WO2016050934A1 - Endosomal disentanglement of artificial transcription factors - Google Patents

Endosomal disentanglement of artificial transcription factors Download PDF

Info

Publication number
WO2016050934A1
WO2016050934A1 PCT/EP2015/072737 EP2015072737W WO2016050934A1 WO 2016050934 A1 WO2016050934 A1 WO 2016050934A1 EP 2015072737 W EP2015072737 W EP 2015072737W WO 2016050934 A1 WO2016050934 A1 WO 2016050934A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
artificial transcription
transcription factor
protein
endosome
Prior art date
Application number
PCT/EP2015/072737
Other languages
French (fr)
Inventor
Alice Huxley
Albert NEUTZNER
Josef Flammer
Original Assignee
Aliophtha Ag
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Aliophtha Ag filed Critical Aliophtha Ag
Publication of WO2016050934A1 publication Critical patent/WO2016050934A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/09—Fusion polypeptide containing a localisation/targetting motif containing a nuclear localisation signal
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
    • C07K2319/10—Fusion polypeptide containing a localisation/targetting motif containing a tag for extracellular membrane crossing, e.g. TAT or VP22
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/80—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor
    • C07K2319/81—Fusion polypeptide containing a DNA binding domain, e.g. Lacl or Tet-repressor containing a Zn-finger domain for DNA binding

Definitions

  • the invention relates to artificial transcription factor proteins engineered for efficient transport to the nuclear compartment of cells through enhanced endosomal disentanglement by incorporation of specific endosomal protease cleavage sites into the artificial transcription factor proteins.
  • Protein-based therapeutics hold great promise in addressing unmet medical needs as well as in offering new therapeutic options due to their high specificity and versatility.
  • existing protein-based therapeutics are largely restricted to extracellular targets as the plasma membrane of cells constitutes a major barrier for such proteins to reach intracellular therapeutic targets.
  • the discovery of the HIV-derived TAT (SEQ ID NO: 1 ) protein transduction domain (PTD) (Fawell, S., 1994, Proc. Natl. Acad. Sci USA 91 , 664-668) and other such peptides promised to provide access for therapeutic proteins to intracellular drug targets.
  • PTDs are short peptides facilitating the transport of fused cargo, such as proteins or small molecules attached to it, across the plasma membrane into the cellular compartment.
  • endolysosomotropic agents such as chloroquine, so called proton sponges, such as polyhistidine tags, or so called fusogenic peptides, such as HA2 (SEQ ID NO: 2), GALA (SEQ ID NO: 3), KALA (SEQ ID NO: 4), GALAdelE3 (SEQ ID NO: 5), or H5WYG (SEQ ID NO: 6) able to interact with and rupture the endosomal membrane. While these methods showed some improvement in terms of endosomal escape of PTD-protein fusions, correct subcellular localization of proteins being part of a PTD-protein fusion is suboptimal.
  • endolysosomotropic agents such as chloroquine, so called proton sponges, such as polyhistidine tags, or so called fusogenic peptides, such as HA2 (SEQ ID NO: 2), GALA (SEQ ID NO: 3), KALA (SEQ ID NO: 4), GALAdelE3 (SEQ ID NO: 5),
  • Zinc fingers are short (30 amino acids) DNA binding motifs targeting almost independently three DNA base pairs. A protein containing several such zinc fingers fused together is thus able to recognize longer DNA sequences. A hexameric zinc finger protein (ZFP) recognizes an 18 base pairs (bp) DNA target, which is almost unique in the entire human genome. Initially thought to be completely context independent, more in-depth analyses revealed some context specificity for zinc fingers (Klug A., 2010, Annu Rev Biochem 79, 213-231 ).
  • these zinc finger proteins are ideal tools for transporting protein domains with transcription-modulatory activity to specific promoter sequences resulting in the modulation of expression of a gene of interest.
  • Suitable domains for the silencing of transcription are the Krueppel-associated domain (KRAB) as N-terminal (SEQ ID NO: 7) or Clterminal (SEQ ID NO: 8) KRAB domain, the Sin3-interacting domain (SID, SEQ ID NO: 9) and the ERF repressor domain (ERD, SEQ ID NO: 10), while activation of gene transcription is achieved through herpes virus simplex VP16 (SEQ ID NO: 1 1 ) or VP64 (tetrameric repeat of VP16, SEQ ID NO: 12) domains (Beerli R.R.
  • Additional domains considered to confer transcriptional activation are CJ7 (SEQ ID NO: 13), p65-TA1 (SEQ ID NO: 14), SAD (SEQ ID NO: 15), NF-1 (SEQ ID NO: 16), AP-2 (SEQ ID NO: 17), SP1 -A (SEQ ID NO: 18), SP1-B (SEQ ID NO: 19), Oct-1 (SEQ ID NO: 20), Oct-2 (SEQ ID NO: 21 ), Oct-2_5x (SEQ ID NO: 22), MTF-1 (SEQ ID NO: 23), BTEB- 2 (SEQ ID NO: 24) and LKLF (SEQ ID NO: 25).
  • transcriptionally active domains of proteins defined by gene ontology GO: 0001071 are considered to achieve transcriptional regulation of target proteins. Fusion proteins comprising engineered zinc finger proteins as well as regulatory domains are referred to as artificial transcription factors.
  • receptor molecules that are either stimulated or blocked by the action of small molecule drugs with oftentimes considerable off-target activities.
  • Examples for such receptors are the histamine H1 receptor or alpha- and beta- adrenoreceptors, but in general proteins defined by gene ontology GO:0004888 and
  • the eye is an extremely organ that strongly relies on a balanced and sufficient perfusion to meet its high oxygen demand. Failure to provide sufficient and stable oxygen supply causes ischemia-reperfusion injury leading to glial activation and neuronal damage as observed in glaucoma patients with progressing disease despite normal or normalized intraocular pressure. Insufficient blood supply also leads to hypoxia causing run-away neovascularization with the potential of further retinal damage as evident during diabetic retinopathy or wet age related macular degeneration. Eye tissue perfusion is under complex control and depends on blood pressure, intraocular pressure as well as local factors modulating vessel diameter. Such local factors are, for example endothelins, short peptides with a strong vasoconstrictive activity.
  • ET-1 , ET-2, and ET-3 Three isoforms of endothelins (ET-1 , ET-2, and ET-3) are produced by endothelin converting enzyme from precursor molecules secreted by endothelial cells localized in the blood vessel wall.
  • Endothelin converting enzyme Two cognate receptors for mature ET are known, ETRA and ETRB. While ETRA is localized to smooth muscle cells forming vessels walls and promoting
  • ETRB is mainly expressed on endothelial cells and acts vasodilatatory by promoting the release of nitric oxide, thus causing smooth muscle relaxation.
  • ETRA and ETRB belong to the large class of G-protein coupled seven transmembrane helix receptors. The binding of ET to ETRA or ETRB results in G protein activation, thus triggering an increase in intracellular calcium concentration and thereby causing a wide array of cellular reactions.
  • the vasoactive endothelin system plays an important role in the pathogenesis of various diseases. Endothelins, on the one hand, are involved in the regulation of blood supply and, on the other hand, are main players in the cascade of events induced by hypoxia. Endothelin is, for example, involved in the breakdown of the blood-brain or the blood-retina barrier and in the neovascularisation. Endothelin is furthermore involved in neurodegeneration, but also the regulation of the threshold of pain sensation or even thirst feeling.
  • Endothelin Influencing the endothelin system systemically or locally is of interest for the treatment of many diseases such as subarachnoidal or brain hemorrhages. Endothelin also influences the course of multiple sclerosis. Endothelin contributes to (pulmonary) hypertension, but also to arterial hypotension, cardiomyopathy and to Raynaud syndrome, variant angina and other cardiovascular diseases. Endothelin is involved in diabetic nephropathy and diabetic retinopathy.
  • the eye In the eye it further plays a role for the glaucomatous neurodegeneration, retinal vein occlusion, giant cell arthritis, retinitis pigmentosa, age related macula degeneration, central serous chorioretinopathy, Morbus Leber, Susac syndrome, intraocular hemorrhages, epiretinal gliosis and certain other pathological conditions.
  • LPS lipopolysaccharide
  • TLR4 Toll-like receptor 4
  • PAMPs pathogen associated molecular patterns
  • TLR4 While recognition of LPS as danger signal is an important part of innate immunity, overstimulation or prolonged stimulation of the TLR4 receptor is connected to a variety of pathological conditions associated with chronic inflammation. Examples are various liver diseases such as alcoholic liver disease, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, chronic hepatitis B or C virus (HCV) infection, and HIV-HCV co-infection. Other diseases associated with TLR4 signaling are rheumatoid arthritis, artherosclerosis, psoriasis, Crohn's disease, uveitis, contact lens associated keratitis and corneal
  • TLR4-mediated signaling is involved in cancer progression and resistance to chemotherapy.
  • Immunoglobulins isotype E are part of the adaptive immune system and as such involved in the protection against infections but also neoplastic transformation. IgE is bound by the high-affinity IgE receptor (FcER1 ) localized on mast cells and basophiles. Binding of IgE to FcER1 followed by cross-linking these complexes via specific antigens called allergens leads to the release of various factors from mast cells and basophils causing the allergic response. Among these factors are histamine, leukotrienes, various cytokines but also lysozyme, tryptase or ⁇ -hexosaminidase. The release of these factors is associated with allergic diseases such as allergic rhinitis, asthma, eczema and anaphylaxis.
  • allergic diseases such as allergic rhinitis, asthma, eczema and anaphylaxis.
  • Nuclear receptors are a protein superfamily of ligand-activated transcription factors. They are, unlike most other cellular receptors, soluble proteins localized to the cytosol or the nucleoplasm. Ligands for nuclear receptors are lipophilic molecules, among them steroid and thyroid hormones, fatty and bile acids, retinoic acid, vitamin D3 and prostaglandins (McEwan I.J., Methods in Molecular Biology: The Nuclear Receptor Superfamily, 505, 3-17). Upon ligand binding, nuclear receptors dimerize, thus triggering binding to specific transcription- factor-specific DNA response elements inside ligand-responsive gene promoters causing either activation or repression of gene expression. Given that nuclear receptors are responsible for mediating the activity of many broad-acting hormones such as steroids and important metabolites, the miss- and dysfunction of nuclear receptors is involved in the natural history of many diseases.
  • Glucocorticoid receptor Glucocorticoid receptor
  • corticosteroids such as agonistic dexamethasone
  • Another modulation of nuclear receptor activity is exemplified in oral contraception where activation of the estrogen receptor (ESR1 ) and the progesterone receptor is used to prevent egg fertilization in women.
  • ESR1 estrogen receptor
  • progesterone receptor is used to prevent egg fertilization in women.
  • blocking the androgen receptor (AR) using anti-androgens such as flutamide or bicalutamide proved useful for the treatment of AR-dependent prostate cancers.
  • blockage of the estrogen receptor by blocking estrogen synthesis and thus the availability of estrogen is a standard treatment for breast cancer in women or gynaecomastia in men.
  • Genetic mutations are at the heart of many inherited disorders. In general, such mutations can be classified into dominant or recessive regarding their mode of inheritance, with a dominant mutation being able to cause the disease phenotype even when only one gene copy - be it the maternal or the paternal - is affected, while for a recessive mutation to cause disease both, maternal and paternal, gene copies need to be mutated. Dominant mutations are able to cause disease by one of two general mechanisms, either by dominant-negative action or by haploinsufficiency. In case of a dominant-negative mutation, the gene product gains a new, abnormal function that is toxic and causes the disease phenotype. Examples are subunits of multimeric protein complexes that upon mutation prevent proper function of said protein complex.
  • mitochondria is mirrored in the many cellular mechanisms in place to maintain mitochondria and to prevent mitochondrial failure and subsequently cell death (Neutzner A. et a/., 2012, Semin Cell Dev Biol 23, 499-508).
  • a central role among these processes plays the maintenance of a dynamic mitochondrial network with a balanced mitochondrial morphology. This is achieved by the so called mitochondrial morphogens that promote either fission of mitochondria in the case of Drp1 , Fis1 , Mff, MiD49 and MiD51 - or fusion of mitochondrial tubules in the case of Mfn1 , Mfn2 and OPA1.
  • OPA1 optic atrophy 1
  • OPA1 is a large GTPase encoded by the OPA 1 gene and essential for mitochondrial fusion.
  • OPA1 plays an important role in maintaining mitochondrial cristae structure. It was shown that downregulation of OPA 1 gene expression causes mitochondrial fragmentation due to a loss of fusion and sensitizes cells to apoptotic stimuli. Mutations in OPA 1 were identified to be responsible for about 70 % of Kjer's optic neuropathy or autosomal dominant atrophy
  • ADOA retinal ganglion cells
  • the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or several, i.e. two or more, endosome-specific protease cleavage sites, wherein the one single endosome-specific protease cleavage site is different from the amino acid sequence SEQ ID NO: 26, to pharmaceutical compositions comprising such an artificial transcription factor, to mammalian cells comprising such an artificial transcription factor, and to an expression vector comprising nucleic acids coding for such an artificial transcription factor.
  • the invention relates to the use of such artificial transcription factors for modulating the expression of genes, and in treating diseases where modulation of such gene expression is beneficial. Furthermore the invention relates to a method of constructing a specifically targeted therapeutic agent, a method of specifically targeting a therapeutically active protein to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell of a subject, and a method of treatment comprising administering to a subject in need thereof a therapeutically active protein.
  • the artificial transcription factor comprises two or more endosome-specific protease cleavage sites, said endosome-specific protease cleavage sites being cleaved by different endosome-specific proteases.
  • the endosome-specific protease cleavage site is a cathepsin cleavage site, more particular a cathepsin cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 27 to 46, even more particular a cathepsin cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 30, 31 , 32, 35, 36, 40 and 41 , and even more particular a cathepsin cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 31 ,35, 36, 40 and 41.
  • the one single or one of two or more cathepsin cleavage sites is a cathepsin D cleavage site.
  • the one single or one of two or more cathepsin cleavage sites is a cathepsin K cleavage site.
  • one single or one of two or more cathepsin cleavage sites is a cathepsin L cleavage site.
  • the one single or one of two or more cathepsin cleavage sites is a cathepsin S cleavage site.
  • the one of two or more cathepsin cleavage sites is a cathepsin B cleavage site.
  • the one single or two or more endosome-specific protease cleavage sites are cleaved each by at least two different endosome-specific proteases.
  • the one single or two or more endosome-specific protease cleavage sites are cleaved each by at least two different endosome-specific proteases, wherein the at least two different endosome-specific proteases are selected from the group consisting of i) cathepsin B and D, ii) cathepsin B, D, K, and S, iii) cathepsin K and S, iv) cathepsin D, K, L, and S, v) cathepsin B, D, K, L and S, and vi) cathepsin D and K.
  • the cathepsin cleavage site CS1 (QPMKRLTLGN, SEQ ID NO: 26) contained in the cathepsin in vitro substrate prorenin is a cathepsin B, D, K, L, and S cleavage site.
  • the cathepsin cleavage site CS2 (GKPILFFRLK, SEQ ID NO: 27) is a cathepsin B and K cleavage site.
  • a further cathepsin cleavage site of the invention is the cleavage site CS3 (APISFFELG, SEQ ID NO: 28).
  • the cathepsin cleavage sites CS4 (GRWPPMGLPWE, SEQ ID NO: 29) and CS5
  • GWHPMGAPWE SEQ ID NO: 30
  • the cathepsin cleavage site CS6 (HPGGPQ, SEQ ID NO: 31 ) is a cathepsin D, K, L, and S cleavage site.
  • the cathepsin cleavage site CS7 (TFLGGPKPPQRVMFTEDLKLPASF, SEQ ID NO: 32) is a cathepsin B, D, K, L, and S cleavage site.
  • a further cathepsin cleavage site of the invention is the cleavage site CS8
  • the cathepsin cleavage site CS9 (LSQDTVSVPCQSASSASALG, SEQ ID NO: 34) is a cathepsin D and K cleavage site.
  • the cathepsin cleavage site CS10 (KGKVFQEPLFYEAPRSVD, SEQ ID NO: 35) is a cathepsin D, K, L and S cleavage site.
  • the cathepsin cleavage site CS1 1 is a cathepsin D, K, L, and S cleavage site.
  • the cathepsin cleavage site CS12 (MSYREAASGNFSLF, SEQ ID NO: 37) is a cathepsin K and S cleavage site.
  • the cathepsin cleavage site CS13 (NALKFLASLLELPE, SEQ ID NO: 38) is a cathepsin D cleavage site.
  • the cathepsin cleavage site CS14 (AGLTTELFSPVDLN, SEQ ID NO: 39) is a cathepsin D and K cleavage site.
  • the cathepsin cleavage site CS15 (MQYFSHFIRSGNPN, SEQ ID NO: 40) is a cathepsin D, K, L and S cleavage site.
  • the cathepsin cleavage site CS16 (AQTKLLAVSGPFHY, SEQ ID NO: 41 ) is a cathepsin B, D, K, L, and S cleavage site.
  • the cathepsin cleavage site CS17 (YPYEFSRKVPTFAT, SEQ ID NO: 42) is a cathepsin D and K cleavage site.
  • a further cathepsin cleavage site of the invention is the cathepsin D cleavage site CS18 (TNSQLFRRAVLMGG, SEQ ID NO: 43).
  • a further cathepsin cleavage site of the invention is the cathepsin B cleavage site CS19 (KKKRKVGLEPGEKP, SEQ ID NO: 44).
  • a further cathepsin cleavage site of the invention is the cathepsin B cleavage site CS20 (KRKVGLEPGE, SEQ ID NO: 45).
  • a further cathepsin cleavage site of the invention is the cathepsin B cleavage site CS21 (RKVGLEPG, SEQ ID NO: 46).
  • one endosome-specific protease cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 27 to SEQ ID NO: 46 is located between the transport protein comprising one or more protein transduction domains of the transducible artificial transcription factor of the invention and the amino acid sequence comprising all three components regulatory domain, nuclear localization sequence, and polydactyl zinc finger protein.
  • one of at least two endosome-specific protease cleavage sites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between the transport protein comprising one or more protein transduction domains of the transducible artificial transcription factor of the invention and the amino acid sequence comprising all three components regulatory domain, nuclear localization sequence, and polydactyl zinc finger protein, and another endosome-specific protease-cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between the nuclear localization sequence and the amino acid sequence comprising the regulatory domain and the polydactyl zinc finger protein, or between the regulatory domain and the polydactyl zinc finger protein, and/or within the nuclear localization sequence, the regulatory domain and/or the polydactyl zinc finger protein.
  • one of at least two endosome-specific protease cleavage sites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between the transport protein comprising one or more protein transduction domains of the transducible artificial transcription factor of the invention and the amino acid sequence comprising the nuclear localization sequence, the regulatory domain, and the polydactyl zinc finger protein, and another endosome-specific protease-cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between two of the amino acid sequences for regulatory domain, nuclear localization sequence or the polydactyl zinc finger protein, and/or within the nuclear localization sequence, the regulatory domain and/or the polydactyl zinc finger protein.
  • the transport protein comprises one protein transduction domain.
  • the transport protein comprises two or more protein transduction domains, preferably two, three, four or more copies of the same protein transduction domain, more preferably four copies of the same protein transduction domain.
  • the preferred protein transduction domain is the TAT peptide.
  • the artificial transcription factor further comprises a protein tag.
  • the protein tag is selected from the group consisting of an amino acid sequence composed of 6 to 15 histidines, a HA (influenza hemagglutinin) epitope tag, and a myc epitope tag, preferably selected from the group consisting of an amino acid sequence composed of 6 to 15 histidines, a HA epitope tag of SEQ ID NO: 343, and a myc epitope tag of SEQ ID NO: 344.
  • two or more successive protein tags e.g. 1 to 5 successive HA epitope tags or 1 to 5 successive myc epitope tags may be comprised by the artificial transcription factor.
  • the artificial transcription factor comprises an amino acid sequence composed of 6 to 15 histidines, preferably 6 histidines, a HA epitope tag, and three successive myc epitope tags, more particular an amino acid sequence composed of 6 to 15 histidines, preferably 6 histidines, a HA epitope tag of SEQ ID NO: 343, and three successive myc epitope tags each of SEQ ID NO: 344.
  • the protein tag is located at the N- terminal end, between the protein transduction domain and the endosome-specific protease cleavage site and/or at the C-terminal end of the artificial transcription factor.
  • the artificial transcription factor further comprises an amino acid sequence composed of 6 to 15 histidines, preferably at the N-terminal end. More preferably said amino acid sequence is composed of 8 to 15 histidines, even more preferably 10 to 15 histidines, most preferred are 6 to 10 histidines, in particular 6 histidines.
  • the gene promoter targeted by the artificial transcription factors of the invention is a receptor gene promoter.
  • the receptor gene promoter is the endothelin receptor A (ETRA) promoter (SEQ ID NO: 47).
  • ETRA endothelin receptor A
  • the invention relates to such an artificial transcription factor for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases.
  • the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • the receptor gene promoter is the endothelin receptor B promoter (SEQ ID NO: 48).
  • the invention relates to such an artificial transcription factor for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor B levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases.
  • the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • the receptor gene promoter is the Toll-like receptor 4 promoter (SEQ ID NO: 49).
  • the invention relates to such an artificial transcription factor for use in influencing the cellular response to lipopolysaccharide, for lowering or increasing Toll-like receptor 4 levels, and for use in the treatment of diseases modulated by lipopolysaccharide, in particular for use in the treatment of eye diseases.
  • the invention relates to a method of treating a disease modulated by
  • lipopolysaccharide comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • the receptor gene promoter is the high-affinity immunoglobulin epsilon receptor subunit alpha (FcERIA) promoter (SEQ ID NO: 50).
  • the invention relates to such an artificial transcription factor for use in influencing the cellular response to immunoglobulin E (IgE), for lowering or increasing high-affinity IgE receptor levels, and for use in the treatment of diseases modulated by IgE, in particular for use in the treatment of eye diseases.
  • the invention relates to a method of treating a disease modulated by IgE comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • the promoter region of the nuclear receptor gene is the glucocorticoid receptor promoter (SEQ ID NO: 51 ).
  • the invention relates to an artificial transcription factor targeting the glucocorticoid receptor promoter for use in influencing the cellular response to glucocorticoids, for lowering or increasing glucocorticoid receptor levels, and for use in the treatment of diseases modulated by glucocorticoids, in particular for use in the treatment of eye diseases modulated by glucocorticoids.
  • the invention relates to a method of treating a disease modulated by glucocorticoids comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting the glucocorticoid receptor promoter to a patient in need thereof.
  • the promoter region of the nuclear receptor gene is the androgen receptor promoter (SEQ ID NO: 52).
  • the invention relates to an artificial transcription factor targeting the androgen receptor promoter for use in influencing the cellular response to testosterone, for lowering or increasing androgen receptor levels, and for use in the treatment of diseases modulated by testosterone.
  • the invention relates to a method of treating a disease modulated by testosterone comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting the androgen receptor promoter to a patient in need thereof.
  • the promoter region of the nuclear receptor gene is the estrogen receptor promoter (SEQ ID NO: 53).
  • the invention relates to such an artificial transcription factor targeting the estrogen receptor promoter for use in influencing the cellular response to estrogen, for lowering or increasing estrogen receptor levels, and for use in the treatment of diseases modulated by estrogen.
  • the invention relates to a method of treating a disease modulated by estrogen comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting the estrogen receptor promoter to a patient in need thereof.
  • the invention relates to engineered mammalian cells capable of producing and secreting an artificial transcription factor of the invention.
  • the invention relates to the encapsulation of engineered mammalian cells capable of producing and secreting an artificial transcription factor of the invention into an implantable device which allows for the release of artificial transcription factor into the surrounding tissue.
  • the invention relates to an expression vector comprising nucleic acids, in particular DNA, coding for the artificial transcription factor of the invention.
  • Preferred expression vectors are based on the pET expression system (Studier F.W., 1986, J Mol Biol. 189(1 ):1 13-30) or other bacterial expression systems (Chen R. , 201 1 ,
  • the invention relates to the use of such artificial transcription factors for increasing the expression from haploinsufficient gene promoters, and in treating diseases caused or influenced by such haploinsufficient gene promoters.
  • the invention relates to a method of treating a disease caused or modulated by haploinsufficiency comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting a haploinsufficient gene promoter to a patient in need thereof.
  • the haploinsufficient gene promoter is the OPA 1 promoter (SEQ ID NO: 54).
  • the invention relates to an artificial transcription factor for use in enhancing the expression of the OPA 1 gene, and for use in the treatment of diseases caused or modified by low OPA1 levels, in particular for use in the treatment of eye diseases.
  • the invention relates to artificial transcription factors binding to OPA1_TS1 (SEQ ID NO: 193), OPA1_TS2 (SEQ ID NO: 194), or
  • OPA1_TS3 (SEQ ID NO: 195).
  • the invention relates to a method of treating a disease influenced by OPA1 comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • FIG. 1 The fusogenic peptide TATHA2 does not increase the activity of an E7T?/A-specific transducible artificial transcription factor in a luciferase-based reporter assay.
  • HEK293 Flpln cells containing Gaussia luciferase under control of a hybrid CMV/ETRA- TS+74 promoter and secreted alkaline phosphatase under control of the constitutive CMV promoter were treated with inhibitory ATF1488 or its inactive control protein (ATF1714) in the presence (+) or absence (-) of the fusogenic peptide TATHA2.
  • Luciferase values normalized to secreted alkaline phosphatase activity RLA, relative luciferase activity
  • FIG. 1 Schematic presentation of modulating gene expression using protease-sensitive transducible artificial transcription factors
  • An artificial transcription factor comprising a protein transduction domain (PTD), an endosome-specific protease cleavage site (X and/or Y), a domain with transcription regulating activity (RD), a nuclear localization sequence (NLS), and a polydactyl zinc finger protein (ZFP) specific for the promoter region (P) of a gene (G) enters the cell via an endocytotic mechanism.
  • PTD protein transduction domain
  • X and/or Y domain with transcription regulating activity
  • NLS nuclear localization sequence
  • ZFP polydactyl zinc finger protein
  • An endosome-specific protease (symbolized by scissors X) is activated during endosomal maturation, recognizes cleavage site X and cleaves the artificial transcription factor, thus separating PTD from RD-NLS-ZFP.
  • mRNA Upon binding to its target site in the promoter region P of gene G, production of mRNA (m) is either up- (arrow up) or downregulated (arrow down), depending on the nature of the RD.
  • HeLa cells were incubated for two hours in OptiMEM media with 1 ⁇ cathepsin B-insensitive ATF1488 or cathepsin B-sensitive ATF1688 for 2 hours.
  • Cells were fixed, stained using anti- myc epitope antibody to detect artificial transcription factors, and images were taken.
  • Nuclear import (Nl) of artificial transcription factor was determined using image analysis, and was expressed as percentage of maximal fluorescence signal. Shown is the average of three independent experiments with 200 cells/experiment.
  • Figure 4 Inclusion of a cathepsin cleavage site increases activity of an E773 ⁇ 4A-specific artificial transcription factor in a luciferase reporter assay
  • HEK293 Flpln cells stably expressing Gaussia luciferase under the control of a hybrid CMV/ETRA-TS+74 (target site for ATF1488/ATF 1688) and secreted alkaline phosphatase under control of a constitutive CMV promoter were treated with ATF1688 (contains cathepsin site) or ATF1488 (without cathepsin site). Treatment with ATF1806, an inactive mutant of ATF1688 lacking all zinc complexing cysteine residues, was used as control.
  • Luciferase and secreted alkaline phosphatase activity were measured 24 hours after treatment. Luciferase activity was normalized to secreted alkaline phosphatase activity and expressed as percentage of control (RLA, relative luciferase activity). Shown is the average of three independent experiments with three technical replicates. Error bars represent SD.
  • FIG. 5 Inclusion of a cathepsin cleavage site increases activity of an FcER7/A-specific artificial transcription factor in a luciferase reporter assay HEK293 Flpln cells stably expressing Gaussia luciferase under the control of a hybrid CMV/lgER-TS-147 (target site for ATF1572/ATF1880) and secreted alkaline phosphatase under control of a constitutive CMV promoter were treated with ATF1880 (contains cathepsin site) or ATF1572 (without additional cathepsin site). Treatment with ATF1881 , an inactive variant of ATF1880, served as control.
  • Luciferase and secreted alkaline phosphatase activity were measured 24 hours after treatment. Luciferase activity was normalized to secreted alkaline phosphatase activity and expressed as percentage of control (RLA, relative luciferase activity). Shown is the average of three independent experiments with three technical replicates. Error bars represent SD.
  • cathepsins B (cath B), D (cath D), F (cath F), G (cath G), H (cath H), K (cath K), L (cath L), and S (cath S) were determined relative to the house keeping gene GAPDH in ARPE19, Ben-Men-I, HaCat, HEK293, HeLa cells cultured in normal (HeLa NM) as well as in synthetic media (HeLa SM), HMEC-1 , human astrocytes (HAC), human keratinocytes (HK), human primary fibroblast (HpF), human pericytes (HP), human uterine smooth muscle cells (hUtSMC), and SH-SY5Y cells. Shown are the cathepsin expression levels (CE) in percent relative to GAPDH expression levels.
  • Figure 7 Nuclear import of artificial transcription factors containing different cathepsin sensitive sites in cell lines with different cathepsin inventory
  • HAC Human astrocytes
  • HEK293, and HeLa cells were treated with ATF1688, or ATF1688 variants ATF2443, ATF2445, ATF2446, ATF2450 with different cathepsin sensitivities, or buffer (marked with b) as control.
  • FIG. 8 Proteolytic processing of ATF1688 and ATF1688 variants in vivo following transduction into the endosomal compartment
  • HAC Human astrocytes
  • HEK293 and HeLa cells were treated for 2 hours with ATF1688 or ATF1688 variants ATF2443 and ATF2450 with different cathepsin sensitivities.
  • Cells were harvested and whole cells lysates were prepared and analyzed by western blot using anti- myc antibodies. Shown are density plots expressed as fluorescence values in arbitrary units (marked F) of western blot lanes as well as marker proteins (marked m) highlighted using vertical lines at 37, 26, and 19 kDa.
  • FIG. 9 Schematic presentation of cell type-specific protease-mediated endosomal escape of transducible artificial transcription factors
  • a transducible artificial transcription factor of the invention containing a protein transduction domain (PTD), an endosomal protease cleavage site (marked X) between the PTD and the nuclear localization sequence (NLS), a further endosomal protease cleavage site (marked Y) between the regulatory domain (RD) and the NLS and the zinc finger protein (ZFP) is generated.
  • PTD protein transduction domain
  • NLS nuclear localization sequence
  • ZFP zinc finger protein
  • ATF1688, and ATF1688 variant ATF2491 with mutated cathepsin B off-target site were incubated with purified cathepsin B (cath B), D (cath D), K (cath K), L (cath L), or S (cath S).
  • Digestion products were analyzed by infrared-laser based western blot using anti-myc antibodies recognizing a 3xmyc epitope located at the very C-terminus of the artificial transcription factor proteins. Shown are density plots expressed as fluorescence values in arbitrary units (marked F) of western blot lanes of cathepsin-digested ATF1688, and
  • ATF2491 protein as well as marker proteins (marked m). Highlighted using vertical lines are size markers at 37, 26, and 19 kDa. Desired cathepsin B cleavage products of ATF2491 and ATF1688 are marked with *.
  • TS+74 promoter and secreted alkaline phosphatase under control of the constitutive CMV promoter were treated with ATF1688 (includes hexa-histidine tag), or ATF2102 (hexa- histidine tag removed), or ATF1806, an inactive variant of ATF1688, as control.
  • Luciferase and secreted alkaline phosphatase activity were measured 24 hours after treatment.
  • Luciferase activity was normalized to secreted alkaline phosphatase activity and expressed as percentage of contro (RLA, relative luciferase activity)!. Shown is the average of three independent experiments with three technical replicates. Error bars represent SD.
  • CMV/ETRA-TS+74 hybrid promoter and secreted alkaline phosphatase under control of a constitutive CMV promoter were treated with (A) decreasing concentrations of ATF1688 ranging from 1 ⁇ to 0 ⁇ or (B) with 2 ⁇ of a mixture between active ATF1688 and inactive ATF1806 with decreasing concentrations of ATF1688 ranging from 2 ⁇ to 0 ⁇ in the mixture.
  • Luciferase activity was measured, expressed as ratio of luciferase to secreted alkaline phosphatase activity, and normalized (act [a.u.]).
  • a four parameter log-logistic model was fitted to the data and the half-maximal effective dose (labeled ED50) was calculated.
  • HEK293 cells containing Gaussia luciferase under control of a CMV/FcERIa hybrid promoter were treated with 0.25, 0.5, or 1 uM hexameric anti-FcERIa ATF AO501 or the AO501 - derived octameric zinc finger protein containing ATF2615, suppression of luciferase activity was measured and expressed as percentage suppression of luciferase activity compared to control treated cells. While both artificial transcription factors have comparable activity at 1 ⁇ concentrations, clearly at lower, non-saturating concentrations, the octameric ATF2615 is more active and causes significantly higher suppression of luciferase activity.
  • FIG. 14 Treatment with FcERIa-specific transducible artificial transcription factor effects downregulation of IgE receptor downregulation in primary human basophiles
  • Figure 15 Increased activity of octameric compared to hexameric zinc finger containing anti- ETRA transducible artificial transcription factors
  • Reporter cells containing Gaussia luciferase under control of a CMV/ETRA hybrid promoter were treated with decreasing concentrations (1 to 0 ⁇ ) of hexameric or octameric zinc finger containing ATF1688 or ATF2602, respectively.
  • the total concentration of applied transcription factor protein was kept constant at 1 ⁇ through addition of unrelated, and in this context, inactive transducible artificial transcription factor.
  • FIG. 1 depicts the dose-response curve with the y-axis showing the relative luciferase activity (labeled R for response) and the x-axis showing the partial dose (labeled D) of ATF1688 (solid line) or ATF2602 (dashed line).
  • FIG. 1 depicts the dose-response curve with the y-axis showing the relative luciferase activity (labeled R for response) and the x-axis showing the partial dose (labeled D) of ATF1688 (solid line) or ATF2602 (dashed line).
  • FIG. 1 depicts the dose-response curve with the y-axis showing the relative luciferase activity (labeled R for response) and the x-axis showing the partial dose (labeled D) of ATF1688 (solid line) or ATF2602 (dashed line).
  • FIG. 16 Octameric zinc finger protein containing anti-ETRA transducible artificial transcription
  • Sus scrofa is a suitable model for testing efficacy of human anti-ETRA transducible artificial transcription factors
  • CMV/human labeleled H.s. for Homo sapiens
  • CMV/porcine labeleled S.s. for Sus scrofa
  • CMV/bovine labeleled B.t. for Bos taurus
  • CMV/murine labeleled M.m. for Mus musculus
  • CMV/rabbit labelele
  • ATF2468 is a negative regulatory transducible artificial transcription factor, thus, suppression of luciferase activity is a measure of transcription factor activity.
  • Figure 19 Anti-ETRA transducible artificial transcription factor has desired activity in vivo in porcine retinal vessels
  • FIG. 20 The SID domain contains an off-target cathepsin D site
  • transducible artificial transcription factor of the invention containing the TAT protein transduction domain (labeled TAT), a cathepsin recognition site (labeled CAT), a negative-regulatory domain (SID), as well as a polydactyl zinc finger protein (ZFP) but omitting the nuclear localization sequence.
  • TAT TAT protein transduction domain
  • CAT cathepsin recognition site
  • SID negative-regulatory domain
  • ZFP polydactyl zinc finger protein
  • CatD cuts off-center from its binding site leading to the processing of such transducible artificial transcription factors inside the SID domain. While such off-target processing by CatD also leads to endosomal disentanglement, processing inside the SID domain leads to the inactivation of the transducible artificial transcription factor.
  • a DNA library was generated containing random sequences (CAT-RS) inside a cathepsin binding site (CAT- BS) and near a potential cathepsin cleavage (CATp) site located inside a domain essential (ED) for function of the artificial transcription factor.
  • CAT-RS random sequences
  • CATp cathepsin binding site
  • ED domain essential
  • the invention relates to the enhanced and cell type selective delivery of an artificial transcription factor to the nuclear compartment of cells, and to pharmaceutical compositions comprising such an artificial transcription factor. Furthermore the invention relates to the use of such artificial transcription factors for modulating the expression of genes, for example (but not limited to) receptor genes, such as membrane-bound or nuclear receptor genes, or haploinsufficient genes, and in treating diseases caused or modulated by proteins or other gene products encoded by such genes, the promoters of which are targeted by the transcription factors of the invention, for example (but not limited to) receptor proteins, such as membrane-bound or nuclear receptor proteins, or proteins produced by haploinsufficient genes.
  • receptor genes such as membrane-bound or nuclear receptor genes, or haploinsufficient genes
  • the invention further relates to a method of constructing a specifically targeted therapeutic agent to be delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell.
  • the invention further relates to a method of specifically targeting a therapeutically active protein to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell of a subject.
  • the invention further relates to a method of treatment comprising administering to a subject in need thereof a therapeutically active protein.
  • An artificial transcription factor in the sense of the invention comprises a polydactyl zinc finger protein targeting specifically a gene promoter fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a protein transduction domain, and one or two or more endosome-specific protease cleavage sites selected and placed within the artificial transcription factor to facilitate cell type targeted enhanced endosomal escape.
  • the artificial transcription factor of the invention usually comprises listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, an inhibitory or activatory protein domain, a nuclear localization sequence and a zinc finger protein, wherein the inhibitory or activatory protein domain, the nuclear localization sequence and the zinc finger protein may be in any order.
  • an artificial transcription factor comprising listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a nuclear localization sequence, an inhibitory or activatory protein domain and a zinc finger protein; an artificial transcription factor comprising listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a nuclear localization sequence, a zinc finger protein and an inhibitory or activatory protein domain; an artificial transcription factor comprising listed from the N- to the C-terminus a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a zinc finger protein, a nuclear localization sequence, and an inhibitory or activatory protein domain; an artificial transcription factor comprising listed from the N- to the C-terminus a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a zinc finger protein, a nuclear
  • the artificial transcription factor of the invention preferably comprises listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, an inhibitory or activatory protein domain, a nuclear localization sequence and a zinc finger protein.
  • the artificial transcription factor of the invention may further comprise an endosome-specific protease cleavage site located within or between domains of the artificial transcription factor essential for its activity.
  • domains of the artificial transcription factor essential for its activity are the nuclear localization sequence, the inhibitory or activatory domain or the polydactyl zinc finger protein.
  • the artificial transcription factor of the invention may further comprise linker between the domains of the artificial transcription factors, i.e. linker between the protein transduction domain, the inhibitory or activatory protein domain, the nuclear localization sequence and/or the zinc finger protein.
  • the artificial transcription factor of the invention may further comprise an endosome-specific protease cleavage site which is located in the linker regions connecting e.g. the inhibitory or activatory protein domain, the nuclear localization sequence and/or the zinc finger protein.
  • a polydactyl zinc finger protein in the sense of the invention is a fusion protein of four to ten zinc finger modules according to Gonzalez B., 2010, Nat Protoc 5, 791-810, or a fusion protein of eight or more e.g. eight to twelve zinc finger modules as selected or designed to bind to a twelve to thirty base pair target site in the promoter of a gene of interest.
  • a polydactyl zinc finger protein targeting “specifically" a gene promoter means that the protein has a binding affinity of 20 nM or less towards its DNA target.
  • a polydactyl zinc finger protein targeting specifically a gene promoter refers to a polydactyl zinc finger protein binding with a binding affinity of 20 nM or less than 20 mM towards a gene promoter. Binding affinity is preferably measured using enzyme linked DNA interaction assay (ELDIA) as described e.g. in the examples.
  • ELDIA enzyme linked DNA interaction assay
  • a promoter is defined as the regulatory region of a gene as well known in the art.
  • a gene is defined, as well known in the art, as genomic region containing regulatory sequences as well as sequences for the gene product resulting in the production of proteins or RNAs.
  • a regulatory domain refers to an activatory domain or an inhibitory domain.
  • an activatory domain or an activatory protein domain is a protein domain as known in the art that, when brought in contact with a promoter by a polydactyl zinc finger protein, increases production of gene product from the gene controlled by the promoter compared to the normal state.
  • an inhibitory domain or an inhibitory protein domain is a protein domain as known in the art that, when brought in contact with a promoter by a polydactyl zinc finger protein, decreases production of gene product from the gene controlled by the promoter compared to the normal state.
  • the artificial transcription factor of the present invention might also contain other elements
  • transcriptionally active protein domains of proteins defined by gene ontology GO:0001071 such as an inhibitory domain selected from the group consisting of N-terminal KRAB, C- terminal KRAB, SID and ERD domains, preferably KRAB or SID.
  • Activatory protein domains considered are the transcriptionally active domains of proteins defined by gene ontology GO:0001071 , such as an activatory domain selected from the group consisting of VP16,VP64 (tetrameric repeat of VP16), CJ7, p65-TA1 , SAD, NF-1 , AP-2, SP1-A, SP1-B, Oct-1 , Oct-2, Oct2-5x, MTF-1 , BTEB-2 and LKLF, preferably VP64 and LKLF.
  • an activatory domain selected from the group consisting of VP16,VP64 (tetrameric repeat of VP16), CJ7, p65-TA1 , SAD, NF-1 , AP-2, SP1-A, SP1-B, Oct-1 , Oct-2, Oct2-5x, MTF-1 , BTEB-2 and LKLF, preferably VP64 and LKLF.
  • the transcriptionally active part of the artificial transcription factor comprises usually an inhibitory or activatory protein domain, a nuclear localization sequence and a zinc finger protein.
  • an endosome-specific protease cleavage site is a peptide sequence that is recognized and cleaved in a sequence-specific manner by proteases resident in the endosomal compartment.
  • An endosome-specific protease cleavage site "recognized by an endosome- protease" as referred herein relates to an endosome- specific protease cleavage site that is recognized and cleaved by the endosome-specific protease.
  • proteases are generally called cathepsins, as well known in the art.
  • an endosome-specific protease is a cathepsin, more specifically a cathepsin which is resident in the endosome i.e. a cathepsin which is resident in the endosomal compartments.
  • a "cleavage site" as used in the present context represents an amino acid sequence, preferably an amino acid sequence of between about two and about 15, preferably between about two and about 10, more preferably between about four and about eight amino acids, which is recognized and cleaved by the particular endosome-specific protease.
  • endosome-specific proteases bind to an endosome-specific protease binding site which is located about 1 to about 50 amino acids, preferably about 5 to about 20 amino acids, more preferably about 5 to about 15 amino acids, upstream or downstream, preferably upstream of the peptide sequence that is recognized and cleaved by the endosome-specific protease i.e. upstream or downstream, preferably upstream of the endosome-specific protease cleavage site cleaved by endosome-specific protease.
  • the endosome-specific protease binding site comprises an amino acid sequence of up to 20 amino acids e.g.
  • 1-20 amino acids preferably an amino acid sequence up to 15 amino acids e.g. 1-15 amino acids, more preferably an amino acid sequence of five to15 amino acids.
  • modification, i.e. substitution, insertion or deletion of one or more amino acids preferably substitution of one or more amino acids within the amino acid sequence of the endosome-specific protease binding site alters, i.e. increases or decreases the cleavage sensitivity of the endosome-specific protease cleavage site.
  • the cleavage sensitivity of the cleavage site can be increased i.e.
  • the cleavage site is digested by the endosome-specific protease more rapidly and/or more completely or the cleavage sensitivity of the cleavage site can be decreased i.e. the cleavage site is digested by the endosome-specific protease less rapidly and/or less completely compared to the unmodified endosome-specific protease binding site.
  • “Cleavage sensitivity” as used herein refers to the degree or rate of digestion of a particular cleavage site by a particular endosome-specific protease.
  • a protein transduction domain is defined as a peptide capable of transporting proteins, such as artificial transcription factors, across the plasma membrane into the intracellular compartment by inducing endocytotic or macropinocytotic cellular uptake.
  • Protein transduction domains considered are for example the HIV derived TAT peptide (SEQ ID NO: 1 ), mT02 (SEQ ID NO: 55), mT03 (SEQ ID NO: 56), R9 (SEQ ID NO: 57), ANTP (SEQ ID NO: 58) and others.
  • Protein transduction domains are preferably selected from the group consisting of HIV derived TAT peptide (SEQ ID NO: 1 ), mT02 (SEQ ID NO: 55), mT03 (SEQ ID NO: 56), R9 (SEQ ID NO: 57), ANTP (SEQ ID NO: 58). More preferred is the HIV derived TAT peptide, most preferred is the HIV derived TAT peptide (SEQ ID NO: 1 ).
  • the term "about” is defined as plus or minus ten percent; for example, about 50 means 45 to 55.
  • a membrane-bound receptor gene causes the production of a protein or a protein that is part of a protein complex capable of binding to extracellular ligands and relaying the signal of ligand binding across the cellular membrane causing a cellular response.
  • a nuclear receptor gene causes the production of a soluble protein localized to the nucleus or the cytosol capable of binding cell-permeable ligands and capable of acting as transcription factor or accessory to a transcription factor for the modulation of gene expression upon binding their cognate ligand.
  • a haploinsufficient gene is defined as a gene capable of causing the production of sufficient gene product in all cell types under all circumstances only if two functional gene copies are present in the genome.
  • mutation of one gene copy of a haploinsufficient gene causes insufficient gene product generation in some or all cells of an organism under some or all physiological circumstances.
  • the artificial transcription factors of the invention comprise a nuclear localization sequence (NLS).
  • artificial transcription factors of the invention containing tetrameric, pentameric, hexameric, heptameric, octameric, nonameric, or decameric zinc finger proteins where individual zinc finger modules are exchanged to improve binding affinity towards target sites of the respective nuclear receptor promoter gene, or to alter the immunological profile of the zinc finger protein for improved tolerability.
  • artificial transcription factors comprising an octameric or higher order zinc finger protein, more preferably an octameric, nonameric, decameric, undecameric and duodecameric zinc finger protein, in particular an octameric zinc finger protein.
  • an octameric zinc finger protein selected from the group consisting of SEQ ID NO: 345 and SEQ ID NO: 346.
  • the domains of the artificial transcription factors of the invention may be connected by flexible or rigid linkers, in particular by flexible or rigid linkers comprising between about 1 and about 50 amino acids, preferably between about 1 and about 30 amino acids, more preferably between about 1 and about 15 amino acids.
  • Particular linkers considered are selected from the group consisting of GGSGGS (SEQ ID NO: 60), EAAAK (SEQ ID NO: 61 ), EAAAKEAAAK (SEQ ID NO: 62), EAAAK EAAAK EAAAK (SEQ ID NO: 63),
  • Linkers considered are also single amino acids such as a single amino acid with a small side chain e.g. glycine or alanine. Also linkers are considered which have two to five, preferably two amino acids such as aspartic acid and isoleucine. Artificial transcription factors may further contain markers, such as (but not limited to) epitope tags to ease their detection and processing.
  • the artificial transcription factor further comprises a linker selected from the group consisting of G, A, Dl, GGSGGS (SEQ ID NO: 60), EAAAK (SEQ ID NO: 61 ), EAAAKEAAAK (SEQ ID NO: 62), EAAAKEAAAKEAAAK (SEQ ID NO: 63), AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 64), APAPAPAPAPAP (SEQ ID NO: 65), and EAAAKEAAAKKYPN EAAAKEAAAK (SEQ ID NO: 66), preferably selected from the group consisting of G, A, Dl, and GGSGGS (SEQ ID NO: 60), more preferably selected from the group consisting of G and Dl.
  • a linker selected from the group consisting of G, A, Dl, and GGSGGS (SEQ ID NO: 60), more preferably selected from the group consisting of G and Dl.
  • the linker is located upstream of the protein transduction domain in particular directly after the amino acid sequence of the protein transduction domain, between the endosome-specific protease cleavage site and the regulatory domain and/or downstream of the zinc finger protein of the artificial transcription factor in particular directly after the amino acid sequence of the zinc finger protein.
  • Treatment of many diseases is based on modulating cellular receptor signaling.
  • Examples are high blood pressure where beta blockers inhibit the function of the beta adrenergic receptors, depression where serotonin uptake blockers increase agonist concentration and thus serotonin receptor signaling or glaucoma where prostaglandin analogues activate prostaglandin receptors in turn decreasing intraocular pressure.
  • small molecules either in the form of receptor agonist or antagonists are used to impact receptor signaling for therapeutic purposes.
  • cellular receptor signaling can also be influenced by direct modulation of receptor protein expression.
  • Pathological processes amenable to direct modulation of receptor expression levels are, for example, the following: Patients with congestive heart failure due to congenital heart disease will benefit from the upregulation of beta-adrenoceptors, since downregulation of this receptor in the myocardium is associated with the risk of post-operative heart failure.
  • Parkinson's disease treatment with dopaminergic medication suppresses the availability of dopamine receptors, thus, upregulation of dopamine receptor will improve the efficacy of dopaminergic medication.
  • epilepsy insufficient expression of cannabinoid receptors in the hippocampus is involved in disease etiology, thus, upregulation of cannabinoid receptor will be a viable therapy for epileptic patients.
  • receptor molecules proteins from the so called seven-transmembrane or G protein coupled receptor (GPCR) family of proteins, characterized by seven transmembrane domains anchoring the receptor in the plasma membrane and a G protein dependent signaling cascade.
  • GPCR G protein coupled receptor
  • Examples for such proteins are receptors A and B for endothelin.
  • Other receptor proteins are anchored via a single transmembrane region, for example the receptor for lipopolysaccharide, Toll-like receptor 4, or various cytokine receptors such as IL-4
  • receptors consist of multimeric protein complexes, for example the high- affinity receptor for IgE antibodies that consists of alpha, beta and gamma chains, or the T- cell receptor consisting of alpha, beta, gamma, delta, epsilon and zeta chains.
  • receptor molecule proteins from different protein families with very different modes of action.
  • Receptors considered in the present invention are human receptor molecules encoded by HTR1A, HTR1B, HTR1D, HTR1E, HTR1F, HTR2A, HTR2B, HTR2C, HTR4, HTR5A,
  • Further receptors considered are human receptors recognizing interleukin (IL)-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1 1 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL- 19, IL-20, IL-21 , IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31 , IL-32, IL-33, IL-34, IL-35, IL-36, IL-37, IL-38, leptin, interferon-alpha, interferon-beta, interferon-gamma, tumor necrosis factor alpha, lymphotoxin, prolactin, oncostatin M, leukemia inhibitory factor, colony-stimulating factor, immuno
  • receptors encoded by homologous non-human genes for example by porcine, equine, bovine, feline, canine, or murine genes
  • receptors encoded by homologous plant receptor genes for example genes found in crop plants such as wheat, barley, corn, rice, rye, oat, soybean, peanut, sunflower, safflower, flax, beans, tobacco, or life- stock feed grasses, and genes found in fruit plants such as apple, pear, banana, citrus fruit, grape or the like.
  • nuclear receptors are soluble proteins incorporating ligand binding and transcription factor activity in one polypeptide.
  • Nuclear receptors are either localized in the cytosol or the nucleoplasm where they are activated upon ligand binding, dimerize and become active transcription factors regulating a vast array of transcriptional programs. Unlike above mentioned membrane-anchored receptors that bind their ligands outside the cell and transduce the signal across the plasma membrane into the cell, nuclear receptors bind lipophilic ligands that are capable of crossing the plasma membrane to gain access to their cognate receptor. In addition, most receptors rely on intricate signal amplification mechanisms before the intended cellular outcome is achieved. Nuclear receptors, on the other hand, directly convert the binding of a ligand into a cellular response.
  • Treatment of many diseases is based on modulating nuclear receptor signaling. Examples are inflammatory processes where glucocorticoids activate the glucocorticosteriod receptor, prostate cancer where antagonists of androgen receptor possess beneficial therapeutic effect, or breast cancer where blocking estrogen receptor signaling proves useful.
  • nuclear receptor signaling can also be influenced by direct modulation of nuclear receptor protein expression, and such modulation is the subject of the present invention.
  • Nuclear receptors considered in the present invention are human nuclear receptors encoded by the human genes AR, ESR1, ESR2, ESRRA, ESRRB, ESRRG, HNF4A, HNF4G, NR0B1, NR0B2, NR1D1, NR1D2, NR1H2, NR1H3, NR1H4, NR1I2, NR1I3, NR2C1, NR2C2, NR2E1, NR2E3, NR2F1, NR2F2, NR2F6, NR3C1, NR3C2, NR4A 1, NR4A2, NR4A3, NR5A 1, NR5A2, NR6A 1, PGR, PPARA, PPARD, PPARG, RARA, RARB, RARG, RORA, RORB, RORC, RXRA, RXRB, RXRG, THRA, THRB and VDR.
  • non-human nuclear receptors for example porcine, equine, bovine, feline, canine, or murine transcription factors, encoded by genes related to the mentioned human nuclear receptor genes.
  • PRKAR1A PRKAR1A
  • FBN1, ELN, TCOF1, ENG GLI3, TCF4, GRN, NKX2-1, SOX10, SHOX, MC4R, GATA3, NKX2-5, TBX1, COL10A 1, PAX6, LMX1B, BMPR2, PAX9, SOX9, TRPV4, SPAST, TBX5, TWIST1, EHMT1, FOXC2, TBX3, TNXB, DSP, OPA 1, TRPS1, RUNX2, SCN1A, HOXD13, NSD1, SATB2, PRPF31, SOX2, COL6A1, APC, RAI1, PAX3, ZEB2, SLC40A 1, AFG3L2, KCNQ2, SALL1, PPARG, GDF5, GCH1, MYH9, SALL4, PITX2, FO
  • non-human genes for example porcine, equine, bovine, feline, canine, or murine genes, as well as their homologous human genes as well as plant genes, for example genes found in crop plants such as wheat, barley, corn, rice, rye, oat, soybean, peanut, sunflower, safflower, flax, beans, tobacco, or life-stock feed grasses, and genes found in fruit plants such as apple, pear, banana, citrus fruit, grape or the like, under the control of a haploinsufficient promoter.
  • crop plants such as wheat, barley, corn, rice, rye, oat, soybean, peanut, sunflower, safflower, flax, beans, tobacco, or life-stock feed grasses
  • fruit plants such as apple, pear, banana, citrus fruit, grape or the like, under the control of a haploinsufficient promoter.
  • artificial transcription factors of the invention combine, in one class of molecule, exceptionally high specificity for a very wide and diverse set of targets with overall similar composition.
  • immunogenicity in the form of anti-drug antibodies and the associated immunological reaction are a concern.
  • due to the high conservation of zinc finger modules such an immunological reaction will be minor or absent following application of artificial transcription factors of the invention, or might be avoided or further minimized by small changes to the overall structure eliminating immunogenicity while still retaining target site binding and thus function.
  • modification of artificial transcription factors of the invention with polyethylene glycol is considered to reduce immunogenicity.
  • artificial transcription factors are tailored to act specifically on the promoter region of specific genes, the use of artificial transcription factors allows for selectively targeting even closely related proteins. This is based on the only loose conservation of the promoter regions even of closely related proteins. Taking advantage of the high selectivity of the artificial transcription factors according to the invention, even a tissue-specific targeting of a drug action is possible based on the oftentimes tissue-specific expression of certain members of a given protein family that are individually addressable using artificial transcription factors.
  • artificial transcription factors need to be present in the nuclear compartment of cells in order to be effective as they act through modulation of gene expression.
  • the method of choice for the therapeutic delivery of artificial transcription factors is either in the form of plasmid DNA through transfection or by employing viral vectors. Plasmid transfection for therapeutic purposes has low efficacy, while viral vectors have exceptionally high potential for immunogenicity, thus limiting their use in repeated application of a certain treatment. Thus other modes of delivering artificial transcription factors for example in protein form instead of as nuclei acid are required.
  • Protein transduction domain (PTD) mediated, intracellular delivery of artificial transcription factors is a new way of taking advantage of the high selectivity and versatility of artificial transcription factors in a novel fashion (WO/2013/053719 A2).
  • Protein transduction domains are small peptides capable of crossing the plasma membrane barrier and delivering cargo proteins into the cell. Such protein transduction domains are for example the HIV derived TAT peptide, mT02, mT03, R9, ANTP and others. The mode of cellular uptake is likely by endocytosis and it was shown that the TAT peptide is able to induce a cell-type independent macropinocytotic uptake when fused to cargo proteins (Wadia J.S. et a/., 2004, Nat Med 10, 310-315).
  • endosomal localization is not equivalent to cytoplasmic or nucleoplasms localization.
  • delivered proteins are capable to escape endosomes and reach other truly intracellular targets to some extent.
  • the amount of protein successfully escaping the endosomal compartment and able to reach the intended subcellular compartment is miniscule and severely hampers the effectiveness of therapeutical proteins as the effective dose at the site of action is considerable below the applied dose.
  • One such strategy is to interfere with the osmotic balance of the endosome by employing endolysosomotropic agents such as chloroquine or so called proton sponges such as polyhistidine-tags. Disruption of the osmotic balance leads to a swelling of the endosome causing endosomal rupture.
  • a second proposed strategy to enhance endosomal escape is the co-delivery of the membrane-active, fusogenic peptide TATHA2 or others such as GALA or KALA peptide. These peptides are able to interact with the endosomal membrane from the inside and cause membrane rupture. Indeed, mechanisms capable of disrupting the endosomal membrane are the state-of-the-art for increased endosomal escape of cargo proteins delivered using a protein transduction domain.
  • hexameric zinc finger proteins were selected from a zinc finger protein library based on their binding to 18 bp DNA target sites selected from the human ETRA or human FcERIA promoter. These zinc finger proteins were incorporated into fusion proteins containing, listed from the N- to the C-terminus, a hexa- histidine tag, a TAT protein transduction domain, a HA tag, optionally a cathepsin cleavage site, a SID negative regulatory domain, a SV40 nuclear localization sequence, a gene promoter specific hexameric zinc finger protein, and a triple myc epitope tag.
  • the artificial transcription factors ATF1488 (SEQ ID NO: 67) lacking a purposefully introduced cathepsin cleavage site, and the cathepsin cleavage site-containing ATF1688 (SEQ ID NO: 68) were generated.
  • inactive artificial transcription factor ATF1714 (SEQ ID NO: 69) based on ATF1488, and ATF1806 (SEQ ID NO: 70) based on ATF1688 were generated.
  • the artificial transcription factors ATF1572 (SEQ ID NO: 71 ) lacking a purposefully introduced cathepsin cleavage site, and the cathepsin cleavage site-containing ATF1880 (SEQ ID NO: 72) were generated.
  • octameric zinc finger protein ZFP-147Aocta (SEQ ID NO: 346) containing ATF2729 (SEQ ID NO: 196) was generated targeting also the human FcERIA promoter.
  • inactive ATF1881 (SEQ ID NO: 73) was generated.
  • Fusogenic peptide fails to increase activity of artificial transcription factors
  • Membrane disrupting agents are not as efficient in promoting delivery as expected from reports in the literature. In fact, no benefit was seen in terms of increased activity for a transduced artificial transcription factor when co-delivered with TATHA2 ( Figure 1 ).
  • Cells expressing luciferase reporter under control of a promoter regulatable by the anl ⁇ -ETRA specific artificial transcription factor ATF1488 were treated with the fusogenic peptide TATHA2 or left untreated as control in the presence of ATF1488 or an inactive control (ATF1714). While treatment with ATF1488 suppressed expression of the luciferase reporter compared to control as expected, additional treatment with fusogenic peptide did not result in increased activity of ATF1488. Thus, additional endosomal rupture through the activity of TATHA2 did not enhance artificial transcription factor activity. Endosomal entanglement caused by protein transduction domains
  • TAT -fused artificial transcription factors may mainly reside in the endosomal compartment with some nuclear localization.
  • protein transduction domains hinder efficient subcellular localization once protein transduction takes place.
  • PTD is dispensable after entry of cargo into the endosomal compartment, and removal of the PTD at this point of the transport of artificial transcription factors to the nucleus might reverse the entanglement with the endosomal membrane.
  • Endosomal disentanglement through targeted, endosome-specific proteolytic processing of artificial transcription factors The removal of the TAT protein transduction domain from the artificial transcription factor following entry into the endosomal compartment is beneficial for the successful delivery of artificial transcription factors to the nuclear compartment. Inclusion of a specific cathepsin cleavage site between the TAT protein transduction domain and the transcriptionally active part of the artificial transcription factor protein turns out to be beneficial and increases the amount of zinc finger protein reaching the intended target. As shown in Figure 2, removal of the PTD through the action of endosome-specific proteases following entry into the endosomal compartment will lead to the disentanglement of the active artificial transcription protein from the inside of the endosomal membrane. This will allow for the efficient exit of the active artificial transcription factor from the endosomal compartment once the endosomal membrane is ruptured and will facilitate its efficient nuclear import and allow for the intended target gene regulation.
  • ATF1688 Increased nuclear import of ATF1688 is proven by four times higher mean nuclear fluorescence intensity in ATF1688-treated cells compared to ATF1488-treated control cells. Furthermore, in a luciferase reporter assay, ATF1688 displayed increased activity compared to ATF1488 resulting in a superior suppression of luciferase activity ( Figure 4). Also, inclusion of a cathepsin cleavage site into an FcER 7/A-specific artificial transcription factor resulted in increased activity in a luciferase reporter assay as shown following treatment of reporter cells with the ATF1572 lacking a specific cathepsin site compared to treatment with the cathepsin-site containing ATF1880 ( Figure 5).
  • Cathepsin-mediated enhanced endosomal disentanglement critically depends on the expression of the cathepsins for which the corresponding cleavage site was introduced into an artificial transcription factor. Insufficient expression of such cathepsins in a target cell type would prevent enhanced endosomal disentanglement and increased nuclear localization.
  • cathepsin expression in the intended target cell type is necessary for the prediction of successful enhanced endosomal disentanglement.
  • knowing the cathepsin complement of a given target cell type enables one to employ appropriate cathepsin cleavage sites when engineering transducible artificial transcription factors for enhanced endosomal disentanglement.
  • expression levels of various cathepsins, and thus likely cathepsin activity differ between various cell lines.
  • mRNA levels of cathepsin B, D, F, G, H, K, L, and S compared to GAPDH as control were determined in retinal pigment epithelial cells (ARPE19), human meningothelial cells (Ben-Men-I), human keratinocytes (HaCat), human embryonic kidney cells (HEK293), HeLa cells grown in normal or synthetic media, human endothelial cells (HMEC-1 ), human astrocytes, human primary keratinocytes, human primary fibroblasts, human pericytes, human uterine smooth muscle cells (hUtSMCs), and human neuron-like cells (SH-SY5Y).
  • ARPE19 retinal pigment epithelial cells
  • Ben-Men-I human meningothelial cells
  • HaCat human keratinocytes
  • HEK293 human embryonic kidney cells
  • HMEC-1 human astrocytes
  • human primary keratinocytes human primary fibroblasts
  • cathepsins B, H, and K can reach up to 6 % of GAPDH expression level in certain cell types, while other cathepsins such as F, G, L, and S are expressed at levels below 1 % of GAPDH expression level.
  • cathepsin D can reach up to 60 % of GAPDH expression level. While there is considerable difference in the average expression level of cathepsins with cathepsins F, G, L, and S considered of low abundance, cathepsin B, H, and K considered of medium
  • cathepsin D considered of high abundance, cathepsin expression levels also vary considerably between different cell types.
  • incorporation of sites sensitive to digestion by cathepsin B, D and K is preferred over incorporation of sites sensitive to cleavage by cathepsin G.
  • incorporation of sites sensitive to digestion by cathepsin B, D, K and I is preferred. In such cases enhanced endosomal disentanglement is accomplished in smooth muscle cells.
  • cathepsin expression profiling in cultured cells is already helpful to decide on suitable cathepsin cleavage sites for inclusion into artificial transcription factors to enhance endosomal disentanglement
  • defining cathepsin expression of potential target cells in target tissues is important to rationally design artificial transcription factors for maximal and cell type-specific endosomal disentanglement.
  • analysis of ATF1688 localization in porcine retina following intravitreal injection revealed exceptional nuclear translocation of this artificial transcription factor into cells of the neural retina, such as photoreceptor or retinal ganglion cells.
  • ATF1688 only minimal nuclear translocation of ATF1688 was found in smooth muscle cells of retinal vessels, potential target cells for this E7/3 ⁇ 4A-specific artificial transcription factor.
  • This differential pharmacokinetic profile of ATF1688 can likely be attributed to differential expression of cathepsins in different cell types of the retina, as endosomal disentanglement critically depends on the cathepsin inventory of cells.
  • cathepsin expression pattern was determined in eye tissues.
  • expression of cathepsins B, D, E, F, G, H, K, L, and S was determined in human (Table 1 ) and African green monkey eyes (Table 2).
  • Analysis of cathepsin expression in these tissues revealed a complex picture of cathepsin expression in smooth muscle cells of retinal vessels and other cell types of the retina.
  • Table 1 Expression of cathepsins B, D, E, F, G, H, K, L and S in smooth muscle cells of vessels in the human eye evaluated by staining of human eye tissue with specific anti- cathepsin antibodies
  • Cathepsin expression was graded as high for immunoreactivity that reached at least 20% of the highest immunoreactivity for a given cathepsin otherwise cathepsin expression was graded as low as judged by an experienced pathologist.
  • Table 2 Expression of cathepsins B, D, F, K, and L in smooth muscle cells (SMCs) of vessels in the Chlorocebus sabaeus (African Green Monkey) eye evaluated by staining of eye tissue with specific anti-cathepsin antibodies
  • Cathepsin expression was graded as high for immunoreactivity that reached at least 20% of the highest immunoreactivity for a given cathepsin otherwise cathepsin expression was graded as low as judged by an experienced pathologist.
  • the artificial transcription factor of the present invention targets smooth muscle cells of vessels in the human eye i.e. is applied to smooth muscle cells of vessels in the human eye wherein the one single or two or more endosome-specific protease cleavage sites are cleaved by cathepsins selected from the group consisting of B, D, K and I, preferably selected from the group consisting of B, D and K.
  • the artificial transcription factor of the present invention comprises one single or two or more endosome-specific protease cleavage sites which are selected according to the abundance of the endosome-specific proteases in the target cell type of the artificial transcription factor. "Abundance of the endosome-specific proteases in the target cell type” is referred herein as abundance of endosome-specific proteases which are expressed in the target cell type at an expression level which provides for an
  • Modulating the sensitivity of an artificial transcription factor towards cathepsin cleavage by including different cathepsin cleavage sites is a means to modulate endosomal
  • cathepsins exhibit some sequence specificity for their endopeptidase activity and some cleavage sites and various consensus sequences for different cathepsins are described in the literature. However, defining useful cleavage sites for incorporation into artificial transcription factors of the invention to achieve enhanced endosomal disentanglement and especially to achieve cell type-specific nuclear transduction is not trivial.
  • the context in which a cathepsin site is embedded within the artificial transcription factor is likely to be important for the efficacy by which these sites are cleaved by various cathepsins.
  • cathepsin sensitivity of potential peptide sequences for the promotion of endosomal disentanglement needs to be defined in the context of artificial transcription factors.
  • the cathepsin-sensitive site (CS1 ) in ATF1688 was exchanged by other potential cleavage sites (CS2-CS18, see Table 3) and the resulting artificial transcription factors were incubated with purified cathepsins B, D, K, L, and S in vitro.
  • Analysis of the artificial transcription factor cleavage products by western blot revealed that alternative cathepsin sites are differentially recognized and digested (cleaved) by different cathepsins (Table 4).
  • Table 3 List of names and amino acid sequence of potential cleavage sites (CS) and the names of ATF1688-based E773 ⁇ 4A-specific artificial transcription factors containing these sequences.
  • the sensitivity of the potential cleavage site towards a specific cathepsin is graded into low, medium and high. Off-target cleavage products smaller than 26 kDa were not considered. Cleavage of an artificial transcription factor at the intended target site by a given cathepsin was graded as low for peaks between about 1 and 5% of the maximal peak height, medium for peaks above 5% and below 20% of maximal peak height and high for peaks above 20% of maximal peak height.
  • cleavage products containing the regulatory SID domain, the nuclear localization sequence and the DNA-binding zinc finger protein domain and constitute an active artificial transcription factor, i.e. a transcriptionally active part of the artificial transcription factor.
  • Such cleavage products can be detected following digestion of ATF1688 with cathepsin B, D, K, L, and S, ATF2403 with cathepsin B and K, ATF2405 with cathepsin K and S, ATF2406 with cathepsin K and S, and ATF2407 with cathepsin D, K, L, and S.
  • Such cleavage products can be detected following digestion of ATF2443 with cathepsin B, D, K, L, and S, ATF2445 with cathepsin D and K, ATF2446 and ATF 2447 with cathepsin D, K, L, and S.
  • Productive cleavage events are also detected for ATF2448 digested with cathepsin K and S, ATF2449 digested with cathepsin D, ATF2450 digested with cathepsin D and K, ATF2451 digested with cathepsin D, K, L, and S, ATF2452 digested with B, D, K, L, S, and ATF2453 digested with cathepsin D and K, and ATF2454 digested with cathepsin D (Table 4). However, not all cathepsin sites are cleaved with the same efficiency by a given cathepsin.
  • Cathepsin B shows medium activity towards CS1 , CS2, CS7, and CS16.
  • Cathepsin D shows high activity towards CS1 , CS7, CS9, CS10, CS11 , CS13, CS15, CS16, and CS17, and medium activity towards CS6 and CS14.
  • Cathepsin K shows high activity towards CS1 , CS6, CS7, CS11 , CS15, and CS16, medium activity towards CS2, CS4, CS5, CS9, CS10, CS12, CS14 and CS17.
  • Cathepsin L showed high activity towards CS7 and CS16, and medium activity towards CS1 , CS6, CS10, CS1 1 and CS15.
  • Cathepsin S showed high activity towards CS1 , CS6, CS7 and C16, and medium activity towards CS4, CS5, CS10, CS1 1 , CS12 and CS15.
  • Transducible artificial transcription factors of the invention are useful for the treatment of pathological conditions. To this end, such artificial transcription factors have to reach the nuclear compartment of target cells which are involved in such a pathological process. For most diseases, such target cells constitute only a minor part of the overall population of this target cell in the body.
  • target cell is used in this context as a cell type with respect to general classification of cells in the biological sense, e.g. smooth muscle cells in retinal vessels walls and smooth muscle cells in the aortic wall are the same cell type, i.e. the term target cell is in this context used as a cell type in the cell biological sense e.g. smooth muscle cells in retinal vessels walls and smooth muscle cells in the aortic wall are the same cell type.
  • a diseased cell in the context of the present invention refers to a cell with (A) an altered physiological status compared to a normal or healthy cell including but not limited to altered gene expression and (B) which is part of a
  • cathepsin expression levels in cell of the same cell with respect to general classification of cells in the biological sense vary with their location and physiological condition; for example, a smooth muscle cell in a retinal vessel wall has a cathepsin expression pattern different from a smooth muscle cell in a placental vessel i.e. cathepsin expression levels in a cell of the same cell type in the cell biological sense vary with their location and physiological condition; for example, a smooth muscle cell in a retinal vessel wall has a cathepsin expression pattern different from a smooth muscle cell in a placental vessel.
  • endosomal disentanglement is a major factor in the successful delivery of therapeutic artificial transcription factor
  • adapting endosomal disentanglement of the artificial transcription factor is a way to preferentially target diseased cell populations. For example, increased cathepsin L expression in response to hypoxic conditions would permit successful endosomal disentanglement of a cathepsin L-sensitive artificial transcription factor in cells in hypoxic areas, while relative lower cathepsin L expression in normoxic areas is less permissive for endosomal disentanglement.
  • adjusting cathepsin sensitivity of artificial transcription factors to the differences in cathepsin expression levels based on location, physiological and pathological status between cells of the same cell type in the cell biological sense is a means to achieve more efficient endosomal disentanglement of such therapeutic proteins in cells connected to the disease process compared to cells not involved in the disease.
  • This targeted endosomal disentanglement will therefore minimize side effects as cells not involved in the disease process will receive a lower dose of effective artificial transcription factor compared to cells directly connected to the pathological process.
  • Altered cathepsin-sensitivity of artificial transcription factors impacts transport into the nuclear compartment of cells and influences activity in a luciferase reporter assay
  • Nuclear translocation of artificial transcription factors was assessed following transduction into HEK293 cells using immunofluorescence analyses employing anti-myc antibodies detecting a 3xmyc epitope tag at the very C-terminus.
  • the activity of ATF1688 variants is shown as percent of ATF1688 activity compared to ATF1806 as measured using a luciferase reporter assay also based on HEK293 cells.
  • Cathepsin sensitivity of artificial transcription factors and cathepsin inventory of target cells determines efficiency of nuclear import Endosomal disentanglement depends on the cathepsin-sensitivity of the artificial transcription factor itself and the cathepsin inventory of the target cell.
  • matching the cathepsin sensitivity of an artificial transcription factor to the cathepsin inventory of the target cell type is a means to achieve endosomal disentanglement in the target cell while minimizing nuclear translocation in non-target cell types with different cathepsin inventory.
  • transduction of artificial transcription factors into cells followed by the recovery of transduced proteins and western blot analyses allows judging the resistance of such artificial transcription factors of the invention against cathepsins present in vivo.
  • analysis of recovered ATF1688, ATF2443, and ATF2450 from human astrocytes, HEK293, and Hela cells following transduction revealed that cells with different cathepsin inventories process artificial transcription factors differentially depending on their cathepsin sensitivity.
  • ATF2443 has increased desired processing resulting in the generation of cleavage products (around 28 kDa) in astrocytes, HEK293, and HeLa cells compared to ATF1688.
  • an artificial transcription factor containing a cathepsin cleavage site located between the PTD and the transcriptionally active part of the transducible artificial transcription factor specific for a cathepsin that is not expressed in a certain cell type will not enhance disentanglement of this PTD-protein fusion.
  • incorporating a cleavage site recognized by a cathepsin expressed in the target cell type, but low expressed or absent in other cell types will restrict effective delivery of the transducible artificial transcription factor to the intended target cell.
  • the invention relates to an artificial transcription factor comprising a cathepsin cleavage site recognized by a cathepsin expressed in the target cell type, but low expressed or absent in other cell types, in particular to such artificial transcription factor wherein the cathepsin cleavage site is located between the PTD and the transcriptionally active part of the transducible artificial transcription factor.
  • the artificial transcription factor does not contain any other cathepsin cleavage site other than the one located between the PTD and the transcriptionally active part of the transducible artificial transcription factor.
  • the mentioned cathepsin cleavage site is recognized by two or more different cathepsins expressed in the target cell type, but low expressed or absent in other cell types.
  • the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor does not contain any other protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
  • any other protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is a cathepsin B cleavage site.
  • the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor does not contain any cathepsin B cleavage site apart from the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
  • the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is modified to decrease cle
  • the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is a cathepsin B cleavage site.
  • the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor has a decreased cle
  • ATF2491 preferably a decreased cleavage sensitivity compared to the cleavage sensitivity of the artificial transcription factor of SEQ ID NO: 67 (ATF1488).
  • Adding negative selection of non-target cells based on cathepsin expression pattern further increases specific delivery of transducible artificial transcription factors to the intended target cell types. This is achieved through the incorporation of additional cathepsin cleavage sites in the transducible artificial transcription factor into or between domains of the protein essential for its activity, such as the nuclear localization sequence, the regulatory domain or the zinc finger protein.
  • additional negative-selective cathepsin cleavage sites are selected based on the expression pattern of cathepsins in target and non-target cell types in a way that target cell types do not express or contain only minor amount of the corresponding cathepsin while non-target cell types are positive for the cathepsin recognizing the negative- selective cathepsin cleavage site (for a schematic representation see Figure 9).
  • This negative selection can be extended to include additional cell types by using a multifunctional cathepsin cleavage site which is not recognized in the target cell type but which is cleaved by one of several cathepsins expressed in various non-target cell types.
  • negative selection can be achieved by adding a combination of negative-selective cathepsin cleavage sites to increase the amount of cathepsin able to cleave the artificial transcription factor inside its transcriptionally active region.
  • Preferred is the addition of such negative-selective cathepsin cleavage sites into the linker regions connecting the regulatory domain and the nuclear localization sequence or the zinc finger protein domain, respectively.
  • incorporation of such negative-selective cathepsin cleavage sites into regulatory domain, nuclear localization sequence, or zinc finger protein is also considered.
  • the invention relates to an artificial transcription factor comprising a cathepsin cleavage site recognized by a cathepsin low expressed or absent in the target cell type, but expressed in non-target cell types, wherein such cathepsin cleavage site is located within or between domains of the protein essential for its activity.
  • an artificial transcription factor comprises two or more such cathepsin cleavage sites located within or between domains essential for its activity, wherein the two or more cathepsin clavage sites are low expressed or absent in the target cell type, but expressed in non-target cell types.
  • a cathepsin cleavage site or such multiple cathepsin cleavage sites are recognized by two or more different cathepsins low expressed or absent in the target cell type, but expressed in non-target cell types.
  • an endosome-specific protease or cathepsin cleavage site recognized by a endosome-specific protease or a cathepsin low expressed in the target cell type refers to an expression level of a certain endosome-specific protease or a cathepsin in the target cell type which is at least 2-fold, preferably at least 3-fold, more preferably at least 5-fold less in the target cell type compared to other cells, in particular compared to non-target cells types.
  • an endosome-specific protease or cathepsin cleavage site recognized by a cathepsin absent in the target cell type means that a certain endosome-specific protease or a certain cathepsin is not expressed at all in the target cell type.
  • the invention relates to an artificial transcription factor comprising an endosome-specific protease cleavage site recognized by an endosome-specific protease low expressed or absent in the target cell type, but expressed in non-target cell types, wherein such an endosome-specific protease cleavage site is located within or between domains of the artificial transcription factor essential for its activity.
  • domains of the artificial transcription factor essential for its activity are the nuclear localization sequence, the inhibitory or activatory domain or the polydactyl zinc finger protein.
  • the invention relates to an artificial transcription factor comprising an endosome-specific protease cleavage site recognized by an endosome-specific protease low expressed or absent in the target cell type, but expressed in non-target cell types, wherein such an endosome-specific protease cleavage site is located in the linker regions connecting the regulatory domain and the nuclear localization sequence or the zinc finger protein domain.
  • a target cell type or a target cell type of the artificial transcription factor refers to a cell type which has endosome-specific protease inventory i.e. expresses at least one endosome-specific protease which specifically cleaves the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
  • a target cell type or a target cell type of the artificial transcription factor both terms are used interchangeably herein, refers to a cell type which has an endosome-specific protease inventory i.e.
  • endosome-specific protease which specifically cleaves the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor but does not specifically cleave or does specifically cleave to a lesser degree other protease cleavage site comprised by the artificial transcription factor other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
  • a non-target cell type or a non-target cell type of the artificial transcription factor refers to a cell type which has an endosome-specific protease inventory i.e. expresses at least one endosome-specific protease which does not specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor or does specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor to a lesser degree than other protease cleavage site comprised by the artificial transcription factor other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
  • a non-target cell type or a non-target cell type of the artificial transcription factor refers to a cell type which has an endosome-specific protease inventory i.e. expresses at least one endosome-specific protease which does not specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor or does specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor to a lesser degree than other protease cleavage site comprised by the artificial transcription factor other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the at least one endosome-specific protease inventory i.e. expresses at least one end
  • target or non-target cell types may be of the same type with respect to general classification of cells i.e. in the cell biological sense, and may differ only in that the target cell type is a diseased cell and non-target cell is a non-diseased cell, or may differ only in their localization in particular organs or parts of organs, or may differ only in their physiological context.
  • specific cleavage of a given endosome-specific protease cleavage site by one endosome-specific protease but not by another endosome-specific protease is defined as a 2-times, preferably 3-times, more preferably 4-times higher processing of a protein containing this cleavage site i.e.
  • differences in endosome-specific protease expression pattern between two cell types is defined as a 2-times preferably 3-times, more preferably 4-times difference in expression of said endosome-specific protease .
  • transducible artificial transcription factors at defined sites greatly enhances their correct localization and activity and can be used to narrow down successful delivery to certain cell types based on their cathepsin expression pattern
  • unspecific cleavage by cathepsins outside predefined sequences likely interferes with the activity of these proteins.
  • To increase the successful delivery of functional artificial transcription factors to the nuclear compartment making these proteins resistant to cathepsin cleavage outside the intentionally introduced cleavage sites might prove useful.
  • Various transducible artificial transcription factors of the invention were digested with purified cathepsins in vitro (Table 4).
  • ATF2491 SEQ ID NO: 94
  • ATF2493 SEQ ID NO: 95
  • removing this off-target cathepsin-sensitive site greatly increased the preferred processing of ATF2491 compared to ATF1688 (peaks marked with *).
  • removal of unwanted cathepsin cleavage sites in artificial transcription factors greatly improves their correct processing at intended cleavage sites thereby improving their endosomal disentanglement.
  • the present invention is directed to artificial transcription factors wherein unwanted cathepsin cleavage sites are removed, in particular to ATF2491 (SEQ ID NO: 94) and ATF2493 (SEQ ID NO: 95).
  • endosomal protease cleavage sites such as a cathepsin B cleavage site and others in this invention to improve the endosomal disentanglement of cargo proteins such as artificial transcription factors is beyond state-of-the-art.
  • cargo proteins such as artificial transcription factors
  • no additional endosomal vesicle rupture is introduced, but the cargo protein is solely separated from the protein transduction domain after entry into the endosome, in fact disentangled from the endosomal membrane, to allow for efficient escape from the endosome following base- line vesicle rupture.
  • cell penetrating peptides were used together with protease cleavage sites (EP 2 399 939, WO 2008/0631 13), for the sole purpose of increasing the selectivity of protein transduction meaning the process of entry into the cell before entry into the endosomal compartment.
  • protease cleavage sites EP 2 399 939, WO 2008/0631 13
  • an endosomal protease cleavage site was used together with a protein transduction domain (WO 2005/003315).
  • the procedure provided is a method of transport of DNA (used for transfection) into cells.
  • the endosomal protease site was only used as a marker to confirm entry of the DNA complex via an endosomal route, but not to enhance endosomal escape of DNA.
  • constructs of the present invention provide increased endosomal disentanglement and cell- type specific inactivation of a protein, not a marker for the detection of a route of entry of a DNA complex.
  • fusogenic peptides have certain restrictions in terms of size, in possibility to interact, and in N- as well as C-terminal amino acid sequence in order to act as fusogen for endosomal membranes.
  • simply incorporating a fusogenic peptide into a cargo protein is not yet a viable option to increase endosomal escape.
  • incorporation of fusogenic peptides into artificial transcription factors of the invention via an endosomal protease-sensitive linker region allows for the simultaneous delivery of cargo protein and fusogenic peptide into the endosomal lumen. Once inside the endosome, separation of the artificial transcription factor from the protein transduction domain occurs, and in addition the liberation of fusogenic peptides.
  • Removing the polyhistidine-tag from ATF1688 significantly reduces suppression of gene expression compared to the polyhistidine-tag containing artificial transcription factor ATF1688 ( Figure 1 1 ).
  • the polyhistidine-tag improves activity of ATF1688 consistent with a proton sponge activity.
  • Variants of ATF1688 containing octameric zinc finger proteins were generated by extending the hexameric zinc finger protein with two additional zinc finger modules.
  • the additional zinc finger modules were selected through a yeast-one-hybrid screen employing an octameric zinc finger library based on the hexameric zinc finger similar to the protein contained in ATF1688.
  • ATF2467 SEQ ID NO: 101
  • ATF2468 SEQ ID NO: 102
  • ATF2469 SEQ ID NO: 103
  • ATF2470 SEQ ID NO: 104
  • Protein transduction efficiency depends on local TA T concentration
  • Successful protein transduction depends on the induction of endosomal vesicle formation followed by the engulfment of PTD fusion proteins into such vesicles and endosomal uptake.
  • PTD such as the TAT peptide have the intrinsic capability to induce endosomal vesicle formation making these peptides useful for the transport of cargo across the plasma membrane.
  • a single TAT peptide fused to an artificial transcription factor is capable of fully inducing an endosomal vesicle, or whether several TAT moieties have to come in close contact to efficiently perform this task.
  • TAT peptides likely does not induce endosomal vesicle formation in an optimal manner. It is to assume that an optimal spatial arrangement of TAT domains exists that induces vesicle formation with a minimum of TAT moieties. While above mentioned data suggests that several artificial transcription factors fused to TAT need to come together in order to trigger vesicle formation, fusing optimally arranged TAT domains to an artificial transcription factor will help to alleviate this prerequisite and will help to overcome the bottleneck of endosomal vesicle formation.
  • Such artificial transcription factors can be generated by replacing the single TAT peptide with TetraTAT-l (SEQ ID NO: 105) consisting of four TAT moieties coupled through specific linkers.
  • ATF2505 (SEQ ID NO: 106) is such an artificial transcription factor targeting the human ETRA promoter.
  • transducible artificial transcription factors depends on the contained zinc finger protein and its binding to its cognate target site. Most crucial in this regard is the binding affinity of the zinc finger protein to its target site. This binding affinity is on the one hand defined by the protein-DNA interaction of the individual zinc fingers of a given zinc finger protein but also by the amount of zinc finger modules making contact to the DNA.
  • tetrameric to hexameric zinc finger proteins are used to construct artificial transcription factors. Tetrameric and hexameric in this context describes the use of four or six individual zinc finger modules for the construction of a zinc finger protein, respectively.
  • Hexameric are preferred over tetrameric zinc finger proteins as they provide a large enough surface to distinguish between closely related sequences in effect allowing to address one single target site located inside the human genome.
  • construction of zinc finger proteins consisting of more than six zinc finger modules is very challenging due to the library sizes involved. For example, using the Barbas zinc finger modules, the library size to generate octameric zinc finger proteins would exceed 1.5*10 9 clones making it in effect impossible to identify the best binders for a given 24 bp target site by using state-of-the-art screening systems.
  • a hexameric zinc finger protein is selected from a zinc finger protein library by using a modified yeast one hybrid scheme where zinc finger proteins are expressed as fusions to the GAL4 activation domain in yeast leading to the expression of a Aureobasidin resistance.
  • every other state-of-the-art screening method could also be employed to obtain such a hexameric zinc finger protein.
  • another zinc finger protein library is constructed based on such a hexameric zinc finger protein by fusing this hexameric zinc finger protein to a random library of two or more zinc finger modules.
  • a library of polydacytly zinc finger proteins is generated where six positions are given through the use of the hexameric zinc finger protein obtained in the first round and were up to six additional positions are randomized.
  • the library size necessary for the screening of e.g an duodecameric zinc finger protein is lowered from about 3x 10 14 to about 6x 10 6 .
  • This step of library size reduction is necessary but not sufficient to allow screening for zinc finger proteins consisting of more than six zinc finger modules.
  • the sensitivity of currently employed screening methods is not especially suited to distinguish between different zinc finger proteins contained in such an extended library, as the library is based on a preselected hexameric zinc finger protein with already high binding affinity to the intended target site.
  • Yeast cells expressing a GAL4AD-ZFP protein (SEQ ID NO: 198) under the control of the ADH promoter or the truncated SV40 promoter and containing an Aureobasidin A resistance under control of a minimal promoter containing a binding site for said GAL4AD-ZFP were serially diluted onto plates containing increasing concentrations of Aureobasidin A.
  • the difference in GAL4AD-ZFP expression driven by either the ADH or the truncated SV40 promoter was evident in the different ability of the respective yeast cells to grow on such selection plates.
  • the expression rate of a sufficiently weak promoter suitable for selecting polydactyl zinc finger proteins with more than six zinc fingers e.g.
  • heptameric, octameric or even higher order zinc finger proteins is defined as follows: Expression of the GAL4AD-ZFP protein of SEQ ID NO: 198 under control of such a promoter in yeast Y1 H Gold (Clontech) containing bait plasmid pAN2636 of (SEQ ID NO: 199) integrated into the URA3 marker results in the growth of such yeast cells only on selection plates containing less than 2500 ng/ml Aureobasidin A. In addition, 1 : 10 serial dilution of such yeast cells onto selection plates containing Aureobasidin A results only in growth of cells up to the 1 :100 dilution step on selection plates containing 1000 ng/ml Aureobasidin A.
  • Growth in this context is defined as the formation of a closed area of yeast where no individual yeast colonies can be identified upon application of 5 ⁇ of serially diluted cell suspension and after three days of incubation at 30 °C.
  • This assay is known to the person in the field of yeast studies as spot test and should be evaluated as such.
  • the employed strategy of two-step selection combined with extraordinarily low expression of bait protein through the use of very weak promoters and limiting gene dose is by no means limited to yeast one hybrid-based system. Bacterial one-hybrid, but also other screening systems such as mammalian systems could be adapted using this novel strategy.
  • this modified yeast one hybrid based scheme based on such a prey vector to obtain octameric zinc finger proteins based on hexameric zinc finger proteins recognizing target sites in the human ETRA and the human FcERIa promoter. And as shown in Figure 13, transducible artificial transcription factors based on octameric zinc finger proteins have higher activity compared to their hexameric counterparts.
  • our novel, beyond state-of-the-art yeast one hybrid system is capable of selecting polydactyl zinc finger proteins from bait libraries based on a common hexameric zinc finger protein.
  • this prey vector can also be used to screen libraries based on nonameric, decameric, undecameric, and also duodecameric zinc fingers.
  • Table 6 Use of a truncated SV40 promoter to obtain suitable expression of GAL4AD-ZFP fusion proteins for selecting higher order zinc finger proteins using yeast one hybrid.
  • Yeast cells containing bait plasmid of SEQ ID NO: 199 and expressing GAL4AD-ZFP of SEQ ID NO: 198 under control of the ADH or a truncated SV40 promoter capable of binding the minimal promoter driving the expression of the Aureobasidin A resistance gene contained on the bait plasmid were serially diluted (1 : 10), spotted onto selection plates containing increasing concentrations of Aureobasidin A and growth was assessed after three days of incubation at 30 °C.
  • the growth of the serially diluted yeast cells was assessed and is shown from left to right representing 1 :0, 1 :10, 1 : 100, 1 :1000, 1 :10000 dilutions with + representing growth and - representing no growth of the respective spot.
  • the zinc finger protein domain contained in transducible artificial transcription factors determines not only the specificity but also the specific activity of these therapeutic molecules. While a hexameric zinc finger protein is capable of binding to a 18 bp stretch of DNA in the genome, zinc finger proteins consisting of more zinc finger modules recognize longer stretches of DNA e.g a octameric zinc finger protein interacts with 24 bp of DNA. Thus, the binding of such octameric zinc finger proteins to their cognate recognition site is stronger compared to hexameric zinc finger proteins.
  • octameric zinc finger protein containing anti-FcERIa ATF2615 has significantly higher activity at lower concentrations compared to hexameric zinc finger protein containing artificial transcription factor AO501.
  • octameric zinc finger protein ZFP+74AGocta SEQ ID NO: 345
  • ATF2602 SEQ ID NO: 200
  • transducible artificial transcription factors of the invention While a wide application of transducible artificial transcription factors of the invention is envisioned and no limitiation in terms of target tissue and application route is implied, intravitreal application of anti-ETRA transducible artificial transcription factors for the treatment of diseases amenable to modulation of ETRA activity was evaluated. To this end, hexameric (ATF1688) or octameric (ATF2468 and ATF2602) zinc finger protein containing transducible artificial transcription factors were injected into live porcine eyes and their tissue distribution and penetration into the nucleus of retinal and other cells of the eye was assessed.
  • ATF1688 was found to distribute into the retina and into some nuclei of vessel-associated smooth muscle cells, ATF2468 and ATF2602 showed vastly improved distribution following intravitreal injection and were found to penetrate exceptionally well into the nuclei of analyzed cells.
  • Octameric zinc finger containing transducible artificial transcription factors were found to localize to the nuclei of their target cell type (vessels associated smooth muscle cells) up to seven days following a single injection.
  • hexameric zinc finger protein containing ATF1688 did not display this extended retention in tissues of the eye.
  • Table 7 Localization of anti-ETRA transducible artificial transcription factors following intravitreal injection into porcine eyes. Shown is a grading of nuclear localization in various tissues of the eye of transducible artificial transcription factors ATF1688, ATF2468 and ATF2602 24 hours following injection into porcine eyes. NA stands for not analyzed, - signifies no nuclear localization of artificial transcription factor, (+) weakly positive in some nuclei, + positive in a high percentage of nuclei, ++ highly positive in almost all nuclei.
  • Anti-ETRA transducible artificial transcription factors have desired activity in vitro in human aortic smooth muscle cells (haSMCs)
  • Treatment with anti-ETRA transducible artificial transcription factors for therapeutic purposes is expected to suppress the expression of the ETRA gene in smooth muscle cells.
  • primary human aortic smooth muscle cells were treated with octameric zinc finger protein containing ATF2468 or ATF2602 and ETRA mRNA levels were measured by quantitative RT-PCR in comparison to vehicle treated control cells.
  • treatment with ATF2468 or ATF2602 suppressed expression of ETRA by 58.1 % and 64 % compared to control cells. Subsequent to suppression of ETRA expression, lowered levels of ETRA protein and therefore diminished ETRA-dependent calcium signaling is expected.
  • An octameric zinc finger protein containing transducible artificial transcription factor has desired activity ex vivo in human tissue
  • ET-1 is the most potent vasoconstrictor known and acts through the endothelin receptor A (ETRA).
  • ETRA endothelin receptor A
  • Anti-ETRA transducible artificial transcription factors are expected to downregulate expression of ETRA protein on e.g. human smooth muscle cells, thus rendering these cells less responsive to ET-1 and, in turn, diminishing vessel contraction.
  • human vessels were isolated from placenta and treated with octameric zinc finger protein containing ATF2468 or inactive control protein for three days. Following treatment, vessel contraction in response to increasing ET-1 concentrations were measured using myography. As shown in Figure 17, treatment with ATF2468 diminished ET-1 -mediated vessel contraction compared to control vessels over a wide range of ET-1 concentrations.
  • anti-ETRA transducible artificial transcription factors display the desired pharmacological activity in isolated human tissue and are capable of suppressing ET-1 dependent contraction of human vessels.
  • An octameric zinc finger protein containing artificial transcription factor has desired activity in vivo in porcine retinal vessels
  • ATF2468 In order to determine the suitability of Sus scrofa as animal model for testing anti-ETRA transducible artificial transcription factors targeting the human ETRA the cross-species specificity of ATF2468 was determined. To this end, the Gaussia luciferase reporter was placed under the control of a hybrid promoter consisting of the CMV promoter and the homologous porcine target site of ATF2468. Cells were generated containing this reporter construct and a similar reporter construct containing the human instead of the porcine target site for ATF2468. Following treatment of these reporter cell lines with either ATF2468 or inactive control protein, luciferase activity was measured. As shown in Figure 18, ATF2468 possesses considerable cross-species specificity.
  • ATF2602 was applied to porcine eyes. To this end, ATF2602 or vehicle control were intravitreally injected and eyes were harvested three days post-injection. ATF2602 shares the zinc finger protein with ATF2468 and, thus, is expected to display similar cross-species specificity. To determine ATF2602 activity in target tissue in the eye, retinal vessels from ATF2602 and control eyes were isolated by laser capture microscopy and levels of ETRA mRNA in relation to GAPDH as internal control were determined by quantitative RT-PCR. As shown in Figure 19, treatment with ATF2602 resulted in the suppression of ETRA expression compared to controls of 78.3 +/- 14.1 %. Thus, ATF2602 is capable of downregulating ETRA expression following application in vivo. These data constitute in vivo proof-of-concept for anti-ETRA transducible artificial transcription factors in a relevant animal model.
  • the negative regulatory SID domain contained in a subset of the transducible artificial transcription factors of the invention is processed by cathepsins.
  • Edman sequencing of cathepsin D digestion products of ATF1688 revealed a cleavage site located inside the SID domain in front of the LEAAD peptide sequence (see Figure 20 for a schematic overview).
  • Mutational analyses of ATF1688 revealed that cathepsin D is binding across the interface between the prorenin-derived cathepsin cleavage site in ATF1688 and the SID domain. Interfering with the binding of cathepsin D did result in diminished processing at this cathepsin D cleavage site.
  • cathepsin D processing of SID-containing artificial transcription factors by cathepsin D likely interferes with their activity. While cathepsin D cleavage in fact aids endosomal disentanglement, truncation of the negative regulatory SID domain likely interferes with the transcription suppression of such artificial transcription factors.
  • the extended cathepsin recognition site encompassing the prorenin-derived cathepsin B cleavage site and the cathepsin D binding site (SEQ ID NO: 201 ) when incorporated into transducible artificial transcription factors leads to differential activity in cells expressing high levels of cathepsin D compared to cells expressing low levels of cathepsin D. Using mRNA-display to generate transducible artificial transcription factors with altered cathepsin sensitivity
  • Endosomal disentanglement is critical for successful delivery of transducible artificial transcription factors to their site of action.
  • TAT fusion proteins In order to reach the nuclear compartment, TAT fusion proteins have to traverse the endosomal compartment where they encounter various proteases from the class of the cathepsins.
  • the sequence specificity of some cathepsins together with cell type-specific differences in their expression and activity can be harnessed to influence TAT-mediated protein delivery and to achieve cell type-specific, productive delivery of cargo proteins such as transducible artificial transcription factors.
  • the sensitivity of the TAT fusion protein towards cathepsins needs to be controlled and manipulated.
  • cleavage and binding sites for certain cathepsins in various essential domains of the TAT fusion protein.
  • Important in this context is the distinction between a cathepsin binding site and its cleavage site. While studying the cleavage of transducible artificial transcription factors by cathepsin D, we made the observation that altering sequences in the proximity of the actual cleavage site had severe impact on the ability of cathepsin D to process such proteins. Thus, sequences adjacent to the cleavage site (e.g. 10 to 20 amino acids up- or downstream) greatly influence how certain cathepsins process their substrates.
  • cathepsin D recognizes a cleavage site inside the negative regulatory SID domain as determined by Edman sequencing of cleavage products.
  • the SID domain is cleaved by cathepsin D at cleavage site QML
  • the sequence QPMKRLTLGNDI SEQ ID NO: 341
  • upstream of the SID domain promotes digestion by cathepsin D, thus comprises a cathepsin D binding site.
  • the cathepsin D binding and cleavage site is comprised by amino acid sequence QPMKRLTLGNDIMAAAVRMNIQMLLEAAD (SEQ ID NO: 202) with the SID domain starting at position 13 and with changes to position 1 to 12, in particular with changes to position 6 to 12 impacting the binding of and alter cleavage sensitivity by cathepsin in particular by cathepsin D.
  • QPMKRLTLGNDIMAAAVRMNIQMLLEAAD SEQ ID NO: 202
  • ATF2869 DRHLIIS (SEQ ID NO: 203) 21 -
  • ATF2870 DLVTLLT (SEQ ID NO: 204) 71 n.d.
  • ATF2871 DEHLLVY (SEQ ID NO: 205) 1 1 +/-
  • ATF2872 DFYTHLA (SEQ ID NO: 206) 20 n.d.
  • ATF2873 PLTLPTI (SEQ ID NO: 207) 47 n.d.
  • ATF2874 PRLMFLC (SEQ ID NO: 208) 61 n.d.
  • ATF2876 TETLPHI (SEQ ID NO: 210) 80 n.d.
  • ATF2878 QRYLEIT (SEQ ID NO: 212) 39 n.d.
  • ATF2879 NLHTIHI (SEQ ID NO: 213) 45 n.d.
  • ATF2880 NLCSVTQ (SEQ ID NO: 214) 51 n.d.
  • ATF2881 LAKFDMI (SEQ ID NO: 215) 82 n.d.
  • ATF2883 DLTHISI (SEQ ID NO: 217) 45 n.d.
  • ATF2884 DFKSVQF (SEQ ID NO: 218) 78 n.d.
  • ATF2885 REYLIIS (SEQ ID NO: 219) 84 n.d.
  • ATF2886 RIDQLTL (SEQ ID NO: 220) 80 n.d.
  • ATF2888 YEKITVT (SEQ ID NO: 222) 57 n.d.
  • ATF2890 YFSIHGL (SEQ ID NO: 224) 32 -
  • ATF2891 ELNIDIL (SEQ ID NO: 225) 92 n.d.
  • ATF2892 PSLSFIV (SEQ ID NO: 226) 72 +/-
  • ATF2893 SLLITNL (SEQ ID NO: 227) 88 n.d.
  • ATF2894 EISTTLF (SEQ ID NO: 228) 75 n.d.
  • ATF2895 NMSTTNL (SEQ ID NO: 229) 56 n.d.
  • ATF2896 IKTDYSL (SEQ ID NO: 230) 60 n.d.
  • ATF2899 TTVNLTI (SEQ ID NO: 233) 39 n.d.
  • ATF2909 IVLNLSI (SEQ ID NO: 234) 57 n.d.
  • ATF2910 TSLLYTC (SEQ ID NO: 235) 53 n.d.
  • ATF291 1 PTISFAL (SEQ ID NO: 236) 80 n.d.
  • ATF2912 KESFTLI (SEQ ID NO: 237) 51 n.d.
  • ATF2913 KLDVNFF (SEQ ID NO: 238) 42 n.d.
  • ATF2914 TELSYTL (SEQ ID NO: 239) 75 n.d.
  • ATF2915 IERFQFA (SEQ ID NO: 240) 57 n.d.
  • ATF2916 INQMLSH (SEQ ID NO: 241 ) 33 n.d.
  • ATF2917 ELFILHA (SEQ ID NO: 242) 0 +
  • ATF2918 VYPILPI (SEQ ID NO: 243) 86 n.d.
  • ATF2919 RRELFLL (SEQ ID NO: 244) 86 n.d.
  • charged amino acids comprise arginine, lysine, aspartic acid, and glutamic acid; polar amino acids comprise glutamine, asparagine, histidine, serine, threonine, tyrosine, cysteine, methionine and tryptophan; nonpolar amino acids comprise alanine, isoleucine, leucine, phenylalanine, valine, proline, and glycine.
  • the artificial transcription factor of the present invention comprises an endosome-specific protease binding site which is located about 1 to about 50 amino acids, preferably about 5 to about 20 amino acids, more preferably about 5 to about 15 amino acids, upstream or downstream, preferably upstream of an endosome-specific protease cleavage site, wherein the amino acid sequence of the endosome-specific protease binding site is modified to alter the cleavage sensitivity of the endosome-specific protease cleavage site.
  • the amino acid sequence of the endosome-specific protease binding site is modified by insertion, deletion or substitution, preferably by insertion or substitution, more preferably by substitution.
  • the amino acid sequence of the endosome- specific protease binding site is modified by substitution of an amino acid sequence comprising the following order of amino acids from the amino to the carboxy end:
  • amino acid sequence of the endosome-specific protease binding site is replaced with an amino acid sequence comprising the following order of amino acids from the amino to the carboxy end:
  • transducible artificial transcription factors differing from
  • the pattern D/Q/T/Y, R/E/K, H/Y/V/K, L/R/l, L/E/V/T, l/V/F, S/YT/L also preferred is the pattern T/D/E/l/P/R, L/E/R, L/S/T/V/Y, L/l/T/S, L/T/F/l, L/T/l/H/F, L/l/F, and most preferred is the pattern T/D, L/E/R, L/S/T, L/l/T, L/T/F, L/T/l, L/l/F.
  • the artificial transcription factor comprises an endosome-specific protease binding site, wherein the amino acid sequence of the endosome-specific protease binding site is modified by substitution of at least two up to seven amino acids wherein the at least two up to seven amino acids are replaced with the following amino acids in the order from the amino to the carboxy end:
  • amino acid selected from the group consisting of D/E/I/K/LN/P/Q/R/S/T/V/Y;
  • amino acid selected from the group consisting of A/D/E/F/J/K/L/M/N/Q/R/S/T/V/Y;
  • amino acid selected from the group consisting of C/D/E/F/H/l/K/L/N/P/Q/R/S/T/V/Y amino acid selected from the group consisting of D/F/H/l/L/M/N/Q/R/S/T/V,
  • amino acid selected from the group consisting of D/E/F/H/l/L/N/M/P/Q/R/T/V/Y,
  • amino acid selected from the group consisting of A/F/G/H/l/L/M/N/P/Q/S/T/V/Y,
  • amino acid selected from the group consisting of A/C/F/H/l/L/Q/R/S/T/V/Y.
  • ATF2869 (SEQ ID NO: 245)
  • ATF2870 (SEQ ID NO: 246, ATF2871 (SEQ ID NO: 247)
  • ATF2872 (SEQ ID NO: 248), ATF2873 (SEQ ID NO: 249), ATF2874 (SEQ ID NO: 250),
  • ATF2875 (SEQ ID NO: 251 ), ATF2876 (SEQ ID NO: 252), ATF2877 (SEQ ID NO: 253),
  • ATF2878 (SEQ ID NO: 254), ATF2879 (SEQ ID NO: 255), ATF2880 (SEQ ID NO: 256),
  • ATF2881 (SEQ ID NO: 257), ATF2882 (SEQ ID NO: 258), ATF2883 (SEQ ID NO: 259),
  • ATF2884 (SEQ ID NO: 260), ATF2885 (SEQ ID NO: 261 ), ATF2886 (SEQ ID NO: 262),
  • ATF2887 (SEQ ID NO: 263), ATF2888 (SEQ ID NO: 264), ATF2889 (SEQ ID NO: 265),
  • ATF2890 (SEQ ID NO: 266), ATF2891 (SEQ ID NO: 267), ATF2892 (SEQ ID NO: 268),
  • ATF2893 (SEQ ID NO: 269), ATF2894 (SEQ ID NO: 270), ATF2895 (SEQ ID NO: 271 ),
  • ATF2896 (SEQ ID NO: 272)
  • ATF2897 (SEQ ID NO: 273)
  • ATF2898 (SEQ ID NO: 274)
  • ATF2899 (SEQ ID NO: 275), ATF2909 (SEQ ID NO: 276), ATF2910 (SEQ ID NO: 277),
  • ATF291 1 (SEQ ID NO: 278), ATF2912 (SEQ ID NO: 279), ATF2913 (SEQ ID NO: 280),
  • ATF2914 (SEQ ID NO: 281 ), ATF2915 (SEQ ID NO: 282), ATF2916 (SEQ ID NO: 283), ATF2917 (SEQ ID NO: 284), ATF2918 (SEQ ID NO: 285), and ATF2919 (SEQ ID NO: 286) with altered cathepsin sensitivity were created, which are preferred embodiments of the invention.
  • the artificial transcription factor comprises an endosome-specific protease binding site, wherein the amino acid sequence of the endosome-specific protease binding site comprises the amino acid sequence LTLGNDI (SEQ ID NO: 342) and wherein the endosome-specific protease binding site is modified by replacing the amino acid sequence LTLGNDI (SEQ ID NO: 342) with an amino acid sequence selected from the group consisting of an amino acid sequence selected from the group consisting of DRHLIIS (SEQ ID NO: 203), DLVTLLT(SEQ ID NO: 204), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), PLTLPTI (SEQ ID NO: 207), PRLMFLC (SEQ ID NO: 208), TAYLPHI (SEQ ID NO:
  • TETLPHI SEQ ID NO: 210
  • TDYLDPH SEQ ID NO: 21 1
  • QRYLEIT SEQ ID NO:
  • NLHTIHI SEQ ID NO: 213
  • NLCSVTQ SEQ ID NO: 214
  • LAKFDMI SEQ ID NO: 215
  • LYLTQFR SEQ ID NO: 216
  • DLTHISI SEQ ID NO: 217
  • DFKSVQF SEQ ID NO:
  • NLCSVTQ SEQ ID NO: 214
  • LAKFDMI SEQ ID NO: 215)
  • LYLTQFR SEQ ID NO: 216
  • DLTHISI SEQ ID NO: 217)
  • DFKSVQF SEQ ID NO: 218
  • REYLIIS SEQ ID NO: 219
  • RIDQLTL SEQ ID NO: 220
  • RQVTLAL SEQ ID NO: 221
  • YEKITVT SEQ ID NO: 222
  • YVTIRLF SEQ ID NO: 223
  • ELNIDIL SEQ ID NO: 225
  • PSLSFIV SEQ ID NO: 226)
  • SLLITNL SEQ ID NO: 227)
  • EISTTLF SEQ ID NO: 228)
  • NMSTTNL SEQ ID NO: 229
  • IKTDYSL SEQ ID NO: 230
  • TKVRVFL SEQ ID NO: 231
  • EYILNYY SEQ ID NO: 232
  • TTV TTV
  • TTVNLTI SEQ ID NO: 233
  • KLDVNFF SEQ ID NO: 2308
  • TDYLDPH SEQ ID NO: 21 1
  • NLHTIHI SEQ ID NO: 213
  • DLTHISI SEQ ID NO: 217
  • PLTLPTI SEQ ID NO: 207
  • ELFILHA SEQ ID NO: 242
  • DEHLLVY SEQ ID NO: 205
  • DFYTHLA SEQ ID NO: 206
  • TAYLPHI SEQ ID NO: 209
  • YVTIRLF SEQ ID NO: 223)
  • LYLTQFR ELFILHA
  • TKVRVFL SEQ ID NO: 231
  • INQMLSH SEQ ID NO: 241
  • TKVRVFL SEQ ID NO: 231
  • LYLTQFR SEQ ID NO: 216
  • ELFILHA SEQ ID NO: 242
  • DEHLLVY SEQ ID NO: 205
  • LYLTQFR SEQ ID NO: 216
  • ELFILHA SEQ ID NO: 242
  • DEHLLVY SEQ ID NO: 205
  • the artificial transcription factor comprises a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the artificial transcription factor comprises an amino acid sequence selected from the group consisting of DRHLIIS (SEQ ID NO: 203), DLVTLLT(SEQ ID NO:
  • DEHLLVY SEQ ID NO: 205
  • DFYTHLA SEQ ID NO: 206
  • PLTLPTI SEQ ID NO:
  • PRLMFLC SEQ ID NO: 208
  • TAYLPHI SEQ ID NO: 209
  • TETLPHI SEQ ID NO: 210
  • TDYLDPH SEQ ID NO: 21 1
  • QRYLEIT SEQ ID NO: 212
  • NLHTIHI SEQ ID NO:
  • NLCSVTQ SEQ ID NO: 214
  • LAKFDMI SEQ ID NO: 215)
  • LYLTQFR SEQ ID NO: 216
  • DLTHISI SEQ ID NO: 217)
  • DFKSVQF SEQ ID NO: 218
  • REYLIIS SEQ ID NO: 219
  • RIDQLTL SEQ ID NO: 220
  • RQVTLAL SEQ ID NO: 221
  • YEKITVT SEQ ID NO: 222
  • YVTIRLF SEQ ID NO: 223
  • YFSIHGL SEQ ID NO: 224
  • ELNIDIL SEQ ID NO: 225
  • PSLSFIV SEQ ID NO: 226)
  • SLLITNL SEQ ID NO: 227)
  • EISTTLF SEQ ID NO: 228)
  • NMSTTNL (SEQ ID NO: 229), IKTDYSL (SEQ ID NO: 230), TKVRVFL (SEQ ID NO: 231 ), EYILNYY (SEQ ID NO: 232), TTVNLTI (SEQ ID NO: 233), IVLNLSI (SEQ ID NO: 234), TSLLYTC (SEQ ID NO: 235), PTISFAL (SEQ ID NO: 236), KESFTLI (SEQ ID NO: 237), KLDVNFF (SEQ ID NO: 238), TELSYTL (SEQ ID NO: 239), IERFQFA (SEQ ID NO: 240), INQMLSH (SEQ ID NO: 241 ), ELFILHA (SEQ ID NO: 242), VYPILPI (SEQ ID NO: 243), and RRELFLL (SEQ ID NO: 244), usually DLVTLLT(SEQ ID NO: 204), DEHLLVY (SEQ ID NO: 204), DEHLLVY (SEQ ID NO
  • DFYTHLA SEQ ID NO: 206
  • PLTLPTI SEQ ID NO: 207
  • PRLMFLC SEQ ID NO:
  • TAYLPHI SEQ ID NO: 209
  • TETLPHI SEQ ID NO: 210
  • TDYLDPH SEQ ID NO: 21 1
  • QRYLEIT SEQ ID NO: 212
  • NLHTIHI SEQ ID NO: 213
  • NLCSVTQ SEQ ID NO: 214
  • LAKFDMI SEQ ID NO: 215
  • LYLTQFR SEQ ID NO: 216
  • DLTHISI SEQ ID NO: 217)
  • DFKSVQF SEQ ID NO: 218)
  • REYLIIS SEQ ID NO: 219
  • RIDQLTL SEQ ID NO: 220
  • RQVTLAL SEQ ID NO: 221
  • YEKITVT SEQ ID NO: 222
  • YVTIRLF SEQ ID NO: 223
  • ELNIDIL SEQ ID NO: 225
  • PSLSFIV SEQ ID NO: 226)
  • SLLITNL EISTTL
  • ELFILHA preferably ELFILHA (SEQ ID NO: 242), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), DRHLIIS (SEQ ID NO: 203), YVTIRLF (SEQ ID NO: 223), LYLTQFR (SEQ ID NO: 216), YFSIHGL (SEQ ID NO: 224), INQMLSH (SEQ ID NO: 241 ), QRYLEIT (SEQ ID NO: 212), TTVNLTI (SEQ ID NO: 233), KLDVNFF (SEQ ID NO: 238), TDYLDPH (SEQ ID NO: 21 1 ), NLHTIHI (SEQ ID NO: 213), DLTHISI (SEQ ID NO: 217), PLTLPTI (SEQ ID NO: 207), and more preferably ELFILHA (SEQ ID NO: 242), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO:
  • the artificial transcription factor comprises a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the artificial transcription factor is selected from the group consisting of ATF2869 (SEQ ID NO: 245), ATF2870 (SEQ ID NO: 246, ATF2871 (SEQ ID NO: 247), ATF2872 (SEQ ID NO: 248), ATF2873 (SEQ ID NO: 249), ATF2874 (SEQ ID NO: 250), ATF2875 (SEQ ID NO: 251 ), ATF2876 (SEQ ID NO: 252), ATF2877 (SEQ ID NO: 253), ATF2878 (SEQ ID NO: 254), ATF2879 (SEQ ID NO: 255), ATF2880 (SEQ ID NO: 256),
  • ATF2878 (SEQ ID NO: 254), (SEQ ID NO: 255), ATF2880 (SEQ ID NO: 256),
  • ATF2881 (SEQ ID NO: 257), (SEQ ID NO: 258), ATF2883 (SEQ ID NO: 259),
  • ATF2884 (SEQ ID NO: 260), (SEQ ID NO: 261 ), ATF2886 (SEQ ID NO: 262),
  • ATF2887 (SEQ ID NO: 263), (SEQ ID NO: 264), ATF2889 (SEQ ID NO: 265),
  • ATF2891 (SEQ ID NO: 267), (SEQ ID NO: 268), ATF2893 (SEQ ID NO: 269),
  • ATF2894 (SEQ ID NO: 270), (SEQ ID NO: 271 ), ATF2896 (SEQ ID NO: 272),
  • ATF2897 (SEQ ID NO: 273), (SEQ ID NO: 274), ATF2899 (SEQ ID NO: 275),
  • ATF2909 (SEQ ID NO: 276), (SEQ ID NO: 277), ATF291 1 (SEQ ID NO: 278),
  • ATF2912 (SEQ ID NO: 279), (SEQ ID NO: 280), ATF2914(SEQ D NO: 281 ),
  • ATF2915 (SEQ ID NO: 282), (SEQ ID NO: 283), ATF2917 (SEQ ID NO: 284),
  • ATF2918 (SEQ ID NO: 285), and ATF2919 (SEQ ID NO: 286),
  • cathepsin D is by no means exclusive for cathepsin D, but is applicable to all cathepsins for which cleavage sites are present or can be incorporated into or between essential protein sequences.
  • cathepsin processing inside the essential domain could be altered.
  • simple deletion of the cathepsin cleavage sites is not possible as alterations to an essential domain such as e.g. the SID sequence would likely be harmful to its function.
  • DNA libraries encoding the transducible artificial transcription factor are assembled to include a region of random sequences inside the cathepsin binding region adjacent to an essential domain containing a cathepsin cleavage site targeted for modulation.
  • Such random sequences are introduced during the DNA library construction via degenerated oligonucleotides e.g. containing 21 randomized nucleotides resulting in a DNA library of about 10 13 different DNA molecules.
  • This DNA library is used for mRNA-display (Lipovsek D., Pluckthun A., 2004, J Immunol Methods. 290(1 -2):51 -67;
  • the transcribed mRNA library is linked to a puromycin-containing oligonucleotide and in vitro translated into proteins linked via puromycin to the mRNA from which the individual protein molecule was translated by the ribosome.
  • the ribosome is able to use puromycin instead of a tRNA for transfer to the nascent protein chain.
  • the mRNA library contains such a puromycin moiety at its 3' end in effect the coding mRNA is transferred to the nascent protein linking phenotype with genotype.
  • the linkage between phenotype and genotype is essential for genetic screens and allows here for an in vitro evolution process.
  • the mRNA display ready mRNA-protein library is bound via an included affinity tag to a solid support and subjected to cathepsin digestion. Depending on the desired outcome, using the supernatant for a next round of in vitro selection will select for proteins sensitive to cathepsin digestion while using the support-bound fraction enriches for proteins resistant to cathepsin digestion.
  • proteins with desired cathepsin sensitivities can be generated. For example, digestion of support-bound mRNA-display library with cathepsin D followed by digestion with cathepsin B will yield in the supernatant cathepsin D-resistant, cathepsin B-sensitive artificial transcription factors. These proteins are advantageous for delivery into cell types with high cathepsin D expression compared to their cathepsin D- sensitive counterparts.
  • the described method is generally applicable for obtaining transducible artificial transcription factors of the invention and is by no means limited to only cathepsin B or D or to sequences encompassing parts of the SID domain.
  • the one single or two or more endosome-specific protease cleavage sites comprise the amino acid sequence SEQ ID NO: 26.
  • the one single or two or more endosome-specific protease cleavage sites comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46.
  • the artificial transcription factor comprises a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the polydactyl zinc finger protein is an octameric or higher order zinc finger protein.
  • the octameric or higher order zinc finger protein is selected from the group consisting of octameric, nonameric, decameric, undecameric and duodecameric zinc finger proteins, more preferably the polydactyl zinc finger protein is an octameric zinc finger protein.
  • the polydactyl zinc finger protein is an octameric zinc finger protein selected from the group consisting of SEQ ID NO: 345 and SEQ ID NO: 346.
  • each monomer of the zinc finger protein has an amino acid sequence different from the other monomers e.g. each monomer of the octameric or higher order zinc finger protein has an amino acid sequence different from the other monomers.
  • the artificial transcription factor further comprises a protein tag as described supra.
  • the artificial transcription factor further comprises a linker as described supra.
  • the inhibitory or activatory protein domain, the nuclear localization sequence, the protein transduction domain, and an endosome-specific protease cleavage site, the location of each domain inside the artificial transcription factor from the N- to the C-terminus, may be as described supra for an artificial transcription factor of the invention.
  • the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
  • the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is modified to alter, preferably to decrease cleavage sensitivity.
  • compositions wherein the artificial transcription factor does not contain any other protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
  • compositions comprising an artificial transcription factor as defined above.
  • Pharmaceutical compositions considered are compositions for parenteral systemic administration, in particular intravenous administration, compositions for inhalation, and compositions for local administration, in particular ophthalmic-topical administration, e.g. as eye drops, or intravitreal, subconjunctival, parabulbar or retrobulbar administration, to warm-blooded animals, especially humans.
  • Particularly preferred are eye drops and compositions for intravitreal, subconjunctival, parabulbar or retrobulbar administration.
  • the compositions comprise the active ingredient alone or, preferably, together with a pharmaceutically acceptable carrier. Further considered are slow-release formulations.
  • compositions useful for oral delivery in particular compositions comprising suitably encapsulated active ingredient, or otherwise protected against degradation in the gut.
  • pharmaceutical compositions may contain a membrane permeability enhancing agent, a protease enzyme inhibitor, and be enveloped by an enteric coating.
  • the pharmaceutical compositions comprise from approximately 1 % to approximately 95 % active ingredient.
  • Unit dose forms are, for example, ampoules, vials, inhalers, eye drops and the like.
  • the pharmaceutical compositions of the present invention are prepared in a manner known per se, for example by means of conventional mixing, dissolving or lyophilizing processes.
  • solutions of the active ingredient and also suspensions or dispersions, especially isotonic aqueous solutions, dispersions or suspensions which, for example in the case of lyophilized compositions comprising the active ingredient alone or together with a carrier, for example mannitol, can be made up before use.
  • a carrier for example mannitol
  • compositions may be sterilized and/or may comprise excipients, for example preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers and are prepared in a manner known per se, for example by means of conventional dissolving and lyophilizing processes.
  • excipients for example preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers.
  • the said solutions or suspensions may comprise viscosity-increasing agents, typically sodium
  • carboxymethylcellulose carboxymethylcellulose, carboxymethylcellulose, dextran, polyvinylpyrrolidone, or gelatins, or also solubilizers, e.g. Tween 80* (polyoxyethylene(20)sorbitan mono-oleate).
  • Suspensions in oil comprise as the oil component the vegetable, synthetic, or semi-synthetic oils customary for injection purposes.
  • liquid fatty acid esters that contain as the acid component a long-chained fatty acid having from 8 to 22, especially from 12 to 22, carbon atoms.
  • the alcohol component of these fatty acid esters has a maximum of 6 carbon atoms and is a monovalent or polyvalent, for example a mono-, di- or trivalent, alcohol, especially glycol and glycerol.
  • vegetable oils such as cottonseed oil, almond oil, olive oil, castor oil, sesame oil, soybean oil and groundnut oil are especially useful.
  • the manufacture of injectable preparations is usually carried out under sterile conditions, as is the filling, for example, into ampoules or vials, and the sealing of the containers.
  • aqueous solutions of the active ingredient in water-soluble form for example of a water-soluble salt, or aqueous injection suspensions that contain viscosity-increasing substances, for example sodium carboxymethylcellulose, sorbitol and/or dextran, and, if desired, stabilizers, are especially suitable.
  • the active ingredient optionally together with excipients, can also be in the form of a lyophilizate and can be made into a solution before parenteral administration by the addition of suitable solvents.
  • Compositions for inhalation can be administered in aerosol form, as sprays, mist or in form of drops.
  • Aerosols are prepared from solutions or suspensions that can be delivered with a metered-dose inhaler or nebulizer, i.e. a device that delivers a specific amount of medication to the airways or lungs using a suitable propellant, e.g. dichlorodifluoro-methane,
  • Eye drops are preferably isotonic aqueous solutions of the active ingredient comprising suitable agents to render the composition isotonic with lacrimal fluid (295-305 mOsm/l).
  • Agents considered are sodium chloride, citric acid, glycerol, sorbitol, mannitol, ethylene glycol, propylene glycol, dextrose, and the like.
  • the composition comprise buffering agents, for example phosphate buffer, phosphate-citrate buffer, or Tris buffer (tris(hydroxymethyl)-aminomethane) in order to maintain the pH between 5 and 8, preferably 7.0 to 7.4.
  • the compositions may further contain antimicrobial preservatives, for example parabens, quaternary ammonium salts, such as benzalkonium chloride, polyhexamethylene biguanidine (PHMB) and the like.
  • the eye drops may further contain xanthan gum to produce gel-like eye drops, and/or other viscosity enhancing agents, such as hyaluronic acid, methylcellulose, polyvinylalcohol, or polyvinylpyrrolidone.
  • xanthan gum to produce gel-like eye drops
  • other viscosity enhancing agents such as hyaluronic acid, methylcellulose, polyvinylalcohol, or polyvinylpyrrolidone.
  • the covalent attachment of a polyethylene glycol moiety (PEGylation) to an artificial transcription factor of the invention is considered to increase solubility of the artificial transcription factor, to decrease its renal clearance, and control its immunogenicity.
  • thiol reactive polyethylene glycols ranging in size from 1 to 40 Kilodalton.
  • site-specific PEGylation of the artificial transcription factors is achieved.
  • the only essential thiol group containing amino acids in the artificial transcription factors of the invention are the cysteine residues located in the zinc finger modules essential for zinc coordination. These thiol groups are not accessible for PEGylation due their zinc coordination, thus, inclusion of one or several cysteine residue into the artificial transcription factors of the invention provides free thiol groups for PEGylation using thiol-specific polyethylene glycol reagents.
  • the invention relates to an artificial transcription factors directed to the endothelin receptor A promoter as described above for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases.
  • the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor A promoter to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor A promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by endothelin.
  • Endothelin Diseases modulated by endothelin are, for example, cardiovascular diseases such as essential hypertension, pulmonary hypertension, chronic heart failure but also chronic renal failure.
  • cardiovascular diseases such as essential hypertension, pulmonary hypertension, chronic heart failure but also chronic renal failure.
  • renal protection before, during and after radioopaque material application is achieved by blunting the endothelin response.
  • multiple sclerosis is negatively impacted by the endothelin system.
  • diabetic kidney disease or eye diseases such as glaucomatous neurodegeneration, vascular dysregulation in ocular blood circulation, retinal vein occlusion, retinal artery occlusion, macular edema, age related macula degeneration, optic neuropathy, central serous chorioretinopathy, retinitis pigmentosa, Susac syndrome, and Leber's hereditary optic neuropathy.
  • the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • the invention relates to a method of treating glaucomatous neurodegeneration, vascular dysregulation in ocular blood circulation, in particular to a method of treating retinal vein occlusion, retinal artery occlusion, macular edema, optic neuropathy, central serous chorioretinopathy, retinitis pigmentosa, and Leber's hereditary optic neuropathy, comprising administering an effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration.
  • a monthly vitreous injection of 0.5 to 1 mg is preferred.
  • a monthly injection of 10 mg/kg is preferred.
  • implantation of slow release deposits into the vitreous of the eye is also preferred.
  • the invention relates to an artificial transcription factor directed to the endothelin receptor B promoter as described above for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor B levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases.
  • the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor B promoter to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor B promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by endothelin.
  • Diseases modulated by ET-1 -dependent, ETRB-mediated artificial transcription factors are certain cancers, neurodegeneration and inflammation-related disorders.
  • the invention relates to an artificial transcription factor directed to the TLR4 promoter as described above for use in influencing the cellular response to LPS, for lowering or increasing TLR4 levels, and for use in the treatment of diseases modulated by LPS, in particular for use in the treatment of such eye diseases.
  • the invention relates to a method of treating a disease modulated by LPS comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TLR4 promoter to a patient in need thereof.
  • an artificial transcription factor for use in the treatment of a disease modulated by LPS comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TLR4 promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by LPS.
  • Diseases modulated by LPS are rheumatoid arthritis, artherosclerosis, psoriasis, Crohn's disease, uveitis, contact lens associated keratitis, corneal inflammation, resistance of cancers to chemotherapy and the like.
  • the invention relates to an artificial transcription factor directed to the FcERIA promoter as described above for use in influencing the cellular response to IgE or IgE-antigen complexes, for lowering or increasing FcER1 levels, and for use in the treatment of diseases modulated by IgE or IgE-antigen complexes, in particular for use in the treatment of such eye diseases.
  • the invention relates to a method of treating a disease modulated by IgE or IgE- antigen complexes comprising administering a therapeutically effective amount of an artificial transcription factor directed to the FcERIA promoter to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by IgE or IgE-antigen complexes comprising administering a therapeutically effective amount of an artificial transcription factor directed to the FcERIA promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by IgE or IgE- antigen complexes.
  • IgE or IgE-antigen complexes are in general type I reactions according to the Coombs and Gell classification (Gell P. and Coombs R. (eds), 1968, Clinical Aspects fo Immunology, Blackwell Scientific, Oxford).
  • Such reactions include but are not limited to allergic rhinitis, asthma, atopic dermatitis, pollen allergy, food allergy, hay fever, respiratory allergy, pet allergy, dust allergy, dust mite allergy, allergic uriticaria, allergic alveolitis, allergic aspergillosis, allergic bronchitis, allergic blepharitis, allergic contact dermatitis, allergic conjunctivitis, allergic fungal sinusitis, allergic gastroenteritis, allergic interstitial nephritis, allergic keratitis, allergic laryngitis, allergic purpura, allergic urethritis, allergic vasculitis, eczema and .anaphylaxis and the like.
  • the invention relates to an artificial transcription factor assembled as to target the promoter region of a nuclear receptor as described above for use in influencing the cellular response to the nuclear receptor ligand, for lowering or increasing the levels of the nuclear receptor, and for use in the treatment of diseases modulated by such nuclear receptors.
  • the invention relates to a method of treating diseases modulated by a nuclear receptor ligand comprising administering a therapeutically effective amount of an artificial transcription factor directed to a nuclear receptor promoter to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by a nuclear receptor ligand comprising administering a therapeutically effective amount of an artificial transcription factor directed to a nuclear receptor promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by a nuclear receptor ligand.
  • Diseases modulated by ligands of nuclear receptors are, for example, adrenal insufficiency, adrenocortical insufficiency, alcoholism, Alzheimer's disease, androgen insensitivity syndrome, anorexia nervosa, aortic aneurysm, aortic valve sclerosis, arthritis, asthma, atherosclerosis, attention deficit hyperactivity disorder, autism, azoospermia, biliary primary cirrhosis, bipolar disorder, bladder cancer, bone cancer, breast cancer, cardiovascular disease, cardiovascular myocardial infarction, celiac disease, cholestasis, chronic kidney failure and metabolic syndrome, cirrhosis, cleft palate, colorectal cancer, congenital adrenal hypoplasia , coronary heart disease, cryptorchidism, deep vein thrombosis, dementia, depression, diabetic retinopathy, endometriosis, endometrial cancer, enhanced S-cone syndrome, essential hypertension, familial partial lipodyst
  • the invention relates to a method of treating a disease modulated by ligands of nuclear receptors comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • the invention relates to a method of treating adrenal insufficiency, adrenocortical insufficiency, alcoholism, Alzheimer's disease, androgen insensitivity syndrome, anorexia nervosa, aortic aneurysm, aortic valve sclerosis, arthritis, asthma, atherosclerosis, attention deficit hyperactivity disorder, autism, azoospermia, biliary primary cirrhosis, bipolar disorder, bladder cancer, bone cancer, breast cancer, cardiovascular disease, cardiovascular myocardial infarction, celiac disease, cholestasis, chronic kidney failure and metabolic syndrome, cirrhosis, cleft palate, colorectal cancer, congenital adrenal hypoplasia , coronary heart disease, cryptorchidism, deep vein
  • hypertriglyceridemia hypogonadotropic hypogonadism, hypospadias, infertility, inflammatory bowel disease, insulin resistance , ischemic heart disease, liver steatosis, lung cancer, lupus erythematosus, major depressive disorder, male breast cancer, metabolic plasma lipid levels, metabolic syndrome, migraine, mulitple sclerosis, myocardial infarct, nephrotic syndrome, non-Hodgkin's lymphoma, obesity, osteoarthritis, osteopenia, osteoporosis, ovarian cancer, Parkinson's disease, preeclampsia, progesterone resistance, prostate cancer,
  • pseudohypoaldosteronism psoriasis, psychiatric schizophrenia, psychosis, retinitis pigmentosa-37, schizophrenia, sclerosing cholangitis, sex reversal, skin cancer, spinal and bulbar atrophy of Kennedy, susceptibility to myocardial infarction, susceptibility to psoriasis, testicular cancer, type I diabetes, type II diabetes, uterine cancer and vertigo, comprising administering an effective amount of an artificial transcription factor of the invention to a patient in need thereof.
  • the effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration.
  • the invention relates to an artificial transcription factor directed to the glucocorticoid receptor as described above for use in influencing the cellular response to ligands of the glucocorticoid receptor, for lowering or increasing glucocorticoid receptor levels, and for the use in the treatment of diseases modulated by ligands of the glucocorticoid receptor.
  • the invention relates to a method of treating a disease modulated by ligands of the glucocorticoid receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the glucocorticoid receptor to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by ligands of the glucocorticoid receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by ligands of the glucocorticoid receptor.
  • glucocorticoid resistance glucocorticoid resistance
  • type II diabetes obesity, coronary atherosclerosis, coronary artery disease, asthma, celiac disease, lupus erythematosus, depression, stress and nephrotic syndrome.
  • the effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration.
  • a monthly vitreous injection of 0.5 to 1 mg is preferred.
  • a monthly injection of 10 mg/kg is preferred.
  • implantation of slow release deposits into the vitreous of the eye is also preferred.
  • the invention relates to an artificial transcription factor directed to the androgen receptor as described above for use in influencing the cellular response to ligands of the androgen receptor, for lowering or increasing androgen receptor levels, and for the use in the treatment of diseases modulated by ligands of the androgen receptor.
  • the invention relates to a method of treating a disease modulated by ligands of the androgen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the androgen receptor to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by ligands of the androgen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the androgen receptor to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by ligands of the androgen receptor.
  • the effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration.
  • a monthly vitreous injection of 0.5 to 1 mg is preferred.
  • a monthly injection of 10 mg/kg is preferred.
  • implantation of slow release deposits into the vitreous of the eye is also preferred.
  • the invention relates to an artificial transcription factor directed to the estrogen receptor as described above for use in influencing the cellular response to ligands of the estrogen receptor, for lowering or increasing estrogen receptor levels, and for the use in the treatment of diseases modulated by ligands of the estrogen receptor.
  • the invention relates to a method of treating a disease modulated by ligands of the estrogen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the estrogen receptor to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by ligands of the estrogen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the estrogen receptor to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by ligands of the estrogen receptor.
  • an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration.
  • a monthly vitreous injection of 0.5 to 1 mg is preferred.
  • a monthly injection of 10 mg/kg is preferred.
  • implantation of slow release deposits into the vitreous of the eye is also preferred.
  • the invention relates to an artificial transcription factor assembled as to target the promoter region of a haploinsufficient gene as described above for use in restoring gene production to physiological levels in order to alleviate pathological phenotypes caused by insufficient gene production expression.
  • the invention relates to a method of treating diseases caused or modulated by haploinsufficiency comprising administering a therapeutically effective amount of an artificial transcription factor directed to a
  • the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by
  • haploinsufficiency comprising administering a therapeutically effective amount of an artificial transcription factor directed to a haploinsufficient gene promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by haploinsufficiency.
  • Diseases considered in the present invention are Leri-Weill dyschondrosteosis,
  • Microphthalmia 3 Ehlers-Danlos syndrome Type III, aniridia, pseudohypoparathyroidism
  • Type la early infantile epileptic encephalopathy 4, skin fragility-woolly hair syndrome, Miller- Dieker Lissencephaly syndrome, Wolf-Hirschhorn syndrome, trichorhinophalangeal syndrome Type I, otodental dysplasia, otodental syndrome with coloboma, myotonic dystrophy 1 , Treacher-Collins syndrome 1 , familial acne inversa 1 , Ehlers-Danlos syndrome Type I, brachydactyly-mental retardation syndrome, velocardiofacial syndrome, Ulnar-Mammary syndrome, campomelic dysplasia, early infantile epileptic encephalopathy 5, Koolen-De Vries syndrome, holoprosencephaly 5, syndromic microphthalmia 6, Dravet syndrome, Glutl deficiency syndrome 1 , neurodegeneration with brain iron accumulation 3, autosomal recessive juvenile Parkinson disease 2, synpolydactyly 1 , supravalvular aor
  • lipodystrophy Type 4 mononeuropathy of the median nerve, Waardenburg syndrome Type 4c, Waardenburg syndrome Type 4b, atypical hemolytic uremic syndrome 5, autosomal dominant spastic paraplegia 42 , pseudohypoparathyroidism, autosomal dominant spastic paraplegia 31 , autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions 4, spinocerebellar ataxia 27, Charcot-Marie-Tooth Disease Type 2a2, autosomal dominant auditory neuropathy 1 , synpolydactyly 2, limb-girdle muscular dystrophy Type 1c, lissencephaly 1 , spinocerebellar ataxia 15, Ehlers-Danlos-Like syndrome, hereditary motor and sensory neuropathy Type lie, hairy elbows with short stature facial dysmorphism and developmental delay, Axenfeld-Rieger syndrome Type 3, familial infantile convulsions with paroxysmal choreoathetosis, acute myeloid leukemia,
  • the invention relates to artificial transcription factors directed to the OPA1 promoter as described above for use of increasing OPA1 production, and for use in the treatment of diseases influenced by OPA1 , in particular for use in the treatment of such eye diseases.
  • Diseases modulated by OPA1 are autosomal dominant optic atrophy, autosomal dominant optic atrophy plus as wells as normal tension glaucoma.
  • the invention relates to a method of treating a disease influenced by OPA1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the OPA1 promoter to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease influenced by OPA1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the OPA1 promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease influenced by OPA1.
  • the invention relates to a method of treating neurodegeneration associated with normal tension glaucoma or dominant optic atrophy.
  • an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration.
  • a monthly vitreous injection of 0.5 to 1 mg is preferred.
  • a monthly injection of 10 mg/kg is preferred.
  • implantation of slow release deposits into the vitreous of the eye is also preferred.
  • the invention relates to artificial transcription factors directed to the TGFbRI promoter as described above for use of increasing or decreasing TGFbRI production, and for use in the treatment of pathological processes influenced by TGFbRI , in particular of use in the treatment of such pathological processes in the eye.
  • Pathological processes modulated by TGFbRI are mal-adapted wound healing following eye surgery.
  • the invention relates to a method of treating a disease influenced by TGFBR1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TGFbRI promoter to a patient in need thereof.
  • the invention relates to an artificial transcription factor for use in the treatment of a disease influenced by TGFBR1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TGFbRI promoter to a patient in need thereof.
  • the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease influenced by TGFBR1.
  • the invention relates to a method of treating neurodegeneration associated with normal tension glaucoma or dominant optic atrophy.
  • the effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration.
  • a monthly vitreous injection of 0.5 to 1 mg is preferred.
  • a monthly injection of 10 mg/kg is preferred.
  • implantation of slow release deposits into the vitreous of the eye is also preferred.
  • the invention relates to the use of artificial transcription factors targeting plant promoters to improve gene product generation.
  • DNA encoding the artificial transcription factors is cloned into vectors for transformation of plant-colonizing
  • the artificial transcription factors are directly applied in suitable compositions for topical applications to plants.
  • the invention relates to the use of artificial transcription factors targeting non- human animal promoters, haploinsufficient, to enhance gene product generation.
  • the artificial transcription factors are directly applied in suitable compositions for topical applications to non-human animals in need thereof.
  • the invention relates to a method to produce a polydactyl zinc finger protein comprising an octameric or higher order zinc finger protein comprising
  • the first zinc finger protein library and the second zinc finger protein library comprises an expression vector present in the host organism of the protein library with 1 -2 copies and wherein the expression vector comprises a promoter operably linked to the octameric or higher order zinc finger protein which expresses the octameric or higher order zinc finger protein in Saccharomyces cerevisae with an expression rate of equal to or lower as achieved for an octameric or higher order zinc finger protein expressed by a promoter of SEQ ID NO: 197 in the same Saccharomyces cerevisae.
  • the first zinc finger protein library and the second zinc finger protein library comprises an expression vector present in the host organism of the protein library with 1-2 copies wherein the expression vector comprises the promoter of SEQ ID NO: 197 operably linked to the octameric or higher order zinc finger protein.
  • the host organism used in the method is selected from the group consisting of mammal, insect, fungi, yeast, and bacteria, and is preferably yeast.
  • the hexameric zinc finger protein is selected from the zinc finger protein library in i) by using a modified yeast one hybrid scheme where zinc finger proteins are expressed as fusions to the GAL4 activation domain in yeast leading to the expression of a Aureobasidin resistance.
  • Screening system for selecting a protein In particular the invention relates to a screening system for selecting a protein comprising i) a host organism which is capable to express the protein;
  • the expression vector comprises the promoter of SEQ ID NO: 197 operably linked to the protein.
  • the expression vector is an expression vector comprising an ARS/CEN origin of replication.
  • the invention further relates to an expression vector comprising an ARS/CEN origin of replication and a promoter operably linked to a protein wherein the promoter expresses the protein of interest in a host organism at an expression rate equal to or lower than the expression rate of the promoter of SEQ ID NO: 197 operably linked to the same protein in the same host organism.
  • the expression vector comprises the promoter of SEQ ID NO: 197 operably linked to the protein.
  • the expression rate of the promoter of SEQ ID NO: 197 operably linked to a protein e.g a zinc finger protein is defined herein as follows: Expression of the GAL4AD-ZFP protein of SEQ ID NO: 198 under control of such a promoter in yeast Y1 H Gold (Clontech) containing bait plasmid pAN2636 of (SEQ ID NO: 199) integrated into the URA3 marker results in the growth of such yeast cells only on selection plates containing less than 2500 ng/ml
  • the invention further relates to a method of constructing a specifically targeted therapeutic agent to be delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell comprising the steps of
  • step (d) comparing the relative amounts of endosome-specific proteases in steps (b) and (c) and selecting at least one endosome-specific protease having substantially higher relative concentrations in diseased cells than in healthy cells of the same cell type; (e) constructing the specifically targeted therapeutic agent by fusing the therapeutically active protein of step (a) to a transport protein comprising one or more copies of a protein transduction domain, and incorporating at least one endosome-specific protease cleavage site specific for the endosome-specific proteases selected in step (d) between the therapeutically active protein and the protein transduction domain.
  • the invention further relates to a method of specifically targeting a therapeutically active protein to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell of a subject comprising the steps of
  • step (d) comparing the relative amounts of endosome-specific proteases in steps (b) and (c) and selecting at least one endosome-specific protease having substantially higher relative concentrations in diseased cells than in healthy cells of the same cell type; (e) fusing the therapeutically active protein of step (a) to a transport protein comprising one or more copies of a protein transduction domain, and incorporating at least one endosome-specific protease cleavage site specific for the endosome-specific proteases selected in step (d) between the therapeutically active protein and the protein transduction domain;
  • step (f) administering the product of step(e) to a subject so that the therapeutically active protein of step (a) is delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of the diseased cell of the subject.
  • Method of treatment comprising administering to a subject in need thereof a therapeutically active protein
  • the invention further relates to a method of treatment comprising administering to a subject in need thereof a therapeutically active protein comprising the steps of
  • step (d) comparing the relative amounts of endosome-specific proteases in steps (b) and (c) and selecting at least one endosome-specific protease having substantially higher relative concentrations in diseased cells than in healthy cells of the same cell type;
  • step (e) fusing the therapeutically active protein of step (a) to a transport protein comprising one or more copies of a protein transduction domain, and incorporating at least one endosome-specific protease cleavage site specific for the endosome-specific proteases selected in step (d) between the therapeutically active protein and the protein transduction domain;
  • step (f) administering the product of step(e) to a subject so that the therapeutically active protein of step (a) is delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of the diseased cell of the subject.
  • a therapeutically active protein having beneficial properties to the desired cell refers to a protein which has enzymatic or structural properties that, when supplied externally to the subject improves cellular physiology and/or cures or prevents from pathological disorders.
  • the therapeutically active protein is N-terminally fused to the C-terminal of the transport protein.
  • the protein transduction domain is as described above and is preferably the HIV derived TAT peptide, most preferred is the HIV derived TAT peptide (SEQ ID NO: 1 ) .
  • the transport protein further comprises a peptide sequence directing subcellular localization.
  • a peptide sequence directing subcellular localization is defined as an amino acid sequence able to direct transport of proteins containing such a sequence to different intracellular organelles. Proteins lacking such a sequence will by default stay in the cytosol.
  • the peptide sequence directing subcellular localization is a nuclear localization sequence, in particular the SV40 nuclear localization sequence.
  • the therapeutically active protein is an antibody, in particular a full length antibody, preferably a human or humanized antibody binding to an intracellular protein, or an antibody derivative retaining the binding specificities of the antibody to the intracellular protein.
  • the therapeutically active protein is a single chain antibody, preferably a human or humanized single chain antibody binding to an intracellular protein.
  • the therapeutically active protein is a DARPin, preferably a DARPin binding to an intracellular protein.
  • the therapeutically active protein is a monobody, preferably a monobody binding to an intracellular protein.
  • the therapeutically active protein is a nanobody, preferably a nanobody binding to an intracellular protein.
  • the therapeutically active protein is an affibody, preferably an affibody binding to an intracellular protein.
  • the therapeutically active protein is an anticalin, preferably an anticalin binding to an intracellular protein.
  • the therapeutically active protein is an avimer, preferably an avimer binding to an intracellular protein.
  • the therapeutically active protein is an affilin, preferably an affilin binding to an intracellular protein.
  • the therapeutically active protein is a nanofitin, preferably a nanofitin binding to an intracellular protein.
  • the therapeutically active protein is a DNA-binding protein.
  • the therapeutically active protein is a RNA-binding protein.
  • the therapeutically active protein is an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, preferably wherein the gene promoter is a receptor gene promoter.
  • the gene promoter is a receptor gene promoter.
  • therapeutically active protein is a dominant-negative mutation of an intracellular protein.
  • therapeutically active protein is a protein with enzymatic activity.
  • the invention relates also to a therapeutic agent comprising a therapeutically active protein fused to a transport protein comprising one or more copies of a protein transduction domain, and comprising one single or two or more endosome-specific protease cleavage sites, preferably a therapeutic agent comprising a therapeutically active protein fused to a transport protein comprising one or more copies of a protein transduction domain, and comprising one single or two or more endosome-specific protease cleavage sites wherein the one single endosome-specific protease cleavage site is different from the amino acid sequence of SEQ ID NO: 26.
  • restriction endonucleases and T4 DNA ligase are purchased from New England Biolabs.
  • Shrimp Alkaline Phosphatase (SAP) is from Promega.
  • the high-fidelity Platinum Pfx DNA polymerase (Invitrogen) is applied in all standard PCR reactions.
  • DNA fragments and plasmids are isolated according to the manufacturer's instructions using NucleoSpin Gel and PCR Clean-up kit, NucleoSpin Plasmid kit, or NucleoBond Xtra Midi Plus kit (Macherey-Nagel).
  • Oligonucleotides are purchased from Sigma-Aldrich. All relevant DNA sequences of newly generated plasmids were verified by sequencing (Microsynth).
  • Hexameric zinc finger protein libraries containing GNN and/or CNN and/or ANN binding zinc finger (ZF) modules are cloned according to Gonzalez B. et al,. 2010, Nat Protoc 5, 791 -810 with the following improvements.
  • DNA sequences coding for GNN, CNN and ANN ZF modules were synthesized and inserted into pUC57 (GenScript) resulting in pAN1049 (SEQ ID NO: 107), pAN1073 (SEQ ID NO: 108) and pAN1670 (SEQ ID NO: 109), respectively.
  • Stepwise assembly of zinc finger protein (ZFP) libraries is done in pBluescript SK (+) vector.
  • pBluescript and its derived products containing 1ZFP, 2ZFPs, or 3ZFPs
  • pAN1049, pAN1073 or pAN1670 are first incubated with one restriction enzyme and afterwards treated with SAP. Enzymes are removed using NucleoSpin Gel and PCR Cleanup kit before the second restriction endonuclease is added.
  • Cloning of pBluescript-1ZFPL is done by treating 5 ⁇ g pBluescript with Xho ⁇ , SAP and subsequently Spel. Inserts are generated by incubating 10 ⁇ g pAN1049 (release of 16 different GNN ZF modules) or pAN1073 (release of 15 different CNN ZF modules) or pAN1670 (release of 15 different ANN ZF modules) with Spel, SAP and subsequently Xho ⁇ .
  • 7 ⁇ g pBluescript-1ZFPL or pBluescript-2ZFPL are cut with Age ⁇ , dephosphorylated, and cut with Spel.
  • Inserts are obtained by applying Spel, SAP, and subsequently Xma ⁇ to 10 ⁇ g pAN1049 or pAN1073 or pAN1670, respectively.
  • Cloning of pBluescript-6ZFPL was done by treating 14 ⁇ g of pBluescript-3ZFPL with Age ⁇ , SAP, and thereafter Spel to obtain cut vectors.
  • 3ZFPL inserts were released from 20 ug of pBluescript-3ZFPL by incubating with Spel, SAP, and subsequently Xma ⁇ .
  • Ligation reactions for libraries containing one, two, and three ZFPs were set up in a 3:1 molar ratio of insert:vector using 200 ng cut vector, 400 U T4 DNA ligase in 20 ⁇ total volume at RT (room temperature) overnight.
  • Ligation reactions of hexameric zinc finger protein libraries included 2000 ng pBluescript-3ZFPL, 500 ng 3ZFPL insert, 4000 U T4 DNA ligase in 200 ⁇ total volume, which were divided into ten times 20 ⁇ and incubated separately at RT over night. Portions of ligation reactions were transformed into Escherichia coli by several methods depending on the number of clones required for each library.
  • pBluescript- 1ZFPL and pBluescript-2ZFPL 3 ⁇ of ligation reaction were directly used for heat shock transformation of E. coli NEB 5-alpha.
  • Plasmid DNA of ligation reactions of pBluescript- 3ZFPL was purified using NucleoSpin Gel and PCR Clean-up kit and transformed into electrocompetent E. coli NEB 5-alpha (EasyjecT Plus electroporator from EquiBio or
  • Multiporator from Eppendorf, 2.5 kV and 25 ⁇ F, 2 mm electroporation cuvettes from Bio-Rad). Ligation reactions of pBluescript-6ZFP libraries were applied to NucleoSpin Gel and PCR Clean-up kit and DNA was eluted in 15 ⁇ I of deionized water. About 60 ng of desalted DNA were mixed with 50 ⁇ NEB 10-beta electrocompetent E. coli (New England Biolabs) and electroporation was performed as recommended by the manufacturer using EasyjecT Plus or Multiporator, 2.5 kV, 25 ⁇ F and 2 mm electroporation cuvettes. Multiple electroporations were performed for each library and cells were directly pooled afterwards to increase library size.
  • SOC medium was applied to the bacteria and after 1 h of incubation at 37°C and 250 rpm, 30 ⁇ of SOC culture were used for serial dilutions and plating on LB plates containing ampicillin. The next day, total number of obtained library clones was determined. In addition, ten clones of each library were chosen to isolate plasmid DNA and to check incorporation of inserts by restriction enzyme digestion. At least three of these plasmids were sequenced to verify diversity of the library. The remaining SOC culture was transferred to 100 ml LB medium containing ampicillin and cultured over night at 37°C and 250 rpm. Those cells were used to prepare plasmid Midi DNA for each library.
  • hexameric zinc finger protein libraries are transferred to a compatible prey vector.
  • the multiple cloning site of pGAD10 (Clontech) was modified by cutting the vector with Xho ⁇ /EcoR ⁇ and inserting annealed oligonucleotides OAN971 (TCGACAGGCCCAGGCGGCCCTCGAGGATATCATGATG
  • ACTAGTGGCCAGGCCGGCCC SEQ ID NO: 110
  • OAN972 AATTGGGCCGGC CTGGCCACTAGTCATCATGATATCCTCGAGGGCCGCCTGGGCCTG, SEQ ID NO: 11 1 .
  • the resulting vector pAN1025 SEQ ID NO: 1 12 was cut and dephosphorylated, 6ZFP library inserts were released from pBluescript-6ZFPL by Xho ⁇ /Spe ⁇ . Ligation reactions and electroporations into NEB 10-beta electrocompetent E. coli were done as described above for pBluescript-6ZFP libraries.
  • hexameric zinc finger libraries are also transferred into an improved prey vector pAN1375 (SEQ ID NO: 1 13).
  • This prey vector was constructed as follows: pRS315 (SEQ ID NO: 114) was cut / ⁇ pal/A/arl and annealed OAN1 143
  • hexameric zinc finger libraries are also transferred into an improved prey vector pAN1920 (SEQ ID NO: 1 18).
  • hexameric zinc finger libraries are inserted into prey vector pAN 1992 (SEQ ID NO: 119).
  • a 60 bp sequence containing a potential artificial transcription factor target site of 18 bp in the center is selected and a Nco ⁇ site is included for restriction analysis.
  • Oligonucleotides are designed and annealed in such a way to produce 5' Hind ⁇ and 3' Xho ⁇ sites which allowed direct ligation into pAbAi (Clontech) cut with Hind ⁇ /Xho ⁇ . Digestion of the product with Nco ⁇ and sequencing are used to confirm assembly of the bait plasmid.
  • Saccharomyces cerevisiae Y1 H Gold was purchased from Clontech, YPD medium and YPD agar from Carl Roth.
  • Synthetic drop-out (SD) medium contained 20 g/l glucose
  • each bait plasmid is linearized with BstB ⁇ in a total volume of 20 ⁇ and half of the reaction mix is directly used for heat shock transformation of S. cerevisiae Y1 H Gold.
  • Yeast cells are used to inoculate 5 ml YPD medium the day before transformation and grown over night on a roller at RT.
  • One milliliter of this pre-culture is diluted 1 :20 with fresh YPD medium and incubated at 30°C, 225 rpm for 2-3 h.
  • OD 6 oo cells are harvested by centrifugation, yeast cells are washed once with 1 ml sterile water and once with 1 ml TE/LiAc (10 mM Tris/HCI, pH 7.5, 1 mM EDTA, 100 mM lithium acetate).
  • yeast cells are resuspended in 50 ⁇ TE/LiAc and mixed with 50 ⁇ g single stranded DNA from salmon testes (Sigma-Aldrich), 10 ⁇ of BsfBI-linearized bait plasmid (see above), and 300 ⁇ PEG/TE/LiAc (10 mM Tris/HCI, pH 7.5, 1 mM EDTA, 100 mM lithium acetate, 50 % (w/v) PEG 3350). Cells and DNA are incubated on a roller for 20 min at RT, afterwards placed into a 42°C water bath for 15 min.
  • SD-U 200 ng/ml AbA 200 ng/ml AbA. After incubation for 3 days at 30°C, three clones growing well on SD-U and being most sensitive to AbA are chosen for further analysis. Stable integration of bait plasmid into yeast genome is verified by Matchmaker Insert Check PCR Mix 1 (Clontech) according to the manufacturer's instructions. One of three clones is used for subsequent Y1 H screen.
  • electroporation reactions (EasyjecT Plus electroporator or Multiporator, 2.5 kV and 25 ⁇ F) are performed until all yeast cell suspension has been transformed. After electroporation yeast cells are transferred to 100 ml of 1 :1 mix of YPD:1 M Sorbitol and incubated at 30°C and 225 rpm for 60 min. Cells are collected by centrifugation and resuspended in 1 -2 ml of SD-L medium. Aliquots of 200 ⁇ are spread on 15 cm SD-L agar plates containing 1000-4000 ng/ml AbA.
  • Verification of positive interactions and recovery of polydactyl zinc finger protein-encoding prey plasmids For initial analysis, forty good-sized colonies are picked from SD-L plates containing the highest AbA concentration and yeast cells were restreaked twice on SD-L with 1000- 4000 ng/ml AbA to obtain single colonies. For each clone, one colony is used to inoculate 5 ml SD-L medium and cells are grown at RT overnight.
  • 250 ⁇ A1 buffer from NucleoSpin Plasmid kit and one spatula tip of glass beads (Sigma- Aldrich, G8772) are added and tubes are mixed vigorously by vortexing for 1 min. Plasmid isolation is further improved by adding 250 ⁇ A2 buffer from NucleoSpin Plasmid kit and incubating for at least 15 min at RT before continuing with the standard NucleoSpin Plasmid kit protocol. After elution with 30 ⁇ of elution buffer 5 ⁇ of plasmid DNA are transformed into E. coli DH5 alpha by heat shock transformation. Two individual colonies are picked from ampicillin-containing LB plates, plasmids are isolated and library inserts are sequenced.
  • GeneCopeia or pAN1486 (EF1 a-PG04, GeneCopeia) resulting in reporter plasmids containing secreted Gaussia luciferase under the control of a haploinsufficient gene promoter and secreted embryonic alkaline phosphatase under the control of the constitutive CMV promoter allowing for normalization of luciferase to alkaline phosphatase signal.
  • reporter construct containing Gaussia luciferase under the control of a hybrid CMV/artificial transcription factor target site promoter together with secreted alkaline phosphatase under control of the constitutive CMV promoter
  • 42 bp containing the artificial transcription factor binding site were cloned Afl ⁇ ISpe ⁇ into pAN1660 (SEQ ID NO: 120).
  • These reporter constructs contain a Flpln site for stable integration into Flpln site containing cells such as HEK293 Flpln TRex (Invitrogen) cells.
  • Gensynthesis (GenScript) or selected by yeast one hybrid are cloned using standard procedures (Age ⁇ /Xho ⁇ ) into mammalian expression vectors for expression in mammalian cells as fusion proteins between the zinc finger array of interest, a SV40 NLS, a 3x myc epitope tag and a N-terminal KRAB domain (pAN1255 - SEQ ID NO: 121 ), a C-terminal KRAB domain (pAN1258 - SEQ ID NO: 122), a SID domain (pAN1257 - SEQ ID NO: 123) or a VP64 activating domain (pAN1510 - SEQ ID NO: 124).
  • Plasmids for the generation of stably transfected, tetracycline-inducible cells were generated as follows: DNA fragments encoding artificial transcriptions factors comprising polydactyl zinc finger domain, a regulatory domain (N-terminal KRAB, C-terminal KRAB, SID or VP64), SV40 NLS and a 3x myc epitope tag are cloned into pcDNA5/FRT/TO (Invitrogen) using
  • Plasmids for the generation of stably transfected, tetracycline-inducible cells were generated as follows: DNA fragments encoding artificial transcriptions factors comprising polydactyl zinc finger domain, a regulatory domain (N-terminal KRAB, C-terminal KRAB, SID or VP64), and a SV40 NLS are cloned into pAN2071 (SEQ ID NO: 125) EcoRV/Age ⁇ . These artificial transcription factor expression plasmids can be integrated into the human genome into the AAVS1 locus by co-transfection with AAVS1 Left TALEN and AAVS1 Right TALEN
  • HeLa cells are grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 4.5 g/l glucose, 10 % heat-inactivated fetal bovine serum, 2 mM L-glutamine, and
  • DMEM Dulbecco's Modified Eagle's Medium
  • Stable, tetracycline inducible Flp-ln Tm T-RexTM 293 expression cell lines are generated by Flp Recombinase-mediated integration.
  • Flp-ln Tm T-RexTM Core Kit the Flp-ln Tm T-RexTM host cell line is generated by transfecting pFRT/lacZeo target site vector and pcDNA6/TR vector.
  • the pcDNA5/FRT/TO expression vector containing the gene of interest is integrated via Flp recombinase-mediated DNA recombination at the FRT site in the Flp-ln Tm T-RexTM host cell line.
  • Stable Flp-ln Tm T-RexTM expression cell lines are maintained in selection medium containing (DMEM; 10 % Tet-FBS; 2 mM glutamine; 15 ⁇ g/ml blasticidine and 100 ⁇ g/ml hygromycin).
  • selection medium containing (DMEM; 10 % Tet-FBS; 2 mM glutamine; 15 ⁇ g/ml blasticidine and 100 ⁇ g/ml hygromycin).
  • DMEM 10 % Tet-FBS
  • 2 mM glutamine 15 ⁇ g/ml blasticidine
  • 100 ⁇ g/ml hygromycin 100 ⁇ g/ml hygromycin
  • cells are co-transfected with a pAN2071 -based expression construct containing the artificial transcription factor of interest and AAVS1 Left TALEN and AAVS1 Right TALEN (GeneCopoeia) plasmids using Effectene (Qiagen) transfection reagent) according to the manufacturer's recommendations. 8 hours post-transfection, growth medium was aspirated, cells were washed with PBS and fresh growth medium was added. 24h post transfection cells were split at a ratio of 1 :10 in growth medium containing Tet- approved FBS (tetracycline free FBS, Takara) without antibiotics.
  • Tet- approved FBS tetracycline free FBS, Takara
  • Stable HEK293 Flpln cells were prepared containing Gaussia luciferase under control of a hybrid CMV promoter containing the target site appropriate for the respective artificial transcription factor as well as SEAP under control of the constitutive CMV promoter.
  • HEK293 Flpln cells were transfected with pAN1660 or pAN1705 (SEQ ID NO: 126) to generate cell lines for testing artificial transcription factors targeting the ETRA or the FcERIA promoter, respectively.
  • Luciferase values were normalized to SEAP activity and compared to control cells set to 100 %.
  • RNA is isolated from cells using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Frozen cell pellets are resuspended in RLT Plus Lysis buffer containing 10 ⁇ / ml ⁇ -mercaptoethanol. After homogenization using
  • cDNA synthesis is carried out in 20 ⁇ of total reaction volume containing 2 ⁇ 10x Buffer, 0.8 ⁇ 25x dNTP Mix, 2 ⁇ 10x RT Random Primers, 1 ⁇ Multiscribe Reverse Transcriptase and 4.2 ⁇ H 2 0. A final volume of 10 ⁇ RNA is added and the reaction is performed under the following conditions: 10 minutes at 25°C, followed by 2 hours at 37°C and a final step of 5 minutes at 85°C.
  • Quantitative PCR is carried out in 20 ⁇ of total reaction volume containing 1 ⁇ 20x TaqMan Gene Expression Master Mix, 10.0 ⁇ TaqMan ® Universal PCR Master Mix (both Applied Biosystems,
  • Table 9 Sequences of oligonucleotides used to determine the expression levels of cathepsins B, D, F, G, H, K, L, and S in comparison to the house-keeping gene
  • GPDH glyceraldehyde 3-phosphate dehydrogenase
  • 2 ⁇ g purified artificial transcription factor protein were digested for 2 h at 37°C with 3.0 or 0.3 mU cathepsin B (Enzo Life Science; BML-SE198), 30 or 3 mU cathepsin D (Enzo Life Science; BML-SE199), 0.0003 or 0.00003 mU cathepsin K (Enzo Life Science; BML-SE 553), 0.003 or 0.0003 mU cathepsin L (Enzo Life Science; BML-SE201 ) and 0.3 or
  • cathepsin S 0.03 mU cathepsin S (Enzo Life Science; BML-SE453), respectively.
  • the digestions were performed in 100 mM sodium acetate (Merck; 1.01539.0500), 2 mM DTT (Roth; 6908.3), pH 5.5 for cathepsins B, D, K and L or in 100 mM Bis-Tris (Roth; 9140.2), 2 mM DTT, pH 6.5 for cathepsin S.
  • Hela cells were grown to 80 % confluence in a 10 cm dish and transduced with 10 ml of 1 ⁇ purified artificial transcription factor protein in OptiMEM (Gibco; 1 1058-021 ) for 2 h at 37°C and 5 % C0 2 . After transduction, cells were trypsinized, washed with PBS and lysed in 100 ⁇ RIPA buffer (Pierce; 89901 ). The lysate was centrifuged at 14'000xg for 5 min and supernatant was isolated. Protein concentration was determined by BCA assay (Pierce; 23225). Treatment of cells with the fusogenic peptide TATHA2
  • Cells were co-treated with 1 ⁇ purified artificial transcription factor protein in OptiMEM together with 5 ⁇ TATHA2 peptide for 2 hours at 37°C and 5 % C0 2 .
  • DNA fragments encoding artificial transcription factors are cloned using standard procedures EcoRV/Not ⁇ into bacterial expression vector pAN983 (SEQ ID NO: 145) based on pET41 a+ (Novagen) for expression in E. coli as His 6 -tagged fusion proteins between the artificial transcription factor and the TAT protein transduction domain.
  • pAN983 SEQ ID NO: 145
  • pET41 a+ Novagen
  • DNA fragments encoding artificial transcription factors are cloned using standard procedures (EcoRV/Not ⁇ ) into bacterial expression vector pAN1688 (SEQ ID NO: 146).
  • Expression constructs for the bacterial production of transducible artificial transcription factors in suitable E. coli host cells such as BL21 (DE3) are pAN1488 (SEQ ID NO: 147), pAN1572 (SEQ ID NO: 148), pAN1688, pAN1880 (SEQ ID NO: 149), pAN2381 (SEQ ID NO: 150), pAN2383 (SEQ ID NO: 151 ) , pAN2385 (SEQ ID NO: 152) , pAN2387 (SEQ ID NO: 153) pAN2389 (SEQ ID NO: 154) , pAN2403 (SEQ ID NO: 155) , pAN2404 (SEQ ID NO: 156) pAN2405 (SEQ ID NO: 157) , pAN2406 (SEQ ID NO: 158) , pAN2407 (SEQ ID NO: 159) pAN2443 (SEQ ID NO: 160) , pAN2444 (SEQ ID NO: 161 )
  • Expression constructs for the bacterial production of inactive transducible artificial transcription factors for control purposes are, pAN1714 (SEQ ID NO: 190), pAN1806 (SEQ ID NO: 191 ), and pAN1881 (SEQ ID NO: 192).
  • the naming scheme is as follows: artificial transcription factor proteins are named ATF followed by a number e.g. ATF1688; plasmid coding for artificial transcription factors are named pAN followed by a number, e.g pAN1688 encodes for ATF1688.
  • E. coli BL21 (DE3) transformed with expression plasmid for a given artificial transcription factor were grown in 1 I LB media supplemented with 100 ⁇ ZnCI 2 until OD 600 between 0.8 and 1 was reached, and induced with 1 mM IPTG for two hours.
  • Bacteria were harvested by centrifugation, bacterial lysate was prepared by sonication, and inclusion bodies were purified. To this end, inclusion bodies were collected by centrifugation (5000g, 4°C, 15 minutes) and washed three times in 20 ml of binding buffer (50 mM HEPES, 500 mM NaCI, 10 mM imidazole; pH 7.5).
  • Purified inclusion bodies were solubilized on ice for one hour in 30 ml of binding buffer A (50 mM HEPES, 500 mM NaCI, 10 mM imidazole, 6 M GuHCI; pH 7.5). Solubilized inclusion bodies were centrifuged for 40 minutes at 4°C and 13 ⁇ 00 g and filtered through 0.45 ⁇ PVDF filter. His-tagged artificial transcription factors were purified using His- Trap columns on an Aktaprime FPLC (GEHealthcare) using binding buffer A and elution buffer B (50 mM HEPES, 500 mM NaCI, 500 mM imidazole, 6 M GuHCI; pH 7.5).
  • binding buffer A 50 mM HEPES, 500 mM NaCI, 10 mM imidazole, 6 M GuHCI; pH 7.5.
  • Fractions containing purified artificial transcription factor were pooled and dialyzed at 4°C overnight against buffer S (50 mM Tris-HCI, 500 mM NaCI, 200 mM arginine, 100 ⁇ ZnCI 2 , 5 mM GSH, 0.5 mM GSSG, 50 % glycerol; pH 7.5) in case the artificial transcription factor contained a SID domain, or against buffer K (50 mM Tris-HCI, 300 mM NaCI, 500 mM arginine, 100 ⁇ ZnCI 2 , 5 mM GSH, 0.5 mM GSSG, 50 % glycerol; pH 8.5) for KRAB domain containing artificial transcription factors.
  • buffer S 50 mM Tris-HCI, 500 mM NaCI, 200 mM arginine, 100 ⁇ ZnCI 2 , 5 mM GSH, 0.5 mM GSSG, 50 % glycerol; pH 8.5
  • protein samples were centrifuged at 14 ⁇ 00 rpm for 30 minutes at 4°C and sterile filtered using 0.22 ⁇ Millex-GV filter tips (Millipore).
  • the protein was produced from the soluble fraction (binding buffer: 50 mM NaP0 4 pH 7.5, 500 mM NaCI, 10 mM imidazole; elution buffer 50 mM HEPES pH 7.5, 500 mM NaCI, 500 mM imidazole) using His-Bond Ni-NTA resin (Novagen) according to manufactures recommendation.
  • Protein was dialyzed against VP64-buffer (550 mM NaCI pH 7.4, 400 mM arginine, 100 ⁇ ZnCI 2 ). Protein concentration was determined by measuring OD 28 o.
  • 1x 10 ⁇ 12 to 5x 10 ⁇ 7 M of annealed, biotinylated oligos containing 60 bp promoter sequence are incubated in binding buffer (10 mM Tris/HCI pH 7.5, 60 mM KCI, 1 mM DTT, 2 % glycerol, 5 mM MgCI 2 and 100 ⁇ ZnCI 2 ) in the presence of unspecific competitor (0.1 mg/ml ssDNA from salmon sperm, Sigma) with the bound artificial transcription factor for 1 h at RT. After washing (5 times), wells are blocked with 3 % BSA for 30 minutes at RT. Anti-streptavidin-HRP is added in binding buffer for 1 h at RT.
  • binding buffer 10 mM Tris/HCI pH 7.5, 60 mM KCI, 1 mM DTT, 2 % glycerol, 5 mM MgCI 2 and 100 ⁇ ZnCI 2
  • unspecific competitor 0.1 mg/ml s
  • TMB substrate Sigma
  • TMB stop solution Sigma
  • Cells grown to about 80 % confluency are treated with 0.01 to 1 ⁇ artificial transcription factor or mock treated for 2 h to 120 h with optional addition of artificial transcription factor every 24 h in OptiMEM or growth media at 37°C.
  • OptiMEM growth media
  • cells are washed once in PBS, trypsinized and seeded onto glass cover slips for further examination.
  • Cells are fixed with 4 % paraformaldehyde in PBS, treated with 0.15 % Triton X-100 for 15 minutes, blocked with 10 % BSA/PBS and incubated overnight with mouse anti-HA antibody (1 :500, H9658, Sigma) or mouse anti-myc (1 :500, M5546, Sigma). Samples are washed three times with PBS/1 % BSA, and incubated with goat anti-mouse antibodies coupled to Alexa Fluor 546 (1 : 1000, Invitrogen) and counterstained using DAPI (1 : 1000 of 1 mg/ml for 3 minutes, Sigma). Samples are analyzed using fluorescence microscopy.
  • Parafin-embedded tissue slides were stained using standard immunohistochemical procedures using antibodies against cathepsin B (abeam, ab58802), cathepsin D (abeam, ab75852), cathepsin E (abeam, ab36996), cathepsin F (proteintech, 1 1055-1 -AP), cathepsin G (abeam, ab50845), cathepsin K (origene, TA318065), cathepsin L (abeam, ab6314), cathepsin H (abeam, ab115229), and cathepsin S (abeam, ab135651 ).
  • proteins are mixed with Laemmli sample buffer and heated. Proteins are separated by SDS-PAGE according to their size and transferred using electroblotting to nitrocellulose membranes. Detection of proteins is performed using specific primary antibodies raised in mice or rabbits. Detection of primary antibodies is performed either by secondary antibodies coupled to horseradish peroxidase and luminescence-based detection (ECL plus, Pierce) or secondary antibodies coupled to Dyl_ight700 or Dyl_ight800 fluorescent detected and quantified using an infrared laser scanner.
  • Human placental vessels were dissected from placenta obtained from the local labor ward immediately after elective cesarean.
  • the dissected vessels are cut into ring segments of approximately 2 mm length and are cultured in RPMI medium supplemented with penicillin (1000 lU/ml), streptomycin (100 ⁇ g/ml), amphotericin (0.25 ⁇ g/ml) and either control or 1 uM transducible artificial transcription factors.
  • Vessels will be cultured in an incubator at 37 °C in a humidified atmosphere of 5 % C02 in air. The media is replaced daily with fresh media containing either 1 uM transducible artificial transcription facor or corresponding control.
  • Vessel rings are then attached by 40 ⁇ diameter wire running through the lumen of the vessel to stainless steel heads in pre-heated 5 ml myograph baths containing physiological saline solution (PSS with the following composition: 119.0 mM NaCI, 4.7 mM KCI, 1.2 mM MgS04, 24.9 mM NaHC03, 1.2 mM KH2P04, 2.5 mM CaCI2 and 11.1 mM glucose), aerated with 95 % 02 and 5 % C02 and maintained at a temperature of 37 °C. Changes in tension are recorded using a Multi Wire Myograph System-610M (Danish Myo Technology Aarhus, Denmark). The segments are allowed to equilibrate for at least 30 minutes.
  • PSS physiological saline solution
  • vessel segments are exposed to high potassium PSS (KPSS; 62.5 mM) three times in order to measure their contractile responses with washes in between. Then, vessel segments are rinsed with PSS and allowed to return to baseline, before exposure to the contractile mediator U46619 (100 nM) and following plateau of the response, endothelium- dependent relaxation is assessed by adding the known endothelium-dependent dilator bradykinin (BK; 10 ⁇ ). Vessels are then rinsed and allowed to return to baseline over at least 1 hour.
  • KPSS high potassium PSS
  • BK bradykinin
  • mRNA display Following return to baseline, vessel segments are then exposed to the vasoconstrictor peptide Endothelin-1 (ET-1 ) and a cumulative concentration response curve (CCRC) is conducted in half-log steps from 0.1 nM to 100 nM. Without washing, the vessels are then exposed again to the known endothelium-dependent dilator BK (10 ⁇ ). Vessel segments which do not respond to KPSS, U46619 or BK are deemed to be non-functional. mRNA display
  • a DNA library was assembled using OAN1953 (SEQ ID NO: 334), OAN1954 (SEQ ID NO: 335), OAN1955 (SEQ ID NO: 336), OAN1956 (SEQ ID NO: 337), OAN1957 (SEQ ID NO: 338), and OAN1981 (SEQ ID NO: 339) using Phusion polymerase (NEB).
  • This DNA library was in vitro transcribed into mRNA using HiScribe T7 Quick High Yield RNA synthesis Kit (NEB). Afterwards, the mRNA library was treated with DNAse I (NEB) to remove input DNA.
  • RNA was purified using NucleoSpin RNA Clean-up (Macherey-Nagel) and linked to OAN1979 (SEQ ID NO: 340) (5'-Psora-(lMGCGG ⁇ l/GC)-(dA)13-Spacer18-dCdC-Puro-3' (italic sequence represents 2'-OMe-RNA)) modified at its 5' end with psoralen and its 3' end with puromycin (Microsynth) using irradiation with 365 nm light.
  • Cross-linked mRNA library was purified using Amicon Ultra-0.5 centrifugal filter devices.
  • Purified puromycin-modified mRNA library was in vitro translated using PURExpress in vitro protein synthesis kit (NEB) and bound to either magnetic anti-FLAG beads (Sigma-Aldrich) or magnetic HIS-Select beads (Sigma-Aldrich). Bound library was sequentially digested using cathepsin D (Enzo Life Sciences) and cathepsin B (Enzo Life Sciences). Following digestion, mRNA in supernatant after sequential digest was reverse transcribed into cDNA using ProtoScript II reverse transcriptase (NEB) and used again for mRNA display procedure.
  • PURExpress in vitro protein synthesis kit NEB
  • Bound library was sequentially digested using cathepsin D (Enzo Life Sciences) and cathepsin B (Enzo Life Sciences). Following digestion, mRNA in supernatant after sequential digest was reverse transcribed into cDNA using ProtoScript II reverse transcriptase (NEB) and used again for mRNA display procedure.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Transport of artificial transcription factors into the cell via protein transduction domains holds great promise for the development of novel therapeutics. However, conventional protein transduction suffers from poor endosomal escape and subsequent lysosomal degradation of artificial transcription factor proteins. This is in a large part due to endosomal entanglement, where the membrane-binding protein transduction domain tethers the artificial transcription factor to the endosomal membrane thus interfering with further transport to other subcellular localizations. The invention relates endosomal disentanglement followed by enhanced endosomal escape by surmounting endosomal entrapment through incorporation of specific endosomal protease cleavage sites into the artificial transcription factor proteins.

Description

Endosomal disentanglement of artificial transcription factors
Field of the invention The invention relates to artificial transcription factor proteins engineered for efficient transport to the nuclear compartment of cells through enhanced endosomal disentanglement by incorporation of specific endosomal protease cleavage sites into the artificial transcription factor proteins. Background of the invention
Protein-based therapeutics hold great promise in addressing unmet medical needs as well as in offering new therapeutic options due to their high specificity and versatility. However, existing protein-based therapeutics are largely restricted to extracellular targets as the plasma membrane of cells constitutes a major barrier for such proteins to reach intracellular therapeutic targets. The discovery of the HIV-derived TAT (SEQ ID NO: 1 ) protein transduction domain (PTD) (Fawell, S., 1994, Proc. Natl. Acad. Sci USA 91 , 664-668) and other such peptides promised to provide access for therapeutic proteins to intracellular drug targets. PTDs are short peptides facilitating the transport of fused cargo, such as proteins or small molecules attached to it, across the plasma membrane into the cellular compartment. However, despite considerable efforts in the last 20 years, no protein-based drug intended to reach an intracellular target makes use of PTDs to date. This is largely due to the fact that PTD-mediated transport is inefficient in delivering proteins to their intended correct subcellular localization, for example to the nuclear compartment in case of therapeutics intended to modulate gene expression, as is the case with artificial transcription factors. This inefficiency of protein transduction domains is mainly rooted in their mode of action. PTDs induce cellular uptake by triggering endocytotis or macropinocytosis leading to the formation of an endocytotic or macropinocytotic vesicle localized in the cytosol containing the PTD- fused proteins. However, topologically, "inside" the endosomal compartment is still
"extracellular" space, thus, strictly speaking, the PTD-protein fusion has not reached the intracellular space. In addition, the endolysosomal compartment contains many hydrolytic enzymes, such as proteases, leading to the rapid degradation of PTD-protein fusions, thereby limiting the therapeutic potential of such cargo proteins even further. This was recognized early on in the field of protein transduction, and the need for so-called endosomal escape of PTD-protein fusions was established. Various strategies were developed to overcome endosomal entrapment and to enhance endosomal escape of PTD-protein fusions. These strategies include osmotic destabilization of the endosomal compartment through use of endolysosomotropic agents, such as chloroquine, so called proton sponges, such as polyhistidine tags, or so called fusogenic peptides, such as HA2 (SEQ ID NO: 2), GALA (SEQ ID NO: 3), KALA (SEQ ID NO: 4), GALAdelE3 (SEQ ID NO: 5), or H5WYG (SEQ ID NO: 6) able to interact with and rupture the endosomal membrane. While these methods showed some improvement in terms of endosomal escape of PTD-protein fusions, correct subcellular localization of proteins being part of a PTD-protein fusion is suboptimal. Thus, further improvements are necessary to make PTD-mediated delivery of proteins a viable option for therapeutic purposes, e.g. to achieve transport of sufficient amounts of an artificial transcription factor into the nuclear compartment for gene regulatory purposes. Artificial transcription factors are proposed to be useful tools for modulating gene expression (Sera T., 2009, Adv Drug Deliv Rei 61 , 513-526). Many naturally occurring transcription factors, influencing gene expression either through repression or activation of gene transcription, possess complex specific domains for the recognition of a certain DNA sequence. This makes them unattractive targets for manipulation if one intends to modify their specificity and target gene(s). However, a certain class of transcription factors contains several so called zinc finger (ZF) domains, which are modular and therefore lend themselves to genetic engineering. Zinc fingers are short (30 amino acids) DNA binding motifs targeting almost independently three DNA base pairs. A protein containing several such zinc fingers fused together is thus able to recognize longer DNA sequences. A hexameric zinc finger protein (ZFP) recognizes an 18 base pairs (bp) DNA target, which is almost unique in the entire human genome. Initially thought to be completely context independent, more in-depth analyses revealed some context specificity for zinc fingers (Klug A., 2010, Annu Rev Biochem 79, 213-231 ). Mutating certain amino acids in the zinc finger recognition surface altering the binding specificity of ZF modules resulted in defined ZF building blocks for most of 5'-GNN-3', 5'-CNN-3', 5'-ANN-3', and some 5 -TNN-3' codons (e.g. so-called Barbas modules, see
Dreier B., Barbas C.F. 3rd et a/., 2005, J Biol Chem 280, 35588-35597). While early work on artificial transcription factors concentrated on a rational design based on combining preselected zinc fingers with a known 3 bp target sequence, the realization of a certain context specificity of zinc fingers necessitated the generation of large zinc finger libraries which are interrogated using sophisticated methods, such as bacterial or yeast one hybrid, phage display, compartmentalized ribosome display, or in vivo selection using FACS analysis. Using such artificial zinc finger proteins, DNA loci within the human genome can be targeted with high specificity. Thus, these zinc finger proteins are ideal tools for transporting protein domains with transcription-modulatory activity to specific promoter sequences resulting in the modulation of expression of a gene of interest. Suitable domains for the silencing of transcription are the Krueppel-associated domain (KRAB) as N-terminal (SEQ ID NO: 7) or Clterminal (SEQ ID NO: 8) KRAB domain, the Sin3-interacting domain (SID, SEQ ID NO: 9) and the ERF repressor domain (ERD, SEQ ID NO: 10), while activation of gene transcription is achieved through herpes virus simplex VP16 (SEQ ID NO: 1 1 ) or VP64 (tetrameric repeat of VP16, SEQ ID NO: 12) domains (Beerli R.R. et al., 1998, Proc Natl Acad Sci USA 95, 14628-14633). Additional domains considered to confer transcriptional activation are CJ7 (SEQ ID NO: 13), p65-TA1 (SEQ ID NO: 14), SAD (SEQ ID NO: 15), NF-1 (SEQ ID NO: 16), AP-2 (SEQ ID NO: 17), SP1 -A (SEQ ID NO: 18), SP1-B (SEQ ID NO: 19), Oct-1 (SEQ ID NO: 20), Oct-2 (SEQ ID NO: 21 ), Oct-2_5x (SEQ ID NO: 22), MTF-1 (SEQ ID NO: 23), BTEB- 2 (SEQ ID NO: 24) and LKLF (SEQ ID NO: 25). In addition, transcriptionally active domains of proteins defined by gene ontology GO: 0001071 (http://amigo.geneontology.org/cgi- bin/amigo/term_details?term=GO:0001071 ) are considered to achieve transcriptional regulation of target proteins. Fusion proteins comprising engineered zinc finger proteins as well as regulatory domains are referred to as artificial transcription factors.
Artificial transcription factors comprising a polydactyl zinc finger protein targeting specifically a receptor gene promoter fused to an inhibitory or activatory domain, a nuclear localization sequence and a protein transduction domain, and their use in treating diseases modulated by the binding of specific effectors to such receptors have been published (WO 2013/053719).
A large percentage of all known drug targets are receptor molecules that are either stimulated or blocked by the action of small molecule drugs with oftentimes considerable off-target activities. Examples for such receptors are the histamine H1 receptor or alpha- and beta- adrenoreceptors, but in general proteins defined by gene ontology GO:0004888 and
GO:0004930. In the following paragraphs, background information on some of the envisaged receptor molecules chosen as examples for successful targeting by correspondingly engineered artificial transcription factors of the invention is given.
The eye is an exquisite organ that strongly relies on a balanced and sufficient perfusion to meet its high oxygen demand. Failure to provide sufficient and stable oxygen supply causes ischemia-reperfusion injury leading to glial activation and neuronal damage as observed in glaucoma patients with progressing disease despite normal or normalized intraocular pressure. Insufficient blood supply also leads to hypoxia causing run-away neovascularization with the potential of further retinal damage as evident during diabetic retinopathy or wet age related macular degeneration. Eye tissue perfusion is under complex control and depends on blood pressure, intraocular pressure as well as local factors modulating vessel diameter. Such local factors are, for example endothelins, short peptides with a strong vasoconstrictive activity. Three isoforms of endothelins (ET-1 , ET-2, and ET-3) are produced by endothelin converting enzyme from precursor molecules secreted by endothelial cells localized in the blood vessel wall. Two cognate receptors for mature ET are known, ETRA and ETRB. While ETRA is localized to smooth muscle cells forming vessels walls and promoting
vasoconstriction, ETRB is mainly expressed on endothelial cells and acts vasodilatatory by promoting the release of nitric oxide, thus causing smooth muscle relaxation. ETRA and ETRB belong to the large class of G-protein coupled seven transmembrane helix receptors. The binding of ET to ETRA or ETRB results in G protein activation, thus triggering an increase in intracellular calcium concentration and thereby causing a wide array of cellular reactions.
The vasoactive endothelin system plays an important role in the pathogenesis of various diseases. Endothelins, on the one hand, are involved in the regulation of blood supply and, on the other hand, are main players in the cascade of events induced by hypoxia. Endothelin is, for example, involved in the breakdown of the blood-brain or the blood-retina barrier and in the neovascularisation. Endothelin is furthermore involved in neurodegeneration, but also the regulation of the threshold of pain sensation or even thirst feeling.
Influencing the endothelin system systemically or locally is of interest for the treatment of many diseases such as subarachnoidal or brain hemorrhages. Endothelin also influences the course of multiple sclerosis. Endothelin contributes to (pulmonary) hypertension, but also to arterial hypotension, cardiomyopathy and to Raynaud syndrome, variant angina and other cardiovascular diseases. Endothelin is involved in diabetic nephropathy and diabetic retinopathy. In the eye it further plays a role for the glaucomatous neurodegeneration, retinal vein occlusion, giant cell arthritis, retinitis pigmentosa, age related macula degeneration, central serous chorioretinopathy, Morbus Leber, Susac syndrome, intraocular hemorrhages, epiretinal gliosis and certain other pathological conditions.
Bacterial cell wall components, such as lipopolysaccharide (LPS), play important roles in the pathogenesis of various diseases. The presence of LPS in the body points to a bacterial infection that needs to be addressed by the immune system. Since LPS is a general component of Gram-negative bacteria, LPS constitutes a so called danger signal that can activate the immune system. LPS is recognized by the Toll-like receptor 4 (TLR4), a member of the larger family of Toll-like receptors involved in the recognition of varied danger signals or pathogen associated molecular patterns (PAMPs) associated with bacterial or viral infections. While recognition of LPS as danger signal is an important part of innate immunity, overstimulation or prolonged stimulation of the TLR4 receptor is connected to a variety of pathological conditions associated with chronic inflammation. Examples are various liver diseases such as alcoholic liver disease, nonalcoholic fatty liver disease, nonalcoholic steatohepatitis, chronic hepatitis B or C virus (HCV) infection, and HIV-HCV co-infection. Other diseases associated with TLR4 signaling are rheumatoid arthritis, artherosclerosis, psoriasis, Crohn's disease, uveitis, contact lens associated keratitis and corneal
inflammation. In addition, TLR4-mediated signaling is involved in cancer progression and resistance to chemotherapy.
Immunoglobulins isotype E (IgE) are part of the adaptive immune system and as such involved in the protection against infections but also neoplastic transformation. IgE is bound by the high-affinity IgE receptor (FcER1 ) localized on mast cells and basophiles. Binding of IgE to FcER1 followed by cross-linking these complexes via specific antigens called allergens leads to the release of various factors from mast cells and basophils causing the allergic response. Among these factors are histamine, leukotrienes, various cytokines but also lysozyme, tryptase or β-hexosaminidase. The release of these factors is associated with allergic diseases such as allergic rhinitis, asthma, eczema and anaphylaxis.
Nuclear receptors are a protein superfamily of ligand-activated transcription factors. They are, unlike most other cellular receptors, soluble proteins localized to the cytosol or the nucleoplasm. Ligands for nuclear receptors are lipophilic molecules, among them steroid and thyroid hormones, fatty and bile acids, retinoic acid, vitamin D3 and prostaglandins (McEwan I.J., Methods in Molecular Biology: The Nuclear Receptor Superfamily, 505, 3-17). Upon ligand binding, nuclear receptors dimerize, thus triggering binding to specific transcription- factor-specific DNA response elements inside ligand-responsive gene promoters causing either activation or repression of gene expression. Given that nuclear receptors are responsible for mediating the activity of many broad-acting hormones such as steroids and important metabolites, the miss- and dysfunction of nuclear receptors is involved in the natural history of many diseases.
Using agonists or antagonists to modulate the activity of nuclear receptors is employed for therapeutic purposes. Modulation of glucocorticoid receptor (NR3C1 ) function using corticosteroids such as agonistic dexamethasone is common clinical practice for influencing inflammatory diseases. Another modulation of nuclear receptor activity is exemplified in oral contraception where activation of the estrogen receptor (ESR1 ) and the progesterone receptor is used to prevent egg fertilization in women. In another example, blocking the androgen receptor (AR) using anti-androgens such as flutamide or bicalutamide proved useful for the treatment of AR-dependent prostate cancers. Furthermore, blockage of the estrogen receptor by blocking estrogen synthesis and thus the availability of estrogen is a standard treatment for breast cancer in women or gynaecomastia in men.
Genetic mutations are at the heart of many inherited disorders. In general, such mutations can be classified into dominant or recessive regarding their mode of inheritance, with a dominant mutation being able to cause the disease phenotype even when only one gene copy - be it the maternal or the paternal - is affected, while for a recessive mutation to cause disease both, maternal and paternal, gene copies need to be mutated. Dominant mutations are able to cause disease by one of two general mechanisms, either by dominant-negative action or by haploinsufficiency. In case of a dominant-negative mutation, the gene product gains a new, abnormal function that is toxic and causes the disease phenotype. Examples are subunits of multimeric protein complexes that upon mutation prevent proper function of said protein complex. Diseases inherited in a dominant fashion can also be caused by haploinsufficiency, where the disease-causing mutation inactivates the affected gene, thus lowering the effective gene dose. Under these circumstances, the second, intact gene copy is unable to provide sufficient gene product for normal function. About 12Ό00 human genes are estimated to be haploinsufficient (Huang et a/., 2010, PLoS Genet. 6(10), e1001 154) with about 300 genes known to be associated with disease.
Neuronal survival critically depends on mitochondrial function with mitochondrial failure at the heart of many neurodegenerative disorders (Karbowski M., Neutzner A., 2012, Acta
Neuropathol 123(2), 157-71 ). Besides their essential function in providing energy in form of ATP, mitochondria are critically involved in calcium buffering, diverse catabolic as well as metabolic processes and also programmed cell death. This important function of
mitochondria is mirrored in the many cellular mechanisms in place to maintain mitochondria and to prevent mitochondrial failure and subsequently cell death (Neutzner A. et a/., 2012, Semin Cell Dev Biol 23, 499-508). A central role among these processes plays the maintenance of a dynamic mitochondrial network with a balanced mitochondrial morphology. This is achieved by the so called mitochondrial morphogens that promote either fission of mitochondria in the case of Drp1 , Fis1 , Mff, MiD49 and MiD51 - or fusion of mitochondrial tubules in the case of Mfn1 , Mfn2 and OPA1. Balancing mitochondrial morphology is essential since loss of mitochondrial fusion is known to promote the loss of ATP production and sensitizes cells to apoptotic stimuli connecting this process to neuronal cell death associated with neurodegenerative disorders. A key player in the process of mitochondrial fusion is optic atrophy 1 or OPA1. OPA1 is a large GTPase encoded by the OPA 1 gene and essential for mitochondrial fusion. In addition, OPA1 plays an important role in maintaining mitochondrial cristae structure. It was shown that downregulation of OPA 1 gene expression causes mitochondrial fragmentation due to a loss of fusion and sensitizes cells to apoptotic stimuli. Mutations in OPA 1 were identified to be responsible for about 70 % of Kjer's optic neuropathy or autosomal dominant atrophy
(ADOA). In most populations, ADOA is prevalent between 1/10Ό00 and 3/100Ό00 and is characterized by a slowly progressing decrease in vision starting in early childhood. The visual impairment ranges from mild to legally blind, is irreversible and is caused by the slow degeneration of the retinal ganglion cells (RGCs). In most cases, ADOA is non-syndromic, however, in about 15 % of patients extra-ocular, neuro-muscular manifestations such as sensori-neural hearing loss are encountered. Until now, no viable treatment for this disease is available. Interestingly, certain OPA 1 alleles were connected to normal tension, but not high tension glaucoma, highlighting again the importance of OPA1 for maintaining normal mitochondrial physiology. Taken together, combining PTD-mediated protein delivery with artificial transcription factor technology would allow addressing a plethora of unmet medical needs which would benefit from targeted, highly specific up- as well as downregulation of gene expression. However, the still unsolved issue of sufficient endosomal escape of PTD-protein fusions hampers the usefulness of transducible artificial transcription factor therapeutics.
Summary of the invention The invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or several, i.e. two or more, endosome- specific protease cleavage sites, wherein the one single endosome-specific protease cleavage site is different from the amino acid sequence SEQ ID NO: 26, to pharmaceutical compositions comprising such an artificial transcription factor, to mammalian cells comprising such an artificial transcription factor, and to an expression vector comprising nucleic acids coding for such an artificial transcription factor. Furthermore the invention relates to the use of such artificial transcription factors for modulating the expression of genes, and in treating diseases where modulation of such gene expression is beneficial. Furthermore the invention relates to a method of constructing a specifically targeted therapeutic agent, a method of specifically targeting a therapeutically active protein to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell of a subject, and a method of treatment comprising administering to a subject in need thereof a therapeutically active protein.
In a particular embodiment, the artificial transcription factor comprises two or more endosome-specific protease cleavage sites, said endosome-specific protease cleavage sites being cleaved by different endosome-specific proteases. In a particular embodiment, the endosome-specific protease cleavage site is a cathepsin cleavage site, more particular a cathepsin cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 27 to 46, even more particular a cathepsin cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 29, 30, 31 , 32, 35, 36, 40 and 41 , and even more particular a cathepsin cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NOs: 31 ,35, 36, 40 and 41.
In a further particular embodiment the one single or one of two or more cathepsin cleavage sites is a cathepsin D cleavage site. In another particular embodiment the one single or one of two or more cathepsin cleavage sites is a cathepsin K cleavage site. In yet another particular embodiment one single or one of two or more cathepsin cleavage sites is a cathepsin L cleavage site. In yet another particular embodiment the one single or one of two or more cathepsin cleavage sites is a cathepsin S cleavage site. In yet another particular embodiment the one of two or more cathepsin cleavage sites is a cathepsin B cleavage site.
In a further particular embodiment the one single or two or more endosome-specific protease cleavage sites are cleaved each by at least two different endosome-specific proteases. In yet a further particular embodiment the one single or two or more endosome-specific protease cleavage sites are cleaved each by at least two different endosome-specific proteases, wherein the at least two different endosome-specific proteases are selected from the group consisting of i) cathepsin B and D, ii) cathepsin B, D, K, and S, iii) cathepsin K and S, iv) cathepsin D, K, L, and S, v) cathepsin B, D, K, L and S, and vi) cathepsin D and K. The cathepsin cleavage site CS1 (QPMKRLTLGN, SEQ ID NO: 26) contained in the cathepsin in vitro substrate prorenin is a cathepsin B, D, K, L, and S cleavage site.
The cathepsin cleavage site CS2 (GKPILFFRLK, SEQ ID NO: 27) is a cathepsin B and K cleavage site.
A further cathepsin cleavage site of the invention is the cleavage site CS3 (APISFFELG, SEQ ID NO: 28).
The cathepsin cleavage sites CS4 (GRWPPMGLPWE, SEQ ID NO: 29) and CS5
(GRWHPMGAPWE, SEQ ID NO: 30) are cathepsin K and S cleavage sites.
The cathepsin cleavage site CS6 (HPGGPQ, SEQ ID NO: 31 ) is a cathepsin D, K, L, and S cleavage site.
The cathepsin cleavage site CS7 (TFLGGPKPPQRVMFTEDLKLPASF, SEQ ID NO: 32) is a cathepsin B, D, K, L, and S cleavage site.
A further cathepsin cleavage site of the invention is the cleavage site CS8
(AVPAVTEGPIPEVLK, SEQ ID NO: 33). The cathepsin cleavage site CS9 (LSQDTVSVPCQSASSASALG, SEQ ID NO: 34) is a cathepsin D and K cleavage site.
The cathepsin cleavage site CS10 (KGKVFQEPLFYEAPRSVD, SEQ ID NO: 35) is a cathepsin D, K, L and S cleavage site.
The cathepsin cleavage site CS1 1 (ITYKSNPNRILPDSVD, SEQ ID NO: 36) is a cathepsin D, K, L, and S cleavage site.
The cathepsin cleavage site CS12 (MSYREAASGNFSLF, SEQ ID NO: 37) is a cathepsin K and S cleavage site.
The cathepsin cleavage site CS13 (NALKFLASLLELPE, SEQ ID NO: 38) is a cathepsin D cleavage site.
The cathepsin cleavage site CS14 (AGLTTELFSPVDLN, SEQ ID NO: 39) is a cathepsin D and K cleavage site.
The cathepsin cleavage site CS15 (MQYFSHFIRSGNPN, SEQ ID NO: 40) is a cathepsin D, K, L and S cleavage site.
The cathepsin cleavage site CS16 (AQTKLLAVSGPFHY, SEQ ID NO: 41 ) is a cathepsin B, D, K, L, and S cleavage site.
The cathepsin cleavage site CS17 (YPYEFSRKVPTFAT, SEQ ID NO: 42) is a cathepsin D and K cleavage site.
A further cathepsin cleavage site of the invention is the cathepsin D cleavage site CS18 (TNSQLFRRAVLMGG, SEQ ID NO: 43).
A further cathepsin cleavage site of the invention is the cathepsin B cleavage site CS19 (KKKRKVGLEPGEKP, SEQ ID NO: 44).
A further cathepsin cleavage site of the invention is the cathepsin B cleavage site CS20 (KRKVGLEPGE, SEQ ID NO: 45).
A further cathepsin cleavage site of the invention is the cathepsin B cleavage site CS21 (RKVGLEPG, SEQ ID NO: 46).
In another particular embodiment, one endosome-specific protease cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 27 to SEQ ID NO: 46 is located between the transport protein comprising one or more protein transduction domains of the transducible artificial transcription factor of the invention and the amino acid sequence comprising all three components regulatory domain, nuclear localization sequence, and polydactyl zinc finger protein. In another particular embodiment, one of at least two endosome-specific protease cleavage sites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between the transport protein comprising one or more protein transduction domains of the transducible artificial transcription factor of the invention and the amino acid sequence comprising all three components regulatory domain, nuclear localization sequence, and polydactyl zinc finger protein, and another endosome-specific protease-cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between the nuclear localization sequence and the amino acid sequence comprising the regulatory domain and the polydactyl zinc finger protein, or between the regulatory domain and the polydactyl zinc finger protein, and/or within the nuclear localization sequence, the regulatory domain and/or the polydactyl zinc finger protein.
In another particular embodiment, one of at least two endosome-specific protease cleavage sites comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between the transport protein comprising one or more protein transduction domains of the transducible artificial transcription factor of the invention and the amino acid sequence comprising the nuclear localization sequence, the regulatory domain, and the polydactyl zinc finger protein, and another endosome-specific protease-cleavage site comprising an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46 is located between two of the amino acid sequences for regulatory domain, nuclear localization sequence or the polydactyl zinc finger protein, and/or within the nuclear localization sequence, the regulatory domain and/or the polydactyl zinc finger protein. Usually the transport protein comprises one protein transduction domain. In a particular embodiment the transport protein comprises two or more protein transduction domains, preferably two, three, four or more copies of the same protein transduction domain, more preferably four copies of the same protein transduction domain. The preferred protein transduction domain is the TAT peptide.
In a particular embodiment of the invention the artificial transcription factor further comprises a protein tag. Usually the protein tag is selected from the group consisting of an amino acid sequence composed of 6 to 15 histidines, a HA (influenza hemagglutinin) epitope tag, and a myc epitope tag, preferably selected from the group consisting of an amino acid sequence composed of 6 to 15 histidines, a HA epitope tag of SEQ ID NO: 343, and a myc epitope tag of SEQ ID NO: 344. Also two or more successive protein tags e.g. 1 to 5 successive HA epitope tags or 1 to 5 successive myc epitope tags may be comprised by the artificial transcription factor. In particular the artificial transcription factor comprises an amino acid sequence composed of 6 to 15 histidines, preferably 6 histidines, a HA epitope tag, and three successive myc epitope tags, more particular an amino acid sequence composed of 6 to 15 histidines, preferably 6 histidines, a HA epitope tag of SEQ ID NO: 343, and three successive myc epitope tags each of SEQ ID NO: 344. Preferably the protein tag is located at the N- terminal end, between the protein transduction domain and the endosome-specific protease cleavage site and/or at the C-terminal end of the artificial transcription factor. In a particular embodiment of the invention the artificial transcription factor further comprises an amino acid sequence composed of 6 to 15 histidines, preferably at the N-terminal end. More preferably said amino acid sequence is composed of 8 to 15 histidines, even more preferably 10 to 15 histidines, most preferred are 6 to 10 histidines, in particular 6 histidines.
In a particular embodiment, the gene promoter targeted by the artificial transcription factors of the invention is a receptor gene promoter.
In a more particular embodiment, the receptor gene promoter is the endothelin receptor A (ETRA) promoter (SEQ ID NO: 47). In another particular embodiment the invention relates to such an artificial transcription factor for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases. Likewise the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
In another more particular embodiment, the receptor gene promoter is the endothelin receptor B promoter (SEQ ID NO: 48). In another particular embodiment the invention relates to such an artificial transcription factor for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor B levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases. Likewise the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
In another more particular embodiment, the receptor gene promoter is the Toll-like receptor 4 promoter (SEQ ID NO: 49). In another particular embodiment the invention relates to such an artificial transcription factor for use in influencing the cellular response to lipopolysaccharide, for lowering or increasing Toll-like receptor 4 levels, and for use in the treatment of diseases modulated by lipopolysaccharide, in particular for use in the treatment of eye diseases.
Likewise the invention relates to a method of treating a disease modulated by
lipopolysaccharide comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
In another more particular embodiment, the receptor gene promoter is the high-affinity immunoglobulin epsilon receptor subunit alpha (FcERIA) promoter (SEQ ID NO: 50). In another particular embodiment the invention relates to such an artificial transcription factor for use in influencing the cellular response to immunoglobulin E (IgE), for lowering or increasing high-affinity IgE receptor levels, and for use in the treatment of diseases modulated by IgE, in particular for use in the treatment of eye diseases. Likewise the invention relates to a method of treating a disease modulated by IgE comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
In a particular embodiment, the promoter region of the nuclear receptor gene is the glucocorticoid receptor promoter (SEQ ID NO: 51 ). In this particular embodiment the invention relates to an artificial transcription factor targeting the glucocorticoid receptor promoter for use in influencing the cellular response to glucocorticoids, for lowering or increasing glucocorticoid receptor levels, and for use in the treatment of diseases modulated by glucocorticoids, in particular for use in the treatment of eye diseases modulated by glucocorticoids. Likewise the invention relates to a method of treating a disease modulated by glucocorticoids comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting the glucocorticoid receptor promoter to a patient in need thereof.
In another particular embodiment, the promoter region of the nuclear receptor gene is the androgen receptor promoter (SEQ ID NO: 52). In this particular embodiment the invention relates to an artificial transcription factor targeting the androgen receptor promoter for use in influencing the cellular response to testosterone, for lowering or increasing androgen receptor levels, and for use in the treatment of diseases modulated by testosterone. Likewise the invention relates to a method of treating a disease modulated by testosterone comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting the androgen receptor promoter to a patient in need thereof.
In another particular embodiment, the promoter region of the nuclear receptor gene is the estrogen receptor promoter (SEQ ID NO: 53). In this particular embodiment the invention relates to such an artificial transcription factor targeting the estrogen receptor promoter for use in influencing the cellular response to estrogen, for lowering or increasing estrogen receptor levels, and for use in the treatment of diseases modulated by estrogen. Likewise the invention relates to a method of treating a disease modulated by estrogen comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting the estrogen receptor promoter to a patient in need thereof.
In another particular embodiment, the invention relates to engineered mammalian cells capable of producing and secreting an artificial transcription factor of the invention.
In another particular embodiment, the invention relates to the encapsulation of engineered mammalian cells capable of producing and secreting an artificial transcription factor of the invention into an implantable device which allows for the release of artificial transcription factor into the surrounding tissue.
In another particular embodiment, the invention relates to an expression vector comprising nucleic acids, in particular DNA, coding for the artificial transcription factor of the invention. Preferred expression vectors are based on the pET expression system (Studier F.W., 1986, J Mol Biol. 189(1 ):1 13-30) or other bacterial expression systems (Chen R. , 201 1 ,
Biotechnology Advances 30(5): 1 102-1 107). Particularly preferred are the expression vectors described in the Examples.
Furthermore the invention relates to the use of such artificial transcription factors for increasing the expression from haploinsufficient gene promoters, and in treating diseases caused or influenced by such haploinsufficient gene promoters. Likewise the invention relates to a method of treating a disease caused or modulated by haploinsufficiency comprising administering a therapeutically effective amount of an artificial transcription factor of the invention targeting a haploinsufficient gene promoter to a patient in need thereof.
In a particular embodiment, the haploinsufficient gene promoter is the OPA 1 promoter (SEQ ID NO: 54). In this particular embodiment the invention relates to an artificial transcription factor for use in enhancing the expression of the OPA 1 gene, and for use in the treatment of diseases caused or modified by low OPA1 levels, in particular for use in the treatment of eye diseases. In another particular embodiment the invention relates to artificial transcription factors binding to OPA1_TS1 (SEQ ID NO: 193), OPA1_TS2 (SEQ ID NO: 194), or
OPA1_TS3 (SEQ ID NO: 195). Likewise the invention relates to a method of treating a disease influenced by OPA1 comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof.
Brief description of the figures
Figure 1 : The fusogenic peptide TATHA2 does not increase the activity of an E7T?/A-specific transducible artificial transcription factor in a luciferase-based reporter assay.
HEK293 Flpln cells containing Gaussia luciferase under control of a hybrid CMV/ETRA- TS+74 promoter and secreted alkaline phosphatase under control of the constitutive CMV promoter were treated with inhibitory ATF1488 or its inactive control protein (ATF1714) in the presence (+) or absence (-) of the fusogenic peptide TATHA2. Luciferase values normalized to secreted alkaline phosphatase activity (RLA, relative luciferase activity) were expressed as percentage of inactive ATF1714 control protein. No significant difference was seen between cells treated with TATHA2 or left untreated in the presence as well as the absence of active ATF1488. Error bars represent standard deviation. Statistical significance was assessed using paired t-test with p-value adjustment according to Bonferroni.
Figure 2: Schematic presentation of modulating gene expression using protease-sensitive transducible artificial transcription factors
(Panel A) An artificial transcription factor comprising a protein transduction domain (PTD), an endosome-specific protease cleavage site (X and/or Y), a domain with transcription regulating activity (RD), a nuclear localization sequence (NLS), and a polydactyl zinc finger protein (ZFP) specific for the promoter region (P) of a gene (G) enters the cell via an endocytotic mechanism. Such an artificial transcription factor is trapped inside the endosomal compartment (marked E) unable to reach efficiently the nucleus (marked N) where its target is located. An endosome-specific protease (symbolized by scissors X) is activated during endosomal maturation, recognizes cleavage site X and cleaves the artificial transcription factor, thus separating PTD from RD-NLS-ZFP.
(Panel B) Following rupture of the endosomal vesicle, the now cleaved artificial transcription factor is disentangled from the endosomal membrane, thus able to leave the endosomal compartment, and is being transported to the nucleus.
(Panel C) Upon binding to its target site in the promoter region P of gene G, production of mRNA (m) is either up- (arrow up) or downregulated (arrow down), depending on the nature of the RD.
Figure 3: Increased endosomal escape of ATF1688 compared to ATF1488
HeLa cells were incubated for two hours in OptiMEM media with 1 μΜ cathepsin B-insensitive ATF1488 or cathepsin B-sensitive ATF1688 for 2 hours. Cells were fixed, stained using anti- myc epitope antibody to detect artificial transcription factors, and images were taken. Nuclear import (Nl) of artificial transcription factor was determined using image analysis, and was expressed as percentage of maximal fluorescence signal. Shown is the average of three independent experiments with 200 cells/experiment. Figure 4: Inclusion of a cathepsin cleavage site increases activity of an E77¾A-specific artificial transcription factor in a luciferase reporter assay
HEK293 Flpln cells stably expressing Gaussia luciferase under the control of a hybrid CMV/ETRA-TS+74 (target site for ATF1488/ATF 1688) and secreted alkaline phosphatase under control of a constitutive CMV promoter were treated with ATF1688 (contains cathepsin site) or ATF1488 (without cathepsin site). Treatment with ATF1806, an inactive mutant of ATF1688 lacking all zinc complexing cysteine residues, was used as control. Luciferase and secreted alkaline phosphatase activity were measured 24 hours after treatment. Luciferase activity was normalized to secreted alkaline phosphatase activity and expressed as percentage of control (RLA, relative luciferase activity). Shown is the average of three independent experiments with three technical replicates. Error bars represent SD.
Figure 5: Inclusion of a cathepsin cleavage site increases activity of an FcER7/A-specific artificial transcription factor in a luciferase reporter assay HEK293 Flpln cells stably expressing Gaussia luciferase under the control of a hybrid CMV/lgER-TS-147 (target site for ATF1572/ATF1880) and secreted alkaline phosphatase under control of a constitutive CMV promoter were treated with ATF1880 (contains cathepsin site) or ATF1572 (without additional cathepsin site). Treatment with ATF1881 , an inactive variant of ATF1880, served as control. Luciferase and secreted alkaline phosphatase activity were measured 24 hours after treatment. Luciferase activity was normalized to secreted alkaline phosphatase activity and expressed as percentage of control (RLA, relative luciferase activity). Shown is the average of three independent experiments with three technical replicates. Error bars represent SD.
Figure 6: Expression levels of different cathepsins in various cell lines
Using quantitative RT-PCR, expression levels of cathepsins B (cath B), D (cath D), F (cath F), G (cath G), H (cath H), K (cath K), L (cath L), and S (cath S) were determined relative to the house keeping gene GAPDH in ARPE19, Ben-Men-I, HaCat, HEK293, HeLa cells cultured in normal (HeLa NM) as well as in synthetic media (HeLa SM), HMEC-1 , human astrocytes (HAC), human keratinocytes (HK), human primary fibroblast (HpF), human pericytes (HP), human uterine smooth muscle cells (hUtSMC), and SH-SY5Y cells. Shown are the cathepsin expression levels (CE) in percent relative to GAPDH expression levels. Figure 7: Nuclear import of artificial transcription factors containing different cathepsin sensitive sites in cell lines with different cathepsin inventory
Human astrocytes (HAC), HEK293, and HeLa cells were treated with ATF1688, or ATF1688 variants ATF2443, ATF2445, ATF2446, ATF2450 with different cathepsin sensitivities, or buffer (marked with b) as control. Nuclear import of these artificial transcription factors following protein transduction was quantified using fluorescence microscopy and image analysis of anti-myc stained samples detecting the transduced artificial transcription factor (NF[a.u.] = nuclear fluorescence, arbitrary units).
Figure 8: Proteolytic processing of ATF1688 and ATF1688 variants in vivo following transduction into the endosomal compartment
Human astrocytes (HAC), HEK293 and HeLa cells were treated for 2 hours with ATF1688 or ATF1688 variants ATF2443 and ATF2450 with different cathepsin sensitivities. Cells were harvested and whole cells lysates were prepared and analyzed by western blot using anti- myc antibodies. Shown are density plots expressed as fluorescence values in arbitrary units (marked F) of western blot lanes as well as marker proteins (marked m) highlighted using vertical lines at 37, 26, and 19 kDa.
Figure 9: Schematic presentation of cell type-specific protease-mediated endosomal escape of transducible artificial transcription factors
Differential targeted digestion by endosomal proteases is used for the cell-type specific delivery of transducible artificial transcription factors to the nuclear compartment. To this end, a transducible artificial transcription factor of the invention containing a protein transduction domain (PTD), an endosomal protease cleavage site (marked X) between the PTD and the nuclear localization sequence (NLS), a further endosomal protease cleavage site (marked Y) between the regulatory domain (RD) and the NLS and the zinc finger protein (ZFP) is generated. Application of such an artificial transcription factor to a tissue or organism containing cells of type A and cells of type B (marked A for type A and B for type B) results in differential nuclear localization marks successful nuclear localization; * marks
unproductive nuclear localization) of said transcription factor, if cells of type A express endosomal protease X (marked C-X), but are negative for the expression of endosomal protease Y (marked C-Y), and if cells of type B are either positive or negative for the expression of endosomal protease X, but express endosomal protease Y. Cells of type A or type B are not necessarily of the same type in the cell biological sense, but are here categorized solely by their endosomal protease expression pattern. In addition, the endosomal cleavage site Y in such an artificial transcription factor could also be placed between the regulatory domain (RD) and the zinc finger protein (ZFP) or could be
incorporated into the nuclear localization sequence, the regulatory domain or the zinc finger protein. Furthermore, additional endosomal protease cleavage sites could be incorporated in or between nuclear localization sequence, regulatory domain and zinc finger protein allowing for even more selectivity between cell types as long as cells of type A do not express this additional endosomal protease site while cells of type non-A express such a protease.
Figure 10: Increased resistance of artificial transcription factors to unwanted cathepsin digestion
ATF1688, and ATF1688 variant ATF2491 with mutated cathepsin B off-target site were incubated with purified cathepsin B (cath B), D (cath D), K (cath K), L (cath L), or S (cath S). Digestion products were analyzed by infrared-laser based western blot using anti-myc antibodies recognizing a 3xmyc epitope located at the very C-terminus of the artificial transcription factor proteins. Shown are density plots expressed as fluorescence values in arbitrary units (marked F) of western blot lanes of cathepsin-digested ATF1688, and
ATF2491 protein as well as marker proteins (marked m). Highlighted using vertical lines are size markers at 37, 26, and 19 kDa. Desired cathepsin B cleavage products of ATF2491 and ATF1688 are marked with *.
Figure 1 1 : Polyhistidine-tag removal severely impacts activity of ATF1688
HEK293 Flpln cells containing Gaussia luciferase under control of a hybrid CMV/ETRA-
TS+74 promoter and secreted alkaline phosphatase under control of the constitutive CMV promoter were treated with ATF1688 (includes hexa-histidine tag), or ATF2102 (hexa- histidine tag removed), or ATF1806, an inactive variant of ATF1688, as control. Luciferase and secreted alkaline phosphatase activity were measured 24 hours after treatment.
Luciferase activity was normalized to secreted alkaline phosphatase activity and expressed as percentage of contro (RLA, relative luciferase activity)!. Shown is the average of three independent experiments with three technical replicates. Error bars represent SD.
Figure 12: Determination of half-maximal activity of ATF1688 in decreasing and constant concentration of TAT protein transduction domain
HEK293 cells containing Gaussia luciferase under control of an ATF1688-sensitive
CMV/ETRA-TS+74 hybrid promoter and secreted alkaline phosphatase under control of a constitutive CMV promoter were treated with (A) decreasing concentrations of ATF1688 ranging from 1 μΜ to 0 μΜ or (B) with 2 μΜ of a mixture between active ATF1688 and inactive ATF1806 with decreasing concentrations of ATF1688 ranging from 2 μΜ to 0 μΜ in the mixture. Luciferase activity was measured, expressed as ratio of luciferase to secreted alkaline phosphatase activity, and normalized (act [a.u.]). A four parameter log-logistic model was fitted to the data and the half-maximal effective dose (labeled ED50) was calculated.
Figure 13: Incorporating an octameric zinc finger protein into an artificial transcription factor increases its activity
HEK293 cells containing Gaussia luciferase under control of a CMV/FcERIa hybrid promoter were treated with 0.25, 0.5, or 1 uM hexameric anti-FcERIa ATF AO501 or the AO501 - derived octameric zinc finger protein containing ATF2615, suppression of luciferase activity was measured and expressed as percentage suppression of luciferase activity compared to control treated cells. While both artificial transcription factors have comparable activity at 1 μΜ concentrations, clearly at lower, non-saturating concentrations, the octameric ATF2615 is more active and causes significantly higher suppression of luciferase activity.
Figure 14: Treatment with FcERIa-specific transducible artificial transcription factor effects downregulation of IgE receptor downregulation in primary human basophiles
Primary human basophiles isolated from peripheral blood were treated with 1 μΜ ATF2729 for 96 hrs or vehicle as control and expression of IgE receptor on the surface was measured using flow cytometric analysis. Shown is the median expression of IgE receptor over time. Note the suppression of IgE receptor expression at 72 and 96 hours of treatment with ATF2729.
Figure 15: Increased activity of octameric compared to hexameric zinc finger containing anti- ETRA transducible artificial transcription factors
Reporter cells containing Gaussia luciferase under control of a CMV/ETRA hybrid promoter were treated with decreasing concentrations (1 to 0 μΜ) of hexameric or octameric zinc finger containing ATF1688 or ATF2602, respectively. In order to prevent limitations of TAT - mediated transport, the total concentration of applied transcription factor protein was kept constant at 1 μΜ through addition of unrelated, and in this context, inactive transducible artificial transcription factor. (A) depicts the dose-response curve with the y-axis showing the relative luciferase activity (labeled R for response) and the x-axis showing the partial dose (labeled D) of ATF1688 (solid line) or ATF2602 (dashed line). (B) depicts the relative potency of ATF2602 compared to ATF1688 (RP) in relation to the level of luciferase activity as measure of the response level (RL). Figure 16: Octameric zinc finger protein containing anti-ETRA transducible artificial transcription factors suppress ETRA expression and signaling in human aortic smooth muscle cells
(A) Human aortic smooth muscle cells grown in serum-free media were treated for two hours with 1 μΜ ATF2468, ATF2602 or buffer as control, and ETRA expression levels in comparison to GAPDHwere determined by quantitative RT-PCR at 24 hours after treatment. Shown is a boxplot of Act values (labeled Act) representing the difference between the curve threshold values (ct) for detection of ETRA mRNA and GAPDH mRNA in cells treated with buffer (labeled b), ATF2468, or ATF2602. (B) Human aortic smooth muscle cells grown in serum-free media were treated for two hours with 1 μΜ ATF2602 or buffer as control. Calcium flux as percentage of base line (labeled cf [% bl]) was measured 24 hours after treatment in response to stimulation with 1 , 5, 10, or 100 nM ET-1 (labeled 1 , 5, 10, 100). Please note the suppression of ET-1 dependent calcium flux after treatment with anti-ETRA transducible artificial transcription factor ATF2602 (dashed line) compared to control treated cells (solid line).
Figure 17: Octameric ATF2468 decreases ET-1 dependent contraction of human placental vessels ex vivo
Vessels were isolated from human placenta after elective cesarean and were incubated for three days with 1 μΜ ATF2468 or inactive protein control (marked with c) and ET-1 dependent contraction relative to the unrelated vasoconstrictor U46619 induced contraction was measured by adding increasing doses of ET-1 as indicated. Note the loss of
contractibility of ATF2468 treated compared to control treated vessels. Figure 18: Sus scrofa is a suitable model for testing efficacy of human anti-ETRA transducible artificial transcription factors
HEK 293 cells containing Gaussia luciferase under control of a hybrid CMV/human (labeled H.s. for Homo sapiens), CMV/porcine (labeled S.s. for Sus scrofa), CMV/bovine (labeled B.t. for Bos taurus), CMV/murine (labeled M.m. for Mus musculus), or CMV/rabbit (labeled O.c. for Oryctolagus cuniculus) ETRA promoter target site were treated with ATF2468 or inactive control protein (labeled with c) and luciferase activity was determined. Please note, ATF2468 is a negative regulatory transducible artificial transcription factor, thus, suppression of luciferase activity is a measure of transcription factor activity. Figure 19: Anti-ETRA transducible artificial transcription factor has desired activity in vivo in porcine retinal vessels
ATF2602 or vehicle as control were injected intravitreally into porcine eyes. Eyes were harvested after six days and retinal vessel tissue was isolated by laser capture microscopy from ATF2602 and vehicle-treated eyes. Using quantitative RT-PCR, the levels of ETRA mRNA were determined in relation to GAPDH as control (housekeeping) gene. Shown is a boxplot of ACt values (labeled Act) representing the difference between the curve threshold values (ct) for detection of ETRA mRNA and GAPDH mRNA between ATF2602 and buffer (labeled with B) treated porcine eyes. Two-tailed, independent Student's t-test revealed a difference between buffer and ATF2602 treated eyes (p = 0.02088) consistent with a downregulation of ETRA mRNA in ATF2602 treated eyes.
Figure 20: The SID domain contains an off-target cathepsin D site
Schematic representation of a transducible artificial transcription factor of the invention containing the TAT protein transduction domain (labeled TAT), a cathepsin recognition site (labeled CAT), a negative-regulatory domain (SID), as well as a polydactyl zinc finger protein (ZFP) but omitting the nuclear localization sequence. Following endocytotic uptake, such transducible artificial transcription factors are subject to processing by cathepsin B (labeled CatB) inside the cathepsin recognition site leading to endosomal disentanglement. Cathepsin D (CatD) also is able to bind to a subset of potential CAT sites. However, CatD cuts off-center from its binding site leading to the processing of such transducible artificial transcription factors inside the SID domain. While such off-target processing by CatD also leads to endosomal disentanglement, processing inside the SID domain leads to the inactivation of the transducible artificial transcription factor.
Figure 21 : Optimization of cathepsin-mediated processing of transducible artificial transcription factors
Schematic representation of an in vitro selection process allowing for the generation of transducible artificial transcription factors with modified cathepsin sensitivities. A DNA library was generated containing random sequences (CAT-RS) inside a cathepsin binding site (CAT- BS) and near a potential cathepsin cleavage (CATp) site located inside a domain essential (ED) for function of the artificial transcription factor. This DNA library is used to generate a hybrid mRNA-protein molecule library suitable for mRNA-display (MD). By digesting such mRNA-display libraries with various cathepsins (symbolized with oval and hexagon-marked CAT), selection of artificial transcription factors with increased (marked S for sensitive) or decreased (marked R for resistant) cathepsin sensitivities is achieved. The digestion process for the different entities in the MD-library is symbolized by the double arrow/question mark. By performing sequential digestion with cathepsins, artificial transcription factors with defined resistance (labeled R) and sensitivity (labeled S) towards various cathepsins are generated. Detailed description of the invention
The invention relates to the enhanced and cell type selective delivery of an artificial transcription factor to the nuclear compartment of cells, and to pharmaceutical compositions comprising such an artificial transcription factor. Furthermore the invention relates to the use of such artificial transcription factors for modulating the expression of genes, for example (but not limited to) receptor genes, such as membrane-bound or nuclear receptor genes, or haploinsufficient genes, and in treating diseases caused or modulated by proteins or other gene products encoded by such genes, the promoters of which are targeted by the transcription factors of the invention, for example (but not limited to) receptor proteins, such as membrane-bound or nuclear receptor proteins, or proteins produced by haploinsufficient genes. The invention further relates to a method of constructing a specifically targeted therapeutic agent to be delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell. The invention further relates to a method of specifically targeting a therapeutically active protein to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell of a subject. The invention further relates to a method of treatment comprising administering to a subject in need thereof a therapeutically active protein. An artificial transcription factor in the sense of the invention comprises a polydactyl zinc finger protein targeting specifically a gene promoter fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a protein transduction domain, and one or two or more endosome-specific protease cleavage sites selected and placed within the artificial transcription factor to facilitate cell type targeted enhanced endosomal escape. The artificial transcription factor of the invention usually comprises listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, an inhibitory or activatory protein domain, a nuclear localization sequence and a zinc finger protein, wherein the inhibitory or activatory protein domain, the nuclear localization sequence and the zinc finger protein may be in any order. Thus one may envisage an artificial transcription factor comprising listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a nuclear localization sequence, an inhibitory or activatory protein domain and a zinc finger protein; an artificial transcription factor comprising listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a nuclear localization sequence, a zinc finger protein and an inhibitory or activatory protein domain; an artificial transcription factor comprising listed from the N- to the C-terminus a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a zinc finger protein, a nuclear localization sequence, and an inhibitory or activatory protein domain; an artificial transcription factor comprising listed from the N- to the C-terminus a protein transduction domain, one or two or more endosome-specific protease cleavage sites, a zinc finger protein, an inhibitory or activatory protein domain and a nuclear localization sequence; an artificial transcription factor comprising listed from the N- to the C-terminus a protein transduction domain, one or two or more endosome-specific protease cleavage sites, an inhibitory or activatory protein domain, a zinc finger protein and a nuclear localization sequence; an artificial transcription factor comprising listed from the N- to the C-terminus a protein transduction domain, one or two or more endosome-specific protease cleavage sites, an inhibitory or activatory protein domain, a nuclear localization sequence and a zinc finger protein. The artificial transcription factor of the invention preferably comprises listed from the N- to the C-terminus, a protein transduction domain, one or two or more endosome-specific protease cleavage sites, an inhibitory or activatory protein domain, a nuclear localization sequence and a zinc finger protein.
The artificial transcription factor of the invention may further comprise an endosome-specific protease cleavage site located within or between domains of the artificial transcription factor essential for its activity. In the context of the invention domains of the artificial transcription factor essential for its activity are the nuclear localization sequence, the inhibitory or activatory domain or the polydactyl zinc finger protein. The artificial transcription factor of the invention may further comprise linker between the domains of the artificial transcription factors, i.e. linker between the protein transduction domain, the inhibitory or activatory protein domain, the nuclear localization sequence and/or the zinc finger protein. Thus in a particular embodiment the artificial transcription factor of the invention may further comprise an endosome-specific protease cleavage site which is located in the linker regions connecting e.g. the inhibitory or activatory protein domain, the nuclear localization sequence and/or the zinc finger protein.
A polydactyl zinc finger protein in the sense of the invention is a fusion protein of four to ten zinc finger modules according to Gonzalez B., 2010, Nat Protoc 5, 791-810, or a fusion protein of eight or more e.g. eight to twelve zinc finger modules as selected or designed to bind to a twelve to thirty base pair target site in the promoter of a gene of interest.
In the context of the present invention, a polydactyl zinc finger protein targeting "specifically" a gene promoter means that the protein has a binding affinity of 20 nM or less towards its DNA target. Thus "a polydactyl zinc finger protein targeting specifically a gene promoter" refers to a polydactyl zinc finger protein binding with a binding affinity of 20 nM or less than 20 mM towards a gene promoter. Binding affinity is preferably measured using enzyme linked DNA interaction assay (ELDIA) as described e.g. in the examples.
In the context of this invention, a promoter is defined as the regulatory region of a gene as well known in the art. Again in this context, a gene is defined, as well known in the art, as genomic region containing regulatory sequences as well as sequences for the gene product resulting in the production of proteins or RNAs.
In the context of this invention a regulatory domain refers to an activatory domain or an inhibitory domain.
In the context of this invention, an activatory domain or an activatory protein domain, both terms are used interchangeably herein, is a protein domain as known in the art that, when brought in contact with a promoter by a polydactyl zinc finger protein, increases production of gene product from the gene controlled by the promoter compared to the normal state.
In the context of this invention, an inhibitory domain or an inhibitory protein domain, both terms are used interchangeably herein, is a protein domain as known in the art that, when brought in contact with a promoter by a polydactyl zinc finger protein, decreases production of gene product from the gene controlled by the promoter compared to the normal state.
The artificial transcription factor of the present invention might also contain other
transcriptionally active protein domains of proteins defined by gene ontology GO:0001071 , such as an inhibitory domain selected from the group consisting of N-terminal KRAB, C- terminal KRAB, SID and ERD domains, preferably KRAB or SID. Activatory protein domains considered are the transcriptionally active domains of proteins defined by gene ontology GO:0001071 , such as an activatory domain selected from the group consisting of VP16,VP64 (tetrameric repeat of VP16), CJ7, p65-TA1 , SAD, NF-1 , AP-2, SP1-A, SP1-B, Oct-1 , Oct-2, Oct2-5x, MTF-1 , BTEB-2 and LKLF, preferably VP64 and LKLF.
In the context of this invention the transcriptionally active part of the artificial transcription factor comprises usually an inhibitory or activatory protein domain, a nuclear localization sequence and a zinc finger protein.
Again in the context of the invention, an endosome-specific protease cleavage site is a peptide sequence that is recognized and cleaved in a sequence-specific manner by proteases resident in the endosomal compartment. An endosome-specific protease cleavage site "recognized by an endosome- protease" as referred herein relates to an endosome- specific protease cleavage site that is recognized and cleaved by the endosome-specific protease. Such proteases are generally called cathepsins, as well known in the art. Thus usually an endosome-specific protease is a cathepsin, more specifically a cathepsin which is resident in the endosome i.e. a cathepsin which is resident in the endosomal compartments. A "cleavage site" as used in the present context represents an amino acid sequence, preferably an amino acid sequence of between about two and about 15, preferably between about two and about 10, more preferably between about four and about eight amino acids, which is recognized and cleaved by the particular endosome-specific protease. It has been surprisingly found by the inventors that endosome-specific proteases bind to an endosome- specific protease binding site which is located about 1 to about 50 amino acids, preferably about 5 to about 20 amino acids, more preferably about 5 to about 15 amino acids, upstream or downstream, preferably upstream of the peptide sequence that is recognized and cleaved by the endosome-specific protease i.e. upstream or downstream, preferably upstream of the endosome-specific protease cleavage site cleaved by endosome-specific protease. Usually the endosome-specific protease binding site comprises an amino acid sequence of up to 20 amino acids e.g. 1-20 amino acids, preferably an amino acid sequence up to 15 amino acids e.g. 1-15 amino acids, more preferably an amino acid sequence of five to15 amino acids. Unexpectedly, modification, i.e. substitution, insertion or deletion of one or more amino acids, preferably substitution of one or more amino acids within the amino acid sequence of the endosome-specific protease binding site alters, i.e. increases or decreases the cleavage sensitivity of the endosome-specific protease cleavage site. Thus by modification of the endosome-specific protease binding site the cleavage sensitivity of the cleavage site can be increased i.e. the cleavage site is digested by the endosome-specific protease more rapidly and/or more completely or the cleavage sensitivity of the cleavage site can be decreased i.e. the cleavage site is digested by the endosome-specific protease less rapidly and/or less completely compared to the unmodified endosome-specific protease binding site. "Cleavage sensitivity" as used herein refers to the degree or rate of digestion of a particular cleavage site by a particular endosome-specific protease.
Again in the context of this invention, a protein transduction domain is defined as a peptide capable of transporting proteins, such as artificial transcription factors, across the plasma membrane into the intracellular compartment by inducing endocytotic or macropinocytotic cellular uptake. Protein transduction domains considered are for example the HIV derived TAT peptide (SEQ ID NO: 1 ), mT02 (SEQ ID NO: 55), mT03 (SEQ ID NO: 56), R9 (SEQ ID NO: 57), ANTP (SEQ ID NO: 58) and others. Protein transduction domains are preferably selected from the group consisting of HIV derived TAT peptide (SEQ ID NO: 1 ), mT02 (SEQ ID NO: 55), mT03 (SEQ ID NO: 56), R9 (SEQ ID NO: 57), ANTP (SEQ ID NO: 58). More preferred is the HIV derived TAT peptide, most preferred is the HIV derived TAT peptide (SEQ ID NO: 1 ).
In the context of the present invention the term "about" is defined as plus or minus ten percent; for example, about 50 means 45 to 55.
In the context of the present invention, a membrane-bound receptor gene causes the production of a protein or a protein that is part of a protein complex capable of binding to extracellular ligands and relaying the signal of ligand binding across the cellular membrane causing a cellular response. Also in the context of the present invention, a nuclear receptor gene causes the production of a soluble protein localized to the nucleus or the cytosol capable of binding cell-permeable ligands and capable of acting as transcription factor or accessory to a transcription factor for the modulation of gene expression upon binding their cognate ligand. In the context of the present invention, a haploinsufficient gene is defined as a gene capable of causing the production of sufficient gene product in all cell types under all circumstances only if two functional gene copies are present in the genome. Thus, mutation of one gene copy of a haploinsufficient gene causes insufficient gene product generation in some or all cells of an organism under some or all physiological circumstances. Further, the artificial transcription factors of the invention comprise a nuclear localization sequence (NLS). Nuclear localization sequences considered are amino acid motifs conferring nuclear import through binding to proteins defined by gene ontology GO:0008139, for example clusters of basic amino acids containing a lysine residue followed by a lysine or arginine residue, followed by any amino acid, followed by a lysine or arginine residue (K-K/R- X-K/R consensus sequence, Chelsky D. et a/., 1989, Mol Cell Biol 9, 2487-2492) or the SV40 NLS (SEQ ID NO: 59), with the SV40 NLS being preferred. Considered are also artificial transcription factors of the invention containing tetrameric, pentameric, hexameric, heptameric, octameric, nonameric, or decameric zinc finger proteins where individual zinc finger modules are exchanged to improve binding affinity towards target sites of the respective nuclear receptor promoter gene, or to alter the immunological profile of the zinc finger protein for improved tolerability. Preferred are artificial transcription factors comprising an octameric or higher order zinc finger protein, more preferably an octameric, nonameric, decameric, undecameric and duodecameric zinc finger protein, in particular an octameric zinc finger protein. More particular preferred is an octameric zinc finger protein selected from the group consisting of SEQ ID NO: 345 and SEQ ID NO: 346. The domains of the artificial transcription factors of the invention may be connected by flexible or rigid linkers, in particular by flexible or rigid linkers comprising between about 1 and about 50 amino acids, preferably between about 1 and about 30 amino acids, more preferably between about 1 and about 15 amino acids. Particular linkers considered are selected from the group consisting of GGSGGS (SEQ ID NO: 60), EAAAK (SEQ ID NO: 61 ), EAAAKEAAAK (SEQ ID NO: 62), EAAAK EAAAK EAAAK (SEQ ID NO: 63),
AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 64), APAPAPAPAPAPAP (SEQ ID NO: 65), and EAAAKEAAAKKYPN EAAAKEAAAK (SEQ ID NO: 66). Linkers considered are also single amino acids such as a single amino acid with a small side chain e.g. glycine or alanine. Also linkers are considered which have two to five, preferably two amino acids such as aspartic acid and isoleucine. Artificial transcription factors may further contain markers, such as (but not limited to) epitope tags to ease their detection and processing.
Thus in a particular embodiment of the invention the artificial transcription factor further comprises a linker selected from the group consisting of G, A, Dl, GGSGGS (SEQ ID NO: 60), EAAAK (SEQ ID NO: 61 ), EAAAKEAAAK (SEQ ID NO: 62), EAAAKEAAAKEAAAK (SEQ ID NO: 63), AEAAAKEAAAKEAAAKEAAAKALEAEAAAKEAAAKEAAAKEAAAKA (SEQ ID NO: 64), APAPAPAPAPAPAP (SEQ ID NO: 65), and EAAAKEAAAKKYPN EAAAKEAAAK (SEQ ID NO: 66), preferably selected from the group consisting of G, A, Dl, and GGSGGS (SEQ ID NO: 60), more preferably selected from the group consisting of G and Dl. Preferably the linker is located upstream of the protein transduction domain in particular directly after the amino acid sequence of the protein transduction domain, between the endosome-specific protease cleavage site and the regulatory domain and/or downstream of the zinc finger protein of the artificial transcription factor in particular directly after the amino acid sequence of the zinc finger protein.
Treatment of many diseases is based on modulating cellular receptor signaling. Examples are high blood pressure where beta blockers inhibit the function of the beta adrenergic receptors, depression where serotonin uptake blockers increase agonist concentration and thus serotonin receptor signaling or glaucoma where prostaglandin analogues activate prostaglandin receptors in turn decreasing intraocular pressure. Traditionally, small molecules either in the form of receptor agonist or antagonists are used to impact receptor signaling for therapeutic purposes. However, cellular receptor signaling can also be influenced by direct modulation of receptor protein expression.
Pathological processes amenable to direct modulation of receptor expression levels are, for example, the following: Patients with congestive heart failure due to congenital heart disease will benefit from the upregulation of beta-adrenoceptors, since downregulation of this receptor in the myocardium is associated with the risk of post-operative heart failure. In Parkinson's disease, treatment with dopaminergic medication suppresses the availability of dopamine receptors, thus, upregulation of dopamine receptor will improve the efficacy of dopaminergic medication. In epilepsy, insufficient expression of cannabinoid receptors in the hippocampus is involved in disease etiology, thus, upregulation of cannabinoid receptor will be a viable therapy for epileptic patients.
For genetic diseases caused by haploinsufficiency of a receptor protein, such as insulin-like growth factor I receptor causing growth retardation, but also others, additional activation of the remaining functional receptor gene will be beneficial for the patient. Furthermore and among others, induction and perpetuation of pathological autoimmunity is connected to inappropriate signaling from Toll-like receptors. Thus, downregulation of Toll-like receptors breaks the vicious cycle of various autoimmune diseases. In allergic disease, prevention of the IgE-mediated signaling through the high-affinity IgE receptor is useful to manage allergic reactions. In cancer, downregulation of growth factor receptors or upregulation of extracellular matrix receptors are beneficial for the prevention of tumor progression.
Among such receptor molecules are proteins from the so called seven-transmembrane or G protein coupled receptor (GPCR) family of proteins, characterized by seven transmembrane domains anchoring the receptor in the plasma membrane and a G protein dependent signaling cascade. Examples for such proteins are receptors A and B for endothelin. Other receptor proteins are anchored via a single transmembrane region, for example the receptor for lipopolysaccharide, Toll-like receptor 4, or various cytokine receptors such as IL-4
receptor. Other receptors consist of multimeric protein complexes, for example the high- affinity receptor for IgE antibodies that consists of alpha, beta and gamma chains, or the T- cell receptor consisting of alpha, beta, gamma, delta, epsilon and zeta chains. Thus, subsumed under the term "receptor molecule" are proteins from different protein families with very different modes of action.
Receptors considered in the present invention are human receptor molecules encoded by HTR1A, HTR1B, HTR1D, HTR1E, HTR1F, HTR2A, HTR2B, HTR2C, HTR4, HTR5A,
HTR5BP, HTR6, HTR7, CHRM1, CHRM2, CHRM3, CHRM4, CHRM5, ADORA 1, ADORA2A, ADORA2B, ADORA3, ADRA 1A, ADRA 1B, ADRA 1D, ADRA2A, ADRA2B, ADRA2C, ADRB1, ADRB2, ADRB3, AGTR1, AGTR2, APLNR, GPBAR1, NMBR, GRPR, BRS3, BDKRB1, BDKRB2, CNR1, CNR2, CCR1, CCR2, CCR3, CCR4, CCR5, CCR6, CCR7, CCR8, CCR9, CCR10, CXCR1, CXCR2, CXCR3, CXCR4, CXCR5, CXCR6, CXCR7, CX3CR1, XCR1 , CCKAR, CCKBR, C3AR1, C5AR1, GPR77, DRD1, DRD2, DRD3, DRD4, DRD5, EDNRA, EDNRB, GPER, FPR1, FPR2, FPR3, FFAR1, FFAR2, FFAR3, GPR42, GALR1, GALR2, GALR3, GHSR, FSHR, LHCGR, TSHR, GNRHR, GNRHR2, HRH1, HRH2, HRH3, HRH4, HCAR1, HCAR2, HCAR3, KISS1R, LTB4R, LTB4R2, CYSLTR1, CYSLTR2, OXER1, FPR2, LPAR1, LPAR2, LPAR3, LPAR4, LPAR5, S1PR1, S1PR2, S1PR3, S1PR4, S1PR5, MCHR1, MCHR2, MC1R, MC2R, MC3R, MC4R, MC5R, MTNR1A, MTNR1B, MLNR, NMUR1, NMUR2, NPFFR1, NPFFR2, NPSR1, NPBWR1, NPBWR2, NPY1R, NPY2R, PPYR1, NPY5R, NPY6R, NTSR1, NTSR2, OPRD1, OPRK1, OPRM1, OPRL1, HCRTR1, HCRTR2, P2RY1, P2RY2, P2RY4, P2RY6, P2RY11, P2RY12, P2RY13, P2RY14, QRFPR, PTAFR, PROKR1, PROKR2, PRLHR, PTGDR, PTGDR2, PTGER1, PTGER2, PTGER3, PTGER4, PTGFR, PTGIR, TBXA2R, F2R, F2RL1, F2RL2, F2RL3, RXFP1, RXFP2, RXFP3, RXFP4, SSTR1, SSTR2, SSTR3, SSTR4, SSTR5, TACR1, TACR2, TACR3, TRHR, TAAR1, UTS2R, AVPR1A, AVPR1B, AVPR2, OXTR, CCRL2, CMKLR1, GPR1, GPR3, GPR4, GPR6, GPR12, GPR15, GPR17, GPR18, GPR19, GPR20, GPR21, GPR22, GPR25, GPR26, GPR27, GPR31, GPR32, GPR33, GPR34, GPR35, GPR37, GPR37L1, GPR39, GPR42, GPR45, GPR50, GPR52, GPR55, GPR61, GPR62, GPR63, GPR65, GPR68, GPR75, GPR78, GPR79, GPR82, GPR83, GPR84, GPR85, GPR87, GPR88, GPR101, GPR119, 03FAR1, GPR132, GPR135, GPR139, GPR141, GPR142, GPR146, GPR148, GPR149, GPR150, GPR151, GPR152, GPR153, GPR160, GPR161, GPR162, GPR171, GPR173, GPR174, GPR176, GPR182, GPR183, LGR4, LGR5, LGR6, LPAR6, MAS1, MAS1L, MRGPRD, MRGPRE, MRGPRF, MRGPRG, MRGPRX1, MRGPRX2, MRGPRX3, MRGPRX4, OPN3, OPN5, OXGR1, P2RY8, P2RY10, SUCNR1, TAAR2, TAAR3, TAAR4P, TAAR5, TAAR6, TAAR8, TAAR9, CCBP2, CCRL1, DARC, CALCR, CALCRL, CRHR1, CRHR2, GHRHR, GIPR, GLP1R, GLP2R, GCGR, SCTR, PTH1R, PTH2R, ADCYAP1R1, VIPR1, VIPR2, BAH, BAI2, BAI3, CD97, CELSR1, CELSR2, CELSR3, ELTD1, EMR1, EMR2, EMR3, EMR4P, GPR56, GPR64, GPR97, GPR98, GPR110, GPR111, GPR112, GPR113, GPR114, GPR115, GPR116, GPR123, GPR124, GPR125, GPR126, GPR128, GPR133, GPR144, GPR157, LPHN1, LPHN2, LPHN3, CASR, GPRC6A, GABBR1, GABBR2, GRM1, GRM2, GRM3, GRM4, GRM5, GRM6, GRM7, GRM8, GPR156, GPR158, GPR179, GPRC5A, GPRC5B, GPRC5C, GPRC5D, TAS1R1, TAS1R2, TAS1R3, FZD1, FZD2, FZD3, FZD4, FZD5, FZD6, FZD7, FZD8, FZD9, FZD10, SMO, GPR107, GPR137, OR51E1, TPRA 1, GPR143, THRA, THRB, RARA, RARB, RARG, PPARA, PPARD, PPARG, NR1D1, NR1D2, RORA, RORB, RORC, NR1H4, NR1H5P, NR1H3, NR1H2, VDR, NR1I2, NR1I3, HNF4A, HNF4G, RXRA, RXRB, RXRG, NR2C1, NR2C2, NR2E1, NR2E3, NR2F1, NR2F2, NR2F6, ESR1, ESR2, ESRRA, ESRRB, ESRRG, AR, NR3C1, NR3C2, PGR, NR4A 1, NR4A2, NR4A3, NR5A 1, NR5A2, NR6A 1, NR0B1, NR0B2, HTR3A, HTR3B, HTR3C, HTR3D, HTR3E, GABRA 1, GABRA2, GABRA3, GABRA4, GABRA5, GABRA6, GABRB1, GABRB2, GABRB3, GABRG1, GABRG2, GABRG3, GABRD, GABRE, GABRQ, GABRP, GABRR1, GABRR2, GABRR3, GLRA 1, GLRA2, GLRA3, GLRA4, GLRB, GRIA1, GRIA2, GRIA3, GRIA4, GRID1, GRID2, GRIK1, GRIK2, GRIK3, GRIK4, GRIK5, GRIN1, GRIN2A, GRIN2B, GRIN2C, GRIN2D, GRIN3A, GRIN3B, CHRNA 1, CHRNA2, CHRNA3, CHRNA4, CHRNA5, CHRNA6, CHRNA7, CHRNA9, CHRNA 10, CHRNB1, CHRNB2, CHRNB3, CHRNB4, CHRNG, CHRND, CHRNE, P2RX1, P2RX2, P2RX3, P2RX4, P2RX5, P2RX6, P2RX7, ZACN, AGER, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, TLR10, TLR11, LILRA 1, LILRA2, LILRA3, LILRA4, LILRA5, LILRA6, LILRB1, LILRB2, LILRB3a ,LILRB4, LILRB5 ,LILRB6, LILRB7, EGFR, ERBB2, ERBB3, ERBB4, GFRal, GFRa2, GFRa3, GFRa4, NPR1, NPR2, NPR3, NPR4, NGFR, NTRK1, NTRK2, NTRK3, EGFR, ERB2, ERB3, ERB4, INSR, IRR, IG1R, PDGFalpha, PDGFbeta, Fms, Kit, Flt3, FGFR1, FGFR2, FGFR3, FGFR4, BFR2, VGR1, VGR2, VGR3, EPA 1, EPA2, EPA3, EPA4, EPA5, EPA7, EPA8, EPB1, EPB2, EPB3, EPB4, EPB6, TrkA, TrkB, TrkC, UFO, TYR03, MERK, TIE1, TIE2, RON, MET, DDR1, DDR2, RET, ROS, LTK, ROR1, ROR2, RYK, PTK7, and KIT. Further receptors considered are human receptors recognizing interleukin (IL)-1 , IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1 1 , IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL- 19, IL-20, IL-21 , IL-22, IL-23, IL-24, IL-25, IL-26, IL-27, IL-28, IL-29, IL-30, IL-31 , IL-32, IL-33, IL-34, IL-35, IL-36, IL-37, IL-38, leptin, interferon-alpha, interferon-beta, interferon-gamma, tumor necrosis factor alpha, lymphotoxin, prolactin, oncostatin M, leukemia inhibitory factor, colony-stimulating factor, immunoglobulin A, immunoglobulin D, immunoglobulin G, immunoglobulin M, immunoglobulin E, human leukocyte antigen (HLA) A, HLA-B, HLA-C, HLA-E, HLA-F, HLA-G, H LA-DP, HLA-DQ, HLA-DR, transforming growth factor alpha, transforming growth factor beta, nerve growth factor, brain-derived neurotrophic factor, neurotrophin-3, neurotrophin-4, adrenomedullin, angiopoietin, autocrine motility factor, bone morphogenetic proteins, erythropoietin, fibroblast growth factor, glial cell line-derived neurotrophic factor, granulocyte colony-stimulating factor, granulocyte macrophage colony- stimulating factor, growth differentiation factor-9, hepatocyte growth factor, hepatoma-derived growth factor, insulin-like growth factor, insulin, migration-stimulating factor, myostatin, platelet-derived growth factor, thrombopoietin, vascular endothelial growth factor, placental growth factor, connective tissue growth factor, and growth hormone.
Further considered are receptors encoded by homologous non-human genes, for example by porcine, equine, bovine, feline, canine, or murine genes; and receptors encoded by homologous plant receptor genes, for example genes found in crop plants such as wheat, barley, corn, rice, rye, oat, soybean, peanut, sunflower, safflower, flax, beans, tobacco, or life- stock feed grasses, and genes found in fruit plants such as apple, pear, banana, citrus fruit, grape or the like. In contrast to almost all other cellular receptors that are membrane-anchored and consist or contain membrane-spanning proteins, nuclear receptors are soluble proteins incorporating ligand binding and transcription factor activity in one polypeptide. Nuclear receptors are either localized in the cytosol or the nucleoplasm where they are activated upon ligand binding, dimerize and become active transcription factors regulating a vast array of transcriptional programs. Unlike above mentioned membrane-anchored receptors that bind their ligands outside the cell and transduce the signal across the plasma membrane into the cell, nuclear receptors bind lipophilic ligands that are capable of crossing the plasma membrane to gain access to their cognate receptor. In addition, most receptors rely on intricate signal amplification mechanisms before the intended cellular outcome is achieved. Nuclear receptors, on the other hand, directly convert the binding of a ligand into a cellular response.
Treatment of many diseases is based on modulating nuclear receptor signaling. Examples are inflammatory processes where glucocorticoids activate the glucocorticosteriod receptor, prostate cancer where antagonists of androgen receptor possess beneficial therapeutic effect, or breast cancer where blocking estrogen receptor signaling proves useful.
Traditionally, small molecules either in the form of nuclear receptor agonist or antagonists are used to impact receptor signaling for therapeutic purposes. However, nuclear receptor signaling can also be influenced by direct modulation of nuclear receptor protein expression, and such modulation is the subject of the present invention.
Nuclear receptors considered in the present invention are human nuclear receptors encoded by the human genes AR, ESR1, ESR2, ESRRA, ESRRB, ESRRG, HNF4A, HNF4G, NR0B1, NR0B2, NR1D1, NR1D2, NR1H2, NR1H3, NR1H4, NR1I2, NR1I3, NR2C1, NR2C2, NR2E1, NR2E3, NR2F1, NR2F2, NR2F6, NR3C1, NR3C2, NR4A 1, NR4A2, NR4A3, NR5A 1, NR5A2, NR6A 1, PGR, PPARA, PPARD, PPARG, RARA, RARB, RARG, RORA, RORB, RORC, RXRA, RXRB, RXRG, THRA, THRB and VDR.
Further considered are non-human nuclear receptors, for example porcine, equine, bovine, feline, canine, or murine transcription factors, encoded by genes related to the mentioned human nuclear receptor genes.
For genetic diseases caused by haploinsufficiency of a gene promoter, such as insulin-like growth factor I receptor haploinsufficiency causing growth retardation or OPA 1 haploinsufficiency causing dominant optic atrophy, but also others, additional activation of the remaining functional gene copy is beneficial for the patient. Artificial transcription factors of the invention are capable of increasing expression from haploinsufficient gene promoters, thus suited for the treatment of diseases associated with haploinsufficiency.
Considered in the present invention are the following human genes and their respective promoters associated with haploinsufficiency and disease as amenable to treatment using artificial transcription factors of the invention: PRKAR1A, FBN1, ELN, TCOF1, ENG, GLI3, TCF4, GRN, NKX2-1, SOX10, SHOX, MC4R, GATA3, NKX2-5, TBX1, COL10A 1, PAX6, LMX1B, BMPR2, PAX9, SOX9, TRPV4, SPAST, TBX5, TWIST1, EHMT1, FOXC2, TBX3, TNXB, DSP, OPA 1, TRPS1, RUNX2, SCN1A, HOXD13, NSD1, SATB2, PRPF31, SOX2, COL6A1, APC, RAI1, PAX3, ZEB2, SLC40A 1, AFG3L2, KCNQ2, SALL1, PPARG, GDF5, GCH1, MYH9, SALL4, PITX2, FOXF1, RAD51, PKD2, NFKBIA, MSX1, MSX2, COL3A 1, SH3TC2, SBDS, SIX6, KRIT1, SLC33A 1, PARK2, ABCA4, MYOC, PAFAH1B1, CDKN1C, CREBBP, FGF3, MYF6, MPZ, ITPR1, EDN3, C3, TYRP1, OFC12, ATM, FOXP2, PHOX2B, COCH, PITX1, EYA 1, FOXC1, KLF1, GATA4, KIT, MYCN, COL5A 1, RNF135, MIR146A, SI, NLRP12, NDUFA 13, SPRED1, REEP1, SLC6A 19, CHD7, NCF1, IRF6, RXFP2, ZMPSTE24, ATL1, EGLN1, NLRP3, KIF1B, BCM01, SLC6A20, FOXL2, RTN4R, TSC1, WWOX, POLG2, LGI1, RECQL3, CNTNAP2, ATP2C1, KCNQ4, RPS19, ABCC6, STXBP1, NBN, ROB01, ROR2, AGRP, STK11, KCNJ10, LHX4, FGF10, LIG4, ACVRL1, CAV3, GDF6, SMAD4, MYBPC3, IRS2, MSH6, ABCC8, GARS, CDKN2A, PORCN, PHEX, ARX, DMD, TPM1, NOTCH1, ABU, RYR1, PTH1R, PAX8, PAX2, BRAF, MAPT, MC3R, KCNH2, LMNA, KRT5, SOD1, IGF1, MNX1, HNF1A, SLC2A 1, GCK, GABRG2, FUS, DSG2, DCC, OFC1, CHRNA4, BRCA 1, BDNF, BMP2, ATP2A2, ALX4, MITF, SIX3, SMARCB1, RANBP2, GDNF, MYC, ATP1A2, SLC6A4, FOXG1, IGF1R, FGFR1 and SERPINA6.
Further considered are non-human genes, for example porcine, equine, bovine, feline, canine, or murine genes, as well as their homologous human genes as well as plant genes, for example genes found in crop plants such as wheat, barley, corn, rice, rye, oat, soybean, peanut, sunflower, safflower, flax, beans, tobacco, or life-stock feed grasses, and genes found in fruit plants such as apple, pear, banana, citrus fruit, grape or the like, under the control of a haploinsufficient promoter. Using the traditional small molecule approach, the identification of therapeutically active small molecules acting through modulation of protein activity mostly relies on extensive and time- consuming screening procedures among a wide variety of different molecules from different classes of substances and modulation of gene expression by small molecules is so far not possible. In contrast, artificial transcription factors of the invention all belong to the same substance class with a highly defined overall composition. Two hexameric zinc finger protein- based artificial transcription factors targeting two very diverse promoter sequences still have a minimal amino acid sequence identity of 85 % with an overall similar tertiary structure and can be generated via a standardized method (as described below) in a fast and economical manner. Thus, artificial transcription factors of the invention combine, in one class of molecule, exceptionally high specificity for a very wide and diverse set of targets with overall similar composition. As for all biologicals, immunogenicity in the form of anti-drug antibodies and the associated immunological reaction are a concern. However, due to the high conservation of zinc finger modules such an immunological reaction will be minor or absent following application of artificial transcription factors of the invention, or might be avoided or further minimized by small changes to the overall structure eliminating immunogenicity while still retaining target site binding and thus function. Furthermore, modification of artificial transcription factors of the invention with polyethylene glycol is considered to reduce immunogenicity.
And since artificial transcription factors are tailored to act specifically on the promoter region of specific genes, the use of artificial transcription factors allows for selectively targeting even closely related proteins. This is based on the only loose conservation of the promoter regions even of closely related proteins. Taking advantage of the high selectivity of the artificial transcription factors according to the invention, even a tissue-specific targeting of a drug action is possible based on the oftentimes tissue-specific expression of certain members of a given protein family that are individually addressable using artificial transcription factors.
However, artificial transcription factors need to be present in the nuclear compartment of cells in order to be effective as they act through modulation of gene expression. Until now, the method of choice for the therapeutic delivery of artificial transcription factors is either in the form of plasmid DNA through transfection or by employing viral vectors. Plasmid transfection for therapeutic purposes has low efficacy, while viral vectors have exceptionally high potential for immunogenicity, thus limiting their use in repeated application of a certain treatment. Thus other modes of delivering artificial transcription factors for example in protein form instead of as nuclei acid are required.
Transport of proteins through protein transduction domains
Protein transduction domain (PTD) mediated, intracellular delivery of artificial transcription factors is a new way of taking advantage of the high selectivity and versatility of artificial transcription factors in a novel fashion (WO/2013/053719 A2). Protein transduction domains are small peptides capable of crossing the plasma membrane barrier and delivering cargo proteins into the cell. Such protein transduction domains are for example the HIV derived TAT peptide, mT02, mT03, R9, ANTP and others. The mode of cellular uptake is likely by endocytosis and it was shown that the TAT peptide is able to induce a cell-type independent macropinocytotic uptake when fused to cargo proteins (Wadia J.S. et a/., 2004, Nat Med 10, 310-315). While crossing the barrier of the plasma membrane and uptake into endosomal vesicles is the first step in entering the cell, topologically, the inside of the endosomal compartment is identical to the outside of the cell. Thus, endosomal localization is not equivalent to cytoplasmic or nucleoplasms localization. Likely through leakiness of the endosomal compartment and/or some intrinsic property of the cargo or the PTD in terms of modulating membrane integrity, delivered proteins are capable to escape endosomes and reach other truly intracellular targets to some extent. However, the amount of protein successfully escaping the endosomal compartment and able to reach the intended subcellular compartment is miniscule and severely hampers the effectiveness of therapeutical proteins as the effective dose at the site of action is considerable below the applied dose. As the endosomal compartment matures and fuses to the lysosomal compartment, the endosomal content is exposed to various proteases and low pH leading to the hydrolysis of the PTD-delivered protein. This was recognized early in the development of PTDs such as the TAT peptide for therapeutic protein delivery and was characterized as endosomal entrapment. Two strategies were developed to counteract endosomal entrapment and to achieve more efficient endosomal escape following protein transduction. Both strategies aim at disruption of the endosomal membrane with the aim to expose the content of the endosome and therefore the PTD-delivered protein to the cytosol. One such strategy is to interfere with the osmotic balance of the endosome by employing endolysosomotropic agents such as chloroquine or so called proton sponges such as polyhistidine-tags. Disruption of the osmotic balance leads to a swelling of the endosome causing endosomal rupture. A second proposed strategy to enhance endosomal escape is the co-delivery of the membrane-active, fusogenic peptide TATHA2 or others such as GALA or KALA peptide. These peptides are able to interact with the endosomal membrane from the inside and cause membrane rupture. Indeed, mechanisms capable of disrupting the endosomal membrane are the state-of-the-art for increased endosomal escape of cargo proteins delivered using a protein transduction domain.
Artificial transcription factors targeting the ETRA or the FcER1 A promoter Using modified yeast-one-hybrid screening, hexameric zinc finger proteins were selected from a zinc finger protein library based on their binding to 18 bp DNA target sites selected from the human ETRA or human FcERIA promoter. These zinc finger proteins were incorporated into fusion proteins containing, listed from the N- to the C-terminus, a hexa- histidine tag, a TAT protein transduction domain, a HA tag, optionally a cathepsin cleavage site, a SID negative regulatory domain, a SV40 nuclear localization sequence, a gene promoter specific hexameric zinc finger protein, and a triple myc epitope tag. Using an ETRA promoter specific zinc finger protein, the artificial transcription factors ATF1488 (SEQ ID NO: 67) lacking a purposefully introduced cathepsin cleavage site, and the cathepsin cleavage site-containing ATF1688 (SEQ ID NO: 68) were generated. Through mutation of all zinc- coordinating cysteine residues in the zinc finger protein resulting in loss of DNA-binding ability, inactive artificial transcription factor ATF1714 (SEQ ID NO: 69) based on ATF1488, and ATF1806 (SEQ ID NO: 70) based on ATF1688 were generated. Using an FcERIA promoter specific zinc finger protein, the artificial transcription factors ATF1572 (SEQ ID NO: 71 ) lacking a purposefully introduced cathepsin cleavage site, and the cathepsin cleavage site-containing ATF1880 (SEQ ID NO: 72) were generated. Based on ATF1880, octameric zinc finger protein ZFP-147Aocta (SEQ ID NO: 346) containing ATF2729 (SEQ ID NO: 196) was generated targeting also the human FcERIA promoter. Through mutation of all zinc- coordinating cysteine residues in ATF1880, inactive ATF1881 (SEQ ID NO: 73) was generated.
Fusogenic peptide fails to increase activity of artificial transcription factors
Membrane disrupting agents are not as efficient in promoting delivery as expected from reports in the literature. In fact, no benefit was seen in terms of increased activity for a transduced artificial transcription factor when co-delivered with TATHA2 (Figure 1 ). Cells expressing luciferase reporter under control of a promoter regulatable by the anl\-ETRA specific artificial transcription factor ATF1488 were treated with the fusogenic peptide TATHA2 or left untreated as control in the presence of ATF1488 or an inactive control (ATF1714). While treatment with ATF1488 suppressed expression of the luciferase reporter compared to control as expected, additional treatment with fusogenic peptide did not result in increased activity of ATF1488. Thus, additional endosomal rupture through the activity of TATHA2 did not enhance artificial transcription factor activity. Endosomal entanglement caused by protein transduction domains
Careful microscopic analyses of cellular uptake of transducible artificial transcription factors resulted in a surprising finding. Interestingly, in a large percentage of cells stained for TAT- artificial transcription factor, ruptured endosomal vesicles were found open to the cytosol with endosomal membranes clearly decorated with TAT fusion protein consistent with endosomal entanglement of a considerable amount of delivered protein even after endosomal membrane rupture. This surprising and unexpected finding might be explained with the inherent properties of protein transduction domains. Protein transduction domains are known to strongly interact with cellular membranes. This strong membrane interaction is part of the mechanism by which protein internalization and thus protein delivery is triggered. Thus, following internalization into endosomes, this strong membrane-interaction of the protein transduction domain, now with the inside of the endosomal membrane, might actually inhibit redistribution to other subcellular locations even after the rupture of endosomal vesicles. Therefore, TAT -fused artificial transcription factors may mainly reside in the endosomal compartment with some nuclear localization. Thus, while essential for uptake into the cell, protein transduction domains hinder efficient subcellular localization once protein transduction takes place. PTD is dispensable after entry of cargo into the endosomal compartment, and removal of the PTD at this point of the transport of artificial transcription factors to the nucleus might reverse the entanglement with the endosomal membrane.
Endosomal disentanglement through targeted, endosome-specific proteolytic processing of artificial transcription factors The removal of the TAT protein transduction domain from the artificial transcription factor following entry into the endosomal compartment is beneficial for the successful delivery of artificial transcription factors to the nuclear compartment. Inclusion of a specific cathepsin cleavage site between the TAT protein transduction domain and the transcriptionally active part of the artificial transcription factor protein turns out to be beneficial and increases the amount of zinc finger protein reaching the intended target. As shown in Figure 2, removal of the PTD through the action of endosome-specific proteases following entry into the endosomal compartment will lead to the disentanglement of the active artificial transcription protein from the inside of the endosomal membrane. This will allow for the efficient exit of the active artificial transcription factor from the endosomal compartment once the endosomal membrane is ruptured and will facilitate its efficient nuclear import and allow for the intended target gene regulation.
According to the state of the art, which suggests the use of endolysosomotropic agents, such as chloroquine, or fusogenic peptides, such as TATHA2, the mere separation of the protein transduction domain from the artificial transcription factor is not expected to boost endosomal escape and to increase nuclear localization. However, inclusion of a cathepsin cleavage site into artificial transcription factors between the PTD and the transcriptionally active part of the protein unexpectedly and significantly increased nuclear localization (Figure 3). Nuclear import of artificial transcription factors was analyzed in HeLa cells treated with the ETRA- specific ATF1488 or the E7/¾A-specific ATF1688 containing an additional endosome-specific protease cleavage site. Increased nuclear import of ATF1688 is proven by four times higher mean nuclear fluorescence intensity in ATF1688-treated cells compared to ATF1488-treated control cells. Furthermore, in a luciferase reporter assay, ATF1688 displayed increased activity compared to ATF1488 resulting in a superior suppression of luciferase activity (Figure 4). Also, inclusion of a cathepsin cleavage site into an FcER 7/A-specific artificial transcription factor resulted in increased activity in a luciferase reporter assay as shown following treatment of reporter cells with the ATF1572 lacking a specific cathepsin site compared to treatment with the cathepsin-site containing ATF1880 (Figure 5).
Cell-type and tissue-specific expression of cathepsins
Cathepsin-mediated enhanced endosomal disentanglement critically depends on the expression of the cathepsins for which the corresponding cleavage site was introduced into an artificial transcription factor. Insufficient expression of such cathepsins in a target cell type would prevent enhanced endosomal disentanglement and increased nuclear localization.
Thus, analysis of cathepsin expression in the intended target cell type is necessary for the prediction of successful enhanced endosomal disentanglement. In fact, knowing the cathepsin complement of a given target cell type enables one to employ appropriate cathepsin cleavage sites when engineering transducible artificial transcription factors for enhanced endosomal disentanglement. As shown in Figure 6, expression levels of various cathepsins, and thus likely cathepsin activity, differ between various cell lines. To determine the expression of different cathepsins in various cell types, mRNA levels of cathepsin B, D, F, G, H, K, L, and S compared to GAPDH as control were determined in retinal pigment epithelial cells (ARPE19), human meningothelial cells (Ben-Men-I), human keratinocytes (HaCat), human embryonic kidney cells (HEK293), HeLa cells grown in normal or synthetic media, human endothelial cells (HMEC-1 ), human astrocytes, human primary keratinocytes, human primary fibroblasts, human pericytes, human uterine smooth muscle cells (hUtSMCs), and human neuron-like cells (SH-SY5Y). Interestingly, not all cathepsins are expressed to a similar level. When compared to the housekeeping gene GAPDH, cathepsins B, H, and K can reach up to 6 % of GAPDH expression level in certain cell types, while other cathepsins such as F, G, L, and S are expressed at levels below 1 % of GAPDH expression level.
Interestingly, cathepsin D can reach up to 60 % of GAPDH expression level. While there is considerable difference in the average expression level of cathepsins with cathepsins F, G, L, and S considered of low abundance, cathepsin B, H, and K considered of medium
abundance and cathepsin D considered of high abundance, cathepsin expression levels also vary considerably between different cell types.
Based on these data and as an example for endosomal disentanglement in human smooth muscle cells, incorporation of sites sensitive to digestion by cathepsin B, D and K is preferred over incorporation of sites sensitive to cleavage by cathepsin G. As a further example for endosomal disentanglement in human smooth muscle cells, incorporation of sites sensitive to digestion by cathepsin B, D, K and I is preferred. In such cases enhanced endosomal disentanglement is accomplished in smooth muscle cells.
Expression of cathepsins in tissues of the eye While cathepsin expression profiling in cultured cells is already helpful to decide on suitable cathepsin cleavage sites for inclusion into artificial transcription factors to enhance endosomal disentanglement, defining cathepsin expression of potential target cells in target tissues is important to rationally design artificial transcription factors for maximal and cell type-specific endosomal disentanglement. And interestingly, analysis of ATF1688 localization in porcine retina following intravitreal injection revealed exceptional nuclear translocation of this artificial transcription factor into cells of the neural retina, such as photoreceptor or retinal ganglion cells. However, only minimal nuclear translocation of ATF1688 was found in smooth muscle cells of retinal vessels, potential target cells for this E7/¾A-specific artificial transcription factor. This differential pharmacokinetic profile of ATF1688 can likely be attributed to differential expression of cathepsins in different cell types of the retina, as endosomal disentanglement critically depends on the cathepsin inventory of cells.
To allow for the rational design of artificial transcription factors with tissue-specific endosomal disentanglement and to improve endosomal disentanglement of ATF1688 in smooth muscle cells of the retinal vessels, the cathepsin expression pattern was determined in eye tissues. To this end and using specific antibodies, expression of cathepsins B, D, E, F, G, H, K, L, and S was determined in human (Table 1 ) and African green monkey eyes (Table 2). Analysis of cathepsin expression in these tissues revealed a complex picture of cathepsin expression in smooth muscle cells of retinal vessels and other cell types of the retina.
Table 1 : Expression of cathepsins B, D, E, F, G, H, K, L and S in smooth muscle cells of vessels in the human eye evaluated by staining of human eye tissue with specific anti- cathepsin antibodies
Cathepsin B D E F G H K I S
Smooth muscle cells in
arteria centralis retinae high high low n.d. n.d. n.d. - high n .d . main branches of central artery high high low high - - high high h igh retinal vessels
vein high low low high - - high high low arteries on both sides of optic high high - low - high high - nerve
choroid vessels low low - high - low low low retinal arterioles high high - high - - high high low iridial plexus high high high low - - high high high
- no expression; n.d. not determined.
Cathepsin expression was graded as high for immunoreactivity that reached at least 20% of the highest immunoreactivity for a given cathepsin otherwise cathepsin expression was graded as low as judged by an experienced pathologist.
Table 2: Expression of cathepsins B, D, F, K, and L in smooth muscle cells (SMCs) of vessels in the Chlorocebus sabaeus (African Green Monkey) eye evaluated by staining of eye tissue with specific anti-cathepsin antibodies
Figure imgf000043_0001
- no expression; n.d. not determined.
Cathepsin expression was graded as high for immunoreactivity that reached at least 20% of the highest immunoreactivity for a given cathepsin otherwise cathepsin expression was graded as low as judged by an experienced pathologist.
In a particular embodiment the artificial transcription factor of the present invention targets smooth muscle cells of vessels in the human eye i.e. is applied to smooth muscle cells of vessels in the human eye wherein the one single or two or more endosome-specific protease cleavage sites are cleaved by cathepsins selected from the group consisting of B, D, K and I, preferably selected from the group consisting of B, D and K.
In a further particular embodiment the artificial transcription factor of the present invention comprises one single or two or more endosome-specific protease cleavage sites which are selected according to the abundance of the endosome-specific proteases in the target cell type of the artificial transcription factor. "Abundance of the endosome-specific proteases in the target cell type" is referred herein as abundance of endosome-specific proteases which are expressed in the target cell type at an expression level which provides for an
immunoreactivity that reaches at least 20% of the immunoreactivity for cathepsin D expressed in smooth muscle cells in arteria centralis retinae in the human eye as referred to e.g. in Table 1 and as measured as described in the examples.
Altering the sensitivity of artificial transcription factors towards cathepsin cleavage for optimizing endosomal disentanglement in a target cell-dependent manner
Modulating the sensitivity of an artificial transcription factor towards cathepsin cleavage by including different cathepsin cleavage sites is a means to modulate endosomal
disentanglement and therefore nuclear import into a given target cell type. Given that various target cell types contain different cathepsin inventories, inclusion of cathepsin-sensitive sites recognized by cathepsins present in the target cell will promote endosomal disentanglement, while inclusion of sites not compatible with the specific cathepsin inventory of the target cell will not support disentanglement.
Most cathepsins exhibit some sequence specificity for their endopeptidase activity and some cleavage sites and various consensus sequences for different cathepsins are described in the literature. However, defining useful cleavage sites for incorporation into artificial transcription factors of the invention to achieve enhanced endosomal disentanglement and especially to achieve cell type-specific nuclear transduction is not trivial. The context in which a cathepsin site is embedded within the artificial transcription factor is likely to be important for the efficacy by which these sites are cleaved by various cathepsins. Thus, cathepsin sensitivity of potential peptide sequences for the promotion of endosomal disentanglement needs to be defined in the context of artificial transcription factors. To this end, the cathepsin-sensitive site (CS1 ) in ATF1688 was exchanged by other potential cleavage sites (CS2-CS18, see Table 3) and the resulting artificial transcription factors were incubated with purified cathepsins B, D, K, L, and S in vitro. Analysis of the artificial transcription factor cleavage products by western blot revealed that alternative cathepsin sites are differentially recognized and digested (cleaved) by different cathepsins (Table 4). Table 3: List of names and amino acid sequence of potential cleavage sites (CS) and the names of ATF1688-based E77¾A-specific artificial transcription factors containing these sequences.
Figure imgf000045_0001
Table 4 : Sensitivity of different potential cathepsin cleavage sites in the context of an artificial transcription factor of the invention towards in vitro digestion with cathepsin B, D, K, L, and S. cleavage site cath B cath D cath K cath L cath S
CS1 (ATF1688) medium high high medium high
CS2 (ATF2403) medium low medium low low CS3 (ATF2404) low low low low low
CS4 (ATF2405) low low medium low medium
CS5 (ATF2406) low low medium low medium
CS6 (ATF2407) low medium high medium high
CS7 (ATF2443) medium high high high high
CS8 (ATF2444) low low low low low
CS9 (ATF2445) low high medium low low
CS10 (ATF2446) low high medium medium medium
CS1 1 (ATF2447) low high high medium medium
CS12 (ATF2448) low low medium low medium
CS13 (ATF2449) low high low low n.d.
CS14 (ATF2450) low medium medium low low
CS15 (ATF2451 ) low high high medium medium
CS16 (ATF2452) medium high high high high
CS17 (ATF2453) low high medium low low
CS18 (ATF2454) low medium low low low
The sensitivity of the potential cleavage site towards a specific cathepsin is graded into low, medium and high. Off-target cleavage products smaller than 26 kDa were not considered. Cleavage of an artificial transcription factor at the intended target site by a given cathepsin was graded as low for peaks between about 1 and 5% of the maximal peak height, medium for peaks above 5% and below 20% of maximal peak height and high for peaks above 20% of maximal peak height.
Productive cleavage leading to the disentanglement of functional artificial transcription factors results in the generation of C-terminal cleavage products above 26 kDa in size. These cleavage products contain the regulatory SID domain, the nuclear localization sequence and the DNA-binding zinc finger protein domain and constitute an active artificial transcription factor, i.e. a transcriptionally active part of the artificial transcription factor. Such cleavage products can be detected following digestion of ATF1688 with cathepsin B, D, K, L, and S, ATF2403 with cathepsin B and K, ATF2405 with cathepsin K and S, ATF2406 with cathepsin K and S, and ATF2407 with cathepsin D, K, L, and S. Furthermore, such cleavage products can be detected following digestion of ATF2443 with cathepsin B, D, K, L, and S, ATF2445 with cathepsin D and K, ATF2446 and ATF 2447 with cathepsin D, K, L, and S. Productive cleavage events are also detected for ATF2448 digested with cathepsin K and S, ATF2449 digested with cathepsin D, ATF2450 digested with cathepsin D and K, ATF2451 digested with cathepsin D, K, L, and S, ATF2452 digested with B, D, K, L, S, and ATF2453 digested with cathepsin D and K, and ATF2454 digested with cathepsin D (Table 4). However, not all cathepsin sites are cleaved with the same efficiency by a given cathepsin. Further analyses of artificial transcription factor digestion assays revealed preferences of cathepsins for certain cleavage sites. Cathepsin B shows medium activity towards CS1 , CS2, CS7, and CS16. Cathepsin D shows high activity towards CS1 , CS7, CS9, CS10, CS11 , CS13, CS15, CS16, and CS17, and medium activity towards CS6 and CS14. Cathepsin K shows high activity towards CS1 , CS6, CS7, CS11 , CS15, and CS16, medium activity towards CS2, CS4, CS5, CS9, CS10, CS12, CS14 and CS17. Cathepsin L showed high activity towards CS7 and CS16, and medium activity towards CS1 , CS6, CS10, CS1 1 and CS15. Cathepsin S showed high activity towards CS1 , CS6, CS7 and C16, and medium activity towards CS4, CS5, CS10, CS1 1 , CS12 and CS15. Some cathepsins processed the tested artificial transcription factors at off-target sites potentially masking detection of the intended cleavage products. This was especially true for digestion with cathepsin B potentially leading to the
underestimation of the sensitivity of certain artificial transcription factors towards cathepsins B. Altered cathepsin expression during pathological processes
Transducible artificial transcription factors of the invention are useful for the treatment of pathological conditions. To this end, such artificial transcription factors have to reach the nuclear compartment of target cells which are involved in such a pathological process. For most diseases, such target cells constitute only a minor part of the overall population of this target cell in the body. The term target cell is used in this context as a cell type with respect to general classification of cells in the biological sense, e.g. smooth muscle cells in retinal vessels walls and smooth muscle cells in the aortic wall are the same cell type, i.e. the term target cell is in this context used as a cell type in the cell biological sense e.g. smooth muscle cells in retinal vessels walls and smooth muscle cells in the aortic wall are the same cell type. Thus, it would be desirable to preferentially transport therapeutic artificial transcription factors into the nuclear compartment of target cells, like diseased cells involved in the pathological process to minimize side-effects by not influencing gene expression in the target cell population not involved in the disease process. Interestingly, cathepsin expression levels are influenced by pathological conditions, with various cathepsins upregulated in cell populations involved in the disease process. A diseased cell in the context of the present invention refers to a cell with (A) an altered physiological status compared to a normal or healthy cell including but not limited to altered gene expression and (B) which is part of a
pathophysiological mechanism leading to disease or is located in tissue affected by or contributing to a disease state. Also, cathepsin expression levels in cell of the same cell with respect to general classification of cells in the biological sense vary with their location and physiological condition; for example, a smooth muscle cell in a retinal vessel wall has a cathepsin expression pattern different from a smooth muscle cell in a placental vessel i.e. cathepsin expression levels in a cell of the same cell type in the cell biological sense vary with their location and physiological condition; for example, a smooth muscle cell in a retinal vessel wall has a cathepsin expression pattern different from a smooth muscle cell in a placental vessel. Since cathepsin-mediated, endosomal disentanglement is a major factor in the successful delivery of therapeutic artificial transcription factor, adapting endosomal disentanglement of the artificial transcription factor is a way to preferentially target diseased cell populations. For example, increased cathepsin L expression in response to hypoxic conditions would permit successful endosomal disentanglement of a cathepsin L-sensitive artificial transcription factor in cells in hypoxic areas, while relative lower cathepsin L expression in normoxic areas is less permissive for endosomal disentanglement. Thus, adjusting cathepsin sensitivity of artificial transcription factors to the differences in cathepsin expression levels based on location, physiological and pathological status between cells of the same cell type in the cell biological sense is a means to achieve more efficient endosomal disentanglement of such therapeutic proteins in cells connected to the disease process compared to cells not involved in the disease. This targeted endosomal disentanglement will therefore minimize side effects as cells not involved in the disease process will receive a lower dose of effective artificial transcription factor compared to cells directly connected to the pathological process.
Altered cathepsin-sensitivity of artificial transcription factors impacts transport into the nuclear compartment of cells and influences activity in a luciferase reporter assay
To assess the impact of potential cathepsin cleavage sites on endosomal disentanglement, the extent of nuclear translocation of different ATF1688 variants (Table 3) and their activity in a luciferase reporter assay was determined. As shown in Table 5, transduction of ATF1688 variants containing different cathepsin cleavage sites into HEK293 cells resulted in varying degrees of nuclear translocation from 1 % for ATF2454 containing cathepsin cleavage site CS18 to 34 % for ATF2451 containing cathepsin cleavage site CS15. Interestingly, low nuclear translocation resulted in a lowered activity, while increased nuclear translocation resulted in higher activity of these artificial transcription factors.
Table 5: Nuclear translocation and activity of ATF1688 variants containing various potential cathepsin cleavage sites
Figure imgf000049_0001
Nuclear translocation of artificial transcription factors was assessed following transduction into HEK293 cells using immunofluorescence analyses employing anti-myc antibodies detecting a 3xmyc epitope tag at the very C-terminus. The activity of ATF1688 variants is shown as percent of ATF1688 activity compared to ATF1806 as measured using a luciferase reporter assay also based on HEK293 cells. Cathepsin sensitivity of artificial transcription factors and cathepsin inventory of target cells determines efficiency of nuclear import Endosomal disentanglement depends on the cathepsin-sensitivity of the artificial transcription factor itself and the cathepsin inventory of the target cell. Thus, disentanglement of artificial transcription factors yields better results in terms of nuclear translocation if cathepsin- sensitivity and cathepsin-inventory overlaps. To this end, different artificial transcription factors with different cathepsin sensitivity (Table 3) were transduced into human astrocytes, HEK293, and HeLa cells and nuclear translocation was analyzed. And indeed, differential translocation of artificial transcription factors was observed (Figure 7). While ATF1688, ATF2443, and ATF2445 showed higher mean nuclear localization in human astrocytes (HAC) compared to HEK239 and HeLa cells, nuclear translocation of ATF2446 was comparable in these three cell types. Also, nuclear translocation of ATF1688, ATF2443, ATF2446, and ATF2450 in HeLa cells was comparable to nuclear translocation in HEK293 cells.
Interestingly, ATF2445 only poorly translocated into the nuclear compartment of HEK293 cells, while HeLa cells displayed significantly higher nuclear import of ATF2445. As astrocytes, HEK293 and HeLa cells have each a different cathepsin inventory and as the analyzed artificial transcription factors have different cathepsin sensitivities, these data support the notion that cell type specific endosomal disentanglement is a means to maximize nuclear transport of artificial transcription factors in a certain target cell type while minimizing nuclear transport in another cell type. For example, artificial transcription factors exhibiting the cathepsin sensitivity of ATF2445 would translocate well into target cells sharing the cathepsin inventory of astrocytes or HeLa cells while translocation in cell types with a cathepsin inventory comparable to HEK293 cells would be low. Interestingly, luciferase reporter assays performed in HEK293 cells showed that ATF2445 indeed had low activity.
Taken together, matching the cathepsin sensitivity of an artificial transcription factor to the cathepsin inventory of the target cell type is a means to achieve endosomal disentanglement in the target cell while minimizing nuclear translocation in non-target cell types with different cathepsin inventory.
Processing of artificial transcription factors in vivo In general, in vitro digestion of artificial transcription factors with cathepsins active at or around pH 7 to pH 5 (B, D, K, L, and S) is useful for assessing the stability of transducible artificial transcription factors following entry into the endosomal compartment and for estimating the potential of these proteins to resist initial unspecific digestion in the early endosome before endosomal rupture and subsequent liberation into the cytosol occurs.
Additionally, transduction of artificial transcription factors into cells followed by the recovery of transduced proteins and western blot analyses allows judging the resistance of such artificial transcription factors of the invention against cathepsins present in vivo. As shown in Figure 8, analysis of recovered ATF1688, ATF2443, and ATF2450 from human astrocytes, HEK293, and Hela cells following transduction revealed that cells with different cathepsin inventories process artificial transcription factors differentially depending on their cathepsin sensitivity. For example, ATF2443 has increased desired processing resulting in the generation of cleavage products (around 28 kDa) in astrocytes, HEK293, and HeLa cells compared to ATF1688. Interestingly, the amount of disentangled ATF2443 in astrocytes is higher compared to HeLa cells, likely due to differences in cathepsin expression between these cell types (Figure 6). Further differences in cellular uptake of different artificial transcription factors between cell types were evident. While uptake of ATF1668 and ATF2443 in astrocytes and HeLa cells was comparable, HEK293 showed for ATF1688 and ATF2443 lower uptake. Interestingly, uptake of ATF2450 in astrocytes was comparable to uptake of ATF1688 and ATF2443 in these cells. However, uptake of ATF2450 in HeLa and HEK293 cells was considerable lower. These data show, that modification of artificial transcription factor cathepsin-sensitivity through the incorporation of different cathepsin cleavage sites is a way to influence endosomal disentanglement and therefore transcriptional regulatory activity.
Increased resistance of the artificial transcription factors against unintended digestion by cathepsins active at higher pH increases the yield of correctly processed artificial transcription factor and, thus, increases the effective dose of artificial transcription factor reaching the nuclear compartment. Attempting to increase the protease resistance against cathepsins active at lower pH (e.g. pH 4) will likely not yield higher artificial transcription factor activity as under conditions of low pH rather specific digestion of proteins in the endosome gives way to unspecific exo-peptidase activity resulting in the complete degradation of these proteins. This notion stresses further the importance of enhancing endosomal disentanglement and escape by increasing the mobility of artificial transcription factors following endosomal rupture as the time frame for successful cytosolic delivery between entry into the endosomal compartment and the begin of unspecific hydrolysis of proteins in the endolysosomal compartment is quite short. Cell type-specific targeting of artificial transcription factors by combining endosomal disentanglement with cell type-specific, endosomal protease-mediated inactivation
While artificial transcription factors are highly specific and have only minimal off-target activity in terms of altered gene expression of non-target genes, restricting the action of such therapeutics to a specific subset of cell types is desirable to even further increase their specificity. Enhanced disentanglement through the action of cathepsins greatly improves correct subcellular localization and activity of transducible artificial transcription factors. Thus, suitable selection of specific cathepsin sites together with knowledge about cathepsin expression in target tissues allows limiting successful transport of artificial transcription factors to the nuclear compartment of specific cell types. For example, an artificial transcription factor containing a cathepsin cleavage site located between the PTD and the transcriptionally active part of the transducible artificial transcription factor specific for a cathepsin that is not expressed in a certain cell type will not enhance disentanglement of this PTD-protein fusion. Thus, incorporating a cleavage site recognized by a cathepsin expressed in the target cell type, but low expressed or absent in other cell types will restrict effective delivery of the transducible artificial transcription factor to the intended target cell.
In a particular embodiment, the invention relates to an artificial transcription factor comprising a cathepsin cleavage site recognized by a cathepsin expressed in the target cell type, but low expressed or absent in other cell types, in particular to such artificial transcription factor wherein the cathepsin cleavage site is located between the PTD and the transcriptionally active part of the transducible artificial transcription factor. More particularly the artificial transcription factor does not contain any other cathepsin cleavage site other than the one located between the PTD and the transcriptionally active part of the transducible artificial transcription factor. Also more particularly the mentioned cathepsin cleavage site is recognized by two or more different cathepsins expressed in the target cell type, but low expressed or absent in other cell types. Thus in a further particular embodiment, the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor does not contain any other protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor. Preferably the any other protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is a cathepsin B cleavage site. Thus in a further particular embodiment, the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor does not contain any cathepsin B cleavage site apart from the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
In a further particular embodiment, the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is modified to decrease cleavage sensitivity. Preferably the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is a cathepsin B cleavage site.
In a further particular embodiment, the invention relates to an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor has a decreased cleavage sensitivity compared to the cleavage sensitivity of the artificial transcription factor of SEQ ID NO: 67 (ATF1488) or of the artificial transcription factor of SEQ ID NO: 94
(ATF2491 ), preferably a decreased cleavage sensitivity compared to the cleavage sensitivity of the artificial transcription factor of SEQ ID NO: 67 (ATF1488). Adding negative selection of non-target cells based on cathepsin expression pattern further increases specific delivery of transducible artificial transcription factors to the intended target cell types. This is achieved through the incorporation of additional cathepsin cleavage sites in the transducible artificial transcription factor into or between domains of the protein essential for its activity, such as the nuclear localization sequence, the regulatory domain or the zinc finger protein. These additional negative-selective cathepsin cleavage sites are selected based on the expression pattern of cathepsins in target and non-target cell types in a way that target cell types do not express or contain only minor amount of the corresponding cathepsin while non-target cell types are positive for the cathepsin recognizing the negative- selective cathepsin cleavage site (for a schematic representation see Figure 9). This negative selection can be extended to include additional cell types by using a multifunctional cathepsin cleavage site which is not recognized in the target cell type but which is cleaved by one of several cathepsins expressed in various non-target cell types. An even further extension of this negative selection can be achieved by adding a combination of negative-selective cathepsin cleavage sites to increase the amount of cathepsin able to cleave the artificial transcription factor inside its transcriptionally active region. Preferred is the addition of such negative-selective cathepsin cleavage sites into the linker regions connecting the regulatory domain and the nuclear localization sequence or the zinc finger protein domain, respectively. However, incorporation of such negative-selective cathepsin cleavage sites into regulatory domain, nuclear localization sequence, or zinc finger protein is also considered.
In a particular embodiment, the invention relates to an artificial transcription factor comprising a cathepsin cleavage site recognized by a cathepsin low expressed or absent in the target cell type, but expressed in non-target cell types, wherein such cathepsin cleavage site is located within or between domains of the protein essential for its activity. More particularly, an artificial transcription factor comprises two or more such cathepsin cleavage sites located within or between domains essential for its activity, wherein the two or more cathepsin clavage sites are low expressed or absent in the target cell type, but expressed in non-target cell types. Also more particularly such a cathepsin cleavage site or such multiple cathepsin cleavage sites are recognized by two or more different cathepsins low expressed or absent in the target cell type, but expressed in non-target cell types.
In the context of this invention "an endosome-specific protease or cathepsin cleavage site recognized by a endosome-specific protease or a cathepsin low expressed in the target cell type" refers to an expression level of a certain endosome-specific protease or a cathepsin in the target cell type which is at least 2-fold, preferably at least 3-fold, more preferably at least 5-fold less in the target cell type compared to other cells, in particular compared to non-target cells types. In the context of this invention "an endosome-specific protease or cathepsin cleavage site recognized by a cathepsin absent in the target cell type" means that a certain endosome-specific protease or a certain cathepsin is not expressed at all in the target cell type.
In a particular embodiment, the invention relates to an artificial transcription factor comprising an endosome-specific protease cleavage site recognized by an endosome-specific protease low expressed or absent in the target cell type, but expressed in non-target cell types, wherein such an endosome-specific protease cleavage site is located within or between domains of the artificial transcription factor essential for its activity. Usually the domains of the artificial transcription factor essential for its activity are the nuclear localization sequence, the inhibitory or activatory domain or the polydactyl zinc finger protein.
In a particular embodiment, the invention relates to an artificial transcription factor comprising an endosome-specific protease cleavage site recognized by an endosome-specific protease low expressed or absent in the target cell type, but expressed in non-target cell types, wherein such an endosome-specific protease cleavage site is located in the linker regions connecting the regulatory domain and the nuclear localization sequence or the zinc finger protein domain.
In the context of the invention, a target cell type or a target cell type of the artificial transcription factor, both terms are used interchangeably herein, refers to a cell type which has endosome-specific protease inventory i.e. expresses at least one endosome-specific protease which specifically cleaves the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor. In a particular context of the invention a target cell type or a target cell type of the artificial transcription factor, both terms are used interchangeably herein, refers to a cell type which has an endosome-specific protease inventory i.e. expresses at least one endosome- specific protease which specifically cleaves the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor but does not specifically cleave or does specifically cleave to a lesser degree other protease cleavage site comprised by the artificial transcription factor other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
In the context of the invention, a non-target cell type or a non-target cell type of the artificial transcription factor, both terms are used interchangeably herein, refers to a cell type which has an endosome-specific protease inventory i.e. expresses at least one endosome-specific protease which does not specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor or does specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor to a lesser degree than other protease cleavage site comprised by the artificial transcription factor other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor. In a particular context of the invention a non-target cell type or a non-target cell type of the artificial transcription factor, both terms are used interchangeably herein, refers to a cell type which has an endosome-specific protease inventory i.e. expresses at least one endosome- specific protease which does not specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor or does specifically cleave the one single or two or more endosome-specific protease cleavage sites which are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor to a lesser degree than other protease cleavage site comprised by the artificial transcription factor other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the at least one endosome-specific protease expressed by the non-target cell type does cleave one or more protease cleavage sites comprised by the artificial transcription factor other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
In this context target or non-target cell types may be of the same type with respect to general classification of cells i.e. in the cell biological sense, and may differ only in that the target cell type is a diseased cell and non-target cell is a non-diseased cell, or may differ only in their localization in particular organs or parts of organs, or may differ only in their physiological context. In this context, specific cleavage of a given endosome-specific protease cleavage site by one endosome-specific protease but not by another endosome-specific protease is defined as a 2-times, preferably 3-times, more preferably 4-times higher processing of a protein containing this cleavage site i.e. as a 2-times, preferably 3-times, more preferably 4-times higher digestion of this cleavage site by one endosome-specific protease compared to the other endosome-specific protease . Also in this context, differences in endosome-specific protease expression pattern between two cell types is defined as a 2-times preferably 3-times, more preferably 4-times difference in expression of said endosome-specific protease .
Altering sensitivity of artificial transcription factors towards cathepsins to minimize unwanted digestion during transit through the endosomal compartment
While cleavage of transducible artificial transcription factors at defined sites greatly enhances their correct localization and activity and can be used to narrow down successful delivery to certain cell types based on their cathepsin expression pattern, unspecific cleavage by cathepsins outside predefined sequences likely interferes with the activity of these proteins. Thus, to increase the successful delivery of functional artificial transcription factors to the nuclear compartment, making these proteins resistant to cathepsin cleavage outside the intentionally introduced cleavage sites might prove useful. Various transducible artificial transcription factors of the invention were digested with purified cathepsins in vitro (Table 4).
Interestingly, major digestion products likely representing truncated and, thus, inactive artificial transcription factors were evident following digestion of ATF1488 and ATF1688 with cathepsins B, D, K, L, and S. Based on size estimation, one major cathepsin-sensitive site is localized inside the transcriptionally active part of transducible artificial transcription factors. The exact cleavage site was determined following in vitro digestion of ATF1688 with cathepsin B using Edman sequencing of a 26 kDa fragment and was found to be localized in the linker region between the SV40 nuclear localization sequence and the regulatory domain. Modification of the region between the NLS and the regulatory domain in ATF1688 resulted in the generation of ATF2491 (SEQ ID NO: 94) and ATF2493 (SEQ ID NO: 95). As shown in Figure 10, removing this off-target cathepsin-sensitive site greatly increased the preferred processing of ATF2491 compared to ATF1688 (peaks marked with *). Thus, removal of unwanted cathepsin cleavage sites in artificial transcription factors greatly improves their correct processing at intended cleavage sites thereby improving their endosomal disentanglement.
The present invention is directed to artificial transcription factors wherein unwanted cathepsin cleavage sites are removed, in particular to ATF2491 (SEQ ID NO: 94) and ATF2493 (SEQ ID NO: 95).
Cathepsin-mediated endosomal disentanglement of artificial transcription factors goes beyond state-of-the-art
The use of endosomal protease cleavage sites such as a cathepsin B cleavage site and others in this invention to improve the endosomal disentanglement of cargo proteins such as artificial transcription factors is beyond state-of-the-art. Unlike known approaches, no additional endosomal vesicle rupture is introduced, but the cargo protein is solely separated from the protein transduction domain after entry into the endosome, in fact disentangled from the endosomal membrane, to allow for efficient escape from the endosome following base- line vesicle rupture.
In other known examples, cell penetrating peptides were used together with protease cleavage sites (EP 2 399 939, WO 2008/0631 13), for the sole purpose of increasing the selectivity of protein transduction meaning the process of entry into the cell before entry into the endosomal compartment. By masking the protein transduction domain with an inhibitory peptide, cargo transport across the plasma membrane is prevented. Upon encountering a tissue and/or cell type-specific extracellular protease this inhibitory peptide is cleaved allowing now for protein transport across the plasma membrane. These state-of-the art examples are substantially different from the particular constructs leading to increase of endosomal disentanglement described in the present invention. Here, the endosomal disentanglement and the cell-type specific inactivation of artificial transcription factors based on processes inside the endosomal compartment not in the extracellular space is described and claimed. In another known example, an endosomal protease cleavage site was used together with a protein transduction domain (WO 2005/003315). In this instance, the procedure provided is a method of transport of DNA (used for transfection) into cells. The endosomal protease site was only used as a marker to confirm entry of the DNA complex via an endosomal route, but not to enhance endosomal escape of DNA.
In contrast to this described use of an endosomal protease cleavage site as a marker, the constructs of the present invention provide increased endosomal disentanglement and cell- type specific inactivation of a protein, not a marker for the detection of a route of entry of a DNA complex.
Endosome-specific, protease-assisted co-delivery of proteins and fusogenic peptides
Co-delivery of fusogenic peptides such as TATHA2, GALA or KALA was proposed to increase endosomal escape of cargo proteins following protein transduction. However, co- delivery of such peptides is probably not a viable option to increase protein delivery in vivo, as this implies a two-component system - fusogenic peptide and therapeutic protein - with likely differences in distribution and elimination behavior for the components in a living system. Incorporation of fusogenic peptides into the therapeutic protein is a better option to circumvent this two-component problem mentioned above. However, these fusogenic peptides have certain restrictions in terms of size, in possibility to interact, and in N- as well as C-terminal amino acid sequence in order to act as fusogen for endosomal membranes. Thus, simply incorporating a fusogenic peptide into a cargo protein is not yet a viable option to increase endosomal escape. However, incorporation of fusogenic peptides into artificial transcription factors of the invention via an endosomal protease-sensitive linker region allows for the simultaneous delivery of cargo protein and fusogenic peptide into the endosomal lumen. Once inside the endosome, separation of the artificial transcription factor from the protein transduction domain occurs, and in addition the liberation of fusogenic peptides. Through the inclusion of multiple repeats of fusogenic peptides, separating each fusogenic peptide subunit by an endosomal protease site, multiple fusogenic peptides are delivered to the endosome, thereby increasing endosomal rupture. Artificial transcriptions factors of the invention containing such endosomally activated fusogenic peptides are ATF2383 (SEQ ID NO: 96), ATF2385 (SEQ ID NO: 97), ATF2387 (SEQ ID NO: 98), and ATF2389 (SEQ ID NO: 99). The presence of a polyhistidine-tag increases activity of artificial transcription factors
As the mere separation of the PTD from its protein fusion partner is not predicted by the state-of-the-art to increase endosomal escape per se, the observed increased activity of cathepsin-sensitive compared to cathepsin-insensitive artificial transcription factors is likely caused by a second, synergistically acting mechanism. And indeed, additional destabilization of the endosomal membrane through intrinsic proton sponge activity of the analyzed artificial transcription factors likely aids endosomal escape. Polyhistidine-tags employed for protein purification purposes are known to buffer protons in the acidifying endosomal compartment causing its destabilization (Lo, S. L, 2008, Biomaterials 29, 2408-2414). Removing the polyhistidine-tag from ATF1688 (resulting in ATF2102) significantly reduces suppression of gene expression compared to the polyhistidine-tag containing artificial transcription factor ATF1688 (Figure 1 1 ). Thus, the polyhistidine-tag improves activity of ATF1688 consistent with a proton sponge activity.
Observation of increased artificial transcription factor activity following endosomal disentanglement (Figure 4) supports the notion that simply destabilizing the endosomal compartment, e.g. by fusogenic peptides or proton sponge activity, is not sufficient to achieve the full activity of a protein delivered to the cell by a PTD. In addition, loss of proton-sponge activity due to polyhistidine-tag removal does not completely block the activity of cathepsin- sensitive artificial transcription factors. Thus, endosomal destabilization as well as endosomal disentanglement act together yielding optimal endosomal escape of cargo delivered by PTD mechanisms. Based on this notion, increasing the length of the polyhistidine-tag from hexameric to, e.g., decameric will boost proton sponge activity, and together with optimal endosomal disentanglement improve artificial transcription factor activity (ATF2381 - SEQ ID NO: 100).
Activity of artificial transcription factors depends on the number of zinc finger modules constituting their zinc finger protein
Variants of ATF1688 containing octameric zinc finger proteins were generated by extending the hexameric zinc finger protein with two additional zinc finger modules. The additional zinc finger modules were selected through a yeast-one-hybrid screen employing an octameric zinc finger library based on the hexameric zinc finger similar to the protein contained in ATF1688. To obtain ATF2467 (SEQ ID NO: 101 ), ATF2468 (SEQ ID NO: 102), ATF2469 (SEQ ID NO: 103), ATF2470 (SEQ ID NO: 104), the hexameric zinc finger protein of ATF1688 was exchanged to the corresponding octameric zinc finger protein. This exchange resulted in a 1.44 times increase of activity for ATF2468 compared to ATF1688 as measured by luciferase reporter assay. This data is consistent with increased binding affinity of the octameric zinc finger protein to its intended target site. Higher affinity of the artificial transcription factor likely lowers the amount of protein that has to translocate to the nuclear compartment, therefore increasing activity.
Protein transduction efficiency depends on local TA T concentration
Successful protein transduction depends on the induction of endosomal vesicle formation followed by the engulfment of PTD fusion proteins into such vesicles and endosomal uptake. PTD such as the TAT peptide have the intrinsic capability to induce endosomal vesicle formation making these peptides useful for the transport of cargo across the plasma membrane. However, it is unclear whether a single TAT peptide fused to an artificial transcription factor is capable of fully inducing an endosomal vesicle, or whether several TAT moieties have to come in close contact to efficiently perform this task. It was shown that fluorescent quantum dots coupled to single TAT peptides are not capable of entering the cell, while random attachment of several TAT peptides caused the efficient uptake of such compounds (Suzuki, Y., 2013, Mol. Cell. Biol. 33(15), 3036-3049). Likely, the increase in the local concentration of TAT peptide caused this more efficient uptake of these quantum dots. To assess whether the local TAT concentration is also a limiting step of the uptake of artificial transcription factors, the half-maximal activity of ATF1688 in a luciferase-based reporter assay was measured in the presence or absence of inactive ATF1806. By adding increasing amounts of inactive ATF1806, the local TAT concentration could be held constant as decreasing amounts of ATF1688 were used to determine the concentration of half-maximal activity. As shown in Figure 12A, simple dilution of ATF1688 yielded a concentration of half- maximal activity of 143 +/- 1 1 nM. Interestingly, under conditions of a constantly high TAT concentration (2 μΜ) due to the addition of inactive ATF1806, the concentration for half- maximal activity of ATF1688 was determined to be 72 +/- 18 nM (Figure 12B). These data are consistent with the notion that the concentration of TAT protein transduction domain is a rate- limiting factor for the uptake and thus activity of artificial transcription factors. Thus, three bottlenecks for the successful transport of artificial transcription factors to their nuclear target exist. First, initial uptake into the endosomal compartment via the action of a protein transduction domain such as the TAT peptide; second, disentanglement inside the endosomal compartment; and third, escape from the endosomal compartment. While endosomal disentanglement is addressed through the incorporation of cathepsin recognition and cleavage sites, increasing initial uptake needs to be addressed by manipulating the local TAT concentration. As mentioned above, coupling a multitude of TAT peptides to a quantum dot indeed allowed for efficient uptake to these compounds. However, this strategy is not applicable for artificial transcription factors as randomly coupling TAT peptides would most certainly interfere with their activity. Also, a random arrangement of TAT peptides likely does not induce endosomal vesicle formation in an optimal manner. It is to assume that an optimal spatial arrangement of TAT domains exists that induces vesicle formation with a minimum of TAT moieties. While above mentioned data suggests that several artificial transcription factors fused to TAT need to come together in order to trigger vesicle formation, fusing optimally arranged TAT domains to an artificial transcription factor will help to alleviate this prerequisite and will help to overcome the bottleneck of endosomal vesicle formation. Such artificial transcription factors can be generated by replacing the single TAT peptide with TetraTAT-l (SEQ ID NO: 105) consisting of four TAT moieties coupled through specific linkers. ATF2505 (SEQ ID NO: 106) is such an artificial transcription factor targeting the human ETRA promoter.
Generation of octameric zinc finger proteins
Specificity and efficacy of transducible artificial transcription factors depends on the contained zinc finger protein and its binding to its cognate target site. Most crucial in this regard is the binding affinity of the zinc finger protein to its target site. This binding affinity is on the one hand defined by the protein-DNA interaction of the individual zinc fingers of a given zinc finger protein but also by the amount of zinc finger modules making contact to the DNA. Currently, tetrameric to hexameric zinc finger proteins are used to construct artificial transcription factors. Tetrameric and hexameric in this context describes the use of four or six individual zinc finger modules for the construction of a zinc finger protein, respectively.
Hexameric are preferred over tetrameric zinc finger proteins as they provide a large enough surface to distinguish between closely related sequences in effect allowing to address one single target site located inside the human genome. In addition, construction of zinc finger proteins consisting of more than six zinc finger modules is very challenging due to the library sizes involved. For example, using the Barbas zinc finger modules, the library size to generate octameric zinc finger proteins would exceed 1.5*109 clones making it in effect impossible to identify the best binders for a given 24 bp target site by using state-of-the-art screening systems. In order to construct polydactyl zinc finger proteins with more than six zinc finger modules we developed the following two-step strategy: in a first round, a hexameric zinc finger protein is selected from a zinc finger protein library by using a modified yeast one hybrid scheme where zinc finger proteins are expressed as fusions to the GAL4 activation domain in yeast leading to the expression of a Aureobasidin resistance. However, every other state-of-the-art screening method could also be employed to obtain such a hexameric zinc finger protein. In a second step, another zinc finger protein library is constructed based on such a hexameric zinc finger protein by fusing this hexameric zinc finger protein to a random library of two or more zinc finger modules. In effect, a library of polydacytly zinc finger proteins is generated where six positions are given through the use of the hexameric zinc finger protein obtained in the first round and were up to six additional positions are randomized. In effect, the library size necessary for the screening of e.g an duodecameric zinc finger protein is lowered from about 3x 1014 to about 6x 106. This step of library size reduction is necessary but not sufficient to allow screening for zinc finger proteins consisting of more than six zinc finger modules. The sensitivity of currently employed screening methods is not especially suited to distinguish between different zinc finger proteins contained in such an extended library, as the library is based on a preselected hexameric zinc finger protein with already high binding affinity to the intended target site. Thus, an improvement in screening sensitivity beyond state-of-the-art is necessary. This can be achieved by severely limiting the expression of the library proteins in the screening system necessitating the construct of novel screening systems. Such screening systems would rely on extraordinarily weak promoters for driving the expression of bait proteins and would limit gene dose for the bait construct. In order to construct such a novel beyond state-of-the-art screening system, we employed both the strategy of weak promoter as well as low gene dose. To achieve this, we modified the standard yeast one hybrid system and employed a ARS/CEN based vector instead of the standard 2micron vector. While 2micron-based vectors are present in yeast with about 50 copies, ARS/CEN based vectors are only present with 1 -2 copy therefore severely limiting the gene dose of the bait construct. Next, we compared several known standard yeast promoters for their suitability to limit expression of bait proteins sufficiently. However, none of these tested yeast promoters were sufficiently weak to achieve the necessary sensitivity. Interestingly and most surprisingly, a truncated version of the mammalian SV40 promoter (SEQ ID NO: 197) generated by us offered sufficiently weak expression to distinguish between closely related baits based on a common hexameric zinc finger protein. The difference in achieved expression level between the ADH and the truncated SV40 promoter is shown in Table 6. Yeast cells expressing a GAL4AD-ZFP protein (SEQ ID NO: 198) under the control of the ADH promoter or the truncated SV40 promoter and containing an Aureobasidin A resistance under control of a minimal promoter containing a binding site for said GAL4AD-ZFP were serially diluted onto plates containing increasing concentrations of Aureobasidin A. The difference in GAL4AD-ZFP expression driven by either the ADH or the truncated SV40 promoter was evident in the different ability of the respective yeast cells to grow on such selection plates. Thus, the expression rate of a sufficiently weak promoter suitable for selecting polydactyl zinc finger proteins with more than six zinc fingers (e.g. heptameric, octameric or even higher order zinc finger proteins) is defined as follows: Expression of the GAL4AD-ZFP protein of SEQ ID NO: 198 under control of such a promoter in yeast Y1 H Gold (Clontech) containing bait plasmid pAN2636 of (SEQ ID NO: 199) integrated into the URA3 marker results in the growth of such yeast cells only on selection plates containing less than 2500 ng/ml Aureobasidin A. In addition, 1 : 10 serial dilution of such yeast cells onto selection plates containing Aureobasidin A results only in growth of cells up to the 1 :100 dilution step on selection plates containing 1000 ng/ml Aureobasidin A. Growth in this context is defined as the formation of a closed area of yeast where no individual yeast colonies can be identified upon application of 5 μΙ of serially diluted cell suspension and after three days of incubation at 30 °C. This assay is known to the person in the field of yeast studies as spot test and should be evaluated as such. The employed strategy of two-step selection combined with extraordinarily low expression of bait protein through the use of very weak promoters and limiting gene dose is by no means limited to yeast one hybrid-based system. Bacterial one-hybrid, but also other screening systems such as mammalian systems could be adapted using this novel strategy. We employed this modified yeast one hybrid based scheme based on such a prey vector to obtain octameric zinc finger proteins based on hexameric zinc finger proteins recognizing target sites in the human ETRA and the human FcERIa promoter. And as shown in Figure 13, transducible artificial transcription factors based on octameric zinc finger proteins have higher activity compared to their hexameric counterparts. Taken together, our novel, beyond state-of-the-art yeast one hybrid system is capable of selecting polydactyl zinc finger proteins from bait libraries based on a common hexameric zinc finger protein. In addition, using adjusted selection pressure by increasing the concentration of Aureobasidin A in the selection media, this prey vector can also be used to screen libraries based on nonameric, decameric, undecameric, and also duodecameric zinc fingers.
Figure imgf000066_0001
Table 6: Use of a truncated SV40 promoter to obtain suitable expression of GAL4AD-ZFP fusion proteins for selecting higher order zinc finger proteins using yeast one hybrid. Yeast cells containing bait plasmid of SEQ ID NO: 199 and expressing GAL4AD-ZFP of SEQ ID NO: 198 under control of the ADH or a truncated SV40 promoter capable of binding the minimal promoter driving the expression of the Aureobasidin A resistance gene contained on the bait plasmid were serially diluted (1 : 10), spotted onto selection plates containing increasing concentrations of Aureobasidin A and growth was assessed after three days of incubation at 30 °C. The growth of the serially diluted yeast cells was assessed and is shown from left to right representing 1 :0, 1 :10, 1 : 100, 1 :1000, 1 :10000 dilutions with + representing growth and - representing no growth of the respective spot.
Suppression of IgE receptor expression on human primary basophiles following treatment with a transducible artificial transcription factor targeting FcERIa
To assess whether suppression of FcERIa expression affects the amount of IgE holo- receptor in a disease-relevant cellular model, primary human basophiles were treated with the transducible artificial transcription factor ATF2729 targeting the alpha subunit FcERIa of the high affinity IgE holo-receptor or vehicle as control. As shown in Figure 14, treatment of human primary basophiles with ATF2729 resulted in a decreased expression of high-affinity IgE receptor on human basophiles compared to control treated cells after 72 and 96 hours of treatment.
Increased activity of octameric compared to hexameric zinc finger protein containing artificial transcription factors
The zinc finger protein domain contained in transducible artificial transcription factors determines not only the specificity but also the specific activity of these therapeutic molecules. While a hexameric zinc finger protein is capable of binding to a 18 bp stretch of DNA in the genome, zinc finger proteins consisting of more zinc finger modules recognize longer stretches of DNA e.g a octameric zinc finger protein interacts with 24 bp of DNA. Thus, the binding of such octameric zinc finger proteins to their cognate recognition site is stronger compared to hexameric zinc finger proteins. And indeed, as shown in Figure 13, octameric zinc finger protein containing anti-FcERIa ATF2615 has significantly higher activity at lower concentrations compared to hexameric zinc finger protein containing artificial transcription factor AO501. Similar for anti-ETRA artificial transcription factors (Figure 15), octameric zinc finger protein ZFP+74AGocta (SEQ ID NO: 345) containing ATF2602 (SEQ ID NO: 200) has a lower ED50 of 0.016 +/- 0.002 compared to 0.039 +/- 0.005 nM for ATF1688 and higher relative potency compared to hexameric zinc finger protein containing ATF1688. These data are consistent with higher activity of lower effective dose of octameric compared to hexameric zinc finger protein containing transducible artificial transcription factors. Taken together, combining endosomal disentanglement with extending the size of the zinc finger protein leads to transducible artificial transcription factors with increased activity.
Improved pharmacokinetics of octameric compared to hexameric zinc finger protein containing transducible artificial transcription factors following intravitreal injection
While a wide application of transducible artificial transcription factors of the invention is envisioned and no limitiation in terms of target tissue and application route is implied, intravitreal application of anti-ETRA transducible artificial transcription factors for the treatment of diseases amenable to modulation of ETRA activity was evaluated. To this end, hexameric (ATF1688) or octameric (ATF2468 and ATF2602) zinc finger protein containing transducible artificial transcription factors were injected into live porcine eyes and their tissue distribution and penetration into the nucleus of retinal and other cells of the eye was assessed. As shown in table 7, ATF1688 was found to distribute into the retina and into some nuclei of vessel-associated smooth muscle cells, ATF2468 and ATF2602 showed vastly improved distribution following intravitreal injection and were found to penetrate exceptionally well into the nuclei of analyzed cells. Octameric zinc finger containing transducible artificial transcription factors were found to localize to the nuclei of their target cell type (vessels associated smooth muscle cells) up to seven days following a single injection. In contrast to this, hexameric zinc finger protein containing ATF1688 did not display this extended retention in tissues of the eye. These findings are unexpected and surprising and strongly support a favorable pharmacokinetics of octameric compared to hexameric zinc finger protein containing transducible artificial transcription factors.
Figure imgf000068_0001
Table 7: Localization of anti-ETRA transducible artificial transcription factors following intravitreal injection into porcine eyes. Shown is a grading of nuclear localization in various tissues of the eye of transducible artificial transcription factors ATF1688, ATF2468 and ATF2602 24 hours following injection into porcine eyes. NA stands for not analyzed, - signifies no nuclear localization of artificial transcription factor, (+) weakly positive in some nuclei, + positive in a high percentage of nuclei, ++ highly positive in almost all nuclei.
Anti-ETRA transducible artificial transcription factors have desired activity in vitro in human aortic smooth muscle cells (haSMCs)
Treatment with anti-ETRA transducible artificial transcription factors for therapeutic purposes is expected to suppress the expression of the ETRA gene in smooth muscle cells. In order to assess the efficacy of such transducible artificial transcription factors, primary human aortic smooth muscle cells were treated with octameric zinc finger protein containing ATF2468 or ATF2602 and ETRA mRNA levels were measured by quantitative RT-PCR in comparison to vehicle treated control cells. As shown in Figure 16A, treatment with ATF2468 or ATF2602 suppressed expression of ETRA by 58.1 % and 64 % compared to control cells. Subsequent to suppression of ETRA expression, lowered levels of ETRA protein and therefore diminished ETRA-dependent calcium signaling is expected. And indeed (Figure 16B), treatment with ATF2602 compared to control cells did decrease ET-1 dependent calcium flux indicative for decreased signaling by ETRA. Taken together, anti-ETRA transducible artificial transcription factors are capable of suppressing ETRA signaling in their disease-relevant target cell population in vitro.
An octameric zinc finger protein containing transducible artificial transcription factor has desired activity ex vivo in human tissue
ET-1 is the most potent vasoconstrictor known and acts through the endothelin receptor A (ETRA). Anti-ETRA transducible artificial transcription factors are expected to downregulate expression of ETRA protein on e.g. human smooth muscle cells, thus rendering these cells less responsive to ET-1 and, in turn, diminishing vessel contraction. To assess the activity of anti-ETRA transducible artificial transcription factors, human vessels were isolated from placenta and treated with octameric zinc finger protein containing ATF2468 or inactive control protein for three days. Following treatment, vessel contraction in response to increasing ET-1 concentrations were measured using myography. As shown in Figure 17, treatment with ATF2468 diminished ET-1 -mediated vessel contraction compared to control vessels over a wide range of ET-1 concentrations. Thus, anti-ETRA transducible artificial transcription factors display the desired pharmacological activity in isolated human tissue and are capable of suppressing ET-1 dependent contraction of human vessels.
An octameric zinc finger protein containing artificial transcription factor has desired activity in vivo in porcine retinal vessels
In order to determine the suitability of Sus scrofa as animal model for testing anti-ETRA transducible artificial transcription factors targeting the human ETRA the cross-species specificity of ATF2468 was determined. To this end, the Gaussia luciferase reporter was placed under the control of a hybrid promoter consisting of the CMV promoter and the homologous porcine target site of ATF2468. Cells were generated containing this reporter construct and a similar reporter construct containing the human instead of the porcine target site for ATF2468. Following treatment of these reporter cell lines with either ATF2468 or inactive control protein, luciferase activity was measured. As shown in Figure 18, ATF2468 possesses considerable cross-species specificity. Treatment of reporter cells for the human ETRA promoter with ATF2468 resulted in the suppression of luciferase activity to 21 +/- 8 % activity compared to control treated cells, while luciferase activity was suppressed to 24 +/- 1 1 % in reporter cells for the porcine ETRA promoter. Interestingly, treatment of reporter cells for the bovine ETRA promoter resulted in the suppression of luciferase activity to 48 +/- 4 %, while no activity of ATF2468 was found in reporter cells for the murine or rabbit ETRA promoter. Thus, Sus scrofa is a suitable animal model for testing anti-ETRA transducible artificial transcription factors.
To assess whether anti-ETRA transducible artificial transcription factors are capable of performing their intended function in vivo, ATF2602 was applied to porcine eyes. To this end, ATF2602 or vehicle control were intravitreally injected and eyes were harvested three days post-injection. ATF2602 shares the zinc finger protein with ATF2468 and, thus, is expected to display similar cross-species specificity. To determine ATF2602 activity in target tissue in the eye, retinal vessels from ATF2602 and control eyes were isolated by laser capture microscopy and levels of ETRA mRNA in relation to GAPDH as internal control were determined by quantitative RT-PCR. As shown in Figure 19, treatment with ATF2602 resulted in the suppression of ETRA expression compared to controls of 78.3 +/- 14.1 %. Thus, ATF2602 is capable of downregulating ETRA expression following application in vivo. These data constitute in vivo proof-of-concept for anti-ETRA transducible artificial transcription factors in a relevant animal model.
Transducible artificial transcription factors containing prorenin-derived cathepsin cleavage site and the SID negative regulatory domain are cut by cathepsin D
The negative regulatory SID domain contained in a subset of the transducible artificial transcription factors of the invention is processed by cathepsins. Edman sequencing of cathepsin D digestion products of ATF1688 revealed a cleavage site located inside the SID domain in front of the LEAAD peptide sequence (see Figure 20 for a schematic overview). Mutational analyses of ATF1688 revealed that cathepsin D is binding across the interface between the prorenin-derived cathepsin cleavage site in ATF1688 and the SID domain. Interfering with the binding of cathepsin D did result in diminished processing at this cathepsin D cleavage site. Interestingly, processing of SID-containing artificial transcription factors by cathepsin D likely interferes with their activity. While cathepsin D cleavage in fact aids endosomal disentanglement, truncation of the negative regulatory SID domain likely interferes with the transcription suppression of such artificial transcription factors. Thus, the extended cathepsin recognition site encompassing the prorenin-derived cathepsin B cleavage site and the cathepsin D binding site (SEQ ID NO: 201 ) when incorporated into transducible artificial transcription factors leads to differential activity in cells expressing high levels of cathepsin D compared to cells expressing low levels of cathepsin D. Using mRNA-display to generate transducible artificial transcription factors with altered cathepsin sensitivity
Endosomal disentanglement is critical for successful delivery of transducible artificial transcription factors to their site of action. In order to reach the nuclear compartment, TAT fusion proteins have to traverse the endosomal compartment where they encounter various proteases from the class of the cathepsins. The sequence specificity of some cathepsins together with cell type-specific differences in their expression and activity can be harnessed to influence TAT-mediated protein delivery and to achieve cell type-specific, productive delivery of cargo proteins such as transducible artificial transcription factors. To achieve such cell type-specific delivery, the sensitivity of the TAT fusion protein towards cathepsins needs to be controlled and manipulated. This can be achieved by including or removing cleavage and binding sites for certain cathepsins in various essential domains of the TAT fusion protein. Important in this context is the distinction between a cathepsin binding site and its cleavage site. While studying the cleavage of transducible artificial transcription factors by cathepsin D, we made the observation that altering sequences in the proximity of the actual cleavage site had severe impact on the ability of cathepsin D to process such proteins. Thus, sequences adjacent to the cleavage site (e.g. 10 to 20 amino acids up- or downstream) greatly influence how certain cathepsins process their substrates. As illustrated in Figure 20, for example cathepsin D recognizes a cleavage site inside the negative regulatory SID domain as determined by Edman sequencing of cleavage products. For example, the SID domain is cleaved by cathepsin D at cleavage site QML|LEA (| marks the cleavage), however, digestion at this site is strongly dependent on sequences adjacent to the SID domain. We have surprisingly found that the sequence QPMKRLTLGNDI (SEQ ID NO: 341 ) upstream of the SID domain promotes digestion by cathepsin D, thus comprises a cathepsin D binding site. The cathepsin D binding and cleavage site is comprised by amino acid sequence QPMKRLTLGNDIMAAAVRMNIQMLLEAAD (SEQ ID NO: 202) with the SID domain starting at position 13 and with changes to position 1 to 12, in particular with changes to position 6 to 12 impacting the binding of and alter cleavage sensitivity by cathepsin in particular by cathepsin D. Thus, it is possible to suppress cathepsin-mediated cleavage by interfering with the binding of said cathepsin without direct mutation of the actual cathepsin cleavage site. We found that the insertion of amino acid sequences matching a pattern of charged/polar, charged, charged/polar, nonpolar, nonpolar, nonpolar, polar amino acid upstream of a cleavage site did strongly interfere with cathepsin D-mediated processing. Another pattern for such insertions is charged, charged/nonpolar, polar/nonpolar, polar/nonpolar, polar/nonpolar, polar/nonpolar, polar/nonpolar amino acid. This is exemplified by our finding shown in table 8 where the exchange of LTLGNDI (SEQ ID NO: 342) located in the cathepsin binding site of ATF2602 greatly decreased cathepsin cleavage sensitivity i.e. greatly suppressed cathepsin D-dependent processing of such transducible artificial transcription factors.
Artificial LTLGNDI of ATF2602 % cathepsin D Cathepsin B transcription Exchanged to sensitivity in relation sensitivity
factor to ATF2602
ATF2869 DRHLIIS (SEQ ID NO: 203) 21 -
ATF2870 DLVTLLT (SEQ ID NO: 204) 71 n.d.
ATF2871 DEHLLVY (SEQ ID NO: 205) 1 1 +/-
ATF2872 DFYTHLA (SEQ ID NO: 206) 20 n.d.
ATF2873 PLTLPTI (SEQ ID NO: 207) 47 n.d.
ATF2874 PRLMFLC (SEQ ID NO: 208) 61 n.d.
ATF2875 TAYLPHI (SEQ ID NO: 209) 84 +/-
ATF2876 TETLPHI (SEQ ID NO: 210) 80 n.d.
ATF2877 TDYLDPH (SEQ ID NO: 21 1 ) 43 n.d.
ATF2878 QRYLEIT (SEQ ID NO: 212) 39 n.d.
ATF2879 NLHTIHI (SEQ ID NO: 213) 45 n.d.
ATF2880 NLCSVTQ (SEQ ID NO: 214) 51 n.d.
ATF2881 LAKFDMI (SEQ ID NO: 215) 82 n.d.
ATF2882 LYLTQFR (SEQ ID NO: 216) 32 +
ATF2883 DLTHISI (SEQ ID NO: 217) 45 n.d.
ATF2884 DFKSVQF (SEQ ID NO: 218) 78 n.d.
ATF2885 REYLIIS (SEQ ID NO: 219) 84 n.d.
ATF2886 RIDQLTL (SEQ ID NO: 220) 80 n.d.
ATF2887 RQVTLAL (SEQ ID NO: 221 ) 77 n.d.
ATF2888 YEKITVT (SEQ ID NO: 222) 57 n.d.
ATF2889 YVTIRLF (SEQ ID NO: 223) 31 +/-
ATF2890 YFSIHGL (SEQ ID NO: 224) 32 -
ATF2891 ELNIDIL (SEQ ID NO: 225) 92 n.d. ATF2892 PSLSFIV (SEQ ID NO: 226) 72 +/-
ATF2893 SLLITNL (SEQ ID NO: 227) 88 n.d.
ATF2894 EISTTLF (SEQ ID NO: 228) 75 n.d.
ATF2895 NMSTTNL (SEQ ID NO: 229) 56 n.d.
ATF2896 IKTDYSL (SEQ ID NO: 230) 60 n.d.
ATF2897 TKVRVFL (SEQ ID NO: 231 ) 73 +
ATF2898 EYILNYY (SEQ ID NO: 232) 52 n.d.
ATF2899 TTVNLTI (SEQ ID NO: 233) 39 n.d.
ATF2909 IVLNLSI (SEQ ID NO: 234) 57 n.d.
ATF2910 TSLLYTC (SEQ ID NO: 235) 53 n.d.
ATF291 1 PTISFAL (SEQ ID NO: 236) 80 n.d.
ATF2912 KESFTLI (SEQ ID NO: 237) 51 n.d.
ATF2913 KLDVNFF (SEQ ID NO: 238) 42 n.d.
ATF2914 TELSYTL (SEQ ID NO: 239) 75 n.d.
ATF2915 IERFQFA (SEQ ID NO: 240) 57 n.d.
ATF2916 INQMLSH (SEQ ID NO: 241 ) 33 n.d.
ATF2917 ELFILHA (SEQ ID NO: 242) 0 +
ATF2918 VYPILPI (SEQ ID NO: 243) 86 n.d.
ATF2919 RRELFLL (SEQ ID NO: 244) 86 n.d.
Table 8:
Shown is relative sensitivity in percent to cathepsin D digestion compared to ATF2602 of transducible artificial transcription factors with an altered cathepsin binding site. Also shown is the sensitivity to cathepsin B digestion (n.d. not determined; - cleavage below detection threshold; +/- detectable cleavage; + sensitive to cleavage comparable to ATF2602).The amino acid sequences (in single letter code) shown describe the difference between
ATF2602 and the respective transducible artificial transcription factor. In the context of the invention charged amino acids comprise arginine, lysine, aspartic acid, and glutamic acid; polar amino acids comprise glutamine, asparagine, histidine, serine, threonine, tyrosine, cysteine, methionine and tryptophan; nonpolar amino acids comprise alanine, isoleucine, leucine, phenylalanine, valine, proline, and glycine. Thus in a particular embodiment the artificial transcription factor of the present invention comprises an endosome-specific protease binding site which is located about 1 to about 50 amino acids, preferably about 5 to about 20 amino acids, more preferably about 5 to about 15 amino acids, upstream or downstream, preferably upstream of an endosome-specific protease cleavage site, wherein the amino acid sequence of the endosome-specific protease binding site is modified to alter the cleavage sensitivity of the endosome-specific protease cleavage site. Usually the amino acid sequence of the endosome-specific protease binding site is modified by insertion, deletion or substitution, preferably by insertion or substitution, more preferably by substitution. In particular the amino acid sequence of the endosome- specific protease binding site is modified by substitution of an amino acid sequence comprising the following order of amino acids from the amino to the carboxy end:
i) charged or polar amino acid, charged amino acid, charged or polar amino acid, nonpolar amino acid, nonpolar amino acid, nonpolar amino acid, polar amino acid; or
ii) charged amino acid, charged or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid. Thus an amino acid sequence of the endosome-specific protease binding site is replaced with an amino acid sequence comprising the following order of amino acids from the amino to the carboxy end:
i) charged or polar amino acid, charged amino acid, charged or polar amino acid, nonpolar amino acid, nonpolar amino acid, nonpolar amino acid, polar amino acid; or
ii) charged amino acid, charged or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid.
In the context of this invention, transducible artificial transcription factors differing from
ATF2602 in up to seven amino acid positions with these seven amino acids instead of being LTLGNDI of amino acid sequence QPMKRLTLGNDIMAAAVRMNIQMLLEAAD (SEQ ID NO: 202) fitting in single letter amino acid code the pattern D/E/I/K/LN/P/Q/R/S/T/V/Y,
A/D/E/F/J/K/L/M/N/Q/R/S/T/V/Y, C/D/E/F/H/l/K/L/N/P/Q/R/S/T/V/Y, D/F/H/l/L/M/N/Q/R/S/T/V, D/E/F/H/l/L/N/M/P/Q/R/T/V/Y, A F/G/H/l/L/M/N/P/Q/S/T/V/Y, A C/F/H/l/L/Q/R/S/T/V/Y are also considered to possess altered cathepsin sensitivity. More preferred for substitution is the pattern D/Q/T/Y, R/E/K, H/Y/V/K, L/R/l, L/E/V/T, l/V/F, S/YT/L also preferred is the pattern T/D/E/l/P/R, L/E/R, L/S/T/V/Y, L/l/T/S, L/T/F/l, L/T/l/H/F, L/l/F, and most preferred is the pattern T/D, L/E/R, L/S/T, L/l/T, L/T/F, L/T/l, L/l/F. Also preferred is the pattern E/D/Y/L, L/E/F/R, F/H/Y/T, l/L/T, L/H/l/R, H/V/L/l, A/Y/S/F.
Thus in a particular embodiment the artificial transcription factor comprises an endosome- specific protease binding site, wherein the amino acid sequence of the endosome-specific protease binding site is modified by substitution of at least two up to seven amino acids wherein the at least two up to seven amino acids are replaced with the following amino acids in the order from the amino to the carboxy end:
amino acid selected from the group consisting of D/E/I/K/LN/P/Q/R/S/T/V/Y;
amino acid selected from the group consisting of A/D/E/F/J/K/L/M/N/Q/R/S/T/V/Y;
amino acid selected from the group consisting of C/D/E/F/H/l/K/L/N/P/Q/R/S/T/V/Y, amino acid selected from the group consisting of D/F/H/l/L/M/N/Q/R/S/T/V,
amino acid selected from the group consisting of D/E/F/H/l/L/N/M/P/Q/R/T/V/Y,
amino acid selected from the group consisting of A/F/G/H/l/L/M/N/P/Q/S/T/V/Y,
amino acid selected from the group consisting of A/C/F/H/l/L/Q/R/S/T/V/Y.
Based on ATF2602 and using this approach transducible artificial transcription factors
ATF2869 (SEQ ID NO: 245), ATF2870 (SEQ ID NO: 246, ATF2871 (SEQ ID NO: 247),
ATF2872 (SEQ ID NO: 248), ATF2873 (SEQ ID NO: 249), ATF2874 (SEQ ID NO: 250),
ATF2875 (SEQ ID NO: 251 ), ATF2876 (SEQ ID NO: 252), ATF2877 (SEQ ID NO: 253),
ATF2878 (SEQ ID NO: 254), ATF2879 (SEQ ID NO: 255), ATF2880 (SEQ ID NO: 256),
ATF2881 (SEQ ID NO: 257), ATF2882 (SEQ ID NO: 258), ATF2883 (SEQ ID NO: 259),
ATF2884 (SEQ ID NO: 260), ATF2885 (SEQ ID NO: 261 ), ATF2886 (SEQ ID NO: 262),
ATF2887 (SEQ ID NO: 263), ATF2888 (SEQ ID NO: 264), ATF2889 (SEQ ID NO: 265),
ATF2890 (SEQ ID NO: 266), ATF2891 (SEQ ID NO: 267), ATF2892 (SEQ ID NO: 268),
ATF2893 (SEQ ID NO: 269), ATF2894 (SEQ ID NO: 270), ATF2895 (SEQ ID NO: 271 ),
ATF2896 (SEQ ID NO: 272), ATF2897 (SEQ ID NO: 273), ATF2898 (SEQ ID NO: 274),
ATF2899 (SEQ ID NO: 275), ATF2909 (SEQ ID NO: 276), ATF2910 (SEQ ID NO: 277),
ATF291 1 (SEQ ID NO: 278), ATF2912 (SEQ ID NO: 279), ATF2913 (SEQ ID NO: 280),
ATF2914(SEQ ID NO: 281 ), ATF2915 (SEQ ID NO: 282), ATF2916 (SEQ ID NO: 283), ATF2917 (SEQ ID NO: 284), ATF2918 (SEQ ID NO: 285), and ATF2919 (SEQ ID NO: 286) with altered cathepsin sensitivity were created, which are preferred embodiments of the invention.
In a particular embodiment the artificial transcription factor comprises an endosome-specific protease binding site, wherein the amino acid sequence of the endosome-specific protease binding site comprises the amino acid sequence LTLGNDI (SEQ ID NO: 342) and wherein the endosome-specific protease binding site is modified by replacing the amino acid sequence LTLGNDI (SEQ ID NO: 342) with an amino acid sequence selected from the group consisting of an amino acid sequence selected from the group consisting of DRHLIIS (SEQ ID NO: 203), DLVTLLT(SEQ ID NO: 204), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), PLTLPTI (SEQ ID NO: 207), PRLMFLC (SEQ ID NO: 208), TAYLPHI (SEQ ID NO:
209) , TETLPHI (SEQ ID NO: 210), TDYLDPH (SEQ ID NO: 21 1 ), QRYLEIT (SEQ ID NO:
212) , NLHTIHI (SEQ ID NO: 213), NLCSVTQ (SEQ ID NO: 214), LAKFDMI (SEQ ID NO: 215), LYLTQFR (SEQ ID NO: 216), DLTHISI (SEQ ID NO: 217), DFKSVQF (SEQ ID NO:
218), REYLIIS (SEQ ID NO: 219), RIDQLTL (SEQ ID NO: 220), RQVTLAL (SEQ ID NO: 221 ), YEKITVT (SEQ ID NO: 222), YVTIRLF (SEQ ID NO: 223), YFSIHGL (SEQ ID NO: 224), ELNIDIL (SEQ ID NO: 225), PSLSFIV (SEQ ID NO: 226), SLLITNL (SEQ ID NO: 227), EISTTLF (SEQ ID NO: 228), NMSTTNL (SEQ ID NO: 229), IKTDYSL (SEQ ID NO: 230), TKVRVFL (SEQ ID NO: 231 ), EYILNYY (SEQ ID NO: 232), TTVNLTI (SEQ ID NO: 233), IVLNLSI (SEQ ID NO: 234), TSLLYTC (SEQ ID NO: 235), PTISFAL (SEQ ID NO: 236), KESFTLI (SEQ ID NO: 237), KLDVNFF (SEQ ID NO: 238), TELSYTL (SEQ ID NO: 239), IERFQFA (SEQ ID NO: 240), INQMLSH (SEQ ID NO: 241 ), ELFILHA (SEQ ID NO: 242), VYPILPI (SEQ ID NO: 243), and RRELFLL (SEQ ID NO: 244), usually DLVTLLT(SEQ ID NO: 204), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), PLTLPTI (SEQ ID NO: 207), PRLMFLC (SEQ ID NO: 208), TAYLPHI (SEQ ID NO: 209), TETLPHI (SEQ ID NO:
210) , TDYLDPH (SEQ ID NO: 21 1 ), QRYLEIT (SEQ ID NO: 212), NLHTIHI (SEQ ID NO:
213) , NLCSVTQ (SEQ ID NO: 214), LAKFDMI (SEQ ID NO: 215), LYLTQFR (SEQ ID NO: 216), DLTHISI (SEQ ID NO: 217), DFKSVQF (SEQ ID NO: 218), REYLIIS (SEQ ID NO: 219), RIDQLTL (SEQ ID NO: 220), RQVTLAL (SEQ ID NO: 221 ), YEKITVT (SEQ ID NO: 222), YVTIRLF (SEQ ID NO: 223), ELNIDIL (SEQ ID NO: 225), PSLSFIV (SEQ ID NO: 226), SLLITNL (SEQ ID NO: 227), EISTTLF (SEQ ID NO: 228), NMSTTNL (SEQ ID NO: 229), IKTDYSL (SEQ ID NO: 230), TKVRVFL (SEQ ID NO: 231 ), EYILNYY (SEQ ID NO: 232), TTVNLTI (SEQ ID NO: 233), IVLNLSI (SEQ ID NO: 234), TSLLYTC (SEQ ID NO: 235), PTISFAL (SEQ ID NO: 236), KESFTLI (SEQ ID NO: 237), KLDVNFF (SEQ ID NO: 238), TELSYTL (SEQ ID NO: 239), IERFQFA (SEQ ID NO: 240), INQMLSH (SEQ ID NO: 241 ), ELFILHA (SEQ ID NO: 242), VYPILPI (SEQ ID NO: 243), and RRELFLL (SEQ ID NO: 244), preferably ELFILHA (SEQ ID NO: 242), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), DRHLIIS (SEQ ID NO: 203), YVTIRLF (SEQ ID NO: 223), LYLTQFR (SEQ ID NO: 216), YFSIHGL (SEQ ID NO: 224), INQMLSH (SEQ ID NO: 241 ), QRYLEIT (SEQ ID NO:
212) , TTVNLTI (SEQ ID NO: 233), KLDVNFF (SEQ ID NO: 238), TDYLDPH (SEQ ID NO: 21 1 ), NLHTIHI (SEQ ID NO: 213), DLTHISI (SEQ ID NO: 217), PLTLPTI (SEQ ID NO: 207), and more preferably ELFILHA (SEQ ID NO: 242), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), TAYLPHI (SEQ ID NO: 209), YVTIRLF (SEQ ID NO: 223), LYLTQFR
(SEQ ID NO: 216), PSLSFIV (SEQ ID NO: 226), TKVRVFL (SEQ ID NO: 231 ) and INQMLSH (SEQ ID NO: 241 ), and most preferably TKVRVFL (SEQ ID NO: 231 ), LYLTQFR (SEQ ID NO: 216), ELFILHA (SEQ ID NO: 242), and DEHLLVY (SEQ ID NO: 205), in particular LYLTQFR (SEQ ID NO: 216), ELFILHA (SEQ ID NO: 242), and DEHLLVY (SEQ ID NO: 205).
Thus in a further aspect of the invention the artificial transcription factor comprises a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the artificial transcription factor comprises an amino acid sequence selected from the group consisting of DRHLIIS (SEQ ID NO: 203), DLVTLLT(SEQ ID NO:
204) , DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), PLTLPTI (SEQ ID NO:
207) , PRLMFLC (SEQ ID NO: 208), TAYLPHI (SEQ ID NO: 209), TETLPHI (SEQ ID NO: 210), TDYLDPH (SEQ ID NO: 21 1 ), QRYLEIT (SEQ ID NO: 212), NLHTIHI (SEQ ID NO:
213) , NLCSVTQ (SEQ ID NO: 214), LAKFDMI (SEQ ID NO: 215), LYLTQFR (SEQ ID NO: 216), DLTHISI (SEQ ID NO: 217), DFKSVQF (SEQ ID NO: 218), REYLIIS (SEQ ID NO: 219), RIDQLTL (SEQ ID NO: 220), RQVTLAL (SEQ ID NO: 221 ), YEKITVT (SEQ ID NO: 222), YVTIRLF (SEQ ID NO: 223), YFSIHGL (SEQ ID NO: 224), ELNIDIL (SEQ ID NO: 225), PSLSFIV (SEQ ID NO: 226), SLLITNL (SEQ ID NO: 227), EISTTLF (SEQ ID NO: 228),
NMSTTNL (SEQ ID NO: 229), IKTDYSL (SEQ ID NO: 230), TKVRVFL (SEQ ID NO: 231 ), EYILNYY (SEQ ID NO: 232), TTVNLTI (SEQ ID NO: 233), IVLNLSI (SEQ ID NO: 234), TSLLYTC (SEQ ID NO: 235), PTISFAL (SEQ ID NO: 236), KESFTLI (SEQ ID NO: 237), KLDVNFF (SEQ ID NO: 238), TELSYTL (SEQ ID NO: 239), IERFQFA (SEQ ID NO: 240), INQMLSH (SEQ ID NO: 241 ), ELFILHA (SEQ ID NO: 242), VYPILPI (SEQ ID NO: 243), and RRELFLL (SEQ ID NO: 244), usually DLVTLLT(SEQ ID NO: 204), DEHLLVY (SEQ ID NO:
205) , DFYTHLA (SEQ ID NO: 206), PLTLPTI (SEQ ID NO: 207), PRLMFLC (SEQ ID NO:
208) , TAYLPHI (SEQ ID NO: 209), TETLPHI (SEQ ID NO: 210), TDYLDPH (SEQ ID NO: 21 1 ), QRYLEIT (SEQ ID NO: 212), NLHTIHI (SEQ ID NO: 213), NLCSVTQ (SEQ ID NO: 214), LAKFDMI (SEQ ID NO: 215), LYLTQFR (SEQ ID NO: 216), DLTHISI (SEQ ID NO: 217), DFKSVQF (SEQ ID NO: 218), REYLIIS (SEQ ID NO: 219), RIDQLTL (SEQ ID NO: 220), RQVTLAL (SEQ ID NO: 221 ), YEKITVT (SEQ ID NO: 222), YVTIRLF (SEQ ID NO: 223), ELNIDIL (SEQ ID NO: 225), PSLSFIV (SEQ ID NO: 226), SLLITNL (SEQ ID NO: 227), EISTTLF (SEQ ID NO: 228), NMSTTNL (SEQ ID NO: 229), IKTDYSL (SEQ ID NO: 230), TKVRVFL (SEQ ID NO: 231 ), EYILNYY (SEQ ID NO: 232), TTVNLTI (SEQ ID NO: 233), IVLNLSI (SEQ ID NO: 234), TSLLYTC (SEQ ID NO: 235), PTISFAL (SEQ ID NO: 236), KESFTLI (SEQ ID NO: 237), KLDVNFF (SEQ ID NO: 238), TELSYTL (SEQ ID NO: 239), IERFQFA (SEQ ID NO: 240), INQMLSH (SEQ ID NO: 241 ), ELFILHA (SEQ ID NO: 242), VYPILPI (SEQ ID NO: 243), and RRELFLL (SEQ ID NO: 244),
preferably ELFILHA (SEQ ID NO: 242), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), DRHLIIS (SEQ ID NO: 203), YVTIRLF (SEQ ID NO: 223), LYLTQFR (SEQ ID NO: 216), YFSIHGL (SEQ ID NO: 224), INQMLSH (SEQ ID NO: 241 ), QRYLEIT (SEQ ID NO: 212), TTVNLTI (SEQ ID NO: 233), KLDVNFF (SEQ ID NO: 238), TDYLDPH (SEQ ID NO: 21 1 ), NLHTIHI (SEQ ID NO: 213), DLTHISI (SEQ ID NO: 217), PLTLPTI (SEQ ID NO: 207), and more preferably ELFILHA (SEQ ID NO: 242), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), TAYLPHI (SEQ ID NO: 209), YVTIRLF (SEQ ID NO: 223), LYLTQFR (SEQ ID NO: 216), PSLSFIV (SEQ ID NO: 226), TKVRVFL (SEQ ID NO: 231 ) and INQMLSH (SEQ ID NO: 241 ), and most preferably TKVRVFL (SEQ ID NO: 231 ), LYLTQFR (SEQ ID NO: 216), ELFILHA (SEQ ID NO: 242), and DEHLLVY (SEQ ID NO: 205), in particular LYLTQFR (SEQ ID NO: 216), ELFILHA (SEQ ID NO: 242), and DEHLLVY (SEQ ID NO: 205).
Thus in a further aspect of the invention the artificial transcription factor comprises a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the artificial transcription factor is selected from the group consisting of ATF2869 (SEQ ID NO: 245), ATF2870 (SEQ ID NO: 246, ATF2871 (SEQ ID NO: 247), ATF2872 (SEQ ID NO: 248), ATF2873 (SEQ ID NO: 249), ATF2874 (SEQ ID NO: 250), ATF2875 (SEQ ID NO: 251 ), ATF2876 (SEQ ID NO: 252), ATF2877 (SEQ ID NO: 253), ATF2878 (SEQ ID NO: 254), ATF2879 (SEQ ID NO: 255), ATF2880 (SEQ ID NO: 256), ATF2881 (SEQ ID NO: 257), ATF2882 (SEQ ID NO: 258), ATF2883 (SEQ ID NO: 259), ATF2884 (SEQ ID NO: 260), ATF2885 (SEQ ID NO: 261 ), ATF2886 (SEQ ID NO: 262), ATF2887 (SEQ ID NO: 263), ATF2888 (SEQ ID NO: 264), ATF2889 (SEQ ID NO: 265), ATF2890 (SEQ ID NO: 266), ATF2891 (SEQ ID NO: 267), ATF2892 (SEQ ID NO: 268), ATF2893 (SEQ ID NO: 269), ATF2894 (SEQ ID NO: 270), ATF2895 (SEQ ID NO: 271 ), ATF2896 (SEQ ID NO: 272), ATF2897 (SEQ ID NO: 273), ATF2898 (SEQ ID NO: 274), ATF2899 (SEQ ID NO: 275), ATF2909 (SEQ ID NO: 276), ATF2910 (SEQ ID NO: 277), ATF291 1 (SEQ ID NO: 278), ATF2912 (SEQ ID NO: 279), ATF2913 (SEQ ID NO: 280), ATF2914(SEQ ID NO: 281 ), ATF2915 (SEQ ID NO: 282), ATF2916 (SEQ ID NO: 283), ATF2917 (SEQ ID NO: 284), ATF2918 (SEQ ID NO: 285), and ATF2919 (SEQ ID NO: 286), usually selected from the group consisting of ATF2870 (SEQ ID NO: 246, ATF2871 (SEQ ID NO: 247), ATF2872 (SEQ ID NO: 248), ATF2873 (SEQ ID NO: 249), ATF2874 (SEQ ID NO:
250), ATF2875 (SEQ 1 D NO:
ATF2878 (SEQ ID NO: 254), (SEQ ID NO: 255), ATF2880 (SEQ ID NO: 256),
ATF2881 (SEQ ID NO: 257), (SEQ ID NO: 258), ATF2883 (SEQ ID NO: 259),
ATF2884 (SEQ ID NO: 260), (SEQ ID NO: 261 ), ATF2886 (SEQ ID NO: 262),
ATF2887 (SEQ ID NO: 263), (SEQ ID NO: 264), ATF2889 (SEQ ID NO: 265),
ATF2891 (SEQ ID NO: 267), (SEQ ID NO: 268), ATF2893 (SEQ ID NO: 269),
ATF2894 (SEQ ID NO: 270), (SEQ ID NO: 271 ), ATF2896 (SEQ ID NO: 272),
ATF2897 (SEQ ID NO: 273), (SEQ ID NO: 274), ATF2899 (SEQ ID NO: 275),
ATF2909 (SEQ ID NO: 276), (SEQ ID NO: 277), ATF291 1 (SEQ ID NO: 278),
ATF2912 (SEQ ID NO: 279), (SEQ ID NO: 280), ATF2914(SEQ D NO: 281 ),
ATF2915 (SEQ ID NO: 282), (SEQ ID NO: 283), ATF2917 (SEQ ID NO: 284),
ATF2918 (SEQ ID NO: 285), and ATF2919 (SEQ ID NO: 286),
preferably selected from the group consisting of ATF2869, ATF2871 , ATF2872, ATF2875, ATF2882, ATF2890, ATF2892, ATF2897, ATF2917, and ATF2919, more preferably selected from the group consisting of ATF2917, ATF2871 , ATF2872, ATF2875, ATF2889, ATF2882, ATF2892, ATF2897,and ATF2916, and most preferably selected from the group consisting of ATF2882, ATF2917, ATF2871 and ATF2897, in particular selected from the group consisting of ATF2882, ATF2917 and ATF2871 , more particular selected from the group consisting of ATF2882 and ATF2917.
The given example is by no means exclusive for cathepsin D, but is applicable to all cathepsins for which cleavage sites are present or can be incorporated into or between essential protein sequences. Now to modulate the spectrum of cell types into which such artificial transcription factors are productively transduced, cathepsin processing inside the essential domain could be altered. However, simple deletion of the cathepsin cleavage sites is not possible as alterations to an essential domain such as e.g. the SID sequence would likely be harmful to its function. To this end, we devised the following method to overcome this constraint. As shown in Figure 21 , DNA libraries encoding the transducible artificial transcription factor are assembled to include a region of random sequences inside the cathepsin binding region adjacent to an essential domain containing a cathepsin cleavage site targeted for modulation. Such random sequences are introduced during the DNA library construction via degenerated oligonucleotides e.g. containing 21 randomized nucleotides resulting in a DNA library of about 1013 different DNA molecules. This DNA library is used for mRNA-display (Lipovsek D., Pluckthun A., 2004, J Immunol Methods. 290(1 -2):51 -67;
Barendt PA., Ng DT., McQuade CN., Sarkar CA., 2013, ACS Comb Sci. 15(2):77-81 ; Kurz M., Gu K., Lohse PA., 2000, Nucleic Acids Res. 28(18):E83). In short, the transcribed mRNA library is linked to a puromycin-containing oligonucleotide and in vitro translated into proteins linked via puromycin to the mRNA from which the individual protein molecule was translated by the ribosome. Under certain conditions, the ribosome is able to use puromycin instead of a tRNA for transfer to the nascent protein chain. As the mRNA library contains such a puromycin moiety at its 3' end in effect the coding mRNA is transferred to the nascent protein linking phenotype with genotype. The linkage between phenotype and genotype is essential for genetic screens and allows here for an in vitro evolution process. The mRNA display ready mRNA-protein library is bound via an included affinity tag to a solid support and subjected to cathepsin digestion. Depending on the desired outcome, using the supernatant for a next round of in vitro selection will select for proteins sensitive to cathepsin digestion while using the support-bound fraction enriches for proteins resistant to cathepsin digestion. By combining several rounds of cathepsin digestion and repeated library generation from the outcome of the previous selection round, proteins with desired cathepsin sensitivities can be generated. For example, digestion of support-bound mRNA-display library with cathepsin D followed by digestion with cathepsin B will yield in the supernatant cathepsin D-resistant, cathepsin B-sensitive artificial transcription factors. These proteins are advantageous for delivery into cell types with high cathepsin D expression compared to their cathepsin D- sensitive counterparts. However, the described method is generally applicable for obtaining transducible artificial transcription factors of the invention and is by no means limited to only cathepsin B or D or to sequences encompassing parts of the SID domain. In a further particular embodiment of the invention the one single or two or more endosome- specific protease cleavage sites, comprise the amino acid sequence SEQ ID NO: 26. In another particular embodiment the one single or two or more endosome-specific protease cleavage sites comprise an amino acid sequence selected from the group consisting of SEQ ID NO: 26 to SEQ ID NO: 46.
In a further aspect of the invention the artificial transcription factor comprises a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the polydactyl zinc finger protein is an octameric or higher order zinc finger protein. Preferably the octameric or higher order zinc finger protein is selected from the group consisting of octameric, nonameric, decameric, undecameric and duodecameric zinc finger proteins, more preferably the polydactyl zinc finger protein is an octameric zinc finger protein. Most preferably the polydactyl zinc finger protein is an octameric zinc finger protein selected from the group consisting of SEQ ID NO: 345 and SEQ ID NO: 346.
Preferably each monomer of the zinc finger protein has an amino acid sequence different from the other monomers e.g. each monomer of the octameric or higher order zinc finger protein has an amino acid sequence different from the other monomers.
In a preferred embodiment the artificial transcription factor further comprises a protein tag as described supra. In a preferred embodiment the artificial transcription factor further comprises a linker as described supra. The inhibitory or activatory protein domain, the nuclear localization sequence, the protein transduction domain, and an endosome-specific protease cleavage site, the location of each domain inside the artificial transcription factor from the N- to the C-terminus, may be as described supra for an artificial transcription factor of the invention.
In a further preferred embodiment the endosome-specific protease cleavage site is located in the artificial transcription factor between the protein transduction domain and the
transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor. In a particular embodiment the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is modified to alter, preferably to decrease cleavage sensitivity.
In a further preferred embodiment the endosome-specific protease cleavage site is located in the artificial transcription factor between the protein transduction domain and the
transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor does not contain any other protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor. Pharmaceutical compositions
The present invention relates also to pharmaceutical compositions comprising an artificial transcription factor as defined above. Pharmaceutical compositions considered are compositions for parenteral systemic administration, in particular intravenous administration, compositions for inhalation, and compositions for local administration, in particular ophthalmic-topical administration, e.g. as eye drops, or intravitreal, subconjunctival, parabulbar or retrobulbar administration, to warm-blooded animals, especially humans. Particularly preferred are eye drops and compositions for intravitreal, subconjunctival, parabulbar or retrobulbar administration. The compositions comprise the active ingredient alone or, preferably, together with a pharmaceutically acceptable carrier. Further considered are slow-release formulations. The dosage of the active ingredient depends upon the disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. Further considered are pharmaceutical compositions useful for oral delivery, in particular compositions comprising suitably encapsulated active ingredient, or otherwise protected against degradation in the gut. For example, such pharmaceutical compositions may contain a membrane permeability enhancing agent, a protease enzyme inhibitor, and be enveloped by an enteric coating.
The pharmaceutical compositions comprise from approximately 1 % to approximately 95 % active ingredient. Unit dose forms are, for example, ampoules, vials, inhalers, eye drops and the like. The pharmaceutical compositions of the present invention are prepared in a manner known per se, for example by means of conventional mixing, dissolving or lyophilizing processes.
Preference is given to the use of solutions of the active ingredient, and also suspensions or dispersions, especially isotonic aqueous solutions, dispersions or suspensions which, for example in the case of lyophilized compositions comprising the active ingredient alone or together with a carrier, for example mannitol, can be made up before use. The
pharmaceutical compositions may be sterilized and/or may comprise excipients, for example preservatives, stabilizers, wetting agents and/or emulsifiers, solubilizers, salts for regulating osmotic pressure and/or buffers and are prepared in a manner known per se, for example by means of conventional dissolving and lyophilizing processes. The said solutions or suspensions may comprise viscosity-increasing agents, typically sodium
carboxymethylcellulose, carboxymethylcellulose, dextran, polyvinylpyrrolidone, or gelatins, or also solubilizers, e.g. Tween 80* (polyoxyethylene(20)sorbitan mono-oleate).
Suspensions in oil comprise as the oil component the vegetable, synthetic, or semi-synthetic oils customary for injection purposes. In respect of such, special mention may be made of liquid fatty acid esters that contain as the acid component a long-chained fatty acid having from 8 to 22, especially from 12 to 22, carbon atoms. The alcohol component of these fatty acid esters has a maximum of 6 carbon atoms and is a monovalent or polyvalent, for example a mono-, di- or trivalent, alcohol, especially glycol and glycerol. As mixtures of fatty acid esters, vegetable oils such as cottonseed oil, almond oil, olive oil, castor oil, sesame oil, soybean oil and groundnut oil are especially useful. The manufacture of injectable preparations is usually carried out under sterile conditions, as is the filling, for example, into ampoules or vials, and the sealing of the containers.
For parenteral administration, aqueous solutions of the active ingredient in water-soluble form, for example of a water-soluble salt, or aqueous injection suspensions that contain viscosity-increasing substances, for example sodium carboxymethylcellulose, sorbitol and/or dextran, and, if desired, stabilizers, are especially suitable. The active ingredient, optionally together with excipients, can also be in the form of a lyophilizate and can be made into a solution before parenteral administration by the addition of suitable solvents. Compositions for inhalation can be administered in aerosol form, as sprays, mist or in form of drops. Aerosols are prepared from solutions or suspensions that can be delivered with a metered-dose inhaler or nebulizer, i.e. a device that delivers a specific amount of medication to the airways or lungs using a suitable propellant, e.g. dichlorodifluoro-methane,
trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide or other suitable gas, in the form of a short burst of aerosolized medicine that is inhaled by the patient. It is also possible to provide powder sprays for inhalation with a suitable powder base such as lactose or starch.
Eye drops are preferably isotonic aqueous solutions of the active ingredient comprising suitable agents to render the composition isotonic with lacrimal fluid (295-305 mOsm/l).
Agents considered are sodium chloride, citric acid, glycerol, sorbitol, mannitol, ethylene glycol, propylene glycol, dextrose, and the like. Furthermore the composition comprise buffering agents, for example phosphate buffer, phosphate-citrate buffer, or Tris buffer (tris(hydroxymethyl)-aminomethane) in order to maintain the pH between 5 and 8, preferably 7.0 to 7.4. The compositions may further contain antimicrobial preservatives, for example parabens, quaternary ammonium salts, such as benzalkonium chloride, polyhexamethylene biguanidine (PHMB) and the like. The eye drops may further contain xanthan gum to produce gel-like eye drops, and/or other viscosity enhancing agents, such as hyaluronic acid, methylcellulose, polyvinylalcohol, or polyvinylpyrrolidone.
The covalent attachment of a polyethylene glycol moiety (PEGylation) to an artificial transcription factor of the invention is considered to increase solubility of the artificial transcription factor, to decrease its renal clearance, and control its immunogenicity.
Considered are amine as well as thiol reactive polyethylene glycols ranging in size from 1 to 40 Kilodalton. Using thiol reactive polyethylene glycols, site-specific PEGylation of the artificial transcription factors is achieved. The only essential thiol group containing amino acids in the artificial transcription factors of the invention are the cysteine residues located in the zinc finger modules essential for zinc coordination. These thiol groups are not accessible for PEGylation due their zinc coordination, thus, inclusion of one or several cysteine residue into the artificial transcription factors of the invention provides free thiol groups for PEGylation using thiol-specific polyethylene glycol reagents.
Use of artificial transcription factors in a method of treatment Furthermore the invention relates to an artificial transcription factors directed to the endothelin receptor A promoter as described above for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases. Likewise the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor A promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor A promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by endothelin.
Diseases modulated by endothelin are, for example, cardiovascular diseases such as essential hypertension, pulmonary hypertension, chronic heart failure but also chronic renal failure. In addition, renal protection before, during and after radioopaque material application is achieved by blunting the endothelin response. In addition, multiple sclerosis is negatively impacted by the endothelin system. Further diseases modulated by endothelin are diabetic kidney disease or eye diseases such as glaucomatous neurodegeneration, vascular dysregulation in ocular blood circulation, retinal vein occlusion, retinal artery occlusion, macular edema, age related macula degeneration, optic neuropathy, central serous chorioretinopathy, retinitis pigmentosa, Susac syndrome, and Leber's hereditary optic neuropathy.
Likewise the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof. In particular the invention relates to a method of treating glaucomatous neurodegeneration, vascular dysregulation in ocular blood circulation, in particular to a method of treating retinal vein occlusion, retinal artery occlusion, macular edema, optic neuropathy, central serous chorioretinopathy, retinitis pigmentosa, and Leber's hereditary optic neuropathy, comprising administering an effective amount of an artificial transcription factor of the invention to a patient in need thereof. The effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. For administration into the eye, a monthly vitreous injection of 0.5 to 1 mg is preferred. For systemic application, a monthly injection of 10 mg/kg is preferred. In addition, implantation of slow release deposits into the vitreous of the eye is also preferred.
Furthermore the invention relates to an artificial transcription factor directed to the endothelin receptor B promoter as described above for use in influencing the cellular response to endothelin, for lowering or increasing endothelin receptor B levels, and for use in the treatment of diseases modulated by endothelin, in particular for use in the treatment of such eye diseases. Likewise the invention relates to a method of treating a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor B promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by endothelin comprising administering a therapeutically effective amount of an artificial transcription factor directed to the endothelin receptor B promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by endothelin. Diseases modulated by ET-1 -dependent, ETRB-mediated artificial transcription factors are certain cancers, neurodegeneration and inflammation-related disorders.
Furthermore the invention relates to an artificial transcription factor directed to the TLR4 promoter as described above for use in influencing the cellular response to LPS, for lowering or increasing TLR4 levels, and for use in the treatment of diseases modulated by LPS, in particular for use in the treatment of such eye diseases. Likewise the invention relates to a method of treating a disease modulated by LPS comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TLR4 promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by LPS comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TLR4 promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by LPS. Diseases modulated by LPS are rheumatoid arthritis, artherosclerosis, psoriasis, Crohn's disease, uveitis, contact lens associated keratitis, corneal inflammation, resistance of cancers to chemotherapy and the like.
Furthermore the invention relates to an artificial transcription factor directed to the FcERIA promoter as described above for use in influencing the cellular response to IgE or IgE-antigen complexes, for lowering or increasing FcER1 levels, and for use in the treatment of diseases modulated by IgE or IgE-antigen complexes, in particular for use in the treatment of such eye diseases. Likewise the invention relates to a method of treating a disease modulated by IgE or IgE- antigen complexes comprising administering a therapeutically effective amount of an artificial transcription factor directed to the FcERIA promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by IgE or IgE-antigen complexes comprising administering a therapeutically effective amount of an artificial transcription factor directed to the FcERIA promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by IgE or IgE- antigen complexes.
Diseases modulated by IgE or IgE-antigen complexes are in general type I reactions according to the Coombs and Gell classification (Gell P. and Coombs R. (eds), 1968, Clinical Aspects fo Immunology, Blackwell Scientific, Oxford). Such reactions include but are not limited to allergic rhinitis, asthma, atopic dermatitis, pollen allergy, food allergy, hay fever, respiratory allergy, pet allergy, dust allergy, dust mite allergy, allergic uriticaria, allergic alveolitis, allergic aspergillosis, allergic bronchitis, allergic blepharitis, allergic contact dermatitis, allergic conjunctivitis, allergic fungal sinusitis, allergic gastroenteritis, allergic interstitial nephritis, allergic keratitis, allergic laryngitis, allergic purpura, allergic urethritis, allergic vasculitis, eczema and .anaphylaxis and the like.
Furthermore, the invention relates to an artificial transcription factor assembled as to target the promoter region of a nuclear receptor as described above for use in influencing the cellular response to the nuclear receptor ligand, for lowering or increasing the levels of the nuclear receptor, and for use in the treatment of diseases modulated by such nuclear receptors. Likewise, the invention relates to a method of treating diseases modulated by a nuclear receptor ligand comprising administering a therapeutically effective amount of an artificial transcription factor directed to a nuclear receptor promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by a nuclear receptor ligand comprising administering a therapeutically effective amount of an artificial transcription factor directed to a nuclear receptor promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by a nuclear receptor ligand.
Diseases modulated by ligands of nuclear receptors are, for example, adrenal insufficiency, adrenocortical insufficiency, alcoholism, Alzheimer's disease, androgen insensitivity syndrome, anorexia nervosa, aortic aneurysm, aortic valve sclerosis, arthritis, asthma, atherosclerosis, attention deficit hyperactivity disorder, autism, azoospermia, biliary primary cirrhosis, bipolar disorder, bladder cancer, bone cancer, breast cancer, cardiovascular disease, cardiovascular myocardial infarction, celiac disease, cholestasis, chronic kidney failure and metabolic syndrome, cirrhosis, cleft palate, colorectal cancer, congenital adrenal hypoplasia , coronary heart disease, cryptorchidism, deep vein thrombosis, dementia, depression, diabetic retinopathy, endometriosis, endometrial cancer, enhanced S-cone syndrome, essential hypertension, familial partial lipodystrophy, glioblastoma, glucocorticoid resistance, Graves' Disease, high serum lipid levels, hyperapobetalipoproteinemia, hyperlipidemia, hypertension, hypertriglyceridemia, hypogonadotropic hypogonadism, hypospadias, infertility, inflammatory bowel disease, insulin resistance , ischemic heart disease, liver steatosis, lung cancer, lupus erythematosus, major depressive disorder, male breast cancer, metabolic plasma lipid levels, metabolic syndrome, migraine, mulitple sclerosis, myocardial infarct, nephrotic syndrome, non-Hodgkin's lymphoma, obesity, osteoarthritis, osteopenia, osteoporosis, ovarian cancer, Parkinson's disease, preeclampsia, progesterone resistance, prostate cancer, pseudohypoaldosteronism, psoriasis, psychiatric schizophrenia, psychosis, retinitis pigmentosa-37, schizophrenia, sclerosing cholangitis, sex reversal, skin cancer, spinal and bulbar atrophy of Kennedy, susceptibility to myocardial infarction, susceptibility to psoriasis, testicular cancer, type I diabetes, type II diabetes, uterine cancer and vertigo.
Likewise, the invention relates to a method of treating a disease modulated by ligands of nuclear receptors comprising administering a therapeutically effective amount of an artificial transcription factor of the invention to a patient in need thereof. In particular, the invention relates to a method of treating adrenal insufficiency, adrenocortical insufficiency, alcoholism, Alzheimer's disease, androgen insensitivity syndrome, anorexia nervosa, aortic aneurysm, aortic valve sclerosis, arthritis, asthma, atherosclerosis, attention deficit hyperactivity disorder, autism, azoospermia, biliary primary cirrhosis, bipolar disorder, bladder cancer, bone cancer, breast cancer, cardiovascular disease, cardiovascular myocardial infarction, celiac disease, cholestasis, chronic kidney failure and metabolic syndrome, cirrhosis, cleft palate, colorectal cancer, congenital adrenal hypoplasia , coronary heart disease, cryptorchidism, deep vein thrombosis, dementia, depression, diabetic retinopathy, endometriosis, endometrial cancer, enhanced S-cone syndrome, essential hypertension, familial partial lipodystrophy, glioblastoma, glucocorticoid resistance, Graves' Disease, high serum lipid levels, hyperapobetalipoproteinemia, hyperlipidemia, hypertension,
hypertriglyceridemia, hypogonadotropic hypogonadism, hypospadias, infertility, inflammatory bowel disease, insulin resistance , ischemic heart disease, liver steatosis, lung cancer, lupus erythematosus, major depressive disorder, male breast cancer, metabolic plasma lipid levels, metabolic syndrome, migraine, mulitple sclerosis, myocardial infarct, nephrotic syndrome, non-Hodgkin's lymphoma, obesity, osteoarthritis, osteopenia, osteoporosis, ovarian cancer, Parkinson's disease, preeclampsia, progesterone resistance, prostate cancer,
pseudohypoaldosteronism, psoriasis, psychiatric schizophrenia, psychosis, retinitis pigmentosa-37, schizophrenia, sclerosing cholangitis, sex reversal, skin cancer, spinal and bulbar atrophy of Kennedy, susceptibility to myocardial infarction, susceptibility to psoriasis, testicular cancer, type I diabetes, type II diabetes, uterine cancer and vertigo, comprising administering an effective amount of an artificial transcription factor of the invention to a patient in need thereof. The effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. For administration into the eye, a monthly vitreous injection of 0.5 to 1 mg is preferred. For systemic application, a monthly injection of 10 mg/kg is preferred. In addition, implantation of slow release deposits into the vitreous of the eye is also preferred. Furthermore, the invention relates to an artificial transcription factor directed to the glucocorticoid receptor as described above for use in influencing the cellular response to ligands of the glucocorticoid receptor, for lowering or increasing glucocorticoid receptor levels, and for the use in the treatment of diseases modulated by ligands of the glucocorticoid receptor. Likewise the invention relates to a method of treating a disease modulated by ligands of the glucocorticoid receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the glucocorticoid receptor to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by ligands of the glucocorticoid receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the
glucocorticoid receptor to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by ligands of the glucocorticoid receptor.
Diseases considered are glucocorticoid resistance, type II diabetes, obesity, coronary atherosclerosis, coronary artery disease, asthma, celiac disease, lupus erythematosus, depression, stress and nephrotic syndrome. The effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. For administration into the eye, a monthly vitreous injection of 0.5 to 1 mg is preferred. For systemic application, a monthly injection of 10 mg/kg is preferred. In addition, implantation of slow release deposits into the vitreous of the eye is also preferred. Furthermore, the invention relates to an artificial transcription factor directed to the androgen receptor as described above for use in influencing the cellular response to ligands of the androgen receptor, for lowering or increasing androgen receptor levels, and for the use in the treatment of diseases modulated by ligands of the androgen receptor. Likewise the invention relates to a method of treating a disease modulated by ligands of the androgen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the androgen receptor to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by ligands of the androgen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the androgen receptor to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by ligands of the androgen receptor. Diseases considered are prostate cancer, male breast cancer, ovarian cancer, colorectal cancer, endometrial cancer, testicular cancer, coronary artery disease, type I diabetes, diabetic retinopathy, obesity, androgen insensitivity syndrome, osteoporosis, osteoarthritis, type II diabetes, Alzheimer's disease, migraine, attention deficit hyperactivity disorder, depression, schizophrenia, azoospermia, endometriosis, and spinal and bulbar atrophy of Kennedy. The effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. For administration into the eye, a monthly vitreous injection of 0.5 to 1 mg is preferred. For systemic application, a monthly injection of 10 mg/kg is preferred. In addition, implantation of slow release deposits into the vitreous of the eye is also preferred.
Furthermore, the invention relates to an artificial transcription factor directed to the estrogen receptor as described above for use in influencing the cellular response to ligands of the estrogen receptor, for lowering or increasing estrogen receptor levels, and for the use in the treatment of diseases modulated by ligands of the estrogen receptor.
Likewise the invention relates to a method of treating a disease modulated by ligands of the estrogen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the estrogen receptor to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by ligands of the estrogen receptor comprising administering a therapeutically effective amount of an artificial transcription factor directed to the estrogen receptor to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by ligands of the estrogen receptor.
Diseases considered are bone cancer, breast cancer, colorectal cancer, endometrial cancer, prostate cancer uterine cancer, alcoholism, migraine, aortic aneurysm, susceptibility to myocardial infarction, aortic valve sclerosis, cardiovascular disease, coronary artery disease, hypertension, deep vein thrombosis, Graves' Disease, arthritis, mulitple sclerosis, cirrhosis, hepatitis B, chronic liver disease, cholestasis, hypospadias, obesity, osteoarthritis, osteopenia, osteoporosis, Alzheimer's disease, Parkinson's disease, migraine, vertigo), anorexia nervosa, attention deficit hyperactivity disorder, dementia, depression, psychosis, endometriosis and infertility. The effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. For administration into the eye, a monthly vitreous injection of 0.5 to 1 mg is preferred. For systemic application, a monthly injection of 10 mg/kg is preferred. In addition, implantation of slow release deposits into the vitreous of the eye is also preferred. Furthermore, the invention relates to an artificial transcription factor assembled as to target the promoter region of a haploinsufficient gene as described above for use in restoring gene production to physiological levels in order to alleviate pathological phenotypes caused by insufficient gene production expression. Likewise, the invention relates to a method of treating diseases caused or modulated by haploinsufficiency comprising administering a therapeutically effective amount of an artificial transcription factor directed to a
haploinsufficient gene promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease modulated by
haploinsufficiency comprising administering a therapeutically effective amount of an artificial transcription factor directed to a haploinsufficient gene promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease modulated by haploinsufficiency.
Diseases considered in the present invention are Leri-Weill dyschondrosteosis,
frontotemporal lobar degeneration with TDP43 inclusions, Kleefstra syndrome, Digeorge syndrome, neurofibromatosis Type I, Pitt-Hopkins syndrome, mandibulofacial dysostosis with microcephaly, Williams-Beuren syndrome, autosomal dominant Ehlers-Danlos syndrome Type Iv, Dopa-Responsive dystonia due to sepiapterin reductase deficiency, oculocutaneous albinism Type II, Smith-Magenis syndrome, hypoparathyroidism, sensorineural deafness and renal disease (Hdr), Stickler syndrome Type I, Mowat-Wilson syndrome, syndromic
Microphthalmia 3, Ehlers-Danlos syndrome Type III, aniridia, pseudohypoparathyroidism
Type la, early infantile epileptic encephalopathy 4, skin fragility-woolly hair syndrome, Miller- Dieker Lissencephaly syndrome, Wolf-Hirschhorn syndrome, trichorhinophalangeal syndrome Type I, otodental dysplasia, otodental syndrome with coloboma, myotonic dystrophy 1 , Treacher-Collins syndrome 1 , familial acne inversa 1 , Ehlers-Danlos syndrome Type I, brachydactyly-mental retardation syndrome, velocardiofacial syndrome, Ulnar-Mammary syndrome, campomelic dysplasia, early infantile epileptic encephalopathy 5, Koolen-De Vries syndrome, holoprosencephaly 5, syndromic microphthalmia 6, Dravet syndrome, Glutl deficiency syndrome 1 , neurodegeneration with brain iron accumulation 3, autosomal recessive juvenile Parkinson disease 2, synpolydactyly 1 , supravalvular aortic stenosis, dominant optic atrophy 1 , Carney complex Type 1 , Pallister-Hall syndrome, Holt-Oram syndrome, alpha-thalassemia/mental retardation syndrome, seizures, benign familial neonatal 1 , alagille syndrome 1 , brachydactyly type C, familial platelet disorder with associated myeloid malignancy, pancreatic agenesis and congenital heart defects, telomere-related pulmonary fibrosis and/or bone marrow failure 1 , mirror movements 2, speech-language disorder 1 , autosomal dominant deafness 9, Kenny-Caffey syndrome Type 1 , ataxia- telangiectasia, parietal foramina, Feingold syndrome 1 , nail-patella syndrome, autosomal dominant mental retardation 1 , holoprosencephaly 3, congenital clubfoot with or without deficiency of long bones and/or mirror-image Polydactyly, Sotos syndrome 1 , Loeys-Dietz syndrome Type 4, idiopathic basal ganglia calcification 3, trigonocephaly 2, centronuclear myopathy 3, cognitive impairment with or without cerebellar ataxia, familial partial
lipodystrophy Type 4, mononeuropathy of the median nerve, Waardenburg syndrome Type 4c, Waardenburg syndrome Type 4b, atypical hemolytic uremic syndrome 5, autosomal dominant spastic paraplegia 42 , pseudohypoparathyroidism, autosomal dominant spastic paraplegia 31 , autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions 4, spinocerebellar ataxia 27, Charcot-Marie-Tooth Disease Type 2a2, autosomal dominant auditory neuropathy 1 , synpolydactyly 2, limb-girdle muscular dystrophy Type 1c, lissencephaly 1 , spinocerebellar ataxia 15, Ehlers-Danlos-Like syndrome, hereditary motor and sensory neuropathy Type lie, hairy elbows with short stature facial dysmorphism and developmental delay, Axenfeld-Rieger syndrome Type 3, familial infantile convulsions with paroxysmal choreoathetosis, acute myeloid leukemia, Charcot-Marie-Tooth Disease Type 2d, congenital cataracts with sensorineural deafness, Down syndrome-Like Facial Appearance with short stature and mental retardation, autosomal dominant deafness 5, hyperferritinemia with or without cataract, oblique facial clefting 1 , autosomal dominant deafness 2a, early infantile epileptic encephalopathy 1 , susceptibility to autism X-Linked 2, Usher syndrome Type Ilia, thrombocytopenia-absent Radius syndrome, autosomal recessive Robinow syndrome, alveolar capillary dysplasia with misalignment of pulmonary veins, pseudoxanthoma elasticum, familial hyperinsulinemic hypoglycemia 1 , Ullrich congenital muscular dystrophy, iminoglycinuria, Charge syndrome, Wilms Tumor, aniridia, genitourinary anomalies and mental retardation syndrome, tetralogy of Fallot, autosomal dominant spastic paraplegia 4, familial progressive scleroderma, Crest syndrome, autosomal dominant Emery- Dreifuss muscular dystrophy 2, aplasia of lacrimal and salivary glands, retinoblastoma, Dowling-Degos Disease, primary pulmonary hypertension 1 , Currarino syndrome, sacral agenesis syndrome, Prader-Willi syndrome, Greig cephalopolysyndactyly syndrome, juvenile polyposis/hereditary hemorrhagic telangiectasia syndrome, Piebald Trait, limb-girdle muscular dystrophy Type 1 b, Bethlem myopathy, Cowden Disease, Marfan syndrome, renal hypomagnesemia 2, microcephaly with or without chorioretinopathy, lymphedema or mental retardation tylosis with esophageal cancer, Kabuki syndrome 1 , Jacobsen syndrome, diaphragmatic hernia, congenital Hashimoto thyroiditis, open angle glaucoma 1 , Beckwith- Wiedemann syndrome, dopa-responsive dystonia, episodic kinesigenic dyskinesia 1 , primary failure of tooth eruption, Darier-White disease, autosomal dominant cutis laxa 1 , Cornelia De Lange syndrome 1 , cleidocranial dysplasia, orofacial cleft 1 , Van Der Woude syndrome 1 , cherubism, cerebral cavernous malformations, familial hypertrophic cardiomyopathy 4, cardiofaciocutaneous syndrome, brachydactyly Type D, basal cell nevus syndrome, achondroplasia, parietal foramina 2, Potocki-Shaffer syndrome, autosomal dominant congenital dyskeratosis 2, mental retardation with language impairment and autistic features, autosomal dominant anhidrotic ectodermal dysplasia with T-cell immunodeficiency, corticosteroid-binding globulin deficiency, choreoathetosis, hypothyroidism and neonatal respiratory distress, primary coenzyme Q10 deficiency 1 , Duane-Radial Ray syndrome, familial hemiplegic migraine 2, mirror movements 1 , Nager type acrofacial dysostosis 1 , palmoplanar keratoderma punctate Type la, andhypogonadotropic hypogonadism with or without anosmia 2. Furthermore the invention relates to artificial transcription factors directed to the OPA1 promoter as described above for use of increasing OPA1 production, and for use in the treatment of diseases influenced by OPA1 , in particular for use in the treatment of such eye diseases. Diseases modulated by OPA1 are autosomal dominant optic atrophy, autosomal dominant optic atrophy plus as wells as normal tension glaucoma.
Likewise the invention relates to a method of treating a disease influenced by OPA1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the OPA1 promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease influenced by OPA1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the OPA1 promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease influenced by OPA1. In particular the invention relates to a method of treating neurodegeneration associated with normal tension glaucoma or dominant optic atrophy. The effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. For administration into the eye, a monthly vitreous injection of 0.5 to 1 mg is preferred. For systemic application, a monthly injection of 10 mg/kg is preferred. In addition, implantation of slow release deposits into the vitreous of the eye is also preferred. Furthermore the invention relates to artificial transcription factors directed to the TGFbRI promoter as described above for use of increasing or decreasing TGFbRI production, and for use in the treatment of pathological processes influenced by TGFbRI , in particular of use in the treatment of such pathological processes in the eye. Pathological processes modulated by TGFbRI are mal-adapted wound healing following eye surgery.
Likewise the invention relates to a method of treating a disease influenced by TGFBR1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TGFbRI promoter to a patient in need thereof. Likewise the invention relates to an artificial transcription factor for use in the treatment of a disease influenced by TGFBR1 comprising administering a therapeutically effective amount of an artificial transcription factor directed to the TGFbRI promoter to a patient in need thereof. Likewise the invention relates to the use of an artificial transcription factor for the manufacture of a medicament for treating a disease influenced by TGFBR1.
In particular the invention relates to a method of treating neurodegeneration associated with normal tension glaucoma or dominant optic atrophy. The effective amount of an artificial transcription factor of the invention depends upon the particular type of disease to be treated and upon the species, its age, weight, and individual condition, the individual pharmacokinetic data, and the mode of administration. For administration into the eye, a monthly vitreous injection of 0.5 to 1 mg is preferred. For systemic application, a monthly injection of 10 mg/kg is preferred. In addition, implantation of slow release deposits into the vitreous of the eye is also preferred.
Use of artificial transcription factors in plants Furthermore the invention relates to the use of artificial transcription factors targeting plant promoters to improve gene product generation. Preferably, DNA encoding the artificial transcription factors is cloned into vectors for transformation of plant-colonizing
microorganisms or plants. Alternatively, the artificial transcription factors are directly applied in suitable compositions for topical applications to plants.
Use of artificial transcription factors in non-human animals
Furthermore the invention relates to the use of artificial transcription factors targeting non- human animal promoters, haploinsufficient, to enhance gene product generation. Preferably, the artificial transcription factors are directly applied in suitable compositions for topical applications to non-human animals in need thereof.
Method to produce a polydactyl zinc finger protein
In particular the invention relates to a method to produce a polydactyl zinc finger protein comprising an octameric or higher order zinc finger protein comprising
i) selecting a hexameric zinc finger protein from a first zinc finger protein library;
ii) constructing a second zinc finger protein library based on the hexameric zinc finger protein selected in i) by fusing this hexameric zinc finger protein to a random library of two or more zinc fingers;
iii) selecting a polydactyl zinc finger protein comprising an octameric or higher order zinc finger protein.
Preferably the first zinc finger protein library and the second zinc finger protein library comprises an expression vector present in the host organism of the protein library with 1 -2 copies and wherein the expression vector comprises a promoter operably linked to the octameric or higher order zinc finger protein which expresses the octameric or higher order zinc finger protein in Saccharomyces cerevisae with an expression rate of equal to or lower as achieved for an octameric or higher order zinc finger protein expressed by a promoter of SEQ ID NO: 197 in the same Saccharomyces cerevisae.
More preferably the first zinc finger protein library and the second zinc finger protein library comprises an expression vector present in the host organism of the protein library with 1-2 copies wherein the expression vector comprises the promoter of SEQ ID NO: 197 operably linked to the octameric or higher order zinc finger protein. The host organism used in the method is selected from the group consisting of mammal, insect, fungi, yeast, and bacteria, and is preferably yeast.
In a preferred embodiment the hexameric zinc finger protein is selected from the zinc finger protein library in i) by using a modified yeast one hybrid scheme where zinc finger proteins are expressed as fusions to the GAL4 activation domain in yeast leading to the expression of a Aureobasidin resistance.
Screening system for selecting a protein In particular the invention relates to a screening system for selecting a protein comprising i) a host organism which is capable to express the protein;
ii) an expression vector which is present in the host organism of i) with 1 -2 copies wherein the expression vector comprises a promoter operably linked to the protein wherein the protein is expressed in the host organism with an expression rate equal to or lower as achieved for the protein expressed in the same host organism by a promoter of SEQ ID NO:, operably linked to the same protein. Preferably the expression vector comprises the promoter of SEQ ID NO: 197 operably linked to the protein. Preferably the expression vector is an expression vector comprising an ARS/CEN origin of replication.
Thus the invention further relates to an expression vector comprising an ARS/CEN origin of replication and a promoter operably linked to a protein wherein the promoter expresses the protein of interest in a host organism at an expression rate equal to or lower than the expression rate of the promoter of SEQ ID NO: 197 operably linked to the same protein in the same host organism. Preferably the expression vector comprises the promoter of SEQ ID NO: 197 operably linked to the protein.
The expression rate of the promoter of SEQ ID NO: 197 operably linked to a protein e.g a zinc finger protein is defined herein as follows: Expression of the GAL4AD-ZFP protein of SEQ ID NO: 198 under control of such a promoter in yeast Y1 H Gold (Clontech) containing bait plasmid pAN2636 of (SEQ ID NO: 199) integrated into the URA3 marker results in the growth of such yeast cells only on selection plates containing less than 2500 ng/ml
Aureobasidin A.
Method of constructing a specifically targeted therapeutic agent The invention further relates to a method of constructing a specifically targeted therapeutic agent to be delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell comprising the steps of
(a) selecting a therapeutically active protein having beneficial properties when delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of the diseased cell;
(b) determining the relative amount of endosome-specific proteases in the diseased cell;
(c) determining the relative amount of endosome-specific proteases in a healthy cell of the same cell type as the diseased cell;
(d) comparing the relative amounts of endosome-specific proteases in steps (b) and (c) and selecting at least one endosome-specific protease having substantially higher relative concentrations in diseased cells than in healthy cells of the same cell type; (e) constructing the specifically targeted therapeutic agent by fusing the therapeutically active protein of step (a) to a transport protein comprising one or more copies of a protein transduction domain, and incorporating at least one endosome-specific protease cleavage site specific for the endosome-specific proteases selected in step (d) between the therapeutically active protein and the protein transduction domain.
Method of specifically targeting a therapeutically active protein
The invention further relates to a method of specifically targeting a therapeutically active protein to the cytosol and/or the cell nucleus and/or organelles in the cytosol of a diseased cell of a subject comprising the steps of
(a) selecting a therapeutically active protein having beneficial properties when delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of the diseased cell of the subject;
(b) determining the relative amount of endosome-specific proteases in the diseased cell;
(c) determining the relative amount of endosome-specific proteases in a healthy cell of the same cell type as the diseased cell;
(d) comparing the relative amounts of endosome-specific proteases in steps (b) and (c) and selecting at least one endosome-specific protease having substantially higher relative concentrations in diseased cells than in healthy cells of the same cell type; (e) fusing the therapeutically active protein of step (a) to a transport protein comprising one or more copies of a protein transduction domain, and incorporating at least one endosome-specific protease cleavage site specific for the endosome-specific proteases selected in step (d) between the therapeutically active protein and the protein transduction domain;
(f) administering the product of step(e) to a subject so that the therapeutically active protein of step (a) is delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of the diseased cell of the subject.
Method of treatment comprising administering to a subject in need thereof a therapeutically active protein
The invention further relates to a method of treatment comprising administering to a subject in need thereof a therapeutically active protein comprising the steps of
(a) selecting a therapeutically active protein having beneficial properties when delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of the diseased cell of the subject;
(b) determining the relative amount of endosome-specific proteases in the diseased cell;
(c) determining the relative amount of endosome-specific proteases in a healthy cell of the same cell type as the diseased cell;
(d) comparing the relative amounts of endosome-specific proteases in steps (b) and (c) and selecting at least one endosome-specific protease having substantially higher relative concentrations in diseased cells than in healthy cells of the same cell type;
(e) fusing the therapeutically active protein of step (a) to a transport protein comprising one or more copies of a protein transduction domain, and incorporating at least one endosome-specific protease cleavage site specific for the endosome-specific proteases selected in step (d) between the therapeutically active protein and the protein transduction domain;
(f) administering the product of step(e) to a subject so that the therapeutically active protein of step (a) is delivered to the cytosol and/or the cell nucleus and/or organelles in the cytosol of the diseased cell of the subject.
In the context of this invention a therapeutically active protein having beneficial properties to the desired cell refers to a protein which has enzymatic or structural properties that, when supplied externally to the subject improves cellular physiology and/or cures or prevents from pathological disorders.
The methods described above include the following particular embodiments. In a particular embodiment the therapeutically active protein is N-terminally fused to the C-terminal of the transport protein. The protein transduction domain is as described above and is preferably the HIV derived TAT peptide, most preferred is the HIV derived TAT peptide (SEQ ID NO: 1 ) . In one particular embodiment the transport protein further comprises a peptide sequence directing subcellular localization. A peptide sequence directing subcellular localization is defined as an amino acid sequence able to direct transport of proteins containing such a sequence to different intracellular organelles. Proteins lacking such a sequence will by default stay in the cytosol. In one particular embodiment the peptide sequence directing subcellular localization is a nuclear localization sequence, in particular the SV40 nuclear localization sequence. In a particular embodiment the therapeutically active protein is an antibody, in particular a full length antibody, preferably a human or humanized antibody binding to an intracellular protein, or an antibody derivative retaining the binding specificities of the antibody to the intracellular protein. In another particular embodiment the therapeutically active protein is a single chain antibody, preferably a human or humanized single chain antibody binding to an intracellular protein. In another particular embodiment the therapeutically active protein is a DARPin, preferably a DARPin binding to an intracellular protein. In another particular embodiment the therapeutically active protein is a monobody, preferably a monobody binding to an intracellular protein. In another particular embodiment the therapeutically active protein is a nanobody, preferably a nanobody binding to an intracellular protein. In another particular embodiment the therapeutically active protein is an affibody, preferably an affibody binding to an intracellular protein. In another particular embodiment the therapeutically active protein is an anticalin, preferably an anticalin binding to an intracellular protein. In another particular embodiment the therapeutically active protein is an avimer, preferably an avimer binding to an intracellular protein. In another particular embodiment the therapeutically active protein is an affilin, preferably an affilin binding to an intracellular protein. In another particular embodiment the therapeutically active protein is a nanofitin, preferably a nanofitin binding to an intracellular protein. In another particular embodiment the therapeutically active protein is a DNA-binding protein. In another particular embodiment the therapeutically active protein is a RNA-binding protein. In another particular embodiment the therapeutically active protein is an artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, preferably wherein the gene promoter is a receptor gene promoter. In another particular embodiment the
therapeutically active protein is a dominant-negative mutation of an intracellular protein. In another particular embodiment the therapeutically active protein is a protein with enzymatic activity.
In a particular embodiment, the invention relates also to a therapeutic agent comprising a therapeutically active protein fused to a transport protein comprising one or more copies of a protein transduction domain, and comprising one single or two or more endosome-specific protease cleavage sites, preferably a therapeutic agent comprising a therapeutically active protein fused to a transport protein comprising one or more copies of a protein transduction domain, and comprising one single or two or more endosome-specific protease cleavage sites wherein the one single endosome-specific protease cleavage site is different from the amino acid sequence of SEQ ID NO: 26.
Examples
Cloning of DNA plasmids
For all cloning steps, restriction endonucleases and T4 DNA ligase are purchased from New England Biolabs. Shrimp Alkaline Phosphatase (SAP) is from Promega. The high-fidelity Platinum Pfx DNA polymerase (Invitrogen) is applied in all standard PCR reactions. DNA fragments and plasmids are isolated according to the manufacturer's instructions using NucleoSpin Gel and PCR Clean-up kit, NucleoSpin Plasmid kit, or NucleoBond Xtra Midi Plus kit (Macherey-Nagel). Oligonucleotides are purchased from Sigma-Aldrich. All relevant DNA sequences of newly generated plasmids were verified by sequencing (Microsynth).
Cloning of hexameric zinc finger protein libraries for yeast one hybrid
Hexameric zinc finger protein libraries containing GNN and/or CNN and/or ANN binding zinc finger (ZF) modules are cloned according to Gonzalez B. et al,. 2010, Nat Protoc 5, 791 -810 with the following improvements. DNA sequences coding for GNN, CNN and ANN ZF modules were synthesized and inserted into pUC57 (GenScript) resulting in pAN1049 (SEQ ID NO: 107), pAN1073 (SEQ ID NO: 108) and pAN1670 (SEQ ID NO: 109), respectively. Stepwise assembly of zinc finger protein (ZFP) libraries is done in pBluescript SK (+) vector. To avoid insertion of multiple ZF modules during each individual cloning step leading to non- functional proteins, pBluescript (and its derived products containing 1ZFP, 2ZFPs, or 3ZFPs) and pAN1049, pAN1073 or pAN1670 are first incubated with one restriction enzyme and afterwards treated with SAP. Enzymes are removed using NucleoSpin Gel and PCR Cleanup kit before the second restriction endonuclease is added.
Cloning of pBluescript-1ZFPL is done by treating 5 μg pBluescript with Xho\, SAP and subsequently Spel. Inserts are generated by incubating 10 μg pAN1049 (release of 16 different GNN ZF modules) or pAN1073 (release of 15 different CNN ZF modules) or pAN1670 (release of 15 different ANN ZF modules) with Spel, SAP and subsequently Xho\. For generation of pBluescript-2ZFPL and pBluescript-3ZFPL, 7 μg pBluescript-1ZFPL or pBluescript-2ZFPL are cut with Age\, dephosphorylated, and cut with Spel. Inserts are obtained by applying Spel, SAP, and subsequently Xma\ to 10 μg pAN1049 or pAN1073 or pAN1670, respectively. Cloning of pBluescript-6ZFPL was done by treating 14 μg of pBluescript-3ZFPL with Age\, SAP, and thereafter Spel to obtain cut vectors. 3ZFPL inserts were released from 20 ug of pBluescript-3ZFPL by incubating with Spel, SAP, and subsequently Xma\.
Ligation reactions for libraries containing one, two, and three ZFPs were set up in a 3:1 molar ratio of insert:vector using 200 ng cut vector, 400 U T4 DNA ligase in 20 μΙ total volume at RT (room temperature) overnight. Ligation reactions of hexameric zinc finger protein libraries included 2000 ng pBluescript-3ZFPL, 500 ng 3ZFPL insert, 4000 U T4 DNA ligase in 200 μΙ total volume, which were divided into ten times 20 μΙ and incubated separately at RT over night. Portions of ligation reactions were transformed into Escherichia coli by several methods depending on the number of clones required for each library. For generation of pBluescript- 1ZFPL and pBluescript-2ZFPL, 3 μΙ of ligation reaction were directly used for heat shock transformation of E. coli NEB 5-alpha. Plasmid DNA of ligation reactions of pBluescript- 3ZFPL was purified using NucleoSpin Gel and PCR Clean-up kit and transformed into electrocompetent E. coli NEB 5-alpha (EasyjecT Plus electroporator from EquiBio or
Multiporator from Eppendorf, 2.5 kV and 25 \F, 2 mm electroporation cuvettes from Bio-Rad). Ligation reactions of pBluescript-6ZFP libraries were applied to NucleoSpin Gel and PCR Clean-up kit and DNA was eluted in 15 μ I of deionized water. About 60 ng of desalted DNA were mixed with 50 μΙ NEB 10-beta electrocompetent E. coli (New England Biolabs) and electroporation was performed as recommended by the manufacturer using EasyjecT Plus or Multiporator, 2.5 kV, 25 \F and 2 mm electroporation cuvettes. Multiple electroporations were performed for each library and cells were directly pooled afterwards to increase library size. After heat shock transformation or electroporation, SOC medium was applied to the bacteria and after 1 h of incubation at 37°C and 250 rpm, 30 μΙ of SOC culture were used for serial dilutions and plating on LB plates containing ampicillin. The next day, total number of obtained library clones was determined. In addition, ten clones of each library were chosen to isolate plasmid DNA and to check incorporation of inserts by restriction enzyme digestion. At least three of these plasmids were sequenced to verify diversity of the library. The remaining SOC culture was transferred to 100 ml LB medium containing ampicillin and cultured over night at 37°C and 250 rpm. Those cells were used to prepare plasmid Midi DNA for each library.
For yeast one hybrid screens, hexameric zinc finger protein libraries are transferred to a compatible prey vector. For that purpose, the multiple cloning site of pGAD10 (Clontech) was modified by cutting the vector with Xho\/EcoR\ and inserting annealed oligonucleotides OAN971 (TCGACAGGCCCAGGCGGCCCTCGAGGATATCATGATG
ACTAGTGGCCAGGCCGGCCC, SEQ ID NO: 110) and OAN972 (AATTGGGCCGGC CTGGCCACTAGTCATCATGATATCCTCGAGGGCCGCCTGGGCCTG, SEQ ID NO: 11 1 ). The resulting vector pAN1025 (SEQ ID NO: 1 12) was cut and dephosphorylated, 6ZFP library inserts were released from pBluescript-6ZFPL by Xho\/Spe\. Ligation reactions and electroporations into NEB 10-beta electrocompetent E. coli were done as described above for pBluescript-6ZFP libraries.
For improved yeast one hydrid screening, hexameric zinc finger libraries are also transferred into an improved prey vector pAN1375 (SEQ ID NO: 1 13). This prey vector was constructed as follows: pRS315 (SEQ ID NO: 114) was cut /\pal/A/arl and annealed OAN1 143
(CGCCGCATGCATTCATGCAGGCC, SEQ ID NO: 1 15) and OAN1 144
(TGCATGAATGCATGCGG, SEQ ID NO: 1 16) were inserted yielding pAN1373 (SEQ ID NO: 1 17). A Sph\ insert from pAN1025 was ligated into pAN1373 cut with Sph\ to obtain pAN1375.
For further improved yeast one hydrid screening, hexameric zinc finger libraries are also transferred into an improved prey vector pAN1920 (SEQ ID NO: 1 18). For even further improved yeast one hybrid screening, hexameric zinc finger libraries are inserted into prey vector pAN 1992 (SEQ ID NO: 119).
Cloning of bait plasm ids for yeast one hybrid screening
For each bait plasmid, a 60 bp sequence containing a potential artificial transcription factor target site of 18 bp in the center is selected and a Nco\ site is included for restriction analysis. Oligonucleotides are designed and annealed in such a way to produce 5' Hind\\\ and 3' Xho\ sites which allowed direct ligation into pAbAi (Clontech) cut with Hind\\\/Xho\. Digestion of the product with Nco\ and sequencing are used to confirm assembly of the bait plasmid.
Yeast strain and media
Saccharomyces cerevisiae Y1 H Gold was purchased from Clontech, YPD medium and YPD agar from Carl Roth. Synthetic drop-out (SD) medium contained 20 g/l glucose,
6.8 g/l Na2HP04-2H20, 9.7 g/l NaH2P04-2H20 (all from Carl Roth), 1.4 g/l yeast synthetic drop-out medium supplements, 6.7 g/l yeast nitrogen base, 0.1 g/l L-tryptophan, 0.1 g/l L- leucine, 0.05 g/l L-adenine, 0.05 g/l L-histidine, 0.05 g/l uracil (all from Sigma-Aldrich). SD-U medium contained all components except uracil, SD-L was prepared without L-leucine. SD agar plates did not contain sodium phosphate, but 16 g/l Bacto Agar (BD). Aureobasidin A (AbA) was purchased from Clontech.
Preparation of bait yeast strains
About 5 μg of each bait plasmid are linearized with BstB\ in a total volume of 20 μΙ and half of the reaction mix is directly used for heat shock transformation of S. cerevisiae Y1 H Gold. Yeast cells are used to inoculate 5 ml YPD medium the day before transformation and grown over night on a roller at RT. One milliliter of this pre-culture is diluted 1 :20 with fresh YPD medium and incubated at 30°C, 225 rpm for 2-3 h. For each transformation reaction 1 OD6oo cells are harvested by centrifugation, yeast cells are washed once with 1 ml sterile water and once with 1 ml TE/LiAc (10 mM Tris/HCI, pH 7.5, 1 mM EDTA, 100 mM lithium acetate). Finally, yeast cells are resuspended in 50 μΙ TE/LiAc and mixed with 50 μg single stranded DNA from salmon testes (Sigma-Aldrich), 10 μΙ of BsfBI-linearized bait plasmid (see above), and 300 μΙ PEG/TE/LiAc (10 mM Tris/HCI, pH 7.5, 1 mM EDTA, 100 mM lithium acetate, 50 % (w/v) PEG 3350). Cells and DNA are incubated on a roller for 20 min at RT, afterwards placed into a 42°C water bath for 15 min. Finally, yeast cells are collected by centrifugation, resuspended in 100 μΙ sterile water and spread onto SD-U agar plates. After 3 days of incubation at 30°C eight clones growing on SD-U from each transformation reaction are chosen to analyze their sensitivity towards Aureobasidin A (AbA). Pre-cultures were grown over night on a roller at RT. For each culture, OD600 was measured and OD60o=0.3 was adjusted with sterile water. From this first dilution five additional 1 : 10 dilution steps were prepared with sterile water. For each clone 5 μΙ from each dilution step were spotted onto agar plates containing SD-U, SD-U 100 ng/ml AbA, SD-U 150 ng/ml AbA, and
SD-U 200 ng/ml AbA. After incubation for 3 days at 30°C, three clones growing well on SD-U and being most sensitive to AbA are chosen for further analysis. Stable integration of bait plasmid into yeast genome is verified by Matchmaker Insert Check PCR Mix 1 (Clontech) according to the manufacturer's instructions. One of three clones is used for subsequent Y1 H screen.
Transformation of bait yeast strain with polydactyl zinc finger protein library
About 500 μΙ of yeast bait strain pre-culture are diluted into 1 I YPD medium and incubated at 30°C and 225 rpm until OD60o=1.6-2.0 (circa 20 h). Cells are collected by centrifugation in a swing-out rotor (5 min, 1500xg, 4°C). Preparation of electrocompetent cells is done according to Benatuil L. et a/., 2010, Protein Eng Des Sel 23, 155-159. For each transformation reaction, 400 μΙ electrocompetent bait yeast cells are mixed with 1 μg prey plasmids encoding 6ZFP libraries and incubated on ice for 3 min. Cell-DNA suspension is transferred to a pre- chilled 2 mm electroporation cuvette. Multiple electroporation reactions (EasyjecT Plus electroporator or Multiporator, 2.5 kV and 25 \F) are performed until all yeast cell suspension has been transformed. After electroporation yeast cells are transferred to 100 ml of 1 :1 mix of YPD:1 M Sorbitol and incubated at 30°C and 225 rpm for 60 min. Cells are collected by centrifugation and resuspended in 1 -2 ml of SD-L medium. Aliquots of 200 μΙ are spread on 15 cm SD-L agar plates containing 1000-4000 ng/ml AbA. In addition, 50 μΙ of cell suspension are used to make 1/100 and 1/1000 dilutions and 50 μΙ of undiluted and diluted cells are plated on SD-L. All plates are incubated at 30°C for 3 days. The total number of obtained clones is calculated from plates with diluted transformants. While SD-L plates with undiluted cells indicate growth of all transformants, AbA-containing SD-L plates only resulted in colony formation if the prey polydactyl ZFP bound to its bait target site successfully.
Verification of positive interactions and recovery of polydactyl zinc finger protein-encoding prey plasmids For initial analysis, forty good-sized colonies are picked from SD-L plates containing the highest AbA concentration and yeast cells were restreaked twice on SD-L with 1000- 4000 ng/ml AbA to obtain single colonies. For each clone, one colony is used to inoculate 5 ml SD-L medium and cells are grown at RT overnight. The next day, OD60o=0.3 is adjusted with sterile water, five additional 1/10 dilutions are prepared and 5 μΙ of each dilution step are spotted onto SD-L, SD-L 500 ng/ml AbA, 1000 ng/ml AbA, SD-L 1500 ng/ml AbA, SD-L 2000 ng/ml AbA, SD-L 2500 ng/ml AbA, SD-L 3000 ng/ml AbA, and SD-L 4000 ng/ml AbA plates. Clones are ranked according to their ability to grow on high AbA concentration. From best growing clones 5 ml of initial SD-L pre-culture are used to spin down cells and to resuspend them in 100 μΙ water or residual medium. After addition of 50 U lyticase (Sigma- Aldrich, L2524) cells are incubated for several hours at 37°C and 300 rpm on a horizontal shaker. Generated spheroblasts are lysed by adding 10 μΙ 20 % (w/v) SDS solution, mixed vigorously by vortexing for 1 min and frozen at -20°C for at least 1 h. Afterwards,
250 μΙ A1 buffer from NucleoSpin Plasmid kit and one spatula tip of glass beads (Sigma- Aldrich, G8772) are added and tubes are mixed vigorously by vortexing for 1 min. Plasmid isolation is further improved by adding 250 μΙ A2 buffer from NucleoSpin Plasmid kit and incubating for at least 15 min at RT before continuing with the standard NucleoSpin Plasmid kit protocol. After elution with 30 μΙ of elution buffer 5 μΙ of plasmid DNA are transformed into E. coli DH5 alpha by heat shock transformation. Two individual colonies are picked from ampicillin-containing LB plates, plasmids are isolated and library inserts are sequenced.
Obtained results are analyzed for consensus sequences among the polydactyl ZFPs for each target site.
Cloning of gene promoters for combined secreted luciferase and alkaline phosphatase assay DNA fragments containing promoter regions are cloned into pAN1485 (NEG-PG04,
GeneCopeia) or pAN1486 (EF1 a-PG04, GeneCopeia) resulting in reporter plasmids containing secreted Gaussia luciferase under the control of a haploinsufficient gene promoter and secreted embryonic alkaline phosphatase under the control of the constitutive CMV promoter allowing for normalization of luciferase to alkaline phosphatase signal.
Cloninp of a reporter plasmid for the generation of stable luciferase/secreted alkaline phosphatase reporter cell lines for testing transducible artificial transcription factor activity
To generate a reporter construct containing Gaussia luciferase under the control of a hybrid CMV/artificial transcription factor target site promoter together with secreted alkaline phosphatase under control of the constitutive CMV promoter, 42 bp containing the artificial transcription factor binding site were cloned Afl\\\ISpe\ into pAN1660 (SEQ ID NO: 120). These reporter constructs contain a Flpln site for stable integration into Flpln site containing cells such as HEK293 Flpln TRex (Invitrogen) cells.
Cloning of artificial transcription factors for mammalian transfection
DNA fragments encoding polydactyl zinc finger proteins either generated through
Gensynthesis (GenScript) or selected by yeast one hybrid are cloned using standard procedures (Age\/Xho\) into mammalian expression vectors for expression in mammalian cells as fusion proteins between the zinc finger array of interest, a SV40 NLS, a 3x myc epitope tag and a N-terminal KRAB domain (pAN1255 - SEQ ID NO: 121 ), a C-terminal KRAB domain (pAN1258 - SEQ ID NO: 122), a SID domain (pAN1257 - SEQ ID NO: 123) or a VP64 activating domain (pAN1510 - SEQ ID NO: 124). Plasmids for the generation of stably transfected, tetracycline-inducible cells were generated as follows: DNA fragments encoding artificial transcriptions factors comprising polydactyl zinc finger domain, a regulatory domain (N-terminal KRAB, C-terminal KRAB, SID or VP64), SV40 NLS and a 3x myc epitope tag are cloned into pcDNA5/FRT/TO (Invitrogen) using
EcoRV/Not\.
Plasmids for the generation of stably transfected, tetracycline-inducible cells were generated as follows: DNA fragments encoding artificial transcriptions factors comprising polydactyl zinc finger domain, a regulatory domain (N-terminal KRAB, C-terminal KRAB, SID or VP64), and a SV40 NLS are cloned into pAN2071 (SEQ ID NO: 125) EcoRV/Age\. These artificial transcription factor expression plasmids can be integrated into the human genome into the AAVS1 locus by co-transfection with AAVS1 Left TALEN and AAVS1 Right TALEN
(GeneCopoeia).
Cell culture and transfections
HeLa cells are grown in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 4.5 g/l glucose, 10 % heat-inactivated fetal bovine serum, 2 mM L-glutamine, and
1 mM sodium pyruvate (all from Sigma-Aldrich) in 5 % C02 at 37°C. For luciferase reporter assay, 7000 HeLa cells/well are seeded into 96 well plates. Next day, co-transfections are performed using Effectene Transfection Reagent (Qiagen) according to the manufacturer's instructions. Plasmid midi preparations coding for artificial transcription factor and for luciferase are used in the ratio 3:1. Medium is replaced by 100 μΙ per well of fresh DMEM 6 h and 24 h after transfection. Generation and maintenance of Flp-lnTm T-Rex™ 293 Expression Cell Lines
Stable, tetracycline inducible Flp-lnTm T-Rex™ 293 expression cell lines are generated by Flp Recombinase-mediated integration. Using Flp-lnTm T-Rex™ Core Kit, the Flp-lnTm T-Rex™ host cell line is generated by transfecting pFRT/lacZeo target site vector and pcDNA6/TR vector. For generation of inducible 293 expression cell lines, the pcDNA5/FRT/TO expression vector containing the gene of interest is integrated via Flp recombinase-mediated DNA recombination at the FRT site in the Flp-lnTm T-Rex™ host cell line. Stable Flp-lnTm T-Rex™ expression cell lines are maintained in selection medium containing (DMEM; 10 % Tet-FBS; 2 mM glutamine; 15 μg/ml blasticidine and 100 μg/ml hygromycin). For induction of gene expression tetracycline is added to a final concentration of 1 μg/ml.
Generation and maintenance of stably artificial transcription factor expressing cell lines using TALENs
To generate cell lines stably expressing artificial transcription factors under the control of a tetracycline-inducible promoter, cells are co-transfected with a pAN2071 -based expression construct containing the artificial transcription factor of interest and AAVS1 Left TALEN and AAVS1 Right TALEN (GeneCopoeia) plasmids using Effectene (Qiagen) transfection reagent) according to the manufacturer's recommendations. 8 hours post-transfection, growth medium was aspirated, cells were washed with PBS and fresh growth medium was added. 24h post transfection cells were split at a ratio of 1 :10 in growth medium containing Tet- approved FBS (tetracycline free FBS, Takara) without antibiotics. 48 h post-transfection, puromycin selection was started at cell-type specific concentration and cells were kept under selection pressure for 7-10 days. Colonies of stable cells were pooled and maintained in selection medium. A luciferase reporter assay for assessing artificial transcription factor activity following protein transduction
Stable HEK293 Flpln cells were prepared containing Gaussia luciferase under control of a hybrid CMV promoter containing the target site appropriate for the respective artificial transcription factor as well as SEAP under control of the constitutive CMV promoter. HEK293 Flpln cells were transfected with pAN1660 or pAN1705 (SEQ ID NO: 126) to generate cell lines for testing artificial transcription factors targeting the ETRA or the FcERIA promoter, respectively.
These cells were treated in OptiMem for 2 hours with the appropriate artificial transcription factor (1 uM) or with buffer, an unrelated or inactive artificial transcription factor as control. Following protein transduction, cells are harvested and reseeded into normal growth medium and luciferase as well as SEAP activity was measured after 24 hours according to
manufacturer's recommendation (Gaussia Luciferase Glow Assay Kit, Thermo Scientific; SEAP Reporter Gene Assay Chemiluminescence, Roche). Luciferase values were normalized to SEAP activity and compared to control cells set to 100 %.
Determination of gene expression levels by quantitative RT-PCR
Total RNA is isolated from cells using the RNeasy Plus Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Frozen cell pellets are resuspended in RLT Plus Lysis buffer containing 10 μΙ / ml β-mercaptoethanol. After homogenization using
QIAshredder spin columns, total lysate is transferred to gDNA Eliminator spin columns to eliminate genomic DNA. One volume of 70 % ethanol is added and total lysate is transferred to RNeasy spin columns. After several washing steps, RNA is eluted in a final volume of 30 μ I RNase free water. RNA is stored at -80°C until further use. Synthesis of cDNA is performed using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems, Branchburg, New Jersey, USA) according to the manufacturer's instructions. cDNA synthesis is carried out in 20 μΙ of total reaction volume containing 2 μΙ 10x Buffer, 0.8 μΙ 25x dNTP Mix, 2 μΙ 10x RT Random Primers, 1 μΙ Multiscribe Reverse Transcriptase and 4.2 μΙ H20. A final volume of 10 μΙ RNA is added and the reaction is performed under the following conditions: 10 minutes at 25°C, followed by 2 hours at 37°C and a final step of 5 minutes at 85°C. Quantitative PCR is carried out in 20 μΙ of total reaction volume containing 1 μΙ 20x TaqMan Gene Expression Master Mix, 10.0 μΙ TaqMan® Universal PCR Master Mix (both Applied Biosystems,
Branchburg, New Jersey, USA) and 8 μΙ H20. For each reaction 1 μΙ of cDNA is added. qPCR is performed using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Branchburg, New Jersey, USA) under the following conditions: an initiation step for 2 minutes at 50°C is followed by a first denaturation for 10 minutes at 95°C and a further step consisting of 40 cycles of 15 seconds at 95°C and 1 minute at 60°C.
Determination of cathepsin expression levels by RT-PCR using SYBR green Real-time PCR was carried out in 10 μΙ of total reaction volume containing 5 μΙ of FastStart Universal SYBR Green Master Mix (Roche, Mannheim, Germany), 0.1 μΙ of 30 μΜ forward and reverse primers (Roche, Basel, Switzerland) specific for each cathepsin and 3.8 μΙ H20. For each reaction 1 μΙ of cDNA (10ng/ μΙ - prepared as described above) was added. Real- time PCR was performed using the ABI VNATM7 Real-time PCR System (Applied
Biosystems, Branchburg, New Jersey, USA) under the following conditions: a hold stage consisting of 2 minutes at 50°C and 10 minutes at 95°C is followed by the PCR step consisting of 40 cycles of 15 seconds at 95°C and 1 minute at 60°C. To evaluate specificity of PCR amplification a final melt curve step was added.
Oligonucleotides used for the determination of cathepsin and GAPDH expression are listed in Table 9.
Table 9: Sequences of oligonucleotides used to determine the expression levels of cathepsins B, D, F, G, H, K, L, and S in comparison to the house-keeping gene
glyceraldehyde 3-phosphate dehydrogenase (GAPDH).
Cathepsin Forward (5') Reverse (3')
B OAN1733 OAN1734
(CAGCCACCCAGATGTAAGC, (GCCGGATCCTAGATCCACTA, SEQ ID NO: 127) SEQ ID NO: 128)
D OAN1735 OAN1736
(CATCTTCTCCTTCTACCTGAGCA, (GTCTGTGCCACCCAGCAT,
SEQ ID NO: 129)
SEQ ID NO: 130)
F OAN1749 OAN1750
(CTCGGCCATAAAGAATTTGG, (GACTGCATGTGACCCTGGTA, SEQ ID NO: 131 ) SEQ ID NO: 132)
G OAN1739 OAN1740
(TTCTGCTGGCC I I I CTCCTA, (GGATCTGAAGATACGCCATGT, SEQ ID NO: 133) SEQ ID NO: 134)
H OAN1747 OAN1748
(AGTGGGGAATGAACGGGTA, (ACACCAGAGGGATGGGGTA, SEQ ID NO: 135) SEQ ID NO: 136)
K OAN1741 OAN1742
(GCCAGACAACAGA I I I CCATC, (CAGAGCAAAGCTCACCACAG , SEQ ID NO: 137) SEQ ID NO: 138) L OAN1743 OAN1744
(TGGGTAAATGCTTGGGAGAA, (AAGGCAGCAAGGATGAGTGT, SEQ ID NO: 139) SEQ ID NO: 140)
S OAN1745 OAN1746
(ATACGATCTGGGCATGAACC, (TCTCAGGGAACTCGTCAAAGA, SEQ ID NO: 141 ) SEQ ID NO: 142)
GAPDH OAN1810 OAN181 1
(AGCCACATCGCTCAGACAC, (GCCCAATACGACCAAATCC, SEQ ID NO: 143) SEQ ID NO: 144)
Limited digestion of artificial transcription factors with purified cathepsins
2 μg purified artificial transcription factor protein were digested for 2 h at 37°C with 3.0 or 0.3 mU cathepsin B (Enzo Life Science; BML-SE198), 30 or 3 mU cathepsin D (Enzo Life Science; BML-SE199), 0.0003 or 0.00003 mU cathepsin K (Enzo Life Science; BML-SE 553), 0.003 or 0.0003 mU cathepsin L (Enzo Life Science; BML-SE201 ) and 0.3 or
0.03 mU cathepsin S (Enzo Life Science; BML-SE453), respectively. The digestions were performed in 100 mM sodium acetate (Merck; 1.01539.0500), 2 mM DTT (Roth; 6908.3), pH 5.5 for cathepsins B, D, K and L or in 100 mM Bis-Tris (Roth; 9140.2), 2 mM DTT, pH 6.5 for cathepsin S.
Evaluation of susceptibility of artificial transcription factors to digestion in vivo
Hela cells were grown to 80 % confluence in a 10 cm dish and transduced with 10 ml of 1 μΜ purified artificial transcription factor protein in OptiMEM (Gibco; 1 1058-021 ) for 2 h at 37°C and 5 % C02. After transduction, cells were trypsinized, washed with PBS and lysed in 100 μΙ RIPA buffer (Pierce; 89901 ). The lysate was centrifuged at 14'000xg for 5 min and supernatant was isolated. Protein concentration was determined by BCA assay (Pierce; 23225). Treatment of cells with the fusogenic peptide TATHA2
Cells were co-treated with 1 μΜ purified artificial transcription factor protein in OptiMEM together with 5 μΜ TATHA2 peptide for 2 hours at 37°C and 5 % C02.
Cloning of artificial transcription factors for bacterial expression
DNA fragments encoding artificial transcription factors are cloned using standard procedures EcoRV/Not\ into bacterial expression vector pAN983 (SEQ ID NO: 145) based on pET41 a+ (Novagen) for expression in E. coli as His6-tagged fusion proteins between the artificial transcription factor and the TAT protein transduction domain. For expression of cathepsin B sensitive artificial transcription factor containing a cathepsin B cleavage site of SEQ ID NO: 26, DNA fragments encoding artificial transcription factors are cloned using standard procedures (EcoRV/Not\) into bacterial expression vector pAN1688 (SEQ ID NO: 146).
Expression constructs for the bacterial production of transducible artificial transcription factors in suitable E. coli host cells such as BL21 (DE3) are pAN1488 (SEQ ID NO: 147), pAN1572 (SEQ ID NO: 148), pAN1688, pAN1880 (SEQ ID NO: 149), pAN2381 (SEQ ID NO: 150), pAN2383 (SEQ ID NO: 151 ) , pAN2385 (SEQ ID NO: 152) , pAN2387 (SEQ ID NO: 153) pAN2389 (SEQ ID NO: 154) , pAN2403 (SEQ ID NO: 155) , pAN2404 (SEQ ID NO: 156) pAN2405 (SEQ ID NO: 157) , pAN2406 (SEQ ID NO: 158) , pAN2407 (SEQ ID NO: 159) pAN2443 (SEQ ID NO: 160) , pAN2444 (SEQ ID NO: 161 ) , pAN2445 (SEQ ID NO: 162) pAN2446 (SEQ ID NO: 163) , pAN2447 (SEQ ID NO: 164) , pAN2448 (SEQ ID NO: 165) pAN2449 (SEQ ID NO: 166) , pAN2450 (SEQ ID NO: 167) , pAN2451 (SEQ ID NO: 168) pAN2452 (SEQ ID NO: 169) , pAN2453 (SEQ ID NO: 170) , pAN2454 (SEQ ID NO: 171 ) pAN2467 (SEQ ID NO: 172) , pAN2468 (SEQ ID NO: 173) , pAN2469 (SEQ ID NO: 174) pAN2470 (SEQ ID NO: 175) , pAN2474 (SEQ ID NO: 176) , pAN2491 (SEQ ID NO: 177) pAN2493 (SEQ ID NO: 178) , pAN2499 (SEQ ID NO: 179) , pAN2501 (SEQ ID NO: 180) pAN2503 (SEQ ID NO: 181 ) , pAN2505 (SEQ ID NO: 182) , pAN2510 (SEQ ID NO: 183) pAN251 1 (SEQ ID NO: 184) , pAN2512 (SEQ ID NO: 185) , pAN2513 (SEQ ID NO: 186) pAN2523 (SEQ ID NO: 187) , pAN2524 (SEQ ID NO: 188) , and pAN2525 (SEQ ID NO: 89), pAN2869 (SEQ ID NO: 287) , pAN2870 (SEQ ID NO: 288) , pAN2871 (SEQ ID NO: 289) pAN2872 (SEQ ID NO: 290) , pAN2873 (SEQ ID NO: 291 ) , pAN2874 (SEQ ID NO: 292) pAN2875 (SEQ ID NO: 293) , pAN2876 (SEQ ID NO: 294) , pAN2877 (SEQ ID NO: 295) pAN2878 (SEQ ID NO: 296) , pAN2879 (SEQ ID NO: 297) , pAN2880 (SEQ ID NO: 298) pAN2881 (SEQ ID NO: 299) , pAN2882 (SEQ ID NO: 300) , pAN2883 (SEQ ID NO: 301 ) pAN2884 (SEQ ID NO: 302) , pAN2885 (SEQ ID NO: 303) , pAN2886 (SEQ ID NO: 304) pAN2887 (SEQ ID NO: 305) , pAN2888 (SEQ ID NO: 306) , pAN2889 (SEQ ID NO: 307) pAN2890 (SEQ ID NO: 308) , pAN2891 (SEQ ID NO: 309) , pAN2892 (SEQ ID NO: 310) pAN2893 (SEQ ID NO: 31 1 ) , pAN2894 (SEQ ID NO: 312) , pAN2895 (SEQ ID NO: 313) pAN2896 (SEQ ID NO: 314, pAN2897 (SEQ ID NO: 315), pAN2898 (SEQ ID NO: 316), pAN2899 (SEQ ID NO: 317) , pAN2909 (SEQ ID NO: 318) , pAN2910 (SEQ ID NO: 319) pAN291 1 (SEQ ID NO: 320) , pAN2912 (SEQ ID NO: 321 ) , pAN2913 (SEQ ID NO: 322) pAN2914 (SEQ ID NO: 323, pAN2915 (SEQ ID NO: 324), pAN2916 (SEQ ID NO: 325), pAN2917 (SEQ ID NO: 326), pAN2918 (SEQ ID NO: 327), pAN2919 (SEQ ID NO: 328) , pAN2973 (SEQ ID NO: 329) , pAN2974 (SEQ ID NO: 330) , pAN2975 (SEQ ID NO: 331 ) , pAN2976 (SEQ ID NO: 332), and pAN2977 (SEQ ID NO: 333).
Expression constructs for the bacterial production of inactive transducible artificial transcription factors for control purposes are, pAN1714 (SEQ ID NO: 190), pAN1806 (SEQ ID NO: 191 ), and pAN1881 (SEQ ID NO: 192). The naming scheme is as follows: artificial transcription factor proteins are named ATF followed by a number e.g. ATF1688; plasmid coding for artificial transcription factors are named pAN followed by a number, e.g pAN1688 encodes for ATF1688.
Production of artificial transcription factor protein
E. coli BL21 (DE3) transformed with expression plasmid for a given artificial transcription factor were grown in 1 I LB media supplemented with 100 μΜ ZnCI2 until OD600 between 0.8 and 1 was reached, and induced with 1 mM IPTG for two hours. Bacteria were harvested by centrifugation, bacterial lysate was prepared by sonication, and inclusion bodies were purified. To this end, inclusion bodies were collected by centrifugation (5000g, 4°C, 15 minutes) and washed three times in 20 ml of binding buffer (50 mM HEPES, 500 mM NaCI, 10 mM imidazole; pH 7.5). Purified inclusion bodies were solubilized on ice for one hour in 30 ml of binding buffer A (50 mM HEPES, 500 mM NaCI, 10 mM imidazole, 6 M GuHCI; pH 7.5). Solubilized inclusion bodies were centrifuged for 40 minutes at 4°C and 13Ό00 g and filtered through 0.45 μηι PVDF filter. His-tagged artificial transcription factors were purified using His- Trap columns on an Aktaprime FPLC (GEHealthcare) using binding buffer A and elution buffer B (50 mM HEPES, 500 mM NaCI, 500 mM imidazole, 6 M GuHCI; pH 7.5). Fractions containing purified artificial transcription factor were pooled and dialyzed at 4°C overnight against buffer S (50 mM Tris-HCI, 500 mM NaCI, 200 mM arginine, 100 μΜ ZnCI2, 5 mM GSH, 0.5 mM GSSG, 50 % glycerol; pH 7.5) in case the artificial transcription factor contained a SID domain, or against buffer K (50 mM Tris-HCI, 300 mM NaCI, 500 mM arginine, 100 μΜ ZnCI2, 5 mM GSH, 0.5 mM GSSG, 50 % glycerol; pH 8.5) for KRAB domain containing artificial transcription factors. Following dialysis, protein samples were centrifuged at 14Ό00 rpm for 30 minutes at 4°C and sterile filtered using 0.22 μηι Millex-GV filter tips (Millipore). For artificial transcription factors containing VP64 activation domain, the protein was produced from the soluble fraction (binding buffer: 50 mM NaP04 pH 7.5, 500 mM NaCI, 10 mM imidazole; elution buffer 50 mM HEPES pH 7.5, 500 mM NaCI, 500 mM imidazole) using His-Bond Ni-NTA resin (Novagen) according to manufactures recommendation. Protein was dialyzed against VP64-buffer (550 mM NaCI pH 7.4, 400 mM arginine, 100 μΜ ZnCI2). Protein concentration was determined by measuring OD28o.
Determination of DNA binding activity of artificial transcription factors using ELDIA (enzyme- linked DNA interaction assay)
BSA pre-blocked nickel coated plates (Pierce) are washed 3 times with wash buffer
(25 mM Tris/HCI pH 7.5, 150 mM NaCI, 0.1 % BSA, 0.05 % Tween-20). Plates are coated with purified artificial transcription factor under saturating conditions (50 pmol/well) in storage buffer and incubated 1 h at RT with slight shake. After 3 washing steps, 1x 10 ~12 to 5x 10~7 M of annealed, biotinylated oligos containing 60 bp promoter sequence are incubated in binding buffer (10 mM Tris/HCI pH 7.5, 60 mM KCI, 1 mM DTT, 2 % glycerol, 5 mM MgCI2 and 100 μΜ ZnCI2) in the presence of unspecific competitor (0.1 mg/ml ssDNA from salmon sperm, Sigma) with the bound artificial transcription factor for 1 h at RT. After washing (5 times), wells are blocked with 3 % BSA for 30 minutes at RT. Anti-streptavidin-HRP is added in binding buffer for 1 h at RT. After 5 washing steps, TMB substrate (Sigma) is added and incubated for 2 to 30 minutes at RT. Reaction is stopped by addition of TMB stop solution (Sigma) and sample extinction is read at 450 nm. Data analysis of ligand binding kinetics is done using Sigma Plot V8.1 according to Hill.
Protein transduction
Cells grown to about 80 % confluency are treated with 0.01 to 1 μΜ artificial transcription factor or mock treated for 2 h to 120 h with optional addition of artificial transcription factor every 24 h in OptiMEM or growth media at 37°C. For immunofluorescence, cells are washed once in PBS, trypsinized and seeded onto glass cover slips for further examination.
Immunofluorescence
Cells are fixed with 4 % paraformaldehyde in PBS, treated with 0.15 % Triton X-100 for 15 minutes, blocked with 10 % BSA/PBS and incubated overnight with mouse anti-HA antibody (1 :500, H9658, Sigma) or mouse anti-myc (1 :500, M5546, Sigma). Samples are washed three times with PBS/1 % BSA, and incubated with goat anti-mouse antibodies coupled to Alexa Fluor 546 (1 : 1000, Invitrogen) and counterstained using DAPI (1 : 1000 of 1 mg/ml for 3 minutes, Sigma). Samples are analyzed using fluorescence microscopy.
Analysis of cathepsin expression in tissue
Parafin-embedded tissue slides were stained using standard immunohistochemical procedures using antibodies against cathepsin B (abeam, ab58802), cathepsin D (abeam, ab75852), cathepsin E (abeam, ab36996), cathepsin F (proteintech, 1 1055-1 -AP), cathepsin G (abeam, ab50845), cathepsin K (origene, TA318065), cathepsin L (abeam, ab6314), cathepsin H (abeam, ab115229), and cathepsin S (abeam, ab135651 ).
Western blotting
For measuring protein levels, cells are lysed using RIPA buffer (Pierce) and protein lysates are mixed with Laemmli sample buffer and heated. For purified proteins, proteins are mixed with Laemmli sample buffer and heated. Proteins are separated by SDS-PAGE according to their size and transferred using electroblotting to nitrocellulose membranes. Detection of proteins is performed using specific primary antibodies raised in mice or rabbits. Detection of primary antibodies is performed either by secondary antibodies coupled to horseradish peroxidase and luminescence-based detection (ECL plus, Pierce) or secondary antibodies coupled to Dyl_ight700 or Dyl_ight800 fluorescent detected and quantified using an infrared laser scanner.
Myography
Human placental vessels were dissected from placenta obtained from the local labor ward immediately after elective cesarean. The dissected vessels are cut into ring segments of approximately 2 mm length and are cultured in RPMI medium supplemented with penicillin (1000 lU/ml), streptomycin (100 μg/ml), amphotericin (0.25 μg/ml) and either control or 1 uM transducible artificial transcription factors. Vessels will be cultured in an incubator at 37 °C in a humidified atmosphere of 5 % C02 in air. The media is replaced daily with fresh media containing either 1 uM transducible artificial transcription facor or corresponding control. Vessel rings are then attached by 40 μηι diameter wire running through the lumen of the vessel to stainless steel heads in pre-heated 5 ml myograph baths containing physiological saline solution (PSS with the following composition: 119.0 mM NaCI, 4.7 mM KCI, 1.2 mM MgS04, 24.9 mM NaHC03, 1.2 mM KH2P04, 2.5 mM CaCI2 and 11.1 mM glucose), aerated with 95 % 02 and 5 % C02 and maintained at a temperature of 37 °C. Changes in tension are recorded using a Multi Wire Myograph System-610M (Danish Myo Technology Aarhus, Denmark). The segments are allowed to equilibrate for at least 30 minutes. To assess vessel functionality, vessel segments are exposed to high potassium PSS (KPSS; 62.5 mM) three times in order to measure their contractile responses with washes in between. Then, vessel segments are rinsed with PSS and allowed to return to baseline, before exposure to the contractile mediator U46619 (100 nM) and following plateau of the response, endothelium- dependent relaxation is assessed by adding the known endothelium-dependent dilator bradykinin (BK; 10 μΜ). Vessels are then rinsed and allowed to return to baseline over at least 1 hour. Following return to baseline, vessel segments are then exposed to the vasoconstrictor peptide Endothelin-1 (ET-1 ) and a cumulative concentration response curve (CCRC) is conducted in half-log steps from 0.1 nM to 100 nM. Without washing, the vessels are then exposed again to the known endothelium-dependent dilator BK (10 μΜ). Vessel segments which do not respond to KPSS, U46619 or BK are deemed to be non-functional. mRNA display
First, a DNA library was assembled using OAN1953 (SEQ ID NO: 334), OAN1954 (SEQ ID NO: 335), OAN1955 (SEQ ID NO: 336), OAN1956 (SEQ ID NO: 337), OAN1957 (SEQ ID NO: 338), and OAN1981 (SEQ ID NO: 339) using Phusion polymerase (NEB). This DNA library was in vitro transcribed into mRNA using HiScribe T7 Quick High Yield RNA synthesis Kit (NEB). Afterwards, the mRNA library was treated with DNAse I (NEB) to remove input DNA. RNA was purified using NucleoSpin RNA Clean-up (Macherey-Nagel) and linked to OAN1979 (SEQ ID NO: 340) (5'-Psora-(lMGCGG \l/GC)-(dA)13-Spacer18-dCdC-Puro-3' (italic sequence represents 2'-OMe-RNA)) modified at its 5' end with psoralen and its 3' end with puromycin (Microsynth) using irradiation with 365 nm light. Cross-linked mRNA library was purified using Amicon Ultra-0.5 centrifugal filter devices. Purified puromycin-modified mRNA library was in vitro translated using PURExpress in vitro protein synthesis kit (NEB) and bound to either magnetic anti-FLAG beads (Sigma-Aldrich) or magnetic HIS-Select beads (Sigma-Aldrich). Bound library was sequentially digested using cathepsin D (Enzo Life Sciences) and cathepsin B (Enzo Life Sciences). Following digestion, mRNA in supernatant after sequential digest was reverse transcribed into cDNA using ProtoScript II reverse transcriptase (NEB) and used again for mRNA display procedure.

Claims

Claims
1. An artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and one single or two or more endosome-specific protease cleavage sites, wherein the one single endosome-specific protease cleavage site is different from the amino acid sequence SEQ ID NO: 26.
2. An artificial transcription factor according to claim 1 comprising two or more endosome- specific protease cleavage sites, wherein said endosome-specific protease cleavage sites are cleaved by different endosome-specific proteases.
3. An artificial transcription factor according to claim 1 or 2, wherein the protein transduction domain is the TAT peptide.
4. An artificial transcription factor according to any one of claims 1 to 3, wherein the endosome-specific protease cleavage site is a cathepsin cleavage site.
5. An artificial transcription factor according to any one of claims 1 to 3, wherein one out of the two or more endosome-specific protease cleavage sites is cleaved by cathepsin B.
6. An artificial transcription factor according to claim 5, wherein the endosome-specific protease cleavage site comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 27, 32, 41 , 44, 45, and 46.
7. An artificial transcription factor according to any one of claims 1 to 3, wherein one endosome-specific protease cleavage site is cleaved by cathepsin D.
8. An artificial transcription factor according to claim 7, wherein the endosome-specific protease cleavage site comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 31 , 32, 34, 35, 36, 38, 39, 40, 41 , 42, and 43.
9. An artificial transcription factor according to any one of claims 1 to 3, wherein one endosome-specific protease cleavage site is cleaved by cathepsin K.
10. An artificial transcription factor according to claim 9, wherein the endosome-specific protease cleavage site comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 27, 29, 30, 31 , 32, 34, 35, 36, 37, 39, 40, 41 , or 42.
1 1 . An artificial transcription factor according to any one of claims 1 to 3, wherein one endosome-specific protease cleavage site is cleaved by cathepsin L.
12. An artificial transcription factor according to claim 1 1 , wherein the endosome-specific protease cleavage site comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 31 , 32, 35, 36, 40, or 41.
13. An artificial transcription factor according to any one of claims 1 to 3, wherein the endosome-specific protease cleavage site is cleaved by cathepsin S.
14. An artificial transcription factor according to claim 13, wherein the endosome-specific protease cleavage site comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 29, 30, 31 , 32, 35, 36, 37, 40, or 41.
15. An artificial transcription factor according to any one of claims 1 -14, wherein the artificial transcription factor comprises an endosome-specific protease cleavage site recognized by an endosome-specific protease low expressed or absent in the target cell type, but expressed in non-target cell types, wherein such an endosome-specific protease cleavage site is located within or between domains of the artificial transcription factor essential for its activity.
16. An artificial transcription factor according to claim 15, wherein the domains of the artificial transcription factor essential for its activity are the nuclear localization sequence, the inibitory or activatory domain, or the polydactyl zinc finger protein.
17. An artificial transcription factor according to claim 15, wherein the endosome-specific protease cleavage site is located in the linker regions connecting the regulatory domain and the nuclear localization sequence or the zinc finger protein domain.
18. An artificial transcription factor according to any one of claims 1 -14, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor does not contain any other protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor.
19. An artificial transcription factor according to any one of claims 1 -14, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor is modified to decrease cleavage sensitivity.
20. An artificial transcription factor according to any one of claims 1 -14, wherein the one single or two or more endosome-specific protease cleavage sites are located in the artificial transcription factor between the protein transduction domain and the transcriptionally active part of the artificial transcription factor and wherein the artificial transcription factor further comprises one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor, wherein the one or more protease cleavage sites other than the endosome-specific protease cleavage site located between the protein transduction domain and the transcriptionally active part of the artificial transcription factor has a decreased cleavage sensitivity compared to the protease cleavage site other than the endosome-specific protease cleavage site located between the protein transduction domain comprised by the artificial transcription factor of SEQ ID NO: 67 (ATF1488).
21 . An artificial transcription factor according to any one of claims 18-20, wherein the one single or two or more endosome-specific protease cleavage sites comprise the amino acid sequence SEQ ID NO: 26.
22. An artificial transcription factor according to any one of claims 1-20 wherein the endosome-specific protease cleavage sites are cleaved each by at least two different endosome-specific proteases.
23. An artificial transcription factor according to claim 22, wherein the at least two different endosome-specific proteases are selected from the group consisting of i) cathepsin B and D, ii) cathepsin B, D, K, and S, iii) cathepsin K and S, iv) cathepsin D, K, L, and S, v) cathepsin B, D, K, L and S and vi) cathepsin D and K.
24. An artificial transcription factor according to any one of claims 1-23, wherein the target cell type of the artificial transcription factor are smooth muscle cells of vessels in the human eye.
25. An artificial transcription factor according to claim 24, wherein the one single or two or more endosome-specific protease cleavage sites are selected from the group consisting of endosome-specific protease cleavage sites which are cleaved by cathepsin B, D, K and I.
26. An artificial transcription factor according to any one of claims 1 -20, wherein the one single or two or more endosome-specific protease cleavage sites are selected according to the abundance of the endosome-specific proteases in the target cell type of the artificial transcription factor.
27. An artificial transcription factor according to any one of claims 1 -26 comprising an endosome-specific protease binding site which is located about 1 to about 50 amino acids upstream or downstream of an endosome-specific protease cleavage site, wherein the amino acid sequence of the endosome-specific protease binding site is modified to alter the cleavage sensitivity of the endosome-specific protease cleavage site.
28. An artificial transcription factor according to claim 27, wherein the amino acid sequence of the endosome-specific protease binding site is modified by insertion or substitution of an amino acid sequence comprising the following order of amino acids from the amino to the carboxy end:
i) charged or polar amino acid, charged amino acid, charged or polar amino acid, nonpolar amino acid, nonpolar amino acid, nonpolar amino acid, polar amino acid; or
ii) charged amino acid, charged or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid, polar or nonpolar amino acid.
29. An artificial transcription factor according to claim 27, wherein the amino acid sequence of the endosome-specific protease binding site comprises the amino acid sequence LTLGNDI (SEQ ID NO: 342) and wherein the endosome-specific protease binding site is modified by replacing the amino acid sequence LTLGNDI (SEQ ID NO: 342) with an amino acid sequence selected from the group consisting of DRHLIIS (SEQ ID NO: 203), DLVTLLT(SEQ ID NO: 204), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), PLTLPTI (SEQ ID NO: 207), PRLMFLC (SEQ ID NO: 208), TAYLPHI (SEQ ID NO: 209), TETLPHI (SEQ ID NO: 210), TDYLDPH (SEQ ID NO: 21 1 ), QRYLEIT (SEQ ID NO: 212), NLHTIHI (SEQ ID NO: 213), NLCSVTQ (SEQ ID NO: 214), LAKFDMI (SEQ ID NO: 215), LYLTQFR (SEQ ID NO: 216), DLTHISI (SEQ ID NO: 217), DFKSVQF (SEQ ID NO: 218), REYLIIS (SEQ ID NO: 219), RIDQLTL (SEQ ID NO: 220), RQVTLAL (SEQ ID NO: 221 ), YEKITVT (SEQ ID NO: 222), YVTIRLF (SEQ ID NO: 223), YFSIHGL (SEQ ID NO: 224), ELNIDIL (SEQ ID NO: 225), PSLSFIV (SEQ ID NO: 226), SLLITNL (SEQ ID NO: 227), EISTTLF (SEQ ID NO: 228), NMSTTNL (SEQ ID NO: 229), IKTDYSL (SEQ ID NO: 230), TKVRVFL (SEQ ID NO: 231 ), EYILNYY (SEQ ID NO: 232), TTVNLTI (SEQ ID NO: 233), IVLNLSI (SEQ ID NO: 234), TSLLYTC (SEQ ID NO: 235), PTISFAL (SEQ ID NO: 236), KESFTLI (SEQ ID NO: 237), KLDVNFF (SEQ ID NO: 238), TELSYTL (SEQ ID NO: 239), IERFQFA (SEQ ID NO: 240), INQMLSH (SEQ ID NO: 241 ), ELFILHA (SEQ ID NO: 242), VYPILPI (SEQ ID NO: 243), and RRELFLL (SEQ ID NO: 244).
30. An artificial transcription factor according to claim 27, wherein the amino acid sequence of the endosome-specific protease binding site is modified by substitution of at least two up to seven amino acids wherein the at least two up to seven amino acids are replaced with the following amino acids in the order from the amino to the carboxy end: amino acid selected from the group consisting of D/E/I/K/LN/P/Q/R/S/T/V/Y;
amino acid selected from the group consisting of A/D/E/F/J/K/L/M/N/Q/R/S/T/V/Y;
amino acid selected from the group consisting of C/D/E/F/H/l/K/L/N/P/Q/R/S/T/V/Y, amino acid selected from the group consisting of D/F/H/l/L/M/N/Q/R/S/T/V,
amino acid selected from the group consisting of D/E/F/H/l/L/N/M/P/Q/R/T/V/Y,
amino acid selected from the group consisting of A/F/G/H/l/L/M/N/P/Q/S/T/V/Y,
amino acid selected from the group consisting of A/C/F/H/l/L/Q/R/S/T/V/Y.
31 . An artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the polydactyl zinc finger protein is an octameric or higher order zinc finger protein.
32. An artificial transcription factor according to claim 31 , wherein the octameric or higher order zinc finger protein is selected from the group consisting of octameric, nonameric, decameric, undecameric and duodecameric zinc finger proteins.
33. An artificial transcription factor according to claim 31 , wherein the polydactyl zinc finger protein is an octameric zinc finger protein.
34. An artificial transcription factor according to claim 33, wherein the octameric zinc finger protein is selected from the group consisting of SEQ ID NO: 345 and SEQ ID NO: 346.
35. An artificial transcription factor according to claim 31 , wherein each monomer of the octameric or higher order zinc finger protein has an amino acid sequence different from the other monomers.
36. An artificial transcription factor according to any one of claims 31-35, wherein the artificial transcription factor further comprises a protein tag.
37. An artificial transcription factor according to any one of claims 31 -35 wherein the artificial transcription factor further comprises a linker.
38. An artificial transcription factor comprising a polydactyl zinc finger protein targeting specifically a gene promoter, fused to an inhibitory or activatory protein domain, a nuclear localization sequence, a transport protein comprising one or more copies of a protein transduction domain, and an endosome-specific protease cleavage site, wherein the artificial transcription factor comprises an amino acid sequence selected from the group consisting of DRHLIIS (SEQ ID NO: 203), DLVTLLT(SEQ ID NO: 204), DEHLLVY (SEQ ID NO: 205), DFYTHLA (SEQ ID NO: 206), PLTLPTI (SEQ ID NO: 207), PRLMFLC (SEQ ID NO: 208), TAYLPHI (SEQ ID NO: 209), TETLPHI (SEQ ID NO: 210), TDYLDPH (SEQ ID NO: 21 1 ), QRYLEIT (SEQ ID NO: 212), NLHTIHI (SEQ ID NO: 213), NLCSVTQ (SEQ ID NO: 214), LAKFDMI (SEQ ID NO: 215), LYLTQFR (SEQ ID NO: 216), DLTHISI (SEQ ID NO: 217), DFKSVQF (SEQ ID NO: 218), REYLIIS (SEQ ID NO: 219), RIDQLTL (SEQ ID NO: 220), RQVTLAL (SEQ ID NO: 221 ), YEKITVT (SEQ ID NO: 222), YVTIRLF (SEQ ID NO: 223), YFSIHGL (SEQ ID NO: 224), ELNIDIL (SEQ ID NO: 225), PSLSFIV (SEQ ID NO: 226), SLLITNL (SEQ ID NO: 227), EISTTLF (SEQ ID NO: 228), NMSTTNL (SEQ ID NO: 229), IKTDYSL (SEQ ID NO: 230), TKVRVFL (SEQ ID NO: 231 ), EYILNYY (SEQ ID NO: 232), TTVNLTI (SEQ ID NO: 233), IVLNLSI (SEQ ID NO: 234), TSLLYTC (SEQ ID NO: 235), PTISFAL (SEQ ID NO: 236), KESFTLI (SEQ ID NO: 237), KLDVNFF (SEQ ID NO: 238), TELSYTL (SEQ ID NO: 239), IERFQFA (SEQ ID NO: 240), INQMLSH (SEQ ID NO: 241 ), ELFILHA (SEQ ID NO: 242), VYPILPI (SEQ ID NO: 243), and RRELFLL (SEQ ID NO: 244).
39. A mammalian cell line secreting an artificial transcription factor according to any one of claims 1 to 38.
40. A host cell containing an expression construct selected from the group consisting of SEQ ID NO: 146 to 189 and SEQ ID NO: 287 to 333 coding for an artificial transcription factor according to any one of claims 1 to 38.
41 . A pharmaceutical composition comprising an artificial transcription factor according to any one of claims 1 to 38.
42. A method to produce a polydactyl zinc finger protein comprising an octameric or higher order zinc finger protein comprising
i) selecting a hexameric zinc finger protein from a first zinc finger protein library; ii) constructing a second zinc finger protein library based on the hexameric zinc finger protein selected in i) by fusing this hexameric zinc finger protein to a random library of two or more zinc fingers;
iii) selecting a polydactyl zinc finger protein comprising an octameric or higher order zinc finger protein.
43. The method according to claim 42, wherein the first zinc finger protein library and the second zinc finger protein library comprises an expression vector present in the host organism of the protein library with 1-2 copies and wherein the expression vector comprises a promoter operably linked to the octameric or higher order zinc finger protein which expresses the octameric or higher order zinc finger protein in Saccharomyces cerevisae with an expression rate of equal to or lower as achieved for an octameric or higher order zinc finger protein expressed by a promoter of SEQ ID NO: 197 in the same Saccharomyces cerevisae.
44. The method according to claim 43, wherein the host organism is selected from the group consisting of mammal, insect, fungi, yeast, and bacteria.
45. The method according to any one of claims 42-44, wherein the hexameric zinc finger protein is selected from the zinc finger protein library in i) by using a modified yeast one hybrid scheme where zinc finger proteins are expressed as fusions to the GAL4 activation domain in yeast leading to the expression of an Aureobasidin resistance.
46. A screening system for selecting a protein comprising
i) a host organism which is capable to express the protein;
ii) an expression vector which is present in the host organism of i) with 1-2 copies, wherein the expression vector comprises a promoter operably linked to the protein wherein the protein is expressed in the host organism with an expression rate equal to or lower as achieved for the protein expressed in the same host organism by a promoter of SEQ ID NO: 197 operably linked to the same protein
47. An expression vector comprising an ARS/CEN origin of replication and a promoter operably linked to a protein, wherein the promoter expresses the protein of interest in a host organism at an expression rate equal to or lower than the expression rate of the promoter of SEQ ID NO: 197 operably linked to the same protein in the same host organism.
PCT/EP2015/072737 2014-10-02 2015-10-01 Endosomal disentanglement of artificial transcription factors WO2016050934A1 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
EP14187551.8 2014-10-02
EP14187550 2014-10-02
EP14187551 2014-10-02
EP14187550.0 2014-10-02

Publications (1)

Publication Number Publication Date
WO2016050934A1 true WO2016050934A1 (en) 2016-04-07

Family

ID=54252295

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2015/072737 WO2016050934A1 (en) 2014-10-02 2015-10-01 Endosomal disentanglement of artificial transcription factors

Country Status (1)

Country Link
WO (1) WO2016050934A1 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020163017A1 (en) * 2019-02-06 2020-08-13 Klogenix Llc Dna binding proteins and uses thereof
CN113789379A (en) * 2021-08-30 2021-12-14 远见生物科技（上海）有限公司 Diagnostic kit for detecting prostate cancer, detection method and application thereof
JP2022549057A (en) * 2019-07-11 2022-11-24 厦▲門▼大学 Conjugates for intracellular delivery of molecules
WO2023196880A3 (en) * 2022-04-06 2023-11-09 City Of Hope Human t-cell lymphotropic virus type 1 targeting proteins and methods of use
WO2023225488A1 (en) 2022-05-16 2023-11-23 Enkefalos Biosciences, Inc. Blood-brain barrier translocating peptides and related molecules and methods of use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005003315A2 (en) * 2003-07-01 2005-01-13 Allele Biotechnology & Pharmaceuticals, Inc. Compositions and methods for peptide-assisted transfection
WO2008063113A8 (en) * 2006-11-20 2009-07-23 Cepep Iii Ab Cell -penetrating peptides and constructs containing them consisting 15-25 amino acids of tumor supressor protein p14arf or p19arf
WO2010056808A2 (en) * 2008-11-12 2010-05-20 The Regents Of The University Of California Compositions and methods for re-programming and re-differentiating cells
EP2399939A2 (en) * 2009-02-19 2011-12-28 Nano Intelligent Biomedical Engineering Corporation Co., Ltd. Target activated cell/tissue translocation peptide for impermeable compound strategy, and uses thereof
WO2014161880A1 (en) * 2013-04-03 2014-10-09 Aliophtha Ag Artificial transcription factors engineered to overcome endosomal entrapment

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005003315A2 (en) * 2003-07-01 2005-01-13 Allele Biotechnology & Pharmaceuticals, Inc. Compositions and methods for peptide-assisted transfection
WO2008063113A8 (en) * 2006-11-20 2009-07-23 Cepep Iii Ab Cell -penetrating peptides and constructs containing them consisting 15-25 amino acids of tumor supressor protein p14arf or p19arf
WO2010056808A2 (en) * 2008-11-12 2010-05-20 The Regents Of The University Of California Compositions and methods for re-programming and re-differentiating cells
EP2399939A2 (en) * 2009-02-19 2011-12-28 Nano Intelligent Biomedical Engineering Corporation Co., Ltd. Target activated cell/tissue translocation peptide for impermeable compound strategy, and uses thereof
WO2014161880A1 (en) * 2013-04-03 2014-10-09 Aliophtha Ag Artificial transcription factors engineered to overcome endosomal entrapment

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
PAPWORTH M ET AL: "Designer zinc-finger proteins and their applications", GENE, vol. 366, no. 1, 17 January 2006 (2006-01-17), ELSEVIER, AMSTERDAM, NL, pages 27 - 38, XP024934269, ISSN: 0378-1119, DOI: 10.1016/J.GENE.2005.09.011 *
ROGER R. BEERLI ET AL: "Engineering polydactyl zinc-finger transcription factors", NATURE BIOTECHNOLOGY, vol. 20, no. 2, 1 February 2002 (2002-02-01), pages 135 - 141, XP055015629, ISSN: 1087-0156, DOI: 10.1038/nbt0202-135 *
SERA ET AL: "Zinc-finger-based artificial transcription factors and their applications", ADVANCED DRUG DELIVERY REVIEWS, vol. 61, no. 7-8, 2 July 2009 (2009-07-02), ELSEVIER, AMSTERDAM, NL, pages 513 - 526, XP026139402, ISSN: 0169-409X, DOI: 10.1016/J.ADDR.2009.03.012 *

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2020163017A1 (en) * 2019-02-06 2020-08-13 Klogenix Llc Dna binding proteins and uses thereof
US11866469B2 (en) 2019-02-06 2024-01-09 Klogenix Llc DNA binding proteins and uses thereof
JP2022549057A (en) * 2019-07-11 2022-11-24 厦▲門▼大学 Conjugates for intracellular delivery of molecules
CN113789379A (en) * 2021-08-30 2021-12-14 远见生物科技（上海）有限公司 Diagnostic kit for detecting prostate cancer, detection method and application thereof
WO2023196880A3 (en) * 2022-04-06 2023-11-09 City Of Hope Human t-cell lymphotropic virus type 1 targeting proteins and methods of use
WO2023225488A1 (en) 2022-05-16 2023-11-23 Enkefalos Biosciences, Inc. Blood-brain barrier translocating peptides and related molecules and methods of use thereof

Similar Documents

Publication Publication Date Title
US20160046682A1 (en) Artificial transcription factors engineered to overcome endosomal entrapment
US20140296129A1 (en) Regulation of receptor expression through delivery of artificial transcription factors
WO2016050934A1 (en) Endosomal disentanglement of artificial transcription factors
KR100659922B1 (en) Zinc finger binding domains for GNN
KR102431079B1 (en) Methods and compositions for treating huntington's disease
US20020165356A1 (en) Zinc finger binding domains for nucleotide sequence ANN
US20070154989A1 (en) Zinc finger domains specifically binding agc
WO2011016840A2 (en) Methods and compositions for treating trinucleotide repeat disorders
EP1364027B1 (en) Zinc finger binding domains for nucleotide sequence ann
TW201736394A (en) Endosomal disentanglement of artificial transcription factors
US20160046681A1 (en) Artificial transcription factors regulating nuclear receptors and their therapeutic use
US20060211846A1 (en) Zinc finger binding domains for nucleotide sequence ANN

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15775174

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15775174

Country of ref document: EP

Kind code of ref document: A1