WO2016089898A1

WO2016089898A1 - Antimicrobial compounds and their use in treating plant disease

Info

Publication number: WO2016089898A1
Application number: PCT/US2015/063233
Authority: WO
Inventors: Graciela Lilianna LORCA; Christopher L. Gardner; Claudio F. GONZALEZ; Fernando PAGLIAI
Original assignee: University Of Florida Research Foundation, Inc.
Priority date: 2014-12-01
Filing date: 2015-12-01
Publication date: 2016-06-09

Abstract

The invention pertains to CarD inhibitors or LdtR inhibitors as antimicrobial agents and provides methods of treating and/or preventing microbial infections of plants. In specific embodiments, the invention provides methods of treating infections in plants, particularly, citrus plants, by administering to the plant an effective amount of a compound selected from diphenylamine, tolfenamic acid, benzbromarone, hexestrol, oxantel pamoate, diethylstilbestrol, phloretin, resveratrol, and a derivative thereof.

Description

DESCRIPTION

ANTIMICROBIAL COMPOUNDS AND THEIR USE IN TREATING PLANT DISEASE

CROSS-REFERENCE TO A RELATED APPLICATION

This application claims the benefit of U.S. provisional application Serial No. 62/085,950, filed December 1, 2014, which is incorporated herein by reference in its entirety.

The Sequence Listing for this application is labeled "SeqList-01Decl5-ST25.txt", which was created on December 1 , 2015, and is 27 KB. The entire content is incorporated herein by reference in its entirety.

BACKGROUND OF THE INVENTION

Bacterial plant pathogens pose unique problems for disease control. One primary control strategy for bacterial diseases is excluding the pathogen through the use of disease free seed, or quarantine and eradication if bacterial pathogens are introduced into an area.

There are only a few chemical control agents for established bacterial diseases, and their use is often limited because of phytotoxicity or pathogen mutations resulting in resistance to the agent. Also, commonly applied protective copper compounds (for example sulfates or oxides) have limited benefit in controlling bacterial diseases because of their poor penetration into plant tissues where bacteria establish themselves and, again, mutations provide bacteria with resistance to these materials.

Unlike the control of disease outbreaks in annual crops that can be remediated in subsequent years through sanitation and the use of bacteria-free seed stocks, replanting of perennial crops such as citrus involves high capital costs to establish the planting, and several years after planting before production is initiated.

Established bacterial diseases such as those caused by Candidatus liberibacter species (citrus greening or Huanglongbing (HLB), psyllid yellows and tomato, or purple top and zebra chip of potatoes, etc.) that survive in alternate host plants in the environment and are disseminated by insect vectors that commonly infect throughout the plant life cycle are very difficult to contain because of the wide dissemination range of the insect vector and the long lag time for symptom expression (Bove (2006)). Unfortunately, recent attempts to culture the organism were met with limited success (Sechler el al. (2009)). HLB disease (also known as citrus greening or yellow dragon disease) is one such disease associated with the fastidious, Gram-negative, phloem-limited bacterial pathogen, Candidatus liberibacter. It is the most destructive citrus disease worldwide (da Graca (1991); Halbert et al. (2004); and Gottwald (2010)). The current management strategy of HLB is to chemically control psyllids and scout for and remove infected trees. However, current management practices have not been able to stop the spread of HLB disease (Duan et al. (2009)).

Candidatus Uberibacter asiaticus (CLas) is the causative agent of HLB disease for which there is currently no cure. The lack of stable culturing conditions in a laboratory setting has severely hampered the progress toward understanding the physiology and adaptive strategies of this citms pathogen. The genome of this microorganism has revealed a low percentage (-2%) of transcription factors, which may indicate that (i) a small array of transcription factors respond to changing conditions and (ii) this microorganism is highly adapted to life within its host, and may not be exposed to frequent environmental changes.

CLas species plug the plant's vascular (phloem) tissues to limit nutrient movement. Symptoms of this disease reflect a severe deficiency of essential mineral nutrients (for example, copper, manganese, zinc). A temporary masking of symptoms can be achieved by applying high rates of foliar nutrients; however, the bacterial pathogen remains active and infected trees continue to decline in over-all vigor and productivity. The lag time from infection to symptom expression for this disease varies from six months to five years depending on the age of the tree, vigor, and environmental factors (Bove (2006)). This lag in symptom expression provides ample time for infection before detection and containment in a new area can be accomplished.

The efficacy of current strategies for management of HLB is limited and no conventional measure has shown to provide consistent and effective suppression of the disease. High cost of frequent insect control and tree removal will eventually render citrus groves unprofitable. In addition, large scale application of insecticides will disrupt the eco-system and pollute the environment (Jun et al. (2005)). Frequently, insecticides will become non-effective due to the acquisition of resistance. Insecticides could also kill non-target beneficial insects, disrupting the biological control currently in place.

Antibiotics injected into the tree's vascular system are often toxic to the tree, and previously available surface-applied copper compounds are not mobile enough to inhibit bacterial activity v/ithin vascular or other plant tissues. Current HLB control strategies of frequent insecticide sprays to limit populations of the psyllid insect vector, removal of infected trees, and nutrient maintenance to keep existing trees as productive as possible until they die provide little confidence for a sustainable citrus industry or incentive to reestablish it (Bove (2006)). BRIEF SUMMARY

The invention provides novel compositions and methods for improving plant health and controlling phytopathogenic bacteria and endophytic microorganisms in a plant, for example, CLas in citrus plants. In certain embodiments, the compositions according to the current invention comprise, for example, diphenylamine, tolfenamic acid, benzbromarone, hexestrol, oxantel pamoate, diethylstilbestrol, phloretin, resveratrol and derivatives thereof or a combination thereof.

In one embodiment, the antimicrobial compound comprises:

two aryl rings, an aryl ring and a heteroaryl ring, or two heteroaryl rings connected to each other via a linker,

wherein the linker is selected from the group consisting of S, N, O, P, a saturated or unsaturated carbon chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms, and a saturated or unsaturated chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms and one or more heteroatoms selected from S, N, O, or P;

wherein either or both of the aryl and/or the heteroaryl rings are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety may be further substituted,

and wherein the one or more carbon atoms and/or the one or more heteroatoms in the linker are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, keto, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety may be further substituted.

In further embodiments of the invention, the antimicrobial compound is administered to a plant to contact bacteria infecting the plant. In one embodiment, the antimicrobial compound is injected into the plant's vascular system. The antimicrobial compounds can also be administered in combination with other treatments, such as, other bactericides, fungicides, insecticides, acaricides, rodenticides, nematocides, herbicides, fertilizers, growth-regulating agents or a combination thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

The file of this patent application contains at least one drawing executed in color. Copies of this patent with color drawings(s) will be provided by the Patent and Trademark Office upon request and payment of the necessary fee. Figure 1. CLIBASIA O 1510 (hereinafter, CarD), a transcription factor found in CLas, interacts with the RNAP βΐ domain, β-galactosidase activity was performed using E. coli TOP 10 derivatives as reporter strains transformed with the following plasmid combinations: LB01 (star symbol) carrying the empty ρΒ2ΗΔα and ρΒ2ΗΔω plasmids; B02 (diamond symbol) carrying pB2UAa-CarD and

LB03 (square symbol) carrying pB2HAa-rpoS₂1-150 an pB2HA o-Car£>); LB04 (triangle symbol) carrying pB2UAa-CarD and ρΒ2ΗΔω; and LB05 (circle symbol) carrying ρΒ2ΗΔα and ρΒ2ΗΔω- οβ₂ι-ΐ50· Assays of β-galactosidase activity (expressed in arbitrary units, AU) were performed after 180 h of growth (midexponential phase of growth) in triplicates.

Figures 2A-2B. CarD binds to Ρ_ψικ of CLas. EMSAs were conducted (A) with increasing concentrations of CarD, as indicated on top of the panel. No protein was added to the first lane. (B) Competition experiments. The biotin labeled P_rpiK probe was incubated with 2.5 μΜ CarD and mixed with increasing concentrations of two different unlabeled double-stranded DNA fragments (P_rpiK and Figure 3. Small chemicals affect the unfolding pattern of CarD. The DSC experiments were performed in 10 mM HEPES (pH 7.5), 500 mM NaCl, 0.5 mM TCEP and 10% DMSO in the absence (black line) or presence of 100 μΜ ronidazole (green line), 100 μΜ dimetridazole (blud line) or 100 μΜ metronidazole (red line). Protein concentration was 20 uM.

Figures 4A-4B. Small molecules decrease CarD binding to P_rpi_K. EMSAs were conducted (A) in the presence of 2 mM of metronidazole, acetazolamide, gramine, cotine, tolfenamic acid, menadione, folic acid, or DMSO (solvent control, 5% final concentration); or (B) increasing concentrations of tolfenamic acid (0-500 μΜ), as indicated on top of the panel. CarD was maintained at 2.5 μΜ. No protein was added to the first lane.

Figure 5. Genomic environment of CLIBASIA Ol 180, a homolog of the multidrug resistance regulator MarR (hereinafter, LdtR) from CLas (LdtR_Las). Homologs to ldtR_Las are surrounded by similar genes in all analyzed members of the Rhizobiaceae family. The size of the intergenic region is indicated in each case. Homologs are depicted with identical colors. CLIBASIA 01180 (gi|346722692), CLIBASIA Ol 175 (gi|346722692) (encoding a predicted L,D transpeptidase (renamed LdtP)), CLIBASIA Ol 185 (gi|346722692); B488J0930 (gi|431805346), B488J0920 (gi|431805346), B488J0910 (gi|431805346), B488J0900 (gi|431805346); SMc01766 (gi| 15963753), SMc01767 (gi| 15963753), SMc01768 (gi| 15963753), SMc01769 (gi| 15963753); Arad_1746 (gi|222084201), AradJ 747 (gi|222084201), AradJ 748 (gi|222084201), AradJ 750 (gi|222084201 ), AradJ 751 (gi|222084201 ). Figures 6A-6E. LdtR_Las binds to P_ldtR and P_idtP of CLas. (A) EMSAs were conducted with increasing concentrations of LdtR_Las, as indicated on top of each panel. No protein was added to the first lane. (B) Competition experiments. The biotin labeled P_ldtP probe was incubated with 400 nM LdtR_Las and mixed with increasing concentrations of three different unlabeled double-stranded DNA fragments {CD-I, CD-2, CD-3, and CD-4). (C) Identification of LdtR_Las binding site in P_idlP. DNase I footprint electropherogram shows a fragment of the digested probe in absence (black) or presence (white) of LdtR_Las, highlighting the protected region. LdtR_Las binding site is indicated with a circled box in panels C and D. (D) Characterization of Pi_dtP. (E) The transcription start site (+ 1 ) was experimentally determined using 5 ' RACE-PCR and it is depicted in a triangle. The predicted 210 and 235 boxes, as well as the Shine-Dalgarno sequence (SD) are underlined and highlighted in gray boxes. A putative second binding site for

is circled in a dashed box. Black arrows underneath the sequence denote the location of the primers used to generate the DNA probe for EMS A.

Figures 7A-7F. Characterization of LdtR_Las binding site. (A) Alignment of LdtR_Las binding sites IdtP IdtP '_2, and ldtR_l. Graphical representation (LOGO) of the position specific frequency matrix constructed with LdtR_Las binding sites. Double substitutions on the most conserved nucleotides were carried out in P_!idtP probe. The location of each mutated nucleotide is depicted on probes P,_{dtP M} P_{idl J}vi2, Pidtp m, ΙΛΡ Μ4, and ?/_dtP_M5- (B-F) EMSAs were conducted on P,_{dtP w}, Pidtp_M2, Pid_tp Mh Pid_tp_M4, or P_{tdtP M5} probes with increasing concentrations of LdtR_Las, as indicated on top of each panel. No protein was added to the first lane.

Figure 8. LdtR_Las is a transcriptional activator. Different transcriptional fusions to lacZ were constructed to evaluate ldtR_Las and ldtP_Las promoter activity in presence or absence of the transcriptional regulator, LdtR_Las. β-galactosidase activity was determined at mid-exponential phase and expressed as arbitrary units (AU).

Figures 9A-9D. Inactivation of ldtR_Smc or ldtP_Smc results in a short-cell phenotype. Representative Scanning Electron Micrographs (SEM) of (A) wild type, (B) SMPl , and (C) SMP2 strains of S. meliloti. Cultures were grown in LB medium to mid-exponential phase and processed for SEM analysis to assess the morphological effects of ldtR_Smc or ldtP_Smc gene disruption. (D) Wild type strain grown in presence of 25 μΜ phloretin. Scale bar, 1 .00 μιη.

Figures 10A-10I. Inactivation of ldtR_Smc or ldtP_Smc increases sensitivity to osmotic stress. (A-D) Growth of wild type, SMP l , and SMP2 strains of S. meliloti on osmotic stress plates. Cultures were grown on LB medium until reached OD₆oo = 1 -0, and then spot plated in serial dilutions, as indicated at the top of each panel. Pictures are representative of three biological replicates and were taken after 72 h of growth. Black bars correspond to control conditions, white bars 0.3 M sucrose, and grey bars 0.4 M NaCl (*p < 0.05). (E) The transcriptional activity of the different promoters was followed using the β-glucuronidase reporter in SMP1 and SMP2 disruption mutants (Table 2), as well as SMP3 strain (wild type-phenotype). Cultures were grown until mid-exponential phase in M9- glucose with increasing concentration of NaCl (9, 15, 50, 100, 170, and 250 mM; light gray to dark gray), β-glucuronidase activity was expressed as μΜ p-nitrophenol mnV'C^oo^"1. (F-I) Growth of SMP2A, SMP2B, and SMP2C strains of S. meliloti (Table 2) on osmotic stress plates. Cultures were grown on LB medium until reached ODgoo = 1 .0, and then spot plated in serial dilutions, as indicated at the top of each panel. Pictures are representative of three biological replicates and were taken after 72 h of growth. Black bars correspond to control conditions, white bars 0.3 M sucrose, and grey bars 0.4 M NaCl. (*p < 0.05).

Figures 11A-11F. Small molecules decrease LdtR_Las binding to P_W(/>. EMSAs were conducted in the presence of benzbromarone, hexestroi, oxantel pamoate, or diethyl stilbestrol (identified in the screening assay), and phloretin or resveratrol, at the concentrations indicated on top of each panel. The concentration of LdtR_Las was maintained at 200 nM. No protein was added to the first lane.

Figures 12A-12B. Short-cell phenotype as the result of ldtR inactivation by small molecules.

Micrographs were taken after addition of benzbromarone, hexestroi, or phloretin to (A) S. meliloti, or (B) L. crescens cells. Samples were taken and stained with crystal violet. Magnification 600x, scale bar, 5.00 μιη. Micrograph pictures are representative of three biological replicates.

Figures 13A-13B. The inactivation of LdtR_Smc by small molecules reduces osmotic stress tolerance in S. meliloti. (A) SMP3 strain was grown in M9-glucose minimal medium with increasing concentrations of NaCl in absence (closed squares), or in presence of 25 μΜ benzbromarone (open triangles), or 25 μΜ phloretin (open circles). Growth was expressed as a percentage of the ODeoo of cells grown in M9 media, at early stationary phase. The growth curves were performed in triplicates. (B) The induction the β-glucuronidase activity, as a response to osmotic stress (closed squares), was reduced in the presence of 25 μΜ benzbromarone (open triangles) or 25 μΜ phloretin (open circles). β-glucuronidase activity was expressed as μΜ p-nitrophenol ι ίη^'Όθωο^"1.

Figures 14A-14C. The inactivation of LdtR_LCT by small molecules reduces osmotic stress tolerance in L. crescens. Cells were grown in modified BM7 media (black bars), supplemented with 200 mM sucrose (dark grey bars), or 150 mM NaCl (light gray bars). Increasing concentrations of (A) benzbromarone, (B) phloretin, or (C) hexestroi in the culture media are indicated under each panel. Growth was expressed as a percentage of the OD₆₀o of cells grown in modified BM7 media, at stationary phase. The growth curves were performed in triplicates. Figures 15A-15D. Small molecules modulate the transcriptional activity of LdtR_Las in infected sweet orange leaves. The expression levels of 16S RNA_Las (A) or rplJ_Las (B) were assessed to monitor the viability of CLas on the infected leaves upon treatment with the small molecules. The plant gene cox2 was used to normalize the expression values between samples. The effect of the small molecules on the transcriptional activity of ldtR_Las (C) or ldtP_Las (D) genes was evaluated after 6 and 24 h (light and dark gray, respectively) of incubation with the small molecules. (*p < 0.05; * *p < 0.005).

Figure 16. Determination of the oligomeric state of LdtR_Las. Size-exclusion chromatography was performed using a Superose 12 column.

Figures 17A-17G. The location of LdtR binding sites in P_!dtR and

is conserved upstream of the promoter elements in CLas, L. crescens, and S. meliloti. (A) Graphical representation (to scale) of the LdtR binding sites and promoter elements of IdtP in CLas, L. crescens, and S. meliloti. Detailed characterization of P^p in (B) L. crescens, or (C) S. meliloti. (D) Graphical representation (to scale) of the LdtR binding sites and promoter elements of IdtR in CLas, L. crescens, and S. meliloti. Detailed characterization of / in (E) CLas, (F) Z. crescens, or (G) S. meliloti. The experimentally determined transcription start site (+1) of IdtP and IdtR in CLas and . crescens, as well as the predicted transcription start site in S. meliloti are depicted in a triangle. The -10 and -35 boxes, as well as the SD are underlined and highlighted in gray boxes. The putative binding sites for LdtR are identified by dashed boxes.

Figures 18A-18B. LdtR_Smc binds to P_tdtR and Pi_dtP of S. meliloti. EMSAs were conducted on

(A) Pidtp or (B) Pidtp probes with increasing concentrations of LdtR_Smc, as indicated on top of each panel. No protein was added to the first lane.

Figure 19. Small molecules induce a shift in the thermal stability of LdtR_Las. The melting curves of purified LdtR_Las [30 μΜ] are depicted in absence (no marker) or presence of ligands: oxantel pamoate (diamonds), benzbromarone (triangles), diesthylstilbestrol (circles), and hexestrol (squares).

Figure 20. P_/j(/_/sow5-'LVIS0553 interaction is not affected by LdtR_Las ligands. EMSAs were conducted in the presence of 200 μΜ benzbromarone, hexestrol, oxantel pamoate, diethylstilbestrol, phloretin or resveratrol. The concentration of LVIS0553 was maintained at 20 nM. No protein was added to the first lane.

Figures 21A-21B. Growth of L. crescens with increasing concentrations of NaCl or sucrose.

In (A), sucrose was added at 0 (empty square), 100 (diamond), 200 (triangle), 400 (circle) or 600 (filled square) mM. In (B), NaCl was added at 0 (empty square), 100 (diamond), 150 (triangle), 200 (circle) or 400 (filled square). The growth curves were performed in triplicates. Figure 22. CarD_Las binding to P_rp!K is modulated by tolfenamic acid. EMSAs were conducted with increasing concentrations of CarD_Las, as indicated on top of the panel and P_rplK probe. No protein was added to the first lane.

Figures 23A-23E. Identification of CarD_Las binding site in P_rplK. (A) DNAse I footprint assays identified a protected site located 31 bp from the translation start site in ^.The electropherogram shows a fragment of the digested probe in absence (white) or presence (black) of CarD_Las highlighting the protected region. (B) The most relevant residues for CarD_Las binding in P_rptK were determined by site directed mutagenesis as indicated. (C-E) EMSA assays were conducted using each of the mutant DNA sequences (rplK Ml to Ml 2) at increasing concentrations of CarD_Las as indicated on top of each panel.

Figures 24A-24D. Tolfenamic acid modulates the activity of CarD_Las in vivo. (A) The effect of tolfenamic acid on the transcriptional activity of L. asiaticus was tested at increasing concentrations (1, 10 and 100 μΜ) in infected sweet orange leaves. The expression levels of gyrA, rplJ, 16S RNA, carD and rplK were assessed after 24 h. The plant gene cox2 was used to normalize the expression values between samples. (*p < 0.05; **p < 0.005). Concentrations of 10 and 100 uM affected the overall transcriptional activity and probably the viability of L. asiaticus. (B) Sublethal concentrations of tolfenamic acid (Ι μΜ) CarD_Las modulated the transcriptional levels of rplK and 16S rRNA. The bacterial gyrA gene was used to normalize the expression values between samples. (C) Tolfenamic acid reduced L. asiaticus titer in infected seedlings. Progress of a representative L. asiaticus infected plant (TA-2) after treatment with 100 uM tolfenamic acid. Canopy and roots were photographed before the treatment began and after 2 weeks, two months and 11 months of treatment. Photographs of plants TA-1, TA-3 and TA-4 are shown in Fig 28. (D) Gene expression in leaf (-L) and root tissue (-R) after 1 1 months of treatment. The mRNA level of L. asiaticus L10 and gyrA was determined in four new leaves from each treated plant (TA-1 to TA-4) and compared to the control (C-). The plant gene cox2 was used to normalize the expression values between samples. The lower mRNA expression levels observed in treated plants are indicative of reduced CLas infection. NA= no amplification was observed in root samples TA-1 , TA-2 and TA-3.

Figure 25. Tolfenamic acid reduces HLB symptoms in infected seedlings. Progress of three L. asiaticus infected plants after treatment with 100 μΜ tolfenamic acid. Canopy and roots were photographed before the treatment began and after 1 1 months after treatment.

BRIEF DESCRIPTION OF THE SEQUENCES

Primer Sequence (5'→3') SEQ ID NO qRT-PCR Primer Sequence (5'—3') SEQ ID NO

CLIBASIA_01510-Fw CTGCCCATGGAGTAGGAACTATTAC 1

CLIBASIA_01510-Rv ATCTTGTCCTTGTCAAATGCAATAA 2

CLIBASIA_01510-Ext CGTTCAGAATAGGATTTTTCAGGTT 3

CLIBASIA_01515-Fw AGCTTGATCCAGTGAGCGATA 4

CLIBASIA 01515-Rv TGCACAGTGACGGTAGATCC 5

CLIBASIA_01515-Ext CGGTAATTGAATCGGGAATG 6

CLIBASIA_02490-Fw AAAACCGGAACAAGTCGTTG 7

CLIBASIA_02490-Rv CTCCAGCTAGGCGACAATTC 8

CLIBASIA_02490-Ext TCCTTCTTTCTCGGGGATTT 9

CLIBASIA 00870-Fw TTCGACATATGCGATGTGGT 10

CLIBASIA_00870-Rv CCGAACAACCTTGTGGATTT 1 1

CLIBASIA_00870-Ext GGCGTCAAAGAAGCAAGAAC 12

CLIBASIA_00120-F TG G AGGTGT AAAAGTTGCC AAA 13

CLIBASIA_00120-Rv CCAACGAAAAGATCAGATATTCCTCTA 14

CLIBASIA_00120-Ext AAAAAGATGCGGGAAGCTG 15

CLIBASIA_r05781-Fw TCGAGCGCGTATGCGAATACG 16

CLIBASIA_r05781-Rv GCGTTATCCCGTAGAAAAAGGTAG 17

CLIBASIA_r05781-Ext ACCAACCAGCTAATCCAACG 18

COX-Fw GTATGCCACGTCGCATTCCAGA 19

COX-Rv GCCAAAACTGCTAAGGGCATTC 20

Two-Hybrid Constructs

carD-Fw TATTGCGGCCGCATGACATTCCAACAGAAAAGAGATG 21 carD-Rv TATATGGATCCTGCGGCTTTATCTTGATTTTCGCTT 22 rpoB_Ext-Fw CGTTGTGTTCAATGGTCTCG 23 rpoB_Ext-Rv GGAACCTTGCGACGTCTATC 24 rpoB-Fxv TATTGCGGCCGCCCTGAGATAATTGACATACCTGATCT 25 rpoB-Ry TATATGGATCCCTGAATACCC TTAATAACGA AAGTTCC 26

Overexpression and Protein

Purification in pl5TV-L

TTGTATTTCCAGGGC

CLIB ASI A_0151 OJLIC-For 27

ATGACATTCCAACAGAAAAGAGATG

CLIB ASI A_01510_LIC-Rev CAAGCTTCGTCATCA CTATGCGGCTTTATCTTGATTTTC 28

CLIB ASIA_01510_Ext-Fw GAGTGTGCGTTTGTTTGAAAAG 29

CLIB ASI A_01510_Ext-Rv CCCACGCGATCTTATCTGAC 30

Site directed mutagenesis

CGTGTTAAACGTACGATGTGGTCTGCTGCCGCACAAGAAT

CarD_R98A_R99A_Fw 31

ACGATGCCAAGATT

AATCTTGGCATCGTATTCTTGTGCGGCAGCAGACCACATC

CarD_R98A_R99A_Rv 32

GTACGTTTAACACG

CarD_Dl l lAJFw TACGATGCCAAGATTAACTCTGGAGCCCTAATTGCTATAG 33

Primer Sequence (5'→3') SEQ ID NO

B488_08460_RTPCR_L 10_Rv TTTAGGAGCAGCGACTGGAT 130

LdtP_Lcr_ext_Rv CCCTGATACCAAAGCCTGAA 131

LdtR_Lc[ ext_Rv TCTCCTGCCCAGGCTTAGTA 132

B488_08460_ext_Rv CCTTTGCGAATCTAACAGCA 133

16SLcr_Fw GTTCGGAATAACTGGGCGTA 134

16SLcr_Rv AAGGTTGAGCCTTGGGATTT 135

16SLcr_ext_Rv GCACCTCAGCGTCAGTATCA 136

Cox2_Fw GTATGCCACGTCGCATTCCAGA 137

Cox2_Rv GCCAAAACTGCTAAGGGCATTC 138

Sequencing

M13_Fw GTTGTAAAACGACGGCCAGT 139

M13_Rv AGGAAACAGCTATGACCATG 140

T7 TAATACGACTCACTATAGGG 141

T7 term GCTAGTTATTGCTCAGCGG 142 a Italics show the extra aases added to the 5 ' end for the ligation independent cloning using the

BD-infusion CF Dry-Down PCR cloning kit (BD Biosciences).

b Biotin labeled.

c Underlines indicate the enzyme restriction sites.

SEQ ID NO: 143: The DNA binding sequence for CarD_Las was identified by DNase I footprinting. A protected site of 24 nucleotides (GTAGGTTGGTTGTTTTTTAGAAAG) was identified in the promotor region of rplK.

SEQ ID NO: 144: CarD recognition sequence in the promotor region of rplK nnAnnnnGGTTnnnnnnnnnAAAn.

DETAILED DISCLOSURE

The subject invention provides antimicrobial compounds, compositions comprising these compounds, and their use in treating plant disease such as, for example, HLB in citrus plants. In certain embodiments, the current invention provides antimicrobial compounds that (i) are not subject to the types of antibiotic resistance currently hampering antibiotic treatment of bacteria, (ii) can be developed rapidly and with predictability as to target-bacteria specificity, (iii) are effective at low doses, and (iv) show little or no side effects. In particular, the invention provides antimicrobial compounds to target and treat CLas infections.

Transcription factors, as defined by the Cluster of Orthologous Groups, constitute less than

2% of the CLas genome, while in S. meliloti, another member of the Rhizobiaceae family, it comprises 6% of the genome. As a consequence, a small number of transcription factors may control several metabolic pathways. Therefore, inactivation of a single transcription factor could result in pleiotropic effects, including decreased persistence within the host.

CLIBASIA_01510, a homolog of CarD from Mycobacterium, is a transcription factor found in CLas. This transcription factor is an essential RNA polymerase binding (accessory) protein in Mycobacterium species. CarD regulates the expression of a small subset of genes upon binding to the β-subunit of the RNA polymerase and to a short specific sequence on the promoter region. In CLas, CarD is capable of binding to the promoters of several important genes (i.e. rplJ, carD, dnaK, radA and rplK) with high affinity ~5 μΜ. The proteins encoded by these genes play critical roles in gram negative bacteria during normal cell growth and/or under stress conditions. Thus, CarD is involved in pathogenesis, persistence, cell viability, and resistance to both antibiotics and stress. Its molecular structure and interactions with the β-subunit of the RNA polymerase have recently been elucidated. This unusual regulator lacks a canonical helix-turn-helix DNA binding domain, and was originally thought to be incapable of binding DNA. Garner et al. (2014) showed that CarD binds DNA with low affinity, to modulate the expression of ribosomal genes.

Altering transcription of target genes of CarD by the chemical inactivation of CarD decreases

CLas survival. The CarD inhibitors that were identified in vitro were used in vivo to evaluate the response of model bacteria under stress conditions. The effect of the chemicals was tested in CLas- infected tissue and citrus seedlings, where CarD mediated transcriptional activity decreased significantly.

Thus, in one embodiment, small molecules that inhibit CarD are identified which can be used as a therapeutic treatment for plant diseases, for example, HLB disease.

The CarD inhibiting compounds of this invention can be used in treating bacterial diseases of annual as well as perennial crops and ornamental plants. Preferably, the CarD inhibiting compounds are used with citrus plants; however, in other embodiments, the compounds of the invention can be used with a variety of plant species including, for example, trees, vines, forage, and annual plants.

The CarD inhibiting compounds of the invention are active against a variety of bacteria. According to the subject invention, the CarD inhibiting compound interferes with CarD binding with RNA polymerase and/or target DNA thus affecting transcription of virulence factors for CLas and other bacteria.

Examples of CarD inhibiting compounds of the invention are diphenylamine (N- phenylaniline), tolfenamic acid (2-(3-chloro-2-methylanilino)benzoic acid) and derivatives thereof. The structures of these compounds are provided below:

Another transcription activator found in CLas is LdtR, a homolog of the Multiple antibiotic resistance Regulator (MarR). Transcription activator LdtR increases expression of CLas genes that are required for the pathogen to evade detection by the immune system of a plant host, for example, a citrus plant.

In certain embodiments, the invention characterizes and assesses the biological importance of LdtR and LdtP, and their role in the persistence of CLas within a plant host. Small molecules that modulate the expression and/or activity of the LdtR transcription factor are identified. Since CLas cannot be cultured, two of its closest culturable phylogenetic relatives, Sinorhizobium meliloti and Liberibacter crescens were used as models to assess the biological role of LdtR and LdtP. A model using CLas infected shoots was developed to validate LdtR as an effective target for the design of new therapeutics.

Another embodiment of the invention provides antimicrobial compounds that inhibit, in bacteria, LdtR transcription factor and interrupt LdtR mediated transcription. LdtR regulates the expression of genes that are required for the pathogen to evade detection by the immune system of the citrus host. Small molecules that inhibit LdtR were identified and these small molecule inhibitors of LdtR can be used as a therapeutic treatment for plant diseases, for example, HLB disease.

The LdtR inhibiting compounds of this invention can be used in treating bacterial diseases of annual as well as perennial crops and ornamental plants. Preferably, the LdtR inhibiting compounds are used with citrus plants; however, in other embodiments, the compounds of the invention can be used with a variety of plant species including, for example, trees, vines, forage, and annual plants. The LdtR inhibiting compounds of the invention are active against a variety of bacteria. According to the subject invention, the LdtR inhibiting compound interferes with LdtR binding with its promoters thus affecting transcription of virulence factors for CLas and other bacteria.

Examples of LdtR inhibiting compounds of the invention are benzbromarone ((3,5-dibromo- 4-hydroxyphenyl)-(2-ethyl-l-benzofuran-3-yl)methanone), hexestrol (4-[4-(4-hydroxyphenyl)hexan- 3-yl]phenol), oxantel pamoate (4-[(3-carboxy-2-hydroxynaphthalen-l-yl)methyl]-3- hydroxynaphthalene-2-carboxylic acid;3-[(E)-2-( 1 -methyI-5,6-dihydro-4H-pyrimidin-2- yl)ethenyl]phenol), diethylstilbestrol (4-[(E)-4-(4-hydroxyphenyl)hex-3-en-3-yl]phenol), phloretin (3- (4-hydroxyphenyl)- 1 -(2,4,6-trihydroxyphenyl)propan- 1 -one), resveratrol (5-[(E)-2-(4- hydroxyphenyI)ethenyl]benzene- l ,3-diol) and derivatives thereof. The structures of these compounds are provided below:

Compound Structure

Benzbromarone

Hexestrol

Additional embodiments of the current invention as they relate to LdtR inhibitors and uses thereof are published in Pagliai et al. (2014), The Transcriptional Activator LdtR from 'Candida s Liberibacter asiaticus' Mediates Osmotic Stress Tolerance, PLOS Pathogens, Vol. 10, Issue 4, e 1004101 , pp. 1-19 as well as in the supplemental material associated with the publication. The contents of the Pagliai et al. (2014) publication, including the supplemental materials, are incorporated herein by reference in its entirety.

The invention also relates to compositions, and their use, comprising derivatives of CarD and/or LdtR inhibitors. For example, the compositions comprise derivatives of diphenylamine, tolfenamic acid, benzbromarone, hexestrol, oxantel pamoate, diethylstilbestrol, phloretin, resveratrol, derivatives thereof or a combination thereof as antimicrobial compositions.

To produce the derivatives of diphenylamine, tolfenamic acid, benzbromarone, hexestrol, oxantel pamoate, diethylstilbestrol, phloretin, and/or resveratrol, these compounds can be substituted by various moieties, for example, on various positions on the benzene, the benzofuran, the naphthalene and/or the pyrimidine rings. Non-limiting examples of moieties that can be substituted on these rings include, halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, - NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety may be further substituted. The exemplified compounds having any of these substitutions are referred to herein as "derivatives" of the exemplified compounds.

In one embodiment, the invention provides an antimicrobial composition for treatment of a plant disease, for example, HLB disease, the composition containing a compound comprising:

two aryl rings connected to each other via a linker,

wherein the linker is selected from the group consisting of S, N, O, P, saturated or unsaturated carbon chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms, and saturated or unsaturated chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms and one or more heteroatoms selected from S, N, O, or P;

wherein either or both of the aryl rings are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, - NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety may be further substituted,

An aryl ring includes monocyclic and polycyclic aromatic hydrocarbons, such as, benzene, naphthalene, anthracene, phenanthrene, tetracene, chrysene, triphenylene, pyrene, pentacene, benzo[a]pyrene, corannulene, benzo[ghi]perylene, coronene, and ovalene. Accordingly, non-limiting examples of aryl rings are benzene, naphthalene, anthracene, phenanthrene, tetracene, chrysene, triphenylene, pyrene, pentacene, benzo[a]pyrene, corannulene, benzo[ghi]perylene, coronene, and ovalene. Additional examples of aryl rings are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.

Each of the two aryl rings can be independently selected and hence, can be different from each other.

In another embodiment, the invention provides an antimicrobial composition for treatment of a plant disease, for example, HLB disease, the composition containing a compound comprising:

an aryl and a heteroaryl ring connected to each other via a linker,

wherein the aryl ring and/or the heteroaryl ring is optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety may be further substituted,

Non-limiting examples of the aryl ring include benzene, naphthalene, anthracene, phenanthrene, tetracene, chrysene, triphenylene, pyrene, pentacene, benzo[a]pyrene, corannulene, benzo[ghi]perylene, coronene, and ovalene; whereas, non-limiting examples of the heteroaryl ring include pyrazole, imidazole, isoxazole, oxazole, isothiazole, thiazole, benezimidazole, benzotriazole, pyrrole, triazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, triazine, furan, thiophene, quinoline, indole, benzofuran, benzothiphene. Additional examples of aryl rings and heteroaryl rings are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.

A further embodiment of the invention provides an antimicrobial composition for treatment of a plant disease, for example, HLB disease, the composition containing a compound comprising:

two heteroaryl rings connected to each other via a linker,

wherein either or both of the two heteroaryl rings are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety may be further substituted,

Non-limiting examples of the heteroaryl rings include pyrazole, imidazole, isoxazole, oxazole, isothiazole, thiazole, benezimidazole, benzotriazole, pyrrole, triazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, triazine, furan, thiophene, quinoline, indole, benzofuran, benzothiphene. Additional examples of aryl rings and heteroaryl rings are well known to a person of ordinary skill in the art and such embodiments are within the purview of the current invention.

Each of the two heteroaryl rings can be independently selected and hence, can be different from each other.

The term "inhibiting" as used herein indicates a reduction in the rate or amount of a measurable interaction. A CarD inhibiting compound of the present invention inhibits CarD activity, preferably a bacterial CarD, more preferably a CLas CarD, as measured by the ability of CarD to induce transcription of its target genes. Similarly, an LdtR inhibiting compound of the present invention inhibits LdtR activity, preferably a bacterial LdtR, more preferably a CLas LdtR, as measured by the ability of LdtR to induce transcription of its target genes.

The term "treatment" or "treating" as used herein refers to reducing the incidence of disease in the treated plants. The methods of the current invention reduce the incidence of disease in at least about 50% to about 95% of the treated plants, in at least about 60% to about 90% of the treated plants, or in at least about 70% to about 80% of the treated plants.

The amount of the compound or compounds administered can be at least an effective amount to achieve such treatment. The term "effective amount," as used herein, means an amount of a compound needed to treat the plant. The effective amount of the antimicrobial compound of the subject invention, expressed as μg per Kg of total dry weight (TDW) of the plant, can be about 10 to 1000, about 25 to about 500, about 30 to about 400, about 35 to about 300, about 40 to about 200, or about 50 to about 100. The effective amount of a particular antimicrobial compound can be determined by one of ordinary skill in the art based on the teachings of the current invention.

With respect to the present invention, preferred dosages are amounts of antimicrobial compound that do not cause damage to the plant or plant parts, for example, necrotic damage to flowers or fruits. The precise amount of a particular compound that would be an effective amount without exhibiting any damage to the plant or plant parts will vary in accordance with the compound used, the plants to be treated, and the environment in which the plants are located. The preferred dose of a particular compound can be determined by one skilled in the art based on the teaching of the current invention.

Other compounds may be added to the composition, provided that they do not substantially interfere with the intended activity and efficacy of the composition. Whether a compound interferes with activity and/or efficacy of a compound for use in the methods of current invention can be determined by a person of ordinary skill in the art based on the teaching of the current invention.

The term "administering" or "administration" as used herein refers to delivering the antimicrobial compositions to the plants. Various routes of administration include, but are not limited to, root soaking, trunk-injection, bark-painting, applying the antimicrobial compounds to soil, foliar spraying, dusting, sprinkling, spraying, brushing, dipping, smearing, impregnating, injection into the vascular system, application to root system or other suitable means. In a preferred embodiment, the CarD inhibiting compounds of the invention are injected in the vascular system of a plant. The compositions can be administered to the plants in various forms, for example, solutions, emulsions, suspensions, powders, paste, and granules. Additional routes of administrations and forms of compositions are known to a person of ordinary skill in the art and are within the purview of the current invention. The subject invention provides compositions comprising CarD or LdtR inhibiting compounds, as the active ingredient in anti-microbial compositions. The subject invention further provides methods of combating microbial growth through the use of an effective amount of the CarD or LdtR inhibiting compounds.

Benzbromarone is a nonpurine xanthine oxidase inhibitor. Daily oral administration of benzbromarone is commonly prescribed for the treatment of gout. In one embodiment, the therapeutic concentration of benzbromarone is about 200 μg kg dry weight for HLB and is not phytotoxic in Citrus sinensis (Valencia) sweet orange trees. The average TDW of full grown citrus trees is approximately 100 kg. Benzbromarone effectively eliminates CLas infection when administered to HLB-infected Valencia orange seedlings at about 200 μg/kg TDW. When scaled up, the average dose administered to each full grown tree can be around 20 mg, which is roughly 20% of the average daily dose routinely administered for the treatment of gout in humans. Therefore, even if 100% of the benzbromarone administered to a HLB-infected citrus tree could be recovered from the oranges produced by that tree, a person would have to consume nearly 1 ,000 pounds of Valencia oranges (based on the average number of boxes produced per tree in 201 1-2012) before they would reach the equivalent amount of benzbromarone typically administered daily for the treatment of gout.

Tolfenamic acid is a non-steroidal anti-inflammatory, analgesic and antipyretic drug (Rejholec et al, 1979). Tolfenamic acid is approved by the FDA for its use in humans and veterinary medicine. Tolfenamic acid is of relative low acute toxicity, with LD50 values between 200-1000 mg/kg depending on the administration route and test species (Committee for Veterinary medicinal products, 1997). The therapeutic concentration of tolfenamic acid (e.g. 130 μg kg TDW) required to treat HLB, is not phytotoxic in Valencia sweet orange trees.

Tolfenamic acid was able to decrease interactions between CarD and DNA (Figure 2). L. crescens was used as a model strain to study the effect of tolfenamic acid on mRNA expression. Tolfenamic acid, at a concentration of about 70 μΜ, inhibits the growth of L. crescens.

The HLB-infected leaf assay was used to evaluate the impact of tolfenamic acid on the viability of CLas in infected tissue. After 24 hours of incubation, significant differences (p < 0.001) were observed in samples treated with tolfenamic acid. Thus, tolfenamic acid can be used as a therapeutic treatment for HLB disease.

Diphenylamine is a plant growth regulator used post-harvest to control storage scald on apples. It is restricted to indoor use in the form of dipping, drenching or spraying. The EPA has placed diphenylamine in Toxicity Category III (second lowest of four categories).

The subject compounds can be used in suitable solvents or diluents, in the form of emulsions, suspensions, dispersions, on suitable solid or semi-solid carrier substances, if desired, together with other compounds having antimicrobial activity. These compounds can also be administered in combination with other treatments, for example, administration of bactericides, fungicides, insecticides, acaricides, rodenticides, nematocides, herbicides, fertilizers, and growth-regulating agents.

Solid carrier substances that are suitable for the preparation of compositions in powder form include various inert, porous and pulverous distributing agents of inorganic or organic nature, such as, for example, tricalcium phosphate, calcium carbonate, in the form of prepared chalk or ground limestone, kaolin, bole, bentonite, talcium, kieselguhr and boric acid; powdered cork, sawdust, and other fine pulverous materials of vegetable origin are also suitable carrier substances.

The active ingredient can be mixed with these carrier substances by, for example, being ground therewith. Alternatively, an inert carrier substance can be impregnated with a solution of a CarD inhibiting compound of the invention in a volatile solvent and the solvent is thereafter eliminated by heating or by filtering with suction at reduced pressure. By adding wetting and/or dispersing agents, such pulverous preparations can also be made readily wettable with water, so that suspensions are obtained.

Inert solvents used for the production of liquid preparations should preferably not be flammable and should be, as far as possible, odorless and, as far as possible, non-toxic to warmblooded animals or to plants in the relevant surroundings. Solvents suitable for this purpose are high- boiling oils, for example, of vegetable origin, and lower-boiling solvents with a flash point of at least 30°C, such as, for example, polyethylene glycol isopropanol, dimethylsulfoxide, hydrogenated naphthalenes and alkylated naphthalenes. It is, of course, also possible to use mixtures of solvents. Solutions can be prepared in the usual way, if necessary, with assistance of solution promoters.

Other liquid forms that can be used include emulsions or suspensions of the active compound in water or suitable inert solvents, or also concentrates for preparing such emulsions, which can be directly adjusted to the required concentration. For this purpose, a CarD inhibiting compound of the invention can be, for example, mixed with a dispersing or emulsifying agent. The active component can also be dissolved or dispersed in a suitable inert solvent and mixed simultaneously or subsequently with a dispersing or emulsifying agent.

Furthermore, it is possible for the CarD or LdtR inhibiting compounds of the invention to be used in the form of aerosols. For this purpose, the active component is dissolved or dispersed, if necessary, with the aid of suitable inert solvents as carrier liquids, such as difluorodichloromethane, which at atmospheric pressure boils at a temperature lower than room temperature, or in other volatile solvents. In this way, solutions under pressure are obtained which, when sprayed, yield aerosols which are particularly suitable for controlling or combatting fungi and bacteria, e.g., in closed chambers and storage rooms, and for application to vegetation for eradicating or for preventing infections by bacteria.

When the subject CarD or LdtR inhibiting compounds are employed in combination with suitable carriers, e.g., in solution, suspension, dust, powder, ointment, emulsion, and the like forms, a high activity over a very high range of dilution is observed. For example, concentrations of the CarD or LdtR inhibiting compounds can range from 10 μΜ, 100 μΜ, 500 μΜ and 1 mM. Of course, higher or lower concentrations may also be employed as warranted by the particular situation. Moreover, the subject CarD or LdtR inhibiting compounds can be employed with other treatments, for example, administration of bactericides, fungicides, insecticides, acaricides, rodenticides, nematocides, herbicides, fertilizers, and growth-regulating agents.

Materials and Methods

Bacterial Strains and Growth Conditions

The bacterial strains and plasmids used herein are listed in Tables 1 and 2. E. coli strains were grown at 37°C under aerobic conditions in Luria-Bertani medium (LB) (Difco) or on LB agar plates. E. coli strains DH5a (Invitrogen, Carlslab, CA), TOP 10 (Invitrogen), and XLl-Blue

(Stratagene, La Jolla, CA) were used to propagate the plasmids for protein purification, point mutations, and the two-hybrid system. E. coli strain BL21 -Rosetta(DE3) (Novagen, Gibbstown, NJ) was used for overexpression and protein purification. When required, the medium was supplemented with ampicillin (1 00 μg/ml), tetracycline (10 g/ml), kanamycin (50 μ^/ναΧ), or chloramphenicol (25 μg/ml) for E. coli; neomycin (100 μg ml^"'), gentamicin (30 μg ml^"1), and streptomycin (250 μg ml^"1) for S. meliloti; or with erythromycin (1 μg ml^"1) for B. subtilis.

L. crescens BT-1 was cultured at 25°C with moderate aeration (150 RPM), in modified BM7 media containing 1% Brain Heart Infusion (Difco Laboratories, Detroit, MI), 15% Fetal Bovine Serum (Sigma, St. Louis, MO), 30% TMNFH insect medium (Sigma), a-Ketoglutaric acid (2 mg/ml),

ACES (10 mg/ml), and potassium hydroxide (3.75 mg/ml), at pH 6.9. Sodium chloride (150 mM) or sucrose (200 mM) was used to induce osmotic stress.

Table 1. Bacterial strains and plasmids

Reference or

Strain or plasmid Genotype or description

source

Strains

E. coli

DH5a F<D80/acZAM15 A(lacZYA-argF) U169 recAl endM hsdR\7 (r_K ^", m_K ⁺) Invitrogen

Table 2. Additional strains and lasmids used in this study

DNA Manipulations and Gene Cloning

Standard methods were used for chromosomal DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, ligation, and transformation. Plasmids were isolated using the QIAprep® Spin Miniprep Kit (Qiagen, Valencia, CA), and PCR products were purified using Qiaquick® Purification Kits (Qiagen). All primers used are described under Brief Description of Sequences. For protein expression and purification, the CLIBASIAJ)I5I0 gene was amplified from CLas chromosomal DNA by PCR, and cloned into the pl 5TV-Lic plasmid. The two-hybrid system previously described by Borloo et. al (2007) was used.

For protein expression and purification, IdtR gene was amplified from CLas str. psy62 or S. meliloti 1021 chromosomal DNA via PCR, and then cloned into the pl 5TV-L plasmid as described previously (Pagliai et al. (2010)).

Proteins of interest were fused to complementing β-galactosidase truncations (Δα and Δω), where the resulting level of complemented /9-galactosidase activity corresponds directly to the level of interaction between the proteins. Proteins of interests were cloned into vectors ρΒ2ΗΔα and ρΒ2ΗΔω using the NotI and BamHI restriction sites. All subcloning steps were performed in E. coli XL-1 Blue (Stratagene, La Jolla, CA). Fusion proteins in ρΒ2ΗΔα and ρΒ2ΗΔω were transformed by heat shock and subsequently co-expressed in E. coli TOP 10. Empty vectors were used as a control to determine background β- galactosidase activity. Two-hybrid system

The two-hybrid system previously described by Borloo et al. (2007) was used. Proteins of interest were fused to complementing ?-galactosidase truncations (Δ« and Aco), where the resulting level of complemented ?-galactosidase activity corresponds directly to the level of interaction between the proteins. Proteins of interest were cloned into vectors ρΒ2ΗΔα and ρΒ2ΗΔα> using the Notl and BamHI restriction sites. All subcloning steps were performed in E. coli XL-1 Blue (Stratagene, La Jolla, CA). Fusion proteins in ρΒ2ΗΔ and ρΒ2ΗΔω were transformed by heat shock and subsequently coexpressed in E. coli TOP 10. Empty vectors were used as a control to determine background ?-galactosidase activity. β-galactosidase assays

For the β-galactosidase assays, E. coli cells were grown at 37°C in LB medium until an OD600 of 0.3 (mid-exponential phase), 0.8 (late exponential phase) and 1.2 (stationary phase cells) was reached. Cells were collected and lysed in Z-buffer (60 mM Na₂HP0₄, 40 mM NaH₂P0₄, 10 mM KCl, 1 mM MgS0₄, 50 mM β-mercaptoethanol) (Miller, 1972). β-galactosidase activity was assayed by following the catalytic hydrolysis of chlorophenol red-p-D-galactopyranoside (Sigma-Aldrich). The absorbance at 570 nm was read continuously using a Synergy HT 96-well plate reader (BioTek, Winooski, VT). β-galactosidase activity, expressed as arbitrary units (AU), was calculated using the slope of absorbance curve normalized with the initial cell density. The assays were performed in triplicates.

Protein Purification

Protein purification was performed as previously described. Briefly, the His-tagged fusion protein pl 5TV-CarD was overexpressed in E. coli BL21-Rosetta (DE3) (Novagen). The cells were grown in LB broth at 37°C to an OD600 of 0.6. Expression was induced with 0.5 mM isopropyl-thio- β-D-galactopyranoside (IPTG). After induction, the cells were incubated at 17°C for 16 h. The cells were harvested and resuspended in binding buffer (500 mM NaCl, 5% glycerol, 50 mM HEPES, 5 mM imidazole, pH 7.5) with Roche EDTA-free protease inhibitor cocktail (Roche Applied Science, Germany). Phenylmethylsulfonyl fluoride (0.5 mM) and DTT (0.5 mM) were added to the cells immediately before they were lysed using a French press. The lysates were clarified by centrifugation (30 min at 17,000 x g) and applied to a metal chelate affinity column charged with nickel. The column was washed extensively (in binding buffer with 15 mM imidazole) and the proteins were eluted from the column in elution buffer (binding buffer with 250 mM imidazole). The purified proteins were dialyzed against 10 mM HEPES (pH 7.5), 500 mM NaCl, 2.5% glycerol, 0.5 mM DTT, and stored at -80°C. The identity of the purified proteins was confirmed by Mass Spectrometry from protein bands isolated from SDS-PAGE gels.

The hexa-histidine tag was then cleaved from the protein by treatment with recombinant His- tagged TEV protease. The cleaved protein was then resolved from the cleaved His-tag and the His- tagged protease by passing the mixture through a second Ni²⁺-column. The purified proteins were dialyzed against 10 mM Tris pH 8.0, 500 mM NaCl, 0.5 mM TCEP, and 2.5% glycerol. Finally, the proteins were aliquoted and stored at -80°C. Size Exclusion Chromatography

Size exclusion chromatography was performed using 100 μΐ protein samples, at a concentration of 1 mg/ml. Samples were injected onto a pre-packed Superose 12 10/300 GL (GE Healthcare, Sweden) gel filtration column connected to a LCC-501 plus (Pharmacia Biotech Inc., Piscataway, NJ) equilibrated with 10 mM HEPES (pH 7.5), 500 mM NaCl, 2.5% glycerol, 0.5 mM DTT. Filtration was carried out at 4°C, using a flow rate of 0.5 ml/min. The eluted proteins were monitored continuously for absorbance at 280 nm using a UV-M II monitor (Pharmacia Biotech Inc.). Blue dextran 2000 was used to determine the void volume of the column. A mixture of protein molecular weight standards, containing IgG (150 kDa), BSA (66 kDa), Albumin (45 kDa), Trypsinogen (24 kDa), Cytochrome C (12.4 kDa), and Vitamin B12 (1.36 kDa) was applied to the column under similar conditions. The elution volumes and molecular mass of each protein standard was used to generate a standard curve from which the molecular weight of eluted proteins was determined.

The theoretical molecular weight of LdtR was calculated from the amino acid sequence using the Compute pI/Mw tool at the ExPASy Proteomics Server (see worldwide website: ca.expasy.org/tools/pi_tool.html).

Construction of lacZ fusions and β-galactosidase assays

Plasmid pDG1663 was used for the transcriptional analysis of IdtR expression. Plasmids pBS l, pBS2, pBS3, pBS4, pBS5, and pBS6 described in Table 2, were constructed using primers listed in the brief description of sequences. To this end, the PCR fragments were cut with Hindlll and BamHI restriction enzymes, and ligated into pDG1663 previously digested with the same restriction enzymes. The recombinant clones selected in E. coli DH5a were confirmed by sequencing with primer pDGseq9_Fw. Plasmids pBS6Ml , pBS6M2, pBS6M3, pBS6M4, and pBS6M5 were constructed by site-directed mutagenesis in pBS6 using the QuikChange Site-directed Mutagenesis kit (Agilent Technologies). The primers used are listed in the brief description of sequences. The transfer of plasmids pBS l , pBS2, pBS3, pBS4, pBS5, pBS6, pBS6Ml , pBS6M2, pBS6M3, pBS6M4, and pBS6M5 into B. subtilis 168 was carried out by natural competence. The new generated strains are listed and detailed in Table 2. The integration into the thrC locus was confirmed via extraction of B. subtilis genomic DNA using DNeasy Blood and Tissue kit (Qiagen), followed by PCR with primers pDGseq9_Fw and pDGseqlO Rv (brief description of sequences).

For the β-galactosidase assays, B. subtilis cells were grown at 37°C in LB medium until reached an OD^o of 0.3 (mid-exponential phase). Cells were collected and washed twice with 0.9% NaCl, and permeabilized with 1% toluene in Z-buffer (60 mM Na₂HP0₄, 40 mM NaH₂P0₄, 10 mM CI, 1 mM MgS0₄, 50 mM β-mercaptoethanol). β-galactosidase activity was assayed by following the catalytic hydrolysis of chlorophenol red-P-D-galactopyranoside (Sigma-Aldrich). The absorbance at 570 nm was read continuously using a Synergy HT 96-well plate reader (BioTek, Winooski, VT). β-galactosidase activity, expressed as arbitrary units (AU), was calculated using the slope of absorbance curve normalized with the initial cell density. The assays were performed in triplicates.

Construction of reporter, gene disruption and complemented strains of S. meliloti and β-glucuronidase assays

Promoter fusions to the uidA reporter gene, as well as ldtR_Smc and ldtP_Smc disruption mutants, were generated using plasmid pVMG. pVMG is a modified version of plasmid pV0155, containing a multiple cloning site upstream of a promoterless β-glucuronidase (uidA) reporter gene. For the generation of recombinant strains, a -400 bp region of the target gene (-378 to +29 of ldtR_Smc, +104 to +498 of IdtPs_mc, and +932 to +1332 of ldtP_Smc, for pSMP2, pSMPl, and pSMP3, respectively) was amplified by PCR using the primers detailed in the brief description of sequences. The amplified fragments were inserted into the Spel and Agel restriction sites upstream of uidA, in pVMG. The resultant plasmids were propagated in DH5a and mobilized into S. meliloti 1021 via triparental mating, using helper plasmid pRK600. Transconjugants were selected on M9 sucrose-neomycin plates and their correct insertion confirmed by sequencing, using primers upstream of the original fragment used for cloning into pVMG and primer Gus_Seq_Rv, located 204 bp inside uidA reporter gene (brief description of sequences). For complementation assays, the complete sequence of ldtR_Las gene was amplified by PCR using primers LdtR_Las_EcoRI_Fw and LdtR_Las_BamHI_Rv, while ldtP_Las sequence was amplified using primers LdtP_{I as}JKpnI_Fw and LdtP_Las_EcoRI_Rv (the brief description of sequences). The DNA fragments were inserted into pBBRlMCS-5 plasmid, previously digested with the corresponding restriction enzymes, generating plasmids pSMP4 (ldtR_L ) and pSMP5 (ldtP_Las). The recombinant plasmids were selected in DH5a and confirmed by sequencing using universal Ml 3 primers (brief description of sequences). Plasmids pBBRlMCS-5, pSMP4, and pSMP5 were mobilized into S. meliloti SMP2 via triparental mating, using helper plasmid pRK600. Transconjugants were selected on M9 sucrose-neomycin-gentamicin plates.

For the β-glucuronidase assays, S. meliloti cells were grown in M9 minimal media, supplemented with NaCl, phloretin, or benzbromarone when indicated, until reached late-exponential phase. Cells were collected and washed twice with 0.9% NaCl, and permeabilized with 1% toluene in Z-buffer (60 mM Na₂HP0₄, 40 mM NaH₂P0₄, 10 mM C1, 1 mM MgS0₄, 50 mM β- mercaptoethanol) as previously described, β-glucuronidase activity was measured by means of the hydrolysis of 4-nitrophenyl β-D-glucuronide substrate (Sigma-Aldrich). The absorbance at 405 nm was read continuously using a Synergy HT 96-well plate reader (BioTek). β-glucuronidase activity was expressed as μΜ of ?-nitrophenol generated per min, normalized with the initial cell density. The assays were performed in triplicates. Small Molecule Screening by Differential Scanning Fluorimetry

Purified CLIBASIA_01510 (CarD) protein was screened against the Prestwick chemical library of 1 152 compounds (Prestwick Chemical, France) at a final concentration of 20 g/ml using fluorometry. Briefly, purified CarD protein was diluted to a final concentration of 20 μΜ in 100 mM HEPES, pH 7.5, 150 mM NaCl. 20 μΐ aliquots of a protein solution containing the chemical compounds were placed in duplicate, into 96-well plates (Bio-Rad) and heated from 25 to 80°C, at the rate of 1 °C per minute. A real time PCR device (iCycler IQTM, Bio-Rad) was used to monitor protein unfolding by an increase in the fluorescence of the fluorophor SYPRO Orange (Invitrogen). Fluorescence intensities were plotted against temperature for each sample well and transition curves were fitted with the Boltzmann equation using Origin 8 software (Northampton, MA). The midpoint of each transition was calculated and compared with the midpoint calculated for the reference sample. If the difference between the midpoints was greater than 2.0°C, the corresponding compound was considered to be a "hit" and the experiment was repeated to confirm the effect in a dose-dependent manner. Purified LdtR protein was screened against a library of 160 intracellular compounds at a final concentration of 100 uM, or against the Prestwick chemical library of 1152 compounds (Prestwick Chemical, France) at a final concentration of 1.3 μg/mL, using fluorometry. LdtR was diluted to a final concentration of 30 μΜ in 100 tnM Tris pH 8.0, 150 mM NaCl. SYPRO orange was added to a final concentration of 5X. 25 μ-L aliquots of protein solution containing the chemical compounds were placed in duplicate into 96 well plates (Bio-Rad, Hercules, CA) and heated from 25°C to 80°C at the rate of 1°C per minute. A real-time PCR device (iCycler IQ™, Bio-Rad) was used to monitor protein unfolding by the increase in the fluorescence of the fluorophor SYPRO Orange (Life Technologies, Grand Island, NY). Fluorescence intensities were plotted against temperature for each sample well and transition curves were fitted using the Boltzmann equation using Origin 8 software (Northampton, MA). The midpoint of each transition was calculated and compared to the midpoint calculated for the reference sample. If the difference between them was greater than 2.0 °C, the corresponding compound was considered to be a "hit" and the experiment was repeated to confirm the effect in a dose dependent manner. Figure 19 shows the melting curves obtained for LdtR_Las without chemicals or in presence of the selected hit chemicals. The chemicals that were not selected displayed melting curves similar to the one observed for the control.

Differential Scanning Calorimetry

DSC measurements were carried out using a MicroCal VP-DSC differential scanning microcalorimeter (MicroCal LLC, Northampton, MA). Protein samples were dialyzed extensively against 10 mM HEPES (pH 7.5), 500 mM NaCl, 0.5 mM TCEP. Chemical solutions were prepared in dialysis buffer. Prior to loading, all samples were degassed for 30 min at 4°C using a ThermoVac degassing station (MicroCal). Dialysis buffer (with or without chemical) was used in the reference cell. Samples treated with chemical (10 or 100 μΜ) were incubated at 4°C for 30 min, prior to DSC analysis. Each chemical was also added to the reference buffer at equal concentrations. A scan rate of 45°C/h was used for all experiments, with constant pressure (25 psi) applied to both cells throughout each run. A buffer scan, recorded in the presence or absence of each chemical, was subtracted from the corresponding thermogram prior to further analysis. Data was analyzed using the Origin software supplied by the manufacturer (MicroCal). Curves were fitted to the data using the non-two-state transition model.

Analyses of chemicals on infected leaves

Leaves were collected from a single HLB-symptomatic Valencia Orange tree. All leaves used in this study were collected from new flushes on highly symptomatic branches. Prior to treatment all solutions were autoclaved or filter sterilized. 100 μΜ stocks of each chemical were prepared in 100% DMSO. Immediately before collecting leaves, ronidazole (100 μΜ), metronidazole (100 μΜ), and dimetridazole (100 μΜ) solutions were prepared in ultrapure water with DMSO. The final DMSO concentration in each solution was 1 percent. A solution of ultrapure water and DMSO (1 %) was used for the controls. A scalpel was used to harvest leaves from the tree, with a horizontal cut at the base of the petiole. Each leaf was immediately suspended in 8 ml of treatment solution (with or without chemicals).

Leaves were supported in a vertical position throughout the incubation period, with only the lower inch of the petiole submerged in solution (with or without chemical). Steady air flow was maintained over the leaf blades throughout the incubation period, to facilitate transpiration and the adsorption of each solution. Each treatment group consisted of 18 leaves. Nine leaves from each treatment group were processed after 6 h of incubation (with or without chemical), and the remaining nine leaves were processed after 24 h of incubation (with or without chemical).

For each treatment group, biological triplicates (A, B, and C) were prepared from nine leaves. Due to the variable distribution of CLas within host trees, the tissue from three leaves was combined for each sample. RNA extractions were carried out using the midribs and petioles only. Each tissue sample was immediately submerged in KNAlater solution upon harvesting, and stored at -80°C until processed for RNA isolation.

Plant and bacterial RNA was extracted from midrib and petiole samples using TRI Reagent solution (Sigma, St. Louis, MO), with the addition of a mechanical homogenization step and pressure lysis. Midrib and petiole samples were thawed on ice, and transferred to FT500-S Pulse Tubes (Pressure Biosciences, Easton, MA) with 500 μΐ of TRI Reagent (Sigma). Samples were homogenized for a total of 2 minutes, in 30 s intervals, on ice, using a PCT Shredder (Pressure Biosciences, Easton, MA).

Samples were then transferred to FT500-ND Pulse Tubes (Pressure Biosciences) and subjected to pressure cycling using a NEP 2320 Barocycler (Pressure Biosciences) at 35,000 psi for 30 s and 0 psi for 30 s, for a total of 20 cycles. Crude lysate was then centrifuged at 5,000 x g for 5 min, at 4°C, and the super transferred to a clean RNase free falcon tube for RNA extraction. Chloroform (0.2 volumes) was added to each sample followed by thorough mixing and centrifugation at 5,000 x g for 30 min, at 4°C.

The aqueous phase was transferred to a clean RNase free falcon tube, and precipitated with isopropanol (0.5 volumes). RNA pellets were washed with 75% ethanol (0.75 volumes), briefly air dried, and re-suspended in 100 μΐ of RNase-free water. RNA samples were treated with RNase-free DNase I for 30 min, at 37°C, followed by DNase Inactivation Reagent (Life Technologies, Grand Island, NY). The concentration of total isolated RNA was determined using a NanoDrop ND 1000 (Thermo Scientific, Wilmington, DE). RNA samples were stored at -80°C. qRT-PCR studies

L. crescens cells were cultured in broth with hexestrol (25 μΜ), phloretin (50 μΜ), or benzbromarone (50 μΜ) when required. The cells were collected by centrifugation at 4°C when OD₆₀o = 0.3 (mid-exponential phase). Total RNA was subsequently isolated with RiboPure™- Bacteria (Ambion) in accordance with the manufacturer's protocol.

cDNAs were synthesized with M-MLV Reverse Transcriptase (Life Technologies) in accordance with the manufacturer's instructions, using the primers listed under Brief Description of Sequences. cDNA products were stored at -80°C prior to use. Real time quantitative PCR (RTPCR) was carried out on the iCycler IQTM apparatus (Bio-Rad) using Platinum® SYBR® Green qPCR SuperMix for iCycler (Invitrogen) in accordance with the manufacturer's recommended protocol. The genes measured were CLIBASTA_01510, CLIBASIA_01515, CLIBASIA_02490, CLIBASIA_00870, CLIBASIA_00210, and CLIBASIA_r05781. The cox gene was measured as an internal plant control.

Quantitative reverse transcription-PCR primers are described in detail under Brief Description of Sequences.

The following genes were used as internal controls: RNA polymerase sigma factor rpoD (B488J3350), 50S ribosomal protein L10 (B488J8460), 50S ribosomal protein L12 (B488 8450), and the 16S ribosomal RNA.

Stress resistance assays

To test resistance to NaCl and sucrose, S. meliloti cells were grown in LB media to exponential phase (OD₆oo ⁼ 1.0). Serial dilutions were made and 4 μΐ was spot plated. Plates were prepared to contain 0.4 M NaCl or 0.3 M sucrose. In L. crescens the effect of chemical inactivation of LdtR on the stress tolerance was tested by following growth (as increased optical density) on liquid cultures.

Scanning Electron Microscopy (SEM)

The morphology of different strains of S. meliloti (Table 2) was visualized by scanning electron microscopy using a Hitachi S-4000 FE-SEM apparatus. S. meliloti 1021 strain, grown in the presence or absence of 25 μΜ phloretin, as well as SMP1 and SMP2 mutants, were cultured until exponential phase (OD₆oo ⁼ 1 -0) in LB media. Prior to fixation, the cells were centrifuged 3 min at 8,000 rpm and the pellets washed twice with PBS buffer. Finally, the cells were treated with 1 mL of Trump's fixative solution for 20 min at room temperature, and post-fixed in 1% osmium tetroxide followed by dehydration in graded ethanol concentrations, following Electron Microscopy Core Lab recommended procedures. For the statistical analysis, the size of 10 cells per strain per field was determined (6 fields per strain).

Electrophoretic Mobility Shift Assays (EMSAs)

Gel shift assays for CarD or LdtR were performed using aliquots of purified and concentrated protein according to the procedures described above. Fragments of the IdtR, and IdtP promoters were generated by PCR using biotin prelabeled (5 '-end) primers (Brief Description of Sequences), then purified using QIAquick spin columns (Qiagen). Incubation mixtures for EMSA (20 μί) contained 1 ng of a 5'- labelled DNA probe, 50 mM Tris-HCl pH 7.2, 150 mM KC1, 10 mM MgC12, 0.01% TritonXlOO, 12.5 ng/μΕ of both Poly(dl-dC) and Poly(dA-dT) nonspecific competitor DNAs, purified LdtR protein (0 - 400 nM), and ligand (0 - 1 mM) where indicated. After incubation for 20 min at 37°C, samples were separated on 6% acrylamidebisacrylamide non-denaturing gels in 0.5X Tris borate-EDTA buffer, pH 8.3 (TBE).

Electrophoresis was performed at 100 V using ice-cold 0.5X TBE as a running buffer. DNA was then transferred from the polyacrylamide gel to a Hybond-N+ membrane (GE Healthcare, Pittsburgh, PA) by electroblotting at 250 mA for 45 min in a semidry transfer. Transferred DNA was cross-linked to the membrane using a Spectrolinker XL- 1000 UV cross-linker equipped with 312 nm UV bulbs. Biotin labeled DNA was detected using a Phototope-Star Detection Kit (New England Biolabs, Ipswich, MA). Membranes were exposed to Kodak X-ray film. EMSA competition assays were carried out using fragments of the promoter regions as described by Pagliai et al., 2010 (Brief Description of Sequences). DNase I footprinting

Protection assays were performed on both minus and plus strands using 5'-6FAM or 5'-VIC labeled probes generated by PCR using primers described in the brief description of sequences. The protection assay contained the same components used for EMSAs, except that 5 ng μΓ¹ Pi_dtP labeled probe, 6 μΜ LdtR_Las, 0.5 mM CaCl₂, 2.5 mM MgCl₂, and 0.025 U of DNase I (New England Biolabs) were added into 200 oL of reaction. The mix was incubated for 20 min at 37 °C, and ended by adding 50 mM EDTA pH 8.0. The corresponding digestion reaction without LdtR was included as a control. The digested DNA and the sequencing reaction products were analyzed at the Plant and Microbe Genomics facility, Ohio State University, Columbus, using a 3730 DNA analyzer. The protected regions were identified using GeneMapper software (Life Technologies). 5'RACE-PCR

The transcription start site of IdtR and IdtP genes from CLas and L. crescens were determined by a modified 5'RACE-PCR protocol. Cultures of B. subtilis BS6 (for 'Ca. L. asiaticus' IdtR and IdtP) and L. crescens were grown to exponential phase as described above. The total RNA was extracted using the RiboPure-Bacteria kit (Ambion, Austin, TX) following the manufacturer's protocol. 2.5 μg of each RNA was first treated with 20 U of the Calf intestine alkaline phosphatase (New England Biolabs) for lh to remove the 5'-P0₄ from degraded RNAs followed by a phenol.chloroform.-isoamylalcohol precipitation. The RNAs were further treated with 2.5 U of Tobacco acid pyrophosphatase (Epicentre Biotechnologies, Madison, WI) for lh to remove the 5 '-cap from mRNAs. The CIP/TAP RNAs were then ligated to the 01igo_RACE_RNA adapter (brief description of sequences). The synthesis of the first strand of cDNAs were carried out using primers described in the brief description of sequences, with the Superscript II Reverse Transcriptase (Invitrogen) and according to the manufacturer's protocol. The cDNAs were amplified by PCR using Oligo J ACE_Fw and LdtR_Las_RACE_Rv or LdtP_Las_RACE_Rv for 'Ca. L. asiaticus'. Similarly, OligoJRACE Fw and LdtR_Lci_RACE_Rv or LdtP_Lcr_RACE_Rv were used for L. crescens (brief description of sequences). The PCR fragments were cloned using the StrataClone Blunt PCR cloning kit (Agilent Technologies), following the manufacturer's protocol. The clones were sequenced and IdtR and IdtP transcriptional start sites determined. Evaluation of toxicity of the selected chemicals on sweet orange seedlings

All compounds selected for this study are approved for use in humans; however their toxicity to citrus seedlings has not been previously examined. Tolfenamic acid was administered to groups of 12-month old seedlings by trunk injection/infusion. Concentrations up to 250 μΜ of tolfenamic acid were established to be non- toxic to orange seedlings.

Trunk injections procedure

A shallow injection port was drilled at the base of each trunk (approximately 1.5" above the soil line) immediately prior to the start of each infusion. Each chemical solution was prepared in water immediately prior to each treatment. 5 ml infusions were carried out over a period of 18 hours, using a gravity-fed IV line. One group of plants was administered with 5 ml of water as a procedure control. Upon completion of each infusion, injection needles were removed and a sterile 3/16" dowel rod used to completely seal the injection site.

Treated plants were monitored for a period of 3 months following the injections. During this time, the overall health of the plants was assessed weekly for symptoms of phytotoxicity. Evaluation of antimicrobial efficacy of the selected chemicals

The evaluation of the antimicrobial efficacy in plants was performed by following the remission of HLB symptoms as well as the viability and titer of CLas in tissue samples collected from new growth. The viability was estimated by following the transcriptional activity of CLas.

Citrus sinensis inoculation

Twelve-month old seedlings were graft inoculated with budwood collected from HLB- infected trees. Prior to grafting, the source of the infected tissue was analyzed by PCR to confirm the presence of viable CLas. PCR was carried out using the primers for CLIBASIA_04040, a gene unique to CLas. Inoculated plants were kept in a secure greenhouse approved by the USDA Animal and Plant Health Inspection Service (APHIS). The plants were watered in accordance with the standard watering schedule for the commercial citrus industry.

Two months after grafting, each plant was analyzed for HLB by PCR as described above. A non-infected control group was maintained throughout the duration of the experiment.

Seedlings treatment study

Infected sweet orange seedlings (described above) were randomly divided into groups of 4 seedlings and chemicals tested at the two highest, non-phytotoxic concentrations. Each chemical was applied to infected seedlings. The treatments were done at TO and after two weeks into the treatment (T2). Evaluation of HLB infection and CLas viability was performed as described above.

In vitro model to test chemicals on CLas infected leaves

Source of Leaves: All leaves used in this study were collected from young flushes that grew on highly symptomatic branches. All shoots were collected from a single HLB-infected, Valencia sweet orange tree. The infected status of the tree and widespread distribution of CLas were confirmed by transmission electron microscopy and PCR analysis of leaf, petiole, and root tissue samples, as described.

Leaf Collection and Treatment: All solutions were autoclaved or filter sterilized. 100 raM stocks of each chemical were prepared in 100% DMSO. Immediately before collecting leaves, benzbromarone, hexestrol, and phloretin solutions were diluted to 100 μΜ in ultrapure water. A solution of ultrapure water and DMSO (1%) was used for the controls. A scalpel was used to harvest leaves from the tree, with a horizontal cut at the base of the petiole. Each leaf was immediately suspended in 8 ml of treatment solution (with or without chemicals). Leaves were supported in a vertical position throughout the incubation period, with only the lower inch of the petiole submerged in solution (with or without the chemical). Steady air flow was maintained over the leaf blades throughout the incubation period to facilitate transpiration and the uptake of each solution. Each treatment group consisted of 18 leaves. Nine leaves from each treatment group (including controls) were processed after 6 h of incubation and the remaining nine leaves were processed after 24 h of incubation.

Leaf Tissue Processing: For each treatment group, biological triplicates (A, B and C) were prepared from nine leaves. Due to the variable distribution of CLas within host trees, the tissue from three leaves was combined for each sample. RNA extractions were carried out using the midribs and petioles only. The leaf blades were removed using a scalpel. The remaining midrib and petiole of each leaf was cut into sections (1 cm long) and immediately submerged in KNAlater solution (Life Technologies) as per the manufacturer's instructions. The samples were stored at -80°C until being processed for RNA isolation.

RNA Extraction: Plant and bacterial RNA was extracted from midrib and petiole samples using TRI Reagent solution (Sigma-Aldrich), with the addition of a mechanical homogenization step and pressure lysis. Midrib and petiole samples were thawed on ice, and transferred to FT500-S Pulse Tubes (Pressure Biosciences, Easton, MA) with 500 μΐ of TRI Reagent (Sigma-Aldrich). Samples were homogenized for a total of 2 minutes, in 30 s intervals, on ice, using a PCT Shredder (Pressure Biosciences, Easton, MA). Samples were then transferred to FT500-ND Pulse Tubes (Pressure Biosciences) and subjected to pressure cycling using a NEP 2320 Barocycler (Pressure Biosciences) at 35,000 psi for 30 s, and 0 psi for 30 s, for a total of 20 cycles. Crude lysate was then centrifuged at 5,000 x g for 5 min, at 4°C, and the supernatant transferred to a clean RNase free falcon tube for RNA extraction. Chloroform (0.2 volumes) was added to each sample followed by thorough mixing and centrifugation at 5,000 x g for 30 min, at 4°C. The aqueous phase was transferred to a clean RNase free falcon tube, and precipitated with isopropanol (0.5 volumes). RNA pellets were washed with 75% ethanol (0.75 vol), briefly air dried, and re-suspended in 100 μΐ of RNase-free water. RNA samples were treated with RNase-free DNase I for 30 min, at 37°C, followed by DNase Inactivation Reagent (Life Technologies). The concentration of total isolated RNA was determined using a NanoDrop ND 1000 (Thermo Scientific, Wilmington, DE). RNA samples were stored at -80°C. cDNAs were synthesized with M-MLV Reverse Transcriptase (Life Technologies) in accordance with the manufacturer's instructions, using the primers listed in the brief description of sequences. Real time quantitative PCR (qRT-PCR) was carried out on as described above. The cox2 gene was measured as an internal plant control. Quantitative reverse transcription-PCR primers are described in detail in the brief description of sequences. Statistical analyses

The statistical significance of data obtained from SEM (cell size) and stress resistance assays (CFU/ml), was determined using a Student's /-test. qRT-PCR statistical significance was assessed using a two-tail P-value, calculated with the Mann- Whitney nonparametric test.

Following are examples which illustrate procedures for practicing the invention. These examples should not be construed as limiting. All percentages are by weight and all solvent mixture proportions are by volume unless otherwise noted. EXAMPLE 1 - CLas CarD interacts with the β-subunit of the RNA polymerase

CarD plays a regulatory role for virulence factors in Mycobacterium resulting from interactions between CarD and the β-subunit of the RNA polymerase (RNAP). To determine if CLIBASIA 01510 (CarD homolog in CLas) has a similar role in CLas, a bacterial two-hybrid system was used to investigate interactions between CarD and the β-subunit of the RNAP. The plasmids ρΒ2ΗΔα and ρΒ2ΗΔω were used to create fusions of the CLas genes CLIBASIA 01510 {CarD) and CLIBAS1A_ 0011021-150 (rpoB, residues 21-150), to the ?-gaIactosidase truncations Δα and Δω as described by Borloo et al. (2007). The recombinant plasmids were then co-transformed in E. coli TOP 10, and protein-protein interactions were followed by β-galactosidase activity. A control strain (LB01 ) carrying the empty pB2HA and ρΒ2ΗΔω plasmids was used to determine the enzymatic baseline activity. The p-galactosidase activity for each strain was quantified after subtraction of the baseline activity. In the strains LB02 (carrying pB2HAot-CarZ⁾ and pB2HA -rpoB₂i.i5o) and LB03 (carrying pB2HAa-rpoB₂i-i5o and pB2HAa-CarD), significant changes in the enzymatic activity (5823 ± 345 AU and 3252 ± 217, respectively) were observed (Figures 1 and 25). In contrast, low levels of activity were observed in the strains LB04 and LB05, each carrying only one of the fusion proteins (pB2HAa-CarD and ρΒ2ΗΔω; ρΒ2ΗΔα and ρΒ2ΗΔω-Γ/>ο>¾-ΐ 50, respectively) (Figure 1).

These results confirm that CLas CarD interacts with the RNAP and may have a regulatory role

EXAMPLE 2 - CarD binds specifically to the promoter region of rplK

Previous studies in Mycobacterium have found that CarD binds non-specifically to the promoter regions of the rrnA, rpsH, 16S, 23S and 5S rRNA genes. In this study, the promoter regions of CarD {P_CarD), rplK (P_rplK), rplJ (P_rpU\ dnaK (i ), radA (P_radA) and 16S rRNA (P16S) were used to examine the DNA binding properties of CarD. CarD was able to bind P_rp,_K at 5 μΜ while binding to P_rpU, PcarD, PdnaK, and P_radA only at higher concentrations (10 - 15 μΜ). The specificity of the CarD/ ^ interaction was tested by EMS A using competition assays. Increasing concentrations of unlabeled P_rplK, or P_mdA were added to the EMSA reaction mix (Figure 2). It was found that unlabeled Ρ_ψΙΚ at a ratio 1 : 10 was able to outcompete the labeled fragment while ratio up to 1 :500 of P_raciA, {P_rpiK-PcarD, labeled to unlabeled, respectively) did not affect CarD binding to P_rpiK- Competition assays were then used to examine the specificity of the CarO_L∞P_rpi_K interaction, where a 10-fold excess of unlabeled P_rpi_Kwas found to outcompete the labeled P_rpi_K fragment (Fig. IB). The addition of excess (up to 400-fold) unlabeled P_mdA or unlabeled P_carD had no effect. These results indicate that CarD binds to specific sequences in the promoter regions of P_rp/K.

The DNA binding sequence for CarD_Las was identified by DNase I footprinting. A protected site of 24 nucleotides (GTAGGTTGGTTGTTTTTTAGAAAG (SEQ ID NO: XYZ) was identified in the promoter region of rplK (Fig. 26A). The binding sequence is located 31 bp from the ATG translational start codon, on the plus strand. The critical DNA contact residues were identified by EMSA analysis, following site directed mutagenesis of the rplK promoter region (Fig. 2C-D). Of the twelve mutant EMSA probes tested, only rplKMl, rplK4, rplK5, rplKMlO and rplKM l 1 resulted in decreased binding to CarD_Las (Fig 2).These results indicate that the sequence nnAnnnnGGTTnnnnnnnnnAAAn is the CarD recognition sequence.

EXAMPLE 3 - Identification of small molecules that bind CarD

Small molecules that bind and/or interact with the CarD protein to regulate its activity were identified. The CLas CarD gene was cloned into vector pl5TV-Lic, and subsequently overexpressed in E. coli BL21. CarD was purified as a soluble polypeptide with high recovery (12 mg/liter). The purified protein was screened against the Prestwick chemical library of small molecules, by differential scanning fluorometry. The midpoint transition temperature of CarD was determined to be 37.3 ± 0.5°C. From the 1200 small molecules examined in the screening, 8 compounds were found to induce a shift in the midpoint transition temperature (ATm) of CarD.

Metronidazole, cotine, gramine, menadione, folic acid, and tolfenamic acid were found to have the strongest effect, inducing a Tm shift of 1.8°C, 2.1°C, -2.5°C, -2.5°C, -3.5°C and -4.5°C, respectively. Berberine chloride and acetazolamide affected CarD to a lesser degree, with a ATm of 1.5°C and 1 .7°C, respectively. These results were confirmed in a dose dependent manner, with concentrations up to 1 mM. EXAMPLE 4 - Small molecules modify multistate denaturation profiles in CarD

Differential scanning calorimetry (DSC) was used to characterize the thermal unfolding properties of CarD, in both the presence and absence of 100 μΜ metronidazole, dimetridazole, or ronidazole. The calorimetric scans of the native protein (Figure 3) indicated a four-state endothermic unfolding transition in solution, with transition midpoint temperatures (Tm) of 25.9°C, 36.7°C, 45.2°C and 49.4°C (Tmi, Tm₂, Tm^, and Tm₄, respectively). A strong, positive Tm shift was observed in the presence of dimetridazol and ronidazole (ATm4 of 10.2°C and 1 1.0°C, respectively, Figure 3).

A smaller Tm shift was observed in the presence of metronidazole (ATm4 of 1.6°C). Multistate denaturation profiles have been linked to the disruption of protein oligomerization, coupled with the unfolding of the different functional domains (Thorolfsson et a!., 2002); however, no oligomeric structures were observed during analysis of the CLas CarD. Size exclusion chromatography was carried out under numerous conditions, where CarD was found to consistently elute with an apparent molecular mass of 25 kDa, the expected size for the monomer. These results indicate that the four state thermal denaturation profile observed for CarD is not due to changes in the oligomeric state, but may indicate the presence of multiple domains.

EXAMPLE 5 - Small molecules modulate CarD interactions with the RNA polymerase

In vivo analysis of the chemicals identified by thermal screening was carried out using the bacterial two-hybrid system, in absence and presence of each chemical. The minimal inhibitory concentration (MIC) was determined for each chemical in E. coli (Table 3). Preliminary β- galactosidase assays were performed using strains LB01 and LB02, in absence and presence (Ι μΜ - 1 mM) of each chemical. The highest concentration that did not adversely affect the base levels in the controls was used for subsequent in vivo assays (Table 3). Metronidazole showed the strongest effect, decreasing the CarD/RpoB interaction by 53.7%, while berberine, acetazolamide, gramine, cotine, menadione, folic acid, and tolfenamic acid had a lesser effect, decreasing the interaction by 5.1%, 3.7%, 15.3%, 5.2%), 9.8%, 2.2%, and 17.5%, respectively.

Next, we identified compounds with a chemical scaffold similar to metronidazole (dimetridazole, 2-methyl-4(5)-nitroimidazole, 1,2-dimethylimidazol, ornidazole, and ronidazole) and tested their effect on the interaction between CarD and RpoB. The inhibition values obtained were low for ornidazole (1 1.6%), 2-methyl-4(5)-nitroimidazole (17.5%), and dimetridazole (25.8%). When tested at higher concentrations (200 μΜ), 1,2-dimethylimidazole decreased the CarD/RpoB interaction by 37.6%; however, no effect was observed at lower concentrations (<50μΜ). Conversely, at lower concentrations (1 μΜ), ronidazole had a significant effect on the CarD/RpoB interactions (48%, Table 3). Based on these results, metronidazole, dimetridazole and ronidazole were selected to be used in further experiments. Accordingly, the effects of the identified molecules on the DNA binding activity of CarD were analyzed.

Table 3. Effect of small molecules on the thermal stability of CarD and their effect on CarD interactions with RpoB

¹ AT was calculated as the difference in the transition temperature between the proteins in the absence (CarD = 37.3°C) and the presence of a given chemical. The results are average of duplicates.

² MIC: Minimal Inhibitory Concentration for the E. coli TOP10 reporter strain

3 Concentration tested used to test the effect of the chemical in the bacterial 2-hybrid system.

⁴ β-galactosidase activity (expressed as arbitrary units, AU) as a result of pB2HA(x-c rD and ρΒ2ΗΔω- ο5₂ι-ΐ 5ο interaction is expressed as a decrease in the activity in the presence of chemicals, compared to the control without chemicals after 180 min. The assay was performed a minimum of three times, each in triplicates.

EXAMPLE 6 - Small molecules disrupt CarD-DNA interaction The effect of small molecules that interacted with CarD on the thermal denaturation screen was evaluated by binding assays as described before using P_rpiK as DNA target (Figure 4). It was found that the addition of 2 mM metronidazole, acetazolamide, gramine, cotine, menadione and folic acid had no effect on C&rO P_rpi_K interactions. Increasing the concentration of metronidazole or ronidazole (up to 10 mM) did not affect CarD binding to F_rpiK-

Interestingly, tolfenamic acid was highly effective in disrupting CarD: P_rpi_K interactions (Figure 4A). The addition of increasing concentrations of tolfenamic determined that 350 μΜ is sufficient to disrupt the CwT>:P_rpi_K complex (Figure 4B). Metronidazole, ronidazole, acetazolamide, gramine, cotine, menadione and folic acid had no effect on the

complex when present at concentrations up to 2 mM. These results indicated that small molecules that modulate CarD interactions with RpoB did not affect CarD binding to DNA, while tolfenamic acid specifically decreased P_rpi_K:CarO binding.

EXAMPLE 7 - Small molecules against CarD alters the expression of several genes involved in transcription and translation processes in Liberibacter crescens

As CLas still remains elusive to propagation under laboratory conditions we used the culturable close relative L. crescens for mRNA studies. The genes selected in CLas showed high amino acid sequence conservation in L. crescens (59%, 79%, 76%, 76%, 56% and 66% for rplY, carD, CLIBASIA_01505, rpoH, rluC, mnmA, respectively).

Bacterial cells were grown in presence and absence of increasing concentrations ( 1-500 μΜ) of metronidazole, dimetridazole, ronidazole and tolfenamic acid. It was found that L. crescens was tolerant to concentrations up to 500 μΜ of metronidazole, dimetridazole and ronidazole while a concentration of 70 μΜ of tolfenamic inhibited growth. Based on these results we used tolfenamic acid at 50 μΜ for the studies of mRNA expression.

Cells were collected in exponential growth phase. We determined that the expression of carD, etc, rpoH , rluC and mnmA was significantly affected.

EXAMPLE 8 - Small molecules as therapeutics against CLas

As propagation of L. asiaticus still remains elusive under laboratory conditions, the culturable close relative L. crescens was used to determine the antimicrobial activity of metronidazole, dimetridazole, ronidazole and tolfenamic acid. Metronidazole, dimetridazole and ronidazole were not inhibitory at concentrations up to 500 μΜ. Conversely, growth inhibition of L. crescens was observed in the presence of tolfenamic acid (70 μΜ). These results suggest that interactions between CarD_{I r} and RNAP may not be critical for the persistence of L. crescens; however, interactions between CarD_Lc, and DNA are indeed essential for the survival of L. crescens.

An infected leaf assay was used to assess the efficacy of potential therapeutics against L. asiaticus, in vitro. Leaves were collected from L. asiaticus-positive Valencia Orange (C. sinensis) trees, and immediately suspended in 1, 10 or 100 μΜ tolfenamic acid. A control group was also prepared under the same conditions using buffer vehicle only. Following incubation, each sample was analyzed by qRT-PCR to determine the transcriptional activity of the 16S RNA gene, DNA gyrase subunit A, and the L10 ribosomal protein (encoded by CLIBASIAj-05785, gyrA, and rplJ, respectively) as viability parameters for L. asiaticus (Pagliai et al., 2014). The expression levels of gyrA and rp/J were not affected by the addition of 1 μΜ tolfenamic acid; however some reduction in gene expression was observed for the 16S rRNA gene. Samples incubated with 10 or 100 μΜ tolfenamic acid showed a significant decrease in the expression of all three genes (Fig. 26A). These results suggest that tolfenamic acid may be lethal to L. asiaticus at the higher concentrations (10 and 100 μΜ) tested, but it may also be involved in transcriptional regulation when present at lower concentrations (1 μΜ).

To assess the role of CarD as a transcription regulator in L. asiaticus, the expression of rplK and 16S ribosomal RNA (CLIBASIA_r05781) was evaluated using sub-lethal concentrations (1 μΜ) of tolfenamic acid using the expression of the bacterial gyrA gene as an internal control. The expression of carD and rplJ was not affected by the addition of (1 μΜ) tolfenamic acid; however, significant differences (p>0.001) were observed in the expression of rplK and 16S rRNA (5.2 ± 0.7 fold decrease and 2.5 ± 0.5 fold decrease, respectively; Fig. 26B). These results indicate that CarD_Las does act as a transcriptional activator for rplK and the 16S ribosomal genes in L. asiaticus. Additionally, these results confirm that expression of carD_Las is not auto-regulated at the level of transcription.

EXAMPLE 9 - LdtR binds to its own promoter region and to the IdtP promoter region

The IdtR gene encodes the only MarR family member of transcriptional regulators in the genome of CLas psy62 {ldtR_Las). It shares high amino acid sequence identity to proteins found in all Rhizobiaceae family, including: 'Ca. L. solanacearum' CLso-ZC l (89%), Liberibacter crescens BT-1 (73%), Sinorhizobium meliloti 1021 (70%), Agrobacterimn tumefaciens F2 (74%), A. radiobacter K84 (71%), Rhizobium leguminosarum bv. viciae 3841 (71%), and Hoeflea phototrophica DFL-43 (65%). The genomic arrangement of ldlR_Las was also similar to that of its orthologs; however, none of these proteins has previously been characterized. LdtR_Las is encoded by the minus strand. CLIP-ASIA 01185 is encoded 341 bp upstream of ldtR_Lm, on the plus strand. This gene encodes for a putative delta-aminolevulinic acid dehydratase ihemE) involved in tetrapyrrole biosynthesis. Downstream of ldtR_Las, on the minus strand, is ldtP_Las, which contains both a YkuD L,D-transpeptidase domain (pfam03734) and a peptidoglycan binding domain (pfam01471), suggesting that it likely acts as an L,D-transpeptidase. Biotinylated probes were generated to contain the intergenic region of CLIBASIA_01185 and LdtR_Las : -395 to +47, positions are relative to ldtRj_MS translation start site), as well as the putative promoter region of ldtP_Las (Pi_dip : -248 to +79, relative to the ldtP_Las translation start site). EMSA analysis of the interaction between IdtR_Las and P^R or P^ip, revealed higher binding affinity for Ρ_ΜΡ, with 50% binding achieved at 100 nM (Figure 6A). With increasing concentrations of LdtR_Las, a higher molecular weight oligomer was also observed. Size exclusion chromatography indicated that LdtR_Las is a stable dimer in solution with an observed molecular weight of 39 kDa (Figure 16). These results suggest that there is either a second binding site within the IdtP promoter, or LdtR_Las may further oligomerize upon binding to DNA.

To confirm the location of LdtR binding, competitor experiments were conducted using unlabeled DNA probes (brief description of sequences). The largest probe (CD-I) contains the whole sequence used in EMSA (from -248 to +79). Probe CD-2 contains LdtR_Las binding site surrounded by promoter elements (-139 to +79). Probe CD-3 was designed to contain only the protected site I identified by DNase I footprinting (-1 18 to -74), while probe CD-4 does not contain the LdtR_Las binding site (-21 to +58). The addition of probe CD-I or CD-2 resulted in a similar decrease in the intensity of the shifted bands (Figure 6B). This effect was further enhanced in the presence of probe CD-3. No competition was observed with probe CD-4. These results indicate that LdtR_Las may have two binding sites within the IdtP the promoter.

The DNA binding sequence for LdtR_Las in the promoter region of ldtP_Las was identified by DNase I footprinting. The protected site consists of 18 nucleotides (nt) (ATATTCCTTGTATTTTAA, IdtP J) on the minus strand (Figure 6C), upstream of the predicted -35 box. Immediately downstream from the protected site, a 15 nt DNase I-hypersensitivity region was identified, which may correspond to a DNA bending site (Figure 6C). Analysis of the DNA sequence upstream of the hypersensitivity region indicated the presence of a second binding site; however, the binding sequence is broken into two segments separated by 9 nt (ATATTTCTT-«9-GTGATTTAA, IdtP 2; Figure 6D). A putative binding site was identified in the promoter region of ldtRi_as with a similar disruption (IdtR 1, Figure 17E). This sequence displays a separation of 6 nt between each segment, which may explain the lower affinity of LdtR_Las for P_idtR (Figure 6A). To determine the residues required for LdtR binding, the three binding sites (ldtP_l, ldtP_2, and ldtR_\) were compared, and a position specific frequency matrix was constructed (Figure 7A). Using plasmid pBS6 as a template, site directed mutagenesis was performed on residues that showed high conservation as follow: Ml (-1 1 1)AT→GG, M2 (-108)TT→GG, M3 (-104)TT→GG, M4 (- 102)GT→AG, and M5 (-99)TtT→GtG. EMSA experiments were then conducted with the mutated binding sites. Decreased LdtR_Las binding was observed with probes PUIH- MI and PidtP Ms (Figure 7B). Mutations M2, M3, and M4 did not affect LdtR_Las binding (Figure 7B).

EXAMPLE 10 - LdfR_Las is a Transcriptional activator

To determine the mode of regulation for LdtR_Las, several lacZ fusions were generated using

Bacillus subtilis as a model strain, since all the genes under study are absent from its genome. This system allows the study of transcriptional fusions by inserting a single copy of the gene into a nonessential chromosomal locus (thrC). The putative promoter regions of CLIBASIA Ol 185, ldtR_lMS, and IdtPi_as were fused to the lacZ gene, resulting in strains BS1 {PCLIBASIAJUSS), BS3 (fW) and BS5 (Pi_dtp)- All three promoters were found to have very low activity (1.1 ± 0.7, 0.1 ± 0.03 and 3.8 ± 0.07 AU, respectively; Figure 8). In the presence of ldtR_Las, increased expression of lacZ was observed in strains BS4 {P_MtR-ldtR_Lai) and BS6 (Pi_dtirldtR_Las-P_!dtP) (16.4 ± 0.02 and 36.3 ± 0.2 AU, respectively; Figure 8). No expression was observed in strain BS2 (harboring ldtR_]MS and PCLIBASIA JUSS)- These results confirmed that LdtR_Las is a transcriptional activator of ldtR_Lm and ldtPi_aS, while it does not regulate CLIBASIAJU85.

The in vivo specificity of LdtR_Las binding to PidtR-ldtR_Las-Pidtp was tested in strains BS6M1 and BS6M5, harboring mutations M l or M5 on the Pi_dtP binding site 1. β-galactosidase activity was significantly reduced (p < 0.001) by 55% and 47%, for BS6M1 and BS6M5 respectively, when compared to the wild type promoter (Figure 8). These results positively correlated with the reduced binding of LdtR_Las to probes PMP MI ^and Pi_dtp us in EMSA experiments (Figure 7B), confirming the specificity of the LdtR_Las binding site.

EXAMPLE 1 1 - IdtR-ldtP mutations resulted in shortened cells and increased sensitivity to osmotic stress in S. meliloti

Inactivation of L,D-transpeptidases have been shown to induce morphological changes, resulting in decreased rigidity of the cell wall. As CLas has yet to be cultured, a model strain was used to study the biological role of LdtR and LdtP. Due to its close phylogenetic relationship to CLas, and the availability of genetic tools, S. meliloti was chosen. Prior to in vivo experiments, SMc01768 (named LdtR_Smc) was purified and confirmed to bind to its own promoter region, as well as to the promoter region of the ldtP_Las homolog, SMc01769 (named LdtP_Smc; Figure 18).

Insertional mutants of ldtP_Smc and ldtR_Smc were constructed in S. meliloti (strains SMPl and SMP2, respectively; Table 2) by homologous insertion of pSMPl and pSMP2 in ldtPs_mc and ldtR_Smc, respectively. In strain SMPl, ldtP_Smc was disrupted at 498 nt from the ATG start codon. In strain SMP2, IdlRs_mc was disrupted 29 nt from ATG start codon.

Analysis of crystal violet-stained cells revealed the SMPl and SMP2 mutants had a shortened rod-type phenotype (short-cell), when compared to the wild type S. meliloti. However, they did not show growth defects in liquid cultures (doubling time or final OD₆oo, data not shown). Scanning electron microscopy was used to verify and quantify these morphological changes. Electron micrographs confirmed the average length of SMPl (1.16 μιη ±0.15) and SMP2 (1.15 μιη ±0.14) mutants to be significantly shorter (30 %, p < 0.005) than wild type cells (1.65 μπι ±0.20) (Figure 9A- C).

To determine if modifications in the cell wall composition would affect tolerance to osmotic stress, a seven-fold serial dilution of each strain was spot plated in the presence of sucrose (0.3 M) or NaCl (0.4 M). Increased sensitivity to osmotic stress was observed in strain SMPl (1.8xl 0⁷ ± 3.9xl 0⁶ and 1.4xl0⁶ ± 5.4x10^s CFU/ml, for sucrose and NaCl respectively), and SMP2 (1.6x10⁷ ± 7.1x10⁵ and l . lxl0⁶ ± 7x10⁵ CFU/ml, for sucrose and NaCl respectively), when compared to the wild type strain (2.2xl0⁸ ± 2.5xl0⁷ and 7.1xl0⁶ ± 6.9xl0⁵ CFU/ml, for sucrose and NaCl respectively; Figure 10A). These results were significantly different for sucrose (/; < 0.05) but not for NaCl. Higher concentrations of NaCl or sucrose were toxic for all strains (data not shown).

To establish a link between elevated sensitivity to osmotic stress, and the regulation of gene expression by LdtR_Smc, β-glucuronidase activity (encoded by the uidA gene) was measured in S. meliloti (Figure 10B). Strain SMP3 was constructed by inserting the uidA reporter gene downstream of ldtPs_mc (no disruption to ldtR_Smc or ldtP_Smc). Strain SMP3 was used as a reporter strain to determine the expression of uidA in a wild type phenotype. In the presence of NaCl, the β-glucuronidase activity was induced in a concentration-dependent manner in strains SMP3 and SMPl (Figure JOB). Induction of β-glucuronidase activity was dependent on the presence of LdtR_Smc- In absence of the regulator (strain SMP2), no changes in the expression of the reporter gene were observed. These results confirm the role of LdtR_Smc as an activator of ldtR_Smc and ldtP_Smc transcription in response to osmotic stress.

To determine if the tolerance to osmotic stress could be recovered by the addition of IdtR, strain SMP2 (IdtR mutant) was transformed with plasmid pSMP4 carrying ldtR_Las (strain SMP2B), and analyzed for sensitivity to osmotic stress. Strain SMP2A (carrying the empty pBBRlMCS-5 plasmid) served as a control. Increased tolerance to osmotic stress was observed in strain SMP2B (6.1x10° ± 5.7xl0⁵ and 3.6xl 0⁶ ± 7.6x10^s CFU/ml, for sucrose and NaCl respectively p < 0.05), when compared to SMP2A (7.2xl 0⁵ ± 5.8xl 0⁴ and 5.7xl 0⁵ ± 1.0x10^s CFU/ml, for sucrose and NaCl respectively) (Figure IOC). These results suggest that LdtR_Las is directly involved in tolerance to osmotic stress by recognizing similar promoter elements in PM,_P of S. meliloti. Further in silico analyses in S. meliloti revealed the presence of LdtR_Las binding sites upstream of the IdtP -35 sequence, in agreement with the arrangement of LdtR binding sites in L. crescens and 'Ca. L. asiaticus' (Figure 17).

To determine if the addition of ldtP_Las could recover the tolerance to osmotic stress, strain SMP2 (IdtR mutant) was transformed with pSMP5 carrying ldtP_Las (SMP2C). Increased tolerance to osmotic stress was observed in strain SMP2C (1.5xl 0⁷ ± 2.6x10° and 8.0x10° ± 2.1x10° CFU/ml, for sucrose and NaCl respectively, /? < 0.05) when compared to SMP2A (7.2xl 0⁵ ± 5.8xl 0⁴ and 5.7xl 0⁵ ± 1.0x10^s CFU/ml, for sucrose and NaCl respectively, (Figure I OC). These results indicate that LdtP from S. meliloti and CLas are functionally homologous. These findings confirm that the decreased tolerance to osmotic stress observed in strain SMP2, was due to the absence of LdtRs_mc transcriptional activity.

EXAMPLE 12 - Identification of small molecules that modulate the activity of LdtR_Las

A fluorescence based small molecule screening assay was used to identify chemical scaffolds that may interact with the transcription factor LdtR_Las. A library containing 196 biologically relevant small molecules and the Prestwick Chemical Library, which contains 1,200 small molecules were utilized. Small molecules that induced a shift in the melting temperature (ATm) of LdtR_Las, by more than two degrees, were considered as positive "hits". The chemicals with the strongest destabilizing effect were hexestrol (Aim = -2.5 +0.5 °C), diethylstilbestrol (ATm = -4.5 ±0.9 °C), and benzbromarone (ATm = -2.0 ±0.3 °C), while oxantel pamoate (ATm = 2.0 ±0.2 °C) was found to greatly increase the stability of the protein (Figure 19).

EXAMPLE 13 - Small molecules decrease LdtR_Las binding to Pi_dtp

A change in thermal stability does not guarantee a biologically relevant interaction; therefore, each of the compounds was tested on the ability to modulate the /W:LdtRi,_as interaction. All of the identified chemicals decreased the DNA binding activity of LdtR_Las in a concentration-dependent manner (Figure 1 1 ). Benzbromarone had the strongest effect and disrupted the /W:LdtR_Las interaction at 50 μΜ. Oxantel pamoate completely impaired the Pu_tp'- LdtR_Las interaction at 250 μΜ, where only partial disruption of the complex was observed with hexestrol and diethylstilbestrol. The chemical scaffold of the strongest destabilizing agents (benzbromarone and hexestrol) served to identify other natural compounds such as resveratrol and phloretin. It was found that resveratrol decreased binding at 250 μΜ, while phloretin disrupted the Pid_tp:LdtR_h!ts interaction at 100 μΜ, consistent with molecules having physiological relevance (Figure 1 1). To determine the specificity of each ligand that decreased /W:LdtRL_as interaction, EMSA experiments were carried using a MarR homolog (LVIS0553), in the presence or absence of each chemical. The PLVISOS53- LVIS0553 interaction was previously found to be modulated by the presence of novobiocin. As expected none of the identified ligands for LdtR_Las affected the binding of LVIS0553 to its cognate promoter (Figure 20). EXAMPLE 14 - Small molecules induce morphological changes in S. meliloti and L. crescens.

Chemicals that modulate binding of the transcription factor can cause phenotypic abnormalities, similar to those observed in IdtR mutants of S. meliloti. The toxicity of each chemical was determined and sub-lethal concentrations were used for these experiments (Table 4). Addition of increasing concentrations of each chemical (25 μΜ phloretin, 25 μΜ benzbromarone, or 1 μΜ hexestrol) resulted in a pronounced decrease in cell size in S. meliloti (Figure 12A). Quantitative assessments of the cell size were conducted in wild type S. meliloti cells grown in the presence of 25 μΜ phloretin. The addition of phloretin resulted in a significant decrease of 27% in the cell size (1.20 μηι ± 0.18, p < 0.005; Figure 9D) when compared to the wild type ( 1.65 μιη ± 0.20; Figure 9A). These results are in agreement with the decrease in cell size observed for the SMP 1 and SMP2 mutants (Figure 9B and 9C).

Confirmatory studies were performed in L. crescens BT-1. L. crescens is a close relative of CLas that was recently isolated from mountain papaya, and can be cultured under laboratory conditions. In addition, the complete genome of L. crescens BT- 1 has been sequenced, and the homolog of IdtR-Las {B488J0910, named ldtR_La) identified. The chemicals (50 μΜ phloretin, 50 μΜ benzbromarone, or 25 μΜ hexestrol) that induced the "short-cell" phenotype in S. meliloti modulated the activity of ldtR_Lcr, resulting in a similar phenotype in L. crescens BT-1 (Figure 12B).

To test if the phenotype induced by the presence of the chemicals correlated with changes in the expression of the ldtR_Lcr and B488 10900 (named ldtP_Lcr), the mRNA levels were determined. L. crescens was grown to exponential phase, in presence or absence of the small molecules. Modest, but highly reproducible decreases of 45.4 ± 8.9, 62.5 ± 7.7, and 37.5 ± 1 1.5 percent in ldtP_Lcr expression, were observed upon growth in the presence of 25 μΜ phloretin, 50 μΜ benzbromarone, or 25 μΜ hexestrol, respectively. These results confirmed the role of the small molecules in modulating the activity of LdtR_Lcr, in vivo. Table 4. Minimal inhibitory concentrations (MICs) and small molecule concentration used for in vivo assays and plant experiments

]The concentration used for in vivo assays and plant experiments.

²MIC for Benzbromarone was not determined due to poor solubility.

EXAMPLE 15 - Small molecules decreased stress tolerance in S. meliloti and L. crescens.

Based on the pivotal role of peptidoglycan in counteracting the effects of osmotic pressure, the downregulation of IdtR and IdtP, by chemicals that impair LdtR activity, can cause decreased tolerance to osmotic stress. The S. meliloti wild type-phenotype strain, SMP3, was used to evaluate the effect of the small molecules, on the ability to grow under osmotic stress conditions. The cells were grown in the presence or absence of phloretin or benzbromarone with increasing concentrations of NaCl (Table 4; Figure 13 A). In the presence of the small molecules, strain SMP3 showed a severe decrease in tolerance to NaCl. At NaCl concentrations as low as 50 mM, a decrease in growth was observed in the presence of phloretin or benzbromarone (50 and 30 %, respectively). Under these conditions, β-glucuronidase activity was determined. Induction of ldtR_Smc and ldtP_Smc expression, in response to high concentrations of NaCl, was overturned in presence of phloretin or benzbromarone (Figure 13B). These results are in agreement with the decrease tolerance to osmotic stress observed in presence of the small molecules.

Since genetic tools are not available yet to manipulate L. crescens, we determined the effect of the addition of chemicals, at sublethal concentrations, on the ability to tolerate high concentrations of NaCl or sucrose. It was establish that the maximal concentration of NaCl and sucrose that L. crescens tolerate is 150 and 200 mM, respectively (Figure 21). The effect of increasing concentrations of the small molecules was tested on the ability to tolerate NaCl or sucrose. The addition of phloretin, benzbromarone, or hexestrol (50, 100, or 25 μΜ, respectively), did not affect the growth of L. crescens in control conditions. Conversely, in the presence of NaCl or sucrose, L. crescens displayed increased sensitivity to all chemicals tested (Figure 13). Together, these results indicate that in S. meliloti and L. crescens, tolerance to osmotic stress is in part mediated by changes in the peptidoglycan crosslinking, which can be manipulated by the addition of small molecules that modulate mRNA levels through LdtR activity.

EXAMPLE 16 - Small molecules as therapeutics

An in vitro model was designed to test the effectiveness of the chemicals identified herein.

Shoots were collected from a single HLB-symptomatic Valencia Orange tree, infected with CLas. Previous studies have reported greater numbers of viable CLas cells in the sieve elements of young, asymptomatic leaves, collected from new flushes. All leaves used for this study were collected from new flushes on highly symptomatic branches. Nine leaves were collected for each treatment and control group. Samples were then incubated for 6 or 24 h (with or without chemical).

Since CLas still remains elusive to culture under laboratory conditions, the transcriptional activity of the 16S RNA gene and the LI 0 ribosomal protein (encoded by the rplJ gene) was followed as viability parameters. The amplification values were normalized to the plant gene cox2 and are expressed relative to the control (incubated without chemical) samples. After 24 h of incubation, significant differences were observed in samples treated with small molecules. Expression of the 16S RNA gene was repressed in samples treated with hexestrol and phloretin [39.7 ± 9.8 (p < 0.05) and 55.9 ± 9.5 (p < 0.005) percent decrease, respectively], while benzbromarone showed the strongest effect, with 90.9 ± 6.1 percent decreased expression (p < 0.005) (Figure 14A). A similar trend was observed for the expression of rplJ, with a decreased expression of 94.2 ± 2.3, 94.6 ± 2.9, and 97.6 ± 1.5 percent for phloretin, hexestrol, and benzbromarone, respectively (p < 0.005) (Figure 14B). After a short period of incubation (6 h) no significant changes were observed (data not shown).

The effect of the chemicals on the expression of the specific genes ldtR_Las and ldtP_Las was then determined in the infected leaves. The expression values are calculated relative to the 16S RNA gene, to assess the specificity of the chemicals to target genes. Phloretin showed a strong effect (88.1 ± 1.2 percent decrease) on the expression oi ld(R_Las after 6 h of incubation, while benzbromarone displayed similar decreased expression values after 6 or 24 h (78.9 ± 1.3 and 80.5 ± 1.1 percent, respectively, /? < 0.005; Figure 15C). The expression of ldtP_Las showed constant and incremental repression values over time. Hexestrol and benzbromarone reached maximal values of 93.7 ± 0.8 and 94.2 ± 0.9, respectively, while phloretin showed a maximal value of 84.8 ± 3.8 percent decrease (p < 0.005) (Figure 15D).

These results indicate that the small molecules tested act specifically on the IdtR_Las activator. Thus, expression of LdtP can increase in response to osmotic stress, allowing persistence of the bacteria within the phloem of the tree. Accordingly, the regulation of IdtP expression through inactivation of LdtR with small molecules provides a direct means of influencing osmotic stress tolerance, and survival of CLas within a host.

EXAMPLE 17 - Small molecule inhibitors of transcription factors which enhance expression of CLas virulence factors

CLas is frequently exposed to changes in osmotic pressure, due to variations in phloem sap composition. Sucrose concentrations in the phloem can vary significantly (between 0.5 and 30% w/v, corresponding to 1 mM and 880 mM, respectively) depending on plant species, tissue, time of day, and season. Consequently, bacterial pathogens that replicate in the phloem must continuously respond to changes in osmotic pressure. L,D transpeptidase activity is critical, as these enzymes are directly involved in cell wall biosynthesis and remodeling in response to stress conditions.

Certain embodiments of the invention identify and characterize a regulon from the citrus pathogen CLas involved in peptidoglycan remodeling. Included in this regulon is IdtR, a member of the MarR family of transcriptional regulators, and IdtP, a predicted L,D-transpeptidase. The genomic context of IdtR^ was conserved among members of the Rhizobiacea family. As such, the two closest phylogenic relatives of CLas, S. meliloti and L. crescens, were used to study the phenotypic effects of L,D-transpeptidase inactivation, and the physiological conditions that contribute to the expression of the IdtR regulon, since CLas is yet to be cultured. The highly conserved nature of IdtR suggests a similar mechanism of regulation among these members of the Rhizobiacea family; however, the response to ligands may vary due to the different lifestyle of each species.

L,D-transpeptidases (E.C. 2.3.2.12) mediate the substitution of 4→3 (D-Ala⁴ to mDAP³) crosslinks, generated by the penicillin binding protein D,D-transpeptidase, to 3->3 (mDAP³ to mDAP³) crosslinks. This pattern of L,D-transpeptidation represents 80% of the crosslinks observed in the cell walls of stationary phase M. tuberculosis cells. Similar results were observed in other microorganisms, including E, coli and V. cholerae. These observations suggest that transpeptidation is an active process in stationary phase cells, which may be critical for adaptation and tolerance to environmental stress. In M. tuberculosis, increased cell wall transpeptidation was positively correlated with increased transcription of Ldt_M1 during nutrient starvation. Interestingly, our results in L. crescens indicate that ldtP_Lcr and ldtR_Lcr are expressed throughout the growth phases, when cultured under laboratory conditions. However, a comparative analysis of the CLas transcriptome revealed that IdtR expression was five times higher in samples obtained from infected trees, when compared to samples collected from infected psyllids (an alternate host and insect vector of CLas). These results suggest that in CLas transcription of Ldt-associated genes may be triggered by the high osmotic pressure generated by the phloem sap. These data suggest that LdtP is involved in both housekeeping activities and stress response.

To further explore the LdtR regulatory mechanism, Bacillus subtilis was used as a heterologous host. Interestingly, LdtR was found to act as a transcriptional activator of the IdtR and IdtP genes. Although the majority of MarR proteins act as transcriptional repressors, several MarR transcriptional activators have been described. In S. meliloti, the MarR family member ExpG binds to the ExpADGE operon to activate expression of the galactoglucan biosynthesis genes. Similarly, PntR and PenR, from Streptomyces arenae and S. exfoliatus, respectively, activate synthesis of the pentalenolactone antibiotic. Interestingly, all of these regulators bind AT-rich sequences similar to the binding sequence identified for LdtR. This high degree of conservation could represent a common feature among binding sequences for MarR members that act as transcriptional activators.

In S. meliloti, changes in cell morphology (short-cell phenotype) were induced by the mutagenesis of IdtR and IdtP. Similar changes in cell morphology have been described for S. meliloti and Rhizobium spp in response to the accumulation of compounds such as glycine, which decreases the extent of crosslinks. A similar short-cell phenotype was also observed in V. cholerae, following the accumulation of D-amino acids in the media. Analysis of the CLas genome revealed no homologs of the transpeptidases involved in these activities, however, a glutamate and alanine racemase were identified. These enzymes contribute to fluctuations in the concentration of D-amino acids. The potential involvement of LdtR in the regulation of these genes may explain the phenotypic changes observed in IdtR mutants.

Based on the biological relevance of the IdtR regulon, we identified small molecules (phloretin, benzbromarone, and hexestrol) that decreased binding of LdtR to its cognate promoters, resulting in decreased expression of IdtP and IdtR. In L. crescens, decreased gene expression in presence of these small molecules was positively correlated with decreased tolerance to osmotic stress. Furthermore, in S. meliloti, the addition of phloretin, benzbromarone, or hexestrol resulted in morphological changes (short-cell phenotype) similar to those observed in IdtR and IdtP mutants. Consequently, we reasoned that chemical manipulation of LdtR_Las activity will reduce long term survival and persistence of the pathogen in infected citrus trees. Thus, we designed an in vitro model using sweet orange leaves infected with CLas to validate the effect of these chemicals. In samples treated with the small molecules, a significant decrease in IdtR and IdtP expression was observed, confirming the specific effect of these chemicals in CLas. The use of a specific target is essential for the development of an effective therapeutic treatment. Modulation of cell wall transpeptidation has been used as a therapeutic treatment for recalcitrant microorganisms, such as Mycobacterium tuberculosis. In contrast, current efforts towards the treatment of Huanglongbing disease are focused primarily on the use of "broad spectrum" treatments {i.e. penicillin, streptomycin, and thermotherapy).

EXAMPLE 18 - Use of tolfenamic acid as an antimicrobial in HLB-infected citrus seedlings

Prior to testing the efficacy of tolfenamic acid in L. asiaticus infected citrus trees, a phytotoxicity assessment was performed using healthy 12 month-old citrus seedlings. Following six months of treatment with tolfenamic acid (1, 10 and 100 μΜ), no phytotoxic effects were observed in any of the treatment groups.

The efficacy of tolfenamic acid was subsequently determined in L. asiaticus infected citrus seedlings {Citrus sinensis, "Valencia"). Seedlings were infected with L. asiaticus (via grafting) and maintained in a greenhouse for an additional 12 months to allow the infection to spread throughout the entire plant. Each plant had symptoms of advanced L. asiaticus infection and the presence of L. asiaticus was confirmed by PCR prior to beginning treatments with tolfenamic acid (Fig. 26C).

Tolfenamic acid (100 μΜ) was applied twice at two week intervals to four L. asiaticus seedlings by root soaking and spraying the leaves to saturation with the same solution. Four L. asiaticus infected seedlings were also maintained under the same conditions as controls. Each plant was examined and photographed every two weeks to monitor the canopy and root tissue for signs of recovery or disease progression. New root growth was the first sign of recovery, which was evident on several of the treated plants after 2 weeks of treatment (Fig. 27C). After two months of treatment, healthy new growth flush began to push on several of the treated plants, and continued to grow for the next 1 1 months with no visible signs of infection (See canopy pictures; Figs. 27C and 28). Eleven months after treatments were applied, three of the four plants treated with tolfenamic acid showed clear signs of recovery in both root and canopy tissues (Figs. 27C and 28). qRT-PCR analysis of root tissue revealed the absence of L. asiaticus infection in plants (TA-1, TA-2 and TA-3) while plant TA- 4 showed only a 10% reduction in the expression of L10 gene (Fig. 27D). The canopy tissue also showed a significant drop in L. asiaticus titer in three of the four treated plants (80-95% reduction; Figs. 27D and 28) in agreement with the symptoms observed in roots and canopy.

EXAMPLE 19 - Use of tolfenamic acid as antimicrobial in FILB-infected citrus seedlings

Since the transcription of rRNA is the rate limiting step during normal cell growth, and/or under stress conditions, altering their transcription via the chemical inactivation of CarD would result in decreased L. asiaticus survival. While several compounds modulated interactions between CarD and RNA polymerase (Table 3), tolfenamic acid was the only small molecule capable of decreasing interactions between CarD and DNA (Figs. 2, 4, and 25). The effect of these chemicals was tested in vivo in an infected leaf assay. Only tolfenamic acid affected the overall transcriptional activity of L. asiaticus in infected citrus tissue suggesting that the stringent ligand specificity for disruption of the complex is more stringent than the binding specificity for ligands that disrupt

interactions between CarD_Las and RNAP.

In order to prove this concept, tolfenamic acid was applied by root soaking and foliar spraying

L. asiaticus infected citrus seedlings in a greenhouse. Each seedling was confirmed to harbor viable, L. asiaticus cells for at least 6 months prior to treatment. In addition to testing positive for L. asiaticus, each plant also displayed severe signs of infection, including blotchy mottle, yellowing shoots, and severe damage to the root system. After the initial treatment, the first sign of recovery in treated seedlings was the development of new root growth. Rapid recovery of the root system was observed in 75% of the L. asiaticus infected seedlings that were treated with tolfenamic acid (Fig. 27). Although several plants showed improved root growth in as little as 14 days after treatment, clear signs of recovery were not observed in the canopy tissue of most plants until 1 1 months after treatment. The delay in canopy recovery may be due to the plant's need to re-establish the root system prior to pushing new canopy tissue. Vascular damage caused by HLB may also affect the rate at which the compound is distributed throughout the canopy. HLB significantly affects the vascular flow and exchange of nutrients between root and canopy tissue. The factors contributing to the reduction in vascular flow include the accumulation of starch within the xylem and phloem, the blockage of sieve elements by callose formation and bacterial cell debris, and compartmentalization as the tree attempts to isolate the pathogen. The highest expression levels of L. asiaticus genes were observed in highly symptomatic leaves that were collected from underdeveloped regions of the canopy, where leaf growth was stagnate. Since the static growth of these branches is indicative of severely obstructed vascular flow, it is possible that the transport of chemical to these regions of the tree was insufficient to completely inhibit the growth of L. asiaticus. As such, a foliar application (in the presence of a penetrant) may facilitate the even distribution of tolfenamic acid throughout the canopy tissue of severely infected trees where vascular flow has potentially been obstructed in response to HLB. There are few antibiotics approved for use in the treatment of plant diseases, and of those, only streptomycin and tetracycline have shown minimal success in the treatment of HLB, with tetracycline having phytotoxic effects at the concentrations required for treatment of L. asiaticus. The combined use of penicillin and streptomycin showed a suppressive effect on L. asiaticus, but the use of β-lactams antibiotics is highly regulated and not approved for use in plants. The use of tolfenamic acid and derivatives for the treatment of HLB provides a new and promising alternative to combat L. asiaticus. All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.

It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

REFERENCES

1. Auclair JL (1963) Aphid Feeding and Nutrition. Annual Review of Entomology 8: 439-490.

2. Battels FW, Baumgarth B, Anselmetti D, Ros R, Becker A (2003) Specific binding of the regulatory protein ExpG to promoter regions of the galactoglucan biosynthesis gene cluster of

Sinorhizobium meliloti - a combined molecular biology and force spectroscopy investigation. Journal of Structural Biology 143: 145-152.

3. Baumgarth B, Bartels FW, Anselmetti D, Becker A, Ros R (2005) Detailed studies of the binding mechanism of the Sinorhizobium meliloti transcriptional activator ExpG to DNA. Microbiology (Reading, England) 151 : 259-268.

4. Betts JC, Lukey PT, Robb LC, McAdam R a, Duncan K (2002) Evaluation of a nutrient starvation model of Mycobacterium tuberculosis persistence by gene and protein expression profiling. Molecular microbiology 43: 717-731.

5. Bishop JL, Boyle EC, Finlay BB (2007) Deception point: peptidoglycan modification as a means of immune evasion. Proceedings of the National Academy of Sciences of the United

States of America 104: 691-692.

6. Borloo J, De Smet L, Vergauwen B, Van Beeumen JJ, Devreese B (2007) A betagalactosidase-based bacterial two-hybrid system to assess protein-protein interactions in the correct cellular environment. Journal of proteome research 6:2587-2595.

7. Bove, J. M. (2006) Huanglongbing: a destructive, newly-emerging, century-old disease of citrus. Journal of Plant Pathology 88:7-37.

8. Brown PJB, de Pedro MA, Kysela DT, Van der Henst C, Kim J, et al. (2012) Polar growth in the Alphaproteobacterial order Rhizobiales. Proceedings of the National Academy of

Sciences of the United States of America 109: 1697-1701.

9. Cava F, de Pedro M a, Lam H, Davis BM, Waldor MK (201 1) Distinct pathways for modification of the bacterial cell wall by non-canonical D-amino acids. The EMBO journal

30: 3442-3453.

10. Chauhan S, O'Brian MR (1993) Bradyrhizobium japonicum delta-aminolevulinic acid dehydratase is essential for symbiosis with soybean and contains a novel metal-binding domain. Journal of bacteriology 175: 7222-7227.

1 1. da Graca, J. V. (1991). Citrus greening disease. Ann. Rev. Phytopathol. 29, 109-136.

12. Davis KM, Weiser JN (2011) Modifications to the peptidoglycan backbone help bacteria to establish infection. Infection and immunity 79: 562-570. 13. Duan, Y., Zhou, L., Hall, D. G., Li, W., Doddapaneni, H., Lin, H., Liu, L., Vahling, C. M., Gabriel, D. W., Williams, K. P., Dickerman, A., Sun, Y. and Gottwald, T. (2009). Complete genome sequence of citrus huanglongbing bacterium, 'Candidatus Liberibacter asiaticus' obtained through metagenomics. Mol. Plant Microbe Interact. 22, 1011-1020.

14. Dubee V, Triboulet S, Mainardi J-L, Etheve-Quelquejeu M, Gutmann L, et al. (2012) Inactivation of Mycobacterium tuberculosis l,d-transpeptidase LdtMti by carbapenems and cephalosporins. Antimicrobial agents and chemotherapy 56: 4189-4195.

15. Erbs G, Newman M (2012) The role of lipopolysaccharide and peptidoglycan, two glycosylated bacterial microbe-associated molecular patterns (MAMPs), in plant innate immunity. 13 : 95-104. doi: 10.1 11 l/J.1364-3703.201 1.00730.X.

16. Finan TM, Kunkel B, De Vos GF, Signer ER (1986) Second symbiotic megaplasmid in Rhizobium meliloti carrying exopolysaccharide and thiamine synthesis genes. Journal of bacteriology 167: 66-72.

17. Folimonova SY, Achor DS (2010) Early events of citrus greening (Huanglongbing) disease development at the ultrastructural level. Phytopathology 100: 949-958.

18. Galibert F, Finan TM, Long SR, Puhler A, Abola P, et al. (2001) The composite genome of the legume symbiont Sinorhizobium meliloti. Science (New York, NY) 293 : 668-672. Available: http://www.ncbi.nlm.nih.gOv/pubmed/l 1474104. Accessed 24 January 2014.

19. Gao M, Chen H, Eberhard A, Gronquist MR, Robinson JB, et al. (2005) sinl- and expR- dependent quorum sensing in Sinorhizobium meliloti. Journal of bacteriology 187: 7931—

7944.

0. Gottwald, T. R. (2010). Current epidemiological understanding of citrus Haunglongbing.

Ann. Rev. Phytopathol. 48, 119-139.

1. Guerout-Fleury a M, Frandsen N, Stragier P (1996) Plasmids for ectopic integration in Bacillus subtilis. Gene 180: 57-61.

2. Gulten G, Sacchettini JC (2013) Structure of the Mtb CarD/RNAP β-lobes complex reveals the molecular basis of interaction and presents a distinct DNA binding domain for Mtb CarD. Structure (London, England : 1993) 21 : 1859-1869.

3. Halbert, S. E., and Manjunath, K. L. (2004) Asian citrus psyllids (Stemorrhyncha: Psyllidae) and greening disease of citrus: A literature review and assessment of risk in Florida. Fla.

Entomol. 87, 330-353.

4. Hammes W, Schleifer KH, Kandler O (1973) Mode of action of glycine on the biosynthesis of peptidoglycan. Journal of bacteriology 1 16: 1029-1053. Hartung JS, Paul C, Achor D, Brlansky RH (2010) Colonization of dodder, Cuscuta indecora, by "Candidatus Liberibacter asiaticus" and "Ca. L. americanus". Phytopathology 100: 756- 762.

Hilf ME, Sims KR, Folimonova SY, Achor DS (2013) Visualization of "Candidatus Liberibacter asiaticus" cells in the vascular bundle of citrus seed coats with fluorescence in situ hybridization and transmission electron microscopy. Phytopathology 103: 545-554. Hoffman MT, Doud MS, Williams L, Zhang M-Q, Ding F, et al. (2013) Heat treatment eliminates "Candidatus Liberibacter asiaticus" from infected citrus trees under controlled conditions. Phytopathology 103: 15-22.

Jun, L. and Xing-Vao. J. (2005). Ecological control of forest pest: a new strategy for forest pest control. J. Forestry Res. 16, 339-342.

Kaur G, Dutta D, Thakur KG (2014) Crystal structure of Mycobacterium tuberculosis CarD, an essential RNA polymerase binding protein, reveals a quasidomain-swapped dimeric structural architecture. Proteins 82: 879-884.

Kovach ME, Elzer PH, Hill DS, Robertson GT, Farris M a, et al. (1995) Four new derivatives of the broad-host-range cloning vector pBBRlMCS, carrying different antibiotic-resistance cassettes. Gene 166: 175-176.

Lam H, Oh D, Cava F, Takacs CN, Clardy J, et al. (2010) NIH Public Access. 325: 1552- 1555. doi : 10.1126/science.1 178123.D-amino.

Lavollay M, Arthur M, Fourgeaud M, Dubost L, Marie A, et al. (2008) The peptidoglycan of stationary-phase Mycobacterium tuberculosis predominantly contains cross-links generated by L,D-transpeptidation. Journal of bacteriology 190: 4360^1366.

Leonard MT, Fagen JR, Davis-Richardson AG, Davis MJ, Triplett EW (2012) Complete genome sequence of Liberibacter crescens BT-1. Standards in genomic sciences 7: 271-283. Li W, Hartung JS, Levy L (2006) Quantitative real-time PCR for detection and identification of Candidatus Liberibacter species associated with citrus huanglongbing. Journal of microbiological methods 66: 104-1 15.

Lorca GL, Ezersky A, Lunin V V, Walker JR, Altamentova S, et al. (2007) Glyoxylate and pyruvate are antagonistic effectors of the Escherichia coli IclR transcriptional regulator. The Journal of biological chemistry 282: 16476-16491.

Miller JH (1972) Experiments in Molecular Genetics. Cold Springs Harbor, N.Y.: Cold Spring Harbor Laboratory Press.

Moorby J (1981) Transport Systems in Plants. London; New York: Longman. Niesen FH, Berglund H, Vedadi M (2007) The use of differential scanning fluorimetry to detect ligand interactions that promote protein stability. Nature protocols 2: 2212-2221. Oke V, Long SR (1999) Bacterial genes induced within the nodule during the Rhizobium- legume symbiosis. Molecular microbiology 32: 837-849.

Pagliai F a, Gardner CL, Pande SG, Lorca GL (2010) LVIS553 transcriptional regulator specifically recognizes novobiocin as an effector molecule. The Journal of biological chemistry 285: 16921-16930.

Pelz-Stelinski KS, Brlansky RH, Ebert T a., Rogers ME (2010) Transmission Parameters for Candidatus Liberibacter asiaticus by Asian Citrus Psyllid (Hemiptera: Psyllidae). Journal of Economic Entomology 103: 1531-1541.

Petit-Glatron MF, Chambert R (1992) Peptide carrier potentiality of Bacillus subtilis levansucrase. Journal of general microbiology 138: 1089-1095.

Sambrook (2008) Molecular Cloning.

Sechler, A., Schuenzel, E. L., Cooke, P., Donnua, S., Thaveechai, N., Postnikova, E., Stone, A. L, Schneider, W. L., Damsteegt, V. D. and Schaad, N. W. (2009). Cultivation of 'Candidatus Liberibacter asiaticus', 'Ca. L. africanus', and 'Ca. L. americanus' associated with Huanglongbing. Phytopathology 99, 480-486.

Skinner FA (1977) An Evaluation of the Nile Blue Test for Differentiating Rhizobia from Agrobacteria. Journal of Applied Bacteriology 43 : 91-98.

Srivastava DB, Leon K, Osmundson J, Garner AL, Weiss LA, et al. (2013) Structure and function of CarD, an essential mycobacterial transcription factor. Proceedings of the National Academy of Sciences of the United States of America 1 10: 12619-12624.

Stallings CL, Glickman MS (2011) CarD: a new RNA polymerase modulator in mycobacteria. Transcription 2: 15-18.

Stallings CL, Stephanou NC, Chu L, Hochschild A, Nickels BE, et al. (2009) CarD is an essential regulator of rRNA transcription required for Mycobacterium tuberculosis persistence. Cell 138: 146-159.

Vanderlinde EM, Yost CK (2012) Mutation of the sensor kinase chvG in Rhizobium leguminosarum negatively impacts cellular metabolism, outer membrane stability, and symbiosis. Journal of bacteriology 194: 768-777.

Vedadi M, Niesen FH, Allali-Hassani A, Fedorov OY, Finerty PJ, et al. (2006) Chemical screening methods to identify ligands that promote protein stability, protein crystallization, and structure determination. Proceedings of the National Academy of Sciences of the United States of America 103: 15835-15840. Weiss L a, Harrison PG, Nickels BE, Glickman MS, Campbell E a, et al. (2012). Interaction of CarD with RNA polymerase mediates Mycobacterium tuberculosis viability, rifampin resistance, and pathogenesis. Journal of bacteriology 194:5621-5631.

Wrench AP, Gardner CL, Gonzalez CF, Lorca GL (2013) Identification of a small molecule that modifies MglA/SspA interaction and impairs intramacrophage survival of Francisella tularensis. PloS one 8: e54498.

Yan Q, Sreedharan A, Wei S, Wang J, Pelz-Stelinski K, et al. (2013) Global gene expression changes in Candidates Liberibacter asiaticus during the transmission in distinct hosts between plant and insect. Molecular plant pathology 14: 391-404.

Zhang M, Powell C a, Zhou L, He Z, Stover E, et al. (201 1) Chemical compounds effective against the citrus Huanglongbing bacterium "Candidates Liberibacter asiaticus" in planta. Phytopathology 101 : 1097-1 103.

Zhu D, Wang Y, Zhang M, Ikeda H, Deng Z, et al. (2013) Product-mediated regulation of pentalenolactone biosynthesis in Streptomyces species by the MarR/SlyA family activators PenR and PntR. Journal of bacteriology 195: 1255-1266.

Zianni M, Tessanne K, Merighi M, Laguna R, Tabita FR (2006) Ab r f. 17: 103-113.

Claims

CLAIMS We claim:

1. A method of treating or preventing a plant disease, wherein said method comprises administering a compound to the plant, wherein the compound is a CarD inhibiting compound or an LdtR inhibiting compound.

2. The method, according to claim 1, wherein said method comprises first determining that the plant has the plant disease and then administering the compound.

3. The method, according to claim 1, wherein the compound is selected from the group consisting of: N-phenylaniline (diphenylamine), 2-(3-chloro-2-methylanilino)benzoic acid (tolfenamic acid), (3,5-dibromo-4-hydroxyphenyl)-(2-ethyl-l -benzofuran-3-yl)methanone (benzbromarone), 4-[4- (4-hydroxyphenyl)hexan-3-yl]phenoi (hexestrol), 4-[(3-carboxy-2-hydroxynaphthalen-l -yl)methyl]-3- hydroxynaphthalene-2-carboxylic acid;3-[(E)-2-(l-methyl-5,6-dihydro-4H-pyrimidin-2- yl)ethenyl]phenol (oxantel pamoate), 4-[(E)-4-(4-hydroxyphenyl)hex-3-en-3-yl]phenol (diethylstilbestrol), 3-(4-hydroxyphenyl)-l-(2,4,6-trihydroxyphenyl)propan-l-one (phloretin), 5-[(E)- 2-(4-hydroxyphenyl)ethenyl]benzene-l,3-diol (resveratrol), and a derivative thereof.

4. The method, according to claim 1, wherein the compound is tolfenamic acid.

5. The method, according to claim 1 , wherein the compound is administered by a method selected from the group consisting of spraying, injection of the compound into plant vasculature, and application to a root system.

6. The method, according to claim 1, wherein the method further comprises administration to the plant a bactericide, fungicide, insecticide, acaricide, rodenticide, nematocide, fertilizer, growth- regulating agent or a combination thereof.

7. The method, according to claim 1, wherein the plant is a citrus plant.

8. The method, according to claim 1, wherein the plant disease is caused by Candidatus liberibacter asiaticus.

9. An agricultural composition, formulated for administration to a plant, wherein said composition comprises an effective amount of an anti-bacterial compound selected from the group consisting of diphenylamine, tolfenamic acid, benzbromarone, hexestrol, oxantel pamoate, diethylstilbestrol, phloretin, resveratrol, and a derivative thereof.

10. The agricultural composition, according to claim 9, wherein said antibacterial compound is tolfenamic acid.

1 1. The agricultural composition, according to claim 9, further comprising a bactericide, fungicide, insecticide, acaricide, rodenticide, nematocide, fertilizer, growth-regulating agent, or a combination thereof.

12. The agricultura composition according to claim 10, further comprising a bactericide, fungicide, insecticide, acaricide, rodenticide, nematocide, fertilizer, growth-regulating agent, or a combination thereof.

13. A method of treating or preventing a plant disease, wherein said method comprises administering a compound to the plant, wherein the compound comprises:

two aryl rings connected to each other via a linker,

wherein the linker is selected from the group consisting of S, N, O, P, saturated or unsaturated carbon chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms, and a saturated or unsaturated chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms and one or more heteroatoms selected from S, N, O, and P;

wherein either or both of the two aryl rings are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety is further optionally substituted; and

wherein the one or more carbon atoms and/or the one or more heteroatoms in the linker are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, keto, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)- NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety is further optionally substituted.

14. The method, according to claim 13, wherein each of the two aryl rings is independently selected from the group consisting of benzene, naphthalene, anthracene, phenanthrene, tetracene, chrysene, triphenylene, pyrene, pentacene, benzo[a]pyrene, corannulene, benzo[ghi]perylene, coronene, and ovalene.

15. A method of treating or preventing a plant disease, wherein said method comprises administering a compound to the plant, wherein the compound comprises:

an aryl ring and a heteroaryl ring connected to each other via a linker, wherein the linker is selected from the group consisting of S, N, O, P, saturated or unsaturated carbon chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms, and saturated or unsaturated chain comprising 1 to 10 carbon atoms, 2 to 8 carbon atoms, 2 to 6 carbon atoms, or 2 to 4 carbon atoms and one or more heteroatoms selected from S, N, O, or P;

wherein the aryl ring and/or the heteroaryl ring is optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety is further optionally substituted,

and wherein the one or more carbon atoms and/or the one or more heteroatoms in the linker are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, keto, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)- NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety is further optionally substituted.

16. The method, according to claim 15, wherein the aryl ring is selected from the group consisting of benzene, naphthalene, anthracene, phenanthrene, tetracene, chrysene, triphenylene, pyrene, pentacene, benzo [a] pyrene, corannulene, benzo[ghi]perylene, coronene, and ovalene, and the heteroaryl ring is selected from the group consisting of pyrazole, imidazole, isoxazole, oxazole, isothiazole, thiazole, benezimidazole, benzotriazole, pyrrole, triazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, triazine, furan, thiophene, quinoline, indole, benzofuran, benzothiphene.

17. A method of treating or preventing a plant disease, wherein said method comprises administering a compound to the plant, wherein the compound comprises:

two heteroaryl rings connected to each other via a linker,

wherein either or both of the two heteroaryl rings are optionally substituted at one or more positions by a moiety selected from halo, hydroxyl, amino, amide, -SH, cyano, nitro, thioalkyl, carboxylic acid, -NH-C(=NH)-NH₂, alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, and heterocycloalkyl, in which the alkyl, alkenyl, alkynyl, alkoxyl, aryl, heteroaryl, cycloalkyl, thioalkyl or heterocycloalkyl moiety is further optionally substituted; and

18. The method, according to claim 17, wherein each of the two heteroaryl rings is independently selected from the group consisting of pyrazole, imidazole, isoxazole, oxazole, isothiazole, thiazole, benezimidazole, benzotriazole, pyrrole, triazole, tetrazole, pyridine, pyridazine, pyrimidine, pyrazine, purine, pteridine, triazine, furan, thiophene, quinoline, indole, benzofuran, benzothiphene.

19. The method, according to any of the claims 13-18, wherein said method comprises first determining that the plant has a plant disease and then administering the compound.

20. The method, according to any of the claims 13-18, wherein the compound is administered by a method selected from the group consisting of spraying, injection of the compound into plant vasculature, and application to a root system.

21. The method, according to any of the claims 13-1 8, wherein the method further comprises administration to the plant of a bactericide, fungicide, insecticide, acaricide, rodenticide, nematocide, fertilizer, growth-regulating agent, or a combination thereof.

22. The method, according to claim 13, wherein the plant is a citrus plant.

23. The method, according to claim 13, wherein the plant disease is caused by Candidates liber ibacter asiaticus.

24. An agricultural composition, formulated for administration to a plant, wherein said composition comprises an effective anti-bacterial amount of a compound of any of claims 13-18.

25. The agricultural composition, according to claim 24, further comprising a bactericide, fungicide, insecticide, acaricide, rodenticide, nematocide, fertilizer, growth-regulating agent, or a combination thereof.