WO2016038054A1

WO2016038054A1 - Stable pharmaceutical composition comprising pdgf

Info

Publication number: WO2016038054A1
Application number: PCT/EP2015/070525
Authority: WO
Inventors: Richard Charvet; José CORREIA
Original assignee: Adocia
Priority date: 2014-09-08
Filing date: 2015-09-08
Publication date: 2016-03-17
Also published as: FR3025428A1

Abstract

The invention relates to a composition comprising at least a functionalised polysaccharide and a PDGF-BB, characterised in that the functionalised polysaccharide comprises less than 2% residual mixed anhydrides and is selected from among functionalised polysaccharides of formula (I). The invention also relates to a pharmaceutical formulation comprising said composition and to the use thereof in the treatment of scarring.

Description

Stable pharmaceutical composition comprising PDGF

[0001] The healing of certain wounds, such as diabetic foot ulcers, venous ulcers and pressure ulcers, remains to this day a major public health problem despite advances in the field of good care practices.

[0002] It is now known that this cicatrization, diabetic foot ulcers, which is slow and incomplete, is due to a healing process that does not proceed normally (R. Lobmann et al., J. of Diabetes and its complication, 2006). , 20, 329-335).

A PDGF-BB growth factor-based treatment is marketed in the United States under the trade name Regranex® for the indication of the treatment of diabetic foot ulcer. It is in the form of a gel for topical application and promotes the healing of ulcers by promoting cell proliferation and thus the formation of new tissues.

However, this treatment is expensive because of the cost of PDGF-BB and the dose used, ie 6.25 μg / cm ² / day (calculated from

In addition, the gel formulation comprising a sodium carboxymethylcellulose (CMC) involves in the treatment process washing the wound between each daily application of Regranex® to remove residual CMC residues. This necessary removal of the residues of the CMC induces a slowing down of the healing because each intervention on the wound creates a trauma on it.

The PDGF-BB formulation used in Regranex® is therefore not optimal, especially since a significant portion of PDGF-BB is not actually used because of its rapid degradation and / or its elimination. daily during the washing phases of the treatment.

It is known in the name of the applicant a European patent EP1940448 which describes in particular a pharmaceutical composition comprising a PDGF / polysaccharide complex intended to promote healing. These compositions were tested, the final results on 195 patients demonstrate the "non-inferiority" of said composition vis-à-vis Regranex® for all doses used. The polysaccharides described in this application are dextrans functionalized by the methyl ester of tryptophan. In general, tryptophan esters are not the best candidates for PDGF-BB formulations.

It is also known, still in the name of the applicant, claims relating to the formulation of active ingredients. This is for example the application WO 2012/153070 relating to oligosaccharides or the US application 2012/0041079.

Also known, in the name of the applicant, osteogenic compositions comprising polysaccharides, described in the application WO 2010/058106.

In order to provide a more effective product, more comfortable in use and providing reduced doses of growth factor, including through improved in situ stability of PDGF-BB, for reasons of price and effects potential side effects, and in the form of a stable aqueous formulation, further research was conducted.

Surprisingly, the stability, and therefore the efficiency, could be improved and a composition in the form of stable aqueous solution at room temperature, that is to say 25 ° C, for three months could be development.

In one embodiment, stability has been demonstrated at 30 ° C.

Without being held by this theoretical approach, this improved stability of the composition appears, at least in part, result from the low residual mixed anhydride content of the functionalized polysaccharide.

The present invention thus consists of a composition, in the form of a stable aqueous solution at 25 ° C for at least 3 months, comprising at least one functionalized polysaccharide and a PDGF-BB, characterized in that said functionalized polysaccharide comprises a of residual mixed anhydrides of less than 2% and is chosen from the functionalized polysaccharides of formula I below:

Formula I the polysaccharides having a weight-average molar mass of between 1 kg / mol and 500 kg / mol, being chosen from the group consisting of dextrans and hydroxyethyl starches (HES)

R, linker, being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally unsaturated and / or optionally comprising one or more rings and / or one or more heteroatoms selected from O , H and S

G being an amide function resulting from the coupling between a carboxylic acid function of the precursor of the linker R and the amine function of a tryptophan,

F being a function resulting from the coupling between the precursor of the House R arm and an alcohol function of the polysaccharide, F being chosen from the ether, ester or carbamate functions,

Trp being a residue of tryptophan, L and / or D, product of said coupling between the amine function of tryptophan and a carboxylic acid function carried by the precursor of the radical R,

R 1 being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally unsaturated and / or optionally comprising one or more rings and / or one or more heteroatoms selected from O, N and S,

Fi being a resultant function of the coupling between the precursor of the radical R 1 and an alcohol function of the polysaccharide, F 1 being chosen from the ether, ester or carbamate functions,

j, between 0.2 and 0.8, representing the degree of substitution of -F-R-G-Trp per saccharide unit,

i, ranging from 0.1 to 1.8, representing the degree of substitution of -IF-R _x -COOX per saccharide unit,

i + j being between 0.5 and 2,

X representing a cation, and

the carboxylic acid function of tryptophan being in the form of X carboxylate.

The present invention also consists of a composition, in the form of an aqueous solution, comprising at least one functionalized polysaccharide and a PDGF-BB, characterized in that said functionalized polysaccharide comprises a residual mixed anhydride content of less than 2% and is chosen from the functionalized polysaccharides of formula I below:

Formula I

the polysaccharides having a weight-average molar mass of between 1 kg / mol and 500 kg / mol, being chosen from the group consisting of dextrans and hydroxyethyl starches (HES)

R, linker, being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally unsaturated and / or optionally comprising one or more rings and / or one or more heteroatoms selected from O , N and S

F being a function resulting from the coupling between the precursor of the linker R and an alcohol function of the polysaccharide, F being chosen from ether, ester or carbamate functions,

Fi being a resultant function of the coupling between the precursor of the radical R 1 and an alcohol function of the polysaccharide, F _t being chosen from the ether, ester or carbamate functions,

i, between 0.1 and 1.8, representing the degree of substitution of -IF-Rr COOX per saccharide unit,

i + j being between 0.5 and 2,

X representing a cation, and The carboxylic acid function of tryptophan being in the form of carboxylate of X.

The present invention also consists of a composition, in the form of a stable aqueous solution at 25 ° C for at least 3 months, comprising at least one functionalized polysaccharide and a PDGF-BB, characterized in that said functionalized polysaccharide is chosen from the functionalized polysaccharides of formula I below:

Formula I

R, linker, being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally in saturated and / or optionally comprising one or more ring (s) and / or one or more heteroatom (s) selected from O, N and S

G being an amide function resulting from the coupling between a carboxylic acid function of the precursor of the linker R and its amine function of a tryptophan,

R 1 being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally unsaturated and / or optionally comprising one or more rings and / or one or more heteroatoms selected from O, N and S, • Fi being a resultant function of the coupling between the precursor of the radical R _x and an alcohol function of the polysaccharide, Fi being chosen from the ether, ester or carbamate functions,

• j, between 0.2 and 0.8, representing the degree of substitution of -F-R-G-Trp per saccharide unit,

I, between 0, 1 and 1.8, representing the degree of substitution in

COOX per saccharide unit,

I + j being between 0.5 and 2,

X representing a cation, and

The carboxylic acid function of tryptophan being in the form of carboxylate of X.

The following embodiments apply to the three compositions according to the invention.

In one embodiment, X represents alkaline cations.

In one embodiment, the alkali cations ns are chosen from the group consisting of Na ⁺ and K ⁺ .

Brief description of the figures:

Figure 1 illustrates a conditioning and spraying device (1).

[00021] FIG. 2 illustrates a device (1) comprising positioning means (4).

[00022] FIG. 3 illustrates a removable device (6) comprising positioning means (4).

Figures 4 and 5 show the stability of formulations according to the invention and comparative formulations. The abscissas represent the time in months and the ordinates the residual activity of the PDGF-BB compared to time t = 0 in%. The dotted curves correspond to the formulation according to the invention and the solid curves correspond to the comparative formulation.

According to a mode of real isation, said composition is stable at 30 ° C, and in particular at 40 ° C, for at least 3 months.

ED ₅₀ is the concentration of PDGF-BB needed to obtain 50% of maximal mitogenic activity.

By "composition or formulation stable at Y ° C for x months" is meant that the composition or formulation stored x months at Y ° C has an ED ₅₀ less than or equal to twice that of the composition at tO. These measurements being carried out according to the protocol described in Example 6.

By "percentage of residual activity at Y ° C after x months" is meant the percentage of activity, relative to the activity of the composition or formulation to t0, the composition or formulation stored x months at Y ° C. These measurements being carried out according to the protocol described in Example 6.

In particular, the composition or formulation according to the invention has a percentage of residual activity at 25 ° C, especially at 30 ° C, after 3 months greater than or equal to 50%, especially greater than or equal to 60%.

By "Z degree of substitution" is meant in the sense of the present invention the average number of Z unit per unit sacc aridic.

The residual mixed anhydride content of the functionalized polysaccharides being determined according to the protocol described in Example 3, namely by gas chromatography assay by flame ionization detection (GC-FID) of the ethanol formed following the treatment. in a basic medium of said polysaccharides.

In one embodiment, i is between 0.2 and 1.2.

In one embodiment, i is between 0.4 and 1.0.

In one embodiment, j is between 0.3 and 0.7.

In one embodiment, j is between 0.35 and 0.6.

In one embodiment, i + j is between 0.6 and 1.7.

In one embodiment, i + j is between 0.8 and 1.4.

In one embodiment, the polysaccharides, dextrans and hydroxyethyl starches (HES) are, before substitution with the substituents -IF-R-COOX and -FRG-Trp, in the native state, that is to say after substitution, they do not include substituents other than -Fi-Ri-COOX and -FRG-Trp.

They can be synthesized according to techniques known to those skilled in the art or purchased from suppliers, for example Pharmacosmos, Serumwerk, Fresenius, Sigma-Aldrich, NOF Corp. or CarboMer Inc.

In one embodiment, the polysaccharide before substitution with the substituents -F COOX and -FRG-Trp, is chosen from the group consisting of polysaccharides with a weight-average molar mass of between 5 kg / mol and 250 kg / mol. .

In one embodiment, the polysaccharide before substitution with the substituents -IF-R COOX and -FRG-Trp, is chosen from the group consisting of polysaccharides with a weight average molar mass of between 10 kg / mol and 100 kg. / mol.

In one embodiment, the polysaccharide before substitution with the substituents -Fx-Ri-COOX and -FRG-Trp is chosen from the group consisting of polysaccharides with a weight average molar mass of between 20 kg / mol and 90 kg / mol.

In one embodiment, the po! Ysaccharide before substitution with the substituents -F 1 -R 1 -COOX and -FRG-Trp is chosen from the group consisting of polysaccharides with a weight-average molar mass of between 1.5 kg / lbs. mol and 750 kg / mol.

In one embodiment, the polysaccharide before substitution with the substituents

and functionalized FRG-Trp is chosen from the group consisting of polysaccharides with a weight-average molar mass of between 7.5 kg / mol and 375 kg / mol.

In one embodiment, the polysaccharide before substitution with the substituents -IF-Ri-COOX and -FRG-Trp is chosen from the group consisting of polysaccharides with a weight average molar mass of between 15 kg / mol and 150 kg. / mol.

In one embodiment, the polysaccharide before substitution with the substituents -Fi-R COOX and -FRG-Trp is chosen from the group consisting of polysaccharides with a weight average molecular mass of between 30 kg / mol and 135 kg. / mol.

[00044] In one embodiment, the polysaccharide before substitution with the substituents

and -FRG-Trp is selected from the group of dextrans.

In one embodiment, the functionalized polysaccharide is selected from the group consisting of functionalized dextrans arbitrarily illustrated by formula II, hereinafter:

Formula II

in which :

each L group independently represents -OH, -FRG-Trp, or -Fi-Rj-COOX, with F, R, G, Trp, FR _lt and X, having the definitions given for Formula I,

the degrees of substitution of -IF-Ri-COOX and -FRG-Trp, respectively called i and j, having the values given for Formula I, and the dextrans have a weight average molar mass of between 1 kg / mol and 500 kg / mol.

In one embodiment, the dextrans are chosen from pharmaceutical grade dextrans ("pharmaceutical grade").

In one embodiment, the dextrans are chosen from the group of dextrans with a weight average molar mass of between 5 kg / mol and 250 kg / mol.

In one embodiment, the dextrans are chosen from the group of dextrans with a weight average molar mass of between 10 kg / mol and 100 kg / mol.

In one embodiment, the dextrans are chosen from the group of dextrans with a weight average molar mass of between 20 kg / mol and 90 kg / mol.

In one embodiment, the dextran has a weight average molecular weight of about 40 kg / mol.

In one embodiment, the functionalized polysaccharide is a functionalized hydroxyethyl starch (HES).

In one embodiment, the functionalized polysaccharide is chosen from the group consisting of functionalized hydroxyethyl starches (HES), illustrated in a

Formula III

in which :

- each L is independently -OH, -FRG-Trp, or -Fi-R-COOX, F, R, G, Trp, F _lr _lf R and X having the meanings defined in Formula I, the degrees of substitution in and in -FRG-Trp, respectively called i and j, having the values given for Formula I,

the HES have a degree of substitution of hydroxyethyl radical ranging from 0.1 to 1.4 per saccharide unit,

the HES have a weight average molar mass of between 5 kg / mol and 250 kg / mol.

In one embodiment, the HES are chosen from pharmaceutical grade HES ("pharmaceutical grade").

In one embodiment, the HES are selected from the group of HES with a weight average molar mass of between 5 kg / mol and 250 kg / mol.

In one embodiment, the HES are selected from the group of HES with a weight average molar mass of between 10 kg / mol and 100 kg / mol.

In one embodiment, the HES are selected from the group of HES with a weight average molar mass of between 20 kg / mol and 90 kg / mol.

According to one embodiment, the HES have a degree of substitution of hydroxyethyl radical ranging from 0.2 to 1.0 per saccharide unit.

According to one embodiment, the HES have a degree of substitution of hydroxyethyl radical ranging from 0.3 to 0.8 per saccharide unit.

In one embodiment, the functionalized polysaccharide comprises a residual mixed anhydride content of less than 1.5%.

In one embodiment, the radical R comprises between 1 and 10 carbon atoms, and is a chain, optionally branched or substituted, optionally unsaturated and / or possibly comprising one or more ring (s).

In one embodiment, the radical R comprises between 1 and 3 carbon atoms, and is a chain, optionally branched or substituted.

In one embodiment, the radical R comprises 3 carbon atoms, and is a chain.

In one embodiment, the R 1 radical comprises between 1 and 10 carbon atoms, and is a chain, optionally branched or substituted, optionally unsaturated and / or possibly comprising one or more rings (s).

In one embodiment, the radical R 1 comprises between 1 and 3 carbon atoms, and is a chain, optionally branched or substituted.

In one embodiment, the radical R comprises 3 carbon atoms, and is a chain. In one embodiment, the radical R and the radical R _{lf which are} identical or different, are chosen from the following radicals of formula IV:

Form IV in which:

P is an integer greater than or equal to 1 and less than or equal to 9, and

R ₃ and R _{4, which may be} identical or different, are chosen from the group consisting of a hydrogen atom, a saturated or unsaturated, linear, branched or cyclic C ₁ to C ₆ alkyl, a benzyl or a C ₁ to C ₆ alkyl aryl; ₇ to ₁₀ and optionally comprising heteroatoms selected from the group consisting of O, N and / or S, or functions selected from the group consisting of carboxylic acid, amine, alcohol or thiol functions.

In one embodiment, the precursor of the radical R, having attached to the radical Trp, is chosen from the following groups, in which represents the site of attachment to F:

or their alkali metal salt salts selected from the group consisting of Na ^÷ or K ⁺ ,

In one embodiment, the Ri-COOX unit is chosen from the following groups, in which * represents the site of attachment to Fi:

with X representing a cation, in particular an alkali metal cation, in particular chosen from the group consisting of Na and K ⁺ .

In one embodiment, the radicals R and R 1 are identical.

In one embodiment, the radicals R and i are radicals -CH ₂ -, [00071] In another embodiment, the radicals R and i are different.

In one embodiment, the function F is an ether function.

In one embodiment, the function F is a carbamate function.

In one embodiment, the function F is an ester function.

In one embodiment, the function F _x is an ether function.

In one embodiment, the function F _x is a carbamate function.

[00077] In one embodiment, the F] _function is an ester function.

In one embodiment, the function F is identical to the function Fi.

In one embodiment, the functions F and F _x are ether functions.

In one embodiment, the F and F functions are carbamate functions.

In one embodiment, the F and F functions are ester functions.

In one embodiment, the functionalized polysaccharide corresponds to Formula I in which the poysaccharide is a dextran, the functions F and F 1 are identical, and the radicals R and R 1 are identical. In a particular embodiment, the functionalized polysaccharide corresponds to Formula I in which the polysaccharide is a dextran, F and F 1 are ether functions, and R and R 1 are -CH ₂ - radicals.

In a particular embodiment, the functionalized polysaccharide corresponds to Formula I in which:

the polysaccharide is a dextran,

F and Fi are ether functions,

R and R 1 are radicals -CH ₂ -,

i is between 0.4 and 1.0,

- j is between 0.35 and 0.6,

i + j is between 0.8 and 1.4 and

the residual mixed anhydride content is less than 1.5%. In a particular embodiment, the functionalized polysaccharide corresponds to Formula I in which:

the polysaccharide is a dextran with a weight average molar mass of approximately 40 kg / mol,

F and Fi are ether functions,

R and i are -CH ₂ - radicals,

i is between 0.4 and 1.0,

- j is between 0.35 and 0.6,

i + j is between 0.8 and 1.4 and

the residual mixed anhydride content is less than 1.5%.

In one embodiment, the PDGF-BB is selected from the group consisting of human recombinant PDGFs comprising two B chains (rhPDGF-BB). Chain B is described in particular in the Uniprot database under No. P01127.

According to one embodiment, the PDGF-BB is chosen from proteins in the form of dimers of polypeptides, each polypeptide comprising the following two sequences:

a sequence having a homology of at least 80% with SEQ ID NO: 1, and

a sequence having a homology of at least 80% with SEQ ID NO: 2.

According to one embodiment, the PDGF-BB is chosen from proteins in the form of polypeptide dimers, each polypeptide comprising the following two sequences:

a sequence having a homology of at least 90% with SEQ ID NO: 1, and

a sequence having a homology of at least 90% with SEQ ID NO: 2.

a sequence having a homology of at least 95% with SEQ ID NO: 1, and

a sequence having a homology of at least 95% with SEQ ID NO: 2.

According to one embodiment, the PDGF-BB is chosen from the proteins in dimer form of polypeptides, each polypeptide comprising a sequence SEQ ID NO: 1 and a sequence SEQ ID NO: 2 having one or more amino acid substitutions. cysteine corresponding to residues 10, 16, 19 and 20 of SEQ ID NO: NO: 2.

The percentages of homology referred to in the description of the present invention are understood in terms of similarity or identity of sequences and refers to the extent to which the sequences are identical or functionally or structurally similar on a nucleotide basis per nucleotide or on an amino acid basis per amino acid on a comparison window. The comparison between two sequences is traditionally performed by comparing these sequences after optimally aligning them, said comparison being possible by segment or by "comparison window". The percentages of homology according to the invention are determined on the basis of an overall alignment of the sequences to be compared, that is to say on an alignment of the sequences taken in their entirety, for example using the Needleman algorithm. and Wunsch (J. Mol Biol., 48, 443-453, 1970). In particular, this comparison of sequences can be carried out using the needle software, in particular available on the website of the European Bioinformatics Institute (ebi.ac.uk).

a sequence SEQ ID NO: 1, and

a sequence SEQ ID NO: 2.

SEQ ID NO: 1 (here named zone 1 of PDGF-B) being: CKTRTEVFEISRRLI.

[00094] SEQ ID NO: 2 (here named zone 2 of PDGF-B) being: NANFLVW PPCVEVQRCS GCCNNRNVQC RPTQVQLRPV QVRKIEIVRK KPIFKKATVT LEDHLACKCE.

The sequences SEQ ID NO: 1 and SEQ ID NO: 2 or the sequences that have at least 80%, 90% or 95% homology therewith each consist of a separate and non-overlapping portion of the sequence of amino acids of the polypeptide.

According to one embodiment, the PDGF-BB is chosen from the proteins in the form of dimers of polypeptides in which the sequences SEQ ID NO: 1 and SEQ ID NO: 2 or the sequences which have at least 80%, 90% or 95% homology with SEQ ID NO: 1 and SEQ ID NO: 2 are 1 to 10 amino acids apart, especially 1 to 5, and in particular 3 amino acids.

According to one embodiment, the PDGF-BB is chosen from proteins in the form of dimers of polypeptides having one or more of the following modifications of SEQ ID NO: 3

a) one or more cysteine amino acid substitutions corresponding to residues 43, 49, 52 and 53 of SEQ ID NO: 3, b) the deletion of I to 14 amino acids at positions 1-14 of SEQ ID NO: 3, and c) the deletion of 1 to 9 amino acids at positions 101-109 of SEQ ID NO: 3.

According to one embodiment, the PDGF-BB is chosen from proteins in the form of polypeptide dimers comprising a sequence having a homology of at least 80% with SEQ ID NO: 3.

According to one embodiment, the PDGF-BB is chosen from proteins in the form of polypeptide dimers comprising a sequence having a homology of at least 90% with SEQ ID NO: 3.

According to one embodiment, the PDGF-BB is chosen from proteins in the form of polypeptide dimers comprising a sequence having a homology of at least 95% with SEQ ID NO: 3.

According to one embodiment, the PDGF-BB is chosen from the proteins in the form of dimers of a protein comprising the sequence SEQ ID NO: 3.

[000102] SEQ ID NO: 3 (herein named zone 3 of PDGF-B) being:

SLGSLTIAEP AMIAECKTRT EVFEISRRLI DRTNANFLVW PPCVEVQRCS GCCNNRI QC RPTQVQLRPV QVRKIEIVRK KPIFKKATVT LEDHLACKCE VATAARPVT

In particular, the PDGF-BB is chosen from proteins in the form of polypeptide dimers comprising a sequence encoded by the cDNA of sequence SEQ ID NO: 4 below:

AGCCTGGGTTCCCTGACCATTGCTGAGCCGGCCATGATCGCCGAGTGCAAGACGCGCACCGA GGTGTTCGAGATCTCCCGGCGCCTCATAGACCGCACCAACGCCAACTTCCTGGTGTGGCCGC CCTGTGTGGAGGTGCAGCGCTGCTCCGGCTGCTGCAACAACCGCAACGTGCAGTGCCGCCCC ACCCAGGTGCAGCTGCGACCTGTCCAGGTGAGAAAGATCGAGATTGTGCGGAAGAAGCCAAT CTTTAAGAAGGCCACGGTGACGCTGGAAGACCACCTGGCATGCAAGTGTGAGACAGTGGCAG CTGCACGGCCTGTGACCT.

In one embodiment, the PDGF-BB is rhPDGF-BB (recombinant human PDGF-BB), whose DCI is becaplermin.

[000104] PDGF-BB can be produced by various methods of genetic engineering.

In particular, PDGF-BB can be obtained by recombinant expression in a bacterium, such as the method described in Example 1.1., Or according to a method based on data published by Karumuri N.N. et al. (Biotechnol Lett, 2007, pp 1333-1339), for example as described in Example 1.2.

PDGF-BB may also be produced by recombinant expression in yeast, in particular via Saccharomyces cerevisiae, as described by PA. Hemecourt et al. in "WOUNDS: A Comprehension of Clinical Research and Practice", 1998, pp69-75, and in the Memorandum of December 9, 1997 filed with the FDA in REGRAN EX (becaplermin), reference BLA-96-1408. PDGF-BB obtained by recombinant expression in yeast is further described in US4845075 to Zymogenetics.

The PDGF-BB can thus be chosen from human recombinant PDGF-BBs, obtained according to the techniques known to those skilled in the art or purchased from suppliers, for example from Gentaur companies (USA) or Research Diagnostic. Inc. (USA).

In one embodiment, the concentration of PDGF-BB is between 0.01 and 10 mg / ml.

In one embodiment, the concentration of PDGF-BB is between 0.05 and 2 mg / ml.

In one embodiment, the concentration of PDGF-BB is between 0.1 and 0.75 mg / ml.

In one embodiment, the concentration of PDGF-BB is between 0.1 and 0.5 mg / ml.

In one embodiment, the concentration of PDGF-BB is about 0.25 mg / ml.

In one embodiment, the concentration of PDGF-BB is about 0.37 mg / ml.

In one embodiment, the PDGF-BB concentration is about 0.50 mg / ml.

In one embodiment, the concentration of functionalized polysaccharide is between 0.1 and 150 mg / ml.

In one embodiment, the concentration of functionalized polysaccharide is between 1 and 100 mg / ml.

In one embodiment, the concentration of functionalized polysaccharide is between 3 and 37.5 mg / ml.

In one embodiment, the concentration of functionalized polysaccharide is about 12.5 mg / ml.

In one embodiment, the concentration of functionalized polysaccharide is about 18.5 mg / ml.

In one embodiment, the concentration of functionalized polysaccharide is about 25 mg / ml. In one embodiment, the weight ratio functionalized polysaccharide / PDGF-BB is between 10 and 200.

In one embodiment, the functionalized polysaccharide / PDGF-BB weight ratio is between 20 and 100.

In one embodiment, the functionalized polysaccharide / PDGF-BB weight ratio is between 30 and 75.

In one embodiment, the functionalized polysaccharide / PDGF-BB weight ratio is about 50. According to another embodiment, the composition is in the form of a powder, for example obtained by lyophilization of the composition. in the form of aqueous solution described above.

The invention also relates to a pharmaceutical formulation comprising as active ingredient a composition according to the invention as described above.

The invention also relates to a pharmaceutical formulation comprising as active ingredient a composition according to the invention as described above for use as a medicament for promoting the healing of wounds.

In one embodiment, it also relates to a pharmaceutical formulation comprising as active ingredient a composition according to the invention as described above for use as a medicament for promoting the healing of chronic wounds.

The invention also relates to a pharmaceutical formulation comprising, as active ingredient, a composition according to the invention as described above, for its use as a medicament for promoting the healing of wounds.

In one embodiment, the pharmaceutical formulation for use as a medicament for promoting wound healing is used in a dosage of between 1 and 25 μg / cm ² at a frequency of once a week at all times. 2 days, for a maximum of 20 weeks.

In one embodiment, the pharmaceutical formulation for use as a medicament for promoting wound healing is used in a dosage of between 1 and 25 μg / cm ² every 2 days for a maximum of 20 minutes. weeks.

In one embodiment, the dosage is of a duration of at most sixteen weeks, or at most twelve weeks. In one embodiment, the dosage is between 2 and 20 μg / cm ² at a frequency ranging from once a week to every other day.

In one embodiment, the dosage is between 2 and 20 μg / cm ² every two days.

According to one embodiment, the dose is between 2.5 and 15 μg / cm ² every two days.

According to one embodiment, the dose is between 2.5 and 15 μg / cm ² at a frequency ranging from once a week to every other day.

[000137] According to one embodiment, the dose is between 7.2 pg / cm ² at a frequency ranging from once per week to every 2 days.

According to one embodiment, the dose is 4.2 μg / cm ² every other day.

The duration of the applications may correspond to the time required for the wound to be closed.

According to one embodiment and depending on the nature of the wounds, the pharmaceutical formulation is applied for a minimum of one week.

[000141] The wounds can be disorders involving a loss of cutaneous tissue, such as burns, tissue destruction, such as abrasions or wounds resulting from surgical procedures, for example the wounds resulting from the integration of skin grafting. or removal of skin graft.

[000142] Chronic wounds can be ulcers, such as diabetic foot ulcers, venous leg ulcers, and pressure ulcers.

According to one embodiment, the chronic wounds are diabetic foot ulcers.

The pharmaceutical formulation according to the invention is preferably a topical and / or topical formulation which may be in the form of a solution optionally administered via spraying means.

The present invention also relates to an assembly comprising a packaging and dispensing device (1) and a pharmaceutical formulation according to the invention (7), said packaging and dispensing device (1) comprising

a container (2) comprising the formulation (7),

pump-type dispensing means (3) mounted on the container (2), said dispensing means (3) comprising spraying means (8) and means for preventing reflux of the formulation into the container,

sealing means for preventing the passage of flow from the outside to the inside of the device, except via air inlet means for balancing the internal pressure of the device with the external pressure after each spray , via a flow of air from outside, and

means for protecting the formulation against microbial contamination.

The protection means of the formulation vis-à-vis the bacterial contamination may be means for filtering the air entering the container, allowing said incoming air to be free of microbial contamination.

[000147] Said filtration means may be a membrane having a porosity of at most 200 nm.

The protection means of the formulation vis-à-vis the bacterial contamination may be a flexible envelope secured with the distribution means (3) sealingly, said flexible envelope comprising the formulation.

[000149] Advantageously, the device (1) also comprises positioning means (4), for positioning the spray means (8) at the desired distance (d).

[000150] These positioning means (4) comprise at least one part (5) intended to be in contact with a healthy skin surface. In particular, the positioning means comprise two parts (5). These parts (5) may be flat, that is to say have a width at least equal to half the outer diameter of the container (2).

These positioning means (4) can be arranged on a removable device (6) adapted to be fixed on the packaging and dispensing device (1), in particular on a distal portion with respect to the spraying means (8). ).

Such a device (1) allows the delivery of a precise amount of composition by spraying. The presence of the positioning means (4) allows the control of the spray distance (d), thus allowing the delivery of a precise dose of PDGF-BB per cm ² by spraying.

An assembly as defined above may allow the sterility of the formulation to be maintained for at least 30 months before the first opening of the device containing it and / or for at least 6 weeks under conditions of use. ie spray every 2 days. "Sterility" means the definition as provided by European Pharmacopoeia 6.0, point 2.6.1. [000154] In one embodiment, the pharmaceutical formulation further comprises pharmaceutical excipients.

The nature of the excipients that can be formulated with the composition according to the invention is chosen according to its presentation form according to the general knowledge of the galenist.

These excipients can be used in this invention to adjust the parameters of the pharmaceutical formulation such as a buffer to adjust the pH, an agent to adjust the isotonicity, antimicrobial preservatives or an antioxidant such as L-lysine hydrochloride or methionine.

According to a particular embodiment, the composition comprises methionine.

The concentration of antioxidant may be between 15 and 300 mM. According to one embodiment, the pharmaceutical formulation is devoid of antimicrobial preservatives.

In particular, the pharmaceutical formulation is devoid of the following antimicrobial preservatives: parabens, especially benzyl parahydroxybenzoate, butyl parahydroxybenzoate, propyl parahydroxybenzoate, ethyl parahydroxybenzoate, and methyl parahydroxybenzoate, m-cresol and phenol.

By "pharmaceutical formulation free of antimicrobial preservatives" is meant that the composition does not comprise any compound (s) in content (s) such (s) they (s) allow (s) said composition to meet criteria for the efficacy of antimicrobial preservation as defined in the European Pharmacopoeia 6.0 point 5.1.3.

In one embodiment, the pharmaceutical formulation is characterized in that the concentration of PDGF-BB is between 10 μg and 10 mg / ml.

[000163] In another embodiment, the pharmaceutical formulation is characterized in that the concentration of PDGF-BB is between 100 and 1000 μg / ml. According to one embodiment, the pharmaceutical formulation is applied at a dose of between 1 and 25 μg / cm ² , at a frequency ranging from once a week to every other day. These applications can be carried out for a maximum of twenty weeks, or even a maximum of sixteen weeks, or a maximum of twelve weeks. According to one embodiment, the pharmaceutical formulation is applied at a dose of between 1 and 25 μg / cm ² every two days. These applications can be carried out for a maximum of twenty weeks, or even a maximum of sixteen weeks, or a maximum of twelve weeks.

According to one embodiment, the pharmaceutical formulation is applied at a dose of between 2 and 20 μg / cm ² , at a frequency ranging from once a week to every other day. These applications can be carried out for a maximum of twenty weeks, or even a maximum of sixteen weeks, or a maximum of twelve weeks.

According to one embodiment, the pharmaceutical formulation is applied at a dose of between 2 and 20 μg / cm ² every two days. These applications can be carried out for a maximum of twenty weeks, or even a maximum of sixteen weeks, or a maximum of twelve weeks.

According to one embodiment, the pharmaceutical formulation is applied at a dose of between 2.5 and 15 μg / cm ² , at a frequency ranging from once a week to every other day. These applications can be carried out for a maximum of twenty weeks, or even a maximum of sixteen weeks, or a maximum of twelve weeks.

According to one embodiment, the pharmaceutical formulation is applied at a dose of between 2.5 and 15 μg / cm ² every two days. These applications can be carried out for a maximum of twenty weeks, or even a maximum of sixteen weeks, or a maximum of twelve weeks.

According to one embodiment, the pharmaceutical formulation is applied at a dose of 7.2 μg / cm ² , at a frequency ranging from 1 once a week to every other day. These applications can be carried out for not more than twenty weeks or more than sixteen weeks, or more than twelve weeks

According to one embodiment, the pharmaceutical formulation is applied at a dose of 4.2 μg / cm ² every other day. These applications may be carried out for not more than twenty weeks or more than sixteen weeks or not more than twelve weeks.

[000174] The invention also relates to the following application protocol.

[000175] The wound must be dried with sterile gauze before application of the composition.

The device comprising the formulation must be held in a vertical position for spraying the formulation. Before the first use, the Spray device must be activated several times, in order to properly start the spraying.

[000177] The administration of the desired amount per unit area is effected via a single spraying of the formulation at a specific distance. This distance can be fixed by the positionnemnt means described above. Several sprays can be carried out to cover the entire surface of the wound, if it requires it, so as to limit the area covered by 2 sprays.

The formulation present on the healthy skin at the edge of the wound must be carefully wiped, however the formulation on the wound, including the edges of the wound, must be left as filed and must not be wiped. neither buffered.

[000179] Then a dressing is placed so as to cover the wound.

According to one embodiment, said dressing is semi-permeable, in particular in the case of treatment of diabetic foot ulcer.

According to another embodiment, said dressing is chosen from the following types: Hydrocolloids, for example composed of carboxymethyl cellulose and pectin and / or gelatin and / or elastomer

- Hydrocellular, for example composed of polyurethane foam

- Alginates, and

Hydrofibers, for example composed of sodium carboxymethylcellulose fibers.

[000181] These steps are repeated at a frequency ranging from once a week to every other day until closure of the wound or for at most 20 weeks, whichever is the shorter, with the exception of priming of the device which must only be performed during the first use.

The invention also relates to a method or a method for stabilizing a formulation comprising a polysaccharide and a PDGF-BB characterized in that the residual mixed anhydride content is lowered to below 2%.

[000183] In one embodiment, it is lowered below 1.5%. According to yet another of its aspects, the invention relates to a process for the preparation of functionalized polysaccharides of Formula I below:

Formula I

polysaccharides having a weight-average molar mass of between 1 kg / mol and 500 kg / mol, and being selected from the group consisting of dextrans and hydroxyethyl starches (HES)

F being a resultant function of the coupling between the precursor of the linker R and an alcohol function of the polysaccharide, F being chosen from ether, ester or carbamate functions,

F _! being a resultant function of the coupling between the precursor of the radical R _t and an alcohol function of the polysaccharide, Fi being chosen from the ether, ester or carbamate functions,

i, between 0.1 and 1.8, representing the degree of substitution of -Ft-Rx-COOX per saccharide unit, I + j being between 0.5 and 2,

X representing a cation, and

The carboxylic acid function of tryptophan being in the form of carboxylate of X,

comprising the following steps:

amidifi cation of at least a portion of the carboxylic acid functions of a polysaccharide selected from the extra-born d and the HES functionalized with a radical carrying a free carboxylic acid function activated by formation of a mixed anhydride,

- decrease in residual mixed anhydride to less than 2%, and

recovery of the functionalized polysaccharide of Formula I.

When the carboxylic acid functions are carried by different radicals R 1 and R, the protection and deprotection methods used in synthesis are applied to selectively amidify the carboxylic acid functions carried by the -F-R-COOH radical.

According to one embodiment, the step of reducing the residual mixed anhydride content to less than 2% is carried out under mild saponification conditions, in particular by passage during the purification step by diafiltration of sodium hydroxide volumes. , 01N at room temperature.

Such a method has the advantage of being simple, especially via the use of tryptophan in amino acid form, and to lead to compositions comprising said functionalized polysaccharide and PDGF-BB having improved stability.

EXAMPLES

Example 1: Method of Preparation of PDGF-BB

Example 1.1: Preparation of PDGF-BB bacterially a. Transfusion of the Bacterial strain

The PDGF-B, SEQ ID NO: 4 of the cDNA used, is cloned into a pET24b vector between the NdeI and Hind3 sites.

To transform the bacterial strain, a competent E. coli BL21 (DE3) tube is thawed on ice. In a pre-cooled tube, 1 μΙ of plasmid pET24b / PDGF-B and 20 μΙ of competent bacteria are deposited. After 5 minutes incubation on ice, a thermal shock is achieved by incubation at 42 ° C for 30 seconds. The tube is immediately cooled on ice for 2 minutes before addition of culture medium containing 97% (v / v) of YES medium (30 g / L Yeast Extract and 5 g / L NaCl), 2% (v / v). glucose and 1% (v / v) MgCl ₂ . The bacteria are incubated for 1 h at 37 ° C. with stirring at 270 rpm and then placed on a Petri dish containing YES Agar medium and 100 mg / ml of Kanamycin. The dish is incubated for 16 hours at 37 ° C. A colony is then isolated. b. Manufacture of a pre-Master Cell Bank

A colony of E.coli BL21 (DE3) transformed with pET24b / PDGF-B isolated on a petri dish of Example 1.1. a is inoculated into 250 ml of YES medium containing 50 mg / ml of kanamycin. The operation is repeated a second time. The two flasks are then incubated at 37 ° C. with stirring (270 rpm) and the optical density at 600 nm is followed until an optical density greater than 1 is obtained.

One of the cultures is selected and centrifuged for 30 minutes at 5020 g at 4 ° C. The pellet is resuspended in 100 ml of YES medium containing 15% glycerol. The resulting library is aliquoted with 1 ml into cryocongeal tubes and stored at 4 ° C for further analysis and use.

[000192] The analyzes making it possible to characterize this bank are as follows:

Colony count on box

[000193] Successive dilutions of the pre-Master Cell Bank are performed after thawing a tube. These dilutions are analyzed on petri dishes without antibiotics. One milliliter of the library is first diluted in 9 ml of sterile 0.9% NaCl. The cell suspension was diluted successively by repeating the same operation to obtain higher dilution factor 10 ^"7. 100 gl of these dilutions are then deposited on a Petri dish containing agar medium YES to obtain boxes containing 10 at 300 colonies After incubation overnight at 37 ° C., the number of colonies (CFU) corresponding to a defined dilution is evaluated in each dish containing between 10 and 300 colonies.The microbial titre (CFU / ml) is then calculated in multiplying the number of colonies on the dish by the dilution factor In the case of the pre-Master Cell Bank of the example, the titre is 3.89 10 ⁸ CFU / mL.

[000194] The cell membrane of the bacteria is stained in violet with crystal violet oxalate. After fixation and discoloration by alcohol-acetone, the bacteria of the cell bank E.coli BL21 (DE3) / pET24b PDGF-B become pink confirming that these bacteria are gram-negative.

Microscopic observation

The bacteria of E. coli / BL21 (DE3) pET24b / PDGF-B colonies appear in the form of small rods with sometimes longer rods, forms compatible with E. coli strain bacteria.

The colonies are circular in shape, cream-colored, shiny, convex and without heterogeneity, as expected for this type of bacteria.

Plasmid stability

[000197] The plasmid stability is determined by successive flask cultures in YES medium and without antibiotics for approximately 100 generations. At each transfer, a sample is diluted and put on a box in order to obtain individual colonies. 100 colonies are then transferred to plates with and without kanamycin (100 mg / ml). The ratio between the number of colonies growing on the box containing the antibiotic and the one not containing the antibiotic gives the percentage of plasmid stability.

Table 1: Plasmidic stability versus number of generations for the pre-

Master Cell Bank E.coli / BL21 (DE3) pET24b / PDGF-BB

Double strand sequencing

The gene sequence coding for PDGF-B inserted into plasmid pET24b is monitored using "primers" directed against the 17 promoter and terminator sequences located on plasmid pET24b.

Primers used:

17 prom: 5'-TAA-TAC-GAC-TCA-CTA-TAG-GG-3 '(SEQ ID NO: 5)

17 term: 5'-CTA-GTT-ATT-GCT-CAG-CGG-T-3 '(SEQ ID NO: 6)

[000199] The results obtained demonstrate that the sequence of the two strands obtained corresponds well to that of the cDNA of PDGF-B described in SEQ ID NO: 4. vs. Production of PDGF-BB by fermentation under IPTG control

From this pre-Master Cell bank, a Master Cell Bank and a Working Cell Bank are obtained and characterized according to the same type of criteria.

[000201] The fermentation described below can be adapted to different scales depending on the necessary amounts of protein. In this example, the fermentation is carried out on a 50L reactor. Two vials of E.coli / BL21 (DE3) pET24b / PDGF-BB Working Cell Bank were thawed and each inoculated into 500 mL of antibiotic-free YEGP medium in 2L flasks. After incubation for approximately 6 h at 37 ° C. with stirring (270 rpm), an optical density at 600 nm of between 1 and 3 is obtained.

One of the cultures is chosen to inoculate a 50L fermenter containing 42 L of medium PPM. The growth of the bacteria is carried out under Fed batch control of glucose up to an optical density of between 45 and 55. The induction of PDGF-B production is then carried out by adding 1 mM IPTG for 5 hours. The overexpressed PDGF-B is found in the inclusion bodies of the bacteria and these bacteria are then harvested and centrifuged. d- Purification of PDGF-BB

[000203] The bacteria containing PDGF-B are then harvested and centrifuged. After resuspension, they are homogenized and centrifuged to remove cell debris and harvest inclusion bodies containing PDGF-BB. The latter are washed and then centrifuged and frozen for further purification.

[000204] A purification method consists in resuspending PDGF-B in a buffer containing urea, guanidium hydrochloride or guanidinium thiocyanate in order to denature these inclusion bodies. After filtration, the denatured PDGF-B can be purified by reverse phase chromatography by loading on a Source RPC resin and eluting in a mobile phase containing acetonitrile.

The PDGF-B thus purified can be renatured by dilution in a renaturation medium containing agents favorable to renaturation, such as a Tris-type buffer, an Arginine salt, and a mixture of oxidizing and reducing agent, such as glutathione reduced and oxidized. After dilution, the PDGF-B folds and dimerizes to PDGF-BB to adopt a dimeric three-dimensional structure allowing it to be active. Three intra-chain disulfide bridges and two inter-chain bridges are also formed. The folded PDGF-BB is then purified in particular by cation exchange chromatography before being diafiltered against its storage buffer and stored frozen. Example 1.2: Preparation of PDGF-BB by bacterial route

[000206] PDGF-BB is obtained by a "bacterial route" method as follows:

1. cloning of PDGF-BB in a plasmid under the control of the T7 promoter and containing the Ampicillin resistance gene,

2. transformation of bacteria similar to BL21 DE (3) and constitution of cell banks,

3. fermentation and induction by adding isopropyl β-D-1-thiogalactopyranoside, or IPTG abbreviated to this, before harvesting the cells,

4. Cell lysis and purification of the inclusion bodies,

5. denaturation of the inclusion bodies and purification of the denatured PDGF-B by reverse phase chromatography, then folding and dimerization by dilution in a Tris-EDTA buffer, and finally

6. Final diafiltration against the storage buffer of the protein.

Examples 2 Synthesis of Functionalized Polysaccharides

Example 2.1 Synthesis of L-Tryptophan Substituted Sodium Dextranemethylcarboxylate According to Method 1 (Functionalized Polysaccharide 1)

Sodium dextranmethylcarboxylate derived from a dextran with a weight average molar mass of approximately 40 kg / mol (Pharmacosmos) and with a degree of substitution of hydroxyl functional groups with sodium methylcarboxylate functions of 1.16 per saccharide unit is synthesized according to the methods described in patent applications WO99 / 29734, WO2010 / 041119 or FR12 / 60808.

The sodium dextranmethylcarboxylate solution is passed through Purolite resin (anionic) to obtain the acidic dextran-methylcarboxylic acid which is then lyophilized for 18 hours.

150 g of dextranmethylcarboxylic acid (0.76 mol methylcarboxylic acid function) are solubilized in DMF and then cooled to 0 ° C. Once the polymer solution at 0 ° C, 84.5 g (0.83 mol) of N-methylmorpholine (NMM) and 90.6 g (0.83 mol) of ethylchloroformate (EtOCOCI) are then added. After 10 minutes of reaction, 66.8 g (0.33 mol) of L-tryptophan (Roth) are added. The medium is then maintained at 10 ° C. for 30 minutes. The medium is then heated to 30 ° C. At 20 ° C, an aqueous solution of imidazole (103.4 g, 1.52 mol) is added. The solution is purified by diafiltration on a 10 kD PES membrane against NaCl (0.9%), NaOH (0.01N), and water. The concentration of the polysaccharide solution is determined by dry extract. According to the dry extract: [functionalized polysaccharide 1] = 41.3 mg / g

According to the UV analysis: the degree of substitution of methylcarboxylic acids modified with L-tryptophan per saccharide unit is 0.45.

Example 2.2 Synthesis of L-Tryptophan Substituted Sodium Methyl Carboxylate Starch 2-hydroxyethyl Ether According to Method 1 (Functionalized Polysaccharide 3)

A 2-hydroxyethyl starch ether sodium methylcarboxylate from a 2-hydroxyethyl starch ether (CAS 9005-27-0, weight average molar mass of about 70 kg / mol, degree of substitution in 0.4 hydroxyethyl, Serumwerk) with a degree of substitution of hydroxyl functions by sodium methylcarboxylate functions of 1.14 per saccharide unit is synthesized according to the methods described in patent applications WO99 / 29734, WO2010 / 041119 or FR12 / 60808.

By a process similar to that described for the preparation of the functionalized polysaccharide 1, a sodium 2-hydroxyethyl ether of sodium methylcarboxylate starch substituted with L-tryptophan is obtained.

[000213] According to the dry extract: [functionalized polysaccharide 3] = 21.3 mg / g

According to UV analysis: the degree of substitution of methylcarboxylic acids modified with L-tryptophan per saccharide unit is 0.40. Comparative Example 2.3: Synthesis of L-Tryptophan Substituted Sodium Dextranemethylcarboxylate According to Method 2 (Functionalized Polysaccharide 2)

[000215] A sodium dextranethylcarboxylate derived from a dextran with a weight average molar mass of approximately 40 kg / mol (Pharmacosmos) and with a degree of substitution of the hydroxyl functions by sodium methylcarboxylate functions of 1.03 per saccharide unit is synthesized according to the methods described in patent applications WO99 / 29734, WO2010 / 041119 or FR12 / 60808.

The sodium dextranmethylcarboxylate solution is passed through Purolite resin (anionic) to obtain the acidic dextranethylcarboxylic acid which is then lyophilized for 18 hours.

[000217] 135.1 g of acid dextranemethylcarboxylic acid (0.675 mol acid methylcarboxylic function) are solubilized in DMF and then cooled to 0 ° C. After the polymer solution at 0 ° C, 68.3 g (0.675 mol) of NMM and 73.2 g (0.675 mol) of EtOCOCI are added. After 10 minutes, 62 g (0.30 mol) of L-tryptophan (oth) is added. The medium is then maintained at 10 ° C. for 30 minutes. The medium is then heated to 30 ° C. At 20 ° C an aqueous solution of imidazole (91.9 g, 1.35 mol) is added to the medium. The solution is purified by diafiltration on a 10 kD PES membrane against NaCl (0.9%) and then with water. The concentration of the polysaccharide solution is determined by dry extract.

[000218] According to the dry extract: [functionalized polysaccharide 2] = 39.4 mg / g

According to UV analysis: the degree of substitution of methylcarboxylic acids modified with L-tryptophan per saccharide unit is 0.41.

The degree of radical substitution -F-R-G-Trp is determined by UV analysis at 280 nm according to the following method.

[000221] The mass concentration of the mother solution to be analyzed is determined by loss on desiccation. The solution is then diluted to a concentration of 0.1 mg / g and the absorbance of the diluted solution is measured by UV spectrometry at 280 nm. The molar amount (mmol) of -Trp per g of functionalized polysaccharide (t _Trp ) is then determined by applying the Beer-Lambert law using the molar extinction coefficient of acetyl tryptophan. The degree of radical substitution -F-RG-Trp is then obtained by the following formula:

_, t _Trp x (162 + DS _carboxylate x 80)

J ~ 1000 (1 - (t _Trp ) / (1000 x 186)

_Trp with t being the molar amount (mmol) of Trp per g of functionalized polysaccharide and DS boxyiate _because the degree of carboxylate substitution before grafting tryptophan Comparative Example 2.4: Synthesis of sodium dextran substituted with ethyl ester of L-tryptophan (functionalized polysaccharide 4)

Sodium dextranmethylcarboxylate derived from a dextran with a weight average molar mass of approximately 40 kg / mol (Pharmacosmos) and with a degree of substitution of hydroxyl functional groups with sodium methylcarboxylate functions of 1.07 per saccharide unit is synthesized according to the methods described in patent applications WO99 / 29734, WO2010 / 041119 or FR12 / 60808.

200 g of dextranmethylcarboxylic acid (0.955 mol methylcarboxylic acid function) are solubilized in DMF and then cooled to 0 ° C. Once the polymer solution at 0 ° C, 96.61 g (0.955 mol) of NMM and 103.75 g (0.955 mol) of EtOCOCI are added. To a solution of 107.95 g (0.401 mol) of L-tryptophan ethyl ester hydrochloride salt (Bachem) in DMF is added 55.9 ml (0.401 mol) of triethylamine. After stirring for 10 minutes, the ethyl ester solution of L-tryptophan is added. 133 mL (0.95 mol) of triethylamine are added to the reaction medium which is maintained at 10 ° C. for 45 minutes. At 20 ° C, an aqueous solution of imidazole (376.8 g, 5.5 mol) is added to the reaction medium and the pH is adjusted to 8 by addition of 1N sodium hydroxide. The solution is purified by diafiltration on a 10 kD PES membrane against NaCl (0.9%) and then with water. The concentration of the polysaccharide solution is determined by dry extract. The degree of substitution of methylcarboxylic acids modified with ethyl ester of L-tryptophan per saccharide unit is 0.47 according to the MN ¹ H in D ₂ 0.

polvsaccharides 1 and 2 functionalized with L-Trvptophane

A functionalized polysaccharide 1 prepared according to Example 2.1 and a functionalized polysaccharide 2 prepared according to Example 2.3 are analyzed to determine the amount of residual mixed anhydrides present on the polysaccharide. The amount of residual mixed anhydrides present on the polysaccharide was determined by assaying the ethanol formed following the hydrolysis in basic medium of the latter. The ethanol formed is assayed by gas chromatography with flame ionization detection (GC-FID).

[000225] The free ethanol resulting from the grafting reaction and remaining in trace form in the polysaccharide solution is first metered.

The mixed anhydrides present on each polysaccharide are then hydrolysed by adding 10 N sodium hydroxide (10 μl in 500 μl of polysaccharide solution) which leads to the formation of ethanol which is determined by GC-FID.

[000227] To determine the amount of ethanol before and after treatment by adding sodium hydroxide to the polysaccharide solution, the following protocol is used.

From each polysaccharide solution before and after treatment by addition of sodium hydroxide, five solutions are prepared. These solutions contain the same concentration of polysaccharide, a concentration of internal standard

(isopropanol) of 20 μg per g of solution, and an added ethanol concentration of 5,

10, 20, 40 and 80 μg per g of solution.

These solutions are then filtered using a centrifuge filter (cutoff threshold of 10 kD) for 45 minutes at 5000 g to remove the polysaccharide.

The ethanol recovered in the filtrate is assayed by GC-FID with direct injection using a temperature gradient starting at 40 ° C for 1 minute, then an increase of 20 ° C per minute up to 260 ° C. The ethanol concentration is calculated by the method of additions dosed with internal standard.

[000232] Results: 34 μg of ethanol per g of functionalized polysaccharide 1 and 357 μg of ethanol per g of functionalized polysaccharide 2 were measured in the functionalized polysaccharide 1 and functionalized polysaccharide 2 solutions, respectively.

After addition of sodium hydroxide to the solution of each of the polysaccharides, 1774 μg of ethanol per g of functionalized polysaccharide 1 and 4823 μg of ethanol per g of functionalized polysaccharide 2 were measured.

By difference, it is deduced that the residual anhydrides present on the polysaccharide led by addition of sodium hydroxide to the formation of 1740 μg of ethanol per g of functionalized polysaccharide 1 and 4466 μg of ethanol per g. functionalized polysaccharide 2.

[000235] Knowing that the average molar mass of the polysaccharide unit used in this assay is respectively 339 g / mol for the functionalized polysaccharide 1 and 302 g / mol for the functionalized polysaccharide 2, the results expressed in molar percentage of anhydrides. Residual mixtures present on the polysaccharides are collated in Table 2 below.

Table 2: Results of the quantification of the residual mixed anhydrides present on the polysaccharides.

EXAMPLES 4 Preparation of a RhPDGF-BB / Polysaccharide Formulation Example 4.1 Preparation of a Formulation Comprising 0.25 mg / mL of rhPDGF-BB and 12.5 mg / mL of Functionalized Polysaccharide 1 (Formulation

1)

Formulation 1 (the final composition of which is specified in Table 3 below) is prepared by mixing 1 L of a functionalized polysaccharide solution 1 at 25 mg / mL, 20 mM sodium phosphate, 300 mOsm / kg, pH 7.2 and 1 L of a solution of rhPDGF-BB at 0.5 mg / mL, 300 mOsm / kg as prepared below. The functionalized polysaccharide solution 1 at 25 mg / ml is prepared from lyophilized functionalized polysaccharide 1 (synthesized according to Example 1). For this, 28 g of functionalized polysaccharide lyophilisate 1 are redissolved with 750 g of 20 mM sodium phosphate buffer solution, pH 7. The pH of the functionalized polysaccharide solution 1 is then adjusted to 7.2 by 1.5. 1M sodium hydroxide solution. The osmolality is adjusted to 300 mOsm / kg by addition of 20 g of a 30% (w / v) sodium chloride solution. Finally, the functionalized polysaccharide solution 1 is diluted to 25 mg / ml by adding 216.8 g of a 20 mM sodium phosphate solution, 300 mOsm / kg, at pH 7. 1 L of a functionalized polysaccharide solution 1 to 25 mg / mL, 20 mM sodium phosphate, 300 mOsm / kg, pH 7.2 is thus obtained.

Alternatively, the functionalized polysaccharide solution 1 at 25 mg / mL may be directly prepared from a sufficiently concentrated solution of functionalized polysaccharide 1, 200 mM sodium phosphate buffer pH 7 and a chloride solution. 30% sodium (w / v).

The solution of rhPDGF-BB at 0.5 mg / mL is prepared from 198.5 g of a filtered solution of rhPDGF-BB obtained according to Example 2 at 2.56 mg / mL by addition of 829.5 g of sodium chloride 0.9% (w / v). IL of a solution of rhPDGF-BB at 0.5 mg / mL, 300 mOsm / kg is thus obtained.

Formulation 1

rhPDGF-BB (0.25 mg / mL)

Polysaccharide 1 (12.5 mg / mL)

Ta m po n sod i u m p h osp h ate (10 m M)

Sodium chloride (0.8% w / v) _

Sodium hydroxide (0.5 mM)

Water

Table 3: Formulation 1 Example 4.2: Preparation of variants of Formulation 1

The rhPDGF-BB / functionalized polysaccharide formulation 1 can also be prepared at concentrations of rhPDGF-BB and functionalized polysaccharide 1 which are different from those according to Example 4.1. A rhPDGF-BB (1 mg / mL) / functionalized polysaccharide 1 (50 mg / mL) formulation is, for example, prepared by mixing 1 L of a solution of polysaccharide functionalized at 100 mg / mL, sodium phosphate 20 m, 300 mOsm / kg, pH 7.2 and 1 L of a solution of rhPDGF-BB at 2 mg / mL, 300 mOsm / kg.

Formulation 1 (prepared according to Example 4.1) can also be prepared by replacing the sodium phosphate buffer with a hydrochloride salt buffer of Tris (hydroxylmethyl) aminomethane (Tris), or with a potassium phosphate buffer.

Formulation 1 (prepared according to Example 4.1) can also be prepared by replacing the sodium chloride with one or more other tonicity agents eg potassium chloride, mannitol, sorbitol, glycerin, dextrose, sucrose, trehalose and / or or maltose.

Formulation 1 (prepared according to Example 4.1) can also be prepared by replacing the sodium hydroxide with another pH adjusting agent eg sodium citrate, diethanolamine, sodium sulfate, ammonium sulfate, potassium hydroxide or sodium borate.

Tables 4 and 5 below show examples of formulations according to the invention.

Table 4: Formulations 2 to 5 Formulation 6 Formulation 7 Formulation 8 Formulation 9 rhPDGF-BB (0.37 rhPDGF-BB (0.50 rhPDGF-BB (0.37 rhPDGF-BB (0.50 mq / mL) mg / mL) mg / mL mg / mL ml)

Polysaccharide Polysaccharide Polysaccharide Functionalized Polysaccharide 1 (18.5 functionalized 1 (functionalized 1 functionalized 1 (50 mq / mL) mg / mL) (18.5 mg / mL) mg / mL

Sodium buffer Potassium buffer Potassium buffer Potassium phosphate buffer (10 mM) phosphate (10 mM) phosphate (10 mM) phosphate (10 mM)

Sodium Chloride Sodium Chloride Sodium Chloride Sodium Chloride (0.8% w / v) (0.8% w / v) (0.45% w / v) (0.45% w / v)

Sodium Hydroxide Sodium Hydroxide Hydroxide Hydroxide (0.7 mM) (1.0 mM) Sodium (0.7 mM) Sodium (1.0 mM)

Water Water Water Water

Table 5: Formulations 6 to 9 Comparative Example 5; Pr aration of a formulation rtlPMF-

PP / PiYSaÇc andefunctionalized

A formulation comprising 0.25 mg / ml of rhPDGF-BB and 12.5 mg / ml of functionalized polysaccharide 2 (Formulation A), see Table 6, is prepared according to the same protocol as that described in Example 4.1.

Formulation A

rhPDGF-BB (0.25 mq / mL)

Functionalized Polysaccharide 2 (12.5

JSaZmt) _ _ _,

Sodium phosphate buffer (10 mM)

Sodium Chloride (0.8% w / v)

Sodium hydroxide (0.5 mM)

Water

Table 6: Formulation A Example 6; In the case of stability, women have been shown to be

PB / P <? LYsaççharjt | ¾ fonç¾i9npa | jsé,

The stability of the rhPDGF-BB / polysaccharide formulations is determined by measurement of ED _5C , ie rhPDGF-BB concentrations necessary to obtain 50% of the maximum mitogenic activity, compared to the activity of the formulation at 100.degree. = 0 stored at -80 ° C.

The stability of the formulations was tested at 30 ° C and 40 ° C over a period of up to 3 months or 6 months with several intermediate measurements.

HDFα cells (Human Dermal Fibroblasts Adults, Life Technologies) are cultured in a flask of 75 cm ² (Dutscher) in culture medium MEM alpha (Minimum Essential Medium Eagle alpha, Life Technologies) supplemented with 10% of FCS (Serum of Fetal Calf, Sigma) until they are between passages 2 and 8.

At J1, the culture medium is removed and the cells washed with PBS (Phosphate Buffered Saline; Life Technologies) at the rate of 10 ml of PBS per flask. The cells are detached with trypsin (Life Technologies) at a rate of 1mL of trypsin per flask for 3 minutes at room temperature. The detachment of the cells is checked under a microscope. The action of trypsin is stopped by adding 9mL of MEM alpha culture medium supplemented with 10% FCS. The cells are counted on Malassez cell. The number of cells per flask must be between 2 and 4 million.

The cells are centrifuged at 365 g for 5 minutes at room temperature. The supernatant is removed and the cell pellet is taken up with MEM alpha culture medium supplemented with 0.5% FCS at the rate of 100000 cells per ml. 100 μl of the resumed pellet are then distributed per well of a 96-well cell culture plate (Dutscher).

At day 2, the HDFα cells are activated with the various rhPDGF-BB / polysaccharide formulations. For each formulation, temperature and kinetic time to be analyzed, a range prepared from the incubated formulation at the desired temperature and time is deposited on the same plate as well as a range of the same formulation stored at -80 ° C. for the time t = 0.The ranges are carried out according to the following procedure:

[000250] A dilution range of two in two (rhPDGF-BB concentrations ranging from 250 ng / ml to 0.5 ng / ml) of each rhPDGF-BB / polysaccharide formulation (Formulation 1 and Formulation A) is carried out in alpha MEM medium containing 0.5% FCS. 25 μl of each dilution are then added to the wells of the culture plate prepared in duplicate. Controls containing no rhPDGF-BB are also deposited on the plates (ie negative control: culture medium ME alpha 0.5% final SVF, positive control: MEM alpha 10% final FCS). The plates are then incubated for 2 hours at 37 ° C. under an atmosphere containing 5% CO ₂ . 12.5 μl of BrdU solution (bromodeoxyuridine, supplied in the BrdU ELISA Cell proliferation kit, Roche Applied Science) diluted 1/100 in MEM medium alpha supplemented with 0.5% of FCS are then added per well. The plates are then incubated for 22 h at 37 ° C. under an atmosphere containing 5% CO ₂ .

At J3, the incorporation of BrdU is revealed: The BrdU solution diluted in culture medium is removed. 200pL of Fix Denat solution (supplied in the ELISA Kit) are deposited per well. After incubation for 30 minutes at room temperature, Fix Denat solution is removed. The anti-BrdU-POD stock solution (provided in the ELISA Kit and prepared by reconstituting the anti-BrdU POD lyophilisate in 1.1 mL of double-distilled water for 10 min with stirring) is extemporaneously diluted to 1/100 in 10 mL of water. Antibody Dilution Solution (provided in the ELISA kit). 100 μl of diluted anti-BrdU-POD solution are deposited per well. After incubation for 1 hour and 30 minutes at room temperature, the anti-BrdU-POD solution is removed. Four successive washes are then performed by dispensing and then removing 250 μl of 0.06% PBS-Tween per well. Substrate Component B (provided in the ELISA Kit) is then extemporaneously diluted 1/100 with Substrate Component A (provided in the ELISA Kit). 100 μl of the substrate solution obtained are deposited per well. An opaque film is placed on the bottom of the plate. Within 15 minutes of adding the substrate solution, the luminescence is measured with an EnVision plate reader (Perkin Elmer) and an integration time of 900ms.

The ED ₅₀ are calculated for each rhPDGF-BB / polysaccharide formulation and each time and temperature after a non-linear 4-parameter regression by the residual least squares method using Excel (Microsoft) software.

The percentage of activity at time t with respect to the activity at t = 0 is calculated by the ratio of ED ₅₀ of time t = 0 divided by ED ₅₀ at time t multiplied by 100.

The stability results for Formulation 1 prepared with functionalized polysaccharide 1 in comparison with Formulation A prepared with functionalized polysaccharide 2 are shown in FIG. 4 (stability at 30 ° C.) and FIG. 5 (stability at 40 ° C. ).

In FIGS. 4 and 5, the abscissae represent the time in months and the ordinates the residual activity of the PDGF-BB relative to the time t = 0 in%. The dotted curves correspond to formulation 1 and solid curves correspond to formulation A.

[000257] It is clearly demonstrated that the stability of the formulation 1 comprising a functionalized polysaccharide whose residual mixed anhydride content is less than 2% is improved compared to the formulation A according to the prior art.

Example 7 Use of a Formulation According to the Invention in the Treatment of Chronic Wounds

The composition is a topical formulation comprising recombinant PDGF-BB in the form of a solution to be applied to the wound, by means of a device comprising a container equipped with pump-type dispensing means.

The administration is carried out by positioning the nozzle of the sprayer about 1.8 cm from the wound.

[000260] This distance is substantially respected thanks to a removable device which is fixed on the bottle and which allows to be at the appropriate distance between the sprayer and the wound. This device, removable, is polypropylene.

Formulation 1 described in Example 4.1 is a sterile, clear and colorless solution which contains 0.25 mg / ml of rh PDGF-BB and 12.5 mg / ml of functionalized polysaccharide 1.

The container carrying a sprayer is filled with 2.2 ml of solution.

[000263] The administration and application scheme is as follows:

The wound is dried with a sterile gauze before the application of the composition according to the invention. The bottle is held vertically to allow vaporization. Before first use, the spray device must be activated several times in order to properly initiate the spraying.

Administration of the desired amount per unit area is accomplished via one (1) spraying of the composition at about 1.8 cm of the wound with a composition amount of 53 μl spray. Several sprays are performed when necessary to cover the entire surface of the wound.

The composition present on the healthy skin is carefully wiped, however the composition which has been sprayed on the wound, is neither wiped nor buffered. The container is used until more than six weeks after the first use.

[000267] Then a dressing, in particular a semi-permeable dressing, is placed so as to cover the wound. [000268] These steps (with the exception of the priming of the device which must only be performed during the first use) are repeated every two days until closure of the wound or for at most 20 weeks.

This protocol allows the application of the following dosage: delivery of a 4.2 μg / cm ² dose of rhPDGF-BB every two days after debridement of the wound or cleaning thereof.

Example 8 Effect of Functionalized Polysaccharides on the Stability of RhPDGF-BB in the Presence of Cells

As shown in Example 6, the activity of PDGF-BB can be measured by measuring its mitogenic effect on human dermal cells by measuring ED ₅₀ , i.e. rhPDGF-BB concentrations required to achieve 50% of maximal mitogenic activity. Here we compared the activity of rh PDGF-BB in the presence of functionalized polysaccharides with that of rhPDGF-BB alone after a 24-hour exposure.

HDFα cells (Human Dermal Fibroblasts Adults, Life Technologies) are cultivated in a 75 cm ² (Dutscher) flask in an EM alpha culture medium (Minimum Essential Eagle Medium alpha, Life Technologies) supplemented with 10% FCS (Serum). of Fetal Calf, Sigma) until they are between passages 2 and 8.

At 31, the culture medium is removed and the cells washed with PBS (Phosphate Buffered Saline; Life Technologies) at the rate of 10 ml of PBS per flask. The cells are detached with trypsin (Life Technologies) at a rate of 1 mL of trypsin per flask for 3 minutes at room temperature. The detachment of the cells is checked under a microscope. The action of trypsin is stopped by adding 9mL of MEM alpha culture medium supplemented with 10% FCS. The cells are counted on Malassez cell. The number of cells per flask must be between 2 and 4 million.

[000273] The cells are centrifuged at 365 g for 5 minutes at room temperature. The supernatant is removed and the cell pellet is taken up with MEM alpha culture medium supplemented with 0.5% FCS at the rate of 100000 cells per ml. 100 μl of the resumed pellet are then distributed per well of a 96-well cell culture plate (Dutscher).

At day 2, the HDFα cells are activated with the various functionalized rhPDGF-BB / polysaccharide formulations. For each formulation, a range prepared from the formulation containing the desired polysaccharide and a range of PDGF-BB alone is deposited on the same plate. The ranges are made according to the following procedure: [000275] A PDGF-BB solution obtained according to Example 1 is diluted to 250 ng / ml in MEM alpha medium containing 0.1% BSA and 3 μg / ml of the functionalized polysaccharide of interest. A two-fold dilution range (rh PDGF-BB concentrations ranging from 250 ng / mL to 0.5 ng / mL) of each functionalized rhPDGF-BB / polysaccharide formulation was performed in 0.1 alpha MEM medium. % BSA and 3 μg / ml of the same functionalized polysaccharide. In the case of the PDGF-BB formulation alone, the dilution medium does not contain a polysaccharide. 25 μl of each dilution are then added to the wells of the culture plate prepared at Jl in quadruplicates.

Controls containing no rhPDGF-BB are also deposited on the plates (i.e. negative control: culture medium MEM alpha 0.1% BSA, positive control: MEM alpha 10% FCS).

The plates are then incubated for 4 hours at 37 ° C. under an atmosphere containing 5% of C0 ₂ . 12.5 μl of BrdU solution (bromodeoxyuridine, supplied in the BrdU ELISA Cell proliferation kit, Roche Applied Science) diluted 1/100 in MEM medium alpha supplemented with 0.5% of FCS are then added per well. The plates are then incubated for 20 hours at 37 ° C. under an atmosphere containing 5% CO ₂ .

At J3, the incorporation of BrdU is revealed: The BrdU solution diluted in culture medium is removed. 200pL of Fix Denat solution (supplied in the ELISA Kit) are deposited per well. After incubation for 30 minutes at room temperature, Fix Denat solution is removed. The anti-BrdU-POD stock solution (provided in the ELISA Kit and prepared by reconstituting the anti-BrdU POD lyophilisate in 1.1 mL of double-distilled water for 10 min with stirring) is extemporaneously diluted to 1/100 in 10 mL of water. Antibody Dilution Solution (provided in the ELISA kit). 100 μl of diluted anti-BrdU-POD solution are deposited per well. After incubation for 1 hour and 30 minutes at room temperature, the anti-BrdU-POD solution is removed. Four successive washes are then performed by dispensing and then removing 250 μl of 0.06% PBS-Tween per well. Substrate Component B (provided in the ELISA Kit) is then extemporaneously diluted 1/100 with Substrate Component A (provided in the ELISA Kit). 100 μl of the substrate solution obtained are deposited per well. An opaque film is placed on the bottom of the plate. Within 15 minutes of adding the substrate solution, the luminescence is measured with an EnVision plate reader (Perkin Elmer) and an integration time of 900 ms.

The ED _50s are calculated for each rhPDGF-BB / polysaccharide or rhPDGF-BB formulation alone after a non-linear 4-parameter regression by the residual least squares method using Excel (Microsoft) software. The ratio of rh PDGF-BB activity in the presence of the polysaccharide relative to that of rhPDGF-BB alone is calculated by the ED ₅₀ ratio of PDGF-BB alone divided by the ED ₅₀ of the formulation. rhPDGF-BB / functionalized polysaccharide.

The ratios thus calculated for PDGF-BB in the presence of the functionalized polysaccharide 2 or the functionalized polysaccharide 4 are shown in Table 7.

Table 7 [000282] These ratios demonstrate that over 24 hours, rhPDGF-BB in the presence of functionalized polysaccharide 2 is more active than PDGF-BB in the presence of functionalized polysaccharide 4 which is itself more active than PDGF-BB. alone. This reflects the better stability of the rhPDGF-BB in the presence of the functionalized polysaccharide 2 compared to the functionalized polysaccharide 4. This stability over 24 hours in the presence of dermal cells is close to the conditions of use.

Claims

45 CLAIMS

A composition, in the form of an aqueous solution, comprising at least one functionalized polysaccharide and a PDGF-BB, characterized in that said functionalized polysaccharide comprises a residual mixed anhydride content of less than 2%, and is chosen from functionalized polysaccharides of formula I below:

Formula I

R, linker, being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally in saturated and / or possibly including one or more ring (s) and / or one or more heteroatom (s) chosen among O, N and S

Trp being a residue of tryptophan, L and / or D, produces a coupling between the friendly function of tryptophan and a carboxylic acid function carried by the precursor of the radical R,

R 1 being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally in saturated and / or possibly containing one or more ring (s) and / or one or more heteroatom (s) chosen from O, N and S 46

• Fi being a resultant function of the coupling between the precursor of the R _x radical and an alcohol function of the polysaccharide, F _t being chosen from ether, ester or carbamate functions,

I, ranging between 0.1 and 1.8, representing the degree of substitution of -IF-R COOX per saccharide unit,

I + j being between 0.5 and 2,

X representing a cation, and

2. Composition according to claim 1, characterized in that the polysaccharide before substitution by the substituents -IF-Ri-COOX and -F-R-G-Trp is chosen from the group of dextrans.

3. Composition according to any one of claims 1 or 2, characterized in that the functionalized polysaccharide is selected from the group consisting of the functionalized dextrans, arbitrarily illustrated, by the formula II, hereinafter:

Formula II in which:

each group L independently represents -OH, -FRG-Trp, or -Fi-R-COOX, with F, R, G, Trp, F ₁₇ R _lf and X, having the definitions given for Formula I,

the degrees of substitution in -F-R-G-Trp, and in -Fi-Ri-COOX, respectively called i and j, having the values given for Formula I, and

the dextrans have a weight average molar mass of between 1 kg / mol and 500 kg / mol.

4. Composition according to any one of claims 1 to 3, characterized in that i is between 0.2 and 1.2. 47

5. Composition according to any one of claims 1 to 4, characterized in that j is between 0.3 and 0.7.

6. Composition according to any one of claims 1 to 5, characterized in that i + j is between 0.6 and 1.7.

7. Composition according to any one of claims 1 to 6, characterized in that the radical R comprises between 1 and 10 carbon atoms, and is a chain, optionally branched or substituted, optionally unsaturated and / or optionally comprising one or more cycle (s).

8. Composition according to any one of claims 1 to 7, characterized in that the radical R _t comprises between 1 and 10 carbon atoms, and is a chain, optionally branched or substituted, optionally unsaturated and / or optionally comprising one or several cycle (s).

9. Composition according to any one of claims 1 to 8, characterized in that the radicals R and R ± are identical.

10. Composition according to any one of claims 1 to 9, characterized in that the function F is an ether function.

11. Composition according to any one of claims 1 to 10, characterized in that the function F _L is an ether function.

12. Composition according to any one of Claims 3 to 11, characterized in that the functionalized polysaccharide is chosen from functionalized polysaccharides of Formula I in which:

F and Fi are ether functions,

R and R 1 are -CH ₂ - radicals.

13. Composition according to any one of claims 1 and 3 to 12, characterized in that the functionalized polysaccharide is selected from functionalized polysaccharides of Formula I or II, wherein the polysaccharide is a dextran, F and F _x are ether functions, and R and R _x are -CH ₂ - radicals. 48

14. Composition according to any one of Claims 1 and 3 to 13, characterized in that the functionalized polysaccharide is chosen from functionalized polysaccharides of Formula I or II, in which:

the polysaccharide is a dextran,

F and Fx are ether functions,

R and R 1 are radicals -CH ₂ -,

i is between 0.4 and 1.0,

- j is between 0.35 and 0.6

i + j is between 0.8 and 1.4 and

the residual mixed anhydride content is less than 1.5%.

15. Composition according to any one of claims 1 to 12, characterized in that the concentration of PDGF-BB is between 0.01 and 10 mg / ml.

16. Composition according to any one of claims 1 to 13, characterized in that the concentration of polysaccharide is between 0.1 and 150 mg / ml.

17. Composition according to any one of claims 1 to 14, characterized in that the polysaccharide / PDGF-BB ratio is between 10 and 200.

A pharmaceutical formulation comprising as an active ingredient a composition according to any one of claims 1 to 17.

19. Pharmaceutical formulation according to claim 18, characterized in that it further comprises an antioxidant agent being methionine.

20. Pharmaceutical formulation according to any one of claims 18 or 19 for its use as a medicament for promoting the healing of wounds.

21. Pharmaceutical formulation according to any one of claims 18 or 19, for its use as a medicament for promoting the healing of wounds in a dosage of between 1 and 25 μg / cm ² , at a frequency ranging from 1 to every two days, for a maximum of 20 weeks. 49

22. An assembly comprising a packaging and dispensing device (1) and a pharmaceutical formulation according to any one of claims 18 to 21 (7), said packaging and dispensing device (1) comprising

a container (2) comprising the pharmaceutical formulation (7),

- Pump type dispensing means (3) mounted on the container (2), said dispensing means (3) comprising spraying means (8) and retentive means for avoiding the reflux of the formulation in the container,

sealing means making it possible to prevent the passage of flows from the outside to the inside of the device, except via air inlet means making it possible to balance the internal pressure of the device with external pressure after each spraying, via a flow of air from outside, and

means for protecting the formulation against microbial contamination.

23. Process for preparing functionalized polysaccharides of Formula I below;

Formula I

Polysaccharides having a weight-average molar mass of between 1 kg / mol and 500 kg / mol, being chosen from the group consisting of dextrans and hydroxyethyl starches (HES)

R, linker, being a radical comprising between 1 and 10 carbon atoms, optionally branched or substituted, optionally in saturated and / or optionally comprising one or more ring (s) and / or one or more heteroatom (s) chosen among O, N and S

G being an amide function resulting from the coupling between a carboxylic acid function of the precursor of the linker R and the amine function of a tryptophan, 50

Trp being a residue of tryptophan, L and / or D, produced coupling between the amine function of tryptophan and a carboxylic acid function carried by the precursor of the radical R,

Fi being a resultant function of the coupling between the precursor of the radical R _x and an alcohol function of the polysaccharide, Fj. being chosen from ether, ester or carbamate functions,

i, ranging from 0.1 to 1.8, representing the degree of substitution of -IF-R-COOX per saccharide unit,

i + j being between 0.5 and 2,

X representing a cation, and

the carboxylic acid function of tryptopha not being in the form of X carboxylate

taking the following steps:

amidifi cation of at least a portion of the carboxylic acid functions of a polysaccharide selected from dextrans and HES functionalized with a radical carrying a free carboxylic acid function activated by formation of a mixed anhydride,

to reduce the residual mixed anhydride content to less than 2%, and

recovery of the functionalized polysaccharide of Formula I.