WO2016097288A1

WO2016097288A1 - Biomarker and method for assessing the risk of arthrofibrosis

Info

Publication number: WO2016097288A1
Application number: PCT/EP2015/080480
Authority: WO
Inventors: Christian Herzog
Original assignee: Christian Herzog
Priority date: 2014-12-18
Filing date: 2015-12-18
Publication date: 2016-06-23
Also published as: EP3234610A1

Abstract

The invention relates to a method for assessing the risk of a patient of developing arthrofibrosis, for example after implantation of a prosthesis, using a RASAL1 and/or a RAS biomarker. The invention further relates to a biomarker with the aid of which it can assessed whether a patient will develop arthrofibrosis. Another embodiment of the invention relates to a method for treating arthrofibrosis and to a prevention method.

Description

Biomarkers. and methods for determining the risk of arthrofibrosis

The present invention relates to the field of medicine, in particular diagnostic methods for detecting and checking the course of arthrofibrosis and in particular for determining the risk of the development of arthrofibrosis. Another aspect relates to a method of treating arthrofibrosis and a method of prevention.

The syndrome of arthrofibrosis is characterized by an increase of connective tissue due to inflammatory processes within a joint. This leads to a local mechanical movement restriction. This leads to an increased expression of collagen, which serves as a network for the adhesion and proliferation of fibroblasts. In addition to type IV collagen, other types of collagen, in particular of the type I u. III formed. Due to inflammatory processes, there may also be a change in the composition of the extracellular matrix of the articular cartilage.

After transplantation of a joint prosthesis can be observed in many patients such arthrofibrosis. The restriction of movement caused by arthrofibrosis can lead to greater disability of the patient. In order to restore the mobility of the joint, it requires surgical intervention.

The aim of the present invention is therefore to early detection and / or to avoid the development of arthrofibrosis, in particular in connection with the implantation of prostheses.

This objective has been achieved by providing an improved diagnosis that can be used to assess whether a prosthesis is appropriate for the patient or alternative measures need to be taken into account and improved treatment of arthrofibrosis.

An object of the invention is therefore a method for diagnosing and checking the course of arthrofibrosis and in particular for determining the risk that a patient develops arthrofibrosis, for example after implantation of a prosthesis. Another object of the invention relates to a biomarker, by means of which it can be determined whether a patient has an increased risk of developing arthrofibrosis, for example after implantation of a prosthesis.

Another object of the invention is a method for the prevention, treatment and / or alleviation of arthrofibrosis.

The present invention thus relates to a method, in particular an in vitro method, for the detection of arthrofibrosis or for determining the course of arthrofibrosis, but in particular for determining the risk for the development of arthrofibrosis in a patient, in particular in a patient who has a prosthesis, in particular, a joint prosthesis has been implanted, comprising the step of qualitative and / or quantitative determination

a) the expression of RASAL1; and or

b) the activity of the RAS protein

in a sample of the patient, in particular in a sample comprising cartilage tissue and / or cartilage skin, or in situ.

In a specific embodiment of the present invention, the RASAL1 expression and / or the activity of the RAS protein in a blood sample of the patient can be determined.

In a further specific embodiment of the invention, in the context of the method according to the invention, as described herein, additionally a reference value is determined by qualitative and / or quantitative determination a) of the expression of RASAL1; and or

b) the activity of the RAS protein

in a control population.

In particular, said patient to be examined is an arthritic patient.

In particular, said control population is a patient of the same sex and of the same age, in particular healthy patients of the same sex and of the same age, in particular patients of the same sex and of the same age who do not suffer from arthrofibrosis.

In particular, said reference value is an average of the values determined within the quantitative determination of RASAL1 expression or RAS activity in the control population. This can be calculated using generally known methods. This can be a concrete numerical value or an area. In one embodiment, the present invention thus relates to a method, in particular an in vitro method for determining the risk for the development of arthrofibrosis in a patient, comprising the following steps:

(i) determining RASAL1 expression in a sample, in particular a blood sample of the patient to be examined;

(ii) determining RASAL1 expression in a control population as a control or reference value;

(iii) comparing the RASAL1 expression determined in (i) with the control or reference value determined in (ii);

(iv) providing the results obtained in (i) - (iii) which allow to determine the risk of developing arthrofibrosis.

In one embodiment of the invention, said patient is a patient to whom a prosthesis, in particular a joint prosthesis, has been implanted.

In a specific embodiment of the invention, it is an arthritic patient.

A RASAL1 expression deviating from the reference or mean value, but in particular a reduction in RASAL1 expression, means an increased risk for the development of arthrofibrosis.

A deviation from the reference or mean of more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, but in particular a deviation from the mean of 15% -50%, 20% -40%, 25% -30%, to an increased risk of developing arthrofibrosis.

In a specific embodiment of the present invention, said deviation from the reference value is a 25% -30% deviation. The determination of the RASAL1 expression can be carried out in the context of the present invention by quantification of the RASAL1 expression using generally known methods, as described below.

In one embodiment, the invention relates to a method for diagnosing arthrofibrosis in a patient, comprising the steps of:

(i) determining RASAL1 expression in a sample, especially a blood sample of the patient;

(ii) determining RASAL1 expression in a control population as a reference; (iii) comparing the RASAL1 expression determined in (i) with the reference value determined in (ii);

(iv) providing the results obtained in (i) - (iii) which allow the presence or absence of arthrofibrosis to be determined.

In this case, a RASAL1 expression deviating from the reference value, but in particular a reduction in RASAL1 expression, indicates the presence of arthrofibrosis.

In another embodiment, the invention relates to a method for following the course of arthrofibrosis in a patient following treatment with a pharmaceutical composition suitable for modifying RASAL1 expression, the method comprising the steps of:

(i) determining RASAL1 expression in a sample, especially a blood sample of the patient during a defined period of time;

(ii) determining RASAL1 expression in a control population during the period defined in (i) as a reference;

(iii) comparing the RASAL1 expression determined in (i) with the reference values determined in (ii);

(iv) providing the results obtained in (i) - (iii) that allow the disease to be tracked.

In this case, a RASAL1 expression deviating from the reference value, but in particular a reduction in RASAL1 expression, indicates that the patient is still suffering from a minimal residual arthrofibrosis.

The invention further relates to a method for predicting the response of a patient being treated with a pharmaceutical composition suitable for modifying RASAL1 expression, the method comprising the steps of:

(ii) determining RASAL1 expression in a control population as a reference;

(iii) comparison of RASAL1 expression determined in (i) before and after initiation of treatment;

(iv) providing the results obtained in (i) - (iii) which allow the patient's response to the treatment to be determined.

An increase in RASAL1 expression indicates an approximation the reference value indicates that the patient has a high potential to respond to the treatment.

The patients studied with the methods of the invention described herein are primarily mammals, but especially humans.

Within the scope of the methods according to the invention described herein, the determination of RASAL1 expression can be carried out by isolating nucleic acid from the sample taken by the patient and subsequent quantification. The quantification of RASAL1 expression can be carried out in a specific embodiment of the invention by means of quantitative "real-time" PCR (qRT-PCR), wherein in particular the primer pair

forward primer

CTCC AG CAG AAG CCACCTAAAG (SEQ ID NO: 1)

and

reverse primer

TCCATGAGAGGCTGGTAGCACT (SEQ ID NO: 2)

is used. RASAL 1 occurs in different splice variants, at least 10, of which 4 are protein-coding. These are known to the person skilled in the art and can be viewed in publicly accessible databases. In particular, the 4 protein coding splice variants in the UniProt database are described as 095294-1 (SEQ ID NO: 4), 095294-2 (SEQ ID NO: 6), 095294-3 (SEQ ID NO: 8) and 095294-4 (SEQ ID NO: 10) (http://www.uniprot.org/uniprot/095294). The named primer pair is particularly suitable for detecting the expression of the first splice variant 095294-1 (SEQ ID NO: 4). Spike variants 095294-2 (SEQ ID NO: 6), 095294-3 (SEQ ID NO: 8) and 095294-4 (SEQ ID NO: 10) can also be detected. The person skilled in the art is able to find and use further individualized primers based on the known sequences for these splice variants. For this purpose, both protein and mRNA sequences of the respective splice variants are known to the person skilled in the art (see, for example, SEQ ID NOS 4-11).

In an alternative embodiment of the invention, the determination of the RASAL1 expression can be carried out by quantification of the RASAL1 protein.

The content of RASAL1 protein in a sample can be determined in particular by Western blot, enzyme immunoassays such as ELISA or by HPLC (high pressure liquid chromatography). In a further embodiment of the present invention, in the above-described methods for detecting an arthrofibrosis or for determining the course or the risk for the development of arthrofibrosis in a patient, in particular in a patient who has been implanted with a prosthesis, in particular a joint prosthesis, alternatively or cumulatively, the following steps are performed:

(i) determining the activity of the RAS protein in a sample, in particular a blood sample of the patient;

(ii) determining the activity of the RAS protein in a control population as a reference;

(iii) comparing the RAS activity determined in (i) with the reference value determined in (ii);

In a specific embodiment of the invention, this is an arthritic patient, in particular an arthritic patient, to whom a prosthesis, in particular a joint prosthesis, has been implanted.

A RAS activity deviating from the reference or mean value, but in particular an increase in RAS activity, indicates an increased risk for the development of arthrofibrosis or the presence of arthrofibrosis.

A deviation from the reference or mean value is a deviation of more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50%, but especially a deviation from the mean of 15% -50%, 20% -40%, 25% -30%.

In a specific embodiment of the present invention, said deviation from the reference value is a 25% -30% deviation. In a specific embodiment of the invention, the determination of the RAS activity can be carried out in the context of fluorometric or enzymatic methods.

In an alternative embodiment of the invention, the determination of RAS activity can be made by quantitating the level of RasG protein in the sample.

The present invention further relates to RASAL1 and / or RasG as a biomarker for determining the risk for the development of arthrofibrosis or for determining the presence of arthrofibrosis in a patient, in particular in a patient to whom a prosthesis has been implanted. This is in particular an arthritic patient. Another object of the present invention relates to a method for the prevention, treatment and / or alleviation of arthrofibrosis in a patient using measures that determine the amount of free active RAS-G protein and / or RAS activity in the tissues of the patient to be treated reduced. Thus, the method according to the invention for the prevention, treatment and / or alleviation of arthrofibrosis aims at bioavailability, that is the amount of free active RAS-G protein and / or the activity of RAS-G, ie GTP bound RAS protein to reduce. The bioavailability of RAS-G and / or the activity of RAS can be reduced at several levels in the process according to the invention.

This can e.g. by blocking or inhibiting the RAS protein. Alternatively or additionally, this can be done by stimulating the hydrolysis of GAS bound to RAS. Also contemplated is the reduction of expression of genes encoding RAS and / or translation of mRNA encoding RAS.

An inhibitor for use in a method for the prevention, treatment and / or alleviation of arthrofibrosis may be a molecule, particularly a protein, which blocks the binding of GTP to the RAS protein and / or the exchange of GDP to GTP with RAS and thereby reduced the bioavailability of RAS-G. Usually, the exchange of GDP to GTP to RAS is stimulated by GTP exchange factors that bind to RAS. Thus, for use in the method according to the invention, those molecules are also provided which inhibit the activity of GTP exchange factors or the interaction of GTP exchange factors with RAS. An exchange factor known to those skilled in the art is hSosI, whose interaction with RAS can be inhibited in the method according to the invention. A preferred inhibitory protein is the "Ras inhibitory peptide" (Bachem AG, Bubendorf, Switzerland, http://shop.bachem.com/h-1392-1.html), a decapeptide of amino acids 1149-1158 of hSosl (N Li et al., Nature, 363, 85 (1993)). Thus, it is preferred that the inhibitory peptide for use in the present invention has the sequence H-Val-Pro-Pro-Pro-Val-Pro-Pro-Arg Arg-Arg-OH ("Ras inhibitory peptide", SEQ ID NO: 3) Also included are variants of the "Ras inhibitory peptide" which at least 50%, in particular at least 60%, 70%, 80%, 90%. , 95%, 98%, 99%, 100% of the inhibitory potency of the unaltered peptide and are suitable for use in the method of the invention are. In said variants, one to more, in particular 1-4, 1-3, 1-2 amino acids can be deleted, replaced or added. An amino acid exchange relates in particular to amino acids having the same or similar properties (conservative exchange). Other inhibitors, but are not limited to these are S-trans, trans-farnesylthiosalicylic acid and farnesylthiosalicylic acid. An inhibitor for use in a method for the prevention, treatment and / or alleviation of arthrofibrosis may also be a molecule, in particular a protein, which stimulates the exchange of GTP to GDP for RAS, in particular the hydrolysis of the io GTP already bound to RAS , thereby also reducing the bioavailability of RAS-G. The exchange of GTP to GDP for RAS, especially hydrolysis, is naturally slow in nature, and therefore GTPase-activating proteins usually stimulate activity. In the method according to the invention for the prevention, treatment and / or alleviation of arthrofibrosis, the

Activity of the GTPase can be stimulated by RAS, similar to the mode of action of GTPase-activating proteins, and / or the activity of GTPase-activating proteins stimulated. Especially preferred is the stimulation of the activity of RASAL 1, which stimulates the GTPase activity of native RAS and thus inhibits RAS activity and reduces the bioavailability of RAS-G.

The bioavailability of RAS-G can also be reduced at the nucleic acid level. For this purpose, various techniques are known to the person skilled in the art, which at the level of transcription, ie the process of reading a DNA sequence and the generation of an mRNA, and / or at the level of translation, that is the conversion of an mRNA into a protein of resulting protein

25 reduce. For use in the method according to the invention, measures are therefore provided at the nucleic acid level which reduce the bioavailability of RAS-G. This may relate directly to the inhibition of transcription and / or translation of RAS as well as the stimulation of the transcription and / or translation of proteins that interact directly or indirectly with RAS and their

For example, RASAL 1 can be used at the nucleic acid level to regulate gene expression, such as, for example, a miRNA, an antisense RNA, a ribozyme or other well-known gene regulators. In particular, molecules are provided which inhibit the gene expression of RAS on the

35 post-transcriptional level, preferably miRNA molecules. Also included in the present invention are measures that indirectly reduce the bioavailability of RAS-G. As already mentioned, this can be done by stimulating protein activity that causes RAS activity to be reduced. Alternatively or additionally, the bioavailability of RAS-G can be reduced by reducing protein activity that causes GTPase-activating proteins to be inhibited. In particular, the present invention thus encompasses measures that increase the expression and / or bioavailability of RASAL 1, a GTPase-activating protein, in the subject to be treated. RASAL 1 occurs in different splice variants, at least 10, of which 4 are protein-coding. These are known to the person skilled in the art and can be viewed in publicly accessible databases. In particular, the 4 protein coding splice variants in the UniProt database are described as 095294-1 (SEQ ID NO: 4), 095294-2 (SEQ ID NO: 6), 095294-3 (SEQ ID NO: 8) and 095294-4 (SEQ ID NO: 10) (http://www.uniprot.org/uniprot/095294). In order to increase the gene expression of the mentioned Spieissvarianten in the treatment of arthrofibrosis, various techniques are known in the art. Thus, genes are regulated by special promoters whose activity can be stimulated in the method according to the invention. In particular, it is known that the expression and / or bioavailability of RASAL 1 is reduced by epigenetic modifications, in particular methylations. The reversal and / or inhibition of this process increases the bioavailability of RASAL 1 and thus reduces the bioavailability of RAS-G.

The invention thus encompasses a method of preventing, treating and / or relieving arthrofibrosis in a patient using measures that reduce the amount of free active RAS-G protein and / or RAS activity in the tissues of the patient to be treated these measures are an increase in the bioavailability of RASAL 1. In particular, the present invention relates, inter alia, to a method for the prevention, treatment and / or alleviation of arthrofibrosis in a patient using measures that increase the amount of free active RAS-G protein and / or RAS activity in the tissues of the subject reduce the number of patients treated with a molecule that stimulates RASAL 1 gene expression. Further, the present invention relates to a method for the prevention, treatment and / or alleviation of arthrofibrosis in a patient using measures that include the amount of free active RAS-G protein and / or the RAS Reduce activity in the tissues of the patient to be treated, said measures being the inhibition of proteins that reduce the bioavailability of RASAL 1 by epigenetic modifications.

Such epigenetic modifications, in particular methylations, are described in particular for the promoter which regulates the gene expression of RASAL 1 at the DNA level. Various proteins are known that are responsible for methylations of CpG islands, regions of increased CpG dinucleotide density. The inhibition of such proteins is therefore provided in the method according to the invention to prevent, treat and / or alleviate arthrofibrosis. In particular, the use of compounds is conceivable which inhibit the methyltransferase Dnmtl and thus prevent the hypermethylation of the RASAL1 coding gene. The present invention thus further relates to compounds which are capable of reducing the amount of free active RAS-G protein and / or RAS activity in the tissues of the subject to be treated for use in the prevention, treatment and / or alleviation of arthrofibrosis in a patient. Such compounds may be those which directly reduce RAS activity and / or reduce the amount of free active RAS-G protein. Furthermore, compounds may be those that indirectly reduce the bioavailability of RAS-G. Therefore, the present invention particularly relates to inhibitors of proteins which cause epigenetic modifications in RASAL 1, in particular inhibitors of Dnmtl, for use in the prevention, treatment and / or alleviation of arthrofibrosis in a patient. Suitable inhibitors of Dnmtl are known in the art and are, for example, in Mack (2010) Nat. Biotech. 28 (12): 1259-66. In a first aspect, the invention relates to the use of RASAL1 for determining the risk of whether a patient, in particular an arthritic patient, reacts with the development of an arthrofibrosis, for example after implantation of a prosthesis.

The protein RASAL1 belongs to the family of GTPase-activating proteins. The gene is also known in the literature as RASAL or LOC8437 and encodes an inhibitor of the RAS protein. The gene product has also been described as "rasGAP-activating-like protein 1", "GAP1-like protein", "RAS-GTPase-activating protein-like" (http://www.ncbi.nlm.nih.gov/IEB/Research /Acembly/av.cgi?db=human&c=Gene&l= RASAL1) An example of a Homo sapiens rasGAP-activating-like protein (RASAL1) mRNA is listed at http://www.ncbi.nlm.nih.gov/nuccore/AF086713 and SEQ ID NOs: 5, 7, 9 and 11.

Also encompassed by, and thus in the present application, are paralogous and orthologous sequences, as well as homologous and conserved sequences from other species, especially mammalian species, especially Homo sapiens.

From Wynn, T.A. (2010), Nat. Med. 16: 523-525 and Bechtel, W. et al. (2010), Nat.

Med. 16 (5): 544-550 it is known that in fibrotic kidneys the RASAL1-encoding gene is hypermethylated via the methyltransferase Dnmtl. This reduces RASAL1 expression, which in turn activates RAS.

As a result, fibroblasts proliferate and fibrogenesis occurs in the kidney.

Surprisingly, it has now been shown in the context of the present soil formation that a similar epigenetic change as has been found in the kidney also takes place in the cartilaginous tissue in the case of arthrofibrosis, although kidney cells and joint cells differ considerably from one another.

In the joint completely different additional factors play a role than in the kidney. The joint serves mobility, the kidney of blood purification. The joint cell is accordingly ausgestatlet as a support cell in the joint system, while the function of the kidney cell is aligned to the blood detoxification. The corresponding cells therefore differ fundamentally in their physiology, so that the teaching of RAS signaling and the environmental functions in kidney cells can not be transferred to articular cells.

In a second aspect, a method for determining the risk of arthrofibrosis in a patient, in particular an arthritic patient, for example after implantation of a prosthesis, is disclosed. This includes the steps:

(i) determining RASAL1 expression in a sample of the patient;

(ii) determining if RASAL1 expression is under-regulated;

wherein the underregulation of RASAL1 indicates that the patient carries an increased risk of arthrofibrosis, for example, after implantation of a prosthesis.

The procedure is usually performed in vitro.

For this purpose, the level of expression of RASAL1 is compared with a reference value. This reference value can be a range and, for example, determined by expressing RASAL1 in persons / patients of the same sex and the same age. Then a mean value is determined by means of common methods. If the RASAL1 expression is within a normal range, then the patient can be implanted with a joint prosthesis. If the expression of RASAL1 is lower than usual, there is an increased risk that the use of a prosthesis leads to a later arthrofibrosis.

There is a deviation from the mean of more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50 %, but especially a deviation from the mean of 15% - 50%, 20% -40%, 25% -30%, indicating an increased risk of developing arthrofibrosis.

In this case, an alternative to the prosthesis is preferable, for example, cartilage transplantation and / or the GristleRepair method.

In order to assess whether a patient is at risk of developing arthrofibrosis and therefore a prosthesis is worthwhile for the patient, in a specific embodiment of the invention, cartilage tissue and / or cartilaginous skin are removed by means of biopsy and current methods. From this ex vivo or in vitro cells are isolated, and the RASAL1 expression is measured. Depending on the method of measurement, this may include the isolation of nucleic acids, but RASLA1 expression may also be measured directly in the sample material. Alternatively, determination of RASAL1 expression can also be made in a blood sample taken from the patient. In particular, the leukocytes are separated from the blood sample and the RNA is isolated from the leukocyte fraction thus obtained using conventional methods.

The determination of the RASAL1 expression can be carried out, for example, via an RT-PCR. For this purpose, the RNA isolated from the cells is transcribed into cDNA, which then serves as starting material for a PCR in which gene-specific primers are used. Ideally, the determination of the RASAL1 expression includes their quantification, for example via a quantitative real-time RT-PCR (qRT-PCR). However, other methods for determining gene expression are also known to the person skilled in the art.

It is known that during transcription 12 different mRNAs are produced by RASAL1, of which 10 are alternative splice variants and 2 are non-spliced forms. In particular, the 4 protein coding splice variants in the UniProt database are described as 095294-1 (SEQ ID NO: 4), 095294-2 (SEQ ID NO: 6), 095294-3 (SEQ ID NO: 8) and 095294-4 (SEQ ID NO: 10) (http://www.uniprot.org/uniprot/095294). The corresponding sequences are in generally accessible databases, such as Genbank, UniProt database, etc., recorded. Based on this sequence information, one skilled in the art can prepare PCR primers. For example, for RASAL1, the following primers, available from OriGene Technologies, Inc, Rockville MD (USA) may be used:

forward primer

CTCCAGCAGAAGCCACCTAAAG (SEQ ID NO: 1)

reverse primer

TCCATGAGAGGCTGGTAGCACT (SEQ ID NO: 2)

The named primer pair is in particular capable of detecting Spieissvariante 1, 095294-1 (SEQ ID NO: 4). The other Spieissvarianten can also be detected. Based on the known and disclosed herein sequences, one skilled in the art will be able to find and use suitable primers.

As an alternative to the presented method of nucleic acid determination, the gene product of RASAL1, the RASAL1 protein, can also be determined. Suitable methods include, for example, Western Blot, enzyme immunoassays such as ELISA or HPLC (high performance liquid chromatography).

As stated above, the RASAL 1 gene encodes a protein that is an inhibitor of the RAS protein and belongs to the family of GTPase-activating proteins. Since RASAL1 and RAS are closely linked, the content and / or the activity of the RAS protein can also be determined in the context of the present invention. RAS is a monomeric GTP-binding protein with the function of a regulated molecular switch that can be used to turn cellular processes on or off. RAS switches between two states in which it has either bound GTP (RAS-G) or in which the GTP is hydrolyzed to GDP (RAS). In these states, the protein assumes different conformations, depending on whether it is in the GTP or GDP bound state. The coding gene is also known as NRAS or NRAS1.

In a further specific embodiment, the present invention therefore relates to an alternative method, in particular an alternative in vitro method, for determining the risk for the development of arthrofibrosis in a patient, in particular an arthritic patient, for example after implantation of a prosthesis comprising the following steps : (i) determining the RAS activity in a sample of the patient;

(ii) determining if RAS activity is over-regulated;

wherein over-regulation of RAS indicates that the patient carries an increased risk of arthrofibrosis, for example after implantation of a prosthesis.

The sample can be removed and processed by conventional methods as described above.

Inhibition via RASAL1 results in the inactive GDP-bound form of RAS. So, at a low level of RASAL1, a higher amount of active RAS can be measured. The measurement of active RAS can be made by several assays, for example, using the "Ras activation assay" Biochem Kit, Cat. # BK008, Cytoskeleton, Denver, USA, or the Immunocytochemical Assay described by Sherman LS, Ratner N. (2001) for Ras activity "(Methods Enzymol., 333: 348-55). Increasing the RAS value increases the risk of arthrofibrosis.

As described above, RAS overregulation can be determined by comparison with a reference value. This reference value may be an area and determined by establishing an average of active RAS in persons / patients of the same sex and age. If the value determined by the method presented here is in a normal range, then the patient can be implanted with a joint prosthesis. If this value is higher than the mean value, there is an increased risk for the later development of arthrofibrosis.

There is a deviation from the mean of more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35%, more than 40%, more than 45%, more than 50 %, but especially a deviation from the mean of 15% - 50%, 20% -40%, 25% -30%, indicating an increased risk of developing arthrofibrosis. The patient should then prefer an alternative to a prosthesis.

As stated above, RAS is persistently activated in fibrosis. By administering an inhibitor in an effective dose to a patient, arthrofibrosis can be prevented and / or arthrofibrosis treated and / or alleviated. Such an inhibitor may be, for example, a protein or an antisense RNA. A preferred protein is the "Ras inhibitory peptide" (Bachem AG, Bubendorf, Switzerland), a decapeptide of amino acids 1149-1158 of hSosl (N.Li et al., Nature, 363, 85 (1993)). Further inhibitors, without To be limited to these are S-trans, trans-farnesylthiosalicylic acid and farnesylthiosalicylic acid. The inhibitor can be administered in a variety of ways, including parenteral, subcutaneous, intraperitoneal, topical, transmucosal, transdermal, intrabronchial, intrapulmonary, intranasal, intraventricular, intraarticular, intrathecal, intravaginal, intratracheal administration. Parenteral administration includes intraperitoneal, intramuscular, intradermal, subcutaneous, intravenous or intraarterial administration.

Preference is given to administration by the skin as well as by injection.

The formulation of the inhibitor in the context of a pharmaceutical composition is dependent on the nature of the inhibitor and can be carried out using known additives and according to well-known methods.

The present invention thus further relates to pharmaceutical or diagnostic compositions comprising at least one of said compounds.

The invention further relates to kits comprising the compounds used in the method according to the invention and instructions for use. In particular, instructions for using the kit according to the invention may contain instructions on how to carry out the methods according to the invention in order to obtain the most reliable results possible. The kits of the invention may further comprise agents / chemicals and / or articles suitable for carrying out the methods of the invention.

The sequences used in this invention are listed in the Sequence Listing. They relate to the following DNA or protein sequences:

SEQ ID NO: 1 is a forward primer.

SEQ ID NO: 2 is a reverse primer.

SEQ ID NO: 3 is the "RAS inhibitory peptide".

SEQ ID NO: 4 is the protein sequence of RASAL1 in variant 095294-1.

SEQ ID NO: 5 is the mRNA sequence of RASAL1 in variant 095294-1.

SEQ ID NO: 6 is the protein sequence of RASAL1 in variant 095294-2.

SEQ ID NO: 7 is the mRNA sequence of RASAL1 in variant 095294-2. SEQ ID NO: 8 is the protein sequence of RASAL1 in variant 095294-3.

SEQ ID NO: 9 is the mRNA sequence of RASAL1 in variant 095294-3.

SEQ ID NO: 10 is the protein sequence of RASAL1 in variant 095294-4.

SEQ ID NO: 11 is the mRNA sequence of RASAL1 in variant 095294-4.

The mRNA sequences of RASAL1 in the variants 095294-2, 095294-3 and 095294-4 were prepared with the aid of the "reverse translation" software, starting from SEQ ID N0: 6, 8 or 10 (Stothard (2000) Biotechniques 28: 1102-1104).

definitions

The technical terms and expressions used in the context of the present invention are to be understood to mean the meaning usually understood by them, unless stated otherwise herein.

The term "composition" as used in the present invention refers to compositions comprising at least one of the compounds of the present invention and / or can be used in the methods of the present invention, Optionally compositions may also contain compounds which alter certain properties of the compounds of the invention in that they act, for example, in stabilizing, altering or enhancing the function of the compounds according to the invention The compositions can be in liquid or solid form, for example in the form of a powder, a tablet or a solution.

A "pharmaceutical composition" in the context of the present invention is a composition for administration to a patient comprising compositions for use in the treatment, control, enhancement or prevention of a disease or condition in a human or animal Thus, compositions for use in medicine and / or veterinary medicine are included.

The composition may further comprise a pharmacologically acceptable carrier which comprises a non-toxic solid, semi-solid or liquid agent, diluent or packaging. Suitable carriers are known in the art and include, for example, sodium chloride, phosphate buffers, water, emulsions such as oil / water emulsions, sterile solutions, organic solvents, etc. Pharmacologically acceptable carriers are often low Amounts of additives such as substances that increase isotonicity and / or chemical stability. Such materials are non-toxic at the dosages and concentrations employed and further include phosphate, citrate, succinate, acetylic acid and other organic acids or their salts; Antioxidants such as ascorbic acid; low molecular weight peptides such as polyarginine or tripeptides; Proteins such as serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; Amino acids such as glycine, glutamic acid, aspartate or arginine; Monosaccharides, disaccharides and other carbohydrates comprising cellulose or its derivatives, glucose, mannose or dextrins; chelating agents such as EDTA; Sugar alcohols such as mannitol or sorbitol; Ions such as sodium; and / or nonionic agents such as polysorbates or PEG. The pharmaceutical composition may also contain other agents, depending on their intended use, for example, targeted agents such as antibodies or the like.

The pharmaceutically acceptable carrier as part of the pharmaceutical composition is preferably suitable for the chosen administration form. The administration of the pharmaceutical compositions of the invention or the compounds of the invention or the administration in the context of the inventive method for the prevention, treatment and / or alleviation of arthrofibrosis is carried out at a suitable therapeutically effective dosage. The dosage is determined by the attending physician based on clinical factors. Dosages depend on many factors, such as Gender, height and weight, age, time and form of administration, general health and the presence of other medicines. The therapeutically effective amount, depending on the circumstances, can be determined by methods that are well known in the art. In particular, the amount may be selected depending on the outcome of the methods of the invention for detecting arthrofibrosis, diagnosing arthrofibrosis, and / or responding to a patient for treatment of arthrofibrosis. The administration can take place once or continuously over a selected period of time.

The term "patient" is intended in the context of the present invention to include both humans and animals, but especially mammals. The methods described herein are therefore applicable in both human and veterinary medicine. For the purposes of the method according to the invention, a "value higher than the mean" means a deviation from the mean of more than 10%, more than 15%, more than 20%, more than 25%, more than 30%, more than 35% , more than 40%, more than 45%, more than 50%, but especially a deviation from the mean of 15% - 50%, 20% -40%, 25% -30%, such a deviation indicates the presence Arthrofibrosis or, if arthrofibrosis has not yet developed, an increased risk of developing arthrofibrosis.

For the purposes of the present invention, the term "determination of RASAL1 expression" is to be understood as meaning the qualitative and / or quantitative determination of the expression, specifically with regard to a control or reference value to be determined.

Methods for the determination of protein expression at the nucleic acid level which can be used in the context of the present invention are e.g. These include, but are not limited to, methods such as Northern blotting, PCR, RT-PCR, or "real time RT PCR." These methods are well known and used to obtain a large number of copies to generate the respective target sequence.

Typically, the expression of genes, e.g. by RT-PCR hybridization in samples taken from the patient or also "in situ." Alternative methods include high-throughput sequencing, eg, using Lynx Therapeutics' Massively Parallel Signature Sequencing (MPSS), Polony Sequencing, 454 Pyrosequencing, lllumina (Solexa) Sequencing, SOLid Sequencing, Ion-Semiconductor Sequencing, DNA Nanoball Sequencing, Helioscope® Single-Molecule Sequencing, Single-Molecule Real Time (RNAP), Single-Molecule SMRT® Sequencing, Nanopore DNA Sequencing, VisiGen biotechnologies procedure.

In these methods, typically, samples containing selective reagents, such as e.g. Probes, primers or ligands, thereby determining the presence or extent of the nucleic acids of interest in the sample.

The contact of the probes with the selective reagents may be accomplished using any suitable adjuncts, including slides, microtiter wells, test tubes, or columns.

In specific embodiments, the sample is contacted with the selective reagents on a substrate coated with the reagent, such as a nucleic acid array or a specific ligand array. The substrate may be a solid or semi-solid substrate. In this case, any support of glass, plastic, nylon, paper, metal, polymers, etc. come into question. The substrate may have various shapes and sizes and be present for example in the form of a plate, a membrane, a bead, a column or a gel. The contact between substrate and reagent can be carried out under any conditions, provided that they lead to the formation of a detectable complex between substrate and reagent, such as the formation of a nucleic acid hybrid of the reagent and the nucleic acids of interest of the sample.

In a preferred embodiment, the expression levels of genes can be determined by quantifying the RNA of the genes, e.g. the mRNA or the miRNA.

Methods for quantitative determination of mRNA are known in the art and described in the prior Techik.

For example, the nucleic acid contained in samples taken from the patient (e.g., cells or tissues) may first be extracted according to standard techniques, e.g. using lytic enzymes or chemical solutions or nucleic acid-binding resins as specified by the manufacturer. The extracted mRNA can then be detected by hybridization (eg by Northern blot analysis).

Alternatively, the extracted mRNA may be subjected to coupled reverse transcription and amplification, for example, by a polymerase chain reaction (RT-PCR) using specific oligonucleotide primers that allow amplification of a particular region in the target gene. In this case, preference is given to using quantitative or semi-quantitative RT-PCR, and in particular quantitative or semi-quantitative RT-PCR in real time. The extracted mRNA can be reverse transcribed and amplified and subsequently detected by any suitable method known in the art. In particular, the amplified sequences can be detected by hybridization with a suitable probe or by direct sequencing or using high-throughput sequencing.

Alternative methods of amplification include ligase chain reaction (LCR), transcription-mediated amplification (TMA), strand displacement amplification (SDA) and nucleic acid sequence-based amplification (Nucleic Acid Sequence Based Amplification / NASBA). Suitable hybridization probes or amplification probes are, in particular, nucleic acids which have at least 10 nucleotides and have sequence complementarity or homology with the RNA to be detected. It is known that such nucleic acids need not have absolute sequence identity with the RNA to be detected, but typically at least 80%, 85%, 90% 95% are identical to the homologous region of comparable size. In certain embodiments, it may be advantageous to use nucleic acids in combination with suitable adjuvants, such as. As a detectable label to use for the detection of hybridization. A large number of such adjuvants are known in the art, for example in the form of fluorescent, radioactive, enzymatic or other ligands (eg avidin / biotin).

As probes, single-stranded nucleic acids having a length of 10 to 1000 nucleotides, 10 to 800 nucleotides, 15 to 700 nucleotides, 20 to 500 nucleotides are typically used.

Primers are typically shorter single-stranded nucleic acids of 10 to 25 nucleotides in length, designed to exactly or nearly exactly match the nucleic acid to be amplified. The probes and primers have a specificity for the nucleic acid to be detected, which is sufficient to hybridize with it, preferably under high-stringency hybridization conditions.

In an alternative embodiment of the invention, the determination of the expression levels of the genes can also be carried out by quantifying the corresponding coding proteins. All techniques available for the measurement of protein content can be used. This can e.g. done using protein-specific antibodies.

Such methods include contacting a sample with a binding partner capable of selectively interacting with the target protein present in the sample. The binding partner is generally an antibody which may be polyclonal or monoclonal, preferably monoclonal.

The presence of the protein can be detected using standard electrophoretic and immunodiagnostic techniques, including known immunoassays such as competition assays, direct reaction assays, or sandwich-type assays. Such assays include, but are not limited to, Western blotting, agglutination, enzyme-labeled and enzyme-mediated immunoassays such as ELISAs; Biotin / avidin type assays, radioimmunoassays, immunoelectrophoresis, immunoprecipitation, etc. These assays typically use specific reaction marker usage such as eg fluorescent markers, chemiluminescent markers, radioactive markers, enzymatic markers or dye molecules.

The methods for determining protein expression at the amino acid level include, but are not limited to, Western blotting or polyacrylamide gel electrophoresis in conjunction with protein staining techniques, such as e.g. Colouration with Coomassie Brilliant Blue or a silver stain. The total protein of a sample is loaded onto a polyacrylamide gel and subjected to electrophoresis. Thereafter, the separated proteins are transferred to a membrane, e.g. a polyvinyl difluoride (PVDF) membrane by applying an electric current. The membrane-bound proteins are then contacted with antibodies that bind specifically to the protein to be detected. After a wash, a second antibody that specifically binds to the first antibody is applied, as well as a read-out system, e.g. in the form of a fluorescent dye. The content of protein to be detected is then determined on the basis of the fluorescence intensities. Alternatively, the so-called "Agilent Bioanalyzer Technique" can be used to quantify the protein content.

Alternatively, the protein content may also be determined using purely immunological methods, such as e.g. By the so-called "enzyme-linked immunosorbent assay" (ELISA), the above immunological methods generally involve the separation of unbound protein present in the liquid phase from the antigen-antibody complexes bound to a solid phase support used in practice in this context include substances such as nitrocellulose (eg in the form of a membrane or microtiter well), polyvinyl chlorides (eg, films or microtiter wells), polystyrene latex (eg, beads or microtiter plates), polyvinylidine fluoride, diazotized paper, nylon membrane, activated beads, magnetizable beads, and the like.

In particular, in the context of the present invention, an ELISA method can be used wherein the wells of a microtiter plate are coated with a set of antibodies against the proteins to be tested. Then, a sample containing the marker protein or suspected of containing the marker protein is added to the coated wells. After an incubation time sufficient to allow the formation of antibody-antigen complexes, the plate (s) can be washed to remove unbound units and become a detectable labeled secondary binding molecule added. The secondary binding molecule is reacted with any trapped marker protein, the plate is washed, and the presence of the secondary binding molecule is detected by methods well known in the art.

Alternatively, the determination of the protein content can also be carried out using the "intracellular fluorescence activated cell sorting" (FACS) technique.

For the purposes of the present invention, the term "determination of the activity of the RAS protein" is to be understood as meaning the quantitative determination of the content of active RAS protein with regard to a control value to be determined, whereby on the one hand the protein content can be determined directly quantitatively by measurement the concentration of RasG protein or indirectly by determining RAS activity in the tissue sample by appropriate methods.

Measurement of active RAS can be made using known assays, such as the Ras activation assay biochem kit (Cat. # BK008, Cytoskeleton, Denver, USA) or Sherman LS, and Ratner N. (2001). Methods Enzymol.; 333: 348-55) for determining RAS activity.

Another assay based on the kinetic measurement of the GTPase activity of the RAS protein is the "luminescent microwell plate assay" described in Spangler et al ((2009) Anal. Bioanal Chem., 394 (4): 989-96). ,

The total protein content of GTP-bound RAS (RasG) can be e.g. be determined by the method described in US 5741635.

By "PCR" is generally meant a process involving a plurality of repetitions of a reaction cycle and comprising the steps of: (a) a denaturation step, (b) a cooling step, and (c) an amplification step of amplifying a specific nucleic acid molecule using of primers of different length and / or composition. It is known to the person skilled in the art how the process conditions can be optimized by adapting the duration and temperature of the various process steps.

In general, the PCR process is carried out, for example, in a 50 μM reaction mixture containing a PCR buffer, deoxynucleoside triphosphates, primers, a template DNA and a polymerase. Suitable amounts and concentrations of the various ingredients are known to those skilled in the art. It is also known how the reaction can be adapted for particular purposes, eg by reducing or increasing the volume of the reaction mixture, by altering it the concentration of certain ingredients and / or by adding other ingredients.

Suitable polymerase for use with a DNA template include, for example, E. coli DNA polymerase I or its Klenow fragment, T4 DNA polymerase, Tth polymerase, Taq polymerase, a heat-stable DNA polymerase isolated from Thermus aquaticus Vent, Amplitaq, Pfu and KOD.

If the nucleic acid to be amplified is RNA, the "reverse transcriptase polymerase chain reaction" (RT-PCR) is used.

By "reverse transcriptase" is meant an enzyme that catalyzes the polymerization of the deoxyribonucleoside triphosphates to form primer extension products that are complementary to the ribonucleic acid template.

After preparation of the complementary c-DNA, the genomic RNA / cDNA duplex template is typically denatured by heat as part of a first denaturation step, so that a DNA strand becomes available as an amplification template. The condition for carrying out the reverse transcription and the subsequent amplification of the cDNA template are known to the person skilled in the art and can be adapted according to the respective needs, e.g. by changing the incubation temperature or duration or by increasing or decreasing the concentration of individual components of the reaction mixture.

The resulting reaction products are then loaded onto an agarose gel and the ribbon intensities after staining of the nucleic acid molecules with an intercalating dye, e.g. Ethidium bromide or SybrGreen. The "real-time PCR" method uses a specific sample, commonly referred to as the TaqMan sample. This has a reporter dye (a fluorophore) covalently attached at the 5 'end and a quencher at the 3' end. After the TaqMan probe has hybridized to the complementary region of the polynucleotide to be amplified, the 5'-linked fluorophore is cleaved off by the 5'-nuclease activity of the Taq polymerase in the extension phase of the PCR reaction. As a result of this reaction, the fluorescence of the 5 'fluorophore increases, which was previously suppressed due to the proximity of the quencher in the TaqMan sample. As a result, the amplification can be followed directly and simultaneously, as a result of which a significantly more accurate determination of the expression level of the target sequence is possible than is possible with the traditional PCR method.

Real time RT-PCR also uses an intercalating DNA dye such as SybrGreen, to follow the "de novo" synthesis of double-stranded DNA molecules.

EMBODIMENTS

1. Determination of the transcription rate of RASAL1 from human blood

Blood served as the starting material for determining the transcription rate of RASAL1. From the leukocyte fraction of the EDTA blood, the intact RNA was isolated by means of the High Pure RNA Isolation Kit (Cat No. 11 828 665 001) from Roche Diagnostics. The concentration of isolated RNA was determined by NanoDrop Spectrophotometer. Real-time quantitative reverse transcriptase PCR was used to determine the RASAL1 mRNA transcription rate.

1.1 Isolation of the RNA:

0.5 ml of EDTA blood is mixed with 1 ml of "Red Blood Cell Lysis" buffer and mixed gently The sample is incubated for 10 minutes at room temperature in a shaker at 200 rpm After incubation, the sample is centrifuged for 5 minutes at 500 × g The clear reddish supernatant is carefully removed with a pipette and the leukocytes form a white pellet which is resuspended in 1 ml of "Red Blood Cell Lysis" buffer. After resuspension, centrifugation is performed at 500 xg for 3 minutes. The supernatant is gently removed and the whitish pellet is resuspended in 0.2 ml PBS. After resuspension, 0.4 ml Lysis / Binding buffer is added to the homogenate and thoroughly mixed for 15 seconds in a Vortex mixer. The 0.6 ml of lysed leukocytes is transferred to a High Pure Filter Tube (attached to a collection tube) and centrifuged for 15 seconds at 8000 xg. The flow is discarded. 90 microliters of DNase I incubation buffer are mixed with 10 microliters of DNase I and pipetted onto the "glass fiber fleece" of the "High Pure Filter Tube". Subsequently, the DNase solution is allowed to act on the column for 15 minutes at room temperature to degrade the DNA. The RNA bound on the column is purified by two treatments (Wash Buffer I and Wash Buffer II and centrifugation steps (15 seconds at 8000 × g and 2 minutes at 13000 × g).) The "High Pure Filter Tube" is introduced into a sterile 1.5 ml reaction vessel ( For the elution of the RNA, 50 microliters of elution buffer (Elution Buffer) are added to the "High Pure Filter Tube" and centrifuged for 1 minute at 8000 xg. The isolated RNA can be used directly for PCR or stored at -80 ° C for later analysis.

1.2 Determination of the concentration of isolated RNA

The concentration of isolated RNA is determined using the NanoDrop Spectrophotometer and adjusted to a concentration of 10 nanograms / microliter.

1.3 Real-time quantitative reverse transcriptase PCR

To determine the RASAL1 mRNA transcription rate, a quantitative real-time PCR is carried out, wherein in the first step of the reaction the isolated RNA is converted by means of reverse transcriptase into complementary DNA strands and in the second step of the reaction the DNA strands are converted into double-stranded DNA and amplified. For the quantification of the resulting PCR products, DNA dyes such as SYBR Green I, which intercalate or bind to the DNA, or specific DNA probes labeled with a reporter fluorescent dye at one end and a quencher at the other end are to be used. The increase in fluorescence is proportional to the number of newly formed DNA copies and is measured in each cycle. The quantification is derived via the derived C _T value. The real-time PCR is performed using the SensiFAST SYBR NoRox OneStep Kit from BIOLINE according to the instructions. An approach is performed with the isolated RNA from the blood sample of a patient with arthrofibrosis and an approach with RNA from a patient without symptoms of arthrofibrosis. Each approach performs a duplicate determination. The following substances are used for a real-time quantitative reverse transcriptase PCR approach:

• 10 μΙ_ 2x SensiFAST SYBR No-ROX One Step Mix

• 0.8 [iL (10 micromolar) forward RASAH primer: CTCCAGCAGAAGCCACCTAAAG

• 0.8 μΙ_ (10 micromolar) reverse RASAL1 primer: TCCATGA-GAGGCTGGTAGCACT

• 0.2 μΙ_ reverse transcriptase (included in the kit)

• 0.4 [iL RiboSafe RNase Inhibitor (included in the kit)

• 3.8 μΙ_ DEPEC-H ₂ 0

• 4.0 [iL of isolated RNA as template (40 ng) The real-time quantitative reverse transcriptase PCR is performed using the Rotor-Gene Q from Qiagen. The set parameters on the device consisted of the following cycles:

Table 1: PCR program set on Rotor-Gene Q:

2. Results of real-time quantitative reverse transcriptase PCR

2.1 Results of the Rotor-Gene-Q analysis

Analysis of blood samples from patients without arthrofibrosis shows that the reverse transcriptase PCR product is formed earlier than blood samples from patients suffering from arthrofibrosis (see Figure 1). RASAL-1 mRNA transcription is included the negative samples (patients without arthrofibrosis) are higher than in the patients with arthrofibrosis.

2.2 Results of the eal-time quantitative reverse transcriptase PCR "

After performing the "real-time quantitative reverse transcriptase PCR", the products formed are separated by electrophoresis on an agarose gel The two primers RASALI-forward primer and RASALI-reverse primer amplify splice variants of the RASAL1 gene. In the case of the 136 bp amplification product, the corresponding RASAL1 variant shows a higher transcription rate in the samples of patients without arthrofibrosis (Figure 2, bands 3 and 4) on the samples of patients suffering from arthrofibrosis (Figure 2, lanes 1 and 2).

Claims

claims

A method for detecting arthrofibrosis or for determining the course or risk of developing arthrofibrosis in a patient, comprising the step of qualitatively and / or quantitatively determining a) the expression of RASAL1; and or

b) the activity of the RAS protein

in a sample of the patient or in situ.

2. The method according to claim 1, characterized in that it is a patient who has a prosthesis implanted.

A method according to any one of the preceding claims, wherein said sample comprises cartilage tissue and / or cartilage skin.

4. The method according to any one of the preceding claims, characterized in that in addition a reference value is determined by a qualitative and / or quantitative determination

a) the expression of RASAL1; and or

b) the activity of the RAS protein

in a control population.

A method according to claim 4, characterized in that said control population is of the same sex and age.

6. Method according to claim 4 or claim 5, characterized in that said reference value is an average of the values determined in the control population.

7. A method according to any one of claims 1-6 for determining the risk of developing arthrofibrosis in a patient comprising the steps of:

(i) determining RASAL1 expression in a sample of the patient;

8. The method according to claim 7, wherein a deviating from the reference RASAL1 expression indicates an increased risk of arthrofibrosis.

9. The method according to claim 8, wherein said deviation is a reduction in RASAL1 expression.

10. The method according to claim 9, wherein said RASAL1 expression deviating from the reference value is a 25% -30% deviation.

11. A method of diagnosing arthrofibrosis in a patient, comprising the steps of:

(i) determining RASAL1 expression in a sample of the patient;

(ii) determining RASAL1 expression in a control population as a reference;

(iii) comparing the RASAL1 expression determined in (i) with the reference value determined in (ii);

12. The method according to claim 11, wherein a deviating from the reference RASAL1 expression indicates the presence of arthrofibrosis.

13. The method according to claim 12, wherein said deviation is a reduction in RASAL1 expression.

14. A method of following the course of arthrofibrosis in a patient following treatment with a pharmaceutical composition adapted to modify RASAL1 expression, the method comprising:

(i) determining RASAL1 expression in a sample of the patient during a defined period of time; (ii) determining RASAL1 expression in a control population during the period defined in (i) as a reference;

(iv) providing the results obtained in (i) - (iii) that allow to track the course of the disease.

15. The method of claim 14, wherein a reference deviating RASAL1 expression indicates that the patient is still suffering from a minimal residual arthrofibrosis.

16. The method according to claim 15, wherein said deviation is a reduction in RASAL1 expression. 5

17. A method for predicting the response of a patient being treated with a pharmaceutical composition suitable for modifying RASAL1 expression, the method comprising the steps of:

(i) determining RASAL1 expression in a sample of the patient;

(ii) determining RASAL1 expression in a control population as the reference value;

5

18. The method of claim 17, wherein an increase in RASAL1 expression, and thus an approximation to the reference value, indicates that the patient has a high potential to respond to the treatment. 0

The method of any of claims 11 to 14, wherein the patient is a mammal.

The method of claim 19, wherein the mammal is a human. 5

21. The method of any preceding claim, wherein the determination of RASAL1 expression comprises quantifying RASAL1 expression.

22. The method according to any one of the preceding claims, wherein from the sample nucleic acids are isolated and quantified.

5 23. The method according to any one of the preceding claims, wherein the quantification of RASAL1 expression by means of quantitative "real-time" PCR (qRT-PCR) is carried out.

24. The method of claim 23, wherein in the context of the quantitative "real-time" i o PCR (qRT-PCR) the primer pair

SEQ ID No .: 1: forward primer

CTCC AG CAG AAG CCACCTAAAG (SEQ ID NO: 1)

and

SEQ ID No .: 2: reverse primer

15 TCCATGAGAGGCTGGTAGCACT (SEQ ID NO: 2)

is used.

25. The method of any one of the preceding claims, wherein the determination of RASAL1 expression is the quantification of the RASAL1 protein

20 includes.

26. The method according to any one of claims 1-6, characterized in that alternatively or cumulatively, the following steps are carried out:

(i) determining the level of active RAS protein (RasG) in a sample of the 25 patient;

(ii) determining the level of active RAS protein (RasG) in a control population as a reference;

(iii) comparison of the RasG content determined in (i) with the reference value determined in (ii);

30 (iv) Provide the results obtained in (i) - (iii) that allow it

a) determine the risk of developing arthrofibrosis; or (b) determine the presence or absence of arthrofibrosis; or

c) to track the course of arthrofibrosis disease; or

35 d) determine the patient's response to treatment.

27. The method according to claim 26, wherein a different from the reference value RasG content indicates an increased risk of arthrofibrosis.

28. The method according to claim 27, wherein said deviation is an increase in the RasG content.

29. Method according to claim 28, wherein said deviation from the reference value is a 25% -30% deviation.

30. A method according to any one of the preceding claims, wherein the determination of the RasG content comprises the quantitative determination of the RasG protein.

A method according to any one of the preceding claims, wherein the determination of the RasG content comprises the qualitative determination of the RAS activity.

32. RASAL1 as a biomarker to determine the risk of developing arthrofibrosis in a patient.

33. RasG as a biomarker for determining the risk of developing arthrofibrosis in a patient.

34. A method of preventing, treating and / or alleviating arthrofibrosis in a patient using measures that reduce the amount of free active RAS-G protein and / or RAS activity in the tissues of the patient being treated.

35. The method according to claim 34, wherein said measures are an inhibition or blockade of the RAS protein.

36. The method of claim 34, wherein said measures are an increase in the bioavailability of RASAL1.

The method of claim 36, wherein increasing the bioavailability of RASAL 1 comprises stimulating RASAL 1 gene expression.

38. The method of claim 38, wherein stimulating gene expression of RASAL 1 comprises inhibiting proteins that reduce the bioavailability of RASAL 1 by epigenetic modifications.

39. The method of claim 38, wherein inhibition comprises inhibiting Dnmtl.

40. The method of claim 35, wherein inhibiting or blocking the RAS protein comprises inhibiting or blocking the binding of GTP to the RAS protein and / or inhibiting or blocking the exchange of GDP to GTP with RAS.

41. The method of claim 41, wherein the inhibiting or blocking comprises inhibiting the interaction of hSosI with RAS.

42. The method according to claim 41, wherein the interaction of hSosI with RAS is achieved by a peptide which comprises the sequence according to SEQ ID NO: 3 or a peptide which is at least 50%, preferably at least 60%, 70%, 80%, 90%, 95%, 98%, 99%, 100% of the inhibitory potency of the unaltered peptide.