WO2016060912A2 - Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests - Google Patents

Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests Download PDF

Info

Publication number
WO2016060912A2
WO2016060912A2 PCT/US2015/054472 US2015054472W WO2016060912A2 WO 2016060912 A2 WO2016060912 A2 WO 2016060912A2 US 2015054472 W US2015054472 W US 2015054472W WO 2016060912 A2 WO2016060912 A2 WO 2016060912A2
Authority
WO
WIPO (PCT)
Prior art keywords
seq
plant
polynucleotide
pest
rna
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/054472
Other languages
English (en)
French (fr)
Other versions
WO2016060912A3 (en
Inventor
Kenneth Narva
Huarong Li
Chaoxian Geng
Navin ELANGO
Matthew J. Henry
Murugesan Rangasamy
Aaron T. Woosley
Kanika ARORA
Premchand GANDRA
Sarah E. Worden
Elane FISHILEVICH
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Corteva Agriscience LLC
Original Assignee
Dow AgroSciences LLC
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to JP2017519275A priority Critical patent/JP2017536097A/ja
Priority to EP15850026.4A priority patent/EP3207051A4/en
Priority to KR1020177009376A priority patent/KR20170066403A/ko
Priority to BR112017007084A priority patent/BR112017007084A8/pt
Priority to US15/757,997 priority patent/US20200224214A1/en
Priority to RU2017111817A priority patent/RU2017111817A/ru
Priority to MX2017004452A priority patent/MX2017004452A/es
Priority to AU2015333922A priority patent/AU2015333922B2/en
Priority to CN201580057968.0A priority patent/CN107148426A/zh
Priority to CA2963794A priority patent/CA2963794A1/en
Application filed by Dow AgroSciences LLC filed Critical Dow AgroSciences LLC
Publication of WO2016060912A2 publication Critical patent/WO2016060912A2/en
Publication of WO2016060912A3 publication Critical patent/WO2016060912A3/en
Priority to IL251580A priority patent/IL251580A0/en
Priority to PH12017500645A priority patent/PH12017500645A1/en
Priority to CONC2017/0003434A priority patent/CO2017003434A2/es
Anticipated expiration legal-status Critical
Priority to AU2019202749A priority patent/AU2019202749A1/en
Priority to AU2021258028A priority patent/AU2021258028A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/63Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K14/00Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/43504Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
    • C07K14/43563Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from insects
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A40/00Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
    • Y02A40/10Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
    • Y02A40/146Genetically Modified [GMO] plants, e.g. transgenic plants

Definitions

  • the present invention relates generally to genetic control of plant damage caused by insect pests (e.g., coleopteran pests and hemipteran pests).
  • insect pests e.g., coleopteran pests and hemipteran pests.
  • the present invention relates to identification of target coding and non-coding polynucleotides, and the use of recombinant DNA technologies for post-transcriptionally repressing or inhibiting expression of target coding and non-coding polynucleotides in the cells of an insect pest to provide a plant protective effect.
  • MCR Mexican corn rootworm
  • SCR southern corn rootworm
  • Control of corn rootworms may be attempted by crop rotation, chemical insecticides, biopesticides ⁇ e.g., the spore-forming gram-positive bacterium, Bacillus thuringiensis ⁇ Bt)), transgenic plants that express Bt toxins, or a combination thereof.
  • Crop rotation suffers from the significant disadvantage of placing unwanted restrictions upon the use of farmland.
  • oviposition of some rootworm species may occur in crop fields other than corn or extended diapauses results in egg hatching over multiple years, thereby mitigating the effectiveness of crop rotation practiced with corn and soybean.
  • Chemical insecticides are the most heavily relied upon strategy for achieving corn rootworm control. Chemical insecticide use, though, is an imperfect corn rootworm control strategy; over $1 billion may be lost in the United States each year due to corn rootworm when the costs of the chemical insecticides are added to the costs of the rootworm damage that may occur despite the use of the insecticides. High populations of larvae, heavy rains, and improper application of the insecticide(s) may all result in inadequate corn rootworm control. Furthermore, the continual use of insecticides may select for insecticide-resistant rootworm strains, as well as raise significant environmental concerns due to the toxicity of many of them to non-target species.
  • Stink bugs and other hemipteran insects comprise another important agricultural pest complex.
  • stink bugs are known to cause crop damage.
  • McPherson & McPherson (2000) Stink bugs of economic importance in America north of Mexico, CRC Press. These insects are present in a large number of important crops including maize, soybean, fruit, vegetables, and cereals.
  • Stink bugs go through multiple nymph stages before reaching the adult stage. The time to develop from eggs to adults is about 30-40 days. Both nymphs and adults feed on sap from soft tissues into which they also inject digestive enzymes causing extra-oral tissue digestion and necrosis. Digested plant material and nutrients are then ingested. Depletion of water and nutrients from the plant vascular system results in plant tissue damage. Damage to developing grain and seeds is the most significant as yield and germination are significantly reduced. Multiple generations occur in warm climates resulting in significant insect pressure. Current management of stink bugs relies on insecticide treatment on an individual field basis. Therefore, alternative management strategies are urgently needed to minimize ongoing crop losses.
  • RNA interference is a process utilizing endogenous cellular pathways, whereby an interfering RNA (iRNA) molecule (e.g., a double- stranded RNA (dsRNA) molecule) that is specific for all, or any portion of adequate size, of a target gene sequence results in the degradation of the mRNA encoded thereby.
  • iRNA interfering RNA
  • dsRNA double- stranded RNA
  • RNAi has been used to perform gene "knockdown" in a number of species and experimental systems; for example, Caenorhabditis elegans, plants, insect embryos, and cells in tissue culture. See, e.g., Fire et al. (1998) Nature 391:806-811; Martinez et al. (2002) Cell 110:563-574; McManus and Sharp (2002) Nature Rev. Genetics 3:737-747.
  • RNAi accomplishes degradation of mRNA through an endogenous pathway including the DICER protein complex.
  • DICER cleaves long dsRNA molecules into short fragments of approximately 20 nucleotides, termed small interfering RNA (siRNA).
  • siRNA small interfering RNA
  • the siRNA is unwound into two single- stranded RNAs: the passenger strand and the guide strand.
  • the passenger strand is degraded, and the guide strand is incorporated into the RNA-induced silencing complex (RISC).
  • RISC RNA-induced silencing complex
  • U.S. Patent 7,612,194 and U.S. Patent Publication Nos. 2007/0050860, 2010/0192265, and 2011/0154545 disclose a library of 9112 expressed sequence tag (EST) sequences isolated from D. v. virgifera LeConte pupae. It is suggested in U.S. Patent 7,612,194 and U.S. Patent Publication No. 2007/0050860 to operably link to a promoter a nucleic acid molecule that is complementary to one of several particular partial sequences of D. v. virgifera vacuolar-type H + -ATPase (V-ATPase) disclosed therein for the expression of anti-sense RNA in plant cells.
  • V-ATPase vacuolar-type H + -ATPase
  • Patent Publication No. 2010/0192265 suggests operably linking a promoter to a nucleic acid molecule that is complementary to a particular partial sequence of a D. v. virgifera gene of unknown and undisclosed function (the partial sequence is stated to be 58% identical to C56C10.3 gene product in C. elegans) for the expression of anti-sense RNA in plant cells.
  • U.S. Patent Publication No. 2011/0154545 suggests operably linking a promoter to a nucleic acid molecule that is complementary to two particular partial sequences of D. v. virgifera coatomer beta subunit genes for the expression of anti-sense RNA in plant cells. Further, U.S.
  • Patent 7,943,819 discloses a library of 906 expressed sequence tag (EST) sequences isolated from D. v. virgifera LeConte larvae, pupae, and dissected midguts, and suggests operably linking a promoter to a nucleic acid molecule that is complementary to a particular partial sequence of a D. v. virgifera charged multivesicular body protein 4b gene for the expression of double- stranded RNA in plant cells.
  • EST expressed sequence tag
  • Patent 7,943,819 provides no suggestion to use any particular sequence of the more than nine hundred sequences listed therein for RNA interference, other than the particular partial sequence of a charged multivesicular body protein 4b gene. Furthermore, U.S. Patent 7,943,819 provides no guidance as to which other of the over nine hundred sequences provided would be lethal, or even otherwise useful, in species of com rootworm when used as dsRNA or siRNA.
  • U.S. Patent Application Publication No. U.S. 2013/040173 and PCT Application Publication No. WO 2013/169923 describe the use of a sequence derived from a Diabrotica virgifera Snf7 gene for RNA interference in maize. (Also disclosed in Bolognesi et al. (2012) PLOS ONE 7(10): e47534. doi:10.1371/journal.pone.0047534).
  • dsRNA double- stranded RNAs
  • V-ATPase vacuolar ATPase subunit A
  • nucleic acid molecules ⁇ e.g., target genes, DNAs, dsRNAs, siRNAs, miRNAs, shRNAs, and hpRNAs), and methods of use thereof, for the control of insect pests, including, for example, coleopteran pests, such as D. v. virgifera LeConte (western corn rootworm, "WCR”); D. barberi Smith and Lawrence (northern com rootworm, "NCR”); D. u. howardi Barber (southern corn rootworm, "SCR”); D. v. zeae Krysan and Smith (Mexican corn rootworm, "MCR”); D.
  • coleopteran pests such as D. v. virgifera LeConte (western corn rootworm, "WCR”); D. barberi Smith and Lawrence (northern com rootworm, "NCR”); D. u. howardi Barber (southern corn rootworm,
  • exemplary nucleic acid molecules are disclosed that may be homologous to at least a portion of one or more native nucleic acids in an insect pest.
  • the native nucleic acid may be a target gene, the product of which may be, for example and without limitation: involved in a metabolic process or involved in larval/ nymph development.
  • post-translational inhibition of the expression of a target gene by a nucleic acid molecule comprising a polynucleotide homologous thereto may be lethal in coleopteran and or hemipteran pests, or result in reduced growth and or development thereof.
  • a gene consisting of the coat protein complex alpha subunit (referred to herein as COPI alpha subunit and COPI alpha) may be selected as a target gene for post- transcriptional silencing.
  • a target gene useful for post- transcriptional inhibition is the novel gene referred to herein as COP I alpha.
  • An isolated nucleic acid molecule comprising a nucleotide sequence of COPI alpha (SEQ ID NO:l and SEQ ID NO:84); the complement of COPI alpha (SEQ ID NO: 1 and SEQ ID NO:84); and fragments of any of the foregoing is therefore disclosed herein.
  • nucleic acid molecules comprising a polynucleotide that encodes a polypeptide that is at least about 85% identical to an amino acid sequence within a target gene product (for example, the product of a gene referred to as COPI ALPHA).
  • a nucleic acid molecule may comprise a polynucleotide encoding a polypeptide that is at least 85% identical to SEQ ID NO:2 or SEQ ID NO:85 (COPI ALPHA protein).
  • a nucleic acid molecule comprises a nucleotide sequence encoding a polypeptide that is at least 85% identical to an amino acid sequence within a product of COPI ALPHA.
  • nucleic acid molecules comprising a polynucleotide that is the reverse complement of a polynucleotide that encodes a polypeptide at least 85% identical to an amino acid sequence within a target gene product.
  • cDNA polynucleotides that may be used for the production of iRNA (e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA) molecules that are complementary to all or part of a coleopteran and/or hemipteran pest target gene, for example: COPI alpha.
  • dsRNAs, siRNAs, miRNAs, shRNAs, and/or hpRNAs may be produced in vitro, or in vivo by a genetically-modified organism, such as a plant or bacterium.
  • cDNA molecules are disclosed that may be used to produce iRNA molecules that are complementary to all or part of COPI alpha (SEQ ID NO: 1 and SEQ ID NO: 84).
  • a means for inhibiting expression of an essential gene in a coleopteran and/or hemipteran pest is a single- or double- stranded RNA molecule consisting of at least one of SEQ ID NO:3 (COPI alpha region 1, herein sometimes referred to as COPI alpha regl) or SEQ ID NO:4 (COPI alpha region 2, herein sometimes referred to as COPI alpha reg2) or SEQ ID NO:72 (COPI alpha version 1, herein sometimes referred to as COPI alpha verl)or SEQ ID NO:73 (COPI alpha version 2, herein sometimes referred to as COPI alpha ver2)or SEQ ID NO:74 (COPI alpha version 3, herein sometimes referred to as COPI alpha ver3) or SEQ ID NO:75 (COPI alpha
  • Functional equivalents of means for inhibiting expression of an essential gene in a coleopteran and/or hemipteran pest include single- or double- stranded RNA molecules that are substantially homologous to all or part of a WCR or BSB gene comprising SEQ ID NO:l or SEQ ID NO:84.
  • a means for providing coleopteran and/or hemipteran pest resistance to a plant is a DNA molecule comprising a nucleic acid sequence encoding a means for inhibiting expression of an essential gene in a coleopteran and/or hemipteran pest operably linked to a promoter, wherein the DNA molecule is capable of being integrated into the genome of a maize plant.
  • Disclosed are methods for controlling a population of an insect pest comprising providing to an insect pest (e.g., a coleopteran or hemipteran pest) an iRNA (e.g., dsRNA, siRNA, shRNA, miRNA, and hpRNA) molecule that functions upon being taken up by the pest to inhibit a biological function within the pest, wherein the iRNA molecule comprises all or part of a nucleotide sequence selected from the group consisting of: SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:84, SEQ ID NO:86, and SEQ ID NO:87; the complement of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ
  • BSB comprising all or part of any of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:84, SEQ ID NO:86, and SEQ ID NO:87; the complement of a native coding sequence of a Diabwtica or hemipteran organism comprising all or part of any of SEQ ID NO:l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:84, SEQ ID NO:86, and SEQ ID NO:87; a native non-coding sequence of a Diabwtica or hemipteran organism that is transcribed into a native RNA molecule comprising all or part of any of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ
  • dsRNAs, siRNAs, miRNAs, shRNAs and/or hpRNAs may be provided to a coleopteran and/or hemipteran pest in a diet-based assay, or in genetically-modified plant cells expressing the dsRNAs, siRNAs, miRNAs, shRNAs and/or hpRNAs.
  • the dsRNAs, siRNAs, miRNAs, shRNAs and/or hpRNAs may be ingested by coleopteran larvae and/or hemipteran pest nymph.
  • nucleic acid molecules comprising exemplary nucleic acid sequence(s) useful for control of coleopteran and/or hemipteran pests are provided to a coleopteran and/or hemipteran pest.
  • the coleopteran and/or hemipteran pest controlled by use of nucleic acid molecules of the invention may be WCR, NCR, SCR, MCR, D. balteata, D. u. tenella, D. speciosa, D. u. undecimpunctata, Euschistus hews, E. servus, Piezodorus guildinii, Halyomorpha halys, Nezara viridula, Chinavia hilare, C. marginatum, Dichelops melacanthus, D.
  • furcatus Edessa meditabunda
  • Thyanta perditor Horcias nobilellus
  • Taedia stigmosa Dysdercus peruvianus
  • Neomegalotomus parvus Leptoglossus zonatus
  • Niesthrea sidae and/or Lygus Uneolaris.
  • FIG. 1 includes a depiction of the strategy used to generate dsRNA from a single transcription template with a single pair of primers.
  • FIG. 2 includes a depiction of the strategy used to generate dsRNA from two transcription templates.
  • nucleic acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, as defined in 37 C.F.R. ⁇ 1.822.
  • the nucleic acid and amino acid sequences listed define molecules (i.e., polynucleotides and polypeptides, respectively) having the nucleotide and amino acid monomers arranged in the manner described.
  • the nucleic acid and amino acid sequences listed also each define a genus of polynucleotides or polypeptides that comprise the nucleotide and amino acid monomers arranged in the manner described.
  • nucleotide sequence including a coding sequence also describes the genus of polynucleotides encoding the same polypeptide as a polynucleotide consisting of the reference sequence. It will further be understood that an amino acid sequence describes the genus of polynucleotide ORFs encoding that polypeptide.
  • each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • the complement and reverse complement of a primary nucleic acid sequence are necessarily disclosed by the primary sequence, the complementary sequence and reverse complementary sequence of a nucleic acid sequence are included by any reference to the nucleic acid sequence, unless it is explicitly stated to be otherwise (or it is clear to be otherwise from the context in which the sequence appears).
  • SEQ ID NO:l shows a DNA sequence comprising COPI alpha subunit from Diabrotica virgifera.
  • SEQ ID NO:2 shows an amino acid sequence of a COPI alpha protein from Diabrotica virgifera.
  • SEQ ID NO:3 shows a DNA sequence of COPI alpha regl (region 1) from Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO:4 shows a DNA sequence of COPI alpha reg2 (region 2) from Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO: 5 shows a DNA sequence of a T7 phage promoter.
  • SEQ ID NO: 6 shows a DNA sequence of a YFP coding region segment that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NOs:7 to 10 show primers used to amplify portions of a COPI alpha subunit sequence comprising COPI alpha regl and COPI alpha reg2.
  • SEQ ID NO: 11 presents a COPI alpha hairpin v3-RNA-forming sequence from Diabrotica virgifera as found in pDABl 17217.
  • Upper case bases are COPI alpha sense strand
  • underlined lower case bases comprise an ST-LS 1 intron
  • non-underlined lower case bases are COPI alpha antisense strand.
  • SEQ ID NO: 12 presents a COPI alpha hairpin v4-RNA-forming sequence from Diabrotica virgifera as found in pDABl 17218.
  • Upper case bases are COPI alpha sense strand
  • underlined lower case bases comprise an ST-LS 1 intron
  • non-underlined lower case bases are COPI alpha antisense strand.
  • SEQ ID NO: 14 shows a sequence comprising an ST- LSI intron
  • SEQ ID NO:15 shows a YFP protein coding sequence as found in pDAB101556.
  • SEQ ID NO: 16 shows a DNA sequence of Annexin region 1.
  • SEQ ID NO: 17 shows a DNA sequence of Annexin region 2.
  • SEQ ID NO: 18 shows a DNA sequence of Beta spectrin 2 region 1.
  • SEQ ID NO: 19 shows a DNA sequence of Beta spectrin 2 region 2.
  • SEQ ID NO:20 shows a DNA sequence of mtRP-L4 region 1.
  • SEQ ID NO:21 shows a DNA sequence of mtRP-L4 region 2.
  • SEQ ID NO:50 shows a maize DNA sequence encoding a TIP41-like protein.
  • SEQ ID NO:51 shows a DNA sequence of oligonucleotide T20NV.
  • SEQ ID Nos:52 to 56 show sequences of primers and probes used to measure maize transcript levels.
  • SEQ ID NO:57 shows a DNA sequence of a portion of a SpecR coding region used for binary vector backbone detection.
  • SEQ ID NO:58 shows a DNA sequence of a portion of an AAD1 coding region used for genomic copy number analysis.
  • SEQ ID NOs:60 to 68 show sequences of primers and probes used for gene copy number analyses.
  • SEQ ID NOs:69 to 71 show sequences of primers and probes used for maize expression analysis.
  • SEQ ID NO:72 shows a DNA sequence of COPI alpha verl (version 1) from Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO:73 shows a DNA sequence of COPI alpha ver2 (version 2) from Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO:74 shows a DNA sequence of COPI alpha ver3 (version 3) from Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO:75 shows a DNA sequence of COPI alpha ver4 (version 4) from Diabrotica virgifera that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO:76-83 show primers used to amplify portions of a Diabrotica virgifera COPI alpha sequence comprising COPI alpha verl, COPI alpha ver2, COPI alpha ver3, and COPI alpha ver4.
  • SEQ ID NO:84 shows an exemplary DNA sequence of BSB COPI alpha transcript from a Neotropical Brown Stink Bug (Euschistus hews).
  • SEQ ID NO: 85 shows an amino acid sequence of a from Euschistus hews COPI ALPHA protein.
  • SEQ ID NO:86 shows a DNA sequence of BSB_COPI alpha-l from Euschistus hews that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO:87 shows a DNA sequence of BSB_COPI alpha-2 from Euschistus hews that was used for in vitro dsRNA synthesis (T7 promoter sequences at 5' and 3' ends not shown).
  • SEQ ID NO:93-94 show primers used to amplify portions of a YFP-targeted dsRNA: YFPv2
  • SEQ ID NO: 95 presents YFP hairpin sequence (YFP v2- l).
  • Upper case bases are YFP sense strand
  • underlined lower case bases comprise an RTMl intron
  • non-underlined lower case bases are YFP antisense strand.
  • RNAi-mediated control of an insect pest population are also provided.
  • DNA plasmid vectors encoding an RNA molecule may be designed to suppress one or more target gene(s) essential for growth, survival, and/or development.
  • the RNA molecule may be capable of forming dsRNA molecules.
  • some embodiments involve sequence- specific inhibition of expression of target gene products, using iRNA (e.g., dsRNA, siRNA, shRNA, miRNA and/or hpRNA) that is complementary to coding and/or non-coding sequences of the target gene(s) to achieve at least partial control of an insect (e.g., coleopteran and/or hemipteran) pest.
  • iRNA e.g., dsRNA, siRNA, shRNA, miRNA and/or hpRNA
  • an insect e.g., coleopteran and/or hemipteran
  • a set of isolated and purified nucleic acid molecules comprising a polynucleotide, for example, as set forth in any of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:84, SEQ ID NO:86, SEQ ID NO:87, and fragments thereof.
  • a stabilized dsRNA molecule may be expressed from this sequence, fragments thereof, or a gene comprising one of these sequences, for the post- transcriptional silencing or inhibition of a target gene.
  • isolated and purified nucleic acid molecules comprise all or part of SEQ ID NO: l . In other embodiments, isolated and purified nucleic acid molecules comprise all or part of SEQ ID NO: 3. In other embodiments, isolated and purified nucleic acid molecules comprise all or part of SEQ ID NO:4. In still further embodiments, isolated and purified nucleic acid molecules comprise all or part of SEQ ID NO:72. In other embodiments, isolated and purified nucleic acid molecules comprise all or part of SEQ ID NO:73.In yet other embodiments, isolated and purified nucleic acid molecules comprise all or part of SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:84, SEQ ID NO:86, or SEQ ID NO:87.
  • Some embodiments involve a recombinant host cell (e.g., a plant cell) having in its genome at least one recombinant DNA encoding at least one iRNA (e.g., dsRNA) molecule(s).
  • the dsRNA molecule(s) may be produced when ingested by a coleopteran and/or hemipteran pest to post- transcriptionally silence or inhibit the expression of a target gene in the pest.
  • the recombinant DNA may comprise, for example, any of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:84, SEQ ID NO:86, or SEQ ID NO:87; fragments of any of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO: 84, SEQ ID NO:86, or SEQ ID NO:87; or a partial sequence of a gene comprising one or more of SEQ ID NO: l, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:72, SEQ ID NO:73, SEQ ID NO:74, SEQ ID NO:75, SEQ ID NO:84, SEQ ID NO:86, or SEQ ID NO:87; or complements thereof.
  • Some embodiments involve a recombinant host cell having in its genome a recombinant DNA encoding at least one iRNA (e.g., dsRNA) molecule(s) comprising all or part of an RNA encoded by SEQ ID NO: l and/or SEQ ID NO:84.
  • iRNA e.g., dsRNA
  • the iRNA molecule(s) may silence or inhibit the expression of a target gene comprising SEQ ID NO: l and/or SEQ ID NO: 84, in the coleopteran and/or hemipteran pest, and thereby result in cessation of growth, development, and/or feeding in the coleopteran and/or hemipteran pest.
  • a recombinant host cell having in its genome at least one recombinant DNA encoding at least one RNA molecule capable of forming a dsRNA molecule may be a transformed plant cell.
  • Some embodiments involve transgenic plants comprising such a transformed plant cell.
  • progeny plants of any transgenic plant generation, transgenic seeds, and transgenic plant products, are all provided, each of which comprises recombinant DNA(s).
  • an RNA molecule capable of forming a dsRNA molecule may be expressed in a transgenic plant cell. Therefore, in these and other embodiments, a dsRNA molecule may be isolated from a transgenic plant cell.
  • the transgenic plant is a plant selected from the group comprising corn (Zea mays), soybean (Glycine max), and plants of the family Poaceae.
  • a nucleic acid molecule may be provided, wherein the nucleic acid molecule comprises a polynucleotide encoding an RNA molecule capable of forming a dsRNA molecule.
  • a polynucleotide encoding an RNA molecule capable of forming a dsRNA molecule may be operatively linked to a promoter, and may also be operatively linked to a transcription termination sequence.
  • a method for modulating the expression of a target gene in an insect pest cell may comprise: (a) transforming a plant cell with a vector comprising a polynucleotide encoding an RNA molecule capable of forming a dsRNA molecule; (b) culturing the transformed plant cell under conditions sufficient to allow for development of a plant cell culture comprising a plurality of transformed plant cells; (c) selecting for a transformed plant cell that has integrated the vector into its genome; and (d) determining that the selected transformed plant cell comprises the RNA molecule capable of forming a dsRNA molecule encoded by the polynucleotide of the vector.
  • a plant may be regenerated from a plant cell that has the vector integrated in its genome and comprises the dsRNA molecule encoded by the polynucleotide of the vector.
  • a transgenic plant comprising a vector having a polynucleotide encoding an RNA molecule capable of forming a dsRNA molecule integrated in its genome, wherein the transgenic plant comprises the dsRNA molecule encoded by the polynucleotide of the vector.
  • RNA molecule capable of forming a dsRNA molecule in the plant is sufficient to modulate the expression of a target gene in a cell of an insect (e.g., coleopteran or hemipteran) pest that contacts the transformed plant or plant cell (for example, by feeding on the transformed plant, a part of the plant (e.g., root) or plant cell), such that growth and/or survival of the pest is inhibited.
  • an insect e.g., coleopteran or hemipteran
  • Transgenic plants disclosed herein may display resistance and/or enhanced tolerance to insect pest infestations.
  • Particular transgenic plants may display resistance and/or enhanced protection from one or more coleopteran and/or hemipteran pest(s) selected from the group consisting of: WCR; NCR; SCR; MCR; D.
  • control agents such as an iRNA molecule
  • an insect pest e.g., coleopteran and/or hemipteran
  • Such control agents may cause, directly or indirectly, an impairment in the ability of an insect pest population to feed, grow or otherwise cause damage in a host.
  • a method is provided comprising delivery of a stabilized dsRNA molecule to an insect pest to suppress at least one target gene in the pest, thereby causing RNAi and reducing or eliminating plant damage in a pest host.
  • a method of inhibiting expression of a target gene in the insect pest may result in cessation of growth, survival, and/or development, in the pest.
  • compositions e.g., a topical composition
  • an iRNA e.g. , dsRNA
  • the composition may be a nutritional composition or food source to be fed to the insect pest.
  • Some embodiments comprise making the nutritional composition or food source available to the pest.
  • Ingestion of a composition comprising iRNA molecules may result in the uptake of the molecules by one or more cells of the pest, which may in turn result in the inhibition of expression of at least one target gene in cell(s) of the pest.
  • Ingestion of or damage to a plant or plant cell by an insect pest infestation may be limited or eliminated in or on any host tissue or environment in which the pest is present by providing one or more compositions comprising an iRNA molecule in the host of the pest.
  • compositions and methods disclosed herein may be used together in combinations with other iRNA molecules directed to different targets (e.g., RAS Opposite or ROP (U.S. Patent Application Publication No. 20150176025) and RNAPII (U.S. Patent Application Publication No. 20150176009).
  • targets e.g., RAS Opposite or ROP (U.S. Patent Application Publication No. 20150176025) and RNAPII (U.S. Patent Application Publication No. 20150176009).
  • the potential to affect multiple target sequences in a pest for example in larvae, may increase efficacy and also improve sustainable approaches to insect pest management involving iRNA technologies.
  • the compositions and methods disclosed herein may also be used together in combinations with other methods and compositions for controlling damage by insect (e.g., coleopteran and/or hemipteran) pests.
  • NCR northern corn rootworm (Diabrotica barberi Smith and
  • MCR Mexican corn rootworm (Diabrotica virgifem zeae Krysan and Smith)
  • Coleopteran pest refers to insects of the order Coleoptera, including pest insects in the genus Diabrotica, which feed upon agricultural crops and crop products, including corn and other true grasses.
  • a coleopteran pest is selected from a list comprising D. v. virgifem LeConte (WCR); D. barberi Smith and Lawrence (NCR); D. u. howardi (SCR); D. v. zeae (MCR); D. balteata LeConte; D. u. tenella; D. speciosa Germar; and D. u. undecimpunctata Mannerheim.
  • contact with an organism:
  • an organism e.g., a coleopteran or hemipteran pest
  • the term "contact with” or "uptake by" an organism includes internalization of the nucleic acid molecule into the organism, for example and without limitation: ingestion of the molecule by the organism (e.g., by feeding); contacting the organism with a composition comprising the nucleic acid molecule; and soaking of organisms with a solution comprising the nucleic acid molecule.
  • Contig refers to a DNA sequence that is reconstructed from a set of overlapping DNA segments derived from a single genetic source.
  • Corn plant As used herein, the term “corn plant” refers to a plant of the species, Zea mays (maize).
  • expression of a coding polynucleotide refers to the process by which the coded information of a nucleic acid transcriptional unit (including, e.g., gDNA or cDNA) is converted into an operational, non- operational, or structural part of a cell, often including the synthesis of a protein.
  • Gene expression can be influenced by external signals; for example, exposure of a cell, tissue, or organism to an agent that increases or decreases gene expression. Expression of a gene can also be regulated anywhere in the pathway from DNA to RNA to protein.
  • Regulation of gene expression occurs, for example, through controls acting on transcription, translation, RNA transport and processing, degradation of intermediary molecules such as mRNA, or through activation, inactivation, compartmentalization, or degradation of specific protein molecules after they have been made, or by combinations thereof.
  • Gene expression can be measured at the RNA level or the protein level by any method known in the art, including, without limitation, northern blot, RT-PCR, western blot, or in vitro, in situ, or in vivo protein activity assay(s).
  • Genetic material includes all genes, and nucleic acid molecules, such as DNA and RNA.
  • Hemipteran pest refers to insects of the order Hemiptera, including, for example and without limitation, insects in the families Pentatomidae, Miridae, Pyrrhocoridae, Coreidae, Alydidae, and Rhopalidae, which feed on a wide range of host plants and have piercing and sucking mouth parts.
  • a hemipteran pest is selected from the list comprising, Euschistus hews (Fabr.) (Neotropical Brown Stink Bug), Nezara viridula (L.) (Southern Green Stink Bug), Piezodorus guildinii (Westwood) (Red-banded Stink Bug), Halyomorpha halys (Stal) (Brown Marmorated Stink Bug), Chinavia hilare (Say) (Green Stink Bug), Euschistus servus (Say) (Brown Stink Bug), Dichelops melacanthus (Dallas), Dichelops furcatus (F.), Edessa meditabunda (F.), Thyanta perditor (F.) (Neotropical Red Shouldered Stink Bug), Chinavia marginatum (Palisot de Beauvois), Horcias nobilellus (Berg) (Cotton Bug), Taedia stigmosa (B
  • Inhibition when used to describe an effect on a coding polynucleotide (for example, a gene), refers to a measurable decrease in the cellular level of mRNA transcribed from the coding polynucleotide and/or peptide, polypeptide, or protein product of the coding polynucleotide. In some examples, expression of a coding polynucleotide may be inhibited such that expression is approximately eliminated. "Specific inhibition” refers to the inhibition of a target coding polynucleotide without consequently affecting expression of other coding polynucleotides (e.g., genes) in the cell wherein the specific inhibition is being accomplished.
  • Insect pest specifically includes coleopteran insect pests and hemipteran insect pests. In some embodiments, the term also includes some other insect pests.
  • Isolated An "isolated" biological component (such as a nucleic acid or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs (i.e., other chromosomal and extra-chromosomal DNA and RNA, and proteins), while effecting a chemical or functional change in the component (e.g., a nucleic acid may be isolated from a chromosome by breaking chemical bonds connecting the nucleic acid to the remaining DNA in the chromosome).
  • Nucleic acid molecules and proteins that have been "isolated” include nucleic acid molecules and proteins purified by standard purification methods. The term also embraces nucleic acids and proteins prepared by recombinant expression in a host cell, as well as chemically-synthesized nucleic acid molecules, proteins, and peptides.
  • nucleic acid molecule may refer to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, gDNA, and synthetic forms and mixed polymers of the above.
  • a nucleotide or nucleobase may refer to a ribonucleotide, deoxyribonucleotide, or a modified form of either type of nucleotide.
  • a “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.”
  • a nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified.
  • nucleotide sequence of a nucleic acid molecule is read from the 5' to the 3' end of the molecule.
  • the "complement" of a nucleic acid molecule refers to a polynucleotide having nucleobases that may form base pairs with the nucleobases of the nucleic acid molecule (i.e., A- T/U, and G-C).
  • Some embodiments include nucleic acids comprising a template DNA that is transcribed into an RNA molecule that is the complement of an mRNA molecule.
  • the complement of the nucleic acid transcribed into the mRNA molecule is present in the 5' to 3' orientation, such that RNA polymerase (which transcribes DNA in the 5' to 3' direction) will transcribe a nucleic acid from the complement that can hybridize to the mRNA molecule.
  • the term “complement” therefore refers to a polynucleotide having nucleobases, from 5' to 3', that may form base pairs with the nucleobases of a reference nucleic acid.
  • the "reverse complement” of a nucleic acid refers to the complement in reverse orientation.
  • Some embodiments of the invention include hairpin RNA-forming iRNA molecules.
  • both the complement of a nucleic acid to be targeted by RNA interference and the reverse complement may be found in the same molecule, such that the single- stranded RNA molecule may "fold over" and hybridize to itself over region comprising the complementary and reverse complementary polynucleotides, as demonstrated in the following illustration:
  • Nucleic acid molecules include all polynucleotides, for example: single- and double-stranded forms of DNA; single- stranded forms of RNA; and double- stranded forms of RNA (dsRNA).
  • dsRNA double- stranded forms of RNA
  • nucleotide sequence or “nucleic acid sequence” refers to both the sense and antisense strands of a nucleic acid as either individual single strands or in the duplex.
  • RNA ribonucleic acid
  • RNA is inclusive of iRNA (inhibitory RNA), dsRNA (double stranded RNA), siRNA (small interfering RNA), mRNA (messenger RNA), miRNA (micro-RNA), shRNA (small hairpin RNA), hpRNA (hairpin RNA), tRNA (transfer RNAs, whether charged or discharged with a corresponding acylated amino acid), and cRNA (complementary RNA).
  • deoxyribonucleic acid (DNA) is inclusive of cDNA, gDNA, and DNA-RNA hybrids.
  • polynucleotide “nucleic acid,” “segments” thereof, and “fragments” thereof will be understood by those in the art to include, for example, gDNAs; ribosomal RNAs; transfer RNAs; RNAs; messenger RNAs; operons; smaller engineered polynucleotides that encode or may be adapted to encode peptides, polypeptides, or proteins; and structural and/or functional elements within a nucleic acid molecule that are delineated by their corresponding nucleotide sequence.
  • Oligonucleotide An oligonucleotide is a short nucleic acid polymer. Oligonucleotides may be formed by cleavage of longer nucleic acid segments, or by polymerizing individual nucleotide precursors. Automated synthesizers allow the synthesis of oligonucleotides up to several hundred bases in length. Because oligonucleotides may bind to a complementary nucleic acid, they may be used as probes for detecting DNA or RNA.
  • Oligonucleotides composed of DNA may be used in PCR, a technique for the amplification of DNA and RNA (reverse transcribed into a cDNA) sequences.
  • the oligonucleotide is typically referred to as a "primer,” which allows a DNA polymerase to extend the oligonucleotide and replicate the complementary strand.
  • a nucleic acid molecule may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
  • Nucleic acid molecules may be modified chemically or biochemically, or may contain non-natural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art.
  • nucleic acid molecule also includes any topological conformation, including single- stranded, double- stranded, partially duplexed, triplexed, hairpinned, circular, and padlocked conformations.
  • coding sequence refers to a nucleotide sequence that is ultimately translated into a polypeptide, via transcription and mRNA, when placed under the control of appropriate regulatory sequences.
  • coding sequence refers to a nucleotide sequence that is translated into a peptide, polypeptide, or protein. The boundaries of a coding sequence are determined by a translation start codon at the 5'-terminus and a translation stop codon at the 3'-terminus. Coding sequences include, but are not limited to: genomic DNA; cDNA; EST; and recombinant nucleotide sequences.
  • Genome refers to chromosomal DNA found within the nucleus of a cell, and also refers to organelle DNA found within subcellular components of the cell.
  • a DNA molecule may be introduced into a plant cell such that the DNA molecule is integrated into the genome of the plant cell.
  • the DNA molecule may be either integrated into the nuclear DNA of the plant cell, or integrated into the DNA of the chloroplast or mitochondrion of the plant cell.
  • the term "genome” as it applies to bacteria refers to both the chromosome and plasmids within the bacterial cell.
  • a DNA molecule may be introduced into a bacterium such that the DNA molecule is integrated into the genome of the bacterium.
  • the DNA molecule may be either chromosomally-integrated or located as or in a stable plasmid.
  • Sequence identity The term "sequence identity” or “identity”, as used herein in the context of two nucleic acid or polypeptide sequences, refers to the residues in the two sequences that are the same when aligned for maximum correspondence over a specified comparison window.
  • the term "percentage of sequence identity” may refer to the value determined by comparing two optimally aligned sequences (e.g., nucleic acid sequences or polypeptide sequences) over a comparison window, wherein the portion of the sequence in the comparison window may comprise additions or deletions (i.e. , gaps) as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
  • the percentage is calculated by determining the number of positions at which the identical nucleotide or amino acid residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the comparison window, and multiplying the result by 100 to yield the percentage of sequence identity.
  • a sequence that is identical at every position in comparison to a reference sequence is said to be 100% identical to the reference sequence, and vice-versa.
  • Specifically hybridizable/Specifically complementary are terms that indicate a sufficient degree of complementarity such that stable and specific binding occurs between the nucleic acid molecule and a target nucleic acid molecule.
  • Hybridization between two nucleic acid molecules involves the formation of an anti-parallel alignment between the nucleic acid sequences of the two nucleic acid molecules. The two molecules are then able to form hydrogen bonds with corresponding bases on the opposite strand to form a duplex molecule that, if it is sufficiently stable, is detectable using methods well known in the art.
  • a nucleic acid molecule need not be 100% complementary to its target sequence to be specifically hybridizable. However, the amount of sequence complementarity that must exist for hybridization to be specific is a function of the hybridization conditions used.
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na + and/or Mg ++ concentration) of the hybridization will determine the stringency of hybridization. The ionic strength of the wash buffer and the wash temperature also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are known to those of ordinary skill in the art, and are discussed, for example, in Sambrook et al. (ed.) Molecular Cloning: A Laboratory Manual, 2 nd ed., vol.
  • stringent conditions encompass conditions under which hybridization will occur only if there is more than 80% sequence match between the hybridization molecule and a homologous sequence within the target nucleic acid molecule.
  • Stringent conditions include further particular levels of stringency.
  • “moderate stringency” conditions are those under which molecules with more than 80% sequence match ⁇ i.e. having less than 20% mismatch) will hybridize; conditions of “high stringency” are those under which sequences with more than 90% match ⁇ i.e. having less than 10% mismatch) will hybridize; and conditions of "very high stringency” are those under which sequences with more than 95% match ⁇ i.e. having less than 5% mismatch) will hybridize.
  • High Stringency condition detects sequences that share at least 90% sequence identity: Hybridization in 5x SSC buffer at 65°C for 16 hours; wash twice in 2x SSC buffer at room temperature for 15 minutes each; and wash twice in 0.5x SSC buffer at 65°C for 20 minutes each.
  • Moderate Stringency condition detects sequences that share at least 80% sequence identity: Hybridization in 5x-6x SSC buffer at 65-70°C for 16-20 hours; wash twice in 2x SSC buffer at room temperature for 5-20 minutes each; and wash twice in lx SSC buffer at 55-70°C for 30 minutes each.
  • Non-stringent control condition (sequences that share at least 50% sequence identity will hybridize): Hybridization in 6x SSC buffer at room temperature to 55 °C for 16-20 hours; wash at least twice in 2x-3x SSC buffer at room temperature to 55°C for 20-30 minutes each.
  • substantially homologous or substantially homology refers to a polynucleotide having contiguous nucleobases that hybridize under stringent conditions to the reference nucleic acid.
  • substantially homologous polynucleotides may have from about 80% to 100% sequence identity, such as 79%; 80%; about 81%; about 82%; about 83%; about 84%; about 85%; about 86%; about 87%; about 88%; about 89%; about 90%; about 91%; about 92%; about 93%; about 94% about 95%; about 96%; about 97%; about 98%; about 98.5%; about 99%; about 99.5%; and about 100%.
  • the property of substantial homology is closely related to specific hybridization.
  • a nucleic acid molecule is specifically hybridizable when there is a sufficient degree of complementarity to avoid non-specific binding of the nucleic acid to non-target polynucleotides under conditions where specific binding is desired, for example, under stringent hybridization conditions.
  • ortholog refers to a gene in two or more species that has evolved from a common ancestral nucleic acid, and may retain the same function in the two or more species.
  • nucleic acid molecules are said to exhibit "complete complementarity" when every nucleotide of a polynucleotide read in the 5' to 3' direction is complementary to every nucleotide of the other polynucleotide when read in the 3' to 5' direction.
  • a polynucleotide that is complementary to a reference polynucleotide will exhibit a sequence identical to the reverse complement of the reference polynucleotide.
  • Operably linked A first polynucleotide is operably linked with a second polynucleotide when the first polynucleotide is in a functional relationship with the second polynucleotide.
  • operably linked polynucleotides are generally contiguous, and, where necessary to join two protein-coding regions, in the same reading frame (e.g., in a translationally fused ORF).
  • nucleic acids need not be contiguous to be operably linked.
  • operably linked when used in reference to a regulatory genetic element and a coding polynucleotide, means that the regulatory element affects the expression of the linked coding polynucleotide.
  • regulatory elements or “control elements,” refer to polynucleotides that influence the timing and level/amount of transcription, RNA processing or stability, or translation of the associated coding polynucleotide. Regulatory elements may include promoters; translation leaders; introns; enhancers; stem-loop structures; repressor binding polynucleotides; polynucleotides with a termination sequence; polynucleotides with a polyadenylation recognition sequence; etc.
  • Particular regulatory elements may be located upstream and/or downstream of a coding polynucleotide operably linked thereto. Also, particular regulatory elements operably linked to a coding polynucleotide may be located on the associated complementary strand of a double- stranded nucleic acid molecule.
  • promoter refers to a region of DNA that may be upstream from the start of transcription, and that may be involved in recognition and binding of RNA polymerase and other proteins to initiate transcription.
  • a promoter may be operably linked to a coding polynucleotide for expression in a cell, or a promoter may be operably linked to a polynucleotide encoding a signal peptide which may be operably linked to a coding polynucleotide for expression in a cell.
  • a "plant promoter” may be a promoter capable of initiating transcription in plant cells.
  • promoters under developmental control include promoters that preferentially initiate transcription in certain tissues, such as leaves, roots, seeds, fibers, xylem vessels, tracheids, or sclerenchyma. Such promoters are referred to as "tissue-preferred”. Promoters which initiate transcription only in certain tissues are referred to as “tissue-specific”. A "cell type- specific" promoter primarily drives expression in certain cell types in one or more organs, for example, vascular cells in roots or leaves.
  • An “inducible” promoter may be a promoter which may be under environmental control. Examples of environmental conditions that may initiate transcription by inducible promoters include anaerobic conditions and the presence of light.
  • Tissue-specific, tissue-preferred, cell type specific, and inducible promoters constitute the class of "non- constitutive" promoters.
  • a “constitutive” promoter is a promoter which may be active under most environmental conditions or in most tissue or cell types.
  • any inducible promoter can be used in some embodiments of the invention. See Ward et al. (1993) Plant Mol. Biol. 22:361-366. With an inducible promoter, the rate of transcription increases in response to an inducing agent.
  • exemplary inducible promoters include, but are not limited to: Promoters from the ACEI system that respond to copper; ln2 gene from maize that responds to benzenesulfonamide herbicide safeners; Tet repressor from TnlO; and the inducible promoter from a steroid hormone gene, the transcriptional activity of which may be induced by a glucocorticosteroid hormone (Schena et al. (1991) Proc. Natl. Acad. Sci. USA 88:0421).
  • Exemplary constitutive promoters include, but are not limited to: Promoters from plant viruses, such as the 35S promoter from Cauliflower Mosaic Virus (CaMV); promoters from rice actin genes; ubiquitin promoters; pEMU; MAS; maize H3 histone promoter; and the ALS promoter, Xbal/Ncol fragment 5' to the Brassica napus ALS3 structural gene (or a polynucleotide similar to said Xbal/Ncol fragment) (International PCT Publication No. WO96/30530).
  • Promoters from plant viruses such as the 35S promoter from Cauliflower Mosaic Virus (CaMV); promoters from rice actin genes; ubiquitin promoters; pEMU; MAS; maize H3 histone promoter; and the ALS promoter, Xbal/Ncol fragment 5' to the Brassica napus ALS3 structural gene (or a polynucleotide similar to said Xbal/Ncol fragment)
  • tissue-specific or tissue-preferred promoter may be utilized in some embodiments of the invention. Plants transformed with a nucleic acid molecule comprising a coding polynucleotide operably linked to a tissue-specific promoter may produce the product of the coding polynucleotide exclusively, or preferentially, in a specific tissue.
  • tissue-specific or tissue-preferred promoters include, but are not limited to: A seed-preferred promoter, such as that from the phaseolin gene; a leaf- specific and light-induced promoter such as that from cab or rubisco; an anther- specific promoter such as that from LAT52; a pollen- specific promoter such as that from Zml3; and a microspore-preferred promoter such as that from apg.
  • Soybean plant refers to a plant of the species Glycine sp.; for example, G. max.
  • transformation refers to the transfer of one or more nucleic acid molecule(s) into a cell.
  • a cell is "transformed” by a nucleic acid molecule transduced into the cell when the nucleic acid molecule becomes stably replicated by the cell, either by incorporation of the nucleic acid molecule into the cellular genome, or by episomal replication.
  • transformation encompasses all techniques by which a nucleic acid molecule can be introduced into such a cell. Examples include, but are not limited to: transfection with viral vectors; transformation with plasmid vectors; electroporation (Fromm et al.
  • Transgene An exogenous nucleic acid.
  • a transgene may be a DNA that encodes one or both strand(s) of an RNA capable of forming a dsRNA molecule that comprises a polynucleotide that is complementary to a nucleic acid molecule found in a coleopteran and/or hemipteran pest.
  • a transgene may be a gene (e.g., a herbicide-tolerance gene, a gene encoding an industrially or pharmaceutically useful compound, or a gene encoding a desirable agricultural trait).
  • a transgene may contain regulatory elements operably linked to a coding polynucleotide of the transgene (e.g., a promoter).
  • Vector A nucleic acid molecule as introduced into a cell, for example, to produce a transformed cell.
  • a vector may include genetic elements that permit it to replicate in the host cell, such as an origin of replication. Examples of vectors include, but are not limited to: a plasmid; cosmid; bacteriophage; or virus that carries exogenous DNA into a cell.
  • a vector may also include one or more genes, including ones that produce antisense molecules, and/or selectable marker genes and other genetic elements known in the art.
  • a vector may transduce, transform, or infect a cell, thereby causing the cell to express the nucleic acid molecules and/or proteins encoded by the vector.
  • a vector optionally includes materials to aid in achieving entry of the nucleic acid molecule into the cell (e.g., a liposome, protein coating, etc.).
  • Yield A stabilized yield of about 100% or greater relative to the yield of check varieties in the same growing location growing at the same time and under the same conditions.
  • "improved yield” or “improving yield” means a cultivar having a stabilized yield of 105% or greater relative to the yield of check varieties in the same growing location containing significant densities of the coleopteran and/or hemipteran pests that are injurious to that crop growing at the same time and under the same conditions, which pests are targeted by the compositions and methods herein.
  • nucleic acid molecules useful for the control of insect pests are useful for the control of insect pests.
  • the insect pest is a coleopteran or hemipteran insect pest.
  • Described nucleic acid molecules include target polynucleotides (e.g., native genes, and non-coding polynucleotides), dsRNAs, siRNAs, shRNAs, hpRNAs, and miRNAs.
  • target polynucleotides e.g., native genes, and non-coding polynucleotides
  • dsRNAs e.g., native genes, and non-coding polynucleotides
  • siRNAs siRNAs
  • shRNAs e.g., shRNAs
  • hpRNAs e.g., miRNA molecules
  • miRNAs e.g., miRNA, shRNA, and/or hpRNA molecules
  • At least one target gene in an insect pest may be selected, wherein the target gene comprises a COPI alpha (SEQ ID NO: l or SEQ ID NO: 84).
  • a target gene in a coleopteran or hemipteran pest is selected, wherein the target gene comprises a novel nucleotide sequence comprising COPI alpha (SEQ ID NO: 1 or SEQ ID NO:84).
  • a target gene may be a nucleic acid molecule comprising a polynucleotide that can be translated in silico to a polypeptide comprising a contiguous amino acid sequence that is at least about 85% identical (e.g., at least 84%, 85%, about 90%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, or 100% identical) to the amino acid sequence of a protein product of COPI alpha (SEQ ID NO: l or SEQ ID NO: 84).
  • RNAs the expression of which results in an RNA molecule comprising a polynucleotide that is specifically complementary to all or part of a native RNA molecule that is encoded by a coding polynucleotide in an insect (e.g., coleopteran and/or hemipteran) pest.
  • an insect pest e.g., coleopteran and/or hemipteran
  • down-regulation of the coding polynucleotide in cells of the pest may be obtained.
  • down-regulation of the coding sequence in cells of the insect pest may result in a deleterious effect on the growth, development, and/or survival of the pest.
  • target polynucleotides include transcribed non-coding RNAs, such as 5'UTRs; 3'UTRs; spliced leaders; introns; outrons (e.g., 5'UTR RNA subsequently modified in trans splicing); donatrons (e.g., non-coding RNA required to provide donor sequences for trans splicing); and other non-coding transcribed RNA of target insect pest genes.
  • Such polynucleotides may be derived from both mono-cistronic and poly-cistronic genes.
  • iRNA molecules ⁇ e.g., dsRNAs, siRNAs, miRNAs, shRNAs, and hpRNAs
  • iRNA molecules that comprise at least one polynucleotide that is specifically complementary to all or part of a target nucleic acid in an insect ⁇ e.g., coleopteran and/or hemipteran) pest.
  • an iRNA molecule may comprise polynucleotide(s) that are complementary to all or part of a plurality of target nucleic acids; for example, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more target nucleic acids.
  • an iRNA molecule may be produced in vitro, or in vivo by a genetically-modified organism, such as a plant or bacterium.
  • a genetically-modified organism such as a plant or bacterium.
  • cDNAs that may be used for the production of dsRNA molecules, siRNA molecules, miRNA molecules, shRNA molecules, and/or hpRNA molecules that are specifically complementary to all or part of a target nucleic acid in an insect pest.
  • recombinant DNA constructs for use in achieving stable transformation of particular host targets. Transformed host targets may express effective levels of dsRNA, siRNA, miRNA, shRNA, and/or hpRNA molecules from the recombinant DNA constructs.
  • a plant transformation vector comprising at least one polynucleotide operably linked to a heterologous promoter functional in a plant cell, wherein expression of the polynucleotide(s) results in an RNA molecule comprising a string of contiguous nucleobases that is specifically complementary to all or part of a target nucleic acid in an insect pest.
  • nucleic acid molecules useful for the control of insect ⁇ e.g., coleopteran and/or hemipteran) pests may include: all or part of a native nucleic acid isolated from Diabrotica or hemipteran organism comprising COPI alpha (SEQ ID NO:l or SEQ ID NO:84) DNAs; nucleotide sequences that when expressed result in an RNA molecule comprising a polynucleotide that is specifically complementary to all or part of a native RNA molecule that is encoded by COPI alpha (SEQ ID NO:l or SEQ ID NO:84); iRNA molecules ⁇ e.g., dsRNAs, siRNAs, miRNAs, shRNAs, and hpRNAs) that comprise at least one polynucleotide that is specifically complementary to all or part of COPI alpha (SEQ ID NO: 1 or SEQ ID NO: 84); cDNA sequences that may be used for the production of dsRNA
  • the present invention provides, inter alia, iRNA ⁇ e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA) molecules that inhibit target gene expression in a cell, tissue, or organ of an insect ⁇ e.g., coleopteran and/or hemipteran) pest; and DNA molecules capable of being expressed as an iRNA molecule in a cell or microorganism to inhibit target gene expression in a cell, tissue, or organ of an insect pest.
  • iRNA ⁇ e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA DNA molecules capable of being expressed as an iRNA molecule in a cell or microorganism to inhibit target gene expression in a cell, tissue, or organ of an insect pest.
  • Some embodiments of the invention provide an isolated nucleic acid molecule comprising at least one ⁇ e.g., one, two, three, or more) polynucleotide(s) selected from the group consisting of: any of SEQ ID NOs:l or 84; the complement of any of SEQ ID NOs: l or 84; a fragment of at least 15 contiguous nucleotides of any of SEQ ID NO: l or SEQ ID NO:84; the complement of a fragment of at least 15 contiguous nucleotides of any of SEQ ID NO: l or SEQ ID NO:84; a native coding polynucleotide of a Diabrotica organism ⁇ e.g., WCR) comprising SEQ ID NO:l; a native coding sequence of a hemipteran organism comprising SEQ ID NO: 84; the complement of a native coding sequence of a Diabrotica organism comprising SEQ ID NO:l; ; the complement of a native coding sequence of
  • a nucleic acid molecule of the invention may comprise at least one ⁇ e.g., one, two, three, or more) DNA(s) capable of being expressed as an iRNA molecule in a cell or microorganism to inhibit target gene expression in a cell, tissue, or organ of a coleopteran and/or hemipteran pest.
  • DNA(s) may be operably linked to a promoter that functions in a cell comprising the DNA molecule to initiate or enhance the transcription of the encoded RNA capable of forming a dsRNA molecule(s).
  • a fragment of SEQ ID NO: 1 or SEQ ID NO:84 may comprise, for example, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30, about 40, ⁇ e.g., 35, 36, 37, 38, 39, 40, 41, 42, 43, 44,and 45), about 50, about 60, about 70, about 80, about 90, about 100, about 110, about 120, about 130, about 140, about 150, about 160, about 170, about 180, about 190, about 200 or more contiguous nucleotides of SEQ ID NO: l and/or SEQ ID NO:84, or a complement thereof.
  • Some embodiments comprise introducing partially- or fully- stabilized dsRNA molecules into a coleopteran and/or hemipteran pest to inhibit expression of a target gene in a cell, tissue, or organ of the coleopteran and/or hemipteran pest.
  • polynucleotides When expressed as an iRNA molecule (e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA) and taken up by a coleopteran and/or hemipteran pest, polynucleotides comprising one or more fragments of any of SEQ ID NO: l or SEQ ID NO: 84 and the complements thereof, may cause one or more of death, developmental arrest, growth inhibition, change in sex ratio, reduction in brood size, cessation of infection, and/or cessation of feeding by a coleopteran and/or hemipteran pest.
  • iRNA molecule e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA
  • polynucleotides comprising one or more fragments of any of SEQ ID NO: l or SEQ ID NO: 84 and the complements thereof, may cause one or more of death, developmental arrest, growth inhibition, change in sex ratio,
  • a dsRNA molecule comprising a nucleotide sequence including about 15 to about 300 or about 19 to about 300 nucleotides that are substantially homologous to a coleopteran and/or hemipteran pest target gene sequence and comprising one or more fragments of a nucleotide sequence comprising SEQ ID NO: l or SEQ ID NO: 84 is provided.
  • Expression of such a dsRNA molecule may, for example, lead to mortality and/or growth inhibition in a coleopteran and/or hemipteran pest that takes up the dsRNA molecule.
  • dsRNA molecules provided by the invention comprise polynucleotides complementary to a transcript from a target gene comprising SEQ ID NO: l or SEQ ID NO:84 and/or nucleotide sequences complementary to a fragment of SEQ ID NO: l or SEQ ID NO:84, the inhibition of which target gene in an insect pest results in the reduction or removal of a polypeptide or polynucleotide agent that is essential for the pest's growth, development, or other biological function.
  • a selected polynucleotide may exhibit 79%; 80%; about 81%; about 82%; about 83%; about 84%; about 85%; about 86%; about 87%; about 88%; about 89%; about 90%; about 91%; about 92%; about 93%; about 94% about 95%; about 96%; about 97%; about 98%; about 98.5%; about 99%; about 99.5%; or about 100% sequence identity to any of SEQ ID NO: l or SEQ ID NO:84, a contiguous fragment of the nucleotide sequence set forth in SEQ ID NO: l or SEQ ID NO: 84, or the complement of either of the foregoing.
  • a DNA molecule capable of being expressed as an iRNA molecule in a cell or microorganism to inhibit target gene expression may comprise a single polynucleotide that is specifically complementary to all or part of a native polynucleotide found in one or more target insect pest species (e.g., a coleopteran or hemipteran pest species), or the DNA molecule can be constructed as a chimera from a plurality of such specifically complementary polynucleotides.
  • target insect pest species e.g., a coleopteran or hemipteran pest species
  • a nucleic acid molecule may comprise a first and a second polynucleotide separated by a "spacer."
  • a spacer may be a region comprising any sequence of nucleotides that facilitates secondary structure formation between the first and second polynucleotides, where this is desired.
  • the spacer is part of a sense or antisense coding polynucleotide for mRNA.
  • the spacer may alternatively comprise any combination of nucleotides or homologues thereof that are capable of being linked covalently to a nucleic acid molecule.
  • the spacer may be an intron (e.g., an ST-LS 1 intron or a RTM1 intron).
  • the DNA molecule may comprise a polynucleotide coding for one or more different iRNA molecules, wherein each of the different iRNA molecules comprises a first polynucleotide and a second polynucleotide, wherein the first and second polynucleotides are complementary to each other.
  • the first and second polynucleotides may be connected within an RNA molecule by a spacer.
  • the spacer may constitute part of the first polynucleotide or the second polynucleotide.
  • RNA molecule comprising the first and second nucleotide polynucleotides may lead to the formation of a dsRNA molecule, by specific intramolecular base-pairing of the first and second nucleotide polynucleotides.
  • the first polynucleotide or the second polynucleotide may be substantially identical to a polynucleotide (e.g. , a target gene, or transcribed non-coding polynucleotide) native to an insect pest (e.g., a coleopteran or hemipteran pest), a derivative thereof, or a complementary polynucleotide thereto.
  • dsRNA nucleic acid molecules comprise double strands of polymerized ribonucleotides, and may include modifications to either the phosphate-sugar backbone or the nucleoside. Modifications in RNA structure may be tailored to allow specific inhibition.
  • dsRNA molecules may be modified through a ubiquitous enzymatic process so that siRNA molecules may be generated. This enzymatic process may utilize an RNase III enzyme, such as DICER in eukaryotes, either in vitro or in vivo. See Elbashir et al. (2001) Nature 411 :494-8; and Hamilton and Baulcombe (1999) Science 286(5441):950-2.
  • DICER or functionally-equivalent RNase ⁇ enzymes cleave larger dsRNA strands and/or hpRNA molecules into smaller oligonucleotides ⁇ e.g., siRNAs), each of which is about 19-25 nucleotides in length.
  • the siRNA molecules produced by these enzymes have 2 to 3 nucleotide 3' overhangs, and 5' phosphate and 3' hydroxyl termini.
  • the siRNA molecules generated by RNase ⁇ enzymes are unwound and separated into single- stranded RNA in the cell. The siRNA molecules then specifically hybridize with RNAs transcribed from a target gene, and both RNA molecules are subsequently degraded by an inherent cellular RNA-degrading mechanism.
  • siRNA molecules produced by endogenous RNase ⁇ enzymes from heterologous nucleic acid molecules may efficiently mediate the down-regulation of target genes in coleopteran and/or hemipteran pests.
  • a nucleic acid molecule may include at least one non- naturally occurring polynucleotide that can be transcribed into a single- stranded RNA molecule capable of forming a dsRNA molecule in vivo through intermolecular hybridization.
  • dsRNAs typically self-assemble, and can be provided in the nutrition source of an insect ⁇ e.g., coleopteran or hemipteran) pest to achieve the post-transcriptional inhibition of a target gene.
  • a nucleic acid molecule may comprise two different non-naturally occurring polynucleotides, each of which is specifically complementary to a different target gene in an insect pest.
  • a nucleic acid molecule When such a nucleic acid molecule is provided as a dsRNA molecule to, for example, a coleopteran and/or hemipteran pest, the dsRNA molecule inhibits the expression of at least two different target genes in the pest.
  • a variety of polynucleotides in insect ⁇ e.g., coleopteran and hemipteran pests may be used as targets for the design of nucleic acid molecules, such as iRNAs and DNA molecules encoding iRNAs. Selection of native polynucleotides is not, however, a straight-forward process. For example, only a small number of native polynucleotides in a coleopteran or hemipteran pest will be effective targets.
  • a polynucleotide, either DNA or RNA, derived from an insect pest can be used to construct plant cells resistant to infestation by the pests.
  • the host plant of the coleopteran and/or hemipteran pest e.g., Z. mays or G. max
  • the polynucleotide transformed into the host may encode one or more RNAs that form into a dsRNA structure in the cells or biological fluids within the transformed host, thus making the dsRNA available if/when the pest forms a nutritional relationship with the transgenic host. This may result in the suppression of expression of one or more genes in the cells of the pest, and ultimately death or inhibition of its growth or development.
  • a gene is targeted that is essentially involved in the growth and development of an insect (e.g., coleopteran or hemipteran) pest.
  • Other target genes for use in the present invention may include, for example, those that play important roles in pest movement, migration, growth, development, infectivity, and establishment of feeding sites.
  • a target gene may therefore be a housekeeping gene or a transcription factor.
  • a native insect pest polynucleotide for use in the present invention may also be derived from a homolog (e.g., an ortholog), of a plant, viral, bacterial or insect gene, the function of which is known to those of skill in the art, and the polynucleotide of which is specifically hybridizable with a target gene in the genome of the target pest.
  • a homolog e.g., an ortholog
  • Methods of identifying a homolog of a gene with a known nucleotide sequence by hybridization are known to those of skill in the art.
  • the invention provides methods for obtaining a nucleic acid molecule comprising a polynucleotide for producing an iRNA (e.g. , dsRNA, siRNA, miRNA, shRNA, and hpRNA) molecule.
  • iRNA e.g. , dsRNA, siRNA, miRNA, shRNA, and hpRNA
  • One such embodiment comprises: (a) analyzing one or more target gene(s) for their expression, function, and phenotype upon dsRNA-mediated gene suppression in an insect (e.g., coleopteran or hemipteran) pest; (b) probing a cDNA or gDNA library with a probe comprising all or a portion of a polynucleotide or a homolog thereof from a targeted pest that displays an altered (e.g., reduced) growth or development phenotype in a dsRNA- mediated suppression analysis; (c) identifying a DNA clone that specifically hybridizes with the probe; (d) isolating the DNA clone identified in step (b); (e) sequencing the cDNA or gDNA fragment that comprises the clone isolated in step (d), wherein the sequenced nucleic acid molecule comprises all or a substantial portion of the RNA or a homolog thereof; and (f) chemically synthesizing all or a substantial portion of a
  • a method for obtaining a nucleic acid fragment comprising a polynucleotide for producing a substantial portion of an iRNA (e.g. , dsRNA, siRNA, miRNA, shRNA, and hpRNA) molecule includes: (a) synthesizing first and second oligonucleotide primers specifically complementary to a portion of a native polynucleotide from a targeted insect (e.g., coleopteran or hemipteran) pest; and (b) amplifying a cDNA or gDNA insert present in a cloning vector using the first and second oligonucleotide primers of step (a), wherein the amplified nucleic acid molecule comprises a substantial portion of a siRNA, miRNA, hpRNA, mRNA, shRNA, or dsRNA molecule.
  • a targeted insect e.g., coleopteran or hemipteran
  • Nucleic acids can be isolated, amplified, or produced by a number of approaches.
  • an iRNA e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA
  • a target polynucleotide e.g., a target gene or a target transcribed non-coding polynucleotide
  • DNA or RNA may be extracted from a target organism, and nucleic acid libraries may be prepared therefrom using methods known to those ordinarily skilled in the art.
  • gDNA or cDNA libraries generated from a target organism may be used for PCR amplification and sequencing of target genes.
  • a confirmed PCR product may be used as a template for in vitro transcription to generate sense and antisense RNA with minimal promoters.
  • nucleic acid molecules may be synthesized by any of a number of techniques (See, e.g., Ozaki et al. (1992) Nucleic Acids Research, 20: 5205- 5214; and Agrawal et al. (1990) Nucleic Acids Research, 18: 5419-5423), including use of an automated DNA synthesizer (for example, a P.E. Biosystems, Inc. (Foster City, Calif.) model 392 or 394 DNA/RNA Synthesizer), using standard chemistries, such as phosphoramidite chemistry.
  • RNA, dsRNA, siRNA, miRNA, shRNA, or hpRNA molecule of the present invention may be produced chemically or enzymatically by one skilled in the art through manual or automated reactions, or in vivo in a cell comprising a nucleic acid molecule comprising a polynucleotide encoding the RNA, dsRNA, siRNA, miRNA, shRNA, or hpRNA molecule.
  • RNA may also be produced by partial or total organic synthesis- any modified ribonucleotide can be introduced by in vitro enzymatic or organic synthesis.
  • RNA molecule may be synthesized by a cellular RNA polymerase or a bacteriophage RNA polymerase (e.g., T3 RNA polymerase, T7 RNA polymerase, and SP6 RNA polymerase).
  • a cellular RNA polymerase e.g., T3 RNA polymerase, T7 RNA polymerase, and SP6 RNA polymerase.
  • Expression constructs useful for the cloning and expression of polynucleotides are known in the art. See, e.g., International PCT Publication No. WO97/32016; and U.S. Patents 5,593,874, 5,698,425, 5,712,135, 5,789,214, and 5,804,693.
  • RNA molecules that are synthesized chemically or by in vitro enzymatic synthesis may be purified prior to introduction into a cell.
  • RNA molecules can be purified from a mixture by extraction with a solvent or resin, precipitation, electrophoresis, chromatography, or a combination thereof.
  • RNA molecules that are synthesized chemically or by in vitro enzymatic synthesis may be used with no or a minimum of purification, for example, to avoid losses due to sample processing.
  • the RNA molecules may be dried for storage or dissolved in an aqueous solution.
  • the solution may contain buffers or salts to promote annealing, and/or stabilization of dsRNA molecule duplex strands.
  • a dsRNA molecule may be formed by a single self- complementary RNA strand or from two complementary RNA strands. dsRNA molecules may be synthesized either in vivo or in vitro. An endogenous RNA polymerase of the cell may mediate transcription of the one or two RNA strands in vivo, or cloned RNA polymerase may be used to mediate transcription in vivo or in vitro.
  • Post- transcriptional inhibition of a target gene in an insect pest may be host-targeted by specific transcription in an organ, tissue, or cell type of the host (e.g., by using a tissue-specific promoter); stimulation of an environmental condition in the host (e.g., by using an inducible promoter that is responsive to infection, stress, temperature, and/or chemical inducers); and/or engineering transcription at a developmental stage or age of the host (e.g., by using a developmental stage- specific promoter).
  • RNA strands that form a dsRNA molecule may or may not be polyadenylated, and may or may not be capable of being translated into a polypeptide by a cell's translational apparatus.
  • the invention also provides a DNA molecule for introduction into a cell (e.g., a bacterial cell, a yeast cell, or a plant cell), wherein the DNA molecule comprises a polynucleotide that, upon expression to RNA and ingestion by an insect (e.g., coleopteran and/or hemipteran) pest, achieves suppression of a target gene in a cell, tissue, or organ of the pest.
  • a cell e.g., a bacterial cell, a yeast cell, or a plant cell
  • an insect e.g., coleopteran and/or hemipteran
  • some embodiments provide a recombinant nucleic acid molecule comprising a polynucleotide capable of being expressed as an iRNA (e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA) molecule in a plant cell to inhibit target gene expression in an insect pest.
  • a recombinant nucleic acid molecule comprising a polynucleotide capable of being expressed as an iRNA (e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA) molecule in a plant cell to inhibit target gene expression in an insect pest.
  • iRNA e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA
  • a recombinant nucleic acid molecules may comprise one or more regulatory elements, which regulatory elements may be operably linked to the polynucleotide capable of being expressed as an iRNA.
  • Methods to express a gene suppression molecule in plants are known,
  • a recombinant DNA molecule of the invention may comprise a polynucleotide encoding an RNA that may form a dsRNA molecule.
  • Such recombinant DNA molecules may encode RNAs that may form dsRNA molecules capable of inhibiting the expression of endogenous target gene(s) in an insect (e.g., coleopteran and or hemipteran) pest cell upon ingestion.
  • a transcribed RNA may form a dsRNA molecule that may be provided in a stabilized form; e.g., as a hairpin and stem and loop structure.
  • one strand of a dsRNA molecule may be formed by transcription from a polynucleotide which is substantially homologous to a polynucleotide selected from the group consisting of any of SEQ ID NO:l; the complement of SEQ ID NO:l; a fragment of at least 15 contiguous nucleotides of SEQ ID NO: l; the complement of a fragment of at least 15 contiguous nucleotides of SEQ ID NO: l; a native coding sequence of a Diabwtica organism (e.g., WCR) comprising SEQ ID NO:l; the complement of a native coding sequence of a Diabwtica organism comprising SEQ ID NO: l; a native non-coding sequence of a Diabwtica organism that is transcribed into a native RNA molecule comprising SEQ ID NO:l; the complement of a native non- coding sequence of a Diabwtica organism that is transcribed into a native RNA molecule comprising SEQ ID NO
  • hews organism comprising SEQ ID NO: l; and the complement of a fragment of at least 15 contiguous nucleotides of a native coding polynucleotide of a E. hews organism comprising SEQ ID NO:l.
  • one strand of a dsRNA molecule may be formed by transcription from a polynucleotide that is substantially homologous to a polynucleotide selected from the group consisting of SEQ ID NO:84; the complement of SEQ ID NO:84; a fragment of at least 15 contiguous nucleotides of SEQ ID NO: 84; the complement of a fragment of at least 15 contiguous nucleotides of SEQ ID NO:84; a native coding sequence of a hemipteran organism comprising SEQ ID NO: 84; the complement of a native coding sequence of a hemipteran organism comprising SEQ ID NO:84; a native non-coding sequence of a hemipteran organism that is transcribed into a native RNA molecule comprising SEQ ID NO: 84; the complement of a native non-coding sequence of a hemipteran organism that is transcribed into a native RNA molecule comprising SEQ ID NO: 84;
  • a recombinant DNA molecule encoding an RNA that may form a dsRNA molecule may comprise a coding region wherein at least two polynucleotides are arranged such that one polynucleotide is in a sense orientation, and the other polynucleotide is in an antisense orientation, relative to at least one promoter, wherein the sense polynucleotide and the antisense polynucleotide are linked or connected by a spacer of, for example, from about five ( ⁇ 5) to about one thousand (-1000) nucleotides.
  • the spacer may form a loop between the sense and antisense polynucleotides.
  • the sense polynucleotide or the antisense polynucleotide may be substantially homologous to a target gene (e.g., a gene comprising SEQ ID NO: l or SEQ ID NO:84) or fragment thereof.
  • a recombinant DNA molecule may encode an RNA that may form a dsRNA molecule without a spacer.
  • a sense coding polynucleotide and an antisense coding polynucleotide may be different lengths.
  • Polynucleotides identified as having a deleterious effect on an insect pest or a plant-protective effect with regard to the pest may be readily incorporated into expressed dsRNA molecules through the creation of appropriate expression cassettes in a recombinant nucleic acid molecule of the invention.
  • such polynucleotides may be expressed as a hairpin with stem and loop structure by taking a first segment corresponding to a target gene polynucleotide (e.g., SEQ ID NO: l or SEQ ID NO:84 and fragments thereof); linking this polynucleotide to a second segment spacer region that is not homologous or complementary to the first segment; and linking this to a third segment, wherein at least a portion of the third segment is substantially complementary to the first segment.
  • a construct forms a stem and loop structure by intramolecular base-pairing of the first segment with the third segment, wherein the loop structure forms comprising the second segment. See, e.g., U.S. Patent Publication Nos.
  • a dsRNA molecule may be generated, for example, in the form of a double- stranded structure such as a stem- loop structure (e.g., hairpin), whereby production of siRNA targeted for a native insect (e.g., coleopteran and/or hemipteran) pest polynucleotide is enhanced by co-expression of a fragment of the targeted gene, for instance on an additional plant expressible cassette, that leads to enhanced siRNA production, or reduces methylation to prevent transcriptional gene silencing of the dsRNA hairpin promoter.
  • a native insect e.g., coleopteran and/or hemipteran
  • Embodiments of the invention include introduction of a recombinant nucleic acid molecule of the present invention into a plant (i.e., transformation) to achieve insect (e.g., coleopteran and/or hemipteran) pest-inhibitory levels of expression of one or more iRNA molecules.
  • a recombinant DNA molecule may, for example, be a vector, such as a linear or a closed circular plasmid.
  • the vector system may be a single vector or plasmid, or two or more vectors or plasmids that together contain the total DNA to be introduced into the genome of a host.
  • a vector may be an expression vector.
  • Nucleic acids of the invention can, for example, be suitably inserted into a vector under the control of a suitable promoter that functions in one or more hosts to drive expression of a linked coding polynucleotide or other DNA element.
  • a suitable promoter that functions in one or more hosts to drive expression of a linked coding polynucleotide or other DNA element.
  • Many vectors are available for this purpose, and selection of the appropriate vector will depend mainly on the size of the nucleic acid to be inserted into the vector and the particular host cell to be transformed with the vector.
  • Each vector contains various components depending on its function (e.g., amplification of DNA or expression of DNA) and the particular host cell with which it is compatible.
  • a recombinant DNA may, for example, be transcribed into an iRNA molecule (e.g. , a RNA molecule that forms a dsRNA molecule) within the tissues or fluids of the recombinant plant.
  • An iRNA molecule may comprise a polynucleotide that is substantially homologous and specifically hybridizable to a corresponding transcribed polynucleotide within an insect pest that may cause damage to the host plant species.
  • the pest may contact the iRNA molecule that is transcribed in cells of the transgenic host plant, for example, by ingesting cells or fluids of the transgenic host plant that comprise the iRNA molecule.
  • expression of a target gene is suppressed by the iRNA molecule within coleopteran and/or hemipteran pests that infest the transgenic host plant.
  • suppression of expression of the target gene in a target coleopteran and/or hemipteran pest may result in the plant being protected from attack by the pest.
  • a recombinant nucleic acid molecule may comprise a polynucleotide of the invention operably linked to one or more regulatory elements, such as a heterologous promoter element that functions in a host cell, such as a bacterial cell wherein the nucleic acid molecule is to be amplified, and a plant cell wherein the nucleic acid molecule is to be expressed.
  • Promoters suitable for use in nucleic acid molecules of the invention include those that are inducible, viral, synthetic, or constitutive, all of which are well known in the art.
  • Non- limiting examples describing such promoters include U.S. Patents 6,437,217 (maize RS81 promoter); 5,641,876 (rice actin promoter); 6,426,446 (maize RS324 promoter); 6,429,362 (maize PR-1 promoter); 6,232,526 (maize A3 promoter); 6,177,611 (constitutive maize promoters); 5,322,938, 5,352,605, 5,359,142, and 5,530,196 (CaMV 35S promoter); 6,433,252 (maize L3 oleosin promoter); 6,429,357 (rice actin 2 promoter, and rice actin 2 intron); 6,294,714 (light- inducible promoters); 6,140,078 (salt-inducible promoters);
  • Patent Publication No. 2009/757,089 (maize chloroplast aldolase promoter). Additional promoters include the nopaline synthase (NOS) promoter (Ebert et al. (1987) Proc. Natl. Acad. Sci. USA 84(16):5745-9) and the octopine synthase (OCS) promoters (which are carried on tumor-inducing plasmids of Agwbacterium tumefaciens); the caulimo virus promoters such as the cauliflower mosaic virus (CaMV) 19S promoter (Lawton et al. (1987) Plant Mol. Biol. 9:315-24); the CaMV 35S promoter (Odell et al.
  • NOS nopaline synthase
  • OCS octopine synthase
  • nucleic acid molecules of the invention comprise a tissue- specific promoter, such as a root-specific promoter.
  • Root-specific promoters drive expression of operably-linked coding polynucleotides exclusively or preferentially in root tissue. Examples of root-specific promoters are known in the art. See, e.g., U.S. Patents 5,110,732; 5,459,252 and 5,837,848; and Opperman et al. (1994) Science 263:221-3; and Hirel et al. (1992) Plant Mol. Biol. 20:207-18.
  • a polynucleotide or fragment for coleopteran and/or hemipteran pest control according to the invention may be cloned between two root-specific promoters oriented in opposite transcriptional directions relative to the polynucleotide or fragment, and which are operable in a transgenic plant cell and expressed therein to produce RNA molecules in the transgenic plant cell that subsequently may form dsRNA molecules, as described, supra.
  • the iRNA molecules expressed in plant tissues may be ingested by an insect pest so that suppression of target gene expression is achieved.
  • Patent 5,659,122 PhDnaK (U.S. Patent 5,362,865); AtAntl; TEV (Carrington and Freed (1990) J. Virol. 64:1590-7); and AGRtunos (GenBankTM Accession No. V00087; and Bevan et al. (1983) Nature 304:184-7).
  • Additional regulatory elements that may optionally be operably linked to a nucleic acid also include 3' non-translated elements, 3' transcription termination regions, or polyadenylation regions. These are genetic elements located downstream of a polynucleotide, and include polynucleotides that provide polyadenylation signal, and/or other regulatory signals capable of affecting transcription or mRNA processing.
  • the polyadenylation signal functions in plants to cause the addition of polyadenylate nucleotides to the 3' end of the mRNA precursor.
  • the polyadenylation element can be derived from a variety of plant genes, or from T-DNA genes.
  • a non-limiting example of a 3' transcription termination region is the nopaline synthase 3' region (nos 3'; Fraley et al. (1983) Proc. Natl. Acad. Sci. USA 80:4803-7).
  • An example of the use of different 3' non-translated regions is provided in Ingelbrecht et al., (1989) Plant Cell 1:671-80.
  • Non-limiting examples of polyadenylation signals include one from a Pisum sativum RbcS2 gene (Ps.RbcS2-E9; Coruzzi et al. (1984) EMBO J. 3:1671-9) and AGRtu.nos (GenBankTM Accession No. E01312).
  • Some embodiments may include a plant transformation vector that comprises an isolated and purified DNA molecule comprising at least one of the above-described regulatory elements operatively linked to one or more polynucleotides of the present invention.
  • the one or more polynucleotides result in one or more iRNA molecule(s) comprising a polynucleotide that is specifically complementary to all or part of a native RNA molecule in an insect ⁇ e.g., coleopteran and/or hemipteran) pest.
  • the polynucleotide(s) may comprise a segment encoding all or part of a polyribonucleotide present within a targeted coleopteran and/or hemipteran pest RNA transcript, and may comprise inverted repeats of all or a part of a targeted pest transcript.
  • a plant transformation vector may contain polynucleotides specifically complementary to more than one target polynucleotide, thus allowing production of more than one dsRNA for inhibiting expression of two or more genes in cells of one or more populations or species of target insect pests. Segments of polynucleotides specifically complementary to polynucleotides present in different genes can be combined into a single composite nucleic acid molecule for expression in a transgenic plant. Such segments may be contiguous or separated by a spacer.
  • a plasmid of the present invention already containing at least one polynucleotide(s) of the invention can be modified by the sequential insertion of additional polynucleotide(s) in the same plasmid, wherein the additional polynucleotide(s) are operably linked to the same regulatory elements as the original at least one polynucleotide(s).
  • a nucleic acid molecule may be designed for the inhibition of multiple target genes.
  • the multiple genes to be inhibited can be obtained from the same insect (e.g. , coleopteran or hemipteran) pest species, which may enhance the effectiveness of the nucleic acid molecule.
  • the genes can be derived from different insect pests, which may broaden the range of pests against which the agent(s) is/are effective.
  • a polycistronic DNA element can be engineered.
  • a recombinant nucleic acid molecule or vector of the present invention may comprise a selectable marker that confers a selectable phenotype on a transformed cell, such as a plant cell.
  • Selectable markers may also be used to select for plants or plant cells that comprise a recombinant nucleic acid molecule of the invention.
  • the marker may encode biocide resistance, antibiotic resistance (e.g., kanamycin, Geneticin (G418), bleomycin, hygromycin, etc.), or herbicide tolerance (e.g., glyphosate, etc.).
  • selectable markers include, but are not limited to: a neo gene which codes for kanamycin resistance and can be selected for using kanamycin, G418, etc; a bar gene which codes for bialaphos resistance; a mutant EPSP synthase gene which encodes glyphosate tolerance; a nitrilase gene which confers resistance to bromoxynil; a mutant acetolactate synthase (ALS) gene which confers imidazolinone or sulfonylurea tolerance; and a methotrexate resistant DHFR gene.
  • a neo gene which codes for kanamycin resistance and can be selected for using kanamycin, G418, etc
  • a bar gene which codes for bialaphos resistance
  • a mutant EPSP synthase gene which encodes glyphosate tolerance
  • a nitrilase gene which confers resistance to bromoxynil
  • ALS acetolactate synthase
  • selectable markers are available that confer resistance to ampicillin, bleomycin, chloramphenicol, gentamycin, hygromycin, kanamycin, lincomycin, methotrexate, phosphinothricin, puromycin, spectinomycin, rifampicin, streptomycin and tetracycline, and the like. Examples of such selectable markers are illustrated in, e.g., U.S. Patents 5,550,318; 5,633,435; 5,780,708 and 6,118,047.
  • a recombinant nucleic acid molecule or vector of the present invention may also include a screenable marker.
  • Screenable markers may be used to monitor expression.
  • Exemplary screenable markers include a ⁇ -glucuronidase or uidA gene (GUS) which encodes an enzyme for which various chromogenic substrates are known (Jefferson et al. (1987) Plant Mol. Biol. Rep. 5:387-405); an R-locus gene, which encodes a product that regulates the production of anthocyanin pigments (red color) in plant tissues (Dellaporta et al.
  • GUS ⁇ -glucuronidase or uidA gene
  • recombinant nucleic acid molecules may be used in methods for the creation of transgenic plants and expression of heterologous nucleic acids in plants to prepare transgenic plants that exhibit reduced susceptibility to insect (e.g., coleopteran and/or hemipteran) pests.
  • Plant transformation vectors can be prepared, for example, by inserting nucleic acid molecules encoding iRNA molecules into plant transformation vectors and introducing these into plants.
  • Suitable methods for transformation of host cells include any method by which DNA can be introduced into a cell, such as by transformation of protoplasts (See, e.g., U.S. Patent 5,508,184), by desiccation/inhibition-mediated DNA uptake (See, e.g., Potrykus et al. (1985) Mol. Gen. Genet. 199:183-8), by electroporation (See, e.g., U.S. Patent 5,384,253), by agitation with silicon carbide fibers (See, e.g., U.S. Patents 5,302,523 and 5,464,765), by Agrobacterium-mediated transformation (See, e.g., U.S.
  • Patents 5,563,055; 5,591,616; 5,693,512; 5,824,877; 5,981,840; and 6,384,301) and by acceleration of DNA-coated particles See, e.g., U.S. Patents 5,015,580; 5,550,318; 5,538,880; 6,160,208; 6,399,861; and 6,403,865), etc.
  • Techniques that are particularly useful for transforming corn are described, for example, in U.S. Patents 7,060,876 and 5,591,616; and International PCT Publication WO95/06722. Through the application of techniques such as these, the cells of virtually any species may be stably transformed.
  • transforming DNA is integrated into the genome of the host cell.
  • transgenic cells may be regenerated into a transgenic organism. Any of these techniques may be used to produce a transgenic plant, for example, comprising one or more nucleic acids encoding one or more iRNA molecules in the genome of the transgenic plant.
  • A. tumefaciens and A. rhizogenes are plant pathogenic soil bacteria which genetically transform plant cells.
  • the Ti and Ri plasmids of A. tumefaciens and A. rhizogenes, respectively, carry genes responsible for genetic transformation of the plant.
  • the Ti (tumor-inducing)-plasmids contain a large segment, known as T-DNA, which is transferred to transformed plants.
  • Another segment of the Ti plasmid, the Vir region is responsible for T-DNA transfer.
  • the T-DNA region is bordered by terminal repeats.
  • the tumor-inducing genes have been deleted, and the functions of the Vir region are utilized to transfer foreign DNA bordered by the T-DNA border elements.
  • the T-region may also contain a selectable marker for efficient recovery of transgenic cells and plants, and a multiple cloning site for inserting polynucleotides for transfer such as a dsRNA encoding nucleic acid.
  • a plant transformation vector is derived from a Ti plasmid of A. tumefaciens (See, e.g., U.S. Patents 4,536,475, 4,693,977, 4,886,937, and 5,501,967; and European Patent No. EP 0 122 791) or a Ri plasmid of A. rhizogenes.
  • Additional plant transformation vectors include, for example and without limitation, those described by Herrera- Estrella et al. (1983) Nature 303:209-13; Bevan et al. (1983) Nature 304:184-7; Klee et al. (1985) Bio/Technol.
  • transformed cells are generally identified for further culturing and plant regeneration.
  • a selectable or screenable marker gene as previously set forth, with the transformation vector used to generate the transformant.
  • transformed cells are identified within the potentially transformed cell population by exposing the cells to a selective agent or agents.
  • a screenable marker is used, cells may be screened for the desired marker gene trait.
  • Cells that survive the exposure to the selective agent, or cells that have been scored positive in a screening assay may be cultured in media that supports regeneration of plants.
  • any suitable plant tissue culture media e.g., MS and N6 media
  • Tissue may be maintained on a basic medium with growth regulators until sufficient tissue is available to begin plant regeneration efforts, or following repeated rounds of manual selection, until the morphology of the tissue is suitable for regeneration (e.g., at least 2 weeks), then transferred to media conducive to shoot formation. Cultures are transferred periodically until sufficient shoot formation has occurred. Once shoots are formed, they are transferred to media conducive to root formation. Once sufficient roots are formed, plants can be transferred to soil for further growth and maturation.
  • nucleic acid molecule of interest for example, a DNA encoding one or more iRNA molecules that inhibit target gene expression in a coleopteran and/or hemipteran pest
  • assays include, for example: molecular biological assays, such as Southern and northern blotting, PCR, and nucleic acid sequencing; biochemical assays, such as detecting the presence of a protein product, e.g., by immunological means (ELISA and/or western blots) or by enzymatic function; plant part assays, such as leaf or root assays; and analysis of the phenotype of the whole regenerated plant.
  • molecular biological assays such as Southern and northern blotting, PCR, and nucleic acid sequencing
  • biochemical assays such as detecting the presence of a protein product, e.g., by immunological means (ELISA and/or western blots) or by enzymatic function
  • plant part assays such as leaf or root assays
  • Integration events may be analyzed, for example, by PCR amplification using, e.g. , oligonucleotide primers specific for a nucleic acid molecule of interest.
  • PCR genotyping is understood to include, but not be limited to, polymerase-chain reaction (PCR) amplification of gDNA derived from isolated host plant callus tissue predicted to contain a nucleic acid molecule of interest integrated into the genome, followed by standard cloning and sequence analysis of PCR amplification products. Methods of PCR genotyping have been well described (for example, Rios, G. et al. (2002) Plant J. 32:243-53) and may be applied to gDNA derived from any plant species ⁇ e.g., Z. mays or G. max) or tissue type, including cell cultures.
  • a transgenic plant formed using Agwbacterium-dependent transformation methods typically contains a single recombinant DNA inserted into one chromosome.
  • the polynucleotide of the single recombinant DNA is referred to as a "transgenic event" or "integration event".
  • Such transgenic plants are heterozygous for the inserted exogenous polynucleotide.
  • a transgenic plant homozygous with respect to a transgene may be obtained by sexually mating (selfing) an independent segregant transgenic plant that contains a single exogenous gene to itself, for example a T 0 plant, to produce T ⁇ seed.
  • One fourth of the T ⁇ seed produced will be homozygous with respect to the transgene.
  • Germinating T ⁇ seed results in plants that can be tested for heterozygosity, typically using an SNP assay or a thermal amplification assay that allows for the distinction between heterozygotes and homozygotes ⁇ i.e., a zygosity assay).
  • iRNA molecules are produced in a plant cell that have an insect ⁇ e.g., coleopteran and/or hemipteran) pest-inhibitory effect.
  • the iRNA molecules ⁇ e.g., dsRNA molecules
  • a plurality of iRNA molecules are expressed under the control of a single promoter.
  • a plurality of iRNA molecules are expressed under the control of multiple promoters.
  • Single iRNA molecules may be expressed that comprise multiple polynucleotides that are each homologous to different loci within one or more insect pests (for example, the loci defined by SEQ ID NO: 1 or SEQ ID NO:84), both in different populations of the same species of insect pest, or in different species of insect pests.
  • transgenic plants can be prepared by crossing a first plant having at least one transgenic event with a second plant lacking such an event.
  • seeds and commodity products produced by transgenic plants derived from transformed plant cells are included, wherein the seeds or commodity products comprise a detectable amount of a nucleic acid of the invention.
  • such commodity products may be produced, for example, by obtaining transgenic plants and preparing food or feed from them.
  • Commodity products comprising one or more of the polynucleotides of the invention includes, for example and without limitation: meals, oils, crushed or whole grains or seeds of a plant, and any food product comprising any meal, oil, or crushed or whole grain of a recombinant plant or seed comprising one or more of the nucleic acids of the invention.
  • the detection of one or more of the polynucleotides of the invention in one or more commodity or commodity products is de facto evidence that the commodity or commodity product is produced from a transgenic plant designed to express one or more of the iRNA molecules of the invention for the purpose of controlling insect ⁇ e.g., coleopteran and/or hemipteran) pests.
  • a transgenic plant or seed comprising a nucleic acid molecule of the invention also may comprise at least one other transgenic event in its genome, including without limitation: a transgenic event from which is a transcribed iRNA molecule targeting a locus in an insect pest other than the one defined by SEQ ID NO:l or SEQ ID NO:84, such as, for example, one or more loci selected from the group consisting of Cafl-180 (U.S. Patent Application Publication No. 2012/0174258), VatpaseC (U.S. Patent Application Publication No. 2012/0174259), Rhol (U.S. Patent Application Publication No. 2012/0174260), VatpaseH (U.S.
  • Patent Application Publication No. 2014/0033361 or Pseudomonas spp. e.g., PCT Application Publication No. WO2015038734
  • insecticidal protein e.g., an herbicide tolerance gene (e.g., a gene providing tolerance to glyphosate); and a gene contributing to a desirable phenotype in the transgenic plant, such as increased yield, altered fatty acid metabolism, or restoration of cytoplasmic male sterility).
  • polynucleotides encoding iRNA molecules of the invention may be combined with other insect control and disease traits in a plant to achieve desired traits for enhanced control of plant disease and insect damage. Combining insect control traits that employ distinct modes-of- action may provide protected transgenic plants with superior durability over plants harboring a single control trait, for example, because of the reduced probability that resistance to the trait(s) will develop in the field.
  • At least one nucleic acid molecule useful for the control of coleopteran and/or hemipteran pests may be provided to a coleopteran and or hemipteran pest, wherein the nucleic acid molecule leads to RNAi-mediated gene silencing in the pest(s).
  • an iRNA molecule e.g., dsRNA, siRNA, miRNA, shRNA, and hpRNA
  • dsRNA, siRNA, miRNA, shRNA, and hpRNA may be provided to the coleopteran and or hemipteran host.
  • a nucleic acid molecule useful for the control of coleopteran and or hemipteran pests may be provided to a pest by contacting the nucleic acid molecule with the pest.
  • a nucleic acid molecule useful for the control of coleopteran and or hemipteran pests may be provided in a feeding substrate of the pest, for example, a nutritional composition.
  • a nucleic acid molecule useful for the control of a coleopteran and/or hemipteran pest may be provided through ingestion of plant material comprising the nucleic acid molecule that is ingested by the pest.
  • the nucleic acid molecule is present in plant material through expression of a recombinant nucleic acid introduced into the plant material, for example, by transformation of a plant cell with a vector comprising the recombinant nucleic acid and regeneration of a plant material or whole plant from the transformed plant cell.
  • iRNA molecules of the invention may be used in methods for gene suppression in an insect (e.g., coleopteran and/or hemipteran) pest, thereby reducing the level or incidence of damage caused by the pest on a plant (for example, a protected transformed plant comprising an iRNA molecule).
  • insect e.g., coleopteran and/or hemipteran
  • gene suppression refers to any of the well-known methods for reducing the levels of protein produced as a result of gene transcription to mRNA and subsequent translation of the mRNA, including the reduction of protein expression from a gene or a coding polynucleotide including post- transcriptional inhibition of expression and transcriptional suppression.
  • Post- transcriptional inhibition is mediated by specific homology between all or a part of an mRNA transcribed from a gene targeted for suppression and the corresponding iRNA molecule used for suppression. Additionally, post-transcriptional inhibition refers to the substantial and measurable reduction of the amount of mRNA available in the cell for binding by ribo somes.
  • the dsRNA molecule may be cleaved by the enzyme, DICER, into short siRNA molecules (approximately 20 nucleotides in length).
  • the double- stranded siRNA molecule generated by DICER activity upon the dsRNA molecule may be separated into two single- stranded siRNAs; the "passenger strand” and the "guide strand".
  • the passenger strand may be degraded, and the guide strand may be incorporated into RISC.
  • Post-transcriptional inhibition occurs by specific hybridization of the guide strand with a specifically complementary polynucleotide of an mRNA molecule, and subsequent cleavage by the enzyme, Argonaute (catalytic component of the RISC complex).
  • any form of iRNA molecule may be used.
  • dsRNA molecules typically are more stable during preparation and during the step of providing the iRNA molecule to a cell than are single- stranded RNA molecules, and are typically also more stable in a cell.
  • siRNA and miRNA molecules may be equally effective in some embodiments, a dsRNA molecule may be chosen due to its stability.
  • a nucleic acid molecule that comprises a polynucleotide, which polynucleotide may be expressed in vitro to produce an iRNA molecule that is substantially homologous to a nucleic acid molecule encoded by a polynucleotide within the genome of an insect (e.g., coleopteran and/or hemipteran) pest.
  • the in vitro transcribed iRNA molecule may be a stabilized dsRNA molecule that comprises a stem-loop structure. After an insect pest contacts the in vitro transcribed iRNA molecule, post- transcriptional inhibition of a target gene in the pest (for example, an essential gene) may occur.
  • expression of a nucleic acid molecule comprising at least 15 contiguous nucleotides (e.g., at least 19 contiguous nucleotides) of a polynucleotide are used in a method for post-transcriptional inhibition of a target gene in an insect (e.g., coleopteran and/or hemipteran) pest, wherein the polynucleotide is selected from the group consisting of: SEQ ID NO: l; the complement of SEQ ID NO:l; a fragment of at least 15 contiguous nucleotides of SEQ ID NO:l; the complement of a fragment of at least 15 contiguous nucleotides of SEQ ID NO: l; a native coding polynucleotide of a Diabrotica organism comprising SEQ ID NO:l; the complement of an RNA expressed from a native coding polynucleotide of a Diabrotica organism comprising SEQ ID NO:
  • expression of at least one nucleic acid molecule comprising at least 15 contiguous nucleotides of a nucleotide sequence may be used in a method for post- transcriptional inhibition of a target gene in a coleopteran pest, wherein the nucleotide sequence is selected from the group consisting of: SEQ ID NO:l; the complement of SEQ ID NO:l; a fragment of at least 15 contiguous nucleotides of SEQ ID NO: l; the complement of a fragment of at least 15 contiguous nucleotides of SEQ ID NO: l; a native coding sequence of a Diabrotica organism ⁇ e.g., WCR) comprising SEQ ID NO:l; the complement of a native coding sequence of a Diabrotica organism ⁇ e.g., WCR) comprising SEQ ID NO: l; a native non-coding sequence of a Diabrotica organism that is transcribed into a native RNA molecule comprising SEQ ID
  • nucleic acid molecule that is at least 80% identical (e.g., 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, and 100%) with any of the foregoing may be used.
  • a nucleic acid molecule may be expressed that specifically hybridizes to an RNA molecule present in at least one cell of a coleopteran pest.
  • such a nucleic acid molecule may comprise a nucleotide sequence comprising SEQ ID NO: 1.
  • expression of a nucleic acid molecule comprising at least 15 contiguous nucleotides of a nucleotide sequence is used in a method for post- transcriptional inhibition of a target gene in a hemipteran pest, wherein the nucleotide sequence is selected from the group consisting of: SEQ ID NO: 84; the complement of SEQ ID NO: 84; a fragment of at least 15 contiguous nucleotides of SEQ ID NO:84; the complement of a fragment of at least 15 contiguous nucleotides of SEQ ID NO:84; a native coding sequence of a hemipteran organism SEQ ID NO:84; the complement of a native coding sequence of a hemipteran organism comprising SEQ ID NO:84; a native non-coding sequence of a hemipteran organism that is transcribed into a native RNA molecule comprising SEQ ID NO: 84; the complement of a native
  • a nucleic acid molecule that is at least 80% identical (e.g., 80%, about 81%, about 82%, about 83%, about 84%, about 85%, about 86%, about 87%, about 88%, about 89%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, about 100%, and 100%) with any of the foregoing may be used.
  • a nucleic acid molecule may be expressed that specifically hybridizes to an RNA molecule present in at least one cell of a hemipteran pest.
  • such a nucleic acid molecule may comprise a nucleotide sequence comprising SEQ ID NO:84.
  • the RNAi post- transcriptional inhibition system is able to tolerate sequence variations among target genes that might be expected due to genetic mutation, strain polymorphism, or evolutionary divergence.
  • the introduced nucleic acid molecule may not need to be absolutely homologous to either a primary transcription product or a fully-processed mRNA of a target gene, so long as the introduced nucleic acid molecule is specifically hybridizable to either a primary transcription product or a fully- processed mRNA of the target gene.
  • the introduced nucleic acid molecule may not need to be full-length, relative to either a primary transcription product or a fully processed mRNA of the target gene.
  • Inhibition of a target gene using the iRNA technology of the present invention is sequence- specific; i.e., polynucleotides substantially homologous to the iRNA molecule(s) are targeted for genetic inhibition.
  • an RNA molecule comprising a polynucleotide with a nucleotide sequence that is identical to that of a portion of a target gene may be used for inhibition.
  • an RNA molecule comprising a polynucleotide with one or more insertion, deletion, and/or point mutations relative to a target polynucleotide may be used.
  • an iRNA molecule and a portion of a target gene may share, for example, at least from about 80%, at least from about 81%, at least from about 82%, at least from about 83%, at least from about 84%, at least from about 85%, at least from about 86%, at least from about 87%, at least from about 88%, at least from about 89%, at least from about 90%, at least from about 91%, at least from about 92%, at least from about 93%, at least from about 94%, at least from about 95%, at least from about 96%, at least from about 97%, at least from about 98%, at least from about 99%, at least from about 100%, and 100% sequence identity.
  • the duplex region of a dsRNA molecule may be specifically hybridizable with a portion of a target gene transcript.
  • a less than full length polynucleotide exhibiting a greater homology compensates for a longer, less homologous polynucleotide.
  • the length of the polynucleotide of a duplex region of a dsRNA molecule that is identical to a portion of a target gene transcript may be at least about 25, 50, 100, 200, 300, 400, 500, or at least about 1000 bases.
  • a polynucleotide of greater than 20-100 nucleotides may be used.
  • expression of a target gene in a pest may be inhibited by at least 10%; at least 33%; at least 50%; or at least 80% within a cell of the pest, such that a significant inhibition takes place.
  • Significant inhibition refers to inhibition over a threshold that results in a detectable phenotype (e.g. , cessation of growth, cessation of feeding, cessation of development, induced mortality, etc.), or a detectable decrease in RNA and/or gene product corresponding to the target gene being inhibited.
  • a detectable phenotype e.g. , cessation of growth, cessation of feeding, cessation of development, induced mortality, etc.
  • inhibition occurs in substantially all cells of the pest, in other embodiments inhibition occurs only in a subset of cells expressing the target gene.
  • transcriptional suppression is mediated by the presence in a cell of a dsRNA molecule exhibiting substantial sequence identity to a promoter DNA or the complement thereof to effect what is referred to as "promoter trans suppression.”
  • Gene suppression may be effective against target genes in an insect pest that may ingest or contact such dsRNA molecules, for example, by ingesting or contacting plant material containing the dsRNA molecules.
  • dsRNA molecules for use in promoter trans suppression may be specifically designed to inhibit or suppress the expression of one or more homologous or complementary polynucleotides in the cells of the insect pest.
  • Post-transcriptional gene suppression by antisense or sense oriented RNA to regulate gene expression in plant cells is disclosed in U.S. Patents 5,107,065; 5,759,829; 5,283,184; and 5,231,020.
  • iRNA molecules for RNAi-mediated gene inhibition in an insect (e.g., coleopteran and/or hemipteran) pest may be carried out in any one of many in vitro or in vivo formats.
  • the iRNA molecules may then be provided to an insect pest, for example, by contacting the iRNA molecules with the pest, or by causing the pest to ingest or otherwise internalize the iRNA molecules.
  • Some embodiments include transformed host plants of a coleopteran and/or hemipteran pest, transformed plant cells, and progeny of transformed plants.
  • the transformed plant cells and transformed plants may be engineered to express one or more of the iRNA molecules, for example, under the control of a heterologous promoter, to provide a pest-protective effect.
  • a transgenic plant or plant cell is consumed by an insect pest during feeding, the pest may ingest iRNA molecules expressed in the transgenic plants or cells.
  • the polynucleotides of the present invention may also be introduced into a wide variety of prokaryotic and eukaryotic microorganism hosts to produce iRNA molecules.
  • the term "microorganism" includes prokaryotic and eukaryotic species, such as bacteria and fungi.
  • Modulation of gene expression may include partial or complete suppression of such expression.
  • a method for suppression of gene expression in an insect (e.g., coleopteran and/or hemipteran) pest comprises providing in the tissue of the host of the pest a gene-suppressive amount of at least one dsRNA molecule formed following transcription of a polynucleotide as described herein, at least one segment of which is complementary to an mRNA within the cells of the insect pest.
  • a dsRNA molecule, including its modified form such as an siRNA, miRNA, shRNA, or hpRNA molecule, ingested by an insect pest may be at least from about 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or about 100% identical to an RNA molecule transcribed from a COPI alpha DNA molecule, for example, comprising a polynucleotide selected from the group consisting of SEQ ID NO: l or SEQ ID NO: 84.
  • Isolated and substantially purified nucleic acid molecules including, but not limited to, non-naturally occurring polynucleotides and recombinant DNA constructs for providing dsRNA molecules are therefore provided, which suppress or inhibit the expression of an endogenous coding polynucleotide or a target coding polynucleotide in an insect pest when introduced thereto.
  • Particular embodiments provide a delivery system for the delivery of iRNA molecules for the post-transcriptional inhibition of one or more target gene(s) in an insect (e.g., coleopteran and/or hemipteran) plant pest and control of a population of the plant pest.
  • the delivery system comprises ingestion of a host transgenic plant cell or contents of the host cell comprising RNA molecules transcribed in the host cell.
  • a transgenic plant cell or a transgenic plant is created that contains a recombinant DNA construct providing a stabilized dsRNA molecule of the invention.
  • Transgenic plant cells and transgenic plants comprising nucleic acids encoding a particular iRNA molecule may be produced by employing recombinant DNA technologies (which basic technologies are well-known in the art) to construct a plant transformation vector comprising a polynucleotide encoding an iRNA molecule of the invention (e.g., a stabilized dsRNA molecule); to transform a plant cell or plant; and to generate the transgenic plant cell or the transgenic plant that contains the transcribed iRNA molecule.
  • a plant transformation vector comprising a polynucleotide encoding an iRNA molecule of the invention (e.g., a stabilized dsRNA molecule)
  • a recombinant DNA molecule may, for example, be transcribed into an iRNA molecule, such as a dsRNA molecule, an siRNA molecule, an miRNA molecule, an shRNA molecule, or an hpRNA molecule.
  • an RNA molecule transcribed from a recombinant DNA molecule may form a dsRNA molecule within the tissues or fluids of the recombinant plant.
  • Such a dsRNA molecule may be comprised in part of a polynucleotide that is identical to a corresponding polynucleotide transcribed from a DNA within an insect pest of a type that may infest the host plant. Expression of a target gene within the pest is suppressed by the dsRNA molecule, and the suppression of expression of the target gene in the pest results in the transgenic plant being resistant to the pest.
  • the modulatory effects of dsRNA molecules have been shown to be applicable to a variety of genes expressed in pests, including, for example, endogenous genes responsible for cellular metabolism or cellular transformation, including house-keeping genes; transcription factors; molting-related genes; and other genes which encode polypeptides involved in cellular metabolism or normal growth and development.
  • Some embodiments provide methods for reducing the damage to a host plant ⁇ e.g., a corn plant) caused by an insect ⁇ e.g., coleopteran and/or hemipteran) pest that feeds on the plant, wherein the method comprises providing in the host plant a transformed plant cell expressing at least one nucleic acid molecule of the invention, wherein the nucleic acid molecule(s) functions upon being taken up by the pest(s) to inhibit the expression of a target polynucleotide within the pest(s), which inhibition of expression results in mortality and/or reduced growth of the pest(s), thereby reducing the damage to the host plant caused by the pest(s).
  • the nucleic acid molecule(s) comprise dsRNA molecules. In these and further embodiments, the nucleic acid molecule(s) comprise dsRNA molecules that each comprise more than one polynucleotide that is specifically hybridizable to a nucleic acid molecule expressed in a coleopteran and/or hemipteran pest cell. In some embodiments, the nucleic acid molecule(s) consist of one polynucleotide that is specifically hybridizable to a nucleic acid molecule expressed in an insect pest cell.
  • a method for increasing the yield of a corn crop comprises introducing into a corn plant at least one nucleic acid molecule of the invention; cultivating the corn plant to allow the expression of an iRNA molecule comprising the nucleic acid, wherein expression of an iRNA molecule comprising the nucleic acid inhibits insect ⁇ e.g., coleopteran and/or hemipteran) pest damage and/or growth, thereby reducing or eliminating a loss of yield due to pest infestation.
  • the iRNA molecule is a dsRNA molecule.
  • the nucleic acid molecule(s) comprise dsRNA molecules that each comprise more than one polynucleotide that is specifically hybridizable to a nucleic acid molecule expressed in an insect pest cell.
  • the nucleic acid molecule(s) comprises a polynucleotide that is specifically hybridizable to a nucleic acid molecule expressed in a coleopteran and/or hemipteran pest cell.
  • a method for modulating the expression of a target gene in an insect (e.g., coleopteran and/or hemipteran) pest comprising: transforming a plant cell with a vector comprising a polynucleotide encoding at least one iRNA molecule of the invention, wherein the polynucleotide is operatively-linked to a promoter and a transcription termination element; culturing the transformed plant cell under conditions sufficient to allow for development of a plant cell culture including a plurality of transformed plant cells; selecting for transformed plant cells that have integrated the polynucleotide into their genomes; screening the transformed plant cells for expression of an iRNA molecule encoded by the integrated polynucleotide; selecting a transgenic plant cell that expresses the iRNA molecule; and feeding the selected transgenic plant cell to the insect pest.
  • an insect e.g., coleopteran and/or hemipteran
  • Plants may also be regenerated from transformed plant cells that express an iRNA molecule encoded by the integrated nucleic acid molecule.
  • the iRNA molecule is a dsRNA molecule.
  • the nucleic acid molecule(s) comprise dsRNA molecules that each comprise more than one polynucleotide that is specifically hybridizable to a nucleic acid molecule expressed in an insect pest cell.
  • the nucleic acid molecule(s) comprises a polynucleotide that is specifically hybridizable to a nucleic acid molecule expressed in a coleopteran and/or hemipteran pest cell.
  • iRNA molecules of the invention can be incorporated within the seeds of a plant species (e.g., corn), either as a product of expression from a recombinant gene incorporated into a genome of the plant cells, or as incorporated into a coating or seed treatment that is applied to the seed before planting.
  • a plant cell comprising a recombinant gene is considered to be a transgenic event.
  • insect e.g., coleopteran and/or hemipteran
  • the iRNA molecules of the invention may be directly introduced into the cells of a pest(s).
  • Methods for introduction may include direct mixing of iRNA with plant tissue from a host for the insect pest(s), as well as application of compositions comprising iRNA molecules of the invention to host plant tissue.
  • iRNA molecules may be sprayed onto a plant surface.
  • an iRNA molecule may be expressed by a microorganism, and the microorganism may be applied onto the plant surface, or introduced into a root or stem by a physical means such as an injection.
  • a transgenic plant may also be genetically engineered to express at least one iRNA molecule in an amount sufficient to kill the insect pests known to infest the plant.
  • iRNA molecules produced by chemical or enzymatic synthesis may also be formulated in a manner consistent with common agricultural practices, and used as spray-on products for controlling plant damage by an insect pest.
  • the formulations may include the appropriate adjuvants ⁇ e.g., stickers and wetters) required for efficient foliar coverage, as well as UV protectants to protect iRNA molecules ⁇ e.g., dsRNA molecules) from UV damage.
  • adjuvants e.g., stickers and wetters
  • UV protectants to protect iRNA molecules ⁇ e.g., dsRNA molecules
  • Such additives are commonly used in the bioinsecticide industry, and are well known to those skilled in the art.
  • Such applications may be combined with other spray-on insecticide applications (biologically based or otherwise) to enhance plant protection from the pests.
  • Sample preparation and bioassays A number of dsRNA molecules (including those corresponding to COPI alpha regl (SEQ ID NO:3), COPI alpha regl (SEQ ID NO:4), COPI alpha verl (SEQ ID NO:72), COPI alpha ver2 (SEQ ID NO:73), COPI alpha ver3 (SEQ ID NO:74), and COPI alpha ver4 (SEQ ID NO:75) were synthesized and purified using a MEGASCRIPT ® RNAi kit.
  • the purified dsRNA molecules were prepared in TE buffer, and all bioassays contained a control treatment consisting of this buffer, which served as a background check for mortality or growth inhibition of WCR (Diabwtica virgifera virgifera LeConte).
  • the concentrations of dsRNA molecules in the bioassay buffer were measured using a NANODROPTM 8000 spectrophotometer (THERMO SCIENTIFIC, Wilmington, DE).
  • the bioassays were conducted in 128-well plastic trays specifically designed for insect bioassays (C-D INTERNATIONAL, Pitman, NJ). Each well contained approximately 1.0 mL of an artificial diet designed for growth of coleopteran insects. A 60 ⁇ ⁇ aliquot of dsRNA sample was delivered by pipette onto the surface of the diet of each well (40 dsRNA sample concentrations were calculated as the amount of dsRNA per square centimeter (ng/cm ) of surface area (1.5 cm ) in the well. The treated trays were held in a fume hood until the liquid on the diet surface evaporated or was absorbed into the diet.
  • GI [1 - (TWrr/TNIT)/(TWIBC/TNIBC)]
  • is the Total Number of Insects in the Treatment
  • TNIBC is the Total Number of Insects in the Background Check (Buffer control). [00231] The Statistical analysis was done using JMPTM software (SAS, Cary, NC).
  • LC 50 Lethal Concentration
  • GI 50 Rowth Inhibition
  • mean growth e.g. live weight
  • total RNA was isolated from about 0.9 gm whole first- instar WCR larvae; (4 to 5 days post-hatch; held at 16°C), and purified using the following phenol/TRI REAGENT ® -based method (MOLECULAR RESEARCH CENTER, Cincinnati, OH):
  • RNA concentration was determined by measuring the absorbance (A) at 260 nm and 280 nm. A typical extraction from about 0.9 gm of larvae yielded over 1 mg of total RNA, with an A260/A280 ratio of 1.9. The RNA thus extracted was stored at -80°C until further processed.
  • RNA quality was determined by running an aliquot through a 1% agarose gel.
  • the agarose gel solution was made using autoclaved lOx TAE buffer (Tris-acetate EDTA; lx concentration is 0.04 M Tris-acetate, 1 mM EDTA (ethylenediamine tetra-acetic acid sodium salt), pH 8.0) diluted with DEPC (diethyl pyrocarbonate)-treated water in an autoclaved container, lx TAE was used as the running buffer.
  • the electrophoresis tank and the well-forming comb were cleaned with RNaseAwayTM (INVITROGEN INC., Carlsbad, CA).
  • RNA sample Two of RNA sample were mixed with 8 of TE buffer (10 mM Tris HCl pH 7.0; 1 mM EDTA) and 10 of RNA sample buffer (NOVAGEN ® Catalog No 70606; EMD4 Bioscience, Gibbstown, NJ). The sample was heated at 70°C for 3 min, cooled to room temperature, and 5 ⁇ ⁇ (containing 1 ⁇ g to 2 ⁇ g RNA) were loaded per well. Commercially available RNA molecular weight markers were simultaneously run in separate wells for molecular size comparison. The gel was run at 60 volts for 2 hr.
  • a normalized cDNA library was prepared from the larval total RNA by a commercial service provider (EUROFINS MWG Operon, Huntsville, AL), using random priming.
  • the normalized larval cDNA library was sequenced at 1/2 plate scale by GS FLX 454 TitaniumTM series chemistry at EUROFINS MWG Operon, which resulted in over 600,000 reads with an average read length of 348 bp. 350,000 reads were assembled into over 50,000 contigs. Both the unassembled reads and the contigs were converted into BLASTable databases using the publicly available program, FORMATDB (available from NCBI).
  • RNA and normalized cDNA libraries were similarly prepared from materials harvested at other WCR developmental stages.
  • a pooled transcriptome library for target gene screening was constructed by combining cDNA library members representing the various developmental stages.
  • Candidate genes for RNAi targeting were selected using information regarding lethal RNAi effects of particular genes in other insects such as Drosophila and Tribolium. These genes were hypothesized to be essential for survival and growth in coleopteran insects. Selected target gene homologs were identified in the transcriptome sequence database as described below. Full-length or partial sequences of the target genes were amplified by PCR to prepare templates for double-stranded RNA (dsRNA) production.
  • dsRNA double-stranded RNA
  • TBLASTN searches using candidate protein coding sequences were run against BLASTable databases containing the unassembled Diabrotica sequence reads or the assembled contigs. Significant hits to a Diabrotica sequence (defined as better than e - " 20 for contigs homologies and better than e "10 for unassembled sequence reads homologies) were confirmed using BLASTX against the NCBI non-redundant database. The results of this BLASTX search confirmed that the Diabrotica homolog candidate gene sequences identified in the TBLASTN search indeed comprised Diabrotica genes, or were the best hit to the non-Diabwtica candidate gene sequence present in the Diabrotica sequences.
  • Tribolium candidate genes which were annotated as encoding a protein gave an unambiguous sequence homology to a sequence or sequences in the Diabrotica transcriptome sequences.
  • sequences or unassembled sequence reads selected by homology to a non-Diabwtica candidate gene overlapped, and that the assembly of the contigs had failed to join these overlaps.
  • SequencherTM v4.9 GENE CODES CORPORATION, Ann Arbor, MI was used to assemble the sequences into longer contigs.
  • a candidate target gene encoding Diabrotica COP I alpha (SEQ ID NO:l) was identified as a gene that may lead to coleopteran pest mortality, inhibition of growth, inhibition of development, or inhibition of reproduction in WCR.
  • COPI refers to the specific coat protein complex that inhibits the budding process on the cis-Golgi membrane (Nickel,et al. 2002. Journal of Cell Science 115, 3235-3240).
  • the COPI coatomer complex consists of seven subunits.
  • COPI coatomer ALPHA is one of the subunits. The function of the complex is to transport vesicles from the cis-end of the Golgi complex back to the rough endoplasmic reticulum, where they were originally synthesized.
  • Diabrotica virgifera proteins that also contain this domain may share structural and/or functional properties, and thus a gene that encodes one of these proteins may comprise a candidate target gene that may lead to coleopteran pest mortality, inhibition of growth, inhibition of development, or inhibition of reproduction in WCR.
  • the sequence of SEQ ID NO:l is novel. The sequence is not provided in public databases and is not disclosed in WO/2011/025860; U.S. Patent Application No. 20070124836; U.S. Patent Application No. 20090306189; U.S. Patent Application No. US20070050860; U.S. Patent Application No.20100192265;or U.S. Patent No.7,612,194.
  • Diabrotica COPI alpha sequence (SEQ ID NO: l) is somewhat related to a fragment of a sequence from Tribolium casetanum (GENBANK Accession No. XM_962379.2).
  • the closest homolog of the Diabrotica COPI alpha amino acid sequence (SEQ ID NO:2) is a Tribolium casetanum protein having GENBANK Accession No. XP_967472.1 (90% similar; 81% identical over the homology region).
  • COPI alpha dsRNA transgenes can be combined with other dsRNA molecules to provide redundant RNAi targeting and synergistic RNAi effects.
  • Transgenic corn events expressing dsRNA that targets COPI alpha are useful for preventing root feeding damage by corn rootworm.
  • COPI alpha dsRNA transgenes represent new modes of action for combining with Bacillus thuringiensis, Alcaligenes spp., or Pseudomonas spp. insecticidal protein technology in Insect Resistance Management gene pyramids to mitigate against the development of rootworm populations resistant to either of these rootworm control technologies.
  • SEQ ID NO: 1 shows a 4037 bp DNA sequence of Diabrotica COPI alpha.
  • SEQ ID NO:3 shows a 400 bp DNA sequence of COPI alpha regl .
  • SEQ ID NO:72 shows a 123 bp DNA sequence of COPI alpha verl.
  • SEQ ID NO:73 shows a 120 bp DNA sequence of COPI alpha ver2.
  • SEQ ID NO:74 shows a 107 bp DNA sequence of COPI alpha ver3.
  • SEQ ID NO:75 shows a 110 bp DNA sequence of COPI alpha ver4.
  • TTAATACGACTCACTATAGGGAGA SEQ ID NO:5
  • YFP yellow fluorescent protein
  • the PCR products having a T7 promoter sequence at their 5' ends of both sense and antisense strands for each region of a given gene were used for dsRNA generation. See Figure 1.
  • the sequences of the dsRNA templates amplified with the particular primer pairs were: SEQ ID NO:3 (COPI alpha regl), SEQ ID NO:4 (COPI alpha reg2), COPI alpha verl (SEQ ID NO:72), COPI alpha ver2 (SEQ ID NO:73), COPI alpha ver3 (SEQ ID NO:74), COPI alpha ver4 (SEQ ID NO:75) and YFP (SEQ ID NO:6).
  • Double-stranded RNA for insect bioassay was synthesized and purified using an AMBION ® MEGASCRIPT ® RNAi kit following the manufacturer's instructions (INVTTROGEN). The concentrations of dsRNAs were measured using a NANODROPTM 8000 spectrophotometer (THERMO SCIENTIFIC, Wilmington, DE).
  • Entry vectors (pDAB117217 and pDAB117218) harboring a target gene construct for hairpin formation comprising segments of COPI alpha (SEQ ID NO: l) were assembled using a combination of chemically synthesized fragments (DNA2.0, Menlo Park, CA) and standard molecular cloning methods. Intramolecular hairpin formation by RNA primary transcripts was facilitated by arranging (within a single transcription unit) two copies of a segment of COPI alpha target gene sequence in opposite orientation to one another, the two segments being separated by an ST-LS1 intron sequence (SEQ ID NO: 14; Vancanneyt et al. (1990) Mol. Gen. Genet. 220(2):245- 50).
  • the primary mRNA transcript contains the two COPI alpha gene segment sequences as large inverted repeats of one another, separated by the intron sequence.
  • a copy of a maize ubiquitin 1 promoter (U.S. Patent No. 5,510,474) was used to drive production of the primary mRNA hairpin transcript, and a fragment comprising a 3' untranslated region from a maize peroxidase 5 gene (ZmPer5 3'UTR v2; U.S. Patent No. 6,699,984) was used to terminate transcription of the hairpin- RNA-expressing gene.
  • Entry vector pDAB 117211 comprises a COPI alpha hairpin v3-RNA construct (SEQ ID NO: 11) that comprises a segment of COPI alpha (SEQ ID NO: 1)
  • Entry vector pDAB 117212 comprises a COPI alpha hairpin v4-RNA construct (SEQ ID NO: 12) that comprises a segment of COPI alpha (SEQ ID NO: l) distinct from that found in pDAB 117211.
  • Entry vectors pDAB 117211 and pDAB 117212 described above were used in standard GATEWAY® recombination reactions with a typical binary destination vector (pDAB 109805) to produce COPI alpha hairpin RNA expression transformation vectors for Agwbacterium-mediated maize embryo transformations (pDAB114515 and pDAB115770, respectively).
  • Entry Vector pDAB101670 comprises a YFP hairpin sequence (SEQ ID NO: 13) under the expression control of a maize ubiquitin 1 promoter (as above) and a fragment comprising a 3' untranslated region from a maize peroxidase 5 gene (as above).
  • Binary destination vector pDAB 109805 comprises a herbicide resistance gene (aryloxyalknoate dioxygenase; AAD-1 v3) (U.S. Patent No. 7838733(B2), and Wright et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107:20240-5) under the regulation of a sugarcane bacilliform badnavirus (ScBV) promoter (Schenk et al. (1999) Plant Molec. Biol. 39: 1221-30).
  • aryloxyalknoate dioxygenase aryloxyalknoate dioxygenase
  • AAD-1 v3 aryloxyalknoate dioxygenase
  • ScBV sugarcane bacilliform badnavirus
  • a synthetic 5'UTR sequence comprised of sequences from a Maize Streak Virus (MSV) coat protein gene 5'UTR and intron 6 from a maize Alcohol Dehydrogenase 1 (ADH1) gene, is positioned between the 3' end of the SCBV promoter segment and the start codon of the AAD-1 coding region.
  • a fragment comprising a 3' untranslated region from a maize lipase gene was used to terminate transcription of the AAD-1 mRNA.
  • Binary destination vector pDAB9989 comprises a herbicide resistance gene (aryloxyalknoate dioxygenase; AAD-1 v3) (as above) under the expression regulation of a maize ubiquitin 1 promoter (as above) and a fragment comprising a 3' untranslated region from a maize lipase gene (ZmLip 3'UTR; as above).
  • Entry Vector pDAB 100287 comprises a YFP coding region (SEQ ID NO: 15) under the expression control of a maize ubiquitin 1 promoter (as above) and a fragment comprising a 3' untranslated region from a maize peroxidase 5 gene (as above).
  • SEQ ID NO: 11 presents an COPI alpha hairpin v3-RNA-forming sequence as found in pDABl 17217.
  • SEQ ID NO: 12 presents an COPI alpha hairpin v4-RNA-forming sequence as found in pDABl 17218.
  • Annexin, Beta spectrin 2, and mtRP-L4 were each suggested in U.S. Patent No. 7,612,194 to be efficacious in RNAi-mediated insect control.
  • SEQ ID NO:16 is the DNA sequence of Annexin region 1 (Reg 1)
  • SEQ ID NO: 17 is the DNA sequence of Annexin region 2 (Reg 2).
  • SEQ ID NO: 18 is the DNA sequence of Beta spectrin 2 region 1 (Reg 1)
  • SEQ ID NO: 19 is the DNA sequence of Beta spectrin 2 region 2 (Reg2).
  • SEQ ID NO:20 is the DNA sequence of mtRP-L4 region 1 (Reg 1)
  • SEQ ID NO:21 is the DNA sequence of mtRP-L4 region 2 (Reg 2).
  • a YFP sequence was also used to produce dsRNA as a negative control.
  • the second reaction incorporated the T7 promoter sequence at the 5' ends of the antisense strands.
  • the two PCR amplified fragments for each region of the target genes were then mixed in approximately equal amounts, and the mixture was used as transcription template for dsRNA production. See Figure 2.
  • Double-stranded RNA was synthesized and purified using an AMBION ® MEGAscript ® RNAi kit following the manufacturer's instructions (INVITROGEN). The concentrations of dsRNAs were measured using a NANODROPTM 8000 spectrophotometer (THERMO SCIENTIFIC, Wilmington, DE). and the dsRNAs were each tested by the same diet-based bioassay methods described above.
  • Table 4 lists the sequences of the primers used to produce the YFP, Annexin Regl, Annexin Reg2, Beta spectrin 2 Regl, Beta spectrin 2 Reg2, mtRP-L4 Regl, and mtRP-L4 Reg2 dsRNA molecules.
  • YFP primer sequences for use in the method depicted in Figure 2 are also listed in Table 4.
  • Table 5 presents the results of diet-based feeding bioassays of WCR larvae following 9-day exposure to these dsRNA molecules. Replicated bioassays demonstrated that ingestion of these dsRNAs resulted in no mortality or growth inhibition of western corn rootworm larvae above that seen with control samples of TE buffer, Water, or YFP protein.
  • Agrobacterium-mediated Transformation Transgenic maize cells, tissues, and plants that produce one or more insecticidal dsRNA molecules (for example, at least one dsRNA molecule including a dsRNA molecule targeting a gene comprising COPI alpha; SEQ ID NO:l) through expression of a chimeric gene stably-integrated into the plant genome were produced following Agrobacterium-mediated transformation.
  • Maize transformation methods employing superbinary or binary transformation vectors are known in the art, as described, for example, in U.S.
  • Transformed tissues were selected by their ability to grow on Haloxyfop-containing medium and were screened for dsRNA production, as appropriate. Portions of such transformed tissue cultures may be presented to neonate corn rootworm larvae for bioassay, essentially as described in EXAMPLE 1.
  • pp 327-341) contained: 2.2 gm/L MS salts; IX ISU Modified MS Vitamins (Frame et al., ibid.) 68.4 gm/L sucrose; 36 gm/L glucose; 115 mg/L L-proline; and 100 mg/L myo-inositol; at pH 5.4.) Acetosynngone was added to the flask containing Inoculation Medium to a final concentration of 200 ⁇ from a 1 M stock solution in 100% dimethyl sulfoxide and the solution was thoroughly mixed.
  • Ear sterilization and embryo isolation Maize immature embryos were obtained from plants of Zea mays inbred line B104 (Hallauer et al. (1997) Crop Science 37: 1405-1406) grown in the greenhouse and self- or sib-pollinated to produce ears. The ears were harvested approximately 10 to 12 days post-pollination. On the experimental day, de-husked ears were surface- sterilized by immersion in a 20% solution of commercial bleach (ULTRA CLOROX® Germicidal Bleach, 6.15% sodium hypochlorite; with two drops of TWEEN 20) and shaken for 20 to 30 min, followed by three rinses in sterile deionized water in a laminar flow hood.
  • ULTRA CLOROX® Germicidal Bleach 6.15% sodium hypochlorite; with two drops of TWEEN 20
  • Immature zygotic embryos (1.8 to 2.2 mm long) were aseptically dissected from each ear and randomly distributed into microcentrifuge tubes containing 2.0 mL of a suspension of appropriate Agwbacterium cells in liquid Inoculation Medium with 200 ⁇ acetosyringone, into which 2 ⁇ L ⁇ of 10% BREAK-THRU® S233 surfactant (EVONIK INDUSTRIES; Essen, Germany) had been added.
  • BREAK-THRU® S233 surfactant (EVONIK INDUSTRIES; Essen, Germany) had been added.
  • the liquid Agrobacterium suspension was removed with a sterile, disposable, transfer pipette.
  • the embryos were then oriented with the scutellum facing up using sterile forceps with the aid of a microscope.
  • the plate was closed, sealed with 3MTM MICROPORETM medical tape, and placed in an incubator at 25°C with continuous light at approximately 60 ⁇ m " s " of Photosynthetically Active Radiation (PAR).
  • Pre-Regeneration Medium contained 4.33 gm L MS salts; IX ISU Modified MS Vitamins; 45 gm/L sucrose; 350 mg/L L-proline; 100 mg/L myo-inositol; 50 mg/L Casein Enzymatic Hydrolysate; 1.0 mg/L AgN0 3 ; 0.25 gm L MES; 0.5 mg/L naphthaleneacetic acid in NaOH; 2.5 mg/L abscisic acid in ethanol; 1 mg/L 6-benzylaminopurine; 250 mg/L Carbenicillin; 2.5 gm/L GELZANTM; and 0.181 mg/L Haloxyfop acid; at pH 5.8.
  • the plates were stored in clear
  • Regeneration Medium contained 4.33 gm/L MS salts; IX ISU Modified MS Vitamins; 60 gm/L sucrose; 100 mg/L myo-inositol; 125 mg/L Carbenicillin; 3 gm/L GELLANTM gum; and 0.181 mg/L R- Haloxyfop acid; at pH 5.8. Small shoots with primary roots were then isolated and transferred to Elongation Medium without selection.
  • Elongation Medium contained 4.33 gm/L MS salts; IX ISU Modified MS Vitamins; 30 gm/L sucrose; and 3.5 gm/L GELRITETM: at pH 5.8.
  • Transformed plant shoots selected by their ability to grow on medium containing Haloxyfop were transplanted from PHYTATRAYSTM to small pots filled with growing medium (PROMIX BX; PREMIER TECH HORTICULTURE), covered with cups or HUMI-DOMES (ARCO PLASTICS), and then hardened-off in a CONVIRON growth chamber (27°C day/24°C night, 16-hour photoperiod, 50-70% RH, 200 ⁇ m " s " PAR).
  • putative transgenic plantlets were analyzed for transgene relative copy number by quantitative real-time PCR assays using primers designed to detect the AADl herbicide tolerance gene integrated into the maize genome. Further, RNA qPCR assays were used to detect the presence of the ST-LS 1 intron sequence in expressed dsRNAs of putative transformants. Selected transformed plantlets were then moved into a greenhouse for further growth and testing.
  • Plants to be used for insect bioassays were transplanted from small pots to TINUSTM 350-4 ROOTR AINERS ® (SPENCER-LEMAIRE INDUSTRIES, Acheson, Alberta, Canada); (one plant per event per ROOTRAINER®). Approximately four days after transplanting to ROOTRAINERS®, plants were infested for bioassay.
  • Plants of the Ti generation were obtained by pollinating the silks of T 0 transgenic plants with pollen collected from plants of non-transgenic elite inbred line B 104 or other appropriate pollen donors, and planting the resultant seeds. Reciprocal crosses were performed when possible.
  • RNA qPCR Molecular analyses (e.g. RNA qPCR) of maize tissues were performed on samples from leaves and roots that were collected from greenhouse grown plants on the same days that root feeding damage was assessed.
  • RNA qPCR assays for the ST-LS 1 intron sequence (which is integral to the formation of dsRNA hairpin molecules) in expressed RNAs were used to validate the presence of hairpin transcripts.
  • DNA qPCR analyses to detect a portion of the AAD1 coding region in genomic DNA were used to estimate transgene insertion copy number. Samples for these analyses were collected from plants grown in environmental chambers. Results were compared to DNA qPCR results of assays designed to detect a portion of a single-copy native gene, and simple events (having one or two copies of COPI alpha transgenes) were advanced for further studies in the greenhouse.
  • qPCR assays designed to detect a portion of the spectinomycin- resistance gene (SpecR; harbored on the binary vector plasmids outside of the T-DNA) were used to determine if the transgenic plants contained extraneous integrated plasmid backbone sequences.
  • Hairpin RNA transcript expression level Per 5 3'UTR qPCR Callus cell events or transgenic plants were analyzed by real time quantitative PCR (qPCR) of the Per 5 3'UTR sequence to determine the relative expression level of the full length hairpin transcript, as compared to the transcript level of an internal maize gene (SEQ ID NO:50; GENBANK Accession No. BT069734), which encodes a TIP41-like protein (i.e.
  • First strand cDNA was prepared using a HIGH CAPACITY cDNA SYNTHESIS ⁇ (INVrfROGEN) in a 10 ⁇ ⁇ reaction volume with 5 ⁇ ⁇ denatured RNA, substantially according to the manufacturer's recommended protocol.
  • the protocol was modified slightly to include the addition of 10 ⁇ ⁇ of 100 ⁇ T20VN oligonucleotide (IDT) (SEQ ID NO:51; TTTTTTTTTTTTTTTTTTTTTTTTTTVN, where V is A, C, or G, and N is A, C, G, or T/U) into the 1 mL tube of random primer stock mix, in order to prepare a working stock of combined random primers and oligo dT.
  • IDT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTVN, where V is A, C, or G, and N is A, C, G, or T/U
  • samples were diluted 1:3 with nuclease-free water, and stored at -20°C until assayed.
  • Hairpin transcript size and integrity Northern Blot Assay
  • additional molecular characterization of the transgenic plants is obtained by the use of Northern Blot (RNA blot) analysis to determine the molecular size of the COPI alpha hairpin RNA in transgenic plants expressing a COPI alpha hairpin dsRNA.
  • RNAZAP AMBION/INVITROGEN
  • Tissue samples 100 mg to 500 mg are collected in 2 mL SAFELOCK EPPENDORF tubes, disrupted with a KLECKOTM tissue pulverizer (GARCIA MANUFACTURING, Visalia, CA) with three tungsten beads in 1 mL of TRIZOL (INVrfROGEN) for 5 min, then incubated at room temperature (RT) for 10 min.
  • RT room temperature
  • the samples are centrifuged for 10 min at 4°C at 11,000 rpm and the supernatant is transferred into a fresh 2 mL SAFELOCK EPPENDORF tube.
  • the tube is mixed by inversion for 2 to 5 min, incubated at RT for 10 minutes, and centrifuged at 12,000 x g for 15 min at 4°C.
  • the top phase is transferred into a sterile 1.5 mL EPPENDORF tube, 600 ⁇ ⁇ of 100% isopropanol are added, followed by incubation at RT for 10 min to 2 hr, then centrifuged at 12,000 x g for 10 min at 4° to 25°C.
  • the supernatant is discarded and the RNA pellet is washed twice with 1 mL of 70% ethanol, with centrifugation at 7,500 x g for 10 min at 4° to 25°C between washes.
  • the ethanol is discarded and the pellet is briefly air dried for 3 to 5 min before resuspending in 50 ⁇ ⁇ of nuclease-free water.
  • Total RNA is quantified using the NANODROP 8000® (THERMO-FISHER) and samples are normalized to 5 ⁇ g/10 ⁇ L ⁇ 10 of glyoxal (AMBION/INVITROGEN) are then added to each sample. Five to 14 ng of DIG RNA standard marker mix (ROCHE APPLIED SCIENCE, Indianapolis, IN) are dispensed and added to an equal volume of glyoxal.
  • NANODROP 8000® THERMO-FISHER
  • samples are normalized to 5 ⁇ g/10 ⁇ L ⁇ 10 of glyoxal (AMBION/INVITROGEN) are then added to each sample.
  • Five to 14 ng of DIG RNA standard marker mix (ROCHE APPLIED SCIENCE, Indianapolis, IN) are dispensed and added to an equal volume of glyoxal.
  • RNA samples and marker RNAs are denatured at 50°C for 45 min and stored on ice until loading on a 1.25% SEAKEM GOLD agarose (LONZA, Allendale, NJ) gel in NORTHERNMAX 10 X glyoxal running buffer (AMBION/INVITROGEN).
  • RNAs are separated by electrophoresis at 65 volts/30 [00296] Following electrophoresis, the gel is rinsed in 2X SSC for 5 min and imaged on a GEL DOC station (BIORAD, Hercules, CA), then the RNA is passively transferred to a nylon membrane (MILLIPORE) overnight at RT, using 10X SSC as the transfer buffer (20X SSC consists of 3 M sodium chloride and 300 mM trisodium citrate, pH 7.0). Following the transfer, the membrane is rinsed in 2X SSC for 5 minutes, the RNA is UV-crosslinked to the membrane (AGILENT/STRATAGENE), and the membrane is allowed to dry at RT for up to 2 days.
  • the membrane is prehybridized in ULTRAHYB buffer (AMBION/INVITROGEN) for 1 to 2 hr.
  • the probe consists of a PCR amplified product containing the sequence of interest, (for example, the antisense sequence portion of SEQ ID NO: 11 or SEQ ID NO: 12, as appropriate) labeled with digoxygenin by means of a ROCHE APPLIED SCIENCE DIG procedure.
  • Hybridization in recommended buffer is overnight at a temperature of 60°C in hybridization tubes.
  • the blot is subjected to DIG washes, wrapped, exposed to film for 1 to 30 minutes, then the film is developed, all by methods recommended by the supplier of the DIG kit.
  • qPCR analysis Transgene detection by hydrolysis probe assay was performed by real-time PCR using a LightCycler®480 system. Oligonucleotides to be used in hydrolysis probe assays to detect the ST-LS1 intron sequence (SEQ ID NO: 14), or to detect a portion of the SpecR gene (i.e. the spectinomycin resistance gene borne on the binary vector plasmids; SEQ ID NO:68; SPC1 oligonucleotides in Table 9), were designed using LightCycler® Probe Design Software 2.0.
  • oligonucleotides to be used in hydrolysis probe assays to detect a segment of the AAD-1 herbicide tolerance gene (SEQ ID NO:62; GAADl oligonucleotides in Table 9) were designed using Primer Express software (Applied Biosystems). Table 9 shows the sequences of the primers and probes. Assays were multiplexed with reagents for an endogenous maize chromosomal gene (Invertase (SEQ ID NO:59; GENBANK Accession No: U16123; referred to herein as IVRl), which served as an internal reference sequence to ensure gDNA was present in each assay.
  • IVRl endogenous maize chromosomal gene
  • LightCycler®480 Probes Master mix (Roche Applied Science) was prepared at lx final concentration in a 10 ⁇ ⁇ volume multiplex reaction containing 0.4 ⁇ of each primer and 0.2 ⁇ of each probe (Table 10).
  • a two step amplification reaction was performed as outlined in Table 11. Fluorophore activation and emission for the FAM- and HEX-labeled probes were as described above; CY5 conjugates are excited maximally at 650 nm and fluoresce maximally at 670 nm.
  • Cp scores (the point at which the fluorescence signal crosses the background threshold) were determined from the real time PCR data using the fit points algorithm (LightCycler® software release 1.5) and the Relative Quant module (based on the AACt method). Data were handled as described previously (above; RNA qPCR).
  • extracts are prepared from various plant tissues derived from a plant producing the insecticidal dsRNA and the extracted nucleic acids are dispensed on top of artificial diets for bioassays as previously described herein.
  • the results of such feeding assays are compared to similarly conducted bioassays that employ appropriate control tissues from host plants that do not produce an insecticidal dsRNA, or to other control samples.
  • the percent of growth inhibition is calculated as the mean weight of the experimental treatments divided by the mean of the average weight of two control well treatments. The data are expressed as a Percent Growth Inhibition (of the Negative Controls). Mean weights that exceed the control mean weight are normalized to zero.
  • Greenhouse bioassays included two kinds of negative control plants.
  • Transgenic negative control plants were generated by transformation with vectors harboring genes designed to produce a yellow fluorescent protein (YFP) or a YFP hairpin dsRNA ⁇ See Example 4).
  • Nontransformed negative control plants were grown from seeds of lines 7sh382 or B 104. Bioassays were conducted on two separate dates, with negative controls included in each set of plant materials.
  • Table 12 shows the combined results of molecular analyses and bioassays for COPI alpha-hairpin plants. Examination of the bioassay results summarized in Table 12 reveals the surprising and unexpected observation that the majority of the transgenic maize plants harboring constructs that express an COPI alpha hairpin dsRNA comprising segments of SEQ ID NO:l, for example, as exemplified in SEQ ID NO: 11 and SEQ ID NO: 12, are protected against root damage incurred by feeding of western corn rootworm larvae. Twenty-two of the 37 graded events had a root rating of 0.5 or lower. Table 13 shows the combined results of molecular analyses and bioassays for negative control plants.
  • COPI alpha-hairpin v3 expressing maize plants COPI alpha-hairpin v3 expressing maize plants.
  • Additional hairpin dsRNAs may be derived, for example, from coleopteran pest sequences such as, for example, Cafl-
  • VatpaseH U.S. Patent Application Publication No. 2012/0198586
  • PPI-87B U.S. Patent
  • RNA preparations from selected independent T ⁇ lines are optionally used for RT-PCR with primers designed to bind in the
  • RNAi molecules having mismatch sequences with more than 80% sequence identity to target genes affect corn rootworms in a way similar to that seen with RNAi molecules having 100% sequence identity to the target genes.
  • the pairing of mismatch sequence with native sequences to form a hairpin dsRNA in the same RNAi construct delivers plant- processed siRNAs capable of affecting the growth, development and viability of feeding coleopteran pests.
  • RNA-mediated gene silencing In planta delivery of dsRNA, siRNA or miRNA corresponding to target genes and the subsequent uptake by coleopteran pests through feeding results in down-regulation of the target genes in the coleopteran pest through RNA-mediated gene silencing.
  • the function of a target gene is important at one or more stages of development, the growth, development, and reproduction of the coleopteran pest is affected, and in the case of at least one of WCR, NCR, SCR, MCR, D. balteata LeConte, D. u. tenella, and D. u. undecimpunctata Mannerheim, leads to failure to successfully infest, feed, develop, and/or reproduce, or leads to death of the coleopteran pest.
  • the choice of target genes and the successful application of RNAi is then used to control coleopteran pests.
  • Plant shoot characteristics such as height, leaf numbers and sizes, time of flowering, floral size and appearance are similar. In general, there are no observable morphological differences between transgenic lines and those without expression of target iRNA molecules when cultured in vitro and in soil in the glasshouse.
  • Transgenic Zea mays Comprising a Coleopteran Pest Sequence and Additional RNAi Constructs
  • a transgenic Zea mays plant comprising a heterologous coding sequence in its genome that is transcribed into an iRNA molecule that targets an organism other than a coleopteran pest is secondarily transformed via Agwbacterium or WHISKERSTM methodologies (see Petolino and Arnold (2009) Methods Mol. Biol. 526:59-67) to produce one or more insecticidal dsRNA molecules (for example, at least one dsRNA molecule including a dsRNA molecule targeting a gene comprising SEQ ID NO: l).
  • Plant transformation plasmid vectors prepared essentially as described in EXAMPLE 4 are delivered via Agwbacterium or WHISKERSTM-mediated transformation methods into maize suspension cells or immature maize embryos obtained from a transgenic Hi ⁇ or B104 Zea mays plant comprising a heterologous coding sequence in its genome that is transcribed into an iRNA molecule that targets an organism other than a coleopteran pest.
  • Transgenic Zea mays Comprising an RNAi Construct and Additional Coleopteran Pest Control
  • a transgenic Zea mays plant comprising a heterologous coding sequence in its genome that is transcribed into an iRNA molecule that targets a coleopteran pest organism (for example, at least one dsRNA molecule including a dsRNA molecule targeting a gene comprising SEQ ID NO: 1) is secondarily transformed via Agwbacterium or WHISKERSTM methodologies (see Petolino and Arnold (2009) Methods Mol. Biol.
  • insecticidal protein molecules for example, CrylB, Cryll, Cry2A, Cry3, Cry7A, Cry8, Cry9D, Cryl4, Cryl8, Cry22, Cry23, Cry34, Cry35, Cry36, Cry37, Cry43, Cry55, CytlA, and Cyt2C insecticidal proteins.
  • Plant transformation plasmid vectors prepared essentially as described in EXAMPLE 4 are delivered via Agwbacterium or WHISKERSTM-mediated transformation methods into maize suspension cells or immature maize embryos obtained from a transgenic B104 Zea mays plant comprising a heterologous coding sequence in its genome that is transcribed into an iRNA molecule that targets a coleopteran pest organism. Doubly-transformed plants are obtained that produce iRNA molecules and insecticidal proteins for control of coleopteran pests.
  • Neotropical Brown Stink Bug (Euschistus hews) following COPI alpha RNAi injection
  • Neotropical Brown Stink Bug (BSB; Euschistus heros) colony.
  • BSB were reared in a 27°C incubator, at 65% relative humidity, with 16: 8 hour light: dark cycle.
  • One gram of eggs collected over 2-3 days were seeded in 5L containers with filter paper discs at the bottom; the containers were covered with #18 mesh for ventilation.
  • Each rearing container yielded approximately 300-400 adult BSB.
  • the insects were fed fresh green beans three times per week, a sachet of seed mixture that contained sunflower seeds, soybeans, and peanuts (3: 1:1 by weight ratio) was replaced once a week. Water was supplemented in vials with cotton plugs as a wicks. After the initial two weeks, insects were transferred onto new container once a week.
  • BSB artificial diet prepared as follows (used within two weeks of preparation). Lyophilized green beans were blended to a fine powder in a MAGIC BULLET® blender while raw (organic) peanuts were blended in a separate MAGIC BULLET® blender. Blended dry ingredients were combined (weight percentages: green beans, 35%; peanuts, 35%; sucrose, 5%; Vitamin complex (e.g. Vanderzant Vitamin Mixture for insects, SIGMA-ALDRICH, Catalog No. V1007), 0.9%); in a large MAGIC BULLET® blender, which was capped and shaken well to mix the ingredients. The mixed dry ingredients were then added to a mixing bowl.
  • Vitamin complex e.g. Vanderzant Vitamin Mixture for insects, SIGMA-ALDRICH, Catalog No. V1007
  • RNA sequencing using an illumina® HiSeqTM system provided candidate target gene sequences for use in RNAi insect control technology.
  • BSB COPI alpha ortholog identification A tBLASTn search of the BSB pooled transcriptome was performed using as query the Drosophila aCOP protein sequences aCOP-PA and aCOP-PB: GENBANK Accession Nos. NP_477395 and NP_728648, respectively.
  • BSB COPI alpha SEQ ID NO: 84
  • SEQ ID NO: 85 was identified as a Euschistus heros candidate target gene product with predicted peptide sequence SEQ ID NO: 85.
  • cDNA was prepared from total BSB RNA extracted from a single young adult insect (about 90 mg) using TRIzol® Reagent (LIFE TECHNOLOGIES). The insect was homogenized at room temperature in a 1.5 mL microcentrifuge tube with 200 of TRIzol® using a pellet pestle (FISHERBRAND Catalog No. 12-141-363) and Pestle Motor Mixer (COLE-PARMER, Vernon Hills, IL). Following homogenization, an additional 800 ⁇ ⁇ of TRIzol® was added, the homogenate was vortexed, and then incubated at room temperature for five minutes. Cell debris was removed by centrifugation and the supernatant was transferred to a new tube.
  • TRIzol® Reagent LIFE TECHNOLOGIES
  • RNA pellet was dried at room temperature and resuspended in 200 ⁇ ⁇ of Tris Buffer from a GFX PCR DNA AND Gel Extraction kit (illustraTM; GE HEALTHCARE LIFE SCIENCES) using Elution Buffer Type 4 (i.e. 10 mM Tris-HCl pH8.0). RNA concentration was determined using a NanoDropTM 8000 spectrophotometer (Thermo Scientific, Wilmington, DE).
  • cDNA amplification cDNA was reverse-transcribed from 5 ⁇ g of BSB total RNA template and oligo dT primer using a SUPERSCRIPT ⁇ FIRST-STRAND SYNTHESIS SYSTEMTM for RT-PCR (INVITROGEN), following the supplier's recommended protocol. The final volume of the transcription reaction was brought to 100 ⁇ ⁇ with nuclease-free water.
  • the DNA templates were amplified by touch-down PCR (annealing temperature lowered from 60°C to 50°C in a l°C/cycle decrease) with 1 ⁇ L ⁇ of cDNA (above) as the template. Fragments comprising 494 bp and 495 bp of BSB_COPI alpha- 1 and BSB_COPI alpha-2, respectively, were generated during 35 cycles of PCR. The above procedure was also used to amplify a 301 bp negative control template YFPv2 (SEQ ID NO:92) using YFPv2-F (SEQ ID NO:93) and YFPv2-R (SEQ ID NO:94) primers.
  • the BSB_COPI alpha- 1, BSB_COPI alpha-2 and YFPv2 primers contained a T7 phage promoter sequence (SEQ ID NO:5) at their 5' ends, and thus enabled the use of YFPv2 and BSB_COPI alpha DNA fragments for dsRNA transcription.
  • dsRNA synthesis was synthesized using 2 ⁇ L ⁇ of PCR product (above) as the template with a MEGAscriptTM RNAi kit (AMBION) used according to the manufacturer's instructions. (See FIGURE 1). dsRNA was quantified on a NANODROPTM 8000 spectrophotometer and diluted to 500 ng/ ⁇ in nuclease-free 0.1X TE buffer (1 mM Tris HCL, 0.1 mM EDTA, pH7.4).
  • Injections were performed using a NANOJECTTM II injector (DRUMMOND SCIENTIFIC, Broomhall, PA) equipped with an injection needle pulled from a Drummond 3.5 inch #3-000-203-G/X glass capillary. The needle tip was broken and the capillary was backfilled with light mineral oil, then filled with 2 to 3 ⁇ ⁇ of dsRNA. dsRNA was injected into the abdomen of the nymphs (10 insects injected per dsRNA per trial), and the trials were repeated on three different days.
  • NANOJECTTM II injector DRUMMOND SCIENTIFIC, Broomhall, PA
  • Injected insects (5 per well) were transferred into 32-well trays (Bio-RT-32 Rearing Tray; BIO-SERV, Frenchtown, NJ) containing a pellet of artificial BSB diet and covered with Pull-N- PeelTM tabs (BIO-CV-4; BIO-SERV). Moisture was supplied by means of 1.25 mL of water in a 1.5 mL microcentrifuge tube with a cotton wick. The trays were incubated at 26.5°C, 60% humidity and 16: 8 hour light: dark photoperiod. Viability counts and weights were taken on day 7 after the injections.
  • Injections identified BSB COPI alpha as a lethal dsRNA target.
  • dsRNA that targets segment of YFP coding region, YFPv2 was used as a negative control in BSB injection experiments.
  • 27.6 ng of BSB_COPI alpha- 1 and BSB_COPI alpha-2 dsRNA injected into the hemoceol of 2nd instar BSB nymphs produced numerically higher mortality within seven days.
  • Table 1 Results of BSB COPI alpha dsRNA injection into the hemoceol of 2 n instar Brown Stink Bug nymphs seven days after injection.
  • Ten to 20 transgenic To Zea mays plants harboring expression vectors for nucleic acids comprising SEQ ID NO: 84, SEQ ID NO: 86 and/or SEQ ID NO:87 are generated as described in EXAMPLE 7.
  • a further 10-20 T ⁇ Zea mays independent lines expressing hairpin dsRNA for an RNAi construct are obtained for BSB challenge.
  • Hairpin dsRNA may be derived as set forth in SEQ ID NO:86 or SEQ ID NO:87 or otherwise further comprising SEQ ID NO:84.
  • RNA preparations from selected independent T ⁇ lines are optionally used for RT-PCR with primers designed to bind in the ST-LSl intron of the hairpin expression cassette in each of the RNAi constructs.
  • specific primers for each target gene in an RNAi construct are optionally used to amplify and confirm the production of the pre-processed mRNA required for siRNA production in planta.
  • the amplification of the desired bands for each target gene confirms the expression of the hairpin RNA in each transgenic Zea mays plant. Processing of the dsRNA hairpin of the target genes into siRNA is subsequently optionally confirmed in independent transgenic lines using RNA blot hybridizations.
  • RNAi molecules having mismatch sequences with more than 80% sequence identity to target genes affect corn rootworms in a way similar to that seen with RNAi molecules having 100% sequence identity to the target genes.
  • the pairing of mismatch sequence with native sequences to form a hairpin dsRNA in the same RNAi construct delivers plant- processed siRNAs capable of affecting the growth, development and viability of feeding hemipteran pests.
  • a target gene When the function of a target gene is important at one or more stages of development, the growth, development, and reproduction of the hemipteran pest is affected, and in the case of at least one of Euschistus hews, Piezodorus guildinii, Halyomorpha halys, Nez ra viridula, Acrosternum hilare, and Euschistus servus leads to failure to successfully infest, feed, develop, and/or reproduce, or leads to death of the hemipteran pest.
  • the choice of target genes and the successful application of RNAi is then used to control hemipteran pests.
  • Plant shoot characteristics such as height, leaf numbers and sizes, time of flowering, floral size and appearance are similar. In general, there are no observable morphological differences between transgenic lines and those without expression of target iRNA molecules when cultured in vitro and in soil in the glasshouse.
  • transgenic TO Glycine max plants harboring expression vectors for nucleic acids comprising SEQ ID NO: 84, SEQ ID NO: 86 and/or SEQ ID NO: 87 are generated as is known in the art, including for example by Agrobacterium-mediated transformation, as follows. Mature soybean (Glycine max) seeds are sterilized overnight with chlorine gas for sixteen hours. Following sterilization with chlorine gas, the seeds are placed in an open container in a LaminarTM flow hood to dispel the chlorine gas. Next, the sterilized seeds are imbibed with sterile H20 for sixteen hours in the dark using a black box at 24° C.
  • split-seed soybeans Preparation of split-seed soybeans.
  • the split soybean seed comprising a portion of an embryonic axis protocol required preparation of soybean seed material which is cut longitudinally, using a #10 blade affixed to a scalpel, along the hilum of the seed to separate and remove the seed coat, and to split the seed into two cotyledon sections. Careful attention is made to partially remove the embryonic axis, wherein about 1/2 - 1/3 of the embryo axis remains attached to the nodal end of the cotyledon.
  • the split soybean seeds comprising a partial portion of the embryonic axis are then immersed for about 30 minutes in a solution of Agrobacterium tumefaciens (e.g., strain EHA 101 or EHA 105) containing binary plasmid comprising SEQ ID NO: 84, SEQ ID NO:86 and/or SEQ ID NO:87.
  • Agrobacterium tumefaciens solution is diluted to a final concentration of ⁇ 0.6 OD650 before immersing the cotyledons comprising the embryo axis.
  • [00332] Plant induction. After 5 days of co-cultivation, the split soybean seeds are washed in liquid Shoot Induction (SI) media consisting of B5 salts, B5 vitamins, 28 mg/L Ferrous, 38 mg/L Na2EDTA, 30 g/L sucrose, 0.6 g/L MES, 1.11 mg/L BAP, 100 mg/L TimentinTM, 200 mg/L cefotaxime, and 50 mg/L vancomycin (pH 5.7).
  • SI liquid Shoot Induction
  • the split soybean seeds are then cultured on Shoot Induction I (SI I) medium consisting of B5 salts, B5 vitamins, 7 g/L Noble agar, 28 mg/L Ferrous, 38 mg/L Na2EDTA, 30 g/L sucrose, 0.6 g/L MES, 1.11 mg/L BAP, 50 mg/L TimentinTM, 200 mg/L cefotaxime, 50 mg/L vancomycin (pH 5.7), with the flat side of the cotyledon facing up and the nodal end of the cotyledon imbedded into the medium.
  • the explants from the transformed split soybean seed are transferred to the Shoot Induction ⁇ (SI II) medium containing SI I medium supplemented with 6 mg/L glufosinate (Liberty®).
  • the SE medium consists of MS salts, 28 mg/L Ferrous, 38 mg/L Na2EDTA, 30 g/L sucrose and 0.6 g/L MES, 50 mg/L asparagine, 100 mg/L L-pyroglutamic acid, 0.1 mg/L IAA, 0.5 mg/L GA3, 1 mg/L zeatin riboside, 50 mg/L TimentinTM, 200 mg/L cefotaxime, 50 mg/L vancomycin, 6 mg/L glufosinate, 7 g/L Noble agar, (pH 5.7).
  • the cultures are transferred to fresh SE medium every 2 weeks.
  • the cultures are grown in a ConvironTM growth chamber at 24° C with an 18 h photoperiod at a light intensity of 80-90 ⁇ / ⁇
  • Rooting Elongated shoots which developed from the cotyledon shoot pad are isolated by cutting the elongated shoot at the base of the cotyledon shoot pad, and dipping the elongated shoot in 1 mg/L IBA (Indole 3-butyric acid) for 1-3 minutes to promote rooting. Next, the elongated shoots are transferred to rooting medium (MS salts, B5 vitamins, 28 mg/L Ferrous, 38 mg/L Na2EDTA, 20 g/L sucrose and 0.59 g/L MES, 50 mg/L asparagine, 100 mg/L L- pyroglutamic acid 7 g/L Noble agar, pH 5.6) in phyta trays.
  • rooting medium MS salts, B5 vitamins, 28 mg/L Ferrous, 38 mg/L Na2EDTA, 20 g/L sucrose and 0.59 g/L MES, 50 mg/L asparagine, 100 mg/L L- pyroglutamic acid 7 g/L Noble a
  • hairpin dsRNA for an RNAi construct are obtained for BSB challenge.
  • Hairpin dsRNA may be derived as set forth in SEQ ID NO:86 and/or SEQ ID NO:87 or otherwise further comprising SEQ ID NO:84. These are confirmed through RT-PCR or other molecular analysis methods.
  • Total RNA preparations from selected independent T lines are optionally used for RT-PCR with primers designed to bind in the ST-LS1 intron of the hairpin expression cassette in each of the RNAi constructs.
  • RNAi constructs specific primers for each target gene in an RNAi construct are optionally used to amplify and confirm the production of the pre-processed mRNA required for siRNA production in planta.
  • the amplification of the desired bands for each target gene confirms the expression of the hairpin RNA in each transgenic Glycine max plant. Processing of the dsRNA hairpin of the target genes into siRNA is subsequently optionally confirmed in independent transgenic lines using RNA blot hybridizations.
  • RNAi molecules having mismatch sequences with more than 80% sequence identity to target genes affect corn rootworms in a way similar to that seen with RNAi molecules having 100% sequence identity to the target genes.
  • the pairing of mismatch sequence with native sequences to form a hairpin dsRNA in the same RNAi construct delivers plant- processed siRNAs capable of affecting the growth, development and viability of feeding hemipteran pests.
  • a target gene When the function of a target gene is important at one or more stages of development, the growth, development, and reproduction of the hemipteran pest is affected, and in the case of at least one of Euschistus hews, Piezodorus guildinii, Halyomorpha halys, Nezara viridula, Acrosternum hilare, and Euschistus servus leads to failure to successfully infest, feed, develop, and/or reproduce, or leads to death of the hemipteran pest.
  • the choice of target genes and the successful application of RNAi is then used to control hemipteran pests.
  • Plant shoot characteristics such as height, leaf numbers and sizes, time of flowering, floral size and appearance are similar. In general, there are no observable morphological differences between transgenic lines and those without expression of target iRNA molecules when cultured in vitro and in soil in the glasshouse.
  • dsRNA feeding assays on artificial diet 32- well trays are set up with an -18 mg pellet of artificial diet and water, as for injection experiments (EXAMPLE 12). dsRNA at a concentration of 200 ng/ ⁇ is added to the food pellet and water sample, 100 ⁇ to each of two wells.
  • Arabidopsis transformation vectors containing a target gene construct for hairpin formation comprising segments of COPI alpha (SEQ ID NO: 84) are generated using standard molecular methods similar to EXAMPLE 4.
  • Arabidopsis transformation is performed using standard Agrobacterium-based procedure. Tl seeds are selected with glufosinate tolerance selectable marker.
  • Transgenic Tl Arabidopsis plants are generated and homozygous simple-copy T2 transgenic plants are generated for insect studies. Bioassays are performed on growing Arabidopsis plants with inflorescences. Five to ten insects are placed on each plant and monitored for survival within 14 days.
  • the primary mRNA transcript contains the two COPI alpha gene segment sequences as large inverted repeats of one another, separated by the intron sequence.
  • a copy of a Arabidopsis thaliana ubiquitin 10 promoter (Callis et al. (1990) J. Biological Chem. 265: 12486-12493) is used to drive production of the primary mRNA hairpin transcript, and a fragment comprising a 3' untranslated region from Open Reading Frame 23 of Agrobacterium tumefaciens (AtuORF23 3' UTR vl; US Patent No. 5,428,147) is used to terminate transcription of the hairpin-RNA-expressing gene.
  • the hairpin clone within entry vector pDAB3916 described above is used in standard GATEWAY® recombination reaction with a typical binary destination vector pDAB101836 to produce hairpin RNA expression transformation vectors for Agrobacterium- mediated Arabidopsis transformation.
  • Binary destination vector pDAB101836 comprises a herbicide tolerance gene, DSM-2v2 (U.S. Patent App. No. 2011/0107455), under the regulation of a Cassava vein mosaic virus promoter (CsVMV Promoter v2, U.S. Patent No. US 7601885; Verdaguer et al, (1996) Plant Molecular Biology, 31:1129-1139).
  • CsVMV Promoter v2 U.S. Patent No. US 7601885; Verdaguer et al, (1996) Plant Molecular Biology, 31:1129-1139.
  • a fragment comprising a 3' untranslated region from Open Reading Frame 1 of Agrobacterium tumefaciens (AtuORFl 3' UTR v6; Huang et al, (1990) J. Bacteriol, 172:1814-1822) is used to terminate transcription of the DSM2v2 mRNA.
  • Entry construct pDAB 112644 comprises a YFP hairpin sequence (hp YFP v2-l, SEQ ID NO:95) under the expression control of an Arabidopsis Ubiquitin 10 promoter (as above) and a fragment comprising an ORF23 3' untranslated region from Agrobacterium tumefaciens (as above).
  • Arabidopsis transformation and Tl Selection Twelve to fifteen Arabidopsis plants (c.v. Columbia) are grown in 4" pots in the green house with light intensity of 250 ⁇ 1/ ⁇ 2, 25°C, 18:6 hours of light:dark conditions. Primary flower stems are trimmed one week before transformation.
  • Agrobacterium inoculums are prepared by incubating 10 ⁇ of recombinant Agrobacterium glycerol stock in 100 ml LB broth (Sigma L3022) +100 mg/L Spectinomycin + 50 mg/L Kanamycin at 28°C and shaking at 225 rpm for 72 hours.
  • Agrobacterium cells are harvested and suspended into 5% sucrose + 0.04% Silwet-L77 (Lehle Seeds Cat # VIS-02) +10 ⁇ g/L benzamino purine (BA) solution to OD600 0.8-1.0 before floral dipping.
  • the above-ground parts of the plant are dipped into the Agrobacterium solution for 5-10 minutes, with gentle agitation.
  • the plants are then transferred to the greenhouse for normal growth with regular watering and fertilizing until seed set.
  • Tl Arabidopsis transformed with hairpin RNAi constructs Up to 200 mg of Tl seeds from each transformation is stratified in 0.1% agarose solution. The seeds are planted in germination trays (10.5" x 21" x 1"; T.O. Plastics Inc., Clearwater, MN.) with #5 sunshine media. Transformants are selected for tolerance to Ignite® (glufosinate) at 280 g/ha at 6 and 9 days post planting. Selected events are transplanted into 4" diameter pots. Insertion copy analysis is performed within a week of transplanting via hydrolysis quantitative Real-Time PCR
  • DSM2v2 selectable marker using LightCycler Probe Design Software 2.0 (Roche). Plants are maintained at 24°C, with a 16:8 hour ligh dark photoperiod under fluorescent and incandescent lights at intensity of 100-150mE/m2xs.
  • E. heros plant feeding bioassay At least four low copy (1-2 insertions), four medium copy (2-3 insertions), and four high copy (>4 insertions) events are selected for each construct. Plants are grown to a flowering stage (plants containing flowers and siliques). The surface of soil is covered with - 50 ml volume of white sand for easy insect identification. Five to ten 2nd instar E. heros nymphs are introduced onto each plant. The plants are covered with plastic tubes that are 3" in diameter, 16" tall, and with wall thickness of 0.03" (Item No. 484485, Visipack Fenton MO); the tubes are covered with nylon mesh to isolate the insects.
  • the plants are kept under normal temperature, light, and watering conditions in a conviron. In 14 days, the insects are collected and weighed; percent mortality as well as growth inhibition (1 - weight treatment/weight control) are calculated. YFP hairpin-expressing plants are used as controls.
  • T2 Arabidopsis seed generation and T2 bioassays T2 seed is produced from selected low copy (1-2 insertions) events for each construct. Plants (homozygous and/or heterozygous) are subjected to E. heros feeding bioassay, as described above. T3 seed is harvested from homozygotes and stored for future analysis.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Plant Pathology (AREA)
  • Insects & Arthropods (AREA)
  • Virology (AREA)
  • Pest Control & Pesticides (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Agricultural Chemicals And Associated Chemicals (AREA)
  • Catching Or Destruction (AREA)
PCT/US2015/054472 2014-10-13 2015-10-07 Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests Ceased WO2016060912A2 (en)

Priority Applications (15)

Application Number Priority Date Filing Date Title
EP15850026.4A EP3207051A4 (en) 2014-10-13 2015-10-07 Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
KR1020177009376A KR20170066403A (ko) 2014-10-13 2015-10-07 딱정벌레류 및 노린재류 해충에 대한 저항성을 부여하는 copi 코토머 알파 서브유닛 핵산 분자
BR112017007084A BR112017007084A8 (pt) 2014-10-13 2015-10-07 Moléculas de ácido nucleico subunidade copi coatomer alfa que confere resistância a pragas de coleóptero e hemípteros
US15/757,997 US20200224214A1 (en) 2014-10-13 2015-10-07 Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
RU2017111817A RU2017111817A (ru) 2014-10-13 2015-10-07 Молекулы нуклеиновой кислоты альфа-субъединицы коатомера copi, которые придают устойчивость к жесткокрылым и полужесткокрылым вредителям
MX2017004452A MX2017004452A (es) 2014-10-13 2015-10-07 Moléculas de ácido nucleico de la subunida alfa del coatómero copi que confiere resistencia contra plagas de coleoóteros y hemípteros.
AU2015333922A AU2015333922B2 (en) 2014-10-13 2015-10-07 Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
CA2963794A CA2963794A1 (en) 2014-10-13 2015-10-07 Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
CN201580057968.0A CN107148426A (zh) 2014-10-13 2015-10-07 赋予鞘翅目和半翅目害虫抗性的copi外被体alpha亚单位核酸分子
JP2017519275A JP2017536097A (ja) 2014-10-13 2015-10-07 鞘翅目および半翅目害虫に対する抵抗性を付与するcopiコートマーアルファサブユニット核酸分子
IL251580A IL251580A0 (en) 2014-10-13 2017-04-05 Nucleic acid molecules of the alpha subunit of the coatomer copi conferring resistance to pests of the beetle and bedbug series
PH12017500645A PH12017500645A1 (en) 2014-10-13 2017-04-06 Copi coatomer alpha sub unit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
CONC2017/0003434A CO2017003434A2 (es) 2014-10-13 2017-04-10 Moléculas de ácido nucleico de la subunidad alfa del coatómero copi que confiere resistencia contra plagas de coleópteros y hemípteros
AU2019202749A AU2019202749A1 (en) 2014-10-13 2019-04-18 COPI coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
AU2021258028A AU2021258028A1 (en) 2014-10-13 2021-10-28 Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201462063199P 2014-10-13 2014-10-13
US62/063,199 2014-10-13

Publications (2)

Publication Number Publication Date
WO2016060912A2 true WO2016060912A2 (en) 2016-04-21
WO2016060912A3 WO2016060912A3 (en) 2016-06-09

Family

ID=55747536

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/054472 Ceased WO2016060912A2 (en) 2014-10-13 2015-10-07 Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests

Country Status (19)

Country Link
US (1) US20200224214A1 (cg-RX-API-DMAC7.html)
EP (1) EP3207051A4 (cg-RX-API-DMAC7.html)
JP (1) JP2017536097A (cg-RX-API-DMAC7.html)
KR (1) KR20170066403A (cg-RX-API-DMAC7.html)
CN (1) CN107148426A (cg-RX-API-DMAC7.html)
AR (1) AR102252A1 (cg-RX-API-DMAC7.html)
AU (3) AU2015333922B2 (cg-RX-API-DMAC7.html)
BR (1) BR112017007084A8 (cg-RX-API-DMAC7.html)
CA (1) CA2963794A1 (cg-RX-API-DMAC7.html)
CL (1) CL2017000882A1 (cg-RX-API-DMAC7.html)
CO (1) CO2017003434A2 (cg-RX-API-DMAC7.html)
IL (1) IL251580A0 (cg-RX-API-DMAC7.html)
MX (1) MX2017004452A (cg-RX-API-DMAC7.html)
PH (1) PH12017500645A1 (cg-RX-API-DMAC7.html)
PY (1) PY1562426A (cg-RX-API-DMAC7.html)
RU (1) RU2017111817A (cg-RX-API-DMAC7.html)
TW (1) TW201619384A (cg-RX-API-DMAC7.html)
UY (1) UY36352A (cg-RX-API-DMAC7.html)
WO (1) WO2016060912A2 (cg-RX-API-DMAC7.html)

Cited By (21)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016205445A1 (en) 2015-06-16 2016-12-22 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
WO2017066094A1 (en) 2015-10-12 2017-04-20 Pioneer Hi-Bred International, Inc. Biologicals and their use in plants
WO2017218207A1 (en) 2016-06-16 2017-12-21 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
WO2018013333A1 (en) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018111551A1 (en) 2016-12-14 2018-06-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018118811A1 (en) 2016-12-22 2018-06-28 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018140214A1 (en) 2017-01-24 2018-08-02 Pioneer Hi-Bred International, Inc. Nematicidal protein from pseudomonas
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
WO2018208882A1 (en) 2017-05-11 2018-11-15 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
CN109563520A (zh) * 2016-08-05 2019-04-02 先正达参股股份有限公司 使用rna分子控制鞘翅目有害生物
WO2019074598A1 (en) 2017-10-13 2019-04-18 Pioneer Hi-Bred International, Inc. VIRUS-INDUCED GENETIC SILENCING TECHNOLOGY FOR THE CONTROL OF INSECTS IN MAIZE
WO2019143526A1 (en) 2018-01-18 2019-07-25 Pioneer Hi-Bred International, Inc. Alginate encapsulation of fungal microsclerotia
WO2019169150A1 (en) 2018-03-02 2019-09-06 Pioneer Hi-Bred International, Inc. Plant health assay
WO2019226508A1 (en) 2018-05-22 2019-11-28 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
WO2020046701A1 (en) 2018-08-29 2020-03-05 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2021158455A1 (en) 2020-02-04 2021-08-12 Dow Agrosciences Llc Compositions having pesticidal utility and processes related thereto
WO2022035649A1 (en) 2020-08-10 2022-02-17 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
EP3710464A4 (en) * 2017-11-13 2022-03-16 Syngenta Participations AG COMBATING PLANT PESTS USING RNA MOLECULES
EP4083215A1 (en) 2016-06-24 2022-11-02 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
WO2023224815A2 (en) 2022-05-18 2023-11-23 Corteva Agriscience Llc Compositions having pesticidal utility and processes related thereto

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110669761B (zh) * 2018-06-15 2022-11-04 北京大北农生物技术有限公司 用于控制昆虫侵袭的核苷酸序列及其方法
CN110616222B (zh) * 2019-08-05 2021-04-23 华南农业大学 防治茄二十八星瓢虫的靶基因及其应用

Family Cites Families (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
GB9724891D0 (en) * 1997-11-25 1998-01-28 Univ York Use of dehydrodiconiferyl alcohol glucosyl transferase
UA79927C2 (en) * 2000-12-05 2007-08-10 Serono Genetics Inst Sa Polynucleotide, coding a polypeptide of potential-depending portal ionic human channel (canion), polypeptyde, antibody, method for identification of candidate modulator of canion-polypeptyde, method for treatment of bipolar disorder or schizophrenia and use of an antibody for production of drugs for treatment of schizophrenia or bipolar disorder
AU2005244258B2 (en) * 2004-04-09 2010-07-01 Monsanto Technology Llc Compositions and methods for control of insect infestations in plants
EP2281896A3 (en) * 2005-09-16 2012-04-11 deVGen N.V. Transgenic plant-based methods for plant insect pests using RNAi
ATE548459T1 (de) * 2005-09-16 2012-03-15 Monsanto Technology Llc Verfahren zur genetischen kontrolle von insektenbefall bei pflanzen und zusammensetzungen
CA2622671C (en) * 2005-09-16 2020-12-22 Devgen Nv Methods for controlling pests using rnai
CN100342013C (zh) * 2005-10-14 2007-10-10 王健伟 密码子优化的杯状病毒衣壳蛋白的编码核苷酸序列及其应用
US8530440B2 (en) * 2010-05-03 2013-09-10 Board Of Regents Of The University Of Nebraska dsRNA delivery composition and methods of use
US8987552B2 (en) * 2010-12-30 2015-03-24 Dow Agrosciences, Llc. Nucleic acid molecules that target the vacuolar ATPase H subunit and confer resistance to coleopteran pests
UY34001A (es) * 2011-03-30 2012-10-31 Futuragene Israel Ltd Agentes para el control de la avispa de las agallas
CA2836529A1 (en) * 2011-05-18 2012-11-22 Plant Sensory Systems, Llc Methods to increase plant productivity
CN102796187B (zh) * 2011-05-27 2014-07-16 中国科学院上海生命科学研究院 基于RNAi技术防治害虫的新方法
CN103849625B (zh) * 2012-12-07 2016-08-10 中国农业科学院植物保护研究所 一种棉铃虫COPI β基因cDNA及其应用
US9688983B2 (en) * 2012-12-20 2017-06-27 Dow Agrosciences Llc Nucleic acid molecules that confer resistance to coleopteran pests
AR095275A1 (es) * 2013-03-13 2015-09-30 E I Dupont De Nemours & Company Composiciones y métodos para el control insecticida de chinches
US9920316B2 (en) * 2013-03-14 2018-03-20 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
WO2014153254A2 (en) * 2013-03-14 2014-09-25 Pioneer Hi-Bred International Inc. Compositions and methods to control insect pests
RU2021123470A (ru) * 2014-07-29 2021-09-06 Монсанто Текнолоджи Ллс Композиции и способы борьбы с насекомыми-вредителями

Cited By (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016205445A1 (en) 2015-06-16 2016-12-22 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
WO2017066094A1 (en) 2015-10-12 2017-04-20 Pioneer Hi-Bred International, Inc. Biologicals and their use in plants
EP3922100A1 (en) 2015-10-12 2021-12-15 Pioneer Hi-Bred International, Inc. Biologicals and their use in plants
WO2017218207A1 (en) 2016-06-16 2017-12-21 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
EP4083215A1 (en) 2016-06-24 2022-11-02 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
WO2018013333A1 (en) 2016-07-12 2018-01-18 Pioneer Hi-Bred International, Inc. Compositions and methods to control insect pests
CN109563520A (zh) * 2016-08-05 2019-04-02 先正达参股股份有限公司 使用rna分子控制鞘翅目有害生物
WO2018084936A1 (en) 2016-11-01 2018-05-11 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
EP4050021A1 (en) 2016-11-01 2022-08-31 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018111551A1 (en) 2016-12-14 2018-06-21 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018118811A1 (en) 2016-12-22 2018-06-28 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2018140214A1 (en) 2017-01-24 2018-08-02 Pioneer Hi-Bred International, Inc. Nematicidal protein from pseudomonas
WO2018148001A1 (en) 2017-02-08 2018-08-16 Pioneer Hi-Bred International Inc Insecticidal combinations of plant derived insecticidal proteins and methods for their use
WO2018208882A1 (en) 2017-05-11 2018-11-15 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2019074598A1 (en) 2017-10-13 2019-04-18 Pioneer Hi-Bred International, Inc. VIRUS-INDUCED GENETIC SILENCING TECHNOLOGY FOR THE CONTROL OF INSECTS IN MAIZE
US12016339B2 (en) 2017-11-13 2024-06-25 Syngenta Participations Ag Control of plant pests using RNA molecules
EP3710464A4 (en) * 2017-11-13 2022-03-16 Syngenta Participations AG COMBATING PLANT PESTS USING RNA MOLECULES
WO2019143526A1 (en) 2018-01-18 2019-07-25 Pioneer Hi-Bred International, Inc. Alginate encapsulation of fungal microsclerotia
WO2019169150A1 (en) 2018-03-02 2019-09-06 Pioneer Hi-Bred International, Inc. Plant health assay
WO2019226508A1 (en) 2018-05-22 2019-11-28 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
WO2020046701A1 (en) 2018-08-29 2020-03-05 Pioneer Hi-Bred International, Inc. Insecticidal proteins and methods for their use
WO2021158455A1 (en) 2020-02-04 2021-08-12 Dow Agrosciences Llc Compositions having pesticidal utility and processes related thereto
EP4331364A2 (en) 2020-02-04 2024-03-06 Corteva Agriscience LLC Compositions having pesticidal utility and processes related thereto
WO2022035649A1 (en) 2020-08-10 2022-02-17 Pioneer Hi-Bred International, Inc. Plant regulatory elements and methods of use thereof
WO2023224815A2 (en) 2022-05-18 2023-11-23 Corteva Agriscience Llc Compositions having pesticidal utility and processes related thereto

Also Published As

Publication number Publication date
TW201619384A (zh) 2016-06-01
PY1562426A (es) 2017-12-01
RU2017111817A (ru) 2018-11-15
IL251580A0 (en) 2017-06-29
US20200224214A1 (en) 2020-07-16
RU2017111817A3 (cg-RX-API-DMAC7.html) 2019-05-20
WO2016060912A3 (en) 2016-06-09
AR102252A1 (es) 2017-02-15
EP3207051A4 (en) 2018-02-28
AU2021258028A1 (en) 2021-11-25
CL2017000882A1 (es) 2017-11-03
CA2963794A1 (en) 2016-04-21
AU2019202749A1 (en) 2019-05-16
CO2017003434A2 (es) 2017-07-11
BR112017007084A8 (pt) 2023-02-07
CN107148426A (zh) 2017-09-08
KR20170066403A (ko) 2017-06-14
AU2015333922A1 (en) 2017-04-13
PH12017500645A1 (en) 2017-09-25
AU2015333922B2 (en) 2019-01-31
MX2017004452A (es) 2017-12-14
UY36352A (es) 2016-06-01
BR112017007084A2 (pt) 2018-01-16
EP3207051A2 (en) 2017-08-23
JP2017536097A (ja) 2017-12-07

Similar Documents

Publication Publication Date Title
US20210403939A1 (en) Copi coatomer gamma subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
AU2015333922B2 (en) Copi coatomer alpha subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
AU2015333924B2 (en) Copi coatomer delta subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20180251779A1 (en) Copi coatomer beta subunit nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20150322455A1 (en) Sec23 nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20160355841A1 (en) Rna polymerase ii33 nucleic acid molecules to control insect pests
US20160186203A1 (en) Gho/sec24b2 and sec24b1 nucleic acid molecules to control coleopteran and hemipteran pests
US10501755B2 (en) FSH nucleic acid molecules to control insect pests
AU2016350628B2 (en) rab5 nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US10344298B2 (en) WUPA nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US10329581B2 (en) Ribosomal protein L40 (RPL40) nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20190308702A1 (en) Ribosomal protein l40 (rpl40) nucleic acid molecules that confer resistance to coleopteran and hemipteran pests
US20170218390A1 (en) Rpb7 nucleic acid molecules to control insect pests

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15850026

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2963794

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2017/004452

Country of ref document: MX

Ref document number: 251580

Country of ref document: IL

ENP Entry into the national phase

Ref document number: 20177009376

Country of ref document: KR

Kind code of ref document: A

REEP Request for entry into the european phase

Ref document number: 2015850026

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2015850026

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2017519275

Country of ref document: JP

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: NC2017/0003434

Country of ref document: CO

ENP Entry into the national phase

Ref document number: 2015333922

Country of ref document: AU

Date of ref document: 20151007

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

REG Reference to national code

Ref country code: BR

Ref legal event code: B01A

Ref document number: 112017007084

Country of ref document: BR

WWE Wipo information: entry into national phase

Ref document number: A201703275

Country of ref document: UA

ENP Entry into the national phase

Ref document number: 2017111817

Country of ref document: RU

Kind code of ref document: A

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15850026

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 112017007084

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20170406