WO2016023514A1 - Method and formulation of preventing cell infection by mycoplasma hyorhinis - Google Patents

Abstract

Provided are a method and formulation of preventing cell infection by mycoplasma hyorhinis. The present invention provides uses of antagonists for mycoplasma hyorhinis membrane protein P37 or host cell membrane protein Annexin A2 in preparing a formulation for preventing cell infection by mycoplasma hyorhinis or promoting cell migration. The present invention has found that mycoplasma hyorhinis infects cells by interaction between 22 amino acid fragments at an amino terminal of the membrane protein P37 on the surface of mycoplasma hyorhinis and 25 amino acid fragments at an amino terminal of the cell membrane protein Annexin A2, such that anti-P37 antibodies, polypeptides at the amino terminal of the mycoplasma hyorhinis P37 or polypeptides at the amino terminal of Annexin A2, or anti-host cell membrane protein Annexin A2 antibodies can be used to prevent cell infection by mycoplasma hyorhinis.

Description

Method and preparation for preventing infection of cells of Mycoplasma hyorhinis Technical field

The present invention relates to a method and a preparation for preventing infection of cells of Mycoplasma hyorhinis, and in particular to the discovery that a 22-amino acid fragment of the amino acid terminal of the membrane protein P37 on the surface of the cell is infected with the cell membrane protein Annexin A2. Use of an antagonist of Mycoplasma hyopneumoniae membrane protein P37 or host cell membrane protein Annexin A2 for the preparation of a medicament for preventing infection of cells of Mycoplasma hyorhinis or cell migration, and a method for preventing cells or promoting cell migration of Mycoplasma hyorhinis.

Background technique

Mycoplasma belongs to the class of flexible membranes in prokaryotes. It is the smallest microbe that exists in nature and can replicate independently. Its size is about 0.1m. It can pass through the microporous membrane and exist on the membrane surface of host cells or endocytosis. Lo SC. Mycoplasmas and AIDS. In: Maniloff J, McElheney, RN, Finch LR, Baseman JB, editors. Mycoplasmas: molecular biology and pathogenesis. Washington, DC: Am Soc Microbiol Press; 1992. p. 525-45) . It is worth noting that more and more experimental data suggest that persistent chronic infection of mycoplasma has a certain correlation with tumor development (Namiki K, Goodison S, Porvasnik S, et al. (2009) Persistent Exposure to Mycoplasma Induces Malignant Transformation of Human Prostate Cells.PLoS ONE 4,e6872;Urbanek C,Goodison S,Chang M,et al.(2011)Detection of antibodies directed at M.hyorhinis p37 in the serum of men with newly diagnosed prostate cancer.BMC Cancer 11, 233; Yang H, Qu LK, Ma HC, et al. (2010) Mycoplasma hyorhinis infection in gastric carcinoma and its effects on the malignant phenotypes of gastric cancer cells. BMC Gastroenterol 10, 132). As early as 1965, Paton et al reported that oral mycoplasma can cause chromosomal abnormalities in human diploid cell line WI38 and induce cell transformation (Paton GR, Jacobs JP, Perkins FT. (1965) Chromosome changes in human Diploid-cell cultures Infected with mycoplasmas.Nature 207,43-45). In 1986, H. Kotani et al. found that extraordinary spiroplasma can mute transformation of murine NIH3T3 cells and monkey kidney CV21 cells (Kotani H, Phillips D, McGarrity GJ. Malignant transformation of NIH-3T3 and CV-1 cells by a helical mycoplasma , Spiroplasma mirum, strain SMCA. (1986) In Vitro Cell Dev Biol 22, 756-762). The researchers are more interested in the research work of Tsai et al. They infected the mouse embryonic cell line C3H10T1/2 with Mycoplasma fermentum and Mycoplasma, and the cells showed malignant changes after 11 weeks of infection. After 18 weeks of infection, the cells were able to Colonies were formed on soft agar and tumorigenic in nude mice (Tsai S, Wear DJ, Shih JW, et al. Mycoplasmas and oncogenesis: persistent infection and multistage malignant transformation. (1995) Proc Natl Acad Sci USA 92, 10197-10201) . In 2009, Namiki et al. found that persistent infection with Mycoplasma genitalium or Mycoplasma hyorhinis can increase the migration and invasion of BPH-1 in prostatic hyperplasia epithelial cells, cause abnormal karyotypes, and form tumors in nude mice (Namiki K, Goodison S, Porvasnik S, et al. (2009) Persistent Exposure to Mycoplasma Induces Malignant Transformation of Human Prostate Cells. PLoS ONE 4, E6872). These studies indicate that mycoplasma infection is closely related to the occurrence and development of tumors.

The inventor's laboratory was prepared in the 1980s by using tumor cell immunization to obtain a murine anti-tumor monoclonal antibody PD4 (Dong ZW, Wan WH, Li ZF, et al. A monoclonal antibodies PD4 against gastric Cancer cell line MGC803. (1985) Shengwu Huaxue Zazhi 2,52-58), but the subsequent antigen identification work found that the antigen corresponding to the monoclonal antibody PD4 is not from the tumor cells, but from the Mycoplasma hyorhinis, suggesting that the Mycoplasma hyorhinis may Tumor related. In 2001, Huang Su et al., the laboratory of the inventor, used PD4 to detect 600 tissue samples including gastric cancer and intestinal cancer tissue by immunohistochemical staining. The results showed that the antibody reacted positively with gastric cancer tissue. The rate was 56%, and the corresponding non-tumor tissue positive rates were: chronic superficial gastritis: 28%, benign gastric ulcer: 30%, intestinal epithelium: 37% (Huang S, Li JY, Wu J, et al. Mycoplasma infections in different human carcinomas. (2001) World J Gastroenterol 7, 266-269). It can be seen that there is a significant difference in the infection rate of Mycoplasma hyorhinis in gastric cancer and benign gastric diseases. The gastric cancer group is significantly higher than the benign gastric diseases, and the infection rate of Mycoplasma hyorhinis increases with the aggravation of the disease. These results suggest that the infection of Mycoplasma hyorhinis may be related to the disease and the development of the tumor. In addition, Cao Jun and others from the Fourth Military Medical University also used the same method to detect the infection of Mycoplasma hyorhinis in 95 cases of renal cell carcinoma, and found that 64.2% of the tissues were infected with Mycoplasma hyorhinis, and the surface protein p40 protein of Mycoplasma hyorhinis The results of expression analysis in different pathological types of renal cell carcinoma showed that there was no correlation between Mycoplasma hyorhinis infection and pathological types of human renal cell carcinoma (Cao Jun, Li Jianping, Cheng Wei, et al. P40 protein of Mycoplasma hyopneumoniae in renal cell carcinoma Expression and Significance. (2008) Journal of Xi'an Jiaotong University (Medical Edition) 29, 556-558). In 2010, Yang Hua et al. used PD4 to analyze the immunohistochemical staining of 61 gastric cancer tissue samples and 109 ovarian cancer tissue samples. The results showed that the infection rate of Mycoplasma hyorhinis in 45 gastric cancer specimens was 45.9%. Mycoplasma hyorhinis infection and Lymph node metastasis, Lauren typing and TNM staging of gastric cancer were positively correlated (Yang H, Qu LK, Ma HC, et al. (2010) Mycoplasma hyorhinis infection in gastric carcinoma and its effects on the malignant phenotypes of gastric cancer cells. BMC Gastroenterol 10,132 The infection rate of Mycoplasma hyorhinis in the ovarian cancer specimens was 43.1% (47/109).

Since there is a high rate of Mycoplasma hyorhinis infection in tumor tissues, what is the relationship between Mycoplasma hyorhinis infection and tumorigenesis? In 2009, Namiki et al reported that chronic infection with Mycoplasma hyorhinis can induce karyotypic abnormalities in BPH of benign prostatic hyperplasia cells, which ultimately leads to malignant transformation (Namiki K, Goodison S, Porvasnik S, et al. (2009) Persistent Exposure to Mycoplasma Induces Malignant Transformation of Human Prostate Cells. PLoS ONE 4, e6872). Mycoplasma hyorhinis can enhance the invasion of tumor cell lines and inhibit cell contact inhibition (Elkind E, Rechnitzer H, Vaisid T, et al. Mycoplasma hyorhinis upregulates calpastatin and inhibits calpain-dependent proteolysis in SH-SY5Y neuroblastoma cells. (2010) FEMS Microbiol Lett 304, 62-68). The inventor's laboratory found that the gastric cancer cell MGC803 infected with Mycoplasma hyopneumoniae has a much greater ability to form colonies in soft agar than cells without mycoplasma infection (Yang H, Qu LK, Ma HC, et al. (2010) Mycoplasma hyorhinis Infection in gastric carcinoma and its effects on the malignant phenotypes of gastric cancer cells. BMC Gastroenterol 10, 132). In addition, several studies have shown that Mycoplasma hyorhinis can enhance the in vitro migration and invasion of tumor cells.

The above clinical specimens and laboratory related research results suggest that there is a close relationship between Mycoplasma hyorhinis infection and tumor development. However, the molecular mechanism of the cells infected with Mycoplasma hyorhinis is not clear, so there is no specific method for preventing cells infected with Mycoplasma hyorhinis.

Summary of the invention

An object of the present invention is to study the molecular mechanism of Mycoplasma hyorhinis infected cells, and to provide a method for specifically preventing cells infected with Mycoplasma hyorhinis.

Another object of the present invention is to provide a preparation for preventing cells infected with Mycoplasma hyorhinis or promoting cell migration.

Another object of the present invention is to provide use of an antagonist against Mycoplasma hyopneumoniae membrane protein P37 or host cell membrane protein Annexin A2 for the preparation of a medicament for preventing infection or promoting cell migration of Mycoplasma hyorhinis.

The inventors of the present invention discovered that the infection of mammalian cells by Mycoplasma hyorhinis is dependent on its surface membrane protein p37, specifically the amino terminal polypeptide of the membrane protein P37 on its surface (more specifically The amino acid sequence of amino acid sequence 2-23 of the membrane protein P37) infects cells with the interaction of the cell membrane protein Annexin A2 (more specifically, its amino terminal polypeptide, for example, amino acid sequence 2-26).

Based on the results of this study, the present invention provides a method of preventing cells infected with Mycoplasma hyorhinis comprising inhibiting the binding of Mycoplasma hyorhinis to cells using an antagonist against Mycoplasma hyopneumoniae membrane protein P37. Since antagonists (eg, proteins, nucleic acids, carbohydrates) can bind to the membrane protein P37 and inhibit or block the biological activity of the membrane protein P37, it can be used to prevent infection of cells by binding of Mycoplasma hyorhinis to cells. For example, an antibody against Mycoplasma hyopneumoniae P37 protein, which binds to Mycoplasma hyorhinis P37 protein, can inhibit the infection of Mycoplasma hyorhinis cells by blocking action. In a specific embodiment of the present invention, the inventors have experimentally confirmed that the anti-p37 antibody can block not only the cells infected with Mycoplasma hyorhinis but also the cell migration ability caused by Mycoplasma hyorhinis.

Based on the above findings, the present invention also provides another method for preventing cells infected with Mycoplasma hyorhinis, which comprises inhibiting the binding of Mycoplasma hyorhinis to cells by using an antagonist against the host cell membrane protein Annexin A2. Similarly, since antagonists (eg, proteins, nucleic acids, carbohydrates) can bind to the protein Annexin A2 and inhibit or block the biological activity of the protein Annexin A2, it can be used to prevent infection of cells by binding of Mycoplasma hyorhinis to cells.

For example, an antibody against Annexin A2 can be used to block the molecule Annexin A2 on the host cell and bind to M. hyopneumoniae, so that the P37 protein of M. hyopneumoniae can not bind to it, thereby inhibiting the infection of M. hyopneumoniae cells. In a specific embodiment of the present invention, the inventors have experimentally confirmed that the binding of Mycoplasma hyorhinis to cells is significantly reduced after treatment of cells with anti-Annexin A2 antibody, and the cells infected with Mycoplasma hyorhinis can be significantly blocked.

For another example, small molecule RNA can be used to interfere with the expression of Annexin A2, so that the cells do not express or reduce the expression of Annexin A2, thereby inhibiting the infection of cells of Mycoplasma hyorhinis. In a specific embodiment of the present invention, the inventors have experimentally confirmed that the ability of small Molecular RNA to interfere with the expression of Annexin A2 after infection of cells by Mycoplasma hyorhinis and promote cell migration is markedly decreased.

For example, an amino terminal polypeptide of p37 can also be used, for example, a polypeptide comprising a 22 amino acid fragment of the amino acid terminal of the P37 protein, LKKLKNFILFSSIFSPIAFAIS (SEQ ID No. 1, amino acid sequence of amino acids 2-23 of the P37 protein), The binding of the host cell membrane protein Annexin A2, thereby competitively inhibiting the binding of Mycoplasma hyorhinis to cells, thereby preventing the infection of Mycoplasma hyorhinis cells. In a specific embodiment of the present invention, the inventors confirmed by experiments that the prokaryotic recombinantly expressed amino terminal polypeptide fusion protein (GST-p37-2-23) can bind to a gastric cancer cell line; the amino terminal polypeptide is directly labeled with fluorescein FITC FITC-p37-2-23 obtained after (FITC-p37-2-23) can also directly bind to cells; in addition, the synthetic p37-2-23 polypeptide can also block Mycoplasma hyorhinis and gastric cancer in a concentration-dependent manner. Binding of cellular AGS.

In addition, an amino terminal polypeptide of Annexin A2, for example, a polypeptide comprising the amino acid 25 amino acid fragment STVHEILCKLSLEGDHSTPPSAYGS (SEQ ID No. 2, amino acid sequence 2-26 of the Annexin A2 protein) of the Annexin A2 protein can also be used. By binding to the Mycoplasma hominis membrane protein P37, the binding of Mycoplasma hyorhinis to the host cell is competitively inhibited, thereby preventing the infection of Mycoplasma hyorhinis cells. In a specific embodiment of the present invention, the inventors verified by quantitative PCR experiments that the polypeptide of amino acid 2 to 25 amino terminus of Annexin A2 can block the binding of Mycoplasma hyorhinis to the cell Annexin A2 through competitive binding, and can effectively block mycoplasma. Infection.

In the present invention, the "antagonist against Mycoplasma hyopneumoniae membrane protein P37" means a substance which binds to P37 and inhibits or blocks the biological activity of P37, and may be a protein, a nucleic acid or a carbohydrate. The term "biological activity" as used herein refers to the biological activity of P37 binding to host cells, and in particular to the biological activity of binding to the host cell membrane protein Annexin A2.

In the present invention, the "antagonist against the host cell membrane protein Annexin A2" means a substance which binds to Annexin A2 and inhibits or blocks the biological activity of Annexin A2, and may be a protein, a nucleic acid or a carbohydrate. The term "biological activity" as used herein refers to the biological activity of Annexin A2 in combination with Mycoplasma hyorhinis, in particular, the biological activity of binding to P. gingivalis membrane protein P37.

In the present invention, the term "binding" refers to the interaction of Mycoplasma hyorhinis with cells and on the basis of which cells are infected. The inventors have found that Mycoplasma hyorhinis can bind to the cell membrane protein Annexin A2 through the membrane protein P37 on its surface, specifically through the polypeptide fragment of amino acids 2 to 23 of the amino terminus of the P37 protein, specifically through the Annexin A2 protein. Binding of amino acid polypeptide fragments 2 to 26 at the amino terminus, in turn, enables the binding of M. hyopneumoniae to cells and infects cells. Based on this finding, whether the corresponding antigen is blocked with the monoclonal antibody or polyclonal antibody of P37 or Annexin A2, or the polypeptide of P37 or Annexin A2 is used to competitively inhibit the binding of P37 protein to Annexin A2, or by knocking out the cell Annexin A2. The expression, which can block the binding of P37 protein to Annexin A2, can prevent the infection of cells of Mycoplasma hyorhinis and promote cell migration.

Thus, the present invention also provides the use of an antagonist against Mycoplasma hyopneumoniae membrane protein P37 or host cell membrane protein Annexin A2 for the preparation of a medicament for preventing infection of cells or promoting cell migration of Mycoplasma hyorhinis.

According to a specific embodiment of the present invention, in the present invention, an antagonist against Mycoplasma hyopneumoniae membrane protein P37 is an agent that binds to Mycoplasma hyorhinis membrane protein P37, thereby inhibiting the binding of Mycoplasma hyorhinis to cells.

According to a specific embodiment of the present invention, in the present invention, the antagonist against Mycoplasma hyopneumoniae membrane protein P37 is an agent which binds to amino acids 2-23 of the amino terminus of P. hominis membrane protein P37, thereby inhibiting the binding of M. hyopneumoniae to cells.

According to a specific embodiment of the present invention, in the present invention, the antagonist against Mycoplasma hyopneumoniae membrane protein P37 is a specific monoclonal antibody or polyclonal antibody against Mycoplasma hyopneumoniae membrane protein P37 or an antigenic fragment thereof. As used herein, "specificity" refers to an antibody that binds to P37 or a fragment thereof of the invention, preferably those that bind to P37 of the invention but are not recognized and do not bind to other non-related antigen molecules. It is known to those of ordinary skill in the art that the monoclonal antibody or polyclonal antibody can be obtained by immunization with the full length of P37 or an antigenic fragment thereof as an antigen with reference to the prior art.

According to another embodiment of the present invention, the antagonist against Mycoplasma hyopneumoniae membrane protein P37 is a polypeptide or protein comprising an amino acid sequence of the amino acid sequence of the host cell membrane protein Annexin A2 (e.g., amino acid sequence 2-26 of the amino terminus of Annexin A2). The polypeptide or protein comprising the amino acid sequence of amino acid positions 2-26 of the Annexin A2 protein, for example, may be a polypeptide consisting of the amino acid sequence shown in SEQ ID No. 2, or may be an amino acid represented by SEQ ID No. 2. A derivative polypeptide or protein having a function of substituting, deleting or adding one or several amino acids in the sequence and having the same function as the amino acid sequence shown in SEQ ID No. 2 (herein referred to as a function of binding to the Mycoplasma hyopneumonia membrane protein P37) . The polypeptide or protein may be devoid of or carry a label such as a recombinant tag or fluorescein. It is known to those of ordinary skill in the art that such polypeptides or proteins can be prepared by prokaryotic recombinant expression of a fusion protein, or by chemical synthesis, as described in the prior art.

According to a specific embodiment of the present invention, in the present invention, the antagonist against the host cell membrane protein Annexin A2 is an agent that binds to Annexin A2, thereby inhibiting the binding of Mycoplasma hyorhinis to cells.

According to a specific embodiment of the present invention, in the present invention, the antagonist against the host cell membrane protein Annexin A2 is an agent that binds to amino acids 2-26 of the amino terminus of Annexin A2, thereby inhibiting the binding of M. hyopneumoniae to cells.

In a specific embodiment of the invention, the antagonist against the host cell membrane protein Annexin A2 is a specific monoclonal or polyclonal antibody against Annexin A2 or an antigenic fragment thereof. As used herein, "specificity" refers to an antibody that binds to Annexin A2 of the invention or a fragment thereof, preferably those that bind to Annexin A2 of the invention but are not recognized and do not bind to other non-related antigen molecules. It is known to those of ordinary skill in the art that the monoclonal or polyclonal antibodies can be obtained by immunization of the full length of Annexin A2 or an antigenic fragment thereof as an antigen, as described in the prior art.

In another specific embodiment of the invention, the antagonist against the host cell membrane protein Annexin A2 is a small interfering RNA that interferes with the expression of Annexin A2. Preferably, the small interfering RNA has the nucleotide sequence shown in SEQ ID No. 3. The small interfering RNA can be prepared by prior art methods such as chemical synthesis.

In another specific embodiment of the invention, the antagonist against the host cell membrane protein Annexin A2 is a polypeptide or protein comprising the amino terminal sequence of the amino terminal of P. hominis membrane protein P37 (eg, amino acid sequence 2-23 of the amino terminus of P37). The polypeptide or protein comprising the amino acid sequence of amino acid positions 2-23 of the P37 protein, for example, may be a polypeptide consisting of the amino acid sequence shown in SEQ ID No. 1, or may be the amino acid sequence shown in SEQ ID No. 1. A polypeptide which has been substituted, deleted or added with one or several amino acids and which is composed of the amino acid sequence shown in SEQ ID No. 1 has the same function (herein referred to as a host cell) A membrane-protein Annexin A2 binds to a function of a derivative polypeptide or protein. The polypeptide or protein may be devoid of or carry a label such as a recombinant tag or fluorescein. It is known to those of ordinary skill in the art that such polypeptides or proteins can be prepared by prokaryotic recombinant expression of a fusion protein, or by chemical synthesis, as described in the prior art.

According to a specific embodiment of the present invention, in the present invention, the cells inhibiting the infection of Mycoplasma hyorhinis and inhibiting the cell migration by Mycoplasma hyorhinis may be gastric cancer cells MGC803, gastric cancer cells AGS, human renal epithelial cells 293T, human gastric mucosa immortal. Epithelial cells GES-1, African green monkey kidney cells COS-7 or human umbilical vein endothelial cells (HUVEC).

Further, the present invention provides a preparation for preventing infection of cells or promoting cell migration of Mycoplasma hyorhinis, which comprises an antagonist against Mycoplasma hyopneumoniae membrane protein P37 or host cell membrane protein Annexin A2. The antagonist against the Mycoplasma hyopneumoniae membrane protein P37 or the antagonist against the host cell membrane protein Annexin A2 is as described above.

In summary, the present invention provides a novel method for preventing infection of cells of Mycoplasma hyorhinis or promoting cell migration by infecting a cell in which the amino terminus of the membrane protein P37 on the surface thereof interacts with the amino terminal of the cell membrane protein Annexin A2. And related preparations, which can prevent cells infected with Mycoplasma hyorhinis from the perspective of preventing or inhibiting the binding of P37 to Annexin A2.

DRAWINGS

Figure 1A shows the results of a time-concentration gradient-dependent cell ELISA assay of M. sinensis infection of gastric cancer cells MGC803 and AGS.

Figure 1B: shows the results of a time-concentration gradient-dependent ELISA experiment in which GST-p37 binds to gastric cancer cells MGC803 and AGS.

Figure 1C: shows that anti-p37 antibody can block PCR detection of non-tumor cells such as 293T, GES-1, COS-7 and HUVEC.

Figure 1D: Results of an ELISA experiment showing that anti-p37 antibody blocks the binding of M. hyopneumoniae and gastric cancer cells.

Figure 1E: shows the results of immunofluorescence staining of anti-p37 antibody blocking the binding of Mycoplasma hyorhinis and gastric cancer cells.

Figure 1F: Transwell assay results showing that anti-p37 antibody can block the migration of gastric cancer cells by Mycoplasma hyorhinis.

Figure 2A shows that the mycoplasma p37 amino-terminal polypeptide fusion protein GST-p37-2-23 binds to gastric cancer cells MGC803 and AGS and is a time-concentration gradient-dependent cell ELISA.

Figure 2B: Laser confocal detection results showing that the mycoplasma amino terminal polypeptide FITC-p37-2-23 binds to the surface of a gastric cancer cell membrane.

Figure 2C: shows the results of PCR detection of the p37 amino terminal polypeptide p37-2-23 which blocks mycoplasma-infected cells.

Figure 3A: MALDI-TOF mass spectrometry analysis showed that p37 and ANXA2 interact.

Figure 3B: Bi-directional immunoprecipitation experiments confirmed the interaction of p37 and ANXA2.

Figure 3C: Laser confocal immunofluorescence assay showing colocalization of p37 and ANXA2.

Figure 3D: GST pull-down results showing that the amino terminal polypeptide of p37 mediates the interaction of p37 and ANXA2.

Figure 3E: GST pull-down results showing that the amino terminus of ANXA2 mediates the interaction of p37 and ANXA2.

Figure 3F: Results of ELISA experiments showing the interaction of GST-p37 and GST-p37-2-23 and ANXA2-2-26.

Figure 3G: Results of an ELISA experiment showing that the amino terminal polypeptide p37-2-23 of p37 blocks the interaction of GST-p37 and ANXA2.

Figure 3H: Quantitative PCR assay showing that the polypeptide fragment at positions 2 to 26 of the amino terminus of ANXA2 can block infection of M. hyopneumoniae.

Figure 4A: Results of laser confocal immunofluorescence staining showing that anti-ANXA2 antibody blocks the binding of Mycoplasma hyorhinis to gastric cancer cells.

Figure 4B: PCR results showing that anti-ANXA2 antibody blocked non-tumor cells such as 293T, GES-1, COS-7 and HUVEC of Mycoplasma hyorhinis infection.

Figure 4C: Transwell assay results showing that anti-p37 antibodies can block the migration of gastric cancer cells by Mycoplasma hyorhinis.

Figure 4D: Western Blot results showing the RNAi interference effect of ANXA2.

Figure 4E: PCR results showing inhibition of M. hyopneumoniae infected cells after interference with ANXA2 expression.

Figure 4F: shows the results of laser confocal immunofluorescence staining for blocking the binding of Mycoplasma hyorhinis and gastric cancer cells after interference with ANXA2.

Figure 4G: Transwell assay results showing inhibition of migration of gastric cancer cells by blocking M. hyopneumoniae after interference with ANXA2 expression.

Figure 5A: Infection of Mycoplasma hyorhinis in gastric cancer tissues (representative map of p37 protein immunohistochemistry).

Figure 5B: Correlation analysis of Mycoplasma hyorhinis infection and various clinicopathological parameters in gastric cancer tissues.

Figure 5C: Short survival of patients with gastric mycoplasma infection in gastric cancer (Kaplan-Meier curve analysis).

detailed description

The invention is further illustrated by the following specific examples. It is to be understood that the examples are not intended to limit the scope of the invention. The experimental methods in the following examples which do not specify the specific conditions are usually carried out according to the conventional conditions in the art or according to the conditions recommended by the manufacturer. Each of the original reagents and materials used in the examples are commercially available.

Example 1. Mycoplasma hyorhinis infection in mammalian cells depends on its surface membrane protein p37

In this example, it was confirmed by conventional cell ELISA experiments reported in the literature that both Mycoplasma hyorhinis and p37 protein can bind to cells, respectively.

The cell ELISA experiment firstly inoculated gastric cancer cells MGC803 and AGS (these cells were derived from the Chinese Academy of Medical Sciences tumor cell bank) in a 96-well plate for 48 hours, and then added 1x10 ³ CCU, 1×10 ⁴ CCU, 1× ^{10 5} CCU/mL, respectively. Mycoplasma hyorhinis to infect cells. After 24 hours of infection, the cells were washed three times with PBS, fixed with 0.4% glutaraldehyde for 10 min at room temperature, and incubated with 5% milk powder/PBST for 2 h at room temperature, and then sequentially added anti-Swine nasal mycoplasma antibody, enzyme-labeled secondary antibody and substrate solution. Finally, OD _{492 nm was} measured by ELISA READER. Higher readings indicate more binding of mycoplasma to cells. The results showed that Mycoplasma hyorhinis and cell binding were in a concentration-dependent manner (Fig. 1A).

Next, the gastric cancer cells MGC803 and AGS were infected with the above 1×10 ⁴ CCU/mL of Mycoplasma hyorhinis for 0, 24, and 48 hours, respectively. The cell ELISA results showed that the Mycoplasma hyorhinis and cell binding were in a time gradient-dependent manner (Fig. 1A).

In addition, after treatment of gastric cancer cells with recombinant GST-p37 recombinantly expressed by prokaryotic cells, it was found that recombinantly expressed GST-p37 protein can also bind to gastric cancer cell lines, and this binding also showed significant time and concentration gradient dependence (Fig. 1B). ). This suggests that the infection of gastric cancer cells by Mycoplasma hyorhinis is probably mediated by its surface membrane protein p37.

The above prokaryotic recombinant expression protein GST-P37 is obtained by conventional gene recombination, bacterial expression and protein purification. In short, the cDNA that expresses the full-length P37 protein in cells and bacteria by mutation (see Wen-Bin Liu, Jian-Zhi Zhang, Bei-Hai Jiang, et al: Lipoprotein p37 from mycoplasma hyorinis inhibiting mammalian cell adhesion J) Biomedical.Science 2006 13:323-331) was recombined with prokaryotic expression plasmid pGEX4T-1, and the recombinant plasmid was introduced into E. coli BL21 and cultured in LB medium. When OD ₆₀₀ reached 1.0, IPTG was added for induction and collected after 4 hours. The bacteria were centrifuged by lysozyme and sonicated, and the supernatant was purified by GST gel column. The obtained GST-P37 fusion protein was identified and quantified by protein electrophoresis.

A polymerase chain reaction assay (PCR) was used to amplify a specific DNA fragment of Mycoplasma hyopneumoniae in cells, and it was revealed that Mycoplasma hyorhinis can infect not only tumor cell lines but also non-tumor cells such as 293T, GES-1, COS-7 and HUVEC. (The cells used except the gastric mucosal immortalized cells GES-1 were provided by the Beijing Cancer Institute, and the other non-tumor cells were derived from the US ATCC cell bank) (Fig. 1C).

In order to reveal whether p37 plays an important role in the cells infected with Mycoplasma hyorhinis, in this example, a p37 antibody blocking method was used, in which a rabbit antibody against P37 was first reacted with Mycoplasma hyorhinis for 2 hours, and then the reaction mixture was added to the cells. In the culture system, the culture solution was discarded after 24 hours of culture, the cells were collected and DNA was extracted, and then the M. hyopneumoniae-specific DNA fragment in the cells was amplified by PCR. The results showed that 5 μg/mL of anti-p37 antibody significantly blocked the infection of Mycoplasma hyorhinis cells (Fig. 1C). Among them, the anti-P37 rabbit antibody is prepared by a conventional method. In short, the P37 protein obtained by bacterial expression is fully mixed with the Freund's adjuvant, and then the rabbit is multi-immunized by conventional subcutaneous immunization, and the immunization is performed three times, at least four weeks after each immunization. Blood was collected from the tenth to the fourteenth day after the last immunization. After the blood was naturally coagulated, the antiserum was obtained by centrifugation, and then purified by a protein A gel column to obtain a rabbit anti-P37 protein antibody.

The results of the cell ELISA assay also revealed that the anti-p37 antibody significantly blocked the infection of Mycoplasma hyorhinis cells in a concentration-dependent manner (Fig. 1D).

Immunofluorescence staining also showed that anti-p37 antibody significantly blocked the infection of M. hyopneumoniae cells in gastric cancer cell lines (Fig. 1E).

The anti-p37 antibody not only blocked the cells infected with Mycoplasma hyorhinis, but also blocked the cell migration ability caused by Mycoplasma hyorhinis (Fig. 1F).

The above experimental results fully indicate that the cells infected with Mycoplasma hyorhinis are dependent on the surface membrane protein p37, and the anti-P37 antibody can block the infection of Mycoplasma hyorhinis.

Example 2. The amino terminal polypeptide of p37 blocks mycoplasma infected cells

The amino terminal sequence of p37 (amino acid sequence 2 to 23 of the p37 protein sequence, denoted as p37-2-23: LKKLKNFILFSSIFSPIAFAIS, SEQ ID No. 1) is unique to Mycoplasma hyorhinis, and in other types of mycoplasma It does not exist (Dudler R, Schmidhauser C, Parish RW, et al. A mycoplasma high-affinity transport system and the in vitro invasiveness of mouse sarcoma cells. (1988) The EMBO Journal 7, 3963-3970).

In order to investigate the role of the amino terminus of p37 in mediating infection of Mycoplasma hyorhinis cells, in this example, GST fusion protein was used to detect binding to cells by ELISA. It was found that the prokaryotic recombinant expression of the amino-terminal polypeptide fusion protein (GST-p37-2-23) can bind to the gastric cancer cell line in a time- and concentration-dependent manner, while the p37 protein (GST-p37-) lacking the amino-terminal polypeptide. Δ2-23) was not able to bind to cells (Fig. 2A).

The preparation methods of GST-p37-2-23 and GST-p37-Δ2-23 in this example are similar to the preparation of the above GST-P37 protein. In the preparation of GST-p37-2-23, a sense oligonucleotide (5'-) encoding the polypeptide fragment 2 to 23 of P37 was first synthesized.

GAGGTAGCTTTTATGCTCAAAAAATTTAAAAATTTTATTC TATTTTCATCTATA TTTTCGCCAATAGCATTTGCTATATCA

-3', SEQ ID No. 4) and antisense oligonucleotides (5'-

TGATATAGCAAATGCTATTGGCGAAAATATA GATGAAAATAGAATAAAATTTTTAAATT TTTTGAGCATAAAAGCTACCTC

-3', SEQ ID No. 5), after annealing the two to form a double-stranded oligonucleotide, and then recombining with the prokaryotic expression plasmid pGEX4T-1 (the endonuclease viscosity is indicated by the black body in the oligonucleotide chain) End sequence), expression and purification. In the preparation of the fusion protein GST-p37-Δ2-23, which lacks the 22 amino acid fragment of the amino terminus of P37, the corresponding primer was used (sense strand primer: 5'-CGC

TTTGCTATATCATGTTC-3', SEQ ID No. 6; antisense strand primer: 5'-CCG

TAATGGCTTTTTCAT-3', SEQ ID No. 7; the black body is the introduced restriction site) A P37 cDNA lacking the 22 amino acid encoding the amino terminus of P37 was obtained by conventional PCR amplification, and was subjected to conventional digestion and recombination with pGEX4T-1. And purification.

Immunofluorescence staining of the amino-terminal polypeptide directly labeled with fluorescein FITC (FITC-p37-2-23) revealed that FITC-p37-2-23 can also directly bind to cells (Fig. 2B).

In addition, the synthetic p37-2-23 polypeptide blocked the AGS binding of Mycoplasma hyorhinis and gastric cancer cells in a concentration-dependent manner, achieving a near-complete blockade at 30 μM, and the sequence was not related to the p37-2-23 polypeptide. The control peptide (sequence: DSGEGDFLAEGGGVR, SEQ ID No. 8) had no blocking effect (Fig. 2C).

The above results indicate that the amino terminal polypeptide of p37 mediates its binding to cells. The Mycoplasma hyorhinis infection cell depends on the amino terminal polypeptide of p37, and the amino terminal polypeptide of p37 can competitively inhibit the infection of Mycoplasma hyorhinis by binding to cells.

Example 3, p37 protein and host ANXA2 protein interact through the amino terminus, respectively

In order to find a host cell surface receptor molecule that interacts with p37, this example firstly enriched the p37 interacting protein in cell lysate by GST pull-down technique, and then found out by SDS-PAGE and Coomassie blue staining. The differential band (shown by the arrow in Fig. 3A) was identified by MALDI-TOF mass spectrometry and the polypeptide fragment was found to be Annexin. The A2 sequence (Fig. 3A) indicates that the interacting protein of p37 is Annexin A2 (hereinafter referred to as ANXA2).

In order to verify the interaction between p37 and Annexin A2, in this example, p37 and ANXA2 antibodies (this antibody was purchased from Novus Biotechnology) were used to conduct immunoprecipitation with P37 antibody. ANXA2 was precipitated, whereas P37 was precipitated with ANXA2 antibody, indicating that there was indeed an interaction between p37 and ANXA2 (Fig. 3B). In the examples, P37 and other molecules of the Annexin family, such as ANXA1 and ANXA4, were also detected. Role, found that p37 and they do not interact (Figure 3B).

In this example, the P37 protein and the ANXA2 protein were respectively labeled as green and red by specific antibodies, and the laser confocal immunofluorescence experiment was used to more intuitively judge whether there is interaction between the two proteins. With common cell positioning, the green and red overlaps show yellow. The results indicate that p37 and ANXA2 colocalize on the cell membrane (Fig. 3C).

In order to determine the specific region in which the P37 protein interacts with ANXA2, in this example, a GST pull-down experiment was also performed. The results showed that the N-terminal polypeptide fusion protein GST-p37-2-23 of p37 can directly interact with ANXA2, while the p37 fusion proteins GST-p37-△2-23 and ANXA2 lacking the N-terminal polypeptide do not interact (Fig. 3D ), indicating that the N-terminal polypeptide of p37 mediates the interaction of p37 protein with ANXA2.

ANXA2 belongs to the calcium-dependent annexin family, which has 12 members in humans. The difference in protein composition of each member is mainly reflected in the first 26 amino acids of its amino terminus. The unique sequence of each member's amino terminus determines that it has certain specific functions that other family members do not have (Gerke V, Moss S). .Annexins:form structure to function. (2002) Physiol Rev 82, 331-371). For example, the N-terminal domain of ANXA2 mediates its interaction with other proteins. The N-terminus of ANXA2 also contains phosphorylation sites that, when activated by phosphorylation, mediate specific biological functions of ANXA2. For example, tyrosine phosphorylation at position 23 of ANXA2 promotes its transport from the cytosol to the outer surface of the cell membrane, thereby promoting the function of related biological functions (Gerke V, Moss S. Annexes: form structure to function. (2002) Physiol Rev 82, 331-371).

By in vitro GST pull-down experiments, the present inventors found that the N-terminal domain of ANXA2 mediates its binding to p37, and the deletion of the N-terminal 25 amino acid ANXA2 protein does not directly interact with p37 (Fig. 3E). In addition, solid phase binding experiments revealed that there is a direct interaction between the N-terminal domain of ANXA2 and the N-terminal polypeptide of p37 and p37 (Fig. 3F), and that the N-terminal polypeptide of p37 competitively blocks the binding of ANXA2 to p37 ( Figure 3G). In this example, the in vitro GST pull-down assay revealed that the complete ANXA2 fusion protein (His-ANXA2-FL) can interact with GST-p37, but lacks the amino acid 25 amino acid ANXA2 fusion protein (His-ANXA2-△2). -26) Inability to interact with GST-p37, indicating that the ANXA2 amino terminus mediates the binding of ANXA2 to p37 from the 25 amino acid polypeptide fragment of positions 2 to 26 (Fig. 3E).

To further demonstrate that the binding of p37 and ANXA2 is achieved by their amino-terminal polypeptide interactions, this example also employs an ELISA method to coat a 96-well plate with a polypeptide of positions 2 to 26 at the amino terminus of the synthetic ANXA2 (with an unrelated polypeptide SEQ). ID No.8 as a control), then add the GST-p37 fusion protein containing intact p37, and only contain the p37 amino terminal polypeptide. The GST-p37-2-23 fusion protein and the amino-terminal GST-p37-Δ2-23 fusion protein are added to the anti-GST murine monoclonal antibody, the anti-mouse enzyme secondary antibody and the substrate solution after a certain period of time. Then, the degree of detection was carried out on a microplate reader. The results showed that both GST-p37 and GST-p37-2-23 could specifically bind to the coated ANXA2 amino-terminal polypeptide (not bound to the control peptide), but lacked the amino-terminal p37 fusion. The protein GST-p37-Δ2-23 does not bind to the ANXA2 amino-terminal polypeptide, which further demonstrates that there is a direct interaction between the amino-terminal domain of ANXA2 and the amino-terminal polypeptide of p37 and p37 (Fig. 3F).

Using a similar ELISA assay, a 96-well plate was coated with ANXA2 fusion protein His-ANXA2, and GST-p37 and GST-p37-2-23 were added respectively or GST-p37 and GST-p37-2-23 were added simultaneously. This indicates that the p37 amino-terminal polypeptide fusion protein GST-p37-2-23 can competitively block the binding of GST-p37 to ANXA2 (Fig. 3G), further supporting the binding of p37 to ANXA2 through its amino-terminal 22 polypeptide fragments. Realized.

After demonstrating that the Mycoplasma hyorhinis binds to a polypeptide of amino acid 2 to 26 amino acid at the amino terminus of Annexin A2 (STVHEILCKLSLEGDHSTPPSAYGS, SEQ ID No. 2), a polypeptide that demonstrates amino acids 2 to 26 of the amino terminus of Annexin A2 can be competitively bound. Blocking the binding of Mycoplasma hyorhinis to the cell Annexin A2, thereby inhibiting mycoplasma-infected cells, this case was verified by routine quantitative PCR. The method was carried out by routinely culturing the tumor cell MGC803, and then adding different concentrations of polypeptides of amino acid 2 to 26 amino acid at the amino terminus of Annexin A2 (4 μm and 20 μm, respectively), and adding no small peptide or irrelevant peptide as a control. The cell culture supernatant was washed away 24 hours after the cells were infected, and DNA was extracted by conventional methods, and the p37 gene was expanded by quantitative PCR. The results are shown in Fig. 3H. In the figure, 1 is no addition of mycoplasma, 2 is added to mycoplasma, 3 is added to mycoplasma and an unrelated control peptide is added, 4 and 5 are added to mycoplasma, and different concentrations of amino acid 2 to 26 amino acid of Annexin A2 are added. Polypeptides (4 μm and 20 μm, respectively). The results showed that the polypeptide of amino acid 2 to 26 amino terminus of Annexin A2 (SEQ ID No. 2) was effective in blocking the infection of mycoplasma.

The above experiments have fully demonstrated from different angles that the interaction between the Mycoplasma hyorhinis protein p37 and the host cell protein ANXA2 is achieved by direct binding of their amino termini.

Example 4, ANXA2 is required for mediating infection of Mycoplasma hyorhinis cells

In order to investigate the role of ANXA2 in mediating cells infected with Mycoplasma hyorhinis, in this example, an anti-ANXA2 antibody (5 μg/ml) was first added to a cell culture medium without mycoplasma infection to block the ANXA2 protein. After 2 hours of reaction, the cells were infected with Mycoplasma hyorhinis. After 24 hours of culture, the cells infected with Mycoplasma hyorhinis were detected by immunofluorescence staining and PCR amplification of Mycoplasma DNA. The results of the experiment showed that the binding of Mycoplasma hyorhinis to cells was significantly reduced after treatment with anti-ANXA2 antibody (showing that fluorescent staining showed no significant reduction in mycoplasma or PCR amplification of Mycoplasma DNA, Figure 4A and Figure 4B), indicating that ANXA2 antibody was used. Treatment of cells significantly blocked cells infected with Mycoplasma hyorhinis, indicating that ANXA2 mediates infection of cells by Mycoplasma hyorhinis.

Using conventional cell migration assays (ie, Transwell chamber experiments, reference can be made to Hua Yang, Like Qu, Huachong Ma, et al: Mycoplasma hyorhinis infection in gastric carcinoma and its effets on the malignant phenotypes of gastric cancer cells. 2010, BMC Gastroenterology 10 :132) Tests show that cells are in the first pass After treatment with ANXA2 antibody, the pro-cell migration caused by Mycoplasma hyorhinis was significantly reduced (Fig. 4C).

In order to further verify the role of ANXA2 in mediating the infection of Mycoplasma hyorhinis in infected cells, small molecule RNA (interference sequence: AAGGACAU-UAUUUCGGACACA, SEQ ID No. 3) is also used in this example to interfere with the expression of ANXA2, so that cells do not express or The expression of ANXA2 was reduced (Fig. 4D), and then the infection of Mycoplasma hyorhinis was detected by the similar method described above. It was found that the ability of small molecule RNA to interfere with ANXA2 expression after infection of cells of Mycoplasma hyorhinis was significantly decreased (Fig. 4E, cells were detected by PCR). Mycoplasma DNA; Figure 4F, immunofluorescence to detect cells of Mycoplasma hyorhinis p37). Cell migration experiments showed that the ability of M. hyorhinis and cell migration to interfere with ANXA2 expression was also significantly reduced (Fig. 4G). This further demonstrates that Mycoplasma hyorhinis infects cells via ANXA2.

The above experiments demonstrate that the anti-ANXA2 antibody blocks a molecule on the cell membrane which binds to Mycoplasma hyorhinis, thereby inhibiting the infection of cells of Mycoplasma hyorhinis, and thus the present invention provides a novel method for preventing cells infected with Mycoplasma hyorhinis.

Example 5: Detection of Mycoplasma hyorhinis infection in human gastric cancer tissue and correlation analysis with prognosis of patients

In order to detect the relationship between the infection of Mycoplasma hyorhinis and clinicopathological parameters and the prognosis of patients with gastric cancer, the inventors used conventional immunohistochemical detection methods to immunohistochemically analyze 339 gastric cancer tissues with follow-up data using specific anti-p37 protein antibody PD4. For chemical detection (see Yang H, Qu LK, Ma HC, et al. (2010) Mycoplasma hyorhinis infection in gastric carcinoma and its effects on the malignant phenotypes of gastric cancer cells. BMC Gastroenterol 10, 132). Figure 5A provides a representative picture of positive test results, 1 in 5A is a negative control with an irrelevant antibody, and 2 to 6 respectively represent a positive result of histochemical detection for gastric cancer tissues of different degrees of differentiation.

Figure 5B is a correlation analysis between Mycoplasma hyorhinis infection and various clinicopathological parameters of gastric cancer tissues. The results showed that 134 cases were stain positive in 339 cases, the positive rate was 39.5% (134/339), and the detection of mycoplasma infection was positive. In the case, the proportion of tumor invasion of blood vessels and distant metastasis was significantly higher than that of negative cases, indicating that mycoplasma infection was significantly positively correlated with tumor invasion of blood vessels and distant metastasis (P values were 0.021 and 0.029, respectively, Figure 5B).

Kaplan-Meier curve analysis showed that the prognosis of patients with mycoplasma-positive gastric cancer was worse than that of patients with negative mycoplasma, and the survival time was short (P value was 0.040, Figure 5C).

The above results indicate that there is an infection of Mycoplasma hyorhinis in human gastric cancer tissues, and patients with Mycoplasma hyorhinis infection have poor prognosis and short survival time.

Claims (17)

1. The use of an antagonist of Mycoplasma hyopneumoniae membrane protein P37 or host cell membrane protein Annexin A2 for the preparation of a medicament for preventing infection of cells or promoting cell migration of Mycoplasma hyorhinis.
2. The use according to claim 1, wherein the antagonist against Mycoplasma hyopneumoniae membrane protein P37 is an agent which binds to Mycoplasma hyorhinis membrane protein P37, thereby inhibiting the binding of Mycoplasma hyorhinis to cells.
3. The use according to claim 1, wherein the antagonist against Mycoplasma hyopneumoniae membrane protein P37 is an agent that binds to amino acids 2-23 of the amino terminus of P. hominis membrane protein P37, thereby inhibiting the binding of M. hyopneumoniae to cells.
4. The use according to claim 1, wherein the antagonist against Mycoplasma hyopneumoniae membrane protein P37 is a specific monoclonal antibody or polyclonal antibody against Mycoplasma hyopneumoniae membrane protein P37 or an antigenic fragment thereof, or comprises an aminoxin of Annexin A2 A polypeptide or protein of amino acids 2-26.
5. The use according to claim 1, wherein the antagonist against the host cell membrane protein Annexin A2 is an agent which binds to Annexin A2, thereby inhibiting the binding of Mycoplasma hyorhinis to cells.
6. The use according to claim 1, wherein the antagonist against the host cell membrane protein Annexin A2 is an agent that binds to amino acids 2-26 of the amino terminus of Annexin A2, thereby inhibiting the binding of M. hyopneumoniae to cells.
7. The use according to claim 1, wherein the antagonist against the host cell membrane protein Annexin A2 is a polypeptide or protein comprising amino acids 2-23 of the amino terminus of P. hominis membrane protein P37.
8. The use according to claim 1, wherein the antagonist against the host cell membrane protein Annexin A2 is: a monoclonal antibody or a polyclonal antibody specific for Annexin A2 or an antigenic fragment thereof, or a small interfering interference that interferes with the expression of Annexin A2 RNA; preferably, the small interfering RNA has the nucleotide sequence shown in SEQ ID No. 3.
9. The use according to claim 1, wherein the cell is a mammalian cell, for example, gastric cancer cell MGC803, gastric cancer cell AGS, human renal epithelial cell 293T, human gastric mucosal immortalized epithelial cell GES-1, African green monkey Renal cells COS-7 or human venous endothelial cells.
10. A preparation for preventing infection of cells of Mycoplasma hyorhinis or promoting cell migration, comprising an antagonist against Mycoplasma hyopneumoniae membrane protein P37 or host cell membrane protein Annexin A2.
11. A method for preventing cells infected with Mycoplasma hyorhinis comprising inhibiting binding of Mycoplasma hyorhinis to cells by an antagonist against Mycoplasma hyopneumoniae membrane protein P37, or inhibiting binding of Mycoplasma hyorhinis to cells by using an antagonist against host cell membrane protein Annexin A2.
12. The method according to claim 11, wherein the molecule Annexin A2 which binds to M. hyopneumoniae on the host cell is blocked with an antibody against Annexin A2, so that the P37 protein of M. hyopneumoniae cannot be bound thereto, thereby inhibiting the pig. Mycoplasma nasalis infects cells.
13. The method according to claim 11, wherein the small molecule RNA is used to interfere with the expression of Annexin A2, so that the cells do not express or reduce the expression of Annexin A2, thereby inhibiting the infection of cells of Mycoplasma hyorhinis.
14. The method according to claim 11, wherein the amino terminal polypeptide of p37 is used to bind to the host cell membrane protein Annexin A2, thereby competitively inhibiting the binding of Mycoplasma hyorhinis to cells, thereby preventing infection of cells of Mycoplasma hyorhinis.
15. The method according to claim 14, wherein the amino terminal polypeptide of p37 is a polypeptide comprising the amino acid sequence of amino acids 2-23 of the amino terminus of the P37 protein.
16. The method according to claim 11, wherein the amino terminal polypeptide of Annexin A2 is used to bind to the Mycoplasma hominis membrane protein P37 to competitively inhibit the binding of Mycoplasma hyorhinis to the host cell, thereby preventing the infection of Mycoplasma hyorhinis cells. .
17. The method according to claim 16, wherein the amino terminal polypeptide of Annexin A2 is a polypeptide comprising amino acid sequence 2-26 of the amino terminus of Annexin A2 protein.

Images