WO2016063253A1

WO2016063253A1 - A method and a kit to predict prognosis in patients with relapsing remitting multiple sclerosis and poor prognosis: a decision making tool for prescription of treatment

Info

Publication number: WO2016063253A1
Application number: PCT/IB2015/058172
Authority: WO
Inventors: Evelyn PARDO; Reinaldo URIBE; Ethel CIAMPI; Cristobal CURKOVICH; Alfonso González; Claudia CÁRCAMO; Andrea SOZA
Original assignee: Pontificia Universidad Católica De Chile
Priority date: 2014-10-23
Filing date: 2015-10-23
Publication date: 2016-04-28
Also published as: EP3210019A1; CA2965593A1

Abstract

A method to provide prognosis of RRMS is disclosed. In presence of Gal-8 autoantibodies in the patient's blood sample a poor prognosis is given. The disclosure also provides a tool for healthcare professionals to make decision of starting aggressive treatment of RRMS.

Description

A method and a kit to predict prognosis in patients with relapsing remitting multiple sclerosis and poor prognosis: A decision making tool for prescription of treatment.

Claim of Priority

This application claims priority of US provisional application number 62/067554 filed on October 23, 2014, the contents of which is fully incorporated herein by reference. Field of the Invention

This invention is related to diagnosing and monitoring multiple sclerosis. Background of the invention

Multiple Sclerosis (MS) is the most common inflammatory-demyelinating disease of the central nervous system (CNS) and it is one of the principal causes of neurological disability among young adults. A combination of etiological factors has been involved in the development of the disease, and several pathophysiological processes contribute to the heterogeneity of the clinical manifestations and response to treatment.

In about 85% of the patients, MS initially follows a relapsing-remitting course (RRMS) in which acute attack are followed by a complete recovery. There is no known cure for multiple sclerosis. Between attacks the symptoms may disappear, but permanent neurological problems often occur, especially when the disease advances. Eventually about 65% of the RRMS patients go on to develop secondary progressive MS (SPMS), characterized by progressive and irreversible accumulation of neurological disability. Treatments attempt to return function after the attacks, prevent new attacks and prevent permanent disability.

The prognosis of the disease is difficult to give, because it depends on the subtype of the disease, the initial symptoms, the individual's disease characteristics, and the stage where the disease has advance to. One of the biggest problems in the clinical management of MS patients is the lack of biomarkers that predict the clinical course and probability to develop disability. Biomarkers are actively sought for the early diagnosis and the identification of individuals at risk of developing MS, the prediction of disease course, the monitoring of disease progression, selection of specific treatments and for monitoring response to therapy. Several biomarkers have been identified, but there is a need for new biomarkers, and new methodologies to diagnose and provide reliable prognosis of the disease.

Katsavos and Anagnostouli 2013 provide a review of biomarkers in Multiple Sclerosis (Multiple Sclerosis International, Vol. 2013, Article ID 340508). US20120071339 discloses a number of biomarkers that are related to MS-disease.

Such biomarkers include GRO alpha, HB EGF, Tetanus Toxoid, Lipoprotein and Adiponectin. The publication also discloses methods for diagnosing and monitoring multiple sclerosis by detecting one or more of the disclosed biomarkers.

Quintana et al. 2012 (J. Neuroimmunol. 248: 53-57) provide lipids and lipid-reactive antibodies as biomarkers for multiple sclerosis

Galectins are beta-galactoside -binding animal lectins with conserved carbohydrate recognition domains. Galectins are characterized by their ability to recognize N- acetyllactosamine sequences, which can be displayed on both N- and O-glycans on cell surface glycoconjugates. These proteins have been increasingly studied as regulators of the immune response and as potential therapeutic agents for autoimmune disorders. They have been implicated in many essential functions including development, differentiation, cell- cell adhesion, cell-matrix interaction, growth regulation, apoptosis, and RNA splicing.

Galectin-8 (Gal 8) is a protein the galectin family that in humans is encoded by the LGALS8 gene. It is one of the most widely expressed galectins in human tissues. Depending on the cell context and mode of presentation, either as soluble stimulus or extracellular matrix, Gal8 has been involved in cell adhesion, spreading, growth, and apoptosis. There is some evidence suggesting that Gal8 could play an important role in T cell homeostasis and rheumatic autoimmune or inflammatory disorders. A role in shaping the T cell repertoire has been suggested for Gal8 by its intrathymic expression and pro-apoptotic effect upon CD4^highCD8^high thymocytes. Recently a proliferative effect of murine Gal8 upon CD4(+)T isolated from mice spleens has been reported. Gal8 has also recently been reported to induce apoptosis on Jurkat T cells and on activated peripheral blood mononuclear cells (PBMC).

Autoantibodies against galectins have been described in many autoimmune diseases, although their pathogenic role still remains poorly studied.

It has been reported recently that systemic lupus erythamatosus (SLE) patients produce autoantibodies against Gal 8 with a higher frequency than healthy individuals and this associates with lymphopenia. (Pardo et al 2006. Rev Med Chil 2006;134, 159-166;19; Massardo et al. 2009. Lupus 2009; 18, 539-546.)

Brief description of the Drawings

Figure 1 illustrates the initial and the final EDSS-scores in patients with RRMS with and without anti-Gal8. At the end of follow-up, EDSS scores were higher in the group with antiGal8 (17 patients, mean EDSS 1.5) compared to those without antibodies (19 patients, mean EDSS 0), * indicates p = 0.02 by nonparametric Mann-Whitney test. Figure 2 shows an example of immunocomplex detection. 0.1, 0.25, 0.5 and 1 μg of recombinant human galectin-8 was separated by preparative SDS-PAGE 10% and then incubated with selected serum from Multiple Sclerosis patients (two positive and one negative). The antigen was detected by Western blot using alkaline phosphatase. The figure depicts a representative result of three independent experiments.

Figure 3 shows a schematic representation of human Gal -8S (SEQ ID NO: 4a) and Gal-8L (SEQ ID NO: 4b) . The N-terminal end in both of the proteins include amino acids 1-155. The linker sequence in Gal-8S consists of sequenced 156-183 and in the Gal 8L protein the linker consists of sequences 156 to 225. The C-terminal end of the Gal 8S consists of sequences 184-317 and the C-terminal end of the Gal 8L consists of sequences 225-359.

Summary of the invention

A decision making tool for prescription of treatment to a patient previouslydiagnosed with relapsing and recurring multiple sclerosis (RRMS) is provided. Said tool comprises: a) a kit for detecting presence or absence of anti-Gal8 autoantibodies in sera sample of the patient, said kit comprising: i. a platform where full or part of recombinant Gal-8 protein has been immobilized; ii. positive control containing antiGal-8 autoantibodies and a negative control not containing antiGal 8 autoantibodies ;iii. instructions to measure presence or absence of antiGal -8 autoantibodies in a sera sample of the patient, where positive reaction with recombinant Gal-8 indicates presence of anti-gal8 autoantibodies; and b) Instructions to make a decision for starting aggressive treatment when the kit indicates presence of anti-gal8 autoantibodies.

In one aspect of the invention, the immobilized protein on the platform has a sequence of SEQ ID NO:4b.

In one aspect of the invention, the immobilized protein comprises SEQ ID NO:5 in its C terminal domain and SEQ ID NO:6 in its N terminal domain. One aspect of the invention is a to provide a prognosis of relapsing remitting multiple sclerosis, said method comprising the steps of: a) obtaining a sample; b) allowing a recombinant protein having an amino acid sequence SEQ ID NO :4b react with the sample, where presence of the autoantibody Gal-8 in the sample creates an

immunocomplex of recombinant protein and autoantibody;c) detecting the

immunocomplex; and d) providing a progonisis of an aggressive form of the disease in the presence of the immuncomplex.

In one aspect of the invention the immunocomplex comprises residues SEQ ID NO:5 and SEQ ID NO:6.

One aspect of the invention is a method to decide for aggressive treatment of relapsing remitting multiple sclerosis, said method comprising the steps of: a) obtaining a sample; b) allowing a recombinant protein having an amino acid sequence SEQ ID NO:3 react with the sample, where presence of the autoantibody Gal-8 in the sample creates an immunocomplex of recombinant protein and autoantibody; c) detecting the

immunocomplex; and d) deciding for aggressive treatment disease in the presence of the immuncomplex.

One aspect of the invention is a method to decide prescribing aggressive treatment to a patient where the method comprises the steps of: a) diagnosing relapsing remitting multiple sclerosis disease in an individual by detecting autoantibodies of Gall in the sera of the patient; b) detecting autoantibodies of Gal 8 in the sera of the patient detected having autoantibodies of Gal 1 in the sera in step a); and c) prescribing aggressive treatment to a patient having autoantibodies of Gal 8 in step b.

One aspect of the invention is to provide a method to decide prescribing aggressive treatment to a patient where the method comprises the steps of: a) providing a panel to simultaneously detect auto antibodies Gal 1 and Gal 8 in a blood sample of the individual, and b) making a decision of prescribing aggressive treatment when both Gal 1 and Gal8 autoantibodies were detected in the sample. One aspect of the invention is a kit for providing prognosis of remitting relapsing

MS disease in a patient , wherein the kit comprises: a) a platform where full or a part of recombinant Gal-8 protein has been immobilized; b) positive control containing antiGal-8 autoantibodies and a negative control not containing antiGal 8 autoantibodies; and c) instructions of providing a poor prognosis in presence of formation of an immuncomplex between the patient's sample and the Gal-8 protein on the platform.

One aspect of the invention is a method for treating relapsing remitting multiple sclerosis disease in a patient, said method comprising the steps of: a) determining presence or absence of anti-Gal 8 antibodies in serum of a patient that has previously been diagnosed with RRMS; b) in the presence of the antibodies starting an aggressive treatment with medication reducing remitting attacks wherein said medication includes selection of one or more of pharmaceuticals selected from the group consisting of natalizumab IV injections, interferon IM injections, oral dimetilfumarate, oral teriflunomide, alemtuzumab IV injections, glatiramer acetate injections, oral fingolimode, and subcutaneous injection of interferon.

One aspect of the invention is an in vitro method for providing a prognosis of relapsing remitting multiple sclerosis in a human subject, wherein the subject is known to have RRMS, said method comprising the steps of: a) Obtaining a blood sample of the patient; and b) determining from a blood sample a presence or an absence of anti-gal-8 autoantibody, wherein presence of said antibody is indicative of poor prognosis in RRMS.

One aspect of the invention is an artificial set of primers according to SEQ ID NO:2 and SEQ ID NO :3.

One aspect of the invention is a method to provide a prognosis for a patient previously diagnosed with RRMS, said method comprising the steps of: a) providing recombinant

GAL-8 according to SEQ ID NO :4b or a synthetic protein comprising in its N-terminal domain SEQ ID NO:5 and in its C-terminal domain SEQ ID NO: 6; b)providing a sample of patient's sera; c) allowing the recombinant GAL-8 or segments of it encompassing SEQ

ID NO:5 in N-terminal domain and SEQ ID NO:6 in C-terminal domain to react with the sera on nitrocellulose membrane; c) visualizing immune complexes on the membrane by a colorimetric reaction; d) measuring intensity of the complexes and comparing the intensity with intensity measured from a negative and a positive control; and e) providing a poor prognosis when the measured intensity is about twice the intensity of the negative control.

It is an object of this invention to provide a method for giving a prognosis of the course of RRMS in a patient that has previously been diagnosed with the disease.

It is another object this invention to provide a kit for the prognosis of the course of the disease.

A further object of this invention to provide a kit for enabling a health care specialist to make a decision to start aggressive treatment of RRMS.

Yet another object of this invention is to provide a method to treat a patient with RRMS by first analyzing presence or absence of antiGal8 antibody in the sera of the patient and in the presence of the antibody treating the patient with one or more pharmaceutical compounds selected from the group of the DMD-drugs used for treatment of the disease included the following products of Biogen: Tysabri® (natalizumab IV injections),

Avonex® ( interferon EVI injections); and Tecfira® (BG-12, dimetilfumarate, oral); the following products of SANOFI: Aubagio® (teriflunomide, oral), and Lemtrada®

(alemtuzumab IV injections); Copaxone® (glatiramer acetate ) of TEVA; Gilenya®

(fingolimode, oral) of NOVARTIS. Rebif® (subcutaneous injection of interferon) of

MERCK-SERONO and Betaferon® (subcutaneous injection of interferon) of B AYER-

SCHERING.

It is yet another object of this invention to provide a kit and a method to diagnose MS disease and simultaneously provide a prognosis of the disease and to make a decision of treatment. The kit and the method of this embodiment comprises making a diagnose based on presence of anti-Gal 1 antibodies in the sera of a patient, where a diagnosis of MS is given when the antibodies are present and where a poor prognosis is given when antibodies of Gal 8 are also present in the sera and where patients having both Gal 1 and Gal 8 antibodies are subjected to an aggressive treatment of RRMS. Detailed description of the invention

Definitions

MS - multiple sclerosis is a chronic, often disabling disease that attacks the central nervous system (CNS). Symptoms may be mild, such as numbness in the limbs, or severe, such as paralysis or loss of vision. The progress, severity, and specific symptoms of MS are unpredictable and var from one person to another.

RRMS -relapsing and remitting multiple sclerosis. People with this type of MS experience clearly defined attacks of worsening neurologic function. These attacks— which are called relapses, flare-ups, or exacerbations- are followed by partial or complete recovery periods (remissions), during which no disease progression occurs. Approximately 85% of people are initially diagnosed with relapsing-remittmg MS.

SPMS -secondary progressive multiple sclerosis. Most patients with RRMS will eventually develop SPMS. On average around 65% of people with RRMS will develop SPMS within 15 years after being diagnosed. SPMS is characterized by a worsening disability, rather than relapses followed by recovery.

PPMS- primary progressive multiple sclerosis is a course of multiple sclerosis characterized by progression of disability from onset of the condition without plateaus or recovery periods (remissions).

EDSS- Expanded Disability Status Scale. The EDSS provides a total score on a scale that ranges from 0 to 10. The first levels 1.0 to 4.5 refer to people with a high degree of ambulatory ability and the subsequent levels 5.0 to 9.5 refer to the loss of ambulatory ability. The range of main categories include (0) = normal neurologic exam; to (5) = ambulatory without aid or rest for 200 meters; disability severe enough to impair full daily activities; to (10) = death due to MS.

When initially diagnosing MS, the healthcare providers are looking at a combination of factors and tests. Such factors and tests may include changes in strength and reflexes, response to touch, sound and other senses, number of flare-ups, or attacks, and number and type of lesions that may be seen in MRI.

Once the disease has been diagnosed the next step would be to give a prognosis, but this is even more difficult than the diagnosis. However, the prognosis is utterly important, because choosing correct treatment depends on the prognosis. The disease may develop in various ways and therefore a appropriate prognosis of the course of the development of the disease would help in making decisions on the medication. Therefore there is an increasing interest and need for finding novel biomarkers not only to diagnose but also to provide an accurate prognosis the course of an MS disease. A reliable prognosis would be a basis for deciding appropriate medication, dose of medication, and how early and how aggressively the disease should be treated. In the even the patient has developed a secondary progressive form of MS (SPMS) the treatment is usually aggressive and includes medication that may have unpleasant and serious side effects. The medication may include injections of beta interferon, infusion drugs such as Tysabri®. Common side effects include joint pain, fever, tiredness, runny nose, sore throat, headache, dizziness. More serious side effects include serious allergic reaction and skin reaction. In any case, a decision to prescribe aggressive treatment should not be done without certainty of poor prognosis of the disease and on the other hand the aggressive treatment should not be postponed if the poor prognosis is known. However, the current problem is that there is no method or tool to provide the prognosis and therefore no tools helping doctors in the decision making.

Increasing evidence indicates that B cells and antibodies have an important role in MS progression. Some antibodies of clinical interest of indisputable value in MS are

Oligoclonal Bands (OCB). Positive OCB IgG in the cerebrospinal (CSF) of patients with a first demyelinating syndrome has diagnostic and prognostic value. Furthermore, OCB IgM in the CSF is considered to be a bad prognostic biomarker, when correlated with disability progression. Some serum antibodies have been studied as biomarkers, such as antibodies against Myelin Basic Protein (anti MBP) and antibodies against Myelin Oligodendrocyte

Protein (anti MOG). However, their prognostic values are highly controversial, partly because of their methodological diversity.

Autoantibodies against galectins are associated with antiphospholipid syndrome patients with SLE and autoantibodies against Galectin 2 have been proposed as a novel biomarker for the antiphospholipid syndrome. Galectin 1 has been suggested for a biomarker in MS disease, however, this biomarker does not distinguish between RRMS and progressive disease or give any indication of the prognosis of the disease.

From a biological standpoint, antiGal8 are autoantibodies that block Gal8. Gal 18 has been described to have anti-inflammatory features. Therefore, if a patient has autoantibodies in his/her sera, this anti-inflammatory property would be inhibited and conditions that may perpetuate inflammation may be promoted, eventually leading to neuronal death.

Galectin family has been identified to include 15 members in vertebrates. On the basis of their molecular architecture, galectins have been classified into three main types: a) proto-type galectins comprising a single polypeptide chain that is able to dimerize; b) tandem-repeat -type galectins composes of a single polypeptide chain representing two galectin carbohydrate recognitions domains (CRD) connected by a linker peptide, and c) chimera -type galectins consisting of one C-terminal CRD linked to an N-terminal peptide. Galectins 1 , 2, 5, 7, 10, 11, 13, 14 and 15 belong to prototype galectins. Galectins 4, 6, 8, 9, and 12 belong to tandem repeat type and finally galectin 3 belongs to the chimera type of galectins.

Galectin8 (Gal8) exhibits two CRDs joined by a short peptide, with a folding completely different from that reported for other galectins. Figure 3 shows a representation of a short and a long version of Gal 8. Galectin 8 is one of the most widely expressed galectins in human tissues. Depending on the cell context and mode of presentation, either as soluble stimulus or extracellular matrix, Gal8 has been involved in cell adhesion, spreading, growth, and apoptosis. There is some evidence suggesting that Gal8 could play an important role in T cell homeostasis and rheumatic autoimmune or inflammatory disorders. A role in shaping the T cell repertoire has been suggested for Gal8 by its intrathymic expression and pro- apoptotic effect upon CD4^hlghCD8^hlgh thymocytes. Recently a proliferative effect of murine

Gal8 upon CD4(+)T isolated from mice spleens has been reported. Gal8 has been found to induce apoptosis on Jurkat T cells and on activated peripheral blood mononuclear cells

(PBMC).

Gal-8 gene has 11 exons, multiple stop codons and polyadenylation signals. Up to now 14 differentGal-8 transcripts have been identified due to alternative splicing and due to the presence ofmultiple stop codons (Bidon et al., 2001a; Bidon et al., 2001b; Bidon- Wagner and Le Pennec,2004). In theory these transcripts encode 6 different isoforms. 3 of the isoforms have 2 CRDs that are linked by a linker peptide. The linker peptide of these 3 isoforms differs in length giving rise to short, medium and long iso forms. Figure 3 shows the representation of short and long isoforms. The linker peptide in the short form cosists of aa sequences 156-183. The long iso form linker peptide consists of sequnes 156 to 225. Autoantibodies against galectins have been described in many autoimmune diseases, although their pathogenic role still remains poorly studied. Galectins and their autoantibodies could be important modulators of normal or altered immune response, suppressing chronic inflammation and autoimmunity. In this disclosure we describe the presence of antiGal8 in the sera of MS patients. We found that 47% of patients with RRMS and 9% of patients with progressive forms have antiGal8. Remarkably, RRMS patients with antiGal8 develop higher levels of disability than RRMS patients without these auto-antibodies. These results suggest that the presence of antiGal8 could be used as a biomarker for predicting poor prognosis in RRMS and making a decision of starting an aggressive medication in early stages of the disease.

This disclosure shows that the presence of antiGal8 in patients with RRMS predicts worse EDSS, suggesting that patients with RRMS and antiGal8 may have worse disability outcomes, regardless of the duration of the disease or number of relapses. Recognizing these "high risk" patients early on would allow us to start treatment with more aggressive DMD from the beginning, preventing the development of disability.

Use of serum antiGal8 in newly diagnosed MS patients is suggested as a promising biomarker for Relapsing Remitting clinical course and a predictor of worse disability. It will be necessary to study the presence of antiGal8 in Clinically Isolated Syndrome (CIS) patients in order to predict their evolution and halt disability progression in earlier stages of the disease. Currently, there are no clinical tools that predict the disease course in each individual patient; therefore, having a serum biomarker that allows us to identify patients with a high risk for disability, such as antiGal8, could help us to initiate more aggressive treatment early in the course of the disease, thus preventing disability. The invention is now described by means of non-limiting examples. Example 1 : Cloning and expression of recombinant Gal8 in Escherichia coli

The coding sequence of Gal8L (LGALS8 3964) was amplified by PCR from a human brain cDNA library (Lambda Triples Library) using the following primers: sense primer 5'- ACGCGTCGACATGTTGTCCTTAAACAAC-3' (SEQ ID NO:2) and antisense primer 5'-

ATAGTTTAGCGGCCGCCTACCAGCTCCTTACTTC-3' (SEQ ID NO:3). The amplified

DNA was inserted in frame into the Sall-NotI sites of pGEX-4T-3 expression plasmid

(Pharmacia Biotech) that provides the sequence of glutathione S-transferase (GST) in the 5' end. Expression of recombinant GST-Gal8 was induced with 0.2 mM isopropyl-l-thio-h-d- galactopyranoside (Invitrogen) for four hours. GST-Gal8 protein was purified by affinity chromatography on glutathione-Sepharose as described by the manufacturer. Gal8L (SEQ

ID NO:4) was released from GST-Gal8 linked to glutathione-Sepharose by thrombin treatment (10 U/mg of fusion protein) for four hours at room temperature.

Example 2: Patient selection

The study included 58 patients with MS, monitored in the Multiple Sclerosis Center of Pontificia Universidad Catolica of Chile, between 2011 and 2013. All patients accepted and signed an informed consent approved by the Hospital Ethics Committee.

Patients were monitored during standard clinical visits, by collecting demographic data, clinical history, neurologic assessments, Expanded Disability Status Scale (EDSS), and

Magnetic Resonance Imaging (MRI) using 1.5 Tesla MRI with 5 mm thick slices and 2.5 mm separation between each slice.

Blood samples from RRMS patients were obtained before the treatment started. Blood samples from patients with progressive forms were obtained from patients not receiving treatment (disease modifying drugs DMD-drugs) at least 6 months prior the sampling.

Patients were followed up for an average of one year, controlled every 3 to 6 months, or more frequently (e.g. during relapses), as needed. We registered the number of relapses, EDSS, and the use of DMD-drugs. The DMD-drugs used for treatment of the disease included the following products of Biogen: Tysabri® (natalizumab Γν injections), Avonex® ( interferon EVI injections); and Tecfira® (BG-12, dimetilfumarate, oral); the following products of SANOFI: Aubagio® (teriflunomide, oral), and Lemtrada®

(alemtuzumab IV injections); Copaxone® (glatiramer acetate ) of TEVA; Gilenya® (fingolimode, oral) of NOVARTIS. Rebif® (subcutaneous injection of interferon) of MERCK-SERONO or Betaferon® (subcutaneous injection of interferon) of BAYER- SCHERING. All these DMD-drugs are approved by the FDA and EMA with the exception of Lemtrada that is currently in evaluation of FDA but is approved by EMA.

Example 3: Detection of antiGal-8 autoantibodies

Western blot analysis was performed using recombinant Gal-8 to screen sera of patients as described^{18 19}: 0.5 Kg of Gal-8 was resolved in 10% SDS-PAGE and transferred to nitrocellulose membranes. These membranes were incubated with patients sera diluted 1 :250 overnight at 4°C. Then the membranes were washed three times and incubated with alkaline phosphatase for 1 h at room temperature. The immune complexes were visualized by a colometric reaction. A positive and a negative control were used for each western blot analysis. The intensity of each band was densitometrically measured and sera were considered positive when the band intensity was double that of the negative control. This analysis was performed in triplicates and sera were considered positive when the sera of at least two independent experiments were positive.

Figure 2 shows an example of immunocomplex detection. 0.1, 0.25, 0.5 and 1 μg of recombinant human galectin-8 was separated by preparative SDS-PAGE 10% and then incubated with selected serum from Multiple Sclerosis patients (two positive and one negative). The antigen was detected by Western blot using alkaline phosphatase. The figure depicts a representative result of three independent experiments.

Example 4: Anti Galectin-8 antibodies were detected in RRMS with higher frequency than in progressive subtypes.

The presence of antiGal8 was analyzed in sera of 58 MS patients. 36 of the patients had RRMS and 22 had progressive forms (8 SPMS and 14 PPMS). We detected antiGal8 in the sera of 47% of RRMS patients (17/36) versus 9% of the patients with progressive forms

(both PPMS patients) (2/22) (p=0.004; Table I), which doesn't differ from the findings in healthy controls (7% positive antiGal8)¹⁸. Therefore, these results suggest that antiGal8 are particularly associated with RRMS and not with the progressive forms. Example 5: Presence of anti Galectin 8 antibodies correlate with worse disability scores in RRMS patients.

Since we found a statistically significant difference in the presence of antiGal8 only in RRMS patients, we analyzed the clinical evolution in both groups, with and without antiGal8. Before treatment was started, no statistically significant differences were detected in age, gender, age at onset, diagnostic delay, EDSS, or presence of gadolinium-enhanced Tl lesions (Table 2A).

Patients were followed during an average of 12 months. We found that the group with antiGal8 evolved with worse EDSS (mean EDSS 1.5 versus 0, p=0.02) (Figure 1), independent of treatment. No differences were found in other parameters (Table 2B).

Table 1. Expression of anti-Gal-8 in RRMS and progressives forms of MS. p = 0.004 by Fisher exact test.

RRMS AntiGal8 (-) AntiGal8 (+) p Value

N° 19 17

Gender

- Female 12 15

0.13

- Male 7 2

Age (mean years, SD) 32.5 (6.2) 31.1 (8.6) 0.43

Age at symptoms onset

29.0 (6.7) 27.2 (7.2) 0.49

(mean years, SD)

Diagnostic delay

1.2 (2.0) 1.4 (2.9) 0.46

(mean years, SD)

Initial EDSS

0 (0-2) 0 (0-1.5) 0.93

(mean, range)

MRI

Brain

- GD (+) 12 12 0.73

- GD (-) 7 5

Table 2A. Initial evaluation of RRMS patients with and without antiGal8. Abbreviation: SD: Standard deviation, GD: Gadolinium, (+) with, (-) without enhancement.

RRMS AntiGal8 (-) AntiGal8 (+) p Value

Duration of disease

3.5 (2.5) 4.5 (3.9) 0.43

(mean years, SD)

Treatment

- Without 8 3 0.16

- With 11 14

- First line 9 9 0.41

- Second line 2 5

Follow-up (mean years, SD) 1.02 (0.78) 1.07 (0.63) 0.62

Annualized relapse rate

0.64 (0.2-1.9) 0.80 (0.1-1.7) 0.24

(mean, range)

Final EDSS

0 (0-1.5) 1.5 (0-5) 0.02 (mean, range)

Table 2B. Follow-up and final assessments of RRMS patients with and without antiGal8. Abbreviations: SD: Standard deviation, p = 0.02 by nonparametric Mann- Whitney.

Example 6: Variations of Gal-8 protein including at least residues 21-152 in N terminal domain and at least residues 229 to 356 in C terminal domain are effective in assessing severity of the disease.

Several preliminary experiments show that the essential residues in Gal-8 protein are the residues 21-151 (SEQ ID NO:5) in the N terminal domain and residues 229-356 (SEQ ID

NO:6) in the C-terminal domain of Gal 8L that have to be present in the protein to provide reliable assessment of severity of the disease. Accordingly, this invention includes methods to provide a prognosis in a patient having been diagnosed with RRMS, said method including using a recombinant protein comprising SEQ ID NO: 5 in its N terminal domain and SEQ ID

NO:6 in its C-terminal domain. The invention also encompasses antibodies against SEQ ID

NO: 5 and SEQ ID NO: 6. Moreover the invention encompasses immune complexes comprising SEQ ID NO: 5 and an antibody binding to this sequence or parts of it as well as immune complexes comprising SEQ ID NO:6 and antibody binding to this sequence or parts of it. Also kits where peptides comprising SEQ ID NO: 5 and SEQ ID NO:6 have been immobilized in a detection kit are encompassed in this invention. Specifically the invention encompasses an ELISA-kit where a surface is prepared to which a capture antibody having residues according to SEQ ID NO: 5 in its N-terminal end and SEQ ID NO:6 in its C-terminal end. According to one embodiment Gal-8 protein according to SEQ ID NO: 4 is used as the capture antibody. The plasma sample of the patient having been diagnosed with RRMS is applied to the plate. The plate is washed to remove any unbound antigen .A specific antibody is added to bind to the antigen. .Enzyme- linked secondary antibodies are applied as detection antibodies that also bind specifically to the antibody's Fc region (nonspecific).The plate is washed to remove the unbound antibody- enzyme conjugates. A chemical is added to be converted by the enzyme into a color or fluorescent or electrochemical signal. The absorbency or fluorescence or electrochemical signal (e.g., current) of the plate wells is measured to determine the presence and quantity of antigen. A skilled artisan understands that a number of changes may be done to the examples described above without deviating from the spirit and the scope of the invention.

SEQUENCE LISTING

SEQ ID NO:2 sense primer:

ACGCGTCGACATGTTGTCCTTAAACAAC

SEQ ID NO:3 antisense primer:

ATAGTTTAGCGGCCGCCTACCAGCTCCTTACTTC SEP ID NO :4a Human GAL-8 S protein

MMLSLNNLQN IIYNPVIPFV GTIPDQLDPG TLIVIRGHVP DADRFQVDLQ NGSSMKPRAD VAFHFNPRFK RAGCIVCNTL INEKWGREEI TYDTPFKREK SFEIVIMVLK DKFQVAVNGK HTLLYGHRIG PEKIDTLGIY GKVNIHSIGF SFSSDLQSTQ ASSLELTEIS RENVPKSGTP QLRLPFAARL NTPMGPGRTV VVKGEVNAN AKSFNVDLLA GKSKDIALHL NPRLNIKAFV RNSFLQESWG EEERNITSFP FSPGMYFEMI IYCDVREFKV AVNGVHSLEY KHRFKELSSI DTLEINGDIH LLEVRSW

SEQ ID NO: 4b Human GAL -8L .protein

MMLSLNNLQN IIYNPVIPFV GTIPDQLDPG TLIVIRGHVP SDADRFQVDL QNGSSMKPRA DVAFHFNPRF KRAGCIVCNT LINEKWGREE ITYDTPFKRE KSFEIVIMVL KDKFQVAVNG KHTLLYGHRI GPEKIDTLGI YGKVNIHSIG FSFSSDLQST QASSLELTEI SRENVPKSGT PQLPSNRGGD ISKIAPRTVY TKSKDSTVNH TLTCTKIPPMN YVSKRLPFAAR LNTPMGPGRT VVVKGEVNAN AKSFNVDLLA GKSKDIALHL NPRLNIKAFV RNSFLQESWG EEERNITSFP FSPGMYFEMI IYCDVREFKV AVNGVHSLEY KHRFKELSSI DTLEINGDIH LLEVRSW

SEQ ID NO 5 amino acid residues 21- 151 of Human GAL 8L sequence:

GTIPDQLDPG TLIVIRGHVP SDADRFQVDL QNGSSMKPRA DVAFHFNPRF KRAGCIVCNT LINEKWGREE ITYDTPFKRE KSFEIVIMVL KDKFQVAVNGKHTLLYGHRI GPEKIDTLGI YGKVNIHSIGF SEQ ID NO: 6 amino acid residues 229-354 of Human GAL8 L sequence

FAAR LNTPMGPGRT VVVKGEVNAN AKSFNVDLLA GKSKDIALHL NPRLNIKAFV RNSFLQESWG EEERNITSFP FSPGMYFEMI IYCDVREFKV AVNGVHSLEY KHRFKELSSI DTLEINGDIH LLEV REFERENCES

1. Compston A and Coles A. Multiple Sclerosis. Lancet 2002;359, 1221-1231.

2. Biomarkers Definitions Working Group. Biomarkers and surrogate endpoints: preferred definitions and conceptual framework. Clin Pharmacol Ther 2001 ; 69, 89-95.

3. Rabinovich GA. Galectins: an evolutionarily conserved family of animal lectins with multifunctional properties; a trip from the gene to clinical therapy. Cell Death Differ 1999;6,711-721.

4. Rabinovich GA and Toscano MA. Turning 'sweet' on immunity: galectin-glycan interactions in immune tolerance and inflammation. Nat. Rev. Immunol. 2009;9:338-352. 5. Hadari YR, Arbel-Goren R, Levy Y, Amsterdam A, Alon R, Zakut R and Zick Y. Galectin-8 binding to integrins inhibits cell adhesion and induces apoptosis. J Cell Sci 2000; 113,2385-2397.

6. Levy Y, Arbel-Goren, R, Hadari YR, Eshhar S, Ronen D, Elhanany E, Geiger B and Zick Y. Galectin-8 functions as a matricellular modulator of cell adhesion. J Biol Chem 2001 ;276,31285-31295.

7. Yang RY and Liu FT. Galectins in cell growth and apoptosis. Cell Mol Life Sci 2003;60,267- 276.

8. Arbel-Goren R, Levy Y, Ronen D and Zick Y. Cyclin-dependent Kinase Inhibitors and JNK Act as Molecular Switches, Regulating the Choice between Growth Arrest and Apoptosis Induced by Galectin-8. J Biol Chem 2005; 280,19105-191 14.

9. Carcamo C, Pardo E, Oyanadel C, Bravo-Zehnder M, Bull P, Caceres M, Martinez J, Massardo L, Jacobelli S, Gonzalez A and Soza A. Galectin-8 binds specific al integrins and induces polarized spreading highlighted by asymmetric lamellipodia in Jurkat T cells. Exp Cell Res 2006;312,374-386.

10. Hadari YR, Paz K, Dekel R, Mestrovic T, Accili D and Zick Y. Galectin-8 a new rat lectin, related to galectin-4. J Biol Chem 1995; 270, 3447-3453.

11. Bidon N, Brichory F, Bourguet P, Le Pennec JP and Dazord L. Galectin-8 : a complex sub-family of galectins (Review). Int J Mol Med 2001 ;8,245-250.

12. Zick Y, Eisenstein M, Goren RA, Hadari YR, LevyY and Ronen D. Role of galectin-8 as a modulator of cell adhesion and cell growth. Glycoconj 2004; J 19, 517-526.

13. Tribulatti MV, Mucci J, Cattaneo V, Aguero F, Gilmartin T, Head SR and Campetella O. Galectin-8 Induces Apoptosis in the CD4^highCD8^high Thymocyte Subpopulation. Glycobiology 2007; 17, 1404-1412. 14. Tribulatti MV, Cattaneo V, Hellman U, Mucci J and Campetella O. Galectin-8 provides costimulatory and proliferative signals to T lymphocytes. J Leukoc Biol 2009;86,371-380.

15. Norambuena A, Metz C, Vicuna L, Silva A, Pardo E, Oyanadel C, Gonzalez A and Soza A. Galectin-8 Induces Apoptosis in Jurkat T Cells by Phosphatidic Acid-mediated

ERKl/2 Activation Supported by Protein Kinase A Down-regulation. J Biol Chem 2009;284,12670-12679.

16. Polman CH, Reingold SC, Banwell B, Clanet M, Cohen JA, Filippi M, Fujihara K, Havrdova E, Hutchinson M, Kappos L, Lublin FD, Montalban X, O'Connor P, Sandberg- Wollheim M, Thompson AJ, Waubant E, Weinshenker B and Wolinsky JS. Diagnostic criteria for multiple sclerosis: 2010 Revisions to the McDonald criteria. Ann Neurol. 2011 ;69: 292-302.

17. Rabinovich GA, Toscano MA, Uarregui JM and Rubinstein N. Shedding light on the immunomodulatory properties of galectins: novel regulators of innate and adaptive immune responses. Glycoconj 2004; J 19, 565-573.

18. Pardo E, Carcamo C, Massardo L, Mezzano V, Jacobelli S, Gonzalez A and Soza A. Antibodies against galectin-8 in patients with systemic lupus erythematosus. Rev Med Chil 2006;134, 159-166.

19. Massardo L, Metz C, Pardo E, Mezzano V, Babul M, Jarpa E, Guzman A, Andre S, Kaltner H, Gabius H, Jacobelli S, Gonzalez A and Soza A. Autoantibodies against galectin-

8: their specificity, association with lymphopenia in systemic lupus erythematosus and detection in rheumatoid arthritis and acute inflammation. Lupus 2009; 18, 539-546.

20. Noseworthy JH, Lucchinetti C, Rodriguez M and Weinshenker BG. Multiple sclerosis. N Engl J Med 2000; 343: 938-52.

21. Tintore M, Rovira A, Rio J, Tur C, Pelayo R, Nos C, Tellez N, Perkal H, Comabella M, Sastre-Garriga J and Montalban X. Do oligoclonal bands add information to MRI in first attacks of multiple sclerosis? Neurology 2008; 70: 1079-1083.

22. Nilsson P, Larsson EM, Maly-Sundgren P, Perfekt R and Sandberg- Wollheim M. Predicting the outcome of optic neuritis: evaluation of risk factors after 30 years of follow- up. Journal of Neurology 2005; 252: 396-402.

23. Mandrioli J, Sola P, Bedin R, Gambini M and Merelli E. A multifactorial prognostic index in multiple sclerosis: cerebrospinal fluid IgM oligoclonal bands and clinical features to predict the evolution of the disease. Journal of Neurology 2008;255:1023-1031. 24. Berger T, Rubner P, Schautzer F. Antimyehn antibodies as a predictor of clinically definite multiple sclerosis after a first demyelinating event. N Engl J Med 2003 ;349: 139— 145.

25. Kuhle J, Pohl C, Mehling M. Lack of association between antimyehn antibodies and progression to multiple sclerosis. N Engl J Med 2007;356:371-378.

26. Belogurov AA, Kurkova IN, Friboulet A. Recognition and degradation of myelin basic protein peptides by serum autoantibodies: novel biomarker for multiple sclerosis. J. Immunol. 2008;180:1258-1267.

27. Sarter K, Janko C, Andre S, Munoz LE, Schorn C, Winkler S, Rech J, Kaltner H, Lorenz HM, Schiller M, Andreoli L, Manfredi AA, Isenberg DA, Schett G, Herrmann M and

Gabius HJ. Autoantibodies against galectins are associated with antiphospholipid syndrome in patients with systemic lupus erythematosus. Glycobiology 2013; 23, 12-22.

Claims

CLAIMS What is claimed is:

1. A decision making tool for prescription of treatment to a patient previously

diagnosed with relapsing and recurring multiple sclerosis (RRMS), said tool

comprising:

a) a kit for detecting presence or absence of anti-Gal8 autoantibodies in sera

sample of the patient, said kit comprising:

i. a platform where full or part of recombinant Gal-8 protein has been immobilized;

ii. positive control containing antiGal-8 autoantibodies and a negative control not containing antiGal 8 autoantibodies;

iii. instructions to measure presence or absence of antiGal -8

autoantibodies in a sera sample of the patient, where positive reaction with recombinant Gal-8 indicates presence of anti-gal8 autoantibodies; and b) Instructions to make a decision for starting aggressive treatment when the

kit indicates presence of anti-gal8 autoantibodies.

2. The tool of claim 1, wherein the immobilized protein has the sequence of SEQ ID

NO :4b.

3. The tool of claim 1, wherein the immobilized protein comprises SEQ ID NO:5 in its N-terminal domain and SEQ ID NO :6 in its C terminal domain.

4. A method to provide a prognosis of relapsing remitting multiple sclerosis, said

method comprising the steps of:

a) obtaining a sample;

b) allowing a recombinant protein having an amino acid sequence SEQ ID NO :4b react with the sample, where presence of the autoantibody Gal-8 in the sample creates an immunocomplex of recombinant protein and autoantibody;

c) detecting the immunocomplex; and

d) providing a prognosis of an aggressive form of the disease in the presence

of the immuncomplex.

5. The method of claim 4, wherein the immunocomplex comprises SEQ ID NO:5 and

SEQ ID NO:6.

6. A method to decide for aggressive treatment of relapsing remitting multiple sclerosis, said method comprising the steps of:

a) obtaining a sample;

b) allowing a recombinant protein having an amino acid sequence SEQ ID

NO :4b react with the sample, where presence of the autoantibody Gal-8 in the sample creates an immunocomplex of recombinant protein and autoantibody;

c) detecting the immunocomplex; and

d) deciding for aggressive treatment disease in the presence of the immuncomplex.

7. The method of claim 6, wherein the aggressive treatment comprises of treatment of the patient with one or more pharmaceuticals selected from the group consisting of natalizumab IV injections, interferon EVI injections, oral dimetilfumarate, oral teriflunomide, alemtuzumab IV injections, glatiramer acetate injections, oral fingolimode, and subcutaneous injection of interferon.

8. A kit for providing prognosis of remitting relapsing MS disease in a patient,

wherein the kit comprises:

a) a platform where full or a part of recombinant Gal-8 protein has

been immobilized;

b) positive control containing antiGal-8 autoantibodies and a negative control not containing antiGal 8 autoantibodies;

c) instructions of providing a poor prognosis in presence of formation of an immuncomplex between the patient's sample and the Gal-8 protein on the platform.

9. The kit of claim 8, wherein the recombinant Gal-8 protein is according to SEQ ID

NO :4b and wherein the immunocomplex comprises SEQ ID NO :4b.

10. The kit of claim 9, wherein a protein comprising SEQ ID NO:5 in its N-a

terminal end and SEQ ID NO: 6 in its C-terminal end is immobilized in step a).

11. A method for treating relapsing remitting multiple sclerosis disease in a

patient, said method comprising the steps of:

a) determining presence or absence of anti-Gal 8 antibodies in serum of a patient that has previously been diagnosed with RRMS;

b) in the presence of the antibodies starting an aggressive treatment with medication reducing remitting attacks wherein said medication includes selection of one or more of pharmaceuticals selected from the group consisting of natalizumab IV injections, interferon EV1 injections, oral dimetilfumarate, oral teriflunomide, alemtuzumab IV injections, glatiramer acetate injections, oral fingolimode, and subcutaneous injection of interferon.

12. An in vitro method for providing a prognosis of relapsing remitting multiple sclerosis in a human subject, wherein the subject is known to have RRMS, said method comprising the steps of:

a) Obtaining a blood sample of the patient; and

b) determining from a blood sample a presence or an absence of anti-gal-8 autoantibody, wherein presence of said antibody is indicative of poor prognosis in RRMS.

13. An artificial set of primers according to SEQ ID NO:2 and SEQ ID NO:3 for

amplifying coding sequence of human GAL-8.

14. A method to provide a prognosis for a patient previously diagnosed with

RRMS, said method comprising the steps of:

a) providing recombinant GAL-8 according to SEQ ID NO :4b or a synthetic protein comprising SEQ ID NO:5 in its N-terminal end and SEQ ID NO:6 in its C-terminal end;

b) providing a sample of patient's sera;

c) allowing the recombinant GAL-8 or segments of it encompassing SEQ ID NO: 5 and SEQ ID NO:6 to react with the sera on nitrocellulose membrane;

d) visualizing immune complexes on the membrane by a colorimetric

reaction;

e) measuring intensity of the complexes and comparing the intensity with intensity measured from a negative and a positive control; and

f) providing a poor prognosis when the measured intensity is about twice the intensity of the negative control.