place an amber codon is positioned, converting the amber from a stop codon to one that signals incorporation of the chemically specified amino acid.
- Recombinant pegylation technology rPEG can also be used for serum halflife extension.
- This technology involves genetically fusing a 300-600 amino acid unstructured protein tail to an existing pharmaceutical protein. Because the apparent molecular weight of such an unstructured protein chain is about 15 -fold larger than its actual molecular weight, the serum halflife of the protein is greatly increased. In contrast to traditional PEGylation, which requires chemical conjugation and repurification, the manufacturing process is greatly simplified and the product is homogeneous.
- PSA polymer polysialic acid
- PSA is a polymer of sialic acid (a sugar).
- sialic acid a sugar
- polysialic acid provides a protective microenvironment on conjugation. This increases the active life of the therapeutic protein in the circulation and prevents it from being recognized by the immune system.
- the PSA polymer is naturally found in the human body. It was adopted by certain bacteria which evolved over millions of years to coat their walls with it. These naturally polysialylated bacteria were then able, by virtue of molecular mimicry, to foil the body's defense system. PSA, nature's ultimate stealth technology, can be easily produced from such bacteria in large quantities and with predetermined physical characteristics. Bacterial PSA is completely non-immunogenic, even when coupled to proteins, as it is chemically identical to PSA in the human body.
- HES hydroxy ethyl starch
- Another technology include the use of hydroxy ethyl starch (“HES”) derivatives linked to antibodies.
- HES is a modified natural polymer derived from waxy maize starch and can be metabolized by the body's enzymes.
- HES solutions are usually administered to substitute deficient blood volume and to improve the rheological properties of the blood. Hesylation of an antibody enables the prolongation of the circulation half-life by increasing the stability of the molecule, as well as by reducing renal clearance, resulting in an increased biological activity.
- a wide range of HES antibody conjugates can be customized.
- Antibodies having an increased half-life in vivo can also be generated introducing one or more amino acid modifications (i.e., substitutions, insertions or deletions) into an IgG constant domain, or FcRn binding fragment thereof (preferably a Fc or hinge Fc domain fragment). See, e.g., International Publication No. WO 98/23289; International Publication No. WO 97/34631; and U.S. Pat. No. 6,277,375.
- antibodies can be conjugated to albumin in order to make the antibody or antibody fragment more stable in vivo or have a longer half life in vivo.
- the techniques are well- known in the art, see, e.g., International Publication Nos. WO 93/15199, WO 93/15200, and WO 01/77137; and European Patent No. EP 413,622.
- the strategies for increasing half life is especially useful in nanobodies, fibronectin-based binders, and other antibodies or proteins for which increased in vivo half life is desired.
- the present invention provides antibodies or antigen-binding fragments thereof that specifically bind to BMP6 recombinantly fused or chemically conjugated (including both covalent and non-covalent conjugations) to a heterologous protein or polypeptide (or antigen- binding fragment thereof, preferably to a polypeptide of at least 10, at least 20, at least 30, at least 40, at least 50, at least 60, at least 70, at least 80, at least 90 or at least 100 amino acids) to generate fusion proteins.
- the invention provides fusion proteins comprising an antigen-binding fragment of an antibody described herein (e.g., a Fab fragment, Fd fragment, Fv fragment, F (ab) 2 fragment, a VH domain, a VH CDR, a VL domain or a VL CDR) and a heterologous protein, polypeptide, or peptide.
- an antibody described herein e.g., a Fab fragment, Fd fragment, Fv fragment, F (ab) 2 fragment, a VH domain, a VH CDR, a VL domain or a VL CDR
- Methods for fusing or conjugating proteins, polypeptides, or peptides to an antibody or an antibody fragment are known in the art. See, e.g., U.S. Pat. Nos. 5,336,603, 5,622,929, 5,359,046, 5,349,053, 5,447,851, and 5,112,946; European Patent Nos.
- EP 307,434 and EP 367,166 International Publication Nos. WO 96/04388 and WO 91/06570; Ashkenazi et al., 1991, Proc. Natl. Acad. Sci. USA 88: 10535-10539; Zheng et al., 1995, J. Immunol. 154:5590-5600; and Vil et al., 1992, Proc. Natl. Acad. Sci. USA 89: 11337- 11341.
- DNA shuffling may be employed to alter the activities of antibodies and antigen- binding fragments thereof of the invention (e.g., antibodies and antigen-binding fragments thereof with higher affinities and lower dissociation rates). See, generally, U.S. Pat. Nos. 5,605,793, 5,811,238, 5,830,721, 5,834,252, and 5,837,458; Patten et al, 1997, Curr. Opinion Biotechnol.
- Antibodies and antigen- binding fragments thereof, or the encoded antibodies and antigen-binding fragments thereof, may be altered by being subjected to random mutagenesis by error-prone PCR, random nucleotide insertion or other methods prior to recombination.
- a polynucleotide encoding an antibody antigen-binding fragment thereof that specifically binds to BMP6 may be recombined with one or more components, motifs, sections, parts, domains, fragments, etc. of one or more heterologous molecules.
- the antibodies and antigen-binding fragments thereof can be fused to marker sequences, such as a peptide to facilitate purification.
- the marker amino acid sequence is a hexa-histidine peptide (SEQ ID NO: 96), such as the tag provided in a pQE vector (QIAGEN, Inc., 9259 Eton Avenue, Chatsworth, Calif, 91311), among others, many of which are commercially available.
- hexa-histidine provides for convenient purification of the fusion protein.
- peptide tags useful for purification include, but are not limited to, the hemagglutinin ("HA") tag, which corresponds to an epitope derived from the influenza hemagglutinin protein (Wilson et al., 1984, Cell 37:767), and the "flag" tag.
- HA hemagglutinin
- antibodies and antigen -binding fragments thereof of the present invention antigen-binding fragments thereof conjugated to a diagnostic or detectable agent.
- Such antibodies can be useful for monitoring or prognosing the onset, development, progression and/or severity of a disease or disorder as part of a clinical testing procedure, such as determining the efficacy of a particular therapy.
- diagnosis and detection can accomplished by coupling the antibody to detectable substances including, but not limited to, various enzymes, such as, but not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or
- acetylcholinesterase prosthetic groups, such as, but not limited to, streptavidin/biotin and avidin/biotin; fluorescent materials, such as, but not limited to, umbelliferone, fluorescein, fluorescein isothiocynate, rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride or phycoerythrin; luminescent materials, such as, but not limited to, luminol; bioluminescent materials, such as but not limited to, luciferase, luciferin, and aequorin; radioactive materials, such as, but not limited to, iodine (1311, 1251, 1231, and 1211), carbon (14C), sulfur (35S), tritium (3H), indium (115In, 113In, 112In, and 11 lln), technetium (99Tc), thallium (201Ti), gallium (68Ga, 67Ga), pal
- the present invention further encompasses uses of antibodies and antigen-binding fragments thereof conjugated to a therapeutic moiety.
- An antibody antigen-binding fragment thereof may be conjugated to a therapeutic moiety such as a cytotoxin, e.g., a cytostatic or cytocidal agent, a therapeutic agent or a radioactive metal ion, e.g., alpha-emitters.
- a cytotoxin or cytotoxic agent includes any agent that is detrimental to cells.
- an antibody antigen-binding fragment thereof may be conjugated to a therapeutic moiety or drug moiety that modifies a given biological response.
- Therapeutic moieties or drug moieties are not to be construed as limited to classical chemical therapeutic agents.
- the drug moiety may be a protein, peptide, or polypeptide possessing a desired biological activity.
- Such proteins may include, for example, a toxin such as abrin, ricin A, pseudomonas exotoxin, cholera toxin, or diphtheria toxin; a protein such as tumor necrosis factor, alpha-interferon, beta- interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, an anti-angiogenic agent; or, a biological response modifier such as, for example, a lymphokine.
- a toxin such as abrin, ricin A, pseudomonas exotoxin, cholera toxin, or diphtheria toxin
- a protein such as tumor necrosis factor, alpha-interferon, beta- interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator, an apoptotic agent, an anti-angiogenic agent
- a biological response modifier such as, for example, a lymphokine.
- an antibody can be conjugated to therapeutic moieties such as a radioactive metal ion, such as alpha-emitters such as 213Bi or macrocyclic chelators useful for conjugating radiometal ions, including but not limited to, 131In, 131LU, 131Y, 131Ho, 131Sm, to polypeptides.
- the macrocyclic chelator is 1, 4,7,10-tetraazacyclododecane- N,N',N",N"'-tetraacetic acid (DOTA) which can be attached to the antibody via a linker molecule.
- linker molecules are commonly known in the art and described in Denardo et al., 1998, Clin Cancer Res. 4 (10):2483-90; Peterson et al, 1999, Bioconjug. Chem. 10 (4):553-7; and
- Antibodies may also be attached to solid supports, which are particularly useful for immunoassays or purification of the target antigen.
- solid supports include, but are not limited to, glass, cellulose, polyacrylamide, nylon, polystyrene, polyvinyl chloride or polypropylene.
- the invention provides substantially purified nucleic acid molecules which encode polypeptides comprising segments or domains of the BMP6-binding antibody chains described above.
- Some of the nucleic acids of the invention comprise the nucleotide sequence encoding the heavy chain variable region shown in any of SEQ ID NOs: 16; 36; 56; or 76, and/or the nucleotide sequence encoding the light chain variable region shown in any of SEQ ID NOs: 26; 46; 66; or 86.
- the nucleic acid molecules are those identified in Table 1.
- nucleic acid molecules of the invention comprise nucleotide sequences that are substantially identical (e.g., at least 65, 80%, 95%, or 99%) to the nucleotide sequences of those identified in Table 1.
- polypeptides encoded by these polynucleotides are capable of exhibiting BMP6 antigen binding capacity.
- polynucleotides which encode at least one CDR region and usually all three CDR regions from the heavy or light chain of the BMP6-binding antibody set forth in Table 1. Some other polynucleotides encode all or substantially all of the variable region sequence of the heavy chain and/or the light chain of the BMP6-binding antibody set forth in Table 1. Because of the degeneracy of the code, a variety of nucleic acid sequences will encode each of the immunoglobulin amino acid sequences.
- nucleic acid molecules of the invention can encode both a variable region and a constant region of the antibody.
- nucleic acid sequences of the invention comprise nucleotides encoding a mature heavy chain variable region sequence that is substantially identical (e.g., at least 80%, 90%, or 99%) to the mature heavy chain variable region sequence set forth in any of SEQ ID NOs: 16; 36; 56; or 76.
- nucleic acid sequences comprising nucleotide encoding a mature light chain variable region sequence that is substantially identical (e.g., at least 80%, 90%, or 99%) to the mature light chain variable region sequence set forth in any of SEQ ID NOs: 26; 46; 66; or 86.
- the polynucleotide sequences can be produced by de novo solid-phase DNA synthesis or by PCR mutagenesis of an existing sequence (e.g., sequences as described in the Examples below) encoding an BMP6-binding antibody or its binding fragment.
- Direct chemical synthesis of nucleic acids can be accomplished by methods known in the art, such as the phosphotriester method of Narang et al., 1979, Meth. Enzymol. 68:90; the phosphodiester method of Brown et al., Meth. Enzymol. 68: 109, 1979; the diethylphosphoramidite method of Beaucage et al., Terra.
- Nonviral vectors and systems include plasmids, episomal vectors, typically with an expression cassette for expressing a protein or RNA, and human artificial chromosomes (see, e.g., Harrington et al., Nat Genet. 15 :345, 1997).
- nonviral vectors useful for expression of the BMP6-binding polynucleotides and polypeptides in mammalian (e.g., human) cells include pThioHis A, B & C, pcDNA3.1/His, pEBVHis A, B & C, (Invitrogen, San Diego, Calif), MPSV vectors, and numerous other vectors known in the art for expressing other proteins.
- Useful viral vectors include vectors based on retroviruses, adenoviruses, adenoassociated viruses, herpes viruses, vectors based on SV40, papilloma virus, HBP Epstein Barr virus, vaccinia virus vectors and Semliki Forest virus (SFV). See, Brent et al., supra; Smith, Annu. Rev. Microbiol. 49:807, 1995; and Rosenfeld et al., Cell 68: 143, 1992.
- expression vector depends on the intended host cells in which the vector is to be expressed.
- the expression vectors contain a promoter and other regulatory sequences (e.g., enhancers) that are operably linked to the polynucleotides encoding an BMP6- binding antibody chain antigen-binding fragment.
- enhancers e.g., an inducible promoter is employed to prevent expression of inserted sequences except under inducing conditions.
- Inducible promoters include, e.g., arabinose, lacZ, metallothionein promoter or a heat shock promoter. Cultures of transformed organisms can be expanded under noninducing conditions without biasing the population for coding sequences whose expression products are better tolerated by the host cells.
- promoters other regulatory elements may also be required or desired for efficient expression of an BMP6-binding antibody chain antigen-binding fragment. These elements typically include an ATG initiation codon and adjacent ribosome binding site or other sequences.
- the efficiency of expression may be enhanced by the inclusion of enhancers appropriate to the cell system in use (see, e.g., Scharf et al., Results Probl. Cell Differ. 20: 125, 1994; and Bittner et al., Meth. Enzymol, 153:516, 1987).
- the SV40 enhancer or CMV enhancer may be used to increase expression in mammalian host cells.
- the expression vectors may also provide a secretion signal sequence position to form a fusion protein with polypeptides encoded by inserted BMP6-binding antibody sequences. More often, the inserted BMP6-binding antibody sequences are linked to a signal sequences before inclusion in the vector.
- Vectors to be used to receive sequences encoding BMP6-binding antibody light and heavy chain variable domains sometimes also encode constant regions or parts thereof. Such vectors allow expression of the variable regions as fusion proteins with the constant regions thereby leading to production of intact antibodies and antigen -binding fragments thereof.
- such constant regions are human.
- the host cells for harboring and expressing the BMP6-binding antibody chains can be either prokaryotic or eukaryotic.
- E. coli is one prokaryotic host useful for cloning and expressing the polynucleotides of the present invention.
- Other microbial hosts suitable for use include bacilli, such as Bacillus subtilis, and other enterobacteriaceae, such as Salmonella, Serratia, and various Pseudomonas species.
- bacilli such as Bacillus subtilis
- enterobacteriaceae such as Salmonella, Serratia, and various Pseudomonas species.
- expression vectors which typically contain expression control sequences compatible with the host cell (e.g., an origin of replication).
- any number of a variety of well-known promoters will be present, such as the lactose promoter system, a tryptophan (trp) promoter system, a beta-lactamase promoter system, or a promoter system from phage lambda.
- the promoters typically control expression, optionally with an operator sequence, and have ribosome binding site sequences and the like, for initiating and completing transcription and translation.
- Other microbes, such as yeast can also be employed to express BMP6-binding polypeptides of the invention. Insect cells in combination with baculovirus vectors can also be used.
- mammalian host cells are used to express and produce the BMP6- binding polypeptides of the present invention.
- they can be either a hybridoma cell line expressing endogenous immunoglobulin genes (e.g., the 1D6.C9 myeloma hybridoma clone as described in the Examples) or a mammalian cell line harboring an exogenous expression vector (e.g., the SP2/0 myeloma cells exemplified below).
- endogenous immunoglobulin genes e.g., the 1D6.C9 myeloma hybridoma clone as described in the Examples
- an exogenous expression vector e.g., the SP2/0 myeloma cells exemplified below.
- a number of suitable host cell lines capable of secreting intact immunoglobulins have been developed including the CHO cell lines, various Cos cell lines, HeLa cells, myeloma cell lines, transformed B-cells and hybridomas.
- the use of mammalian tissue cell culture to express polypeptides is discussed generally in, e.g., Winnacker, FROM GENES TO CLONES, VCH Publishers, N.Y., N.Y., 1987.
- Expression vectors for mammalian host cells can include expression control sequences, such as an origin of replication, a promoter, and an enhancer (see, e.g., Queen, et al., Immunol. Rev.
- expression vectors usually contain promoters derived from mammalian genes or from mammalian viruses. Suitable promoters may be constitutive, cell type-specific, stage-specific, and/or modulatable or regulatable.
- Useful promoters include, but are not limited to, the metallothionein promoter, the constitutive adenovirus major late promoter, the dexamethasone-inducible MMTV promoter, the SV40 promoter, the MRP poIIII promoter, the constitutive MPSV promoter, the tetracycline- inducible CMV promoter (such as the human immediate-early CMV promoter), the constitutive CMV promoter, and promoter-enhancer combinations known in the art.
- Methods for introducing expression vectors containing the polynucleotide sequences of interest vary depending on the type of cellular host. For example, calcium chloride transfection is commonly utilized for prokaryotic cells, whereas calcium phosphate treatment or electroporation may be used for other cellular hosts. (See generally Sambrook, et al., supra).
- Other methods include, e.g., electroporation, calcium phosphate treatment, liposome-mediated transformation, injection and microinjection, ballistic methods, virosomes, immunoliposomes, polycation:nucleic acid conjugates, naked DNA, artificial virions, fusion to the herpes virus structural protein VP22 (Elliot and O'Hare, Cell 88:223, 1997), agent-enhanced uptake of DNA, and ex vivo transduction. For long-term, high-yield production of recombinant proteins, stable expression will often be desired.
- cell lines which stably express BMP6-binding antibody chains or binding fragments can be prepared using expression vectors of the invention which contain viral origins of replication or endogenous expression elements and a selectable marker gene. Following the introduction of the vector, cells may be allowed to grow for 1-2 days in an enriched media before they are switched to selective media.
- the purpose of the selectable marker is to confer resistance to selection, and its presence allows growth of cells which successfully express the introduced sequences in selective media.
- Resistant, stably transfected cells can be proliferated using tissue culture techniques appropriate to the cell type.
- Monoclonal antibodies can be produced by a variety of techniques, including conventional monoclonal antibody methodology e.g., the standard somatic cell hybridization technique of Kohler and Milstein, 1975 Nature 256: 495. Many techniques for producing monoclonal antibody can be employed e.g., viral or oncogenic transformation of B lymphocytes.
- An animal system for preparing hybridomas is the murine system. Hybridoma production in the mouse is a well established procedure. Immunization protocols and techniques for isolation of immunized splenocytes for fusion are known in the art. Fusion partners (e.g., murine myeloma cells) and fusion procedures are also known. [00458] Chimeric or humanized antibodies and antigen-binding fragments thereof of the present invention can be prepared based on the sequence of a murine monoclonal antibody prepared as described above.
- DNA encoding the heavy and light chain immunoglobulins can be obtained from the murine hybridoma of interest and engineered to contain non-murine (e.g., human) immunoglobulin sequences using standard molecular biology techniques.
- the murine variable regions can be linked to human constant regions using methods known in the art (see e.g., U.S. Pat. No. 4,816,567 to Cabilly et al.).
- the murine CDR regions can be inserted into a human framework using methods known in the art. See e.g., U.S. Pat. No. 5,225,539 to Winter, and U.S. Pat. Nos.
- the antibodies of the invention are human monoclonal antibodies.
- Such human monoclonal antibodies directed against BMP6 can be generated using transgenic or transchromosomic mice carrying parts of the human immune system rather than the mouse system.
- transgenic and transchromosomic mice include mice referred to herein as HuMAb mice and KM mice, respectively, and are collectively referred to herein as "human Ig mice.”
- the HuMAb Mouse® (Medarex, Inc.) contains human immunoglobulin gene miniloci that encode un-rearranged human heavy (mu and gamma) and kappa light chain immunoglobulin sequences, together with targeted mutations that inactivate the endogenous mu and kappa chain loci (see e.g., Lonberg, et al., 1994 Nature 368 (6474): 856-859). Accordingly, the mice exhibit reduced expression of mouse IgM or K, and in response to immunization, the introduced human heavy and light chain transgenes undergo class switching and somatic mutation to generate high affinity human IgG-kappa monoclonal (Lonberg, N.
- human antibodies of the invention can be raised using a mouse that carries human immunoglobulin sequences on transgenes and transchomosomes such as a mouse that carries a human heavy chain transgene and a human light chain transchromosome.
- KM mice a mouse that carries a human heavy chain transgene and a human light chain transchromosome.
- transgenic animal systems expressing human immunoglobulin genes are available in the art and can be used to raise BMP6-binding antibodies and antigen- binding fragments thereof of the invention.
- an alternative transgenic system referred to as the Xenomouse can be used.
- Such mice are described in, e.g., U.S. Pat. Nos. 5,939,598; 6,075,181; 6,114,598; 6,150,584 and 6,162,963 to Kucherlapati et al.
- mice carrying both a human heavy chain transchromosome and a human light chain transchromosome referred to as "TC mice” can be used; such mice are described in Tomizuka et al., 2000 Proc. Natl. Acad. Sci. USA 97:722-727.
- cows carrying human heavy and light chain transchromosomes have been described in the art (Kuroiwa et al., 2002 Nature Biotechnology 20:889-894) and can be used to raise BMP6-binding antibodies of the invention.
- Human monoclonal antibodies of the invention can also be prepared using phage display methods for screening libraries of human immunoglobulin genes. Such phage display methods for isolating human antibodies are established in the art or described in the examples below. See for example: U.S. Pat. Nos. 5,223,409; 5,403,484; and 5,571,698 to Ladner et al; U.S. Pat. Nos. 5,427,908 and 5,580,717 to Dower et al; U.S. Pat. Nos. 5,969,108 and 6,172,197 to McCafferty et al; and U.S. Pat. Nos. 5,885,793; 6,521,404; 6,544,731; 6,555,313; 6,582,915 and 6,593,081 to Griffiths et al.
- Human monoclonal antibodies of the invention can also be prepared using SCID mice into which human immune cells have been reconstituted such that a human antibody response can be generated upon immunization. Such mice are described in, for example, U.S. Pat. Nos.
- Engineered antibodies and antigen-binding fragments thereof of the invention include those in which modifications have been made to framework residues within VH and/or VL, e.g. to improve the properties of the antibody. Typically such framework modifications are made to decrease the immunogenicity of the antibody.
- one approach is to "backmutate" one or more framework residues to the corresponding germline sequence. More specifically, an antibody that has undergone somatic mutation may contain framework residues that differ from the germline sequence from which the antibody is derived. Such residues can be identified by comparing the antibody framework sequences to the germline sequences from which the antibody is derived. To return the framework region sequences to their germline configuration, the somatic mutations can be "backmutated" to the germline sequence by, for example, site-directed mutagenesis. Such "backmutated” antibodies are also intended to be encompassed by the invention.
- Another type of framework modification involves mutating one or more residues within the framework region, or even within one or more CDR regions, to remove T cell-epitopes to thereby reduce the potential immunogenicity of the antibody. This approach is also referred to as "deimmunization" and is described in further detail in U.S. Patent Publication No. 20030153043 by Carr et al.
- antibodies of the invention may be engineered to include modifications within the Fc region, typically to alter one or more functional properties of the antibody, such as serum half-life, complement fixation, Fc receptor binding, and/or antigen-dependent cellular cytotoxicity.
- an antibody of the invention may be chemically modified (e.g., one or more chemical moieties can be attached to the antibody) or be modified to alter its glycosylation, again to alter one or more functional properties of the antibody.
- chemically modified e.g., one or more chemical moieties can be attached to the antibody
- modify its glycosylation again to alter one or more functional properties of the antibody.
- the hinge region of CHI is modified such that the number of cysteine residues in the hinge region is altered, e.g., increased or decreased.
- This approach is described further in U.S. Pat. No. 5,677,425 by Bodmer et al.
- the number of cysteine residues in the hinge region of CHI is altered to, for example, facilitate assembly of the light and heavy chains or to increase or decrease the stability of the antibody.
- the Fc hinge region of an antibody is mutated to decrease the biological half-life of the antibody. More specifically, one or more amino acid mutations are introduced into the CH2-CH3 domain interface region of the Fc-hinge fragment such that the antibody has impaired Staphylococcyl protein A (SpA) binding relative to native Fc-hinge domain SpA binding.
- SpA Staphylococcyl protein A
- the antibody is modified to increase its biological half -life.
- Various approaches are possible. For example, one or more of the following mutations can be introduced: T252L, T254S, T256F, as described in U.S. Pat. No. 6,277,375 to Ward.
- the antibody can be altered within the CHI or CL region to contain a salvage receptor binding epitope taken from two loops of a CH2 domain of an Fc region of an IgG, as described in U.S. Pat. Nos. 5,869,046 and 6,121,022 by Presta et al.
- the Fc region is altered by replacing at least one amino acid residue with a different amino acid residue to alter the effector functions of the antibody.
- one or more amino acids can be replaced with a different amino acid residue such that the antibody has an altered affinity for an effector ligand but retains the antigen -binding ability of the parent antibody.
- the effector ligand to which affinity is altered can be, for example, an Fc receptor or the CI component of complement. This approach is described in further detail in U.S. Pat. Nos. 5,624,821 and 5,648,260, both by Winter et al.
- one or more amino acids selected from amino acid residues can be replaced with a different amino acid residue such that the antibody has altered Clq binding and/or reduced or abolished complement dependent cytotoxicity (CDC).
- CDC complement dependent cytotoxicity
- one or more amino acid residues are altered to thereby alter the ability of the antibody to fix complement. This approach is described further in PCT Publication WO 94/29351 by Bodmer et al.
- the Fc region is modified to increase the ability of the antibody to mediate antibody dependent cellular cytotoxicity (ADCC) and/or to increase the affinity of the antibody for an Fc-gamma receptor by modifying one or more amino acids.
- ADCC antibody dependent cellular cytotoxicity
- This approach is described further in PCT Publication WO 00/42072 by Presta.
- the binding sites on human IgGl for Fc-gamma PJ, Fc-gamma RII, Fc-gamma PJII and FcRn have been mapped and variants with improved binding have been described (see Shields, R. L. et al., 2001 J. Biol. Chen. 276:6591-6604).
- the glycosylation of an antibody is modified.
- an aglycoslated antibody can be made (i.e., the antibody lacks glycosylation).
- Glycosylation can be altered to, for example, increase the affinity of the antibody for "antigen" .
- Such carbohydrate modifications can be accomplished by, for example, altering one or more sites of glycosylation within the antibody sequence.
- one or more amino acid substitutions can be made that result in elimination of one or more variable region framework glycosylation sites to thereby eliminate glycosylation at that site.
- Such aglycosylation may increase the affinity of the antibody for antigen.
- Such an approach is described in further detail in U.S. Pat. Nos. 5,714,350 and 6,350,861 by Co et al.
- an antibody can be made that has an altered type of glycosylation, such as a hypofucosylated antibody having reduced amounts of fucosyl residues or an antibody having increased bisecting GlcNac structures.
- Such altered glycosylation patterns have been demonstrated to increase the ADCC ability of antibodies.
- carbohydrate modifications can be accomplished by, for example, expressing the antibody in a host cell with altered glycosylation machinery. Cells with altered glycosylation machinery have been described in the art and can be used as host cells in which to express recombinant antibodies of the invention to thereby produce an antibody with altered glycosylation. For example, EP 1,176,195 by Hang et al.
- the BMP6 -binding antibodies having VH and VL sequences or full length heavy and light chain sequences shown herein can be used to create new BMP6-binding antibodies by modifying full length heavy chain and/or light chain sequences, VH and/or VL sequences, or the constant region (s) attached thereto.
- the structural features of BMP6-binding antibody of the invention are used to create structurally related BMP6-binding antibodies that retain at least one functional property of the antibodies and antigen-binding fragments thereof of the invention, such as binding to human BMP6 and also inhibiting one or more functional properties of BMP6 (e.g., inhibit red blood cell lysis in a hemolytic assay).
- one or more CDR regions of the antibodies and antigen-binding fragments thereof of the present invention, or mutations thereof, can be combined recombinantly with known framework regions and/or other CDRs to create additional, recombinantly-engineered, BMP6-binding antibodies and antigen-binding fragments thereof of the invention, as discussed above.
- Other types of modifications include those described in the previous section.
- the starting material for the engineering method is one or more of the VH and/or VL sequences provided herein, or one or more CDR regions thereof.
- the engineered antibody it is not necessary to actually prepare (i.e., express as a protein) an antibody having one or more of the VH and/or VL sequences provided herein, or one or more CDR regions thereof. Rather, the information contained in the sequence (s) is used as the starting material to create a "second generation" sequence (s) derived from the original sequence (s) and then the "second generation” sequence (s) is prepared and expressed as a protein.
- the altered antibody sequence can also be prepared by screening antibody libraries having fixed CDR3 sequences or minimal essential binding determinants as described in US20050255552 and diversity on CDR1 and CDR2 sequences.
- the screening can be performed according to any screening technology appropriate for screening antibodies from antibody libraries, such as phage display technology.
- Standard molecular biology techniques can be used to prepare and express the altered antibody sequence.
- the antibody encoded by the altered antibody sequence (s) is one that retains one, some or all of the functional properties of the BMP6-binding antibodies described herein, which functional properties include, but are not limited to, specifically binding to human BMP6 protein; and the antibody inhibit red blood cell lysis in a hemolytic assay.
- the functional properties of the altered antibodies can be assessed using standard assays available in the art and/or described herein, such as those set forth in the Examples (e.g., ELISAs).
- mutations can be introduced randomly or selectively along all or part of an BMP6-binding antibody coding sequence and the resulting modified BMP6-binding antibodies can be screened for binding activity and/or other functional properties as described herein.
- Mutational methods have been described in the art.
- PCT Publication WO 02/092780 by Short describes methods for creating and screening antibody mutations using saturation mutagenesis, synthetic ligation assembly, or a combination thereof.
- PCT Publication WO 03/074679 by Lazar et al. describes methods of using computational screening methods to optimize physiochemical properties of antibodies.
- the antibodies and antigen-binding fragments thereof of the invention can be characterized by various functional assays. For example, they can be characterized by their ability to inhibit BMP6.
- the ability of an antibody to bind to BMP6 can be detected by labelling the antibody of interest directly, or the antibody may be unlabelled and binding detected indirectly using various sandwich assay formats known in the art.
- the BMP6-binding antibodies and antigen-binding fragments thereof of the invention block or compete with binding of a reference BMP6-binding antibody to BMP6 polypeptide.
- BMP6-binding antibodies can be fully human BMP6-binding antibodies described above. They can also be other mouse, chimeric or humanized BMP 6 -binding antibodies which bind to the same epitope as the reference antibody.
- the capacity to block or compete with the reference antibody binding indicates that BMP6-binding antibody under test binds to the same or similar epitope as that defined by the reference antibody, or to an epitope which is sufficiently proximal to the epitope bound by the reference BMP6-binding antibody.
- Such antibodies are especially likely to share the advantageous properties identified for the reference antibody.
- the capacity to block or compete with the reference antibody may be determined by, e.g., a competition binding assay.
- a competition binding assay the antibody under test is examined for ability to inhibit specific binding of the reference antibody to a common antigen, such as BMP6 polypeptide.
- a test antibody competes with the reference antibody for specific binding to the antigen if an excess of the test antibody substantially inhibits binding of the reference antibody.
- Substantial inhibition means that the test antibody reduces specific binding of the reference antibody usually by at least 10%, 25%, 50%, 75%, or 90%.
- solid phase direct labeled assay solid phase direct labeled sandwich assay (see Harlow & Lane, supra); solid phase direct label RIA using 1-125 label (see Morel et al., Molec. Immunol. 25 :7-15, 1988); solid phase direct biotin-avidin EIA (Cheung et al., Virology 176:546-552, 1990); and direct labeled RIA (Moldenhauer et al, Scand. J. Immunol. 32:77-82, 1990).
- such an assay involves the use of purified antigen bound to a solid surface or cells bearing either of these, an unlabelled test BMP6-binding antibody and a labelled reference antibody.
- Antibodies identified by competition assay include antibodies binding to the same epitope as the reference antibody and antibodies binding to an adjacent epitope sufficiently proximal to the epitope bound by the reference antibody for steric hindrance to occur.
- each antibody can be biotinylated using commercially available reagents (e.g., reagents from Pierce, Rockford, 111.). Competition studies using unlabeled monoclonal antibodies and biotinylated monoclonal antibodies can be performed using BMP6 polypeptide coated-ELISA plates. Biotinylated MAb binding can be detected with a strep-avidin-alkaline phosphatase probe. To determine the isotype of a purified BMP6-binding antibody, isotype ELISAs can be performed.
- wells of microtiter plates can be coated with 1 ⁇ g/ml of anti-human IgG overnight at 4 degrees C. After blocking with 1% BSA, the plates are reacted with 1 ⁇ g/ml or less of the monoclonal BMP6-binding antibody or purified isotype controls, at ambient temperature for one to two hours. The wells can then be reacted with either human IgGl or human IgM-specific alkaline phosphatase-conjugated probes. Plates are then developed and analyzed so that the isotype of the purified antibody can be determined.
- BMP6-binding antibodies to live cells expressing BMP6 polypeptide
- flow cytometry can be used. Briefly, cell lines expressing BMP6 (grown under standard growth conditions) can be mixed with various concentrations of BMP6-binding antibody in PBS containing 0.1% BSA and 10% fetal calf serum, and incubated at 37 degrees C. for 1 hour. After washing, the cells are reacted with Fluorescein-labeled anti-human IgG antibody under the same conditions as the primary antibody staining. The samples can be analyzed by FACScan instrument using light and side scatter properties to gate on single cells.
- An alternative assay using fluorescence microscopy may be used (in addition to or instead of) the flow cytometry assay.
- Cells can be stained exactly as described above and examined by fluorescence microscopy. This method allows visualization of individual cells, but may have diminished sensitivity depending on the density of the antigen.
- BMP6-binding antibodies and antigen-binding fragments thereof of the invention can be further tested for reactivity with BMP6 polypeptide or antigenic fragment by Western blotting. Briefly, purified BMP6 polypeptides or fusion proteins, or cell extracts from cells expressing BMP6 can be prepared and subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis. After electrophoresis, the separated antigens are transferred to nitrocellulose membranes, blocked with 10% fetal calf serum, and probed with the monoclonal antibodies to be tested. Human IgG binding can be detected using anti-human IgG alkaline phosphatase and developed with BCIP/NBT substrate tablets (Sigma Chem. Co., St. Louis, Mo.).
- the present invention provides methods of treating a disease or disorder associated with increased BMP6 activity by administering to a subject in need thereof an effective amount of the antibodies and antigen -binding fragments thereof of the invention.
- the present invention provides a method of treating anemia by administering to a subject in need thereof an effective amount of the antibodies and antigen-binding fragments thereof of the invention.
- the antibodies and antigen-binding fragments thereof of the invention can be used, inter alia, to prevent progression of anemia. It can also be used in combination with other therapies for the treatment of anemia patients.
- the present invention provides methods of treating a BMP6 related disease or disorder by administering to a subject in need thereof an effective amount of the antibodies and antigen -binding fragments thereof of the invention.
- BMP6 related diseases or disorders include: anemia, including, as non-limiting examples: anemia of chronic disease (ACD), anemia of (e.g., associated with) chronic kidney disease (CKD), anemia of cancer, anemia of inflammation, erythropoiesis stimulating agent (ESA) resistant anemia (for example erythropoietin (EPO) resistant anemia, ESA hyporesponsive anemia (for example, EPO hyporesponsive anemia), functional iron-deficiency anemia, and/or iron-restricted anemia.
- ACD anemia of chronic disease
- CKD chronic kidney disease
- ESA erythropoiesis stimulating agent
- ESA erythropoietin
- ESA hyporesponsive anemia for example, EPO hyporesponsive anemia
- functional iron-deficiency anemia and/
- the present invention provides methods of treating a BMP6 related disease or disorder by administering to a subject in need thereof an effective amount of the antibodies and antigen -binding fragments thereof of the invention, wherein said disease or disorder is anemia.
- the anemia is anemia of chronic disease.
- the chronic disease is chronic kidney disease.
- the chronic disease is cancer.
- the chronic disease is inflammation.
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia e.g., the anemia of chronic disease
- the subject is a chronic hemodialysis (HD) subject.
- the subject has renal disease, for example, end-stage renal disease.
- the present invention provides methods of treating a BMP6 related disease or disorder by administering to a subject in need thereof an effective amount of an antibody and antigen-binding fragment thereof of the invention, wherein said disease or disorder is functional iron deficiency anemia.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patients.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient with chronic kidney disease.
- the present invention provides methods of treating anemia by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention.
- the present invention provides methods of treating anemia by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention.
- the anemia is anemia of chronic kidney disease.
- the anemia is ESA (for example, EPO)- resistant anemia.
- the anemia is ESA (for example, EPO)-hyporesponsive anemia.
- the anemia is iron-restricted anemia.
- the anemia is anemia associated with kidney disease, for example, chronic kidney disease.
- the subject is a chronic hemodialysis (HD) subject.
- the subject has renal disease, for example, end-stage renal disease.
- the present invention provides methods of treating a BMP6 related disease or disorder by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention, wherein said disease or disorder is functional iron deficiency anemia.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patients.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient with chronic kidney disease.
- the present invention provides methods of treating anemia.
- the present invention provides a method for reducing a subject's ESA (for example, EPO) dosing needs by administering to a subject in need thereof an effective amount of an antibody or antigen -binding fragment thereof of the invention.
- the anemia is anemia of chronic disease.
- the chronic disease is chronic kidney disease.
- the chronic disease is cancer.
- the chronic disease is inflammation.
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO-hyporesponsive anemia.
- the anemia e.g., the anemia of chronic disease
- the subject is a chronic hemodialysis (HD) subject.
- the subject has renal disease, for example, end-stage renal disease.
- the present invention provides methods of reducing s subject's ESA (for example, EPO) dosing needs by administering to a subject in need thereof an effective amount of an antibody or antigen -binding fragment thereof of the invention, wherein said subject has functional iron deficiency anemia.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient with chronic kidney disease.
- the present invention provides a method for reducing a subject's ESA (for example, EPO) dosing needs by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention.
- the subject has anemia.
- the anemia is anemia of chronic disease.
- the chronic disease is chronic kidney disease.
- the chronic disease is cancer.
- the chronic disease is inflammation.
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia of chronic disease is ESA (for example, EPO)- hyporesponsive anemia.
- the anemia e.g., the anemia of chronic disease
- the subject is a chronic hemodialysis (HD) subject.
- the subject has renal disease, for example, end-stage renal disease.
- the present invention provides methods of reducing s subject's ESA (for example, EPO) dosing needs by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention, wherein said subject has functional iron deficiency anemia.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient with chronic kidney disease.
- the present invention provides a method for reducing a subject's iron (for example, IV iron) dosing needs by administering to a subject in need thereof an effective amount of the antibodies and antigen-binding fragments thereof of the invention.
- the subject has anemia.
- the anemia is anemia of chronic disease.
- the chronic disease is chronic kidney disease.
- the chronic disease is cancer.
- the chronic disease is inflammation.
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO- hyporesponsive anemia.
- the anemia e.g., the anemia of chronic disease
- the subject is a chronic hemodialysis (HD) subject.
- the subject has renal disease, for example, end-stage renal disease.
- the present invention provides methods of reducing s subject's iron (for example, IV iron) dosing needs by administering to a subject in need thereof an effective amount of the antibodies and antigen-binding fragments thereof of the invention, wherein said subject has functional iron deficiency anemia.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient with chronic kidney disease.
- the present invention provides a method for reducing a subject's iron (for example, IV iron) dosing needs by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention.
- the subject has anemia.
- the anemia is anemia of chronic disease.
- the chronic disease is chronic kidney disease.
- the chronic disease is cancer.
- the chronic disease is inflammation.
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO- hyporesponsive anemia.
- the anemia e.g., the anemia of chronic disease
- the subject is a chronic hemodialysis (HD) subject.
- the subject has renal disease, for example, end-stage renal disease.
- the present invention provides methods of reducing s subject's iron (for example, IV iron) dosing needs by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention, wherein said subject has functional iron deficiency anemia.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient.
- the subject is an ESA (for example, EPO) treated chronic hemodialysis patient with chronic kidney disease.
- the invention provides a method for reducing a subject's iron (for example, IV iron) dosing needs and reducing a subject's ESA (for example, EPO) dosing needs, comprising administering the antibody or antigen binding fragment of the invention or a composition comprising said antibody or antigen binding fragment.
- the anemia is anemia of chronic disease.
- the chronic disease is chronic kidney disease.
- the chronic disease is cancer.
- the subject has anemia.
- the chronic disease is inflammation.
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia e.g., the anemia of chronic disease
- ESA for example, EPO
- the anemia e.g., the anemia of chronic disease
- iron-restricted anemia e.g., the anemia of chronic disease
- the subject is a chronic hemodialysis (HD) subject.
- the subject has renal disease, for example, end-stage renal disease.
- present invention provides methods of mobilizing sequestered iron by administering to a subject in need thereof an effective amount of the antibodies and antigen- binding fragments thereof of the invention.
- present invention provides methods of mobilizing sequestered iron by administering to a subject in need thereof an effective amount of a composition comprising an antibody of the present invention.
- the present invention provides a method for improving (for example, increasing) the level of hemoglobin in a subject with anemia, while reducing the need for dosing with erythropoietin and/or iron (e.g., IV iron), said method comprising administering to a subject in need thereof an antibody or antigen binding fragment thereof of the invention.
- the anemia is anemia associated with chronic disease.
- the improving the level of hemoglobin comprises improving the level to a level as specified by a clinical practice guideline, for example, Kidney Disease: Improving Global Outcomes (KDIGO) Anemia Work Group. KDIGO Clinical Practice Guideline for Anemia in Chronic Kidney Disease. Kidney inter., Suppl.
- the improving the level of hemoglobin comprises improving the level of hemoglobin to at least about 11.0 g/dL, e.g., to from about 11.0 g/dL to about 12.5 g/dL. In an embodiment, the improving the level of hemoglobin comprises improving the level of hemoglobin to at least 11.0 g/dL, e.g., to from 11.0 g/dL to 12.5 g/dL.
- the present invention provides a method for improving (for example, increasing) the level of hemoglobin in a subject with anemia, while reducing the need for dosing with erythropoietin and/or iron (e.g., IV iron), said method comprising administering to a subject in need thereof a composition comprising an antibody of the invention.
- the anemia is anemia associated with chronic disease.
- the improving the level of hemoglobin comprises improving the level to a level as specified by a clinical practice guideline, for example, Kidney Disease: Improving Global Outcomes (KDIGO) Anemia Work Group. KDIGO Clinical Practice Guideline for Anemia in Chronic Kidney Disease. Kidney inter., Suppl.
- the improving the level of hemoglobin comprises improving the level of hemoglobin to at least about 11.0 g/dL, e.g., to from about 11.0 g/dL to about 12.5 g/dL. In an embodiment, the improving the level of hemoglobin comprises improving the level of hemoglobin to at least 11.0 g/dL, e.g., to from l l .O g/dL to 12.5 g/dL.
- the present invention provides a method for maintaining the level of hemoglobin in a subject with anemia, while reducing the need for dosing with erythropoietin and/or iron (e.g., IV iron), said method comprising administering to a subject in need thereof an antibody or antigen binding fragment thereof of the invention.
- the anemia is anemia associated with chronic disease.
- the improving the level of hemoglobin comprises improving the level to a level as specified by a clinical practice guideline, for example, Kidney Disease: Improving Global Outcomes (KDIGO) Anemia Work Group. KDIGO Clinical Practice Guideline for Anemia in Chronic Kidney Disease. Kidney inter., Suppl.
- the improving the level of hemoglobin comprises improving the level of hemoglobin to at least about 11.0 g/dL, e.g., to from about 11.0 g/dL to about 12.5 g/dL. In an embodiment, the improving the level of hemoglobin comprises improving the level of hemoglobin to at least 11.0 g/dL, e.g., to from 11.0 g/dL to 12.5 g/dL.
- the present invention provides a method for maintaining the level of hemoglobin in a subject with anemia, while reducing the need for dosing with erythropoietin and/or iron (e.g., IV iron), said method comprising administering to a subject in need thereof a composition comprising an antibody of the invention.
- the anemia is anemia associated with chronic disease.
- the improving the level of hemoglobin comprises improving the level to a level as specified by a clinical practice guideline, for example, Kidney Disease: Improving Global Outcomes (KDIGO) Anemia Work Group. KDIGO Clinical Practice Guideline for Anemia in Chronic Kidney Disease. Kidney inter., Suppl. 2012; 2: 279- 335, the contents of which are hereby incorporated by reference in its entirety.
- KDIGO Improving Global Outcomes
- the improving the level of hemoglobin comprises improving the level of hemoglobin to at least about 11.0 g/dL, e.g., to from about 11.0 g/dL to about 12.5 g/dL. In an embodiment, the improving the level of hemoglobin comprises improving the level of hemoglobin to at least 11.0 g/dL, e.g., to from 11.0 g/dL to 12.5 g/dL.
- the isolated antibody or antigen-binding fragment thereof described in Table 1 can be administered to a patient in need thereof in conjunction with a therapeutic method or procedure, such as described herein or known in the art.
- Such a method or procedure includes, as non-limiting examples: administration of a therapeutically effective amount of ESA (for example, EPO), erythropoietin, or iron, and blood transfusion. Treatment is typically continued at intervals for a period of a week, a month, three months, six months or a year. In some patients, treatment is administered for up to the rest of a patient's life.
- ESA for example, EPO
- erythropoietin erythropoietin
- iron blood transfusion
- the two can be administered sequentially in either order or simultaneously.
- an antibody of the present invention is administered to a subject who is also receiving therapy with a second agent or method (e.g., ESA, erythropoietin, iron, blood transfusion).
- a second agent or method e.g., ESA, erythropoietin, iron, blood transfusion.
- the binding molecule is administered in conjunction with surgical treatments.
- Suitable agents for combination treatment with BMP6 -binding antibodies include agents known in the art that inhibit or reduce the expression, level, stability and/or activity of BMP6.
- agents include antibodies, siRNAs, and small molecules to BMP6.
- siRNAs to BMP6 are known in the art, including, inter alia, those described in:
- Additional inhibitors of BMP6 are known. Any of these can be used in combination with any antibody or antigen -binding fragment thereof disclosed herein.
- a combination therapy regimen may be additive, or it may produce synergistic results (e.g., reductions in BMP6 activity more than expected for the combined use of the two agents).
- the present invention provide a combination therapy for preventing and/or treating anemia or another BMP6 related disease as described above with BMP6-binding antibody of the invention and an anti-anemia agent or method, such as ESA, erythropoietin, iron, or blood transfusion.
- the invention encompasses diagnostic assays for determining BMP6 and/or nucleic acid expression as well as BMP6 function, in the context of a biological sample (e.g., blood, serum, cells, tissue) or from individual is afflicted with a disease or disorder, or is at risk of developing a disorder associated with anemia.
- a biological sample e.g., blood, serum, cells, tissue
- Diagnostic assays such as competitive assays rely on the ability of a labelled analogue (the "tracer") to compete with the test sample analyte for a limited number of binding sites on a common binding partner.
- the binding partner generally is insolubilized before or after the competition and then the tracer and analyte bound to the binding partner are separated from the unbound tracer and analyte. This separation is accomplished by decanting (where the binding partner was preinsolubilized) or by centrifuging (where the binding partner was precipitated after the competitive reaction).
- the amount of test sample analyte is inversely proportional to the amount of bound tracer as measured by the amount of marker substance.
- Dose-response curves with known amounts of analyte are prepared and compared with the test results in order to quantitatively determine the amount of analyte present in the test sample.
- These assays are called ELISA systems when enzymes are used as the detectable markers.
- competitive binding between antibodies and BMP6-binding antibodies results in the bound BMP6, preferably the BMP6 epitopes of the invention, being a measure of antibodies in the serum sample, most particularly, neutralising antibodies in the serum sample.
- a significant advantage of the assay is that measurement is made of neutralising antibodies directly (i.e., those which interfere with binding of BMP6, specifically, epitopes).
- Such an assay particularly in the form of an ELISA test has considerable applications in the clinical environment and in routine blood screening.
- the detection of BMP6 proteins in comparison to the levels in a corresponding biological sample from a normal subject is indicative of a patient with disorders associated with anemia.
- In vivo diagnostic or imaging is described in US2006/0067935. Briefly, these methods generally comprise administering or introducing to a patient a diagnostically effective amount of BMP6 binding molecule that is operatively attached to a marker or label that is detectable by noninvasive methods.
- the antibody-marker conjugate is allowed sufficient time to localize and bind to BMP6.
- the patient is then exposed to a detection device to identify the detectable marker, thus forming an image of the location of the BMP6 binding molecules in the tissue of a patient.
- the presence of BMP6 binding antibody or an antigen-binding fragment thereof is detected by determining whether an antibody -marker binds to a component of the tissue.
- Detection of an increased level in BMP6 proteins or a combination of protein in comparison to a normal individual without anemia is indicative of a predisposition for and/or on set of disorders associated with anemia.
- the invention also pertains to the field of predictive medicine in which diagnostic assays, prognostic assays, pharmacogenomics, and monitoring clinical trials are used for prognostic (predictive) purposes to thereby treat an individual prophylactically.
- the invention also provides for prognostic (or predictive) assays for determining whether an individual is at risk of developing a disorder associated with dysregulation of BMP6 pathway activity. For example, mutations in BMP6 gene can be assayed in a biological sample. Such assays can be used for prognostic or predictive purpose to thereby prophylactically treat an individual prior to the onset of a disorder characterized by or associated with BMP6, nucleic acid expression or activity.
- Another aspect of the invention provides methods for determining BMP6 nucleic acid expression or BMP6 activity in an individual to thereby select appropriate therapeutic or prophylactic agents for that individual (referred to herein as "pharmacogenomics").
- Pharmacogenomics allows for the selection of agents (e.g., drugs) for therapeutic or prophylactic treatment of an individual based on the genotype of the individual (e.g., the genotype of the individual examined to determine the ability of the individual to respond to a particular agent.)
- agents e.g., drugs
- Yet another aspect of the invention provides a method of monitoring the influence of agents (e.g., drugs) on the expression or activity of BMP6 in clinical trials.
- the invention provides pharmaceutical compositions comprising the BMP6-binding antibody or binding fragment thereof formulated together with a pharmaceutically acceptable carrier.
- the compositions can additionally contain one or more other therapeutical agents that are suitable for treating or preventing a BMP6-associated disease (e.g., anemia).
- Pharmaceutically carriers enhance or stabilize the composition, or to facilitate preparation of the composition.
- Pharmaceutically acceptable carriers include solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are
- a pharmaceutical composition of the present invention can be administered by a variety of methods known in the art.
- the route and/or mode of administration vary depending upon the desired results. Administration can be intravenous, intramuscular, intraperitoneal, or subcutaneous, or administered proximal to the site of the target.
- the pharmaceutically acceptable carrier should be suitable for intravenous, intramuscular, subcutaneous, parenteral, spinal or epidermal administration (e.g., by injection or infusion). Depending on the route of
- the active compound i.e., antibody, bispecific and multispecific molecule
- the active compound may be coated in a material to protect the compound from the action of acids and other natural conditions that may inactivate the compound.
- the composition should be sterile and fluid. Proper fluidity can be maintained, for example, by use of coating such as lecithin, by maintenance of required particle size in the case of dispersion and by use of surfactants. In many cases, it is preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol or sorbitol, and sodium chloride in the composition. Long-term absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum monostearate or gelatin.
- compositions of the invention can be prepared in accordance with methods well known and routinely practiced in the art. See, e.g., Remington: The Science and Practice of Pharmacy, Mack Publishing Co., 20th ed., 2000; and Sustained and Controlled Release Drug Delivery Systems, J. R. Robinson, ed., Marcel Dekker, Inc., New York, 1978. Pharmaceutical compositions are preferably manufactured under GMP conditions. Typically, a therapeutically effective dose or efficacious dose of the BMP6-binding antibody is employed in the pharmaceutical compositions of the invention. The BMP6-binding antibodies are formulated into pharmaceutically acceptable dosage forms by conventional methods known to those of skill in the art.
- Dosage regimens are adjusted to provide the optimum desired response (e.g., a therapeutic response). For example, a single bolus may be administered, several divided doses may be administered over time or the dose may be proportionally reduced or increased as indicated by the exigencies of the therapeutic situation. It is especially advantageous to formulate parenteral compositions in dosage unit form for ease of administration and uniformity of dosage.
- Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subjects to be treated; each unit contains a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required
- Actual dosage levels of the active ingredients in the pharmaceutical compositions of the present invention can be varied so as to obtain an amount of the active ingredient which is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.
- the selected dosage level depends upon a variety of pharmacokinetic factors including the activity of the particular compositions of the present invention employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the particular compositions employed, the age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors.
- a physician or veterinarian can start doses of the antibodies and antigen-binding fragments thereof of the invention employed in the pharmaceutical composition at levels lower than that required to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.
- effective doses of the compositions of the present invention, for the treatment of an allergic inflammatory disorder described herein vary depending upon many different factors, including means of administration, target site, physiological state of the patient, whether the patient is human or an animal, other medications administered, and whether treatment is prophylactic or therapeutic. Treatment dosages need to be titrated to optimize safety and efficacy.
- the dosage ranges from about 0.0001 to 100 mg/kg, and more usually 0.01 to 15 mg/kg, of the host body weight.
- An exemplary treatment regime entails systemic administration once per every two weeks or once a month or once every 3 to 6 months.
- the dosage ranges from about 0.0001 to about 10 mg.
- An exemplary treatment regime entails systemic administration once per every two weeks or once a month or once every 3 to 6 months.
- Antibody is usually administered on multiple occasions. Intervals between single dosages can be weekly, monthly or yearly. Intervals can also be irregular as indicated by measuring blood levels of BMP6-binding antibody in the patient. In some methods of systemic administration, dosage is adjusted to achieve a plasma antibody concentration of 1-1000 ⁇ g/ml and in some methods 25-500 ⁇ g/ml. Alternatively, antibody can be administered as a sustained release formulation, in which case less frequent administration is required. Dosage and frequency vary depending on the half-life of the antibody in the patient. In general, humanized antibodies show longer half life than that of chimeric antibodies and nonhuman antibodies. The dosage and frequency of administration can vary depending on whether the treatment is prophylactic or therapeutic.
- a relatively low dosage is administered at relatively infrequent intervals over a long period of time. Some patients continue to receive treatment for the rest of their lives.
- a relatively high dosage at relatively short intervals is sometimes required until progression of the disease is reduced or terminated, and preferably until the patient shows partial or complete amelioration of symptoms of disease. Thereafter, the patient can be administered a prophylactic regime.
- composition comprising the antibody or antigen binding fragment of the invention is administered at a dose (antibody or antigen-binding fragment thereof) of between 0.001 mg/kg and 0.1 mg/kg. In a specific embodiment the composition comprising the antibody or antigen binding fragment of the invention is administered at a dose of between about 0.001 mg/kg and about 0.1 mg/kg.
- composition comprising the antibody or antigen binding fragment of the invention is administered at a dose of 0.001 mg/kg, 0.0016 mg/kg, 0.0025 mg/kg, 0.0040 mg/kg, 0.0063 mg/kg, 0.01 mg/kg, 0.016 mg/kg, 0.025 mg/kg, 0.040 mg/kg, 0.063 mg/kg, or 0.1 mg/kg.
- the composition comprising the antibody or antigen binding fragment of the invention is administered at a dose of about 0.001 mg/kg, about 0.0016 mg/kg, about 0.0025 mg/kg, about 0.0040 mg/kg, about 0.0063 mg/kg, about 0.01 mg/kg, about 0.016 mg/kg, about 0.025 mg/kg, about 0.040 mg/kg, about 0.063 mg/kg, or about 0.1 mg/kg.
- the composition comprising the antibody or antigen binding fragment of the invention is administered, including, for example, at any of the doses recited above, intravenously.
- the intravenous administration is an intravenous infusion.
- the infusion takes place over 30-60 minutes. In embodiments, the infusion takes place over about 30-60 minutes.
- All the clones are human IgGl antibodies.
- ACD Anemia of chronic disease
- VL Variable domain fragments of the light chain
- Anemia is prevalent in patients with chronic kidney disease (CKD) and is associated with lower quality of life and higher risk of adverse outcomes, including cardiovascular disease and death.
- CKD chronic kidney disease
- a goal of the BMP6 antibodies is as a hepcidin-lowering therapy to benefit patients with iron-restricted anemia by simultaneously increasing hemoglobin while reducing requirements of erythropoiesis stimulating agents, such as erythropoietin and intravenous iron.
- Hepcidin-lowering agents may be an effective strategy for ameliorating ESA-hyporesponsive anemia in this patient population and in other forms of anemia of chronic disease (ACD) characterized by iron restriction.
- ACD chronic disease
- An overall goal of the project is to identify and develop antibodies against BMP6 which are capable of lowering hepcidin level, and therefore benefit patients with iron -restricted anemia by reducing requirement of Erythropoiesis stimulating agent (ESA).
- ESA Erythropoiesis stimulating agent
- BMP6 antibodies meet most or all of the criteria listed below:
- One final antibody format is human IgGl.
- Antibodies were generated using a commercially available phage display library as described previously (Knappik et al. 2000 J. Mol. Biol. 296: 57-86, Prassler et al. 2011 J. Mol. Biol. 413 : 261-278) and employs technology for displaying the Fab on the phage surface (Rothe et al. 2008 J. Mol. Biol. 376: 1182-1200). Pannings and initial ELISA screenings were done on hBMP6 from R&D Systems. ELISA screening of the protein binding hits resulted in the identification of hBMP6-specific binders.
- Antibody Fab fragments were further characterized for species cross-reactivity to mouse BMP6 homolog and their binding affinities to human BMP6 were determined. The specificity of the Fabs was also checked using hBMP2, hBMP5 and hBMP7 proteins in ELISA. The BMP6-specific activity of the Fabs was also assessed in a Reporter Gene Assay.
- Affinity ranking was in principle performed as described below. For ranking of the matured binders by Solution Equilibrium Titration based on the principles described by (Haenel et al., 2005), a constant amount of diluted BEL extract was equilibrated overnight with different concentrations of antigen.
- Results were processed using XLfit (IDBS) software, applying the corresponding fit model (Section 2.6.2.2) to estimate affinities and thus identify clones most improved by the affinity maturation.
- IDBS XLfit
- Fit model Section 2.6.2.2
- Antigen reagents were coated to ELISA plates by direct immobilization at 3-5 ug/mL o/n at 4°C.
- hBMP6 (Peprotech) was diluted in 50 mM Tris pH 8.0 for coating.
- hBMP6, mBMP6 and hBMP5 (R&D Systems) were diluted in 50 mM Citrate buffer pH 4.7.
- hBMP7 (Peprotech) was diluted in 50 mM Citrate buffer pH 4.7.
- As unrelated antigen, hDKKl-His was coated at 5 ug/mL in PBS.
- each antigen was incubated with 40 uL of purified Fab or IgG samples at a concentration of 1 uM and 0.2 uM respectively (in PBST buffer).
- hBMP6 (Peprotech) antigen was coated to ELISA plates by direct immobilization at 1.5 ug/mL in 50 mM Tris buffer pH 8.0 and incubated o/n at 4°C. The next day, antigen solution was discarded and the plates washed three times with 100 uL TBST. Each well was then blocked with 100 uL 5% Milk in TBST for 2h at RT. In subsequent experiments, the blocking was performed with 100 uL of Superblock blocking buffer.
- the antigen was incubated with 30 uL of purified Fab or IgG samples dilution series, starting from 1 uM to 0.03 nM in PBST for the Fabs, from 0.5 uM to 0.01 nM in PBST for the IgGs.
- Affinity determination in solution was basically performed as described in the literature (Friquet et al., 1985). In order to improve the sensitivity and accuracy of the SET method, it was transferred from classical ELISA to ECL-based technology (Haenel et al., 2005).
- MSD plates were coated with antigen (30 ⁇ per well). After washing the plate with PBS containing 0.05% (v/v) Tween20, the equilibrated samples were transferred to those plates (30 ⁇ per well) and incubated for 20 min. After washing, 30 ⁇ per well of the MSD-Sulfo-tag labeled detection antibody (anti-human (Fab)2, final dilution typically 1 :2000) was added to the MSD plate and incubated for 30 min at RT on an Eppendorf shaker (700 rpm).
- Fab anti-human
- K D determination of Fabs was basically performed as follows: MSD plates were coated o/n at 4°C with 10 uL per well of hBMP6 at 1 - 3 ug/mL in 10 mM Tris buffer pH 8.
- hBMP6 antigen was used for titration of free Fab fragments.
- the antigen stock solution was pre-diluted 1 :40 in 10 mM Tris buffer pH 8.0 to 475 nM before adjusting with assay buffer to intended starting concentration for titration.
- Affinity assessments by determining kinetic parameters were performed via Bio-Layer Interferometry technology.
- Epitope binning by competition ELISA was performed to classify antibodies into groups of identical or significantly overlapping epitopes, i.e. antibodies which were able to inhibit each other's binding.
- Anti-BMP6 IgGs were coated on a Maxisorp 384-well plate with 20 uL at 66 nM in PBS. The plate was incubated o/n at 4°C. After washing twice with TBST, the plate was blocked with 100 uL per well of Superblock blocking buffer for 2.5h at RT, then washed twice with TBST.
- Peprotech hBMP6 at 66 nM in PBST was pre-mixed with purified anti-BMP6 Fabs (Flag-His tagged) at 300 nM in PBST in eppendorf tubes (final concentrations in the mix are mentioned). After 2h incubation at RT, 20 uL of the pre-mixed hBMP6/Fabs were added to the blocked anti-BMP6 IgGs-coated wells, according to the plate layout and incubated for maximum 20 min at RT.
- the plate was washed four times with TBST and anti-His6-POD ("His6" disclosed as SEQ ID NO: 96) antibody conjugate diluted 1/1000 in PBST was added to the plate. After lh incubation at RT, the plate was washed 5x with TBST. A chemiluminescent ELISA substrate solution was added to each well, and the luminescence was read without incubation time using a Tecan plate reader.
- the antibody clones were tested in reporter gene assay (RGA) as purified Fab fragments and/or IgGs samples.
- HEP3B hepatoma cell line was stably transfected with pGL4-BRE2-Luc2 lentiviral vector, which contained a BMP -responsive element BRE in the promoter driving firefly luciferase.
- the BMP proteins from R&D systems were used to induce signaling.
- BrightGlo assay was done 24h post-treatment.
- Progen U Ichip® AV-VAR EP contains 384 purified extracellular or secretory proteins expressed as N-terminal His-tag fusion protein in E. coli.
- Antibody 5 Antibody 6 and Antibody 7 purified antibodies have been tested in an ESA- resistant anemia mouse model.
- the 28 anti-hBMP6 engineered IgGs (germlined and PTM-removed) were produced in micro-scale and tested in specificity ELISA at a concentration of 0.2 uM.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Epidemiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Zoology (AREA)
- Gastroenterology & Hepatology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Mycology (AREA)
- Endocrinology (AREA)
- Microbiology (AREA)
- Hematology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Diabetes (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Description
Claims
Priority Applications (19)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EA201791389A EA039579B1 (en) | 2014-12-19 | 2015-12-18 | METHODS AND COMPOSITIONS OF ANTIBODIES DIRECTED AGAINST BMP6 |
| TN2017000242A TN2017000242A1 (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting bmp6 |
| BR112017012954-0A BR112017012954A2 (en) | 2014-12-19 | 2015-12-18 | antibody compositions and methods targeting bmp6 |
| ES15819883T ES2957214T3 (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies against BMP6 |
| EP15819883.8A EP3233913B1 (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting bmp6 |
| AU2015365373A AU2015365373C1 (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting BMP6 |
| CA2970869A CA2970869A1 (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting bmp6 |
| KR1020177019566A KR20170089010A (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting bmp6 |
| MX2017008191A MX389447B (en) | 2014-12-19 | 2015-12-18 | COMPOSITIONS AND METHODS FOR ANTIBODIES DIRECTED TO BMP6. |
| SG11201704634SA SG11201704634SA (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting bmp6 |
| CR20170262A CR20170262A (en) | 2014-12-19 | 2015-12-18 | COMPOSITIONS AND METHODS FOR ANTIBODIES DIRECTED TO BMP6 |
| CN201580076468.1A CN107531783B (en) | 2014-12-19 | 2015-12-18 | Compositions and methods of targeting BMP6 antibodies |
| JP2017532601A JP6802796B2 (en) | 2014-12-19 | 2015-12-18 | Compositions and Methods for Antibodies Targeting BMP6 |
| MYPI2017702099A MY183779A (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting bmp6 |
| ZA2017/03897A ZA201703897B (en) | 2014-12-19 | 2017-06-07 | Compositions and methods for antibodies targeting bmp6 |
| PH12017501077A PH12017501077A1 (en) | 2014-12-19 | 2017-06-08 | Compositions and methods for antibodies targeting bmp6 |
| CONC2017/0005941A CO2017005941A2 (en) | 2014-12-19 | 2017-06-15 | Compositions and methods for antibodies directed to bmp6 |
| IL252966A IL252966B (en) | 2014-12-19 | 2017-06-18 | Compositions and methods for antibodies targeting bmp6 |
| AU2019203368A AU2019203368A1 (en) | 2014-12-19 | 2019-05-14 | Compositions and methods for antibodies targeting BMP6 |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462094716P | 2014-12-19 | 2014-12-19 | |
| US62/094,716 | 2014-12-19 | ||
| US201562181803P | 2015-06-19 | 2015-06-19 | |
| US62/181,803 | 2015-06-19 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2016098079A2 true WO2016098079A2 (en) | 2016-06-23 |
| WO2016098079A3 WO2016098079A3 (en) | 2016-08-18 |
Family
ID=55069038
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2015/059797 Ceased WO2016098079A2 (en) | 2014-12-19 | 2015-12-18 | Compositions and methods for antibodies targeting bmp6 |
Country Status (26)
| Country | Link |
|---|---|
| US (3) | US9862764B2 (en) |
| EP (1) | EP3233913B1 (en) |
| JP (2) | JP6802796B2 (en) |
| KR (1) | KR20170089010A (en) |
| CN (1) | CN107531783B (en) |
| AU (2) | AU2015365373C1 (en) |
| BR (1) | BR112017012954A2 (en) |
| CA (1) | CA2970869A1 (en) |
| CL (1) | CL2017001461A1 (en) |
| CO (1) | CO2017005941A2 (en) |
| CR (1) | CR20170262A (en) |
| EC (1) | ECSP17045736A (en) |
| ES (1) | ES2957214T3 (en) |
| GT (1) | GT201700131A (en) |
| IL (1) | IL252966B (en) |
| JO (1) | JO3791B1 (en) |
| MX (1) | MX389447B (en) |
| MY (1) | MY183779A (en) |
| PE (1) | PE20170916A1 (en) |
| PH (1) | PH12017501077A1 (en) |
| SG (1) | SG11201704634SA (en) |
| TN (1) | TN2017000242A1 (en) |
| TW (1) | TWI714545B (en) |
| UY (1) | UY36449A (en) |
| WO (1) | WO2016098079A2 (en) |
| ZA (1) | ZA201703897B (en) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2017191437A1 (en) * | 2016-05-03 | 2017-11-09 | Kymab Limited | Methods, regimens, combinations & antagonists |
| WO2017216724A1 (en) * | 2016-06-15 | 2017-12-21 | Novartis Ag | Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6) |
| WO2019238713A2 (en) | 2018-06-13 | 2019-12-19 | Kymab Limited | Treatments etc |
| WO2020065252A1 (en) | 2018-09-25 | 2020-04-02 | Kymab Limited | Antagonists |
| WO2020086736A1 (en) | 2018-10-23 | 2020-04-30 | Scholar Rock, Inc. | Rgmc-selective inhibitors and use thereof |
| US10683346B2 (en) | 2014-12-19 | 2020-06-16 | Novartis Ag | Compositions and methods for antibodies targeting BMP6 |
| WO2020251924A1 (en) * | 2019-06-12 | 2020-12-17 | Regeneron Pharmaceuticals, Inc. | Human antibodies to bone morphogenetic protein 6 |
| WO2021142448A2 (en) | 2020-01-11 | 2021-07-15 | Scholar Rock,Inc. | Tgf-beta inhibitors and use thereof |
| WO2022204581A2 (en) | 2021-03-26 | 2022-09-29 | Scholar Rock, Inc. | Tgf-beta inhibitors and use thereof |
| WO2022256723A2 (en) | 2021-06-03 | 2022-12-08 | Scholar Rock, Inc. | Tgf-beta inhibitors and therapeutic use thereof |
| RU2790023C2 (en) * | 2016-06-15 | 2023-02-14 | Новартис Аг | Methods for treatment of disease, using bone morphogenetic protein 6 (bmp6) inhibitors |
| US11878048B2 (en) | 2017-06-14 | 2024-01-23 | Kymab Limited | Use of the extracellular domain of transferrin receptor 2 for the diagnosis and treatment of primary or secondary sclerosing diseases |
| WO2024187051A1 (en) | 2023-03-07 | 2024-09-12 | Scholar Rock, Inc. | Tgf-beta inhibitors for use for treating resistant or unresponsive cancer in patients |
Families Citing this family (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2991637C (en) | 2015-07-31 | 2022-07-05 | Medimmune Limited | Methods for treating hepcidin-mediated disorders |
| KR20200012823A (en) | 2017-02-01 | 2020-02-05 | 예일 유니버시티 | Treatment of Diuretic Resistance |
| EP3735421A4 (en) | 2018-01-05 | 2021-09-22 | Corvidia Therapeutics, Inc. | METHODS OF TREATING IL-6 MEDIATED INFLAMMATION WITHOUT IMMUNOSUPPRESSION |
| EP3870181B1 (en) | 2018-10-26 | 2024-08-14 | Keros Therapeutics, Inc. | Crystal forms of an alk2 inhibitor |
| US20220372135A1 (en) | 2019-09-27 | 2022-11-24 | Disc Medicine, Inc. | Methods for treating myelofibrosis and related conditions |
| US12508262B2 (en) | 2020-04-30 | 2025-12-30 | Keros Therapeutics, Inc. | Methods of using ALK2 inhibitors |
| KR20230012539A (en) | 2020-05-13 | 2023-01-26 | 디스크 메디슨, 인크. | Anti-hemojuvelin (HJV) antibodies to treat myelofibrosis |
| WO2022098812A1 (en) | 2020-11-04 | 2022-05-12 | Keros Therapeutics, Inc. | Methods of treating iron overload |
Citations (98)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| EP0154316A2 (en) | 1984-03-06 | 1985-09-11 | Takeda Chemical Industries, Ltd. | Chemically modified lymphokine and production thereof |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| EP0307434A1 (en) | 1987-03-18 | 1989-03-22 | Medical Res Council | Altered antibodies. |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US4881175A (en) | 1986-09-02 | 1989-11-14 | Genex Corporation | Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides |
| EP0367166A1 (en) | 1988-10-31 | 1990-05-09 | Takeda Chemical Industries, Ltd. | Modified interleukin-2 and production thereof |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| EP0401384A1 (en) | 1988-12-22 | 1990-12-12 | Kirin-Amgen, Inc. | Chemically modified granulocyte colony stimulating factor |
| EP0413622A1 (en) | 1989-08-03 | 1991-02-20 | Rhone-Poulenc Sante | Albumin derivatives with therapeutic functions |
| US5013653A (en) | 1987-03-20 | 1991-05-07 | Creative Biomolecules, Inc. | Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage |
| WO1991006570A1 (en) | 1989-10-25 | 1991-05-16 | The University Of Melbourne | HYBRID Fc RECEPTOR MOLECULES |
| US5091513A (en) | 1987-05-21 | 1992-02-25 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| WO1992003918A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5112946A (en) | 1989-07-06 | 1992-05-12 | Repligen Corporation | Modified pf4 compositions and methods of use |
| US5132405A (en) | 1987-05-21 | 1992-07-21 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| WO1993012227A1 (en) | 1991-12-17 | 1993-06-24 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| WO1993015199A1 (en) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Novel biologically active polypeptides, preparation thereof and pharmaceutical composition containing said polypeptides |
| WO1993015200A1 (en) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| WO1994004678A1 (en) | 1992-08-21 | 1994-03-03 | Casterman Cecile | Immunoglobulins devoid of light chains |
| US5336603A (en) | 1987-10-02 | 1994-08-09 | Genentech, Inc. | CD4 adheson variants |
| US5349053A (en) | 1990-06-01 | 1994-09-20 | Protein Design Labs, Inc. | Chimeric ligand/immunoglobulin molecules and their uses |
| US5359046A (en) | 1990-12-14 | 1994-10-25 | Cell Genesys, Inc. | Chimeric chains for receptor-associated signal transduction pathways |
| WO1994025585A1 (en) | 1993-04-26 | 1994-11-10 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5447851A (en) | 1992-04-02 | 1995-09-05 | Board Of Regents, The University Of Texas System | DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells |
| US5476996A (en) | 1988-06-14 | 1995-12-19 | Lidak Pharmaceuticals | Human immune system in non-human animal |
| US5476786A (en) | 1987-05-21 | 1995-12-19 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| WO1996004388A1 (en) | 1994-07-29 | 1996-02-15 | Smithkline Beecham Plc | Novel compounds |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| WO1997013852A1 (en) | 1995-10-10 | 1997-04-17 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5622929A (en) | 1992-01-23 | 1997-04-22 | Bristol-Myers Squibb Company | Thioether conjugates |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5641870A (en) | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| WO1997034631A1 (en) | 1996-03-18 | 1997-09-25 | Board Of Regents, The University Of Texas System | Immunoglobin-like domains with increased half lives |
| US5677425A (en) | 1987-09-04 | 1997-10-14 | Celltech Therapeutics Limited | Recombinant antibody |
| US5714350A (en) | 1992-03-09 | 1998-02-03 | Protein Design Labs, Inc. | Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region |
| WO1998023289A1 (en) | 1996-11-27 | 1998-06-04 | The General Hospital Corporation | MODULATION OF IgG BINDING TO FcRn |
| WO1998024884A1 (en) | 1996-12-02 | 1998-06-11 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies |
| US5766886A (en) | 1991-12-13 | 1998-06-16 | Xoma Corporation | Modified antibody variable domains |
| US5789650A (en) | 1990-08-29 | 1998-08-04 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5831012A (en) | 1994-01-14 | 1998-11-03 | Pharmacia & Upjohn Aktiebolag | Bacterial receptor structures |
| US5834252A (en) | 1995-04-18 | 1998-11-10 | Glaxo Group Limited | End-complementary polymerase reaction |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5874299A (en) | 1990-08-29 | 1999-02-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5877397A (en) | 1990-08-29 | 1999-03-02 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5885793A (en) | 1991-12-02 | 1999-03-23 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| WO1999016873A1 (en) | 1997-09-26 | 1999-04-08 | Arne Skerra | Anticalins |
| US5939598A (en) | 1990-01-12 | 1999-08-17 | Abgenix, Inc. | Method of making transgenic mice lacking endogenous heavy chains |
| WO1999045962A1 (en) | 1998-03-13 | 1999-09-16 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| WO1999054342A1 (en) | 1998-04-20 | 1999-10-28 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| WO2000042072A2 (en) | 1999-01-15 | 2000-07-20 | Genentech, Inc. | Polypeptide variants with altered effector function |
| US6121022A (en) | 1995-04-14 | 2000-09-19 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6162963A (en) | 1990-01-12 | 2000-12-19 | Abgenix, Inc. | Generation of Xenogenetic antibodies |
| US6165745A (en) | 1992-04-24 | 2000-12-26 | Board Of Regents, The University Of Texas System | Recombinant production of immunoglobulin-like domains in prokaryotic cells |
| US6172197B1 (en) | 1991-07-10 | 2001-01-09 | Medical Research Council | Methods for producing members of specific binding pairs |
| WO2001004144A2 (en) | 1999-07-13 | 2001-01-18 | Scil Proteins Gmbh | Fabrication of beta-pleated sheet proteins with specific binding properties |
| US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| WO2001014424A2 (en) | 1999-08-24 | 2001-03-01 | Medarex, Inc. | Human ctla-4 antibodies and their uses |
| US6277375B1 (en) | 1997-03-03 | 2001-08-21 | Board Of Regents, The University Of Texas System | Immunoglobulin-like domains with increased half-lives |
| WO2001077137A1 (en) | 2000-04-12 | 2001-10-18 | Human Genome Sciences, Inc. | Albumin fusion proteins |
| EP1176195A1 (en) | 1999-04-09 | 2002-01-30 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
| WO2002043478A2 (en) | 2000-11-30 | 2002-06-06 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
| WO2002092780A2 (en) | 2001-05-17 | 2002-11-21 | Diversa Corporation | Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof |
| WO2003035835A2 (en) | 2001-10-25 | 2003-05-01 | Genentech, Inc. | Glycoprotein compositions |
| WO2003048731A2 (en) | 2001-12-03 | 2003-06-12 | Abgenix, Inc. | Antibody categorization based on binding characteristics |
| US20030153043A1 (en) | 1997-05-21 | 2003-08-14 | Biovation Limited | Method for the production of non-immunogenic proteins |
| US20030157579A1 (en) | 2002-02-14 | 2003-08-21 | Kalobios, Inc. | Molecular sensors activated by disinhibition |
| WO2003074679A2 (en) | 2002-03-01 | 2003-09-12 | Xencor | Antibody optimization |
| US20030198971A1 (en) | 2002-04-18 | 2003-10-23 | Kalobios, Inc. | Reactivation-based molecular interaction sensors |
| US6703199B1 (en) | 1997-06-12 | 2004-03-09 | Research Corporation Technologies, Inc. | Artificial antibody polypeptides |
| US20040175756A1 (en) | 2001-04-26 | 2004-09-09 | Avidia Research Institute | Methods for using combinatorial libraries of monomer domains |
| EP1012280B1 (en) | 1997-06-11 | 2004-11-10 | Borean Pharma A/S | Trimerising module |
| US6818418B1 (en) | 1998-12-10 | 2004-11-16 | Compound Therapeutics, Inc. | Protein scaffolds for antibody mimics and other binding proteins |
| WO2004106368A1 (en) | 2003-05-28 | 2004-12-09 | Scil Proteins Gmbh | Generation of artificial binding proteins based on ubiquitin proteins |
| US20050008625A1 (en) | 2003-02-13 | 2005-01-13 | Kalobios, Inc. | Antibody affinity engineering by serial epitope-guided complementarity replacement |
| US20050048512A1 (en) | 2001-04-26 | 2005-03-03 | Avidia Research Institute | Combinatorial libraries of monomer domains |
| US20050053973A1 (en) | 2001-04-26 | 2005-03-10 | Avidia Research Institute | Novel proteins with targeted binding |
| US20050255552A1 (en) | 2004-01-20 | 2005-11-17 | Kalobios, Inc. | Antibody specificity transfer using minimal essential binding determinants |
| US20060008844A1 (en) | 2004-06-17 | 2006-01-12 | Avidia Research Institute | c-Met kinase binding proteins |
| US20060067935A1 (en) | 2002-10-30 | 2006-03-30 | Jayakrishna Ambati | Compositions and methods for inhibiting drusen complement components C3a and C5a for the treatment of age-related macular degeneration |
| WO2010056981A2 (en) | 2008-11-13 | 2010-05-20 | Massachusetts General Hospital | Methods and compositions for regulating iron homeostasis by modulation bmp-6 |
| US8795665B2 (en) | 2012-12-17 | 2014-08-05 | Eli Lilly And Company | BMP-6 antibodies |
Family Cites Families (22)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5187076A (en) | 1986-07-01 | 1993-02-16 | Genetics Institute, Inc. | DNA sequences encoding BMP-6 proteins |
| US5242813A (en) | 1990-10-12 | 1993-09-07 | The United States Of America As Represented By The Department Of Health And Human Services | Mouse monoclonal antibodies specific for normal primate tissue, malignant human cultural cell lines human tumors |
| DK0528767T3 (en) | 1991-08-21 | 2000-04-17 | Novartis Ag | antibody derivatives |
| US5610021A (en) | 1992-02-21 | 1997-03-11 | Creative Biomolecules, Inc. | Compositions and methods for identification and use of soluble complex forms of osteogenic proteins |
| AU2404695A (en) | 1994-05-04 | 1995-11-29 | Mount Sinai Hospital Corporation | Modulators of cytokines of the tgf-beta superfamily and methods for assaying for same |
| AU6094696A (en) | 1995-06-05 | 1996-12-24 | Bionebraska, Inc. | Lead binding polypeptides and nucleotides coding therefor |
| US20030224501A1 (en) | 2000-03-17 | 2003-12-04 | Young Paul E. | Bone morphogenic protein polynucleotides, polypeptides, and antibodies |
| WO2006088927A2 (en) | 2005-02-14 | 2006-08-24 | Hart Kelly F | Portable stepping device |
| WO2006088972A2 (en) | 2005-02-16 | 2006-08-24 | The General Hospital Corporation | Use of modulatirs of compounds of tgf-beta superfamily to regulate hepcidin-mediated iron metabolism |
| US7612181B2 (en) | 2005-08-19 | 2009-11-03 | Abbott Laboratories | Dual variable domain immunoglobulin and uses thereof |
| PE20071101A1 (en) | 2005-08-31 | 2007-12-21 | Amgen Inc | POLYPEPTIDES AND ANTIBODIES |
| CA2652703C (en) | 2006-06-07 | 2018-08-28 | Bioalliance C.V. | Antibodies recognizing a carbohydrate containing epitope on cd-43 and cea expressed on cancer cells and methods using same |
| EP2062048A4 (en) | 2006-09-12 | 2009-12-02 | Gen Hospital Corp | METHODS OF IDENTIFYING COMPOUNDS THAT MODULATE CELL SIGNALING AND METHODS EMPLOYING SUCH COMPOUNDS |
| WO2009045321A1 (en) | 2007-09-28 | 2009-04-09 | Stryker Corporation | Methods for detecting neutralizing antibodies for bone morphogenetic proteins |
| US20140086919A1 (en) | 2012-09-24 | 2014-03-27 | Herbert Y. Lin | Methods and compositons for regulating iron homeostasis by modulation of bmp-6 |
| US20110070242A1 (en) | 2009-09-01 | 2011-03-24 | Inserm (Institut National De La Sante Et De La Recherche Medicale) | Methods for Diagnosing and Treating Iron Dysregulation |
| AU2012251919B2 (en) | 2011-01-19 | 2016-12-15 | Ferrumax Pharmaceuticals, Inc. | Compositions for regulating iron homeostasis and methods of using same |
| AU2012253204A1 (en) | 2011-05-06 | 2013-04-18 | Women's And Children's Health Research Institute Inc | Method of treatment and prophylaxis of pathologies of the bone |
| CN104411720B (en) | 2012-07-02 | 2018-05-11 | 协和发酵麒麟株式会社 | Therapeutic agent using anti-BMP9 antibody as active ingredient, to anaemias such as renal anemia, cancer-related anemias |
| NZ709532A (en) | 2012-12-07 | 2016-05-27 | Wobben Properties Gmbh | Rotor blade trailing edge |
| US9139648B1 (en) | 2014-07-15 | 2015-09-22 | Kymab Limited | Precision medicine by targeting human NAV1.9 variants for treatment of pain |
| UY36449A (en) * | 2014-12-19 | 2016-07-29 | Novartis Ag | COMPOSITIONS AND METHODS FOR ANTIBODIES DIRECTED TO BMP6 |
-
2015
- 2015-12-16 UY UY0001036449A patent/UY36449A/en not_active Application Discontinuation
- 2015-12-17 JO JOP/2015/0325A patent/JO3791B1/en active
- 2015-12-18 CN CN201580076468.1A patent/CN107531783B/en not_active Expired - Fee Related
- 2015-12-18 KR KR1020177019566A patent/KR20170089010A/en active Pending
- 2015-12-18 PE PE2017001091A patent/PE20170916A1/en unknown
- 2015-12-18 TW TW104142804A patent/TWI714545B/en not_active IP Right Cessation
- 2015-12-18 MX MX2017008191A patent/MX389447B/en unknown
- 2015-12-18 BR BR112017012954-0A patent/BR112017012954A2/en not_active Application Discontinuation
- 2015-12-18 CA CA2970869A patent/CA2970869A1/en active Pending
- 2015-12-18 MY MYPI2017702099A patent/MY183779A/en unknown
- 2015-12-18 CR CR20170262A patent/CR20170262A/en unknown
- 2015-12-18 AU AU2015365373A patent/AU2015365373C1/en not_active Ceased
- 2015-12-18 WO PCT/IB2015/059797 patent/WO2016098079A2/en not_active Ceased
- 2015-12-18 ES ES15819883T patent/ES2957214T3/en active Active
- 2015-12-18 TN TN2017000242A patent/TN2017000242A1/en unknown
- 2015-12-18 JP JP2017532601A patent/JP6802796B2/en not_active Expired - Fee Related
- 2015-12-18 EP EP15819883.8A patent/EP3233913B1/en active Active
- 2015-12-18 US US14/974,318 patent/US9862764B2/en not_active Expired - Fee Related
- 2015-12-18 SG SG11201704634SA patent/SG11201704634SA/en unknown
-
2017
- 2017-06-07 ZA ZA2017/03897A patent/ZA201703897B/en unknown
- 2017-06-08 PH PH12017501077A patent/PH12017501077A1/en unknown
- 2017-06-08 CL CL2017001461A patent/CL2017001461A1/en unknown
- 2017-06-15 CO CONC2017/0005941A patent/CO2017005941A2/en unknown
- 2017-06-16 GT GT201700131A patent/GT201700131A/en unknown
- 2017-06-18 IL IL252966A patent/IL252966B/en active IP Right Grant
- 2017-07-16 EC ECIEPI201745736A patent/ECSP17045736A/en unknown
- 2017-11-20 US US15/818,090 patent/US10683346B2/en active Active
-
2019
- 2019-05-14 AU AU2019203368A patent/AU2019203368A1/en not_active Abandoned
-
2020
- 2020-05-04 US US16/865,723 patent/US11530261B2/en active Active
- 2020-06-30 JP JP2020112233A patent/JP2020182467A/en active Pending
Patent Citations (122)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4458066A (en) | 1980-02-29 | 1984-07-03 | University Patents, Inc. | Process for preparing polynucleotides |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| EP0154316A2 (en) | 1984-03-06 | 1985-09-11 | Takeda Chemical Industries, Ltd. | Chemically modified lymphokine and production thereof |
| US5225539A (en) | 1986-03-27 | 1993-07-06 | Medical Research Council | Recombinant altered antibodies and methods of making altered antibodies |
| US4881175A (en) | 1986-09-02 | 1989-11-14 | Genex Corporation | Computer based system and method for determining and displaying possible chemical structures for converting double- or multiple-chain polypeptides to single-chain polypeptides |
| US5455030A (en) | 1986-09-02 | 1995-10-03 | Enzon Labs, Inc. | Immunotheraphy using single chain polypeptide binding molecules |
| US5260203A (en) | 1986-09-02 | 1993-11-09 | Enzon, Inc. | Single polypeptide chain binding molecules |
| US5648260A (en) | 1987-03-18 | 1997-07-15 | Scotgen Biopharmaceuticals Incorporated | DNA encoding antibodies with altered effector functions |
| EP0307434A1 (en) | 1987-03-18 | 1989-03-22 | Medical Res Council | Altered antibodies. |
| US5624821A (en) | 1987-03-18 | 1997-04-29 | Scotgen Biopharmaceuticals Incorporated | Antibodies with altered effector functions |
| US5013653A (en) | 1987-03-20 | 1991-05-07 | Creative Biomolecules, Inc. | Product and process for introduction of a hinge region into a fusion protein to facilitate cleavage |
| US5091513A (en) | 1987-05-21 | 1992-02-25 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5482858A (en) | 1987-05-21 | 1996-01-09 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| US5132405A (en) | 1987-05-21 | 1992-07-21 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5476786A (en) | 1987-05-21 | 1995-12-19 | Creative Biomolecules, Inc. | Biosynthetic antibody binding sites |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| US5677425A (en) | 1987-09-04 | 1997-10-14 | Celltech Therapeutics Limited | Recombinant antibody |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5336603A (en) | 1987-10-02 | 1994-08-09 | Genentech, Inc. | CD4 adheson variants |
| US5476996A (en) | 1988-06-14 | 1995-12-19 | Lidak Pharmaceuticals | Human immune system in non-human animal |
| US5698767A (en) | 1988-06-14 | 1997-12-16 | Lidak Pharmaceuticals | Human immune system in non-human animal |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5403484A (en) | 1988-09-02 | 1995-04-04 | Protein Engineering Corporation | Viruses expressing chimeric binding proteins |
| US5571698A (en) | 1988-09-02 | 1996-11-05 | Protein Engineering Corporation | Directed evolution of novel binding proteins |
| US5545807A (en) | 1988-10-12 | 1996-08-13 | The Babraham Institute | Production of antibodies from transgenic animals |
| EP0367166A1 (en) | 1988-10-31 | 1990-05-09 | Takeda Chemical Industries, Ltd. | Modified interleukin-2 and production thereof |
| EP0401384A1 (en) | 1988-12-22 | 1990-12-12 | Kirin-Amgen, Inc. | Chemically modified granulocyte colony stimulating factor |
| US6180370B1 (en) | 1988-12-28 | 2001-01-30 | Protein Design Labs, Inc. | Humanized immunoglobulins and methods of making the same |
| US5693762A (en) | 1988-12-28 | 1997-12-02 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5585089A (en) | 1988-12-28 | 1996-12-17 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5530101A (en) | 1988-12-28 | 1996-06-25 | Protein Design Labs, Inc. | Humanized immunoglobulins |
| US5112946A (en) | 1989-07-06 | 1992-05-12 | Repligen Corporation | Modified pf4 compositions and methods of use |
| EP0413622A1 (en) | 1989-08-03 | 1991-02-20 | Rhone-Poulenc Sante | Albumin derivatives with therapeutic functions |
| WO1991006570A1 (en) | 1989-10-25 | 1991-05-16 | The University Of Melbourne | HYBRID Fc RECEPTOR MOLECULES |
| US6150584A (en) | 1990-01-12 | 2000-11-21 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6075181A (en) | 1990-01-12 | 2000-06-13 | Abgenix, Inc. | Human antibodies derived from immunized xenomice |
| US6114598A (en) | 1990-01-12 | 2000-09-05 | Abgenix, Inc. | Generation of xenogeneic antibodies |
| US5939598A (en) | 1990-01-12 | 1999-08-17 | Abgenix, Inc. | Method of making transgenic mice lacking endogenous heavy chains |
| US6162963A (en) | 1990-01-12 | 2000-12-19 | Abgenix, Inc. | Generation of Xenogenetic antibodies |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5580717A (en) | 1990-05-01 | 1996-12-03 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5349053A (en) | 1990-06-01 | 1994-09-20 | Protein Design Labs, Inc. | Chimeric ligand/immunoglobulin molecules and their uses |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5661016A (en) | 1990-08-29 | 1997-08-26 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5874299A (en) | 1990-08-29 | 1999-02-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5814318A (en) | 1990-08-29 | 1998-09-29 | Genpharm International Inc. | Transgenic non-human animals for producing heterologous antibodies |
| WO1992003918A1 (en) | 1990-08-29 | 1992-03-19 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5625126A (en) | 1990-08-29 | 1997-04-29 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5633425A (en) | 1990-08-29 | 1997-05-27 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5789650A (en) | 1990-08-29 | 1998-08-04 | Genpharm International, Inc. | Transgenic non-human animals for producing heterologous antibodies |
| US5569825A (en) | 1990-08-29 | 1996-10-29 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5770429A (en) | 1990-08-29 | 1998-06-23 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5877397A (en) | 1990-08-29 | 1999-03-02 | Genpharm International Inc. | Transgenic non-human animals capable of producing heterologous antibodies of various isotypes |
| US5545806A (en) | 1990-08-29 | 1996-08-13 | Genpharm International, Inc. | Ransgenic non-human animals for producing heterologous antibodies |
| US5359046A (en) | 1990-12-14 | 1994-10-25 | Cell Genesys, Inc. | Chimeric chains for receptor-associated signal transduction pathways |
| US6172197B1 (en) | 1991-07-10 | 2001-01-09 | Medical Research Council | Methods for producing members of specific binding pairs |
| US5885793A (en) | 1991-12-02 | 1999-03-23 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US6555313B1 (en) | 1991-12-02 | 2003-04-29 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US6544731B1 (en) | 1991-12-02 | 2003-04-08 | Medical Research Council | Production of anti-self antibodies from antibody segment repertories and displayed on phage |
| US6593081B1 (en) | 1991-12-02 | 2003-07-15 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US6582915B1 (en) | 1991-12-02 | 2003-06-24 | Medical Research Council | Production of anti-self bodies from antibody segment repertories and displayed on phage |
| US6521404B1 (en) | 1991-12-02 | 2003-02-18 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US5766886A (en) | 1991-12-13 | 1998-06-16 | Xoma Corporation | Modified antibody variable domains |
| WO1993012227A1 (en) | 1991-12-17 | 1993-06-24 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US5622929A (en) | 1992-01-23 | 1997-04-22 | Bristol-Myers Squibb Company | Thioether conjugates |
| WO1993015199A1 (en) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Novel biologically active polypeptides, preparation thereof and pharmaceutical composition containing said polypeptides |
| WO1993015200A1 (en) | 1992-01-31 | 1993-08-05 | Rhone-Poulenc Rorer S.A. | Antithrombotic polypeptides as antagonists of the binding of vwf to platelets or to subendothelium |
| US5714350A (en) | 1992-03-09 | 1998-02-03 | Protein Design Labs, Inc. | Increasing antibody affinity by altering glycosylation in the immunoglobulin variable region |
| US6350861B1 (en) | 1992-03-09 | 2002-02-26 | Protein Design Labs, Inc. | Antibodies with increased binding affinity |
| US5447851A (en) | 1992-04-02 | 1995-09-05 | Board Of Regents, The University Of Texas System | DNA encoding a chimeric polypeptide comprising the extracellular domain of TNF receptor fused to IgG, vectors, and host cells |
| US5447851B1 (en) | 1992-04-02 | 1999-07-06 | Univ Texas System Board Of | Dna encoding a chimeric polypeptide comprising the extracellular domain of tnf receptor fused to igg vectors and host cells |
| US6165745A (en) | 1992-04-24 | 2000-12-26 | Board Of Regents, The University Of Texas System | Recombinant production of immunoglobulin-like domains in prokaryotic cells |
| US5759808A (en) | 1992-08-21 | 1998-06-02 | Vrije Universiteit Brussel | Immunoglobulins devoid of light chains |
| WO1994004678A1 (en) | 1992-08-21 | 1994-03-03 | Casterman Cecile | Immunoglobulins devoid of light chains |
| WO1994025585A1 (en) | 1993-04-26 | 1994-11-10 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1994029351A2 (en) | 1993-06-16 | 1994-12-22 | Celltech Limited | Antibodies |
| US5831012A (en) | 1994-01-14 | 1998-11-03 | Pharmacia & Upjohn Aktiebolag | Bacterial receptor structures |
| US5837458A (en) | 1994-02-17 | 1998-11-17 | Maxygen, Inc. | Methods and compositions for cellular and metabolic engineering |
| US5830721A (en) | 1994-02-17 | 1998-11-03 | Affymax Technologies N.V. | DNA mutagenesis by random fragmentation and reassembly |
| US5811238A (en) | 1994-02-17 | 1998-09-22 | Affymax Technologies N.V. | Methods for generating polynucleotides having desired characteristics by iterative selection and recombination |
| US5605793A (en) | 1994-02-17 | 1997-02-25 | Affymax Technologies N.V. | Methods for in vitro recombination |
| WO1996004388A1 (en) | 1994-07-29 | 1996-02-15 | Smithkline Beecham Plc | Novel compounds |
| US5869046A (en) | 1995-04-14 | 1999-02-09 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US6121022A (en) | 1995-04-14 | 2000-09-19 | Genentech, Inc. | Altered polypeptides with increased half-life |
| US5834252A (en) | 1995-04-18 | 1998-11-10 | Glaxo Group Limited | End-complementary polymerase reaction |
| US5641870A (en) | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| WO1997013852A1 (en) | 1995-10-10 | 1997-04-17 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| WO1997034631A1 (en) | 1996-03-18 | 1997-09-25 | Board Of Regents, The University Of Texas System | Immunoglobin-like domains with increased half lives |
| WO1998023289A1 (en) | 1996-11-27 | 1998-06-04 | The General Hospital Corporation | MODULATION OF IgG BINDING TO FcRn |
| WO1998024884A1 (en) | 1996-12-02 | 1998-06-11 | Genpharm International | Transgenic non-human animals capable of producing heterologous antibodies |
| US6277375B1 (en) | 1997-03-03 | 2001-08-21 | Board Of Regents, The University Of Texas System | Immunoglobulin-like domains with increased half-lives |
| US20030153043A1 (en) | 1997-05-21 | 2003-08-14 | Biovation Limited | Method for the production of non-immunogenic proteins |
| EP1012280B1 (en) | 1997-06-11 | 2004-11-10 | Borean Pharma A/S | Trimerising module |
| US6703199B1 (en) | 1997-06-12 | 2004-03-09 | Research Corporation Technologies, Inc. | Artificial antibody polypeptides |
| WO1999016873A1 (en) | 1997-09-26 | 1999-04-08 | Arne Skerra | Anticalins |
| WO1999045962A1 (en) | 1998-03-13 | 1999-09-16 | Genpharm International, Inc. | Transgenic non-human animals capable of producing heterologous antibodies |
| US6194551B1 (en) | 1998-04-02 | 2001-02-27 | Genentech, Inc. | Polypeptide variants |
| WO1999054342A1 (en) | 1998-04-20 | 1999-10-28 | Pablo Umana | Glycosylation engineering of antibodies for improving antibody-dependent cellular cytotoxicity |
| US6818418B1 (en) | 1998-12-10 | 2004-11-16 | Compound Therapeutics, Inc. | Protein scaffolds for antibody mimics and other binding proteins |
| WO2000042072A2 (en) | 1999-01-15 | 2000-07-20 | Genentech, Inc. | Polypeptide variants with altered effector function |
| EP1176195A1 (en) | 1999-04-09 | 2002-01-30 | Kyowa Hakko Kogyo Co., Ltd. | Method for controlling the activity of immunologically functional molecule |
| WO2001004144A2 (en) | 1999-07-13 | 2001-01-18 | Scil Proteins Gmbh | Fabrication of beta-pleated sheet proteins with specific binding properties |
| WO2001014424A2 (en) | 1999-08-24 | 2001-03-01 | Medarex, Inc. | Human ctla-4 antibodies and their uses |
| WO2001077137A1 (en) | 2000-04-12 | 2001-10-18 | Human Genome Sciences, Inc. | Albumin fusion proteins |
| WO2002043478A2 (en) | 2000-11-30 | 2002-06-06 | Medarex, Inc. | Transgenic transchromosomal rodents for making human antibodies |
| US20050053973A1 (en) | 2001-04-26 | 2005-03-10 | Avidia Research Institute | Novel proteins with targeted binding |
| US20050048512A1 (en) | 2001-04-26 | 2005-03-03 | Avidia Research Institute | Combinatorial libraries of monomer domains |
| US20040175756A1 (en) | 2001-04-26 | 2004-09-09 | Avidia Research Institute | Methods for using combinatorial libraries of monomer domains |
| WO2002092780A2 (en) | 2001-05-17 | 2002-11-21 | Diversa Corporation | Novel antigen binding molecules for therapeutic, diagnostic, prophylactic, enzymatic, industrial, and agricultural applications, and methods for generating and screening thereof |
| WO2003035835A2 (en) | 2001-10-25 | 2003-05-01 | Genentech, Inc. | Glycoprotein compositions |
| WO2003048731A2 (en) | 2001-12-03 | 2003-06-12 | Abgenix, Inc. | Antibody categorization based on binding characteristics |
| US20030157579A1 (en) | 2002-02-14 | 2003-08-21 | Kalobios, Inc. | Molecular sensors activated by disinhibition |
| WO2003074679A2 (en) | 2002-03-01 | 2003-09-12 | Xencor | Antibody optimization |
| US20030198971A1 (en) | 2002-04-18 | 2003-10-23 | Kalobios, Inc. | Reactivation-based molecular interaction sensors |
| US20060067935A1 (en) | 2002-10-30 | 2006-03-30 | Jayakrishna Ambati | Compositions and methods for inhibiting drusen complement components C3a and C5a for the treatment of age-related macular degeneration |
| US20050008625A1 (en) | 2003-02-13 | 2005-01-13 | Kalobios, Inc. | Antibody affinity engineering by serial epitope-guided complementarity replacement |
| WO2004106368A1 (en) | 2003-05-28 | 2004-12-09 | Scil Proteins Gmbh | Generation of artificial binding proteins based on ubiquitin proteins |
| US20050255552A1 (en) | 2004-01-20 | 2005-11-17 | Kalobios, Inc. | Antibody specificity transfer using minimal essential binding determinants |
| US20060008844A1 (en) | 2004-06-17 | 2006-01-12 | Avidia Research Institute | c-Met kinase binding proteins |
| WO2010056981A2 (en) | 2008-11-13 | 2010-05-20 | Massachusetts General Hospital | Methods and compositions for regulating iron homeostasis by modulation bmp-6 |
| US8795665B2 (en) | 2012-12-17 | 2014-08-05 | Eli Lilly And Company | BMP-6 antibodies |
Non-Patent Citations (214)
| Title |
|---|
| "Kidney inter.", vol. 2, 2012, KIDNEY DISEASE: IMPROVING GLOBAL OUTCOMES (KDIGO) ANEMIA WORK GROUP, article "KDIGO Clinical Practice Guideline for Anemia in Chronic Kidney Disease", pages: 279 - 335 |
| "Monoclonal Antibodies For Cancer Detection And Therapy", 1985, ACADEMIC PRESS, article "Analysis, Results, And Future Prospective Of The Therapeutic Use Of Radiolabeled Antibody In Cancer Therapy", pages: 303 - 16 |
| "Remington: The Science and Practice of Pharmacy, 20th ed.,", 2000, MACK PUBLISHING CO. |
| AL-LAZIKANI ET AL., J. MOL. BIOL., vol. 273, 1997, pages 927 - 948 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 10 |
| ALTSCHUL ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., NUC. ACIDS RES., vol. 25, 1977, pages 3389 - 3402 |
| AMON ET AL.: "Monoclonal Antibodies And Cancer Therapy", 1985, ALAN R. LISS, INC., article "Monoclonal Antibodies For Immunotargeting Of Drugs In Cancer Therapy", pages: 243 - 56 |
| ANDRIOPOULOS ET AL., NAT. GENET., vol. 41, 2009, pages 482 - 487 |
| ARNDT ET AL., GASTROENT, vol. 138, 2010, pages 372 - 382 |
| ASHKENAZI ET AL., PROC. NATL. ACAD. SCI. USA, vol. 88, 1991, pages 10535 - 10539 |
| BAMES ET AL., WORLD J. UROL., vol. 13, 1995, pages 337 - 343 |
| BARNES ET AL., W. J. UROL., vol. 13, 1997, pages 337 |
| BATZER ET AL., NUCLEIC ACID RES., vol. 19, 1991, pages 5081 |
| BEAUCAGE ET AL., TETRA. LETT., vol. 22, 1981, pages 1859 |
| BECK ET AL., BMC NEUROSCI., vol. 2, 2003, pages 12 |
| BEKRI ET AL., GASTROENT., vol. 131, 2006, pages 788 - 96 |
| BIRD ET AL., SCIENCE, vol. 242, 1988, pages 423 - 426 |
| BITTNER ET AL., METH. ENZYMOL., vol. 153, 1987, pages 516 |
| BRENNAN ET AL., SCIENCE, vol. 229, 1985, pages 81 - 83 |
| BRENT ET AL.: "Current Protocols in Molecular Biology", 2003, JOHN WILEY & SONS, INC. |
| BROWN ET AL., METH. ENZYMOL., vol. 68, 1979, pages 109 |
| CAMASCHELLA ET AL., NAT. GENET., vol. 41, 2009, pages 386 - 388 |
| CELEMENT ET AL., INT. J. CANCER, vol. 80, 1999, pages 250 - 256 |
| CELESTE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 87, 1991, pages 9843 |
| CHEN ET AL., GROWTH FACTORS, vol. 22, 2004, pages 233 |
| CHEN, J. ET AL., EMBO J., vol. 12, 1993, pages 821 - 830 |
| CHEN, J. ET AL., INTERNATIONAL IMMUNOLOGY, vol. 5, 1993, pages 647 - 656 |
| CHEUNG ET AL., VIROLOGY, vol. 176, 1990, pages 546 - 552 |
| CHOI ET AL., NATURE GENETICS, vol. 4, 1993, pages 117 - 123 |
| CHOTHIA ET AL., J. MOL. BIOL., vol. 196, 1987, pages 901 - 917 |
| CLARK ET AL., GENOME RES., vol. 13, 2003, pages 2265 - 70 |
| CORRADINI ET AL., HEPATOL., vol. 54, 2011, pages 273 - 284 |
| CORTEZ-RETAMOZO, V. ET AL., INT J CANCER, vol. 89, 2002, pages 456 - 62 |
| COX, J. P. L. ET AL., EUR. J IMMUNOL., vol. 24, 1994, pages 827 - 836 |
| CREIGHTON, PROTEINS, 1984 |
| CREWS ET AL., J. NEURO., vol. 30, 2010, pages 12252 - 12262 |
| DAI ET AL., CANCER RES., vol. 65, 2005, pages 8274 |
| DARBY ET AL., J. PATHOL., vol. 214, 2007, pages 394 - 404 |
| DENARDO ET AL., CLIN CANCER RES., vol. 4, no. 10, 1998, pages 2483 - 90 |
| DUMOULIN, M. ET AL., NATURE, vol. 424, 2003, pages 783 - 788 |
| E. MEYERS; W. MILLER, COMPUT. APPL. BIOSCI., vol. 4, 1988, pages 11 - 17 |
| ECKERT ET AL., PCR METHODS AND APPLICATIONS, vol. 1, 1991, pages 17 |
| ELLIOT; O'HARE, CELL, vol. 88, 1997, pages 223 |
| FISHWILD, D. ET AL., NATURE BIOTECHNOLOGY, vol. 14, 1996, pages 845 - 851 |
| FLEMING ET AL., SEMIN. LIVER DIX., vol. 25, 2006, pages 411 - 9 |
| FUKUMA S; YAMAGUCHI T; HASHIMOTO S ET AL.: "Erythropoiesis-stimulating agent responsiveness and mortality in hemodialysis patients: results from a cohort study from the dialysis registry in Japan", AM J KIDNEY DIS, vol. 59, no. 1, 2012, pages 108 - 16, XP028341314, DOI: doi:10.1053/j.ajkd.2011.07.014 |
| GANZ, BLOOD, vol. 102, 2003, pages 783 - 8 |
| GAP; BESTFIT; FASTA; TFASTA: "Wisconsin Genetics Software Package", GENETICS COMPUTER GROUP, 575 SCIENCE DR., MADISON, WIS. |
| GEHRKE ET AL., BLOOD, vol. 102, 2003, pages 371 - 6 |
| GENTZ ET AL., PROC. NATL. ACAD. SCI. USA, vol. 86, 1989, pages 821 - 824 |
| GEYSEN ET AL., MOL. IMMUNOL., vol. 23, 1986, pages 709 - 715 |
| GEYSEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 8, 1984, pages 3998 - 4002 |
| GEYSEN, PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 78 - 182 |
| GILBOA ET AL., MOL. BIOL. CELL, vol. 11, 2000, pages 1023 |
| GITELMAN ET AL., J. CELL BIOL., vol. 126, 1994, pages 1595 |
| GLENN E.MORRIS,: "Epitope Mapping Protocols in Methods in Molecular Biology", vol. 66, 1996, HUMANA PRESS |
| GLENNIE ET AL., J. IMMUNOL., vol. 139, 1987, pages 2367 - 2375 |
| H. A. ERLICH: "PCR Technology: Principles and Applications for DNA Amplification", 1992, FREEMAN PRESS |
| HAHN ET AL., GENOMICS, vol. 14, 1992, pages 759 |
| HAHN ET AL., GENOMICS, vol. 14, 1992, pages 759 - 62 |
| HAMDY ET AL., CANCER RES., vol. 57, 1997, pages 4427 |
| HANSSON ET AL., J. MOL. BIOL., vol. 287, 1999, pages 265 - 76 |
| HARAYAMA, TRENDS BIOTECHNOL., vol. 16, no. 2, 1998, pages 76 - 82 |
| HARDING, F.; LONBERG, N., ANN. N.Y. ACAD. SCI., vol. 764, 1995, pages 536 - 546 |
| HARRINGTON ET AL., NAT GENET., vol. 15, 1997, pages 345 |
| HAUDENSCHILD ET AL., CANCER RES., vol. 64, 2004, pages 8276 |
| HE ET AL., CELL. SIGNAL., vol. 25, 2003, pages 1372 - 1378 |
| HEE ET AL., J. ORTH. RES., vol. 27, 2008, pages 162 - 168 |
| HELLSTROM ET AL.: "Controlled Drug Delivery", 1987, MARCEL DEKKER, INC., article "Antibodies For Drug Delivery", pages: 623 - 53 |
| HENIKOFF; HENIKOFF, PROC. NATL. ACAD. SCI. USA, vol. 89, 1989, pages 10915 |
| HERRERA ET AL., BMC CELL BIOL., vol. 10, 2009, pages 20 |
| HOLLIGER ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 6444 - 6448 |
| HOLLIGER; WINTER, CANCER IMMUNOL. IMMUNOTHER., vol. 45, no. 3-4, 1997, pages 128 - 30 |
| HOLLIGER; WINTER, CANCER IMMUNOL. IMMUNOTHER., vol. 45, no. 34, 1997, pages 128 - 30 |
| HOLLINGER; HUDSON; 2005, NATURE BIOTECHNOLOGY, vol. 23, no. 9, pages 1126 - 1136 |
| HOPP ET AL., PROC. NATL. ACAD. SCI USA, vol. 78, 1981, pages 3824 - 3828 |
| HUNTER ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 37597 - 603 |
| HUSTON ET AL., PROC. NATL. ACAD. SCI., vol. 85, 1988, pages 5879 - 5883 |
| IKEDA ET AL., PLOS, 2012, pages 0040465 |
| ILYIN ET AL., FEBS LETT., vol. 542, 2003, pages 22 - 26 |
| INAGAKI ET AL., ENDOCRIN., vol. 147, 2005, pages 2681 - 2689 |
| INNIS ET AL.,: "PCR Protocols: A Guide to Methods and Applications", 1990, ACADEMIC PRESS |
| ITOH ET AL., EMBO J., vol. 20, 2001, pages 4132 |
| J. R. ROBINSON,: "Sustained and Controlled Release Drug Delivery Systems", 1978, MARCEL DEKKER, INC. |
| JACOLOT ET AL., BLOOD, vol. 103, 2004, pages 2835 - 40 |
| JANZ ET AL., EMERG. MED. PRACT., vol. 15, 2013, pages 1 - 15 |
| JONES, P. ET AL., NATURE, vol. 321, 1986, pages 522 - 525 |
| JUNG ET AL., STEM CELLS, vol. 26, 2008, pages 2042 - 2051 |
| KABAT ET AL.: "Sequences of Proteins of Immunological Interest, fifth ed.", 1991, U.S. DEPARTMENT OF HEALTH AND HUMAN SERVICES |
| KAISER ET AL., J. INVEST. DERM., vol. ILL, 1998, pages 1145 - 1152 |
| KALLUI ET AL., J. CLIN. INVEST., vol. 119, 2009, pages 1420 |
| KARLIN; ALTSCHUL, PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5787 |
| KARPOVSKY ET AL., J. EXP. MED., vol. 160, 1984, pages 1686 |
| KAUTZ ET AL., BLOOD, vol. 112, 2008, pages 1503 |
| KAUTZ ET AL., HAEMATOL., vol. 96, 2011, pages 199 - 203 |
| KHALAF ET AL., EUR. J. ENDOCRIN., vol. 168, 2012, pages 437 - 444 |
| KILPATRICK RD; CRITCHLOW CW; FISHBANE S ET AL.: "Greater epoetin alfa responsiveness is associated with improved survival in hemodialysis patients", CLIN J AM SOC NEPHROL, vol. 3, no. 4, 2008, pages 1077 - 83 |
| KIRKLAND ET AL., J. IMMUNOL., vol. 137, 1986, pages 3614 - 3619 |
| KIRSCH ET AL., EMBO J., vol. 19, 2000, pages 3314 |
| KIRSCH ET AL., FEBS LETT., vol. 468, 2000, pages 215 |
| KISHIMOTO ET AL., DEV., vol. 124, 1997, pages 4457 |
| KLUVER ET AL., J. PEPT. RES., vol. 59, 2002, pages 241 - 8 |
| KNAPPIK ET AL., J. MOL. BIOL., vol. 296, 2000, pages 57 - 86 |
| KOCHANOWSKA ET AL., EXP. BIOL. MED., vol. 227, 2002, pages 57 - 62 |
| KOHLER; MILSTEIN, NATURE, vol. 256, 1975, pages 495 |
| KORCHYNSKYI ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 4882 - 91 |
| KRAUSE ET AL., FEBS LETT., vol. 480, pages 147 - 150 |
| KUROIWA ET AL., NATURE BIOTECHNOLOGY, vol. 20, 2002, pages 889 - 894 |
| KYTE ET AL., J.MOI. BIOL., vol. 157, 1982, pages 105 - 132 |
| LAUWEREYS, M. ET AL., EMBO J, vol. 17, 1998, pages 3512 - 3520 |
| LI ET AL., INT. J. MED. SCI., vol. 3, 2006, pages 97 - 105 |
| LI ET AL., J. PHARM. TOX. METH., vol. 59, 2009, pages 171 - 80 |
| LIU, M A ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 8648 |
| LONBERG ET AL., NATURE, vol. 368, no. 6474, 1994, pages 856 - 859 |
| LONBERG, N.: "Handbook of Experimental Pharmacology", vol. 113, 1994, pages: 49 - 101 |
| LONBERG, N.; HUSZAR, D., INTERN. REV. IMMUNOL., vol. 13, 1995, pages 65 - 93 |
| LOPEZ-GOMEZ JM; PORTOLES JM; ALJAMA P: "Factors that condition the response to erythropoietin in patients on hemodialysis and their relation to mortality", KIDNEY INT SUPPL, 2008, pages 75 - 81 |
| LORENZO; BLASCO; 1998, BIOTECHNIQUES, vol. 24, no. 2, pages 308 - 313 |
| LOU ET AL., BLOOD, vol. 103, 2004, pages 2816 - 2821 |
| LU ET AL., J. BIOL. CHEM., vol. 279, no. 4, 2004, pages 2856 - 65 |
| MA ET AL., DEV., vol. 132, 2005, pages 5601 |
| MAJORE ET AL., HAEMATOLOGICA, vol. 87, 2002, pages 221 - 2 |
| MARIE ET AL., HISTOL. HISTOPATH., vol. 17, 2002, pages 877 |
| MATTILA ET AL., NUCLEIC ACIDS RES., vol. 19, 1991, pages 967 |
| MERRYWEATHER-CLARKE ET AL., HUMAN MOL. GENET., vol. 12, 2004, pages 2241 - 7 |
| MEYNARD D; KAUTZ L; DARNAUD V ET AL.: "Lack of the bone morphogenetic protein BMP6 induces massive iron overload", NAT GENET, vol. 41, no. 4, 2009, pages 478 - 81, XP055068872, DOI: doi:10.1038/ng.320 |
| MEYNARD ET AL., BLOOD, vol. 118, 2011, pages 747 - 756 |
| MI ET AL., J. CANCER RES. CLIN. ONCOL., vol. 137, 2011, pages 245 |
| MOLDENHAUER ET AL., SCAND. J. IMMUNOL., vol. 32, 1990, pages 77 - 82 |
| MOREL ET AL., MOLEC. IMMUNOL., vol. 25, 1988, pages 7 - 15 |
| MORRISON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 6851 - 6855 |
| MORRISON; OI, ADV. IMMUNOL., vol. 44, 1988, pages 65 - 92 |
| NARANG ET AL., METH. ENZYMOL., vol. 68, 1979, pages 90 |
| NATURE GENETICS, vol. 41, no. 4, pages 386 - 8 |
| NEEDLEMAN; WUNSCH, J. MOL, BIOL., vol. 48, 1970, pages 444 - 453 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 443 |
| NEMETH ET AL., BLOOD, vol. 101, 2003, pages 2461 - 3 |
| NICKEL ET AL., J. BONE JOINT SURG., vol. 83-A, no. 1, 2001, pages 7 - 14 |
| OHTSUKA ET AL., J. BIOL. CHEM., vol. 260, 1985, pages 2605 - 2608 |
| OTA ET AL., NAT. GENET., vol. 36, 2004, pages 40 - 45 |
| PADLAN, MOLEC. IMMUN., vol. 28, 1991, pages 489 - 498 |
| PADLAN, MOLEC. IMMUN., vol. 31, 1994, pages 169 - 217 |
| PARK ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 7806 - 10 |
| PATTEN ET AL., CURR. OPINION BIOTECHNOL., vol. 8, 1997, pages 724 - 33 |
| PAULUS, BEHRING INS. MITT. NO. 78, 1985, pages 118 - 132 |
| PEARSON; LIPMAN, PROC. NAT'L. ACAD. SCI. USA, vol. 85, 1988, pages 2444 |
| PEDERSON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 105, 2008, pages 20764 - 69 |
| PETERSON ET AL., BIOCONJUG. CHEM., vol. 10, no. 4, 1999, pages 553 - 7 |
| PIGEON ET AL., J. BIOL. CHEM., vol. 276, 2001, pages 7811 - 9 |
| PLANT ET AL., J. BONE MIN. RES., vol. 17, 2002, pages 782 - 790 |
| PLESCHBERGER, M. ET AL., BIOCONJUGATE CHEM, vol. 14, 2003, pages 440 - 448 |
| PLUCKTHUN; PACK, IMMUNOTECHNOLOGY, vol. 3, no. 2, 1997, pages 83 - 105 |
| POIJAK ET AL., STRUCTURE, vol. 2, 1994, pages 1121 - 1123 |
| PRASSLER ET AL., J. MOL. BIOL., vol. 413, 2011, pages 261 - 278 |
| QUEEN ET AL., IMMUNOL. REV., vol. 89, 1986, pages 49 - 68 |
| QUEEN, C. ET AL., PROC. NATL. ACAD., U.S.A., vol. 86, 1989, pages 10029 - 10033 |
| RIDGWAY ET AL., PROTEIN ENG., vol. 9, no. 7, 1996, pages 617 - 21 |
| RIECHMANN, L. ET AL., NATURE, vol. 332, 1998, pages 323 - 327 |
| ROETTO ET AL., BLOOD, vol. 103, 2004, pages 2407 - 9 |
| ROETTO ET AL., NAT. GENET., vol. 33, 2003, pages 21 - 2 |
| ROSEN, CYT. GROWTH FACT. REV., vol. 20, 2009, pages 475 |
| ROSENFELD ET AL., CELL, vol. 68, 1992, pages 143 |
| ROSSOLINI ET AL., MOL. CELL. PROBES, vol. 8, 1994, pages 91 - 98 |
| ROTHE ET AL., J. MOL. BIOL., vol. 376, 2008, pages 1182 - 1200 |
| ROY ET AL., CURR. OPIN. HEMAT., vol. 12, 2005, pages 107 - 111 |
| SAKAUE ET AL., BIOCHEM. BIOPHYS. RES. COMM., vol. 221, 1996, pages 768 |
| SALIEM S; PATENAUDE V; ABENHAIM HA: "Pregnancy outcomes among renal transplant recipients and patients with end-stage renal disease on dialysis", J PERINAT MED (EPUB AHEAD OF PRINT, 2015, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/25719292> |
| SAMPATH ET AL., J. BIOL. CHEM., vol. 265, 1990, pages 13198 |
| SAUERMANN ET AL., J. NEUROSCI. RES., vol. 33, 1993, pages 142 |
| SAUERMANN ET AL., J. NEUROSCI. RES., vol. 33, 1993, pages 142 - 7 |
| SCHARF ET AL., RESULTS PROBL. CELL DIFFER., vol. 20, 1994, pages 125 |
| SCHLUESENER ET AL., ATHEROSCL., vol. 113, 1994, pages 153 - 156 |
| SCHLUESENER ET AL., ATHEROSCLEROSIS, vol. 113, 1995, pages 153 |
| SCHLUESENER ET AL., GLIA, vol. 12, 2004, pages 161 - 164 |
| SHI ET AL., FERT. STERIL., vol. 92, 2009, pages 1794 - 1798 |
| SHIELDS, R. L. ET AL., J. BIOL. CHEM., vol. 277, 2002, pages 26733 - 26740 |
| SHIELDS, R. L. ET AL., J. BIOL. CHEN., vol. 276, 2001, pages 6591 - 6604 |
| SMITH, AM. J. MAN. CARE, vol. 16, 2010, pages 59 - 66 |
| SMITH, ANNU. REV. MICROBIOL., vol. 49, 1995, pages 807 |
| SMITH; WATERMAN, ADV. APPL. MATH., vol. 2, 1970, pages 482C |
| STAHLI ET AL., METHODS IN ENZYMOLOGY, vol. 9, 1983, pages 242 - 253 |
| STIJLEMANS, B. ET AL., J BIOL CHEM, vol. 279, 2004, pages 1256 - 1261 |
| STRAUSBERG ET AL., PROC. NATL. ACAD. SCI USA, vol. 99, 2003, pages 16899 - 903 |
| SUTTORP MM; HOEKSTRA T; ROTMANS JI ET AL.: "Erythropoiesis-stimulating agent resistance and mortality in hemodialysis and peritoneal dialysis patients", BMC NEPHROL, vol. 14, no. 1, 2013, pages 200, XP021158949, DOI: doi:10.1186/1471-2369-14-200 |
| TAYLOR, L. ET AL., INTERNATIONAL IMMUNOLOGY, 1994, pages 579 - 591 |
| TAYLOR, L. ET AL., NUCLEIC ACIDS RESEARCH, vol. 20, 1992, pages 6287 - 6295 |
| THORPE ET AL., IMMUNOL. REV., vol. 62, 1982, pages 119 - 58 |
| THORPE ET AL.: "Monoclonal Antibodies 84: Biological And Clinical Applications", 1985, article "Antibody Carriers Of Cytotoxic Agents In Cancer Therapy: A Review", pages: 475 - 506 |
| TOMIZUKA ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 722 - 727 |
| TOMLINSON, I. M. ET AL., J. FOL. BIOL., vol. 227, 1992, pages 776 - 798 |
| TUAILLON ET AL., J. IMMUNOL., vol. 152, 1994, pages 2912 - 2920 |
| TUAILLON ET AL., PROC. NATL. ACAD. SCI. USA, vol. 94, 1993, pages 3720 - 3724 |
| UMANA ET AL., NAT. BIOTECH., vol. 17, 1999, pages 176 - 180 |
| VARLEY ET AL., EXP. NEUR., vol. 140, 1996, pages 84 - 94 |
| VERHOEYEN ET AL., SCIENCE, vol. 239, 1988, pages 1534 - 1536 |
| VIL ET AL., PROC. NATL. ACAD. SCI. USA, vol. 89, 1992, pages 11337 - 11341 |
| WANG ET AL., BONE, vol. 48, pages 524 |
| WANG ET AL., J. AM. SOC. NEPH., vol. 12, 2001, pages 2392 |
| WANG ET AL., MOL. CELL. NEUROSCI., vol. 34, 2007, pages 653 - 661 |
| WARD ET AL., NATURE, vol. 341, 1989, pages 544 - 546 |
| WEINSTEIN ET AL., BLOOD, vol. 100, 2003, pages 3776 - 81 |
| WILSON ET AL., CELL, vol. 37, 1984, pages 767 |
| WINNACKER: "FROM GENES TO CLONES", 1987, VCH PUBLISHERS |
| WU ET AL., IMMUNOTECHNOLOGY, vol. 2, no. 1, 1996, pages 21 - 36 |
| XIA ET AL., BLOOD, vol. 111, 2008, pages 5195 |
| XIA ET AL., J. BIOL. CHEM., vol. 282, 2007, pages 18129 - 18140 |
| YANG ET AL., INT. J. BIOCH. CELL BIOL., vol. 41, 2009, pages 853 - 861 |
| ZAPATA ET AL., PROTEIN ENG., vol. 8, no. 10, 1995, pages 1057 - 1062 |
| ZARITSKY J; YOUNG B; GALES B ET AL.: "Reduction of serum hepcidin by hemodialysis in pediatric and adult patients", CLIN J AM SOC NEPHROL, vol. 5, no. 6, 2010, pages 1010 - 14 |
| ZEISBERG ET AL., AM. J. PHYSIOL. RENAL PHYSIOL., vol. 285, 2003, pages F1060 |
| ZHANG ET AL., NEUROSCI., vol. 138, 2006, pages 47 - 53 |
| ZHENG ET AL., J. IMMUNOL., vol. 154, 1995, pages 5590 - 5600 |
| ZIMMERMAN ET AL., NUCL. MED. BIOL., vol. 26, no. 8, 1999, pages 943 - 50 |
Cited By (29)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11530261B2 (en) | 2014-12-19 | 2022-12-20 | Novartis Ag | Compositions and methods for antibodies targeting BMP6 |
| US10683346B2 (en) | 2014-12-19 | 2020-06-16 | Novartis Ag | Compositions and methods for antibodies targeting BMP6 |
| JP2019515933A (en) * | 2016-05-03 | 2019-06-13 | カイマブ・リミテッド | Methods, regimens, combinations and antagonists |
| JP7240177B2 (en) | 2016-05-03 | 2023-03-15 | カイマブ・リミテッド | Methods, Regimens, Combinations and Antagonists |
| CN116059345A (en) * | 2016-05-03 | 2023-05-05 | 科马布有限公司 | Methods, regimens, combinations and antagonists |
| JP2022141801A (en) * | 2016-05-03 | 2022-09-29 | カイマブ・リミテッド | Anti-bmp6 antibodies or antigen binding fragments thereof and combinations |
| US11648308B2 (en) | 2016-05-03 | 2023-05-16 | Kymab Limited | Methods, regimens, combinations and antagonists |
| WO2017191437A1 (en) * | 2016-05-03 | 2017-11-09 | Kymab Limited | Methods, regimens, combinations & antagonists |
| CN109152814A (en) * | 2016-05-03 | 2019-01-04 | 科马布有限公司 | Methods, protocols, combinations and antagonists |
| GB2550114A (en) * | 2016-05-03 | 2017-11-15 | Kymab Ltd | Methods, regimens, combinations & antagonists |
| JP7460697B2 (en) | 2016-05-03 | 2024-04-02 | カイマブ・リミテッド | Anti-BMP6 antibodies or antigen-binding fragments thereof, and combinations |
| AU2017283787B2 (en) * | 2016-06-15 | 2020-09-17 | Novartis Ag | Methods for treating disease using inhibitors of bone morphogenetic protein 6 (BMP6) |
| WO2017216724A1 (en) * | 2016-06-15 | 2017-12-21 | Novartis Ag | Methods for treating disease using inhibitors of bone morphogenetic protein 6 (bmp6) |
| US11434269B2 (en) | 2016-06-15 | 2022-09-06 | Novartis Ag | Methods for treating disease using inhibitors of bone morphogenetic protein 6 (BMP6) |
| RU2790023C2 (en) * | 2016-06-15 | 2023-02-14 | Новартис Аг | Methods for treatment of disease, using bone morphogenetic protein 6 (bmp6) inhibitors |
| JP2019519546A (en) * | 2016-06-15 | 2019-07-11 | ノバルティス アーゲー | Methods of treating diseases using inhibitors of bone morphogenetic protein 6 (BMP 6) |
| US11878048B2 (en) | 2017-06-14 | 2024-01-23 | Kymab Limited | Use of the extracellular domain of transferrin receptor 2 for the diagnosis and treatment of primary or secondary sclerosing diseases |
| EP4733315A2 (en) | 2018-06-13 | 2026-04-29 | Kymab Ltd. | Treatments etc |
| WO2019238713A2 (en) | 2018-06-13 | 2019-12-19 | Kymab Limited | Treatments etc |
| WO2020065252A1 (en) | 2018-09-25 | 2020-04-02 | Kymab Limited | Antagonists |
| TWI848966B (en) * | 2018-09-25 | 2024-07-21 | 英商凱麥博有限公司 | Antagonists |
| AU2019348815B2 (en) * | 2018-09-25 | 2025-05-22 | Kymab Limited | Antagonists |
| WO2020086736A1 (en) | 2018-10-23 | 2020-04-30 | Scholar Rock, Inc. | Rgmc-selective inhibitors and use thereof |
| WO2020251924A1 (en) * | 2019-06-12 | 2020-12-17 | Regeneron Pharmaceuticals, Inc. | Human antibodies to bone morphogenetic protein 6 |
| US12612452B2 (en) | 2019-06-12 | 2026-04-28 | Regeneron Pharmaceuticals, Inc. | Human antibodies to bone morphogenetic protein 6 |
| WO2021142448A2 (en) | 2020-01-11 | 2021-07-15 | Scholar Rock,Inc. | Tgf-beta inhibitors and use thereof |
| WO2022204581A2 (en) | 2021-03-26 | 2022-09-29 | Scholar Rock, Inc. | Tgf-beta inhibitors and use thereof |
| WO2022256723A2 (en) | 2021-06-03 | 2022-12-08 | Scholar Rock, Inc. | Tgf-beta inhibitors and therapeutic use thereof |
| WO2024187051A1 (en) | 2023-03-07 | 2024-09-12 | Scholar Rock, Inc. | Tgf-beta inhibitors for use for treating resistant or unresponsive cancer in patients |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11530261B2 (en) | Compositions and methods for antibodies targeting BMP6 | |
| US10385127B2 (en) | Compositions and methods for antibodies targeting EPO | |
| US11434269B2 (en) | Methods for treating disease using inhibitors of bone morphogenetic protein 6 (BMP6) | |
| US20100034809A1 (en) | Compositions and Methods for Antibodies Targeting Complement Protein C5 | |
| US10047155B2 (en) | Antibodies targeting bone morphogenetic protein 9 (BMP9) and methods therefor | |
| AU2014281292C1 (en) | Lectin-like oxidized LDL receptor1 antibodies and methods of use | |
| WO2012172495A1 (en) | Compositions and methods for antibodies targeting tem8 | |
| HK40049388A (en) | Compositions and methods for antibodies targeting epo | |
| EA039579B1 (en) | METHODS AND COMPOSITIONS OF ANTIBODIES DIRECTED AGAINST BMP6 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15819883 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11201704634S Country of ref document: SG |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12017501077 Country of ref document: PH |
|
| ENP | Entry into the national phase |
Ref document number: 2970869 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: NC2017/0005941 Country of ref document: CO |
|
| ENP | Entry into the national phase |
Ref document number: 2017532601 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2017262 Country of ref document: CR Ref document number: 001091-2017 Country of ref document: PE Ref document number: CR2017-000262 Country of ref document: CR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 252966 Country of ref document: IL |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2017/008191 Country of ref document: MX |
|
| ENP | Entry into the national phase |
Ref document number: 2015365373 Country of ref document: AU Date of ref document: 20151218 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: DZP2017000393 Country of ref document: DZ |
|
| ENP | Entry into the national phase |
Ref document number: 20177019566 Country of ref document: KR Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015819883 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 201791389 Country of ref document: EA |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: 112017012954 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: 112017012954 Country of ref document: BR Kind code of ref document: A2 Effective date: 20170616 |












