WO2016050203A1 - Use of inhibiting activity of casein kinase 2 for enhancing expression of type i interferon - Google Patents

Abstract

A use of a casein kinase 2 inhibitor in preparing a pharmaceutical composition for enhancing the expression of type I interferon and/or a type I interferon-induced gene or a protein thereof; and/or in preparing a pharmaceutical composition for treating and/or preventing the diseases related to the lack of type I interferon.

Description

Application of inhibiting casein kinase 2 activity in promoting expression of type I interferon Technical field

The invention relates to the field of immunotherapy. In particular, the invention relates to novel uses of casein kinase 2 inhibitors in promoting the expression of type I interferons and their downstream genes.

Background technique

Type I interferons include IFNα and IFNβ, which bind to interferon receptors on the cell surface to activate protein kinases Jak1 and Tyk2, and then activate the transcription factors STAT1 or/and STAT2 to induce expression of hundreds of genes (interferon induction) Genes, ISGs), including MX1, MX2, Rsad2/Viperine, CXCL10/IP-10, etc.

These genes induced by interferon play an important physiological role in cell proliferation and apoptosis, angiogenesis, and T cell immune response. Therefore, the application of type I interferon in immune-related diseases has been extensively studied.

The expression of type I interferons is induced by pattern recognition receptors (PRRs, Pattern Recognition Receptors) and their mediated signaling pathways. These pattern recognition receptors include Toll-like receptors (TLRs), NOD-like receptors (NLRs), RIG-I-like receptors (RLRs) and cells. Cytosolic DNA sensors (CDSs) activate complex signaling pathways (including protein kinase TBK1) by identifying pathway-associated Molecular Patterns (PAMPs) secreted by dead cells in tissues. , IKKα/β and MAP kinases), activate key transcription factors IRF3, NFκB and AP-1, induce the expression of type I interferons, cytokines and chemokines, activate natural immune and adaptive immune responses, and implement hosts. Physiological functions such as defense and tissue repair.

However, excessive or abnormal expression of type I interferon may also cause diseases, especially autoimmune diseases such as systemic lupus erythematosus. Therefore, a negative regulation mechanism regulating type I interferon is often present in the body to avoid abnormal expression of interferon. These regulatory mechanisms often lead to the inability of type I interferons to be expressed efficiently under pathological conditions, leading to various diseases with insufficient immune response. Therefore, how to effectively control the immune-related diseases in the pathological state and break through the mechanism of the body's regulation of type I interferon expression is an important subject in the field of basic and clinical medicine.

Therefore, there is an urgent need in the art to develop an effective method for improving the expression of human type I interferon and improving the immune function of the human body to treat various infectious and non-infectious human diseases.

Summary of the invention

The invention provides a use of a CK2 inhibitor for promoting expression of a type I interferon.

In a first aspect of the invention, there is provided a use of a casein kinase 2 (CK2) inhibitor, (i) for the preparation of a type I interferon (IFNα/β) and/or type I interferon induction A pharmaceutical composition for expression of a gene or protein thereof; and/or (ii) a pharmaceutical composition for the preparation of a disease associated with the treatment and/or prevention of type I interferon deficiency.

In another preferred embodiment, the CK2 is derived from a mammal, preferably from a human, a mouse, or a rat.

In another preferred embodiment, the type I interferon deficiency refers to a decrease in the amount and/or activity of type I interferon expression before and/or after the onset of the disease.

In another preferred embodiment, the type I interferon deficiency-associated disease means that the lack of type I interferon causes the occurrence and/or aggravation of the disease, and increases the expression level and/or activity of the type I interferon. The disease has a therapeutic and/or preventive effect.

In another preferred embodiment, the inhibitor comprises an antisense nucleic acid, an inhibitory microRNA, an antibody or a small molecule compound of CK2.

In another preferred embodiment, the antibody comprises a small molecule polypeptide.

In another preferred embodiment, the inhibitor is an siRNA of the CK2 gene, shRNA.

In another preferred embodiment, the shRNA of the CK2 gene is as shown in (SEQ ID NO.: 1-2)

Forward (SEQ ID NO.: 1):

5'CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTTG 3';

Reverse (SEQ ID NO.: 2):

5' AATTCAAAAACCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGG 3'.

In another preferred embodiment, the amino acid sequence of the CK2 protein has Genbank accession numbers NP_031814.2 (mouse) and NP_808227.1 (human).

In another preferred embodiment, the Genbank accession number of the nucleotide sequence encoding the CK2 protein is shown as NM_007788.3 (mouse) and NM_177559 (human).

In another preferred embodiment, the type I interferon deficiency-related diseases include: viral infectious diseases, malignant tumors, multiple sclerosis.

In another preferred embodiment, the viral infectious disease includes a disease infected with the following viruses: herpes simplex virus (HSV), vesicular virus (VSV), Kaposi's tumor herpesvirus (KSHV), respiratory syncytial disease Toxic (RSV), Hand, Foot and Mouth Disease Virus (Enterovirus EV71 and CA16) Hepatitis B Virus (HBV), Hepatitis C Virus (HCV), Human Acquired Immunodeficiency Virus/HIV (HIV); and/or

The malignant tumor includes the following tumors: hairy cell leukaemia, chronic myelogenous leukemia (CML), lymphoma, myeloma, melanoma, renal cell carcinoma and bladder cancer. (renal cell and bladder cell carcinoma), Kaposi's sarcoma.

In another preferred embodiment, the virus is a virus capable of activating a pattern recognition receptor after infecting a cell.

In another preferred embodiment, the inhibitor is also useful for inhibiting immune escape of viral and/or tumor cells.

In another preferred embodiment, the CK2 inhibitor is also used to inhibit viral replication and assembly.

In another preferred embodiment, the expression of the type I interferon and/or type I interferon-inducing gene or protein thereof comprises inducing and/or increasing a type I interferon and/or type I interferon-inducing gene or The amount and/or activity of the protein.

In another preferred embodiment, the inhibitor is a small molecule compound, preferably including tetrabromobenzotriazole (TBB), CX-4945 (Silmitasertib), DMAT (2-dimethylamino-4, 5, 6,7-tetrabromo-1H-benzimidazole), kaempferol, tyrosine phosphorylation inhibitor AG114 (Tyrphostin AG114), tetrabromocinnamic acid, 3-[[5-(4-tolyl)thiophene [2 ,3-d]pyrimidin-4-yl]thio]propionic acid (TTP 22), CX-5011, ellagic acid (Ellagic Acid), 3-methyl-1,6,8-trihydroanthracene (emodin) ), 4',5,7-trihydroxyflavone (apigenin).

In another preferred embodiment, the type I interferon-inducing gene or protein thereof comprises CXCL10/IP-10, STAT1, MX1, MX2, Rsad2/Viperine, phosphokinase TBK1, interferon regulatory factor 3 (IRF3).

In another preferred embodiment, the type I IFN comprises IFN-α, IFN-β.

In another preferred embodiment, the pharmaceutical composition comprises as an active ingredient a CK2 inhibitor, and a pharmaceutically acceptable carrier.

In another preferred embodiment, the effective concentration of the CK2 inhibitor is from 1 to 1000 μM, preferably from 20 to 100 μM.

In another preferred embodiment, the CK2 inhibitor is dose-dependently promoting the type I interferon and/or the type I interferon-inducing gene or its protein.

According to a second aspect of the present invention, there is provided a non-therapeutic promoting cell expressing a type I interferon and/or a type I interferon-inducing gene or a protein thereof and/or a non-therapeutic inhibitor of a type I interferon deficiency-associated virus in vitro. A method for growing cells and/or tumor cells, comprising the steps of: culturing cells in the presence of a CK2 inhibitor, thereby promoting expression of a type I interferon and/or a type I interferon-inducing gene or a protein thereof inhibiting type I interferon Lack of associated viral cells and/or tumor cell growth.

In another preferred embodiment, the cell comprises a tumor cell, or a cell infected with a DNA or RNA virus.

In another preferred embodiment, the method can also be used to prepare a type I interferon or an induced protein thereof, for example, to collect and purify a type I interferon obtained in a cell culture system or an induced protein thereof.

In a third aspect of the invention, there is provided a method of screening for a compound capable of inhibiting CK2, comprising the steps of:

(a) In the test group, the test compound was added to the cell culture system, and the expression amount and/or activity of the type I interferon was determined; in the control group, the test compound was not added to the cell culture system, and the type I was determined. The amount and/or activity of interferon expression;

Wherein, if the expression level and/or activity of the type I interferon in the test group is significantly higher than that of the control group, the candidate compound is a compound capable of inhibiting CK2 and/or

(a2) In the test group, the test compound is added to the virus-infected cell culture system, and the titer of the virus in the cell culture system is determined; in the control group, the test compound is added to the virus-infected cell culture system, And measuring the virus titer in the cell culture system;

Wherein, if the titer of the test group virus is significantly lower than that of the control group, the candidate compound is a compound capable of inhibiting CK2.

In another preferred embodiment, the method further includes the steps of:

(b) The compound in (a) is further tested for its promotion of the casein kinase 2 or type I interferon-inducible gene or its protein.

According to a fourth aspect of the invention, a method for preparing a type I interferon is provided, comprising the steps of:

(i) culturing the cells in the presence of a CK2 inhibitor;

(ii) collecting, isolating and purifying type I interferons in the cell culture medium.

In another preferred embodiment, a CK2 inhibitor is added to L929 cells, cultured for 12-48 hours under non-infective conditions or 12-24 hours under viral infection conditions. The supernatant was collected and the type I interferon was purified by HPLC.

In another preferred embodiment, the cells further comprise fibroblasts, or macrophages.

In a fifth aspect of the invention, there is provided a use of a CK2 gene or a protein thereof for the preparation of a pharmaceutical composition for reducing the expression of a type I interferon and/or a type I interferon-inducing gene or a protein thereof.

In a sixth aspect of the invention, a method of treating a viral infection is provided, wherein a CK2 inhibitor is administered to a subject in need of treatment to treat a viral infection.

In another preferred embodiment, the subject in need of treatment is a mammal, preferably a human.

According to a seventh aspect of the present invention, there is provided a (i) treatment of a type I interferon deficiency-related disease; and/or (ii) A pharmaceutical composition for promoting the expression of a type I interferon and/or a type I interferon-inducing gene or a protein thereof, the pharmaceutical composition comprising a CK2 inhibitor as an active ingredient, and a pharmaceutically acceptable carrier.

According to an eighth aspect of the present invention, a method for determining whether a CK2 inhibitor is effective against a tumor or a virus is provided, comprising the steps of:

(a) adding a CK2 inhibitor to a tumor cell or virus-infected cell culture system;

(b) observing the expression level and/or activity of type I interferon in the culture system before and after the addition of the CK2 inhibitor;

Among them, the expression level and/or activity I1 of type I interferon increased significantly compared with the expression level and/or activity I0 before the addition of the CK2 inhibitor, indicating that the CK2 inhibitor has an inhibitory effect on the tumor or virus.

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the various technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

DRAWINGS

Figure 1 shows that CK2 inhibits the expression of the type I interferon and/or type I interferon-inducible gene or its protein induced by Toll-like receptor signaling, but does not affect the expression of the inflammatory factor TNFα.

Figure 2 shows that CK2 inhibits activation of TBK1 and IRF3 induced by Toll-like receptor signaling, but does not affect activation of MAP kinases.

Figure 3 shows that CK2 inhibits the signaling pathway induced by pattern recognition receptors that recognize RNA and DNA in the cytosol and the expression of type I interferon and/or type I interferon-inducible genes or proteins thereof.

Figure 4 shows that CK2 inhibits the expression of type I interferon and/or type I interferon-inducible genes or their proteins in mouse macrophage cell line by HSV infection, and is highly expressed with type I interferon and its target gene product. The replication, assembly and release of HSV virus were significantly inhibited, and the HSV virus titer detected in the CK2α knockdown Raw264.7 cell culture was nearly 10 times lower than that of the control group.

Figure 5 shows that CK2 inhibits the expression of type I interferon and/or type I interferon-inducible genes or proteins thereof in the mouse fibroblast cell line L929 when infected with Sendai virus.

Figure 6 shows that CK2 inhibits the expression of type I interferon and/or type I interferon-inducible genes or proteins thereof in the mouse fibroblast cell line L929 when VSV virus is infected.

Figure 7 shows that the kinase activity of CK2 plays a key role in inhibiting virus-induced expression of type I interferons.

Figure 8 shows that CK2 inhibitor TBB induces TBK1 activation in mouse fibroblast cell line L929 and I Type of interferon and type I interferon-inducible gene or its protein expression.

Figure 9 shows that the CK2 inhibitor TBB inhibits infection and replication of VSV virus in the fibroblast cell line L929.

Figure 10 shows that the CK2 inhibitor TBB induces activation of TBK1 and expression of type I interferons and type I interferon-inducible genes or proteins thereof in human embryonic kidney cell line 293, and inhibits infection of VSV.

Figure 11 shows that prior to HCV infection of the human hepatocyte line Hu7.5, pretreatment with the CK2 inhibitor TBB induces type I interferon and/or type I interferon-inducible genes or their protein expression and prevents HCV infection.

Figure 12 shows that the CK2 inhibitor TBB is effective in inhibiting viral replication following HCV infection of the human hepatocyte cell line Hu7.5.

Figure 13 shows that the CK2 inhibitor TBB induces the expression of type I interferon and type I interferon-inducible genes or proteins thereof in human promyelocytic leukemia cells HL-60.

Figure 14 shows that the CK2 inhibitor TBB induces the expression of type I interferons and type I interferon-inducible genes or proteins thereof in human renal cancer cell line OS-RC-2.

Figures 15A-15B show the prophylactic and therapeutic effects of CK2 inhibitor TBB on EV71 virus infection, and both are more effective at high concentrations.

Figures 16A-16B show that the CK2 inhibitor TBB effectively activates the key kinase TBK1 that induces type I interferon expression in mouse tissues and inhibits the replication, assembly and release of HSV virus in the blood and spleen of TBB-treated mice. The detected HSV virus titer was significantly lower than the control group.

detailed description

After extensive and intensive research, the present inventors discovered for the first time that in a complex human immune mechanism, CK2 protein is involved in regulating multiple pattern recognition receptor signaling pathways, controlling the activation of TBK1 and IRF3, and limiting the expression of type I interferon. . Experiments have shown that inhibition of CK2 can effectively induce and promote the production of type I interferon, and activate the expression of various type I interferon-inducible genes or their proteins, thereby improving the body's immune defense system and effectively preventing type I interferon-related Diseases, such as viruses associated with type I interferons, tumors, or the treatment of multiple sclerosis, have become a new strategy to improve human immunity, treat viral infectious diseases, and some non-infectious diseases. On the basis of this, the present invention has been completed.

the term

As used herein, the term "type I interferon deficiency" refers to before and/or after the onset of a disease, A decrease in the amount and/or activity of type I interferon. For example, a decrease in the expression level of type I interferon may lead to the occurrence of diseases such as multiple sclerosis and tumors, or the immune escape of tumors or viruses inhibits the expression of normal type I interferons, thereby further aggravating the occurrence of diseases such as tumors or viruses.

As used herein, the term "type I interferon deficiency-associated disease" means that the absence of a type I interferon causes the occurrence and/or exacerbation of the disease, and increases the amount and/or activity of the type I interferon expression. A disease in which the disease acts as a therapeutic and/or preventive agent. Generally, the "type I interferon deficiency-associated disease" referred to in the present invention refers to a type I interferon deficiency-associated viral infectious disease, multiple sclerosis or malignant tumor, and it is understood that it is not related to "type I interferon deficiency". Viral infections or malignancies are not within the scope of this term. In general, it is known in the art to determine whether the disease (such as a tumor or virus) is associated with type I interferon, such as whether the prognosis (including cell growth) of the disease is interfered with type I interference after knocking or inhibiting type I interferon. The expression of the prime is related.

Casein kinase 2 (CK2)

CK2 (also known as casein kinase 2) is a serine and threonine kinase ubiquitous in eukaryotic cells, mainly tetramers - containing two catalytic subunits (α and / or α ') and the form of two regulatory subunits β function. The CK2 of the present invention is derived from a mammal and is usually derived from human, mouse or rat.

The preferred amino acid sequence of the CK2 protein is shown in Genbank accession numbers NP_808227.1 (mouse) and NP_031814.2 (human), and the nucleotide sequence encoded by Genbank accession number is NM_007788.3 (mouse) and NM_177559 (person) is shown. The CK2 gene sequence is shown in Genbank ID No.: 12995 (mouse) and Genbank ID No.: 1457 (human).

At present, various research results show that CK2 plays an important role in regulating cell growth and tumorigenesis. In tumors, the expression and activity of CK2 tend to increase abnormally. Therefore, it has been reported that inhibition of the expression or activity of CK2 can effectively inhibit the growth of tumor cells and induce necrosis of tumor cells. CX-4945, an inhibitor of CK2, has entered clinical phase II and shows a better anti-tumor effect. However, CK2 inhibitors also have a selective effect on the therapeutic effects of tumors. Because of the many substrates and mechanisms of CK2, the specific mechanism of action of CK2 inhibitors in each type of tumor treatment is not known. Therefore, the solution to this selective performance is not currently available.

The present invention firstly found through experiments that CK2 is involved in the regulation of multiple pattern recognition receptor signaling pathways, and controls the activation of TBK1 and IRF3, thereby limiting the expression of type I interferon. Experiments have shown that inhibition of CK2 can increase the expression of type I interferon and its induced genes, and has the effect of inhibiting viral infection, multiple sclerosis and tumors. good effect.

Specifically, the present invention not only theoretically reveals that CK2 is a key molecule that negatively regulates the expression of TBK1 and type I interferon, but also experimentally demonstrates that inhibition of CK2 kinase activity by small molecule compounds can effectively induce type I interferon production, and Thereby inhibiting and killing viral infection, multiple sclerosis and tumor cell growth.

Correlation between pattern recognition receptor and type I interferon expression

Pattern Recognition Receptors (PRRs) activate complex signaling pathways to induce type I interferons and cells by recognizing Pathogen-Associated Molecular Patterns (PAMPs, RNA and DNA secreted by dead cells or viruses). The expression of factors and chemokines, and the implementation of physiological functions such as host defense and tissue repair.

The Toll-like receptor TLR4 located on the cell membrane recognizes the glycoprotein on the surface of the virus and transports it into the endosome; TLR3 in the endosome recognizes the viral double-stranded DNA; TLR3/TLR4 passes through the linker molecule TRIF and in the endosome TRAM, which subsequently activates the phosphokinase TBK1 (TANK-binding kinase 1), causes activation of the downstream transcription factor IRF3, thereby inducing expression of type I interferon.

The RNA released by the virus or the RNA released by the damaged cells of the body can be recognized by the RIG-I-like receptor RIG-I ( retinoic acid-ducible gene-I) and MDA5 (melanoma differentiation-associated gene 5) in the cytoplasm, and the linker molecule MAVS /VISA activates phosphokinase TBK1 and the transcription factor IRF3 on mitochondria and also induces type I interferon expression. Double-stranded DNA (dsDNA) released by viruses or damaged cells is recognized by various DNA receptors in the cytoplasm, such as cGAS, DDX41, and IFI16, and TBK1 and IRF3 are activated by the linker molecule STING to induce type I interferon. expression. These innate immune receptors also induce the expression of pro-inflammatory and chemokines such as IL-6, TNFα and IL-1 by activating the transcription factors NFκB and AP1.

For example, partial viral infection or death of the body's cells can cause activation of the pattern recognition receptor signaling pathway, thereby inducing expression of type I interferon IFNα/β. Binding of IFNα/β to interferon receptor activates Jak1 and Tyk2, activates the transcription factor STAT1, and induces expression of hundreds of interferon- and/or type I interferon-inducible genes or proteins thereof, including MX1, MX2, Rsad2/ Viperine, CXCL10/IP-10, etc., implement host defense functions, remove invading viruses and infected cells, or repair tissue damage to remove diseased or cancerous cells. However, in the long-term evolution process, the virus also acquires the ability to antagonize the pattern recognition receptor signaling pathway and inhibit the expression of type I interferon to escape the host's defense function. For example, the hepatitis C virus HCV-encoded protease NS3/4A cleaves the linker molecule of TLR3/4, the linker molecule Trif and RIG-I/MDA5. MAVS/VISA, causing them to not activate downstream TBK1 and IRF3. Enterovirus EV71 can inhibit the expression of type I interferon by cleavage of MAVS by protease 2A (pro) and by cleavage of Trif by 3C protein. The F protein of vesicular virus VSV and the NS1 of influenza virus can also interfere with host expression of type I interferon by inhibiting the function of RIG-I. Human acquired immunodeficiency virus/HIV (HIV) can inhibit the production of type I interferon by using cells such as Trex1 and SamHD1 to degrade or inhibit reverse transcription of double-stranded DNA. Through these mechanisms, the immune response of the virus to the host produces an escape phenomenon, resulting in an acute or chronic infection of the virus in the host cell, causing the host to develop severe lesions. In addition, in the process of multiple sclerosis and tumor formation, the mechanism of inhibition of type I interferon expression may also cause type I interferon not to be expressed, leading to disease progression.

CK2 inhibitor

As used herein, the terms "active ingredient of the present invention", "inhibitor of the present invention", and "inhibitor of CK2 of the present invention" are used interchangeably and mean a substance capable of reducing the amount and/or activity of expression of a CK2 gene or protein.

The experiments of the present invention prove that the CK2 inhibitor can effectively block the expression amount and/or activity of CK2, thereby inducing or promoting the expression of type I interferon, TBK1, and IRF3, in order to achieve treatment of viral infection, multiple sclerosis and tumor. purpose.

The CK2 inhibitor which can be used in the present invention is not particularly limited and may be any substance which reduces the expression amount and/or activity of the CK2 gene or protein. Representative examples include antisense nucleic acids of the CK2 gene, microRNAs (siRNA) that inhibit CK2 expression, antibodies against the CK2 protein, polypeptides that inhibit the action of CK2 on TBK1, or small molecule compounds that have an inhibitory effect on the amount and/or activity of CK2 expression.

Generally, according to the CK2 gene sequence, one skilled in the art can design and synthesize an antisense nucleic acid or miRNA having a CK2 gene inhibitory effect by conventional techniques. Small molecule compounds having CK2 inhibitory properties can be obtained commercially or synthetically. Preferred examples are tetrabromobenzotriazole (TBB, available from Tocris), DMAT (2-dimethylamino-4, 5,6,7-tetrabromo-1H-benzimidazol, available from MedChem Express), kaempferol, tyrosine phosphate Inhibitor AG114 (Tyrphostin AG114, available from Alexis Biochemicals), CX-4945 (Silmitasertib, available from Selleck), tetrabromocinnamic acid, 3-[[5-(4-methylphenyl)thiophene [2,3-d] Pyrimidine-4-yl]thio]propionic acid (TTP 22, available from Tocris), CX-5011, ellagic acid (Ellagic Acid, available from MedChem Express), 3-methyl-1,6,8-trihydrogen Emo (emodin, purchased from Sigma), 4',5,7-trihydroxyflavone (apigenin, purchased from Shanghai Chemical Industry Development Co., Ltd.).

Preferably, the CK2 inhibitor of the present invention further comprises an expression vector comprising shRNA having CK2 inhibitory activity, It can be obtained by a conventional method. A preferred shRNA sequence having CK2 inhibitory activity is as follows:

Forward (SEQ ID NO.: 1):

5'CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTTG 3’

Reverse (SEQ ID NO.: 2):

5’AATTCAAAAACCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGG 3’

The effective therapeutic concentration range of the CK2 inhibitor useful in the present invention can be screened according to an effective concentration screening method commonly used in the art, thereby obtaining a safe and effective administration dose. Usually, the effective concentration of the CK2 inhibitor is 1-1000 μM, preferably It is 20-100 μM.

Type I interferon

Type I interferons include IFNα and IFNβ, which bind to interferon receptors on the cell surface to activate protein kinases Jak1 and Tyk2, and then activate the transcription factors STAT1 or/and STAT2 to induce expression of hundreds of genes (interferon induction) Genes, ISGs), including MX1, MX2, Rsad2/Viperine, CXCL10/IP-10, etc. These genes induced by interferon play an important physiological role in antiviral infection, regulation of cell proliferation and apoptosis, angiogenesis, and T cell immune response. Therefore, the use of type I interferons in the treatment of viral infections, immune-related diseases and tumors has been extensively studied.

At present, the indications that are effective after receiving type I interferon therapy include a variety of viral infections, such as hepatitis B and C infection, multiple sclerosis and more than a dozen tumors, including leukemia, lymphoma, myeloma, Melanoma, renal cell tumor, bladder tumor, and Kaposi's sarcoma. The mechanism by which interferon inhibits multiple sclerosis may involve its inhibition of NLRP3-mediated inflammatory stimuli, and the mechanism by which interferon inhibits tumors involves activating anti-tumor immunity, inhibiting tumor cell proliferation, and inducing tumor cell dying. Dead and so on. Therefore, those skilled in the art can reasonably expect that the use of the CK2 inhibitor of the present invention to promote the expression of type I interferon can treat various diseases which are deficient in type I interferon, for example, the above-mentioned viral infection, multiple sclerosis and tumor and many more.

Type I interferon-inducible gene or protein thereof

As used herein, the term "type I interferon-inducible gene or protein thereof" refers to a gene that is associated with type I interferon expression on a type I interferon or downstream, when type I interferon expression is altered. Its protein, usually an infection, an immune-related inflammatory factor or an antiviral factor. Preferably, the type I interferon-inducing gene or protein thereof comprises various antibodies such as activated phosphokinase (TBK1), interferon regulatory factor 3 (IRF3), MX1, MX2, Rsad2/Viperine, or CXCL10/IP-10. Regulatory factors and inflammatory chemokines.

Viral infection

As used herein, the terms "viral infection", "viral infectious disease" are used interchangeably and refer to a viral infection-associated disease capable of activating a pattern recognition receptor upon infection of a cell.

The inhibitors of the invention are directed against viral infections caused by various viruses, including a variety of DNA or RNA viruses. For example, herpes simplex virus (HSV), vesicular virus (VSV), Kaposi's tumor virus (KSHV), respiratory syncytial virus (RSV), hand, foot and mouth disease virus (enteric virus EV71 and CA16) hepatitis B virus (HBV), hepatitis C virus (HCV), human acquired immunodeficiency virus/HIV (HIV).

After the virus infects the body, it activates complex signal transduction pathways (including protein kinases TBK1, IKKα/β and MAP kinases) by activating multiple pattern recognition receptors, and activates key transcription factors IRF3, NFκB and AP-1. Induces the expression of type I interferons, cytokines and chemokines, activates innate and adaptive immune responses, and performs physiological functions such as host defense and tissue repair. For example, type I interferons can directly cause apoptosis, inflammatory viral replication, assembly, and release of infected cells. In addition, killer NK and NKT cells and CD8 T cells play various roles in antiviral effects.

The virus which can be used in the present invention is a plurality of viruses capable of inhibiting the expression of type I interferon in an infectious state, for example, viruses including hepatitis B and C viruses, enterovirus EV71, human acquired immunodeficiency virus/HIV ( HIV), herpes simplex virus (HSV), vesicular virus (VSV), Kaposi's tumor herpesvirus (KSHV), respiratory syncytial virus (RSV), and the like.

application

At present, the present invention utilizes corresponding small molecule compounds to gradually induce an appropriate amount of interferon expression in vivo, and will be an ideal solution for treating these viral diseases which antagonize the expression of interferon. Moreover, these viruses are often prone to mutations in viral genes during replication. Therefore, some antiviral drugs designed for viral gene products are temporarily effective, but they can quickly lead to the emergence of resistant strains after extensive application. Small molecule drugs designed for host proteins will not encounter similar problems. Therefore, the strategy for inducing expression of type I interferon against host proteins is more desirable than currently designed for HCV and HIV.

Thus, the use of CK2 inhibitors to promote type I interferon can be applied to a variety of therapeutic or non-therapeutic viral infections, multiple sclerosis or tumors associated with type I interferon deficiency.

The present invention can utilize a CK2 inhibitor to induce or promote the expression of type I interferon in vitro, collect or purify the type I interferon obtained in the cell culture system, thereby providing a method for preparing type I interferon. Method for collecting and purifying type I interferon after type I interferon is usually produced in a cell culture system All are routine experimental methods known to those skilled in the art.

In addition, CK2 inhibitors can also be used to screen for and identify candidate drugs for type I interferon deficiency-related diseases; the present invention can also use the relationship between CK2 inhibitors and type I interferons to determine a specific tumor, multiple sclerosis or Whether the virus has an inhibitory effect (sensitivity assay).

In vivo, CK2 inhibitors can be administered to a desired subject to reduce replication and assembly of the infected virus, thereby reducing infection with type I interferon-associated virus, or reducing type I interferon-related multiple sclerosis and tumorigenesis. And development.

Of course, by using the correlation between CK2 and type I interferon discovered by the present invention, it is also possible to establish an animal model for inhibiting type I interferon by using CK2 itself.

Pharmaceutical composition and method of administration

As used herein, the term "effective amount" or "effective amount" refers to an amount that can produce a function or activity on a human and/or animal and that can be accepted by a human and/or animal.

As used herein, the term "pharmaceutically acceptable" ingredient is a substance that is suitable for use in humans and/or mammals without excessive adverse side effects (eg, toxicity, irritation, and allergies), ie, a substance having a reasonable benefit/risk ratio. . The term "pharmaceutically acceptable carrier" refers to a carrier for the administration of a therapeutic agent, including various excipients and diluents.

The pharmaceutical compositions of the present invention comprise a safe and effective amount of the active ingredient of the present invention together with a pharmaceutically acceptable carrier. Such carriers include, but are not limited to, saline, buffer, dextrose, water, glycerol, ethanol, and combinations thereof. Generally, the pharmaceutical preparation should be matched with the administration mode, and the pharmaceutical composition of the present invention is in the form of an injection, an oral preparation (tablet, capsule, oral liquid), a transdermal agent, and a sustained release agent. For example, it is prepared by a conventional method using physiological saline or an aqueous solution containing glucose and other adjuvants. The pharmaceutical composition is preferably manufactured under sterile conditions.

The effective amount of the active ingredient of the present invention may vary depending on the mode of administration and the severity of the disease to be treated and the like. The selection of a preferred effective amount can be determined by one of ordinary skill in the art based on various factors (e.g., by clinical trials). The factors include, but are not limited to, pharmacokinetic parameters of the active ingredient such as bioavailability, metabolism, half-life, etc.; severity of the disease to be treated by the patient, body weight of the patient, immune status of the patient, administration Ways, etc. In general, when the active ingredient of the present invention is administered at a dose of about 0.00001 mg to 50 mg/kg of animal body weight per day (preferably 0.0001 mg to 10 mg/kg of animal body weight), a satisfactory effect can be obtained. For example, several separate doses may be administered per day, or the dose may be proportionally reduced, as is critical to the condition of the treatment.

Pharmaceutically acceptable carriers of the invention include, but are not limited to, water, saline, liposomes, lipids, proteins, protein-antibody conjugates, peptide materials, cellulose, nanogels, or Its combination. The choice of carrier should be compatible with the mode of administration, which are well known to those of ordinary skill in the art.

Advantageous effects of the invention

The present inventors have found that CK2 is involved in the regulation of multiple pattern recognition receptor signaling pathways and controls the activation of TBK1 and IRF3, thereby limiting the expression of type I interferons. Experiments have shown that inhibition of CK2 kinase activity by small molecule compounds such as TBB can effectively induce type I interferon production, thereby preventing the occurrence and development of type I interferon-related diseases, and providing new immune sclerosis for multiple sclerosis, virus or tumor. The treatment. The method of endogenously increasing type I interferon against the host can overcome the defect that the exogenous injection of interferon is difficult to control the amount of use and cause serious side effects, making the treatment method more effective and safer.

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are not intended to limit the scope of the invention. Experimental methods in which the specific conditions are not indicated in the following examples are generally carried out according to the conditions described in conventional conditions, for example, Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturing conditions. The conditions recommended by the manufacturer. Unless otherwise stated, percentages and parts are by weight and parts by weight.

Example 1 Protein kinase CK2 is involved in the regulation of type I interferon expression induced by multiple pattern recognition receptors

Methods: Lenti-viral vector pLKO.1 was used to construct recombinant viral vectors expressing control shRNA or shRNA against CK2α, and then transfected into macrophage cell line (Raw264.7) and fibroblast cell line (L929), respectively. A stably transfected cell line with low expression of CK2α.

First, the shRNA oligonucleotide sequence against CK2α was designed based on the CK2 gene sequence in the NCBI gene bank:

Forward (SEQ ID NO.: 1):

CCGGCCGAGTTGCTTCTCGATATTTCTCGAGAAATATCGAGAAGCAACTCGGTTTTTG,

Reverse (SEQ ID NO.: 2):

AATTCAAAAACCGAGTTGCTTCTCGATATTTCTCGAGA AATATCGAGAAGCAACTCGG

Plasmid pLKO.1-shRNA expressing the control shRNA or shRNA against CK2α was constructed using Addgene's commercialized pLKO.1 - TRC Cloning Vector vector (Addgene Plasmid No. 10878) and its standard protocol. 10 μg/ml control shRNA or shRNA plasmid against CK2α pLKO.1-shRNA was transformed into HEK293 cells by calcium phosphate (125 mM Cacl2/1x HEPES) transformation with 2.5 μg/ml pMD2.G (Addgene plasmid product number 12259) and 7.5 μg/ml psPAX2 (Addgene plasmid product number 12260), respectively. In the middle package, the cell supernatant was collected 48 hours later to obtain a control shRNA or a recombinant viral vector against shRNA of CK2α (HEK293 cell culture medium: DMEM complete medium containing 10% FBS and 1% penicillin/streptomycin).

A 70% abundance macrophage cell line (Raw264.7 purchased from the US ATCC) or a fibroblast cell line (L929 purchased from the US ATCC) was transfected with a control shRNA or a recombinant viral vector directed against shRNA of CK2α at 50%. ), Raw264.7 and L929 cell culture media are DMEM complete medium. The recombinant viral vector was removed after 4 hours of transfection and culture continued until the cell abundance reached 95%. Cell passage was performed at a ratio of 1:5. Since the control shRNA or shRNA against CK2α had a puromycin resistance site, resistant cells were screened after passage using DMEM complete medium containing 4 μg/ml puromycin. A positive stable cell line and a control cell line of CK2α gene knockdown can be obtained by screening 3-4 generations (about 7-10 days).

The Raw 264.7 stable cell line knocked down by control and CK2α was inoculated into 6-well plates at 10 ⁶ /ml, and 2 ml was inoculated per well. Cells were treated with LPS (100 nM, purchased from Invivogen), polyI:C (50 μg/ml, purchased from Invivogen), respectively, to activate the TLR4 or TLR3 signaling pathways (Figures 1 and 2). After 4 hours of stimulation, cells were harvested and RNA was extracted (Fig. 1); or after 15 to 4 hours of stimulation, cells were collected at different time points to prepare a protein extract (Fig. 2).

Control and CK2α knockdown L929 stable cell lines were inoculated into 6-well plates at 10 ⁶ /ml, and 2 ml was inoculated per well. PolydA:dT (1 μg/ml, purchased from Invivogen) and polyI:C (1 μg/ml, purchased from Invivogen) cells were transfected with lipofect lipofectamine 2000 (purchased from Invitrogen) to activate RIG-I/Mda5 and cGAS, respectively. /STING signal path (Figure 3). Alternatively, cells were directly treated with DMXAA (100 μg/ml, purchased from Selleck) to activate the STING signaling pathway (Figure 3). The cells were harvested 6 hours after stimulation, and RNA was extracted (Fig. 3A); or after 3 hours of stimulation, the cells were collected to prepare a protein extract or a cytoplasmic, nuclear protein extract (Figs. 3B and 3C).

Using TRIZOL (Invitrogen) and L929 Raw264.7 method of extracting RNA, and anti 1μg RNA are transcribed first strand cDNA synthesis with ^{SuperScript TM III Reverse Transcriptase Kit (Invitrogen} ), for real-time quantitative PCR detection of gene expression levels. Real-time quantitative PCR primers are shown in Table 1. The relative expression level of the measured gene relative to GAPDH was calculated using the ΔΔct method. Lysis of cells on ice using lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, protease inhibitor complete (Roche), 1 mM PMSF, 1 mM NaF, 1 mM Na3VO4) After a minute, the insoluble matter was removed by centrifugation (13,000 rpm, 15 minutes) at 4 ° C to prepare a total cell protein extract. The protocol for preparing cytosolic and nuclear protein extracts is as follows: first with hypotonic buffer (10 mM HEPES (pH 7.6), 1.5 mM MgCl2, 10 mM KCl, 1 mM EDTA, protease inhibitor complete (Roche), 1 mM PMSF, 1 mM Cells were lysed with NaF, 1 mM Na3VO4) and treated back and forth 10-15 times with a homogenizer Douncer and then incubated on ice for 20 minutes. After centrifugation at a low temperature of 4 ° C (3000 rpm, 5 minutes), the supernatant was taken out, and after centrifugation at high speed to remove insoluble matter, it was a cytosolic protein extract. The pellet after low-speed centrifugation was lysed by high-salt buffer (20 mM HEPES (pH 7.6), 500 mM NaCl, 1.5 mM MgCl2, 1 mM EDTA, protease inhibitor complete (Roche), 1 mM PMSF, 1 mM NaF, 1 mM Na3VO4), and centrifuged at high speed. After removing the insoluble matter, it is a nuclear protein extract. Phosphorylation of proteins such as TBK1, IRF3, IκBα, STAT1, JNK, ERK, and p38 was detected by Western blot. Tubulin, GAPDH, Lamin B1, etc. are reference molecules for total protein amount of total protein, cytosolic protein or nuclear protein extract.

Table 1. Real-time quantitative PCR primer sequences

RESULTS: Real-time quantitative PCR showed that LPS and polyI:C induced IFNβ and Cxcl10 expression were significantly higher in CK2α knockdown Raw264.7 cells than in control cells (Fig. 1). Correspondingly, the expression levels of IFNβ-induced target genes Mx1 and Mx2 were also significantly increased in LPS and polyI:C-treated CK2α knockdown Raw264.7 cells (Fig. 1). In contrast, the expression of the inflammatory factor TNFα and the chemokine CXCL1 was not significantly different from the control group (Fig. 1), indicating that CK2 selectively inhibits type I interferon and its type I interferon-induced gene expression. Western blotting was used to detect the activation of signaling molecules in the TLR4-induced TLR4 signaling pathway by Western blotting. It was found that the key signaling molecule TBK1 involved in type I interferon induction was found in CK2α knockdown Raw264.7 cells. Phosphorylation of IRF3 was significantly increased, but there was no significant change in phosphorylation of MAP Kinases JNK, ERK, and p38 (Fig. 2). In contrast, phosphorylation of IκBα decreased (Fig. 2). These data show that CK2 inhibits on the one hand Activation of TBK1 and IRF3, on the other hand, positively regulates the activation of IKKα/β and NFκB, and thus CK2 has different regulatory roles in different TLR signaling pathways for different signaling molecules.

Similarly, in CK2 knockdown L929 cells, polyI:C, polydA:dT and DMXAA transformed into cytoplasm induced more IFNα, IFNβ, Cxcl10, Mx1 by activating RIG-I/MDA5 or cGAS/STING signaling pathways. And Mx2 (Figure 3A). It is suggested that CK2 is also involved in the regulation of type I interferon and its type I interferon-induced gene expression induced by pattern recognition receptors such as RNA and DNA in the cytoplasm. Similarly, by Western blotting, it was found that transformed polyI:C activated more TBK1 and IRF3 in CK2 knockdown L929 cells. Accordingly, type I interferon-activated p-STAT1 was significantly more potent than CK2 knockdown L929 cells. The cells are taller (Fig. 3B). In DMXAA-stimulated CK2 knockdown L929 nuclei, not only did p-TBK1 rise, but nuclear transfer of IRF3 was also significantly upregulated (Fig. 3C). In contrast, nuclear transfer of NFκB p65 did not increase significantly (Fig. 3C). It was further demonstrated that CK2-specific inhibition of TBK1 and IRF3 activation regulates the expression of multiple pattern recognition receptor-mediated type I interferons and their type I interferon-inducible genes.

Example 2 Protein Kinase CK2 is involved in the regulation of type I interferon expression induced by various viral infections

Methods: Control and CK2α knockdown stable cell lines were inoculated into 6-well plates at 10 ⁶ /ml, and 2 ml were inoculated per well. DNA virus HSV-1 (1 × 10 ⁷ pfu/ml), RNA virus vesicular virus VSV (2.5 × 10 ⁵ TCID ₅₀ /ml) and Sendai virus SeV (1 × 10 ⁸ HA/ml) were infected, respectively. Six hours after infection with the virus, cells were harvested for RNA extraction preparation. Six hours after infection with HSV virus, the cells were exchanged for 66 hours and the cell supernatant was collected for HSV virus titer determination. Using TRIZOL (Invitrogen) and L929 Raw264.7 method of extracting RNA, and anti 1μg RNA are transcribed first strand cDNA synthesis with ^{SuperScript TM III Reverse Transcriptase Kit (Invitrogen} ), for real-time quantitative PCR detection of gene expression levels. Real-time quantitative PCR primers are shown in Annex Table 1. The relative expression level of the measured gene relative to GAPDH was calculated using the ΔΔct method. The virus titer of HSV in the cell supernatant was detected by classical virus titer assay. The specific protocol was: inoculate Vero cells into 24 well plates at 5×10 ⁴ /ml, and inoculate 0.5 ml per well. When the degree reaches 30%, the cell supernatants with different concentration gradients are added separately (stock solution, 1:10 ¹ , 1:10 ² , 1:10 ³ , 1:10 ⁴ , 1:10 ⁵ , 1:10 ⁶ , 1 ) :10 ⁷ , 1:10 ⁸ , 1:10 ⁹ , 1:10 ¹⁰ ) and the blank control for 4 hours. After 4 hours, the supernatant was removed, and 400 μl of a 0.8% agar-MEM culture solution was added to each well, and allowed to stand at room temperature for 1 hour. After the medium was solidified, the culture was further inverted for 67 hours. After the completion of the culture, 500 μl of a crystal violet solution was added to each well, and the mixture was allowed to stand at room temperature for 2 hours. The agar was removed, the number of plaques was counted, and the virus titer (pfu/ml, plaque forming unit/ml) was calculated.

RESULTS: Real-time quantitative PCR results showed that HSV induction in Raw264.7 cells knocked down by CK2α The expression of IFNα, IFNβ and Cxcl10 was significantly higher than in control cells (Fig. 4). Correspondingly, the expression of the target genes Mx1 and Mx2 of IFNα/β was also greatly increased in CK2α knockdown Raw264.7 cells (Fig. 4). With the large expression of type I interferon and its target gene products, the replication, assembly and release of HSV virus were significantly inhibited, and the HSV virus titer detected in the CK2α knockdown Raw264.7 cell culture medium was higher than that of the control group. It is close to 10 times lower (Figure 4). Similarly, expression of VSV and SeV-induced genes such as IFNα, IFNβ, Cxcl10, Mx1, and Mx2 was also significantly up-regulated in CK2 knockdown L929 cells compared to control cells (Fig. 5 and Fig. 6). Therefore, down-regulation of CK2 expression in a variety of viral infections can significantly enhance the ability of different types of cells to express type I interferons. These results indicate that CK2 is a key molecule for the negative regulation of type I interferon expression.

Example 3 Kinase activity of CK2 plays a key role in the regulation of type I interferon expression

METHODS: The cDNA encoding mouse CK2α wild-type and kinase-inactivated mutant (K68M) was cloned on the lenti-viral vector pCDH, and then transferred into L929 cell line. The control cell lines were screened by puromycin and expressed wild. Type and mutant CK2α cell lines. Expression of wild-type and mutant CK2α was verified by Western blotting (Fig. 7A).

Cell lines expressing wild type and mutant CK2α were inoculated into 6-well plates at 10 ⁶ /ml, and 2 ml was inoculated per well. After 6 hours of infection with VSV (2.5×10 ⁵ TCID ₅₀ /ml), RNA in the cells was extracted by TRIZOL (Invitrogen) method. 1μg RNA first strand cDNA synthesis with ^{SuperScript TM III Reverse Transcriptase Kit (Invitrogen} ) reverse transcriptase, respectively, for real-time quantitative PCR detection of gene expression levels of type I interferon, as measured using ΔΔct method to calculate the relative expression of the gene relative to GAPDH .

Results: The experiments showed that the expression levels of IFNα, IFNβ and Cxcl10 were lower in the cells expressing wild-type CK2α than in the control cells (Fig. 7B). In contrast, in the high expression of kinase-free CK2α mutant cells, the expression levels of these genes were not significantly different from those of the control cells (Fig. 7B). These results indicate that upregulation of CK2 expression reduces the ability of cells to induce type I interferons, and that kinase activity of CK2 is essential for the regulation of type I interferon expression.

Example 4 Inhibition of CK2 Kinase Activity Promotes Cellular Expression of Type I Interferon and Prevents Vesicular Virus Infection

4.1 Method: Mouse fibroblast L929 was inoculated into 6-well plates at 10 ⁶ /ml, 2 ml per well, and when the cell abundance reached 70%, different concentrations of CK2 kinase inhibitor - small molecule compound TBB were used. Or DMSO (control) after treatment of the cells for 6 hours or 12 hours, using lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, protease inhibitor Complete (Roche), The protein lysate of the cells was extracted and prepared by 1 mM PMSF, 1 mM NaF, 1 mM Na3VO4), and phosphorylation of NFκB p65 and TBK1 was detected by Western hybridization.

Results: The results in Figure 8A indicate that after 20 hours of treatment of L929 cells with 20 μM TBB, the kinase activity of CK2 is inhibited, and its mediated phosphorylation of p65 is significantly reduced. Overall, however, treatment with 100 μM TBB for 12 hours was more effective at inhibiting CK2 activity and was the most potent activation of the key kinase TBK1 that induces type I interferon expression (Fig. 8A).

4.2 Method: L929 cells were treated with TBB (100 μM) or DMSO (control) for 12 hours in the same manner, and RNA in the cells was extracted by TRIZOL (Invitrogen) method. 1μg RNA first strand cDNA synthesis with ^{SuperScript TM III Reverse Transcriptase Kit (Invitrogen} ) reverse transcriptase, respectively, for real-time quantitative PCR detection of gene expression levels of type I interferon, as measured using ΔΔct method to calculate the relative expression of the gene relative to GAPDH .

Results: It was found that TBB treatment promoted the synthesis of genes such as IFNα, IFNβ, Cxcl10, Mx1 and Mx2 (Fig. 8B), and thus it was possible to establish an anti-viral infection state. Sure enough, L929 cells were treated with 0, 20, 50, 100 μM TBB for 12 hours, then VSV virus (2.5 × 10 ⁵ TCID ₅₀ /ml, expressing GFP, so fluorescent cells can be used to detect infected cells); After an hour, the efficiency of VSV infection was examined using a fluorescence microscope. Cells pretreated with TBB were found to exhibit resistance to VSV infection, and as the concentration of TBB increased, the ability to resist VSV infection also became stronger. In particular, L929 cells treated with 100 μM TBB were almost completely devoid of VSV infection and were resistant to viral infection (Figure 9).

4.3 In human embryonic kidney cell HEK293T, the effect of inhibition of CK2 kinase activity on cell expression of type I interferon and its role in preventing vesicular virus infection was examined.

METHODS: Human embryonic kidney cells HEK293T were inoculated into 6-well plates at 10 ⁶ cells/ml, and 2 ml were inoculated per well. When the cell abundance reached 70%, cells were treated with TBB or DMSO (control). The protein lysate of the same method was used for Western detection, RNA was extracted for the detection of type I interferon-related gene expression, and the efficiency of VSV infection was detected by fluorescence microscopy.

RESULTS: It was found that in human embryonic kidney cell HEK293T, TBK1 was also significantly activated after 12 or 24 hours of TBB treatment (Fig. 10A), and promoted the expression of genes such as IFNα, IFNβ, Mx1 and Mx2 (Fig. 10B). . More importantly, the ability of TKB-treated HEK 293 cells to resist VSV infection was also greatly enhanced (Fig. 10C). These results indicate that TBB can induce the expression of type I interferon in both mouse and human cells, establish a defense state against viral infection, and effectively resist the infection of VSV virus.

Example 5 CK2 inhibitor TBB prevents HCV infection

Chronic hepatitis caused by HCV infection is increasing in China and around the world. In human hepatoma cell Hu7.5, HCV virus can infect and replicate very efficiently, but does not induce expression of type I interferon. Therefore, exogenous administration of interferon therapy has a good effect on some patients with chronic HCV infection, but interferon is expensive and has obvious side effects. Therefore, it is explored whether TBB can be used to induce the host to produce type I interferon autologously in order to achieve the effect of treating HCV infection.

Methods: Hu7.5 cells were inoculated into 6-well plates at 5×10 ⁴ cells/ml, and each well was inoculated with 2 ml. The medium used was DMEM complete medium. When the cell abundance reached 30%, after treatment with 100 μM TBB or DMSO (control) for 24 hours, HCV infection with MOI (multiplicity of infection) = 0.01 or MOI = 0.1 was carried out for 8 hours, and the medium was changed and the culture was continued for 64 hours. Cells were harvested for efficiency of RNA analysis and HCV infection, respectively, and cell supernatants were collected for HCV virus titer determination. The virus titer of HCV in the cell supernatant was detected by classical virus titer assay. The specific protocol was: inoculate Hu7.5 cells into 96-well plates at 5×10 ⁴ /ml, and inoculate 200 μl per well. When the abundance reaches 30%, the cell supernatants with different concentration gradients are added separately (stock solution, 1:10 ¹ , 1:10 ² , 1:10 ³ , 1:10 ⁴ , 1:10 ⁵ , 1:10 ⁶ , ⁷ 1:10, 1: ^108, 1: ^109, 1: ^1010), cultured for 72 hours, the cells were collected, labeled antibodies specific for HCV paraformaldehyde after immunofluorescence, fluorescence microscopy has been HCV The number of Hu7.5 cells infected with fluorescently labeled cells was calculated and the virus titer (ffu/ml, fluorescence forming foci/ml) was calculated.

RESULTS: The expression levels of RNA and type I interferon-related genes in cells were extracted by the same method. The results of quantitative PCR showed that the expression of type I interferon-related genes such as IFNα, IFNβ, Mx1 and Mx2 in TBB pretreated cells. At the same time, TBB pretreatment also increased the expression of the inflammatory factor IL-6 in the cells (Fig. 11A). In contrast, the expression level of the Hcv gene was very small (Fig. 11A). The cells were fixed in 4% paraformaldehyde for 30 minutes, washed with PBS phosphate buffer, labeled with HCV-specific antibodies by immunofluorescence, and the efficiency of HCV infection was detected by fluorescence microscopy. Untreated cells were found to be heavily infected with HCV, but only very few cells were infected with HCV after TBB treatment (Fig. 11B). The virus titer test results of HCV showed that the titer of HCV virus in the cell supernatant was significantly reduced after TBB pretreatment (Fig. 11C). The above results show that TBB pretreatment can promote liver cell Hu7.5 to produce type I interferon and prevent HCV infection and replication.

Example 6 TBB inhibits HCV replication and clears HCV infection

METHODS: Hu7.5 cells were inoculated into 6-well plates at 5×10 ⁴ cells/ml, and each well was inoculated with 2 ml. When the cell abundance reached 30%, firstly, MOI (multiplicity of infection)=0.01 or MOI= After 0.1% of HCV-infected cells, 24 hours later, HCV had entered the cells and began to replicate, and the infected Hu7.5 cells were treated with 100 μM TBB or DMSO (control). After 48 hours, cells were harvested by the same method and RNA was prepared, and the expression levels of the cells and viral genes were detected by quantitative PCR.

RESULTS: Hu7.5 cells did not induce type I interferon expression after HCV infection. However, after the addition of TBB, the cells began to express large amounts of type I interferons, type I interferon-inducible genes MX1 and MX2, and some pro-inflammatory factors such as IL-6 and TNFα (Fig. 12A). With the large expression of type I interferons and their target gene products, the replication, assembly and release of HCV virus were significantly inhibited, and the HCV virus titer detected in TBC-treated cell culture was lower than that of untreated. -100 times (Fig. 12B). These results indicate that TBB can be used to treat patients with chronic HCV infection.

Example 7 TBB regulates the expression of type I interferon in tumor cells

METHODS: Human promyelocytic leukemia cells HL-60 (purchased from ATCC) and human renal cancer cell line OS-RC-2 were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum. 2 mM glutamine and antibiotics. HL-60 or OS-RC-2 cells were inoculated into 6-well plates at 5×10 ⁴ cells/ml, and each well was inoculated with 2 ml. When the cell abundance reached 30%, 100 μM TBB or DMSO (control) was added. . After 12 hours, cells were harvested and RNA was prepared using Trizol (Sigma). 1μg RNA first strand cDNA synthesis with ^{SuperScript TM III Reverse Transcriptase Kit (Invitrogen} ) reverse transcriptase, respectively, for real-time quantitative PCR detection of gene expression levels of type I interferon, as measured using ΔΔct method to calculate the relative expression of the gene relative to GAPDH .

RESULTS: Quantitative PCR results showed that type I interferon-related genes such as IFNα, IFNβ, Cxcl10, Mx1 and Mx2 were expressed in human promyelocytic leukemia cell line HL-60 and human kidney cancer cell line OS-RC-2 pretreated with TBB. The expression was significantly higher than that of untreated control cells (Figures 13 and 14), indicating that TBB also induced type I interferon expression in tumor cells.

Example 8 CK2 inhibitor TBB inhibits EV71 infection

METHODS: Vero cells were inoculated into a 24-well plate at 3×10 ⁴ cells/ml, and 0.5 ml per well was inoculated. When the abundance of Vero cells reached 70%, Vero cells were treated according to the TBB prevention group and the TBB treatment group, respectively. TBB prevention group: 20, 50, and 100 μM TBB or DMSO (control) were treated with cells for 2 hours, respectively, and infected with enterovirus EV712*10 ² TCID ₅₀ /ml for 4 hours, then change the solution and continue to add 20, 50 and The medium of 100 μM TBB or DMSO (control) was cultured for 24 hours. The medium was changed, culture was continued for 48 hours with medium without addition of TBB or DMSO, and the cell supernatant was collected for EV71 virus titer determination. TBB treatment group: Infected enterovirus EV712*10 ² TCID ₅₀ /ml 4 hours later, change medium, culture with medium supplemented with 20, 50 and 100 μM TBB or DMSO (control) for 72 hours, collect cell supernatant The EV71 virus titer was determined. The viral titer of EV71 in the cell supernatant was determined by the classical virus titer assay TCID ₅₀ (half the number of tissue cell infections). The specific protocol was: inoculate Vero cells into 96-well plates at 3×10 ⁴ /ml, respectively. Each well was inoculated with 0.1 ml. When the cell abundance reached 70%, cell supernatants with different concentration gradients were added (stock solution, 1:10 ¹ , 1:10 ² , 1:10 ³ , 1:10 ⁴ , 1: 10 ⁵ , 1:10 ⁶ , 1:10 ⁷ , 1:10 ⁸ , 1:10 ⁹ , 1:10 ¹⁰ ) and the blank control for 4 hours. After 4 hours, the supernatant was removed, the solution was changed, and incubation was continued for 68 hours. After the completion of the culture, the degree of infection of the cells was observed by an optical microscope, and the number of well plates exceeding half of the infection was counted, and the virus titer (TCID ₅₀ /ml, tissue culture infective dose/ml) was calculated.

RESULTS: Vero cells were treated in different doses of TBB prevention group. After EV71 infection, the EV71 virus titer detected in the cell culture medium treated by TBB prevention group was lower than that in the untreated group, and showed a certain concentration correlation. In the prevention group, the higher the concentration of TBB used, the lower the EV71 virus titer detected in the cell culture solution (Fig. 15A). The EV71 virus titer detected in the cell culture medium of the treatment group infected with EV71 was 10-100 times lower than that of the untreated group (Fig. 15B). The high concentration of TBC (100 μM) can significantly inhibit the EV71 virus. Replication, assembly and release resulted in a 100-fold reduction in the final detected EV71 virus titer (Fig. 15B).

Example 9 Inhibition of herpesvirus HSV infection by TBB in an animal infection model

9.1 TBB activates the key kinase TBK1 that induces type I interferon expression in mice

METHODS: B6 mice of 6-8 weeks old, male and female, were intraperitoneally injected with 2.5, 10, 25 mg/kg TBB or sunflower oil (control group) according to the body weight of the mice. After 24 hours, the mice were sacrificed according to the animal welfare method. Liver and spleen were taken to determine the degree of activation of the cytokine TBK1 associated with type I interferon synthesis in tissue samples. Weigh a tissue sample per unit weight and add lysis buffer (50 mM Tris-HCl (pH 7.4), 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, Protease Inhibitor Complete (Roche), 1 mM PMSF, 1 mM NaF, 1 mM. Na3VO4) homogenate, extract and prepare protein lysate of tissue samples, and detect the phosphorylation of TBK1 by Western blot.

RESULTS: The results in Figure 16A indicate that intraperitoneal injection of 10 mg/kg TBB for 24 hours can effectively activate the key kinase TBK1 that induces type I interferon expression in the liver. Both intraperitoneal injection of 2.5 or 10 mg/kg TBB for 24 hours can effectively activate the spleen. The key kinase TBK1 that induces type I interferon expression. At the same time, according to the results of the Western test, we used 10 mg/kg of TBB as the dose of the intraperitoneal injection example of the subsequent mouse animal infection model.

9.2 TBB inhibits HSV infection in mice

METHODS: B6 mice of 6-8 weeks old, male and female, were intraperitoneally injected with 10 mg/kg TBB or sunflower oil (control group) according to the body weight of the mice. After 6 hours, the mice were injected with 5*10 ⁷ according to the tail weight of the mice. Pfu/g HSV. Twelve hours after the injection of HSV, the second TBB was given by the same method. After 24 hours of HSV injection, the mice were sacrificed according to the animal welfare method, and the blood and spleen were taken to determine the virus titer of HSV in the tissue samples. The virus titer of HSV in mouse tissue samples was detected by classical virus titer assay. The specific protocol was as follows: 1 g tissue sample was weighed, 1 ml PBS was added, and homogenate was obtained to obtain a tissue homogenate. Tissue sample homogenate (stock solution, 1 to 5 × 10 ⁴ cells / ml Vero cells were seeded into 24-well plates, each well was inoculated 0.5ml, abundance of cells to be 30%, were added different concentration gradient: ¹⁰¹ , 1:10 ² , 1:10 ³ , 1:10 ⁴ , 1:10 ⁵ , 1:10 ⁶ , 1:10 ⁷ , 1:10 ⁸ ) and the blank control (PBS) for 4 hours. After 4 hours, the homogenate was removed, and 400 μl of a 0.8% agar-MEM culture solution was added to each well, and allowed to stand at room temperature for 1 hour. After the medium was solidified, the culture was further inverted for 67 hours. After the completion of the culture, 500 μl of a crystal violet solution was added to each well, and the mixture was allowed to stand at room temperature for 2 hours. The agar was removed, the number of plaques was counted, and the virus titer (pfu/g, plaque forming unit/g) was calculated.

RESULTS: The intraperitoneal injection of 10 mg/kg TBB was effective in activating the key kinase TBK1 that induces type I interferon expression in mouse tissues (Fig. 16A), thereby significantly inhibiting the replication, assembly and release of HSV virus. After 24 hours of HSV infection, the HSV virus titer detected in the blood and spleen of the TBB-treated group was significantly lower than that of the control group (Fig. 16B).

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims (10)

1. Use of a casein kinase 2 (CK2) inhibitor, characterized in that (i) is used for the preparation of a type I interferon (I-IFN) and/or a type I interferon-inducible gene or protein thereof. a pharmaceutical composition; and/or (ii) a pharmaceutical composition for the preparation of a disease associated with the treatment and/or prevention of type I interferon deficiency.
2. The use according to claim 1, wherein the inhibitor comprises an antisense nucleic acid, an inhibitory microRNA, an antibody or a small molecule compound of CK2.
3. The use according to claim 1, wherein the type I interferon deficiency-related diseases include: viral infectious diseases, malignant tumors, multiple sclerosis.
4. The use according to claim 3, wherein the viral infectious disease comprises a disease infected with the following viruses: herpes simplex virus (HSV), vesicular virus (VSV), Kaposi's tumor virus ( KSHV), respiratory syncytial virus (RSV), hand, foot and mouth disease virus (enteric virus EV71 and CA16), hepatitis B virus (HBV), hepatitis C virus (HCV), or human acquired immunodeficiency virus/HIV (HIV); and/or

   The malignant tumor includes the following tumors: hairy cell leukaemia, chronic myelogenous leukemia (CML), lymphoma, myeloma, melanoma, renal cell carcinoma (renal cell) Carcinoma, bladder cell carcinoma, or Kaposi's sarcoma.
5. The use according to claim 2, wherein the inhibitor is a small molecule compound that inhibits type I interferon expression and/or activity, preferably including tetrabromobenzotriazole (TBB), CX-. 4945 (Silmitasertib), DMAT (2-dimethylamino-4,5,6,7-tetrabromo-1H-benzimidazole), kaempferol, tyrosine phosphorylation inhibitor AG114 (Tyrphostin AG114), tetrabromocinnamyl Acid, 3-[[5-(4-methylphenyl)thiophene [2,3-d]pyrimidin-4-yl]thio]propionic acid (TTP 22), CX-5011, Ellagic Acid, 3-methyl-1,6,8-trihydropurine (emodin), 4',5,7-trihydroxyflavone (apigenin).
6. The use according to claim 1, wherein the type I interferon-inducing gene or protein thereof comprises CXCL10/IP-10, STAT1, MX1, MX2, Rsad2/Viperine, phosphokinase TBK1, interferon regulatory factor 3 (IRF3).
7. An in vitro non-therapeutic promoting cell expressing a type I interferon and/or a type I interferon-inducible gene or protein thereof and/or in vitro non-therapeutic inhibition of type I interferon deficiency-associated viral cells and/or tumor cell growth The method comprises the steps of: culturing a cell in the presence of a CK2 inhibitor, thereby promoting expression of a type I interferon and/or a type I interferon-inducing gene or a protein thereof and/or inhibiting a type I interferon deficiency Viral cells and/or tumor cells grow.
8. A method for screening a compound capable of inhibiting CK2, comprising the steps of:

   (a1) In the test group, a test compound was added to the cell culture system, and the expression amount and/or activity of the type I interferon was measured; in the control group, the test compound was not added to the cell culture system, and the type I was determined. The amount and/or activity of interferon expression;

   Wherein, if the expression level and/or activity of the type I interferon in the test group is significantly higher than that of the control group, the candidate compound is a compound capable of inhibiting CK2; and/or

   (a2) In the test group, the test compound is added to the virus-infected cell culture system, and the titer of the virus in the cell culture system is determined; in the control group, the test compound is added to the virus-infected cell culture system, And measuring the virus titer in the cell culture system;

   Wherein, if the titer of the test group virus is significantly lower than that of the control group, the candidate compound is a compound capable of inhibiting CK2.
9. The method of claim 8 further comprising the step of:

   (b) Further testing the compound of (a) for its promotion of the casein kinase 2 gene or its protein.
10. A method for preparing a type I interferon, comprising the steps of:

    (i) culturing the cells in the presence of a CK2 inhibitor;

    (ii) collecting, isolating and purifying type I interferons in the cell culture medium.

Images