WO2016018921A1 - Compositions and methods for inhibiting human immunodeficiency virus budding - Google Patents
Compositions and methods for inhibiting human immunodeficiency virus budding Download PDFInfo
- Publication number
- WO2016018921A1 WO2016018921A1 PCT/US2015/042492 US2015042492W WO2016018921A1 WO 2016018921 A1 WO2016018921 A1 WO 2016018921A1 US 2015042492 W US2015042492 W US 2015042492W WO 2016018921 A1 WO2016018921 A1 WO 2016018921A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dub
- gag
- hiv
- nucleic acid
- vector
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/50—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25)
- C12N9/503—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses
- C12N9/506—Proteinases, e.g. Endopeptidases (3.4.21-3.4.25) derived from viruses derived from RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/48—Hydrolases (3) acting on peptide bonds (3.4)
- C12N9/485—Exopeptidases (3.4.11-3.4.19)
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/01—Fusion polypeptide containing a localisation/targetting motif
- C07K2319/06—Fusion polypeptide containing a localisation/targetting motif containing a lysosomal/endosomal localisation signal
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/35—Fusion polypeptide containing a fusion for enhanced stability/folding during expression, e.g. fusions with chaperones or thioredoxin
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
- C07K2319/95—Fusion polypeptide containing a motif/fusion for degradation (ubiquitin fusions, PEST sequence)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/16011—Human Immunodeficiency Virus, HIV
- C12N2740/16211—Human Immunodeficiency Virus, HIV concerning HIV gagpol
Definitions
- This disclosure concerns nucleic acid molecules and vectors encoding fusion proteins that inhibit budding of enveloped viruses, such as human immunodeficiency virus (HIV), from infected cells, and methods of their use.
- enveloped viruses such as human immunodeficiency virus (HIV)
- ESCRT endosomal sorting complex required for transport
- ESCRT pathway is comprised of four multi-protein complexes, named ESCRT-0, 1, II and III.
- An ordered recruitment of ESCRT-I and a subset of ESCRT-III components are believed to facilitate membrane-scission necessary for virus budding (Morita et al.
- nucleic acid molecules and vectors for delivery of deubiquitin enzymes (DUbs) to sites of HIV assembly and production.
- the disclosed nucleic acid molecules and vectors encode a fusion protein that includes a DUb fused to HIV Gag or fused to an ESCRT pathway protein, such as TSG101 or ALIX. Expression of the DUb fusion proteins inhibits HIV budding from infected cells and cell-to-cell transmission, thereby inhibiting HIV release and spread.
- nucleic acid molecules and vectors encoding a fusion protein that includes a DUb catalytic domain fused to a targeting protein, wherein the targeting protein is a protein that targets the fusion protein to sites of HIV assembly or budding in a host cell.
- the targeting protein is HIV Gag, or a functional fragment thereof.
- the targeting protein is an ESCRT protein or functional fragment thereof.
- isolated cells comprising the nucleic acid molecules and vectors, recombinant viruses (such as adeno-associated viruses and lentiviruses) comprising the nucleic acid molecules, and pharmaceutical compositions comprising the nucleic acid molecules and vectors.
- the method is an ex vivo method. In other embodiments, the method is an in vivo method in which contacting the cells includes administering the nucleic acid molecule or vector to a subject infected with HIV.
- FIGS. 1A-1D Fusion of the UL36 catalytic domain DUb to TSG101 inhibits ESCRT-I ubiquitination.
- FIG. 1A Schematic representation of the DUb-TSGlOl fusion proteins. DUb and catalytically inactivated DUb (DUb*) domains were fused to TSG101 as depicted.
- FIG. IB Effect of DUb fusion to TSG101 on ESCRT-I ubiquitination.
- 293T cells were transfected with ESCRT-I members (Flag-tagged VPS28 (800 ng), VPS37 (1.7 ⁇ g) and MVB12 (800 ng)) and either strep-TSGlOl (2.5 ⁇ g) (lanes 1 and 7), DUb-TSGlOl (lanes 3 and 9) or DUb*-TSG101 alone (600 ng) (lanes 5 and 11), or with hemagglutinin (HA)-Ub (1.5 ⁇ g) (lanes 2, 4, 6, 8, 10, 12). Immunocomplexes were analyzed by western blotting (WB) using the indicated antibodies. (FIG. 1C) DUb-TSGlOl fusion proteins bind HIV-1 NCp6 region.
- Glutathione S-transferase (lanes 1, 3 and 5) and GST-NCp6 (lanes 2, 4 and 6) were captured on beads and then incubated with lysates from 293T cells expressing Flag-ESCRT-I/TsglOl (lane 2), DUb-TSGlOl (lane 4) or DUb*-TSG101 (lane 6). Captured proteins and cell lysates were analyzed by WB using the anti- Flag antibody. GST fusion proteins were visualized by Coomassie blue staining. (FIG. ID) DUb- TSG101 deubiquitinated Gag assembly complexes.
- 293T cells were co-transfected with HIV-1 YP- mutant (1 ⁇ g) and HA-Ub alone (lanes 1, 4 and 7), with strep-DUb-TSG-101 (lanes 2, 4 and 6) or strep- DUb*-TSG-101 (lanes 3, 6 and 9).
- Insoluble Gag-enriched fractions were isolated and solubilized to Strep-Tactin-capture DUb-TSGlOl or DUb*-TSG101 containing complexes.
- Gag proteins associated with these complexes and their ubiquitination status assessed by antibodies to p24 and HA, respectively, and input fractions were probed with the indicated antibodies.
- FIGS. 2A-2C DUb-TSGlOl potently inhibits HIV-1 release.
- FIG. 2A Co-expression of DUb-TSGlOl inhibits HIV-1 release.
- 293T cells were transfected with expression plasmids of HIV-1 YP- (lane 1), or co-expressing Flag-TSGlOl, Flag-DUb-TSGlOl or Flag-DUb*-TSG101 (lanes 2, 3, 4, respectively).
- FIGS. 2A-2C DUb-TSGlOl potently inhibits HIV-1 release.
- FIGS. 2A-2C Co-expression of DUb-TSGlOl inhibits HIV-1 release.
- 293T cells were transfected with expression plasmids of HIV-1 YP- (lane 1), or co-expressing Flag-TSGlOl, Flag-DUb-TSGlOl or Flag-DUb*-TSG101 (lanes 2, 3, 4, respectively).
- FIG. 2B DUb-TSGl
- TSG101 293T cells were transfected twice with RNA interference (RNAi) to TSG101 (lanes 2-5) at 36-hour intervals. At the second transfection, cells were co-transfected with expression plasmids of HIV-1 YP- alone (lanes 1 and 2) or either Flag-TSG101 RR (250 ng) (RNAi Resistant form), Flag- DUb-TSGlOl RR or Flag-DUb*-TSG101 RR (15 ng) (lanes 3, 4, 5, respectively). Cells and viruses were collected 24 hours post-transfection and their protein content was analyzed by WB using the indicated antibodies. Virus release efficiency was also quantified using HeLa TZM-bl assays from 3 independent experiments and expressed relative to wild type (WT) HIV (FIG. 2A) or WT
- RNAi RNA interference
- TSG101 RR (FIG. 2B).
- FIG. 2C DUb-TSGlOl inhibits late steps of HIV-1 budding. Shown are electron microscopy (EM) images of thin-sectioned 293T cells co-transfected with HIV-1 and DUb-TSGlOl (panels a and b) or with DUb*-TSG101 (panel c). A high-magnification image of budding virus particles from panel (a) (rectangle) is shown in panel (b); black arrows indicate particles tethered to the plasma membrane or to each other. Quantification of budding defects was performed and approximately >250 virus particles from 2 independent experiments were examined and categorized as immature budding particles, or mature released particles; the results are shown in the graphs ( ⁇ SD).
- FIGS. 3A-3D Fusion with DUb had no effect on ALIX known protein-protein interactions in the cell.
- FIG. 3 A Schematic representation of the DUb-ALIX fusion proteins. The active or inactive UL36 DUb catalytic domain was fused to the ALIX N-terminal region as depicted.
- FIG. 3B Effect of DUb fusion on ALIX ubiquitination. 293T cells were transfected with Flag-ALIX (500 ng), Flag-DUb-ALIX (500 ng) or Flag-DUb*-ALIX (500 ng) (lanes 1, 3, 5, 7, 9 and 11; respectively) or in combination with HA-Ub (lines 2, 4, 6, 8, 10 and 12; respectively).
- FIG. 3C DUb- ALIX fusion proteins bind HIV-1 NCp6 and equine infectious anemia virus (EIAV) NCp9 proteins.
- EIAV equine infectious anemia virus
- GST, GST-NCp6 (right panel) or GST-NCp9 (left panel) fusion proteins were purified on glutathione beads and then incubated with lysates from 293T cells expressing 1.5 g of Flag-ALIX (lanes 2 and 8), Flag-DUb-ALIX (lanes 4 and 10) or Flag-DUb*-ALIX (lanes 6 and 12).
- Captured proteins and cell lysates were analyzed by WB using an anti-Flag antibody and GST fusion proteins visualized by Coomassie blue staining.
- FIG. 3D DUb-ALIX fusion proteins retain binding to CHMP4B.
- 293T cells were co-transfected with HA-CHMP4B alone (2 ⁇ g) (control), or in combination with tyg of Flag-ALIX (lane 2), Flag-ALIXI212D (lane 3), Flag-DUb-ALIX (lane 4) or Flag-DUb*-ALIX (lane 5).
- Cell lysates were incubated with anti-Flag antibody-conjugated beads and both input and immunocomplexes were analyzed by WB using the indicated antibodies.
- FIGS. 4A-4D DUb-ALIX interferes with ALIX mediated virus release.
- FIG. 4A Co- expression of DUb-ALIX inhibits EIAV release. 293T cells were transfected with EIAV proviral DNA alone (500 ng) (lane 1), with Flag-ALIX, Flag-DUb-ALIX, Flag-DUb-ALIXF676D or Flag- DUb*-ALIX (lanes 2, 3, 4, 5; respectively).
- FIG. 4B The active DUb-ALIX fusion protein failed to replace cellular ALIX to promote EIAV release. 293T cells were transfected twice with ALIX RNAi oligonucleotides at 36-hour intervals.
- DUb-ALIX fails to rescue HIV- 1 PTAP- budding.
- 293T cells were transfected with expression plasmids of HIV-1 PTAP- alone (1 ⁇ g) (lane 1), or in combination with Flag-ALIX (500 ng), Flag-DUb-ALIX (100 ng) or Flag-DUb*- ALIX (100 ng) (lanes 2, 3, 4; respectively).
- FIGS. 5A-5D Fusion to DUb suppresses Gag ubiquitination and ability to release virus.
- FIG. 5 A Schematic representation of DUb-Gag fusion proteins. DUb catalytic domain was fused to Gag C-terminal end.
- FIG. 5B DUb fusion to Gag suppresses ubiquitination. 293T cells were transfected with strep-tagged Gag, Gag-DUb or Gag-DUb* fusion proteins (lanes 1, 3, 5, 7, 9, 11; respectively) or in combination with HA-Ub (lanes 2, 4, 6, 8, 10, 12; respectively).
- FIG. 5C Gag-DUb* fusion protein co-assembled with WT Gag and restored the release HIV-1 PTAP-/YP-.
- 293T cells were transfected with HIV-1 PTAP-/YP- alone (lane 1), or Gag-DUb*Strep (lane 2), Gag-DUbStrep (lane 3), or with HIV-1 PTAP-/YP- and increasing amounts of either Gag-DUbStrep (500 ng, 1 ⁇ g or 2 ⁇ g) (lane 4, 5, 6) or Gag-DUb*Strep (500 ng, 1 ⁇ g or 2 ⁇ g) (lane 7, 8, 9).
- Gag-DUb fusion failed to release virus particles and inhibited HIV-1 release in trans.
- 293T cells were transfected with HIV-1 alone (1 ⁇ g) (lane 1), in combination with either Gag-DUbStrep (1.5 ⁇ g) (lane 4), or Gag-DUb*Strep (1.5 ⁇ g) (lane 5), or with Gag-DUbStrep or Gag-DUB*Strep alone (1.5 ⁇ g) (lanes 2, 3; respectively).
- Cells and virions were harvested as above and their protein contents were analyzed by WB using an anti-p24 antibody.
- FIGS. 6A-6D Nedd4-2s mediated Gag ubiquitination correlates with virus release.
- FIG. 6A Gag fusion with DUb inhibits virus budding.
- Cells were transfected with HA-Ub (lane 1) as a control or HIV-1 YP- alone (lane 2), or with both alone (lane 3), in combination with Strep-DUb-TSGlOl (200 ng) (lanes 4) or with the 3 precedent plasmids in addition to Nedd4-2s (150 ng) (lane 5).
- 293T cells expressing HIV YP- were co-transfected with either HA-Ub expression plasmid alone (lane 1), with DUb-TSGlOl (200 ng) (lane 2) or with DUb-TSGlOl (200 ng) and Nedd4-2s (150 ng) (lane 3).
- Cells were lysed and their membrane-enriched fractions (P100) were isolated.
- P100 fractions were re-suspended and were either analyzed directly by SDS-PAGE and western blotting using anti-p24CA antibody (second panel from top) or incubated with anti-HA antibody coated beads to capture HA-Ub modified proteins at the membrane.
- IP Immunoprecipitation
- 293T cells were transfected with expression plasmids of HIV-1 (1 ⁇ g) (lane 1), Gag-DUb*Strep (1.5 ⁇ g) (lane 2) or with both (lane 3), with Gag-DUbStrep alone (1.5 ⁇ g) (lane 4) or with increasing amounts of Nedd4.2s (100 and 200 ng) (lanes 5 and 6). Cells were also transfected with Gag-DUbStrep in combination with HIV-1 (lane 7) or with increasing amount of Nedd4-2s (lanes 8 and 9). In parallel, 293T cells were transfected with HIV-1 PTAP- mutant alone (lane 10) or with increasing amount of Nedd4-2s plasmid (100 and 200 ng) (lanes 11 and 12). Cell lysates (two lower panels) and virus pellet (upper panel) were harvested and analyzed by WB using the indicated antibodies. Triangles indicate lanes where increasing amounts of Nedd4-2s are expressed.
- FIGS. 7A and 7B Ubiquitination of ESCRT-I is not sufficient for HIV-1 release.
- FIGS. 7 A and 7B 293T cells were co-transfected with HA-Ub plasmid and a Flag-tagged version of ESCRT-I components (TSG101 (2.5 ⁇ g), VPS28 (800 ng), VPS37B (1.7 ⁇ g), MVB12B (800 ng); these amounts express comparable levels of ESCRT-I proteins) alone, or in addition to the following plasmids: either Gag-Strep (1.5 ⁇ g) (lanes 2, 7, 12) or Gag-DUbStrep alone (1.5 ⁇ g) (lanes 3, 8, 13) or in combination with the Nedd4-2s expression plasmid (150 ng) (lanes 4, 9, 14) and with Gag-DUb*Strep alone (1.5 ⁇ g) (lanes 5, 10, 15).
- TSG101 2.5 ⁇ g
- VPS28 800 ng
- VPS37B 1.7 ⁇ g
- MVB12B 800 ng
- these amounts express comparable levels of ESCRT-I proteins
- FIG. 7A shows a darker exposure of samples analyzed in lanes 6-10.
- FIGS. 8A and 8B Incorporation of Gag-Ubiquitin fusion protein into virus assembly sites alleviates DUb-ESCRT inhibitory effects.
- FIG. 8 A 293T cells expressing EIAV (lane 1) were also transfected with increasing amounts of EIAV Gag-Ub expression vector (500 ng and 1 ⁇ g) (lanes 2 and 3), with Flag-DUb-ALIX alone (100 ng) (lane 4), in combination with increasing amounts of Gag-Ub (500 ng and 1 ⁇ g) (lanes 5 and 6), or with inactive DUb*-ALIX alone (100 ng) (lane 7), whereas lane 8 shows expression of Gag-Ub alone.
- Virions and cells were harvested 24 hours post-transfection and their protein contents analyzed by WB using an anti-EIAV antibody. ALIX and DUb/DUb*-ALIX fusion proteins were detected by an anti-ALIX antibody.
- FIG. 8B 293T cells expressing HIV-1 YP- (lane 1), were also transfected with increasing amounts of HIV Gag-Ub expression vector (1 and 2 ⁇ g) (lanes 2 and 3), with DUb-TSGlOl alone (200 ng) (lane 4), or in combination with increasing amounts of HIV Gag-Ub expression vector (1 and 2 ⁇ g) (lanes 5 and 6), whereas lane 7 shows expression of HIV Gag-Ub alone (1 ⁇ g).
- Virions and cells were harvested 24 hours post-transfection and their protein contents analyzed by WB using an anti- p24CA antibody. TSG101 and DUb-TSGlOl fusion protein were detected with an anti-TSGlOl antibody.
- FIGS. 9A-9D DUb-TSGlOl inhibition of HIV-1 production is highly specific.
- FIG. 9A DUb-TSGlOl interferes with HIV-1 release. 293T cells were transfected with expression plasmids of HIV-1 (lane 1) and Flag-TSGlOl, Flag-DUb-TSGlOl or Flag-DUb*-TSG101 expression plasmids (lanes 2, 3, 4, respectively).
- FIGS. 9A-9D DUb-TSGlOl had no effect on
- TSG101 M95A mutant fails to inhibit HIV-1 release.
- 293T cells were transfected with expression plasmids of HIV-1 YP- alone (lane 1), or with Flag-TSGlOl (lane 2), DUb-TSGlOl (lane 3), DUb- TSG101 M95A mutant (lane 4) or the inactive form DUb*-TSG101 (lane 5).
- Cells and viruses were collected 24 hours post-transfection and their protein content was analyzed by WB using the indicated antibodies. Virus release was quantified from 3 independent experiments and expressed relative to WT virus.
- FIG. 10 DUb-ALIX and DUb*-ALIX fusion proteins retain ability to dimerize in cells.
- 293T cells were transfected with HA-tagged ALIX, DUb-ALIX or DUb*-ALIX expression vectors alone (first panel, lanes 1, 5 and 9) or in combination with Flag- ALIX (lanes 2, 6 and 10), Flag-V- PRD (lanes 3, 7 and 11) or Flag-Brol (lanes 4, 8 and 12).
- HA-tagged proteins were
- FIG. 11 Low doses of DUb-ALIX have no detectable effect on HIV-1 production.
- 293T cells were transfected with HIV-1 pro virus DNA alone (lane 1), or in combination with either the Flag-DUb-ALIX (lane 2) or DUb*- ALIX (lane 3). Twenty-four hours later, cells and virus were harvested, viral particles pelleted and their protein content analyzed by WB using the indicated antibodies. Relative virus release efficiencies were calculated from three independent experiments and expressed relative to the WT provirus and shown under panels. Error bars represent SD.
- FIGS. 12A-12D Detection of ubiquitinated Gag proteins at the plasma membrane: a tool to specifically monitor DUb activity at HIV-1 production sites.
- 293T cells expressing HIV proviral DNA were co-transfected with HA-tagged Ub-expression plasmid alone (lane 1) or with DUb-TSGlOl (lane 2).
- the PI 00 fractions were isolated and analyzed directly by WB using an HIV hyperimmune human patient serum (FIG. 12B) or incubated with an anti-HA antibody coated beads to capture HA-Ub modified proteins at the membrane.
- the captured immunocomplexes were subsequently analyzed by WB using a hyperimmune human patient serum to detect ubiquitinated Gag molecules (FIG. 12A).
- Expression of DUb-TSGlOl was assessed using an anti- TSG101 monoclonal antibody (FIG. 12D) and inhibition of virus released was confirmed using an anti-p24CA antibody (FIG. 12C, lane
- nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
- sequence Listing is submitted as an ASCII text file, created on July 16, 2015, 36.4 KB, which is incorporated by reference herein. In the accompanying sequence listing:
- SEQ ID NO: 1 is the nucleotide sequence of the DUb-TSGlOl vector insert having the following features:
- nucleotides 904-911 - Notl cloning site nucleotides 904-911 - Notl cloning site
- SEQ ID NO: 2 is the nucleotide sequence of the DUb-ALIX vector insert having the following features:
- SEQ ID NO: 3 is the nucleotide sequence of the Gag-DUb vector insert having the following features:
- SEQ ID NO: 4 is the nucleotide sequence of the inactive form of the UL36 DUb.
- SEQ ID NO: 5 is the nucleotide sequence of the human TSGlOl transcript (GENBANK 1 Accession No. NM_006292) with the following features designated:
- SEQ ID NO: 6 is the amino acid sequence of human TSGlOl (GENBANKTM Accession No. NP_006283) with the following features designated:
- SEQ ID NO: 7 is the nucleotide sequence of the human isoform 1 ALIX transcript (GENBANKTM Accession No. NM_013374) with the following features designated:
- SEQ ID NO: 8 is the amino acid sequence of human isoform 1 ALIX (GENBANKTM Accession No. NP_037506.2) with the following features designated:
- residues 703-868 - PRD SEQ ID NO: 9 is the amino acid sequence of the dimerization domain of the yeast transcription factor GCN4.
- SEQ ID NOs: 10-12 are amino acid sequence motifs that mediate protein-protein interactions.
- Adeno-associated virus A small, replication-defective, non-enveloped virus that infects humans and some other primate species. AAV is not known to cause disease and elicits a very mild immune response. Gene therapy vectors that utilize AAV can infect both dividing and quiescent cells and can persist in an extrachromosomal state without integrating into the genome of the host cell. These features make AAV an attractive viral vector for gene therapy. There are currently 11 recognized serotypes of AAV (AAVl-11).
- Adenovirus A non-enveloped virus with a liner, double- stranded DNA genome and an icosahedral capsid.
- Adl to Ad68 There are currently 68 known serotypes of human adenovirus (Adl to Ad68), which are divided into seven species (species A, B, C, D, E, F and G). Different serotypes of adenovirus are associated with different types of disease, with some serotypes causing respiratory disease (primarily species B and C), conjunctivitis (species B and D) and/or gastroenteritis (species F and G).
- Administration To provide or give a subject an agent, such as a therapeutic agent (for example, a recombinant vector or virus), by any effective route. Exemplary routes of
- administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, intraductal, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
- injection such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous
- oral intraductal, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
- Anti-retroviral agent An agent that specifically inhibits a retrovirus from replicating or infecting cells.
- antiretroviral drugs include entry inhibitors (for example, enfuvirtide), CCR5 receptor antagonists (for example, aplaviroc, vicriviroc, maraviroc), reverse transcriptase inhibitors (for example, lamivudine, zidovudine, abacavir, tenofovir, emtricitabine, efavirenz), protease inhibitors (for example, lopivar, ritonavir, raltegravir, darunavir, atazanavir) and maturation inhibitors (for example, alpha interferon, bevirimat and makecon).
- entry inhibitors for example, enfuvirtide
- CCR5 receptor antagonists for example, aplaviroc, vicriviroc, maraviroc
- reverse transcriptase inhibitors for example, lamivudine, zidovudi
- Anti-retroviral therapy A therapeutic treatment for HIV infection involving administration of at least one anti-retroviral agent (for example, one, two, three or four anti- retroviral agents) to an HIV infected individual during a course of treatment.
- antiretroviral agents include entry inhibitors (for example, enfuvirtide), CCR5 receptor antagonists (for example, aplaviroc, vicriviroc, maraviroc), reverse transcriptase inhibitors (for example, lamivudine, zidovudine, abacavir, tenofovir, emtricitabine, efavirenz), protease inhibitors (for example, lopivar, ritonavir, raltegravir, darunavir, atazanavir) and maturation inhibitors (for example, alpha interferon, bevirimat and makecon).
- An ART regimen includes treatment with a combination of tenofovir, emtricit
- ALIX Apoptosis-linked gene 2- interacting protein X
- ALIX A protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intraluminal endosomal vesicle formation and in enveloped virus budding.
- ALIX is also known as programmed cell death 6 interacting protein (PDCD6IP), AIP1, HP95 and DRIP4.
- Nucleotide and amino acid sequences for ALIX are publically available, such as under NCBI Gene ID 10015 (human ALIX). Exemplary human sequences are deposited under GENBANKTM Accession No. NM_013374.5 (isoform 1 transcript; SEQ ID NO: 7) and Accession No.
- NP_037506.2 isoform 1 protein; SEQ ID NO: 8
- the ALIX coding sequence used in exemplary vectors disclosed herein is set forth as nucleotides 914-3517 of SEQ ID NO: 2.
- ALIX is a portion of ALIX that retains the capacity to bind to HIV Gag.
- the functional fragment of ALIX comprises or consists of the Brol domain of ALIX (residues 1-367 of SEQ ID NO: 8).
- the functional fragment of ALIX comprises or consists of the Brol and V domains of ALIX (residues 1-702 of SEQ ID NO: 8).
- Budding The process by which enveloped viruses, such as HIV, acquire their host-derived envelope and exit from an infected host cell.
- Catalytic domain The portion of protein that forms the active or functional site of the protein.
- Chimeric adenovirus is an adenovirus having genetic material and/or proteins derived from at least two different serotypes (such as from Ad5 and a second serotype of adenovirus).
- Placement in direct physical association includes both in solid and liquid form.
- Degenerate variant refers to a polynucleotide encoding a peptide that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences encoding a peptide are included as long as the amino acid sequence of the peptide encoded by the nucleotide sequence is unchanged.
- Deubiquitinase or deubiquitin enzyme A protease that cleaves ubiquitin from proteins and other molecules. In humans, there are nearly 100 DUb genes, which are classified into two main groups - cysteine proteases and metalloproteases - consisting of 58 ubiquitin-specific proteases (USPs), 4 ubiquitin C-terminal hydrolases (UCHs), 5 Machado-Hosephin domain proteases (MJDs), 14 ovarian tumor proteases (OTUs), and 14 Jabl/Mov34/Mprl Padl N- terminal+ (MPN+) (JAMM) domain-containing genes.
- USPs 58 ubiquitin-specific proteases
- UCHs 4 ubiquitin C-terminal hydrolases
- MJDs 5 Machado-Hosephin domain proteases
- OFTUs ovarian tumor proteases
- the DUb is a human DUb, such as, but not limited to, USP7 (NCBI Gene ID 7874), CYLD (NCBI Gene ID 1540), AMSH (also known as STAMBP; Gene ID 10617) or UBPY (also known as USP8; Gene ID 9101).
- the DUb is a viral DUb, such as, but not limited to, UL36 (from HSV- 1 ; NCBI Gene ID 2703357) or M48 (from gamma herpesvirus).
- Domain A protein structure which retains its tertiary structure independently of the remainder of the protein. In some cases, domains have discrete functional properties and can be added, removed or transferred to another protein without a loss of function.
- Endosomal sorting complex required for transport ESCRT: Cellular machinery that enables membrane remodeling that results in membranes budding away from the cytoplasm.
- the ESCRT machinery is made up of cytosolic protein complexes known as ESCRT-0, ESCRT-I, ESCRT-II and ESCRT- III.
- ESCRT proteins play a vital role in a variety of cellular processes, including multivesicular body biogenesis, cellular abscission and viral budding (such as HIV budding).
- Enhancer A nucleic acid sequence that increases the rate of transcription by increasing the activity of a promoter.
- Fusion protein A protein containing amino acid sequence from at least two different (heterologous) proteins or peptides.
- the fusion protein comprises a DUb and HIV-1 Gag, TSG101 or ALIX.
- Fusion proteins can be generated, for example, by expression of a nucleic acid sequence engineered from nucleic acid sequences encoding at least a portion of two different (heterologous) proteins. To create a fusion protein, the nucleic acid sequences must be in the same reading frame and contain no internal stop codons. Fusion proteins, particularly short fusion proteins, can also be generated by chemical synthesis.
- Gag The retrovirus gene encoding the core structural proteins of the virus.
- the HIV Gag polyprotein includes in the N-terminal to C-terminal direction: matrix (MA; pl7), capsid (CA; p24), SP1, nucleocapsid (NC), SP2 and p6.
- the p6 domain which includes the highly conserved PTAP (Pro-Thr- Ala-Pro; SEQ ID NO: 10) and LYPX n L (Leu-Tyr-Pro-X n -Leu; SEQ ID NO: 11) sequence motifs, plays a critical role in virus release.
- a "functional fragment" of Gag is a fragment of the Gag protein that retains the capacity to incorporate into an HIV particle.
- HIV Gag proteins are publically available. Exemplary HIV-1 Gag sequences are deposited under GENBANKTM Accession No. AF033819.3 (HIV-1 complete genome) and Accession No. ACV94674.1 (HIV-1 Gag protein).
- the HIV-1 Gag nucleotide sequence used in exemplary vectors disclosed herein is set forth as nucleotides 7-1506 of SEQ ID NO: 3.
- heterologous protein or polypeptide refers to a protein or polypeptide derived from a different source or species.
- HIV Human immunodeficiency virus
- HIV disease A retrovirus that causes immunosuppression in humans (HIV disease), and leads to a disease complex known as the acquired immunodeficiency syndrome (AIDS).
- HIV disease refers to a well-recognized constellation of signs and symptoms (including the development of opportunistic infections) in persons who are infected by HIV, as determined by antibody or western blot studies. Laboratory findings associated with this disease include a progressive decline in T cells. HIV includes HIV type 1 (HIV-1) and HIV type 2 (HIV- 2).
- Related viruses that are used as animal models include simian immunodeficiency virus (SIV), and feline immunodeficiency virus (FIV). Treatment of HIV-1 with HAART has been effective in reducing the viral burden and ameliorating the effects of HIV-1 infection in infected individuals.
- Isolated An "isolated" biological component (such as a nucleic acid molecule, protein, virus or cell) has been substantially separated or purified away from other biological components in the cell or tissue of the organism, or the organism itself, in which the component naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA, proteins and cells.
- Nucleic acid molecules and proteins that have been "isolated” include those purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acid molecules and proteins.
- Late (L) domain A type of domain that plays a critical role in the pinching off of virus particles from the plasma membrane of an infected cell. L domains are found, for example, in retroviral Gag proteins. L domains contain highly conserved motifs known to mediate protein- protein interactions between cellular proteins (Freed, J Virol 76(10):4679-4687, 2002).
- L domain motifs include PTAP (which binds TSG101; VerPlank et al, Proc Natl Acad Sci USA 98(14), 7724-7729, 2001), LYPX n L (which binds ALIX) and PPXY (Pro-Pro-X-Tyr (SEQ ID NO: 12) which binds Nedd4-like ubiquitin ligases; Kikonyogo et al., Proc Natl Acad Sci USA
- Lentivirus A genus of retroviruses characterized by a long incubation period and the ability to infect non-dividing cells. Lentiviruses typically cause chronic, progressive, and often fatal disease in humans and other animals. Examples of lentiviruses include HIV, SIV, FIV and EIAV.
- Linker One or more nucleotides or amino acids that serve as a spacer between two molecules, such as between two nucleic acid molecules or two peptides (such as in a fusion protein).
- a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence.
- a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence.
- operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
- compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents.
- parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle.
- physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like
- solid compositions for example, powder, pill, tablet, or capsule forms
- conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate.
- compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- non-toxic auxiliary substances such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
- Preventing a disease refers to inhibiting the full development of a disease.
- Treating refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop.
- “Ameliorating” refers to the reduction in the number or severity of signs or symptoms of a disease.
- Promoter A region of DNA that directs/initiates transcription of a nucleic acid (for example, a gene).
- a promoter includes necessary nucleic acid sequences near the start site of transcription. Typically, promoters are located near the genes they transcribe.
- a promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription.
- a "constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an "inducible promoter" is regulated by an external signal or molecule (for example, a transcription factor or tetracycline).
- purified does not require absolute purity; rather, it is intended as a relative term.
- a purified peptide, protein, virus, or other active compound is one that is isolated in whole or in part from naturally associated proteins and other contaminants.
- substantially purified refers to a peptide, protein, virus or other active compound that has been isolated from a cell, cell culture medium, or other crude preparation and subjected to fractionation to remove various components of the initial preparation, such as proteins, cellular debris, and other components.
- a recombinant nucleic acid molecule, protein or virus is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acid molecules, such as by genetic engineering techniques.
- the term "recombinant" also includes nucleic acids, proteins and viruses that have been altered solely by addition, substitution, or deletion of a portion of the natural nucleic acid molecule, protein or virus.
- Retroviruses Enveloped viruses that replicate in a host cell through the process of reverse transcription. Retroviruses are positive sense, single-stranded RNA viruses with a spherical particle of about 80 to about 120 nm in diameter. Retrovirus particles contain two copies of the positive strand RNA genome.
- the retrovirus genome includes three primary genes coding for the viral proteins - gag-pol-env, and two regulatory genes - tat and rev. Retroviruses also have additional accessory proteins, depending on the particular virus.
- the HIV genome includes the vif, vpr, vpu and nef genes.
- Sequence identity The identity or similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods. This homology is more significant when the orthologous proteins or cDNAs are derived from species which are more closely related (such as human and mouse sequences), compared to species more distantly related (such as human and C. elegans sequences).
- BLAST Basic Local Alignment Search Tool
- NCBI National Center for Biological Information
- Serotype A group of closely related microorganisms (such as viruses) distinguished by a characteristic set of antigens.
- Subject Living multi-cellular vertebrate organisms, a category that includes human and non-human mammals.
- Synthetic Produced by artificial means in a laboratory, for example a synthetic nucleic acid can be chemically synthesized in a laboratory.
- T lymphocyte A type of lymphocyte that expresses a T-cell receptor (TCR) and plays a role in cell-mediated immunity. Most T cells mature in the thymus. T lymphocytes include, for example, T helper cells (CD4 + ), cytotoxic T cells (CD8 + ), regulatory T cells (CD4 + ) and memory T cells (CD4 + or CD8 + ). HIV infects T cells, particularly CD4 + T helper cells.
- T helper cells CD4 +
- CD8 + cytotoxic T cells
- CD4 + regulatory T cells
- CD4 + or CD8 + memory T cells
- Targeting protein is any protein or peptide capable of targeting a fusion protein (such as the fusion proteins disclosed herein) to sites of HIV assembly or budding in a host cell.
- exemplary targeting proteins include, but are not limited to, ESCRT pathway proteins, such as TSGlOl and ALIX, and HIV Gag.
- Therapeutically effective amount A quantity of a specified pharmaceutical or therapeutic agent (for example, a recombinant vector) sufficient to achieve a desired effect in a subject, or in a cell, being treated with the agent.
- the effective amount of the agent will be dependent on several factors, including, but not limited to the subject or cells being treated, and the manner of administration of the therapeutic composition.
- TSGlOl Tumor susceptibility gene 101
- TSGlOl A protein that functions in the ESCRT pathway.
- TSGlOl is also known as VPS23.
- Nucleotide and amino acid sequences for TSGlOl are publically available, such as under NCBI Gene ID 7251 (human TSGlOl).
- Exemplary human sequences are deposited under GENBANKTM Accession No. NM_006292 (transcript; SEQ ID NO: 5) and Accession No. NP_006283 (protein; SEQ ID NO: 6).
- the TSGlOl coding sequence used in exemplary vectors disclosed herein is set forth as nucleotides 912-2081 of SEQ ID NO: 1.
- a "functional fragment" of TSGlOl is a portion of TSGlOl that retains the capacity to bind to HIV Gag.
- the functional fragment of TSGlOl comprises or consists of the ubiquitin E2 variant (UEV) domain (residues 1-145 of SEQ ID NO: 6). The domain structure and functional interactions of TSGlOl are described in Pornillos et al.
- Ubiquitin (Ub) A small regulatory protein of eukaryotic organisms.
- the ubiquitin protein is 76 amino acids in length.
- Ubiquitination is a post-translational modification where ubiquitin is attached to a substrate protein.
- the addition of ubiquitin to a protein can signal for its degradation via the proteosome, alter its cellular location, alter its activity, and promote or prevent protein interactions.
- a vector is a nucleic acid molecule allowing insertion of foreign nucleic acid without disrupting the ability of the vector to replicate and/or integrate in a host cell.
- a vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication.
- a vector can also include one or more selectable marker genes and other genetic elements.
- An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of inserted gene or genes.
- the vector is a lentivirus vector, an adenovirus vector or an AAV vector.
- Gag proteins carry highly conserved sequences called "Late” or "L” domains to recruit ESCRT components to sites of virus budding.
- L domains Three types have been identified so far, and they carry the PTAP, LYPX n L and PPXY motifs, which bind TsglOl, ALIX and members of the Nedd4-like ligase family, respectively.
- TsglOl functions as part of ESCRT-I (Martin- Serrano et al., J Virol 77:4794-4804, 2003) and requires specific isoforms of ESCRT-III to promote human immunodeficiency virus (HIV) budding (Morita et al., Cell Host Microbe 9:235-242, 2011); however, mechanisms of recruitment are not known.
- ALIX binds directly to ESCRT- III members, including charged multivesicular protein 4 (CHMP4) isoforms to sever HIV away from cells (Fisher et al., Cell 128:841-852, 2007; Katoh et al., J Biol Chem 278:39104-39113, 2003).
- CHMP4 charged multivesicular protein 4
- Nedd4-like ubiquitin (Ub) ligase loss of enzymatic activity correlated with inability to function in virus release revealing the importance for Ub conjugation to components of virus budding sites.
- HIV-1 is sensitive to their stimulatory effects (Chung et al, J Virol 82:4884-4897, 2008; Sette et al, J Virol 84:8181-8192, 2010; Usami et al, J Virol 82:4898-4907, 2008).
- ESCRT-0, 1, II and III are believed to act collectively and concertedly to sort ubiquitinated cargo proteins into MVB (Babst et al., Traffic 1:248-258, 2000; Babst et al., Dev Cell 3:271-282, 2002). Indeed, covalent Ub conjugation is necessary and sufficient for the entry of cargo into the degradative MVB/lysosomal pathway (Raiborg and Stenmark, Nature 458:445-452, 2009).
- HIV-1 Gag is ubiquitinated near the nucleocapsid (NC) and p6 regions (Ott et al., Virology
- Gag ubiquitination might be dispensable for virus budding (Zhadina et al., Proc Natl Acad Sci USA 104:20031-20036, 2007).
- Zhadina et al. used spumavirus, which may be using different mechanisms from those used by HIV-1 and other enveloped viruses to produce virus.
- Alleviation of HIV budding defects by deposition of Ub in the vicinity of Gag (Weiss et al., PLoS Pathog 6:el001107, 2010; Zhadina et al., PLoS Pathog 6:el001153, 2010) suggested a role for ubiquitination of Gag-binding proteins in ⁇ budding.
- TSG101 and ALIX are ubiquitinated (Sette et al., J Virol 84:8181-8192, 2010; Amit et al., Genes Dev 18: 1737-1752, 2004) and bind Ub themselves (Joshi et al., Traffic 9: 1972-1983, 2008; Keren-Kaplan et al., EMBO J 32:538-551, 2013; Pashkova et al, Dev Cell 25:520-33, 2013; Pornillos et al., Nat Struct Biol 9:812-817, 2002).
- HIV-1 relies on the host ESCRTs for release from cells. HIV-1 Gag engages ESCRTs by directly binding TSG101 or ALIX. ESCRTs also sort ubiquitinated membrane proteins through endosomes to facilitate their lysosomal degradation. The ability of ESCRTs to recognize and process ubiquitinated proteins suggests that ESCRT-dependent viral release may also be controlled by ubiquitination. Although both Gag and ESCRTs undergo some level of ubiquitination, definitive demonstration that ubiquitin is required for viral release has previously been lacking. The present disclosure describes suppression of ubiquitination at viral budding sites by fusing the catalytic domain of the herpes simplex virus (HSV) UL36 deubiquitinating enzyme (DUb) onto TSG101, ALIX, or Gag.
- HSV herpes simplex virus
- DUb deubiquitinating enzyme
- DUb fusion proteins retained their known protein-protein interactions and efficiently inhibited virus budding in a DUb enzymatic activity-dependent manner. DUb inhibitory effects were alleviated and virus release was restored upon incorporation of Ub molecules into sites of budding as Gag-Ub fusion proteins. In the absence of ESCRTs ubiquitination, Gag ubiquitination at the membrane was sufficient to mediate virus production.
- nucleic acid molecules and vectors for delivery of deubiquitin enzymes (DUbs) to sites of HIV production and assembly.
- the disclosed nucleic acid molecules and vectors encode a fusion protein that includes a DUb fused to HIV Gag or fused to an ESCRT pathway protein, such as TSG101 or ALIX. Expression of the DUb fusion proteins suppresses ubiquitination at viral budding sites, thereby inhibiting HIV budding from infected cells.
- Nucleic acid molecules encoding DUb fusion proteins are provided herein.
- the DUb fusion proteins include a DUb catalytic domain fused to a targeting protein, wherein the targeting protein is a protein that targets the fusion protein to sites of HIV assembly or budding in a host cell.
- the DUb is a human DUb, such as, but not limited to, ubiquitin- specific protease 7 (USP7), cylindromatosis (CYLD), AMSH (also known as STAM binding protein or STAMBP) or ubiquitin- specific processing protease Y (UBPY; also known as USP8).
- the DUb is a viral DUb, for example herpes simplex virus- 1 (HSV-1) UL36 or gamma herpesvirus M48.
- HSV-1 herpes simplex virus- 1
- the DUb portion of the fusion protein includes only the DUb catalytic domain. In other examples, the DUb portion of the fusion protein includes more than the DUb catalytic domain, such as the full-length DUb.
- the DUb is UL36 and the nucleotide sequences of the catalytic domain of the DUb is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 76-813 of SEQ ID NO: 1.
- the nucleotide sequence of the catalytic domain of the DUb comprises or consists of nucleotides 76-813 of SEQ ID NO: 1.
- the targeting protein is an ESCRT pathway protein, or a functional fragment thereof.
- a "functional fragment" of an ESCRT pathway protein is a portion of the protein that retains the capacity to bind to HIV Gag.
- the targeting protein is TSG101 or a functional fragment thereof.
- the functional fragment of TSG101 comprises the UEV domain of TSG101.
- the nucleotide sequence of TSG101 is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 5.
- the nucleotide sequence of TSG101 comprises or consists of SEQ ID NO: 5.
- the functional fragment of TSG101 comprises the UEV domain and the nucleotide sequence of the UEV domain is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 141- 575 of SEQ ID NO: 5.
- the nucleotide sequence of the UEV domain comprises of consists of nucleotides 141-575 of SEQ ID NO: 5.
- the targeting protein is ALIX or a functional fragment thereof.
- the functional fragment of ALIX comprises the Brol domain of ALIX.
- the nucleotide sequence of ALIX is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 159-2765 of SEQ ID NO: 7.
- the nucleotide sequence of ALIX comprises or consists of nucleotides 159-2765 of SEQ ID NO: 7.
- the functional fragment of ALIX comprises the Brol domain and the nucleotide sequence of the Brol domain is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 159-1259 of SEQ ID NO: 7.
- the nucleotide sequence of the Brol domain comprises of consists of nucleotides 159-1259 of SEQ ID NO: 7.
- the functional fragment of ALIX comprises the Brol and V domains and the nucleotide sequence of the Brol and V domains is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 159-2264 of SEQ ID NO: 7.
- the nucleotide sequence of the Brol-V domains comprises of consists of nucleotides 159-2264 of SEQ ID NO: 7.
- the targeting protein is HIV Gag or a functional fragment thereof.
- a "functional fragment" of Gag is a portion of Gag that retains the capacity to incorporate into viral particles.
- the functional fragment of HIV Gag lacks the matrix (MA) domain, the N-terminal half of the capsid (CA) domain, or both.
- the nucleocapsid (NC) domain is replaced with a leucine zipper sequence (for example, replaced with the dimerization domain of the yeast transcription factor GCN4, an RNA binding peptide comprising the sequence RMKQLED KVEELLS KN YHLENEV ARLKKLVGER, set forth herein as SEQ ID NO: 9).
- the functional fragment of Gag is a truncated Gag lacking the MA domain and the N-terminal half of CA, and wherein NC is replaced with SEQ ID NO: 9, or another suitable leucine zipper sequence.
- the Gag protein is an HIV-1 Gag.
- the nucleotide sequence encoding Gag is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 7-1506 of SEQ ID NO: 3.
- the nucleotide sequence encoding Gag comprises or consists of nucleotides 7-1506 of SEQ ID NO: 3.
- the nucleic acid molecules further include a linker sequence between the DUb and targeting protein.
- the length and composition of the linker may vary.
- the linker is about 18 to about 180 nucleotides in length, such as about 36 to about 150 nucleotides in length, about 54 to about 120 nucleotides in length, or about 72 to about 102 nucleotides in length.
- the linker is about 90 nucleotides in length.
- the linker encodes a peptide of about 6 to about 60 amino acids in length, such as about 12 to about 50 amino acids in length, about 18 to about 40 amino acids in length, or about 24 to about 34 amino acids in length.
- the linker encodes a peptide of about 10, about 20, about 30, about 40 or about 50 amino acids in length. In non-limiting examples, the linker encodes a peptide of about 30 amino acids in length.
- the nucleotide sequence of the linker is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 814-903 of SEQ ID NO: 1. In one non- limiting examples, the nucleotide sequence of the linker comprises or consists of nucleotides 814- 903 of SEQ ID NO: 1.
- the encoded DUb is N-terminal to the targeting protein.
- the DUb is N-terminal to TSG101 or ALIX.
- the fusion protein comprises in the N-terminal to C-terminal direction a DUb catalytic domain (or full- length DUB), a linker peptide and an ESCRT protein (such as TSG101 or ALIX) or functional fragment thereof.
- the DUb is C-terminal to the targeting protein.
- the DUb is C-terminal to Gag.
- the fusion protein comprises in the N-terminal to C-terminal direction, a Gag protein or functional fragment thereof, a linker peptide and a DUb catalytic domain (or full-length DUb).
- the encoded fusion proteins may further include a tag.
- the tag can be at the N-terminus or the C-terminus.
- Exemplary tags include, but are not limited to, Flag, Strep, Myc, His, HA, chitin binding protein (CBP), maltose binding protein (MBP) and glutathione-S-transferase (GST).
- the nucleic acid molecule comprises a nucleotide sequence at least
- nucleotides 79-2081 of SEQ ID NO: 1 nucleotides 70-2087 of SEQ ID NO: 1, nucleotides 78-3517 of SEQ ID NO: 2, nucleotides 70-3523 of SEQ ID NO: 2, nucleotides 7-2342 of SEQ ID NO: 3 or nucleotides 7-2342 of SEQ ID NO: 3.
- the nucleic acid molecule comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
- the nucleic acid molecule comprises SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
- the vector is an expression vector, such as a mammalian expression vector, for example pCDNA3.
- the vector is a lentiviral vector.
- the lentiviral vector is an HIV vector (for example, an HIV-1 or HIV-2 vector), a simian immunodeficiency virus (SIV) vector, a feline immunodeficiency virus (FIV) vector, a bovine immunodeficiency virus (BIV) vector, a caprine arthritis encephalitis virus (CAEV) vector or an equine infectious anemia virus (EIAV) vector.
- HIV vector for example, an HIV-1 or HIV-2 vector
- SIV simian immunodeficiency virus
- FV feline immunodeficiency virus
- BIV bovine immunodeficiency virus
- CAEV caprine arthritis encephalitis virus
- EIAV equine infectious anemia virus
- the lentiviral vector specifically targets CD4 + T cells.
- exemplary lentivirus vectors are well-known in the art (see also section VI below).
- the vector is an adeno-associated virus (AAV) vector.
- the AAV vector can be of any suitable or desired serotype.
- the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or AAV12 vector.
- the AAV vector is a hybrid of two or more AAV serotypes, such as, but not limited to, AAV2/1, AAV2/7, AAV2/8 or AAV2/9.
- the vector is an adenovirus vector.
- the adenovirus vector can be any suitable type, such as any one of the 57 human adenovirus types (Adl to Ad57).
- Ad2 or Ad5 Ad5
- the adenovirus is a chimeric adenovirus encoding proteins from at least two different adenovirus types.
- the nucleic acid molecule encoding the DUb fusion protein is operably linked to a promoter.
- the particular promoter selected will depend upon, for example, the level of expression desired and/or the cell or tissue types targeted for expression.
- the promoter is a constitutive promoter.
- the promoter is a CMV promoter (see for example, Hermida-Matsumoto and Resh, J Virol 74: 8670-8679, 2000). In some cases, the CMV promoter is attenuated.
- the promoter is an inducible promoter. In specific non-limiting examples, the inducible promoter is a tetracycline (Tet) responsive promoter.
- the vector is a lentiviral vector with a Tet-inducible promoter.
- the cell is a T lymphocyte, such as a CD4+ T lymphocyte.
- T lymphocytes particularly autologous T lymphocytes, expressing DUb fusion proteins can be used to treat a subject infected with HIV.
- Methods of inhibiting budding of HIV from an infected cell, and methods of inhibiting cell- to-cell transmission of HIV, are also provided.
- the methods include contacting the cell(s) with a DUb fusion protein-encoding nucleic acid molecule or vector disclosed herein or with a
- the method is an ex vivo method.
- the method is an in vivo method in which contacting the cell includes administering a DUb fusion protein-encoding nucleic acid molecule or vector, administering an isolated cell comprising the nucleic acid molecule or vector, or administering a recombinant lentivirus, adenovirus or AAV expressing the DUb fusion protein, to a subject infected with HIV.
- the nucleic acid molecule, vector, virus or cell is administered by an intravenous or intramuscular route.
- the method includes administering to the subject a therapeutically effective amount of a nucleic acid molecule or vector disclosed herein, administering an isolated cell comprising the nucleic acid molecule or vector, or administering a recombinant lentivirus, adenovirus or AAV expressing the DUb fusion protein.
- the nucleic acid molecule, vector, virus or cell is administered by an intravenous or intramuscular route.
- the methods further include administering anti-retroviral therapy (ART) or highly active anti-retroviral therapy (HAART) to the subject, and/or any other therapy suitable for treatment of a patient with an HIV infection or AIDS.
- ART anti-retroviral therapy
- HAART highly active anti-retroviral therapy
- the DUb fusion protein-encoding nucleic acid molecule is incorporated into the genome of target cells ex vivo, or target cells in the subject.
- the target cells are T lymphocytes, such as CD4+ T lymphocytes.
- the vector insert sequences encoding the disclosed DUb-TSGlOl, DUb-ALIX and Gag- DUb fusion proteins are provided below and set forth herein as SEQ ID NOs: 1-3.
- the nucleic acid sequences can be inserted into any suitable vector, such as a mammalian expression vector (for example, pCDNA3), a lentivirus vector, an adenovirus vector, an adenovirus vector or an AAV vector.
- a mammalian expression vector for example, pCDNA3
- a lentivirus vector for example, an adenovirus vector, an adenovirus vector or an AAV vector.
- the exemplary constructs provided below include a tag (for example, Flag tag or Strep- Tag), a 90-nucleotide linker sequence, and specific restriction sites.
- the tags, restriction sites and linkers can be removed, replaced or modified to suit particular cloning and vector requirements.
- HindlH cloning site (upper case letters, underlined; nucleotides 70-75)
- Notl cloning site (upper case letters, underlined; nucleotides 904-911)
- TSG101 coding sequence (upper case letters; nucleotides 912-2081)
- Second Notl cloning site (upper case letters, underlined; nucleotides 906-913)
- Gag-DUb (listed in the 5' to 3' direction):
- Gag coding sequence (upper case letters; nucleotides 7-1506)
- Second Notl cloning site (upper case letters, underlined; nucleotides 2324-2431)
- Gag-DUb (SEQ ID NO: 3)
- Lentiviruses are a genus of retroviruses characterized by a long incubation period and the ability to infect non-dividing cells. Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. The higher complexity enables the virus to modulate its life cycle, as in the course of latent infection. Examples of lentiviruses include HIV, SIV, FIV and EIAV. In some cases, the lentiviral vector specifically targets CD4 + T cells.
- Lentiviral vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef have been deleted to make lentiviral vectors safe as gene therapy vectors for human use.
- Lentiviral vectors provide several advantages for gene therapy. They integrate stably into chromosomes of target cells, which is required for long-term expression, and they do not transfer viral genes, therefore avoiding the problem of generating transduced cells that can be destroyed by cytotoxic T lymphocytes.
- lentiviral vectors have a relatively large cloning capacity, sufficient for most envisioned clinical applications.
- lentiviruses are capable of transducing non-dividing cells. This is very important in the context of gene therapy for some tissue types, particularly hematopoietic cells, brain, liver, lungs and muscle.
- vectors derived from HIV-1 allow efficient in vivo and ex vivo delivery, integration and stable expression of transgenes into cells such a neurons, hepatocytes, and myocytes (Blomer et al., J Virol 71:6641-6649, 1997; Kafri et al, Nat Genet 17:314-317, 1997; Naldini et al, Science 272:263-267, 1996; Naldini et al, Curr Opin Biotechnol 9:457-463, 1998).
- the lentiviral genome and the pro viral DNA have the three genes found in retroviruses: gag, pol and env, which are flanked by two long terminal repeat (LTR) sequences.
- the gag gene encodes the internal structural (matrix, capsid and nucleocapsid) proteins; the pol gene encodes the RNA-directed DNA polymerase (reverse transcriptase), a protease and an integrase; and the env gene encodes viral envelope glycoproteins.
- the 5' and 3'LTR's serve to promote transcription and polyadenylation of the virion RNA's.
- the LTR contains all other cis-acting sequences necessary for viral replication.
- Lentiviruses also have additional genes, including vif, vpr, tat, rev, vpu, nef and vpx.
- Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient encapsidation of viral RNA into particles (the Psi site). If the sequences necessary for encapsidation (or packaging of retroviral RNA into infectious virions) are missing from the viral genome, the cis defect prevents encapsidation of genomic RNA. However, the resulting mutant remains capable of directing the synthesis of all virion proteins.
- lentiviral vectors, packaging cell lines and methods of generating lentiviral gene therapy vectors are known in the art (see, for example, Escors and Breckpot, Arch Immunol The r Exp 58(2): 107-119, 2010; Naldini et al, Science 272:263-267, 1996; Naldini et al, Proc Natl Acad Sci USA 93: 11382-11388, 1996; Naldini et al, Curr Opin Biotechnol 9:457-463, 1998; Zufferey et al., Nat Biotechnol, 15:871-875,1997; Dull et al., J Virol 72: 8463-8471, 1998; Ramezani et al., Mol Ther 2:458-469, 2000; and U.S.
- one of skill in the art is capable of selecting an appropriate lentiviral vector for cloning and expression of the DUb fusion protein-encoding nucleic acid molecules disclosed herein.
- isolated cells comprising the nucleic acid molecules or vectors disclosed herein.
- the isolated cell can be a cell (or cell line) appropriate for production of lentiviral gene therapy vectors, such as a packaging cell line.
- the cell is a HeLa cell, 293 cell or PERC.6 cell.
- compositions comprising a lentiviral vector encoding a DUb fusion protein and a pharmaceutically acceptable carrier, as well as recombinant lenti viruses expressing a DUb fusion protein or isolated cells (such as T cells, for example autologous T cells) transformed with the recombinant lenti virus and a pharmaceutically acceptable carrier, are also provided by the present disclosure.
- the compositions are formulated for intravenous or
- AAV Addeno-Associated Virus
- AAV belongs to the family Parvoviridae and the genus Dependovirus.
- AAV is a small, non-enveloped virus that packages a linear, single- stranded DNA genome. Both sense and antisense strands of AAV DNA are packaged into AAV capsids with equal frequency.
- the AAV genome is characterized by two inverted terminal repeats (ITRs) that flank two open reading frames (ORFs).
- ITRs inverted terminal repeats
- ORFs open reading frames
- the first 125 nucleotides of the ITR are a palindrome, which folds upon itself to maximize base pairing and forms a T-shaped hairpin structure.
- the other 20 bases of the ITR called the D sequence, remain unpaired.
- the ITRs are ds-acting sequences important for AAV DNA replication; the ITR is the origin of replication and serves as a primer for second-strand synthesis by DNA polymerase.
- the double- stranded DNA formed during this synthesis which is called replicating-form monomer, is used for a second round of self -priming replication and forms a replicating-form dimer.
- These double- stranded intermediates are processed via a strand displacement mechanism, resulting in single- stranded DNA used for packaging and double-stranded DNA used for transcription.
- Located within the ITR are the Rep binding elements and a terminal resolution site. These features are used by the viral regulatory protein Rep during AAV replication to process the double- stranded intermediates.
- the ITR is also essential for AAV genome packaging, transcription, negative regulation under non-permissive conditions, and site- specific integration (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).
- the left ORF of AAV contains the Rep gene, which encodes four proteins - Rep78, Rep 68, Rep52 and Rep40.
- the right ORF contains the Cap gene, which produces three viral capsid proteins (VP1, VP2 and VP3).
- the AAV capsid contains 60 viral capsid proteins arranged into an icosahedral symmetry. VP1, VP2 and VP3 are present in a 1: 1: 10 molar ratio (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).
- AAV is currently one of the most frequently used viruses for gene therapy. Although AAV infects humans and some other primate species, it is not known to cause disease and elicits a very mild immune response. Gene therapy vectors that utilize AAV can infect both dividing and quiescent cells and persist in an extrachromosomal state without integrating into the genome of the host cell. Because of the advantageous features of AAV, the present disclosure contemplates the use of AAV for the DUb fusion protein-encoding nucleic acid molecules and methods disclosed herein.
- AAV possesses several desirable features for a gene therapy vector, including the ability to bind and enter target cells, enter the nucleus, the ability to be expressed in the nucleus for a prolonged period of time, and low toxicity.
- the small size of the AAV genome limits the size of heterologous DNA that can be incorporated.
- AAV vectors have been constructed that do not encode Rep and the integration efficiency element (IEE). The ITRs are retained as they are cis signals required for packaging (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).
- rAAV recombinant AAV
- the fusion proteins described herein can be delivered and expressed using an AAV vector.
- the AAV serotype can be any suitable serotype for delivery of heterologous nucleic acids to a cell or a subject.
- the AAV vector is a serotype a serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 vector ⁇ i.e. AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1 or AAV12).
- the AAV vector is a hybrid of two or more AAV serotypes (such as, but not limited to AAV2/1, AAV2/7, AAV2/8 or AAV2/9). The selection of AAV serotype will depend in part on the cell type(s) that are targeted for gene therapy.
- isolated cells comprising the nucleic acid molecules or vectors disclosed herein.
- the isolated cell can be a cell (or cell line) appropriate for production of rAAV.
- the cell is a mammalian cell, such as a HEK-293, BHK, Vero, RD, HT-1080, A549, Cos-7, ARPE-19, or MRC-5 cell.
- Compositions comprising an AAV vector encoding a DUb fusion protein and a pharmaceutically acceptable carrier are also provided by the present disclosure.
- the compositions are formulated for intravenous or intramuscular administration. Suitable pharmaceutical formulations for administration of rAAV can be found, for example, in U.S. Patent Application Publication No. 2012/0219528.
- Adenoviruses are commonly used as vectors for the delivery of genetic material into human cells. Adenoviruses have been isolated from a large number of different species, and more than 100 different serotypes have been reported. There are currently 68 known human adenovirus serotypes. The overall organization of the adenoviral genome is conserved among serotypes, such that specific functions are similarly positioned. Most adults have been exposed to the adenovirus serotypes most commonly used in gene therapy (Ad2 and Ad5).
- the adenovirus genome is a linear, non-segmented, double stranded DNA that is approximately 34-43 kb in length.
- the adenovirus genome is flanked on both sides by inverted terminal repeat (ITR) sequences, which are essential to the replication of adenoviruses.
- ITR inverted terminal repeat
- the virus infectious cycle is divided into an early and a late phase. In the early phase, the virus is uncoated and the genome transported to the nucleus, after which the early gene regions E1-E4 become transcriptionally active.
- the early region-1 (El) contains two transcription regions named EIA and E1B.
- the EIA region (sometimes referred to as immediate early region) encodes two major proteins that are involved in modification of the host-cell cycle and activation of the other viral transcription regions.
- the E1B region encodes two major proteins, 19K and 55K, that prevent, via different routes, the induction of apoptosis resulting from the activity of the EIA proteins.
- the E1B-55K protein is required in the late phase for selective viral mRNA transport and inhibition of host protein expression.
- Early region-2 (E2) is also divided into an E2A and E2B region that together encode three proteins, DNA binding protein, viral polymerase and pre-terminal protein, all involved in replication of the viral genome.
- the E3 region is not necessary for replication in vitro but encodes several proteins that subvert the host defense mechanism towards viral infection.
- the E4 region encodes at least six proteins involved in several distinct functions related to viral mRNA splicing and transport, host-cell mRNA transport, viral and cellular transcription and transformation.
- the late proteins necessary for formation of the viral capsids and packaging of viral genomes are all generated from the major late transcription unit (MLTU) that becomes fully active after the onset of viral DNA replication.
- MLTU major late transcription unit
- a complex process of differential splicing and polyadenylation gives rise to more than 15 mRNA species that share a tripartite leader sequence.
- the early proteins E1B-55K and E4-ORF3 and ORF6 play a pivotal role in the regulation of late viral mRNA processing and transport from the nucleus.
- Adenovirus vectors are classified, for example, as first, second, third and/or fourth generation adenoviral vectors or gutless adenoviral vectors.
- the use of adenovirus vectors provides several advantages as they can be generated to very high titers of infectious particles; infect a great variety of cells; efficiently transfer genes to cells that are not dividing; and are seldom integrated in the host genome, which avoids the risk of cellular transformation by insertional mutagenesis (Douglas and Curiel, Science and Medicine, March/ April 1997, pages 44-53; Zern and Kresinam, Hepatology 25(2), 484-491, 1997).
- Representative adenoviral vectors are described by Stratford- Perricaudet et al. (J. Clin. Invest. 90: 626-630, 1992); Graham and Prevec (In Methods in
- isolated cells comprising the nucleic acid molecules or vectors disclosed herein.
- the isolated cell can be a cell (or cell line) appropriate for production of recombinant adenovirus.
- compositions comprising an adenoviral vector encoding a DUb fusion protein and a pharmaceutically acceptable carrier, as well as recombinant adenoviruses expressing a DUb fusion protein or isolated cells (such as T cells, for example autologous T cells) transformed with the recombinant adenovirus and a pharmaceutically acceptable carrier, are also provided by the present disclosure.
- the compositions are formulated for intravenous or
- Nedd4.2 was amplified from the full-length Nedd4.2 (Sette et al, J Virol 84:8181-8192, 2010) and subcloned in pcDNA3 (Invitrogen life technologies, Grand Island, NY) using HindWJKpnl sites.
- the CHMP4B expression vector was generated by PCR amplification from CHMP4B cDNA (GeneCopoeia, Germantown, MD, USA) and subcloned into pHM6 (Roche, Indianapolis, Indiana, USA) to obtain an N-terminally tagged HA-CHMP4B.
- N-terminal residues 15-260 (UL36) of the type I HSV VPl/2 tegument protein was cloned in-frame with the 5' end of ALIX and TSG101 cDNA in the p3xFlag-myc-CMV-26 and pEXPR- IBA105 vectors using the Notl site (Stringer and Piper, J Cell Biol 192:229-242, 2011) to generate DUB-ALIX and DUB-TSG101 fusion proteins.
- the respective cDNA for VPS28, VPS37 and MVB12 genes were inserted in the p3xFlag-myc-CMV-26.
- the Rev-independent HIV-1 Gag- Strep construct was amplified by PCR from the HIV- 1 Gag-EGFP construct described in Hermida- Matsumoto and Resh (J Virol 74:8670-8679, 2000) using a reverse primer containing the Strep tag sequence and cloned in pcDNA3 vector between BamHVNotl restriction sites. Additionally, the UL36 and ubiquitin sequences were inserted at the C-terminal end of Gag to generate the Gag- DUBStrep and Gag-Ub fusion proteins, respectively. To generate GST expression vectors, the HIV-1 NC-pl-p6 and the EIAV NC-p9 coding regions were subcloned in pGEX-5X-2 (GE
- 293T cells were maintained and transfected as previously described (Sette et al. , J Virol 84:8181-8192, 2010) . Twenty-four hours after transfection, cells and culture media were harvested and their protein content was analyzed using a previously described protocol (Sette et al., Structure 19: 1485-1495, 2011). HIV-1 proteins were detected using anti-HIV-1 p24 monoclonal antibody clone 183-H12-5C (NIH AIDS Reagent Program; Chesebro et al, J Virol 66:6547-6554, 1992) or NEA-9306 (NEN Life Science, Boston, MA).
- Viral infectivity was quantified using the TZM-bl cells assay (Wei et al., Antimicrob Agents Chemother 46: 1896-1905, 2002) as described in Sette et al. (J Virol 86: 11608-11615, 2012).
- HeLa TZM-bl cells were seeded (2 x 10 4 cells) in 96- well plates and the following day infected in triplicate with HIV-1 YP- or HIV-1 PTAP-rescued virus stocks in the presence of 20 ⁇ g/ml DEAE-dextran (Sigma, St. Louis, MO). After 48 hours, cells were assayed for luciferase activity using the STEAD Y-GLOTM Reagent kit (Promega, Madison, WI) according to the manufacturer's instructions. Immunoprecipitation assays
- the empty pGEX vector or pGEX vector carrying the coding sequences of NC-p6 and NC were expressed in BL21(DE3) pLysS E. coli (Stratagene) and their interactions with Flag-ALIX or Flag-DUb-ALIX were examined in GST pull-down assays following the protocol previously described (Sette et al, Structure 19: 1485-1495, 2011). Eluate complexes and cell lysates (input fractions) were analyzed by SDS-PAGE and Western blot using the indicated antibodies.
- 293T cells (2.5 x 10 6 cells/ml) were transfected with 250 pmol of a mixture of two RNAi oligonucleotides or with 75 pmol of an RNAi oligonucleotide against cellular ALIX and cellular TSG101, respectively (Invitrogen Life Technologies, Grand Island, NY). After 36 hours, cells were co-transfected with the same amount of RNAi oligos to ALIX, 500 ng of EIAVU K proviral DNA and RNAi resistant (RR) versions of 150 ng of Flag-ALIX or RR Flag-ALIXDUB expressing plasmids.
- RR RNAi resistant
- 293T cells were harvested and washed twice with cold PBS.
- the cells were resuspended in cold hypotonic buffer (10 mM Tris pH 7.5, 1 mM MgCl 2 ) and kept on ice for 30 minutes. Cells were broken to release nuclei using a pre-chilled 7 ml Dounce homogenizer.
- the samples were centrifuged at 1,000 x g at 4°C for 15 minutes to pellet nuclei and the supernatant representing the cytoplasmic fraction was centrifuged at 100,000 x g at 4°C for 1 hour to collect the membrane fraction.
- the pellet was solubilized in radioimmunoprecipitation assay (RIPA) buffer (0.5% IGEPALTM, 50 mM HEPES [pH 7.3], 150 mM NaCl, 2 mM EDTA, 20 mM ⁇ -glycerophosphate, 0.1 mM Na 3 V0 4 , 1 mM NaF, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and complete protease inhibitor cocktail) and used to perform
- RIPA radioimmunoprecipitation assay
- 293T cells were seeded at 6 x 10 5 /well of a 6- well plate and transfected the following day with 2 ⁇ g of HIV-1 YP- mutant and DUB-TSG101 expression vectors, or with EIAVuk provirus and DUB-ALIX plasmids. At 36 hours post-transfection, the supernatants were removed and the cells were fixed for 15 minutes at room temperature in 2% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4). The cells were then rinsed in cacodylate buffer and postfixed in 1% (v/v) osmium tetroxide in the same buffer.
- the samples were subsequently rinsed again in 0.1 N sodium acetate buffer (pH 4.2), stained in 0.5% uranyl acetate (v/v) in the same buffer, dehydrated in graded ethanol, then infiltrated overnight in pure epoxy resin.
- the wells were embedded in fresh resin the next day and cured at 55°C. Blocks were cut from the cured samples and mounted appropriately for ultramicrotomy. Thin sections were stained in uranyl acetate and lead citrate and stabilized by carbon evaporation. Images were obtained with a Hitachi H7600 electron microscope equipped with an AMT XL41M digital camera. Approximately 600 cells were examined for each sample and arrested budding structures attached to the cell as well as released virions were enumerated to determine the release efficiency.
- the ESCRT-I component TSGlOl binds directly to PTAP motifs within the HIV-1 Gag protein and eliminating the PTAP motif or the ability of TSGlOl to bind Gag reduces viral release by -80%.
- TSGlOl can also non-covalently bind Ub via its UEV domain and undergoes ubiquitination (Pornillos et al, EMBO J 21:2397-2406, 2002).
- a DUb fusion to TSGlOl was constructed by creating a protein comprised of the catalytic domain from the HSV UL36 DUb fused onto the N-terminus of TSGlOl (FIG. 1A).
- the DUb-TSGlOl also contained an N-terminal bivalent Strep tag for affinity purification.
- DUb* a version of TSGlOl fused to UL36 that was catalytically inactivated by a single point mutation (DUb*) was constructed.
- Active and inactive DUb-TSGlOl and DUb*-TSG101, respectively, were co-expressed in 293T cells along with HA-Ub and affinity isolated from cell lysates on Strep-ta.ct beads (FIG. IB, upper panel).
- Complexes with inactive DUb*-TSG101 showed high levels of ubiquitinated proteins revealed by anti-HA Western blot.
- the active DUb-TSGlOl fusion protein had dramatically less ubiquitinated proteins (compare lanes 4-6) even though the levels of DUb- TSGlOl and DUb*-TSG101 were comparable (compare lanes 10 and 12).
- Affinity-isolated TSGlOl, DUb-TSGlOl and DUb*-TSG101 also showed similar levels of association with the other ESCRT-I components MVB12B, VPS37B and VPS28, indicating that the fusion of active or inactive UL36 catalytic domain did not interfere with the ability of TSGlOl to assemble into its native ESCRT-I complex (FIG. IB lower, compare lanes 1, 3 and 5).
- Lysates from cells expressing Flag-tagged TSGlOl, DUb-TSGlOl or DUb*-TSG101 in combination with the other Flag-tagged ESCRT-I subunits were also subjected to GST pull-down assays with GST alone or GST fused to a fragment encompassing the NC and p6 regions of the HIV-1 Gag protein that contains binding sites for ALIX and the PTAP binding site for TSGlOl.
- FIG. 1C shows that GST-NCp6 captured ESCRT-I containing either TSGlOl, DUb-TSGlOl or DUb*-TSG101 comparably.
- DUb-TSGlOl was affinity captured on Strep-tactin beads from cells expressing a divalent strep-tagged TSGIOI, HA-Ub, and co-expressing HIV-1YP-.
- the captured TSGlOl-containing complexes were immunoprecipitated from cell fractions known to be enriched in membrane- associated insoluble Gag assembling proteins (Jager et ah, J Virol 2007, 81:9193- 9201). Immunocomplexes were immunoblotted for Gag using anti-p24 antibodies (FIG. ID, lanes 1-3), levels of ubiquitinated proteins using an anti-HA antibody (FIG.
- TSG101/ESCRT complexes and protected Gag complexes against ubiquitination TSG101/ESCRT complexes and protected Gag complexes against ubiquitination.
- DUb-TSGlOl had no effect on release of MoMLV or EIAV, which use TSGlOl-independent pathways for budding (FIG. 9B and 9C). Furthermore, a mutant DUb-TSGlOl that lost the ability to bind HIV Gag (M95A) had no effect on HIV budding (FIG. 9D, lane 3) demonstrating that DUb-TSGlOl inhibitory effect requires specific recruitment to Gag assembly sites.
- ESCRT-associated ALIX As a means to interact with the ESCRT apparatus to induce viral budding and release. Like TSGlOl, ALIX undergoes ubiquitination and also binds Ub suggesting its function or regulation is Ub-dependent. However the functional significance of these properties in virus budding has not previously been determined. To determine whether there is a role for Ub in ALIX-dependent viral budding, the effect of expressing DUb-ALIX and DUb*-ALIX comprised of ALIX fused to the C-terminus of active or inactive UL36 DUb, respectively, was assessed. These proteins were also tagged with the Flag epitope (FIG. 3A).
- DUb-ALIX had an effect on the release of two viruses that require ALIX for their budding and release. These were EIAV and a mutant HIV-1 (HIV PTAP-) where the PTAP motif within its Gag protein that mediates binding to TSG101 was eliminated (FIG. 4). It was found that expressing DUb-ALIX dramatically inhibited EIAV virus production by 90%.
- DUb-ALIX had a similar inhibitory effect on budding of HIV-1 PTAP- virus. Normally, production of HIV-1 PTAP- virus is low in 293T cells (Demirov et al., Proc Natl Acad Sci USA 99:955-960, 2002; Huang et al, J Virol 69:6810-6818, 1995), but can be greatly stimulated by overexpression of WT ALIX. However, not only did DUb-ALIX lack the ability to stimulate release of HIV-1 PTAP- virus (FIG. 4C), it also inhibited 90% of virus release supported by endogenous levels of ALIX (FIG. 4C, compare lanes 1 and 3).
- Enzymatically active and inactive UL36 were fused to the C-terminus of HIV-1 Gag protein that also contained a divalent strep tag (FIG. 5A).
- HIV-1 Gag results in the production and release of viral-like particles and a portion of the Gag protein contained within them is ubiquitinated.
- Expression of strep-tagged WT HIV-1 Gag resulted in release of Gag particles from cells (FIG. 5B lanes 7 and 8, upper).
- expression of a catalytically dead Gag-DUb* was also efficiently released from cells (lane 9 and 10).
- affinity isolation of released Gag from cells showed that both released WT Gag and Gag-DUb* were ubiquitinated (lanes 2 and 4).
- Gag-DUb containing enzymatically active UL36 was not released from cells (lanes 11 and 12), despite a level of expression comparable to Gag- DUb* (lanes 11 and 12, lower). Additionally, the intracellular Gag-DUb was not ubiquitinated as would be predicted by the presence of the active UL36, whereas a modest signal was detected for Gag-DUb* (FIG. 5B, lower). Further experiments showed that Gag-DUb could also dominantly interfere with budding of HIV-1 demonstrating the Gag-DUb inhibits in trans.
- Gag- DUb* was able to drive release of mutant HIV-1 lacking both ALIX and TSGlOl binding sites (HIV-1 PTAP-/YP-) (FIG. 5C, lanes 7-9) indicating that this Gag fusion protein could co-assemble with the mutant HrV-l Gag-containing budding virus and provide functional late domain PTAP (TSGlOl) and LYPXnL (ALIX) binding sites for interaction and scission by ESCRTs.
- TSGlOl functional late domain PTAP
- LYPXnL ALIX binding sites for interaction and scission by ESCRTs.
- enzymatically active Gag-DUb did not rescue budding of HIV-1 PTAP-/YP- virus (lanes 4-6).
- Gag-DUb also dominantly interfered with the release of WT HIV-1 virus (FIG.
- Nedd4-2s can compensate for some defects in ESCRTs or viral Gag proteins that otherwise lead to inefficient budding.
- Nedd4-2s expression also restored a detectable measure (-50%) of ubiquitinated Gag that was readily identified in released virus (compare lanes 3 and 5) where higher molecular weight Gag bands (labeled 1, 2 and 3) were also detected with the anti-p24 antibody (lanes 7-10, darker exposure).
- ubiquitination of DUb-TSGlOl in cells remained undetectable (FIG. 6B, lanes 4 and 5, upper panel).
- Gag is the target of ubiquitination at sites of virus budding
- ubiquitinated proteins were isolated using agarose beads coated with anti-HA monoclonal antibodies from PI 00 membrane fraction prepared from transfected cells, which has been shown to be enriched in Gag-containing complexes undergoing assembly into nascent virions (Goff et ah, J Virol 77:9173-9182, 2003) and probed for Gag with an anti-p24 antibody.
- Gag-DUb which would represent the most powerful and proximal way of eliminating Gag ubiquitination, was resistant to the stimulatory effects of Nedd4-2s co-expression. These data therefore suggest that ubiquitination of Gag is important for HIV-1 release.
- Gag-DUb was affinity captured on Strep-tactin beads from cells expressing Flag-tagged ESCRT-I subunits, HA- Ub, and co-expressing Nedd4-2s.
- Gag-DUb was isolated from a P100 membrane fraction known to be enriched in Gag-containing complexes undergoing assembly into virus-like particles (Goff et ah, J Virol 77:9173-9182, 2003). The captured Gag-containing complexes were immunoblotted for ESCRT-I components using an anti-Flag antibody (FIG.
- fusion of DUb to Gag led to a permanent deubiquitination and an irreversible adverse effect on HIV release despite a robust and detectable ubiquitination of ESCRT- I components.
- HIV Gag-Ub fusion protein was constructed. ALIX-independent HIV-1 release became insensitive to DUb-TSGlOl inhibitory effect upon co- expression with Gag-Ub (FIG. 8B, compare lanes 4 and 5) and virus stimulation was proportional to the levels of Gag-Ub expressed in trans (lane 6).
- Gag-Ub also enhanced budding of WT virus (compare lane 1 to lanes 2 and 3), further supporting a stimulatory role for Ub conjugation to Gag at assembly sites during HIV exit.
- Gag-Ub incorporation of Gag-Ub into nascent virus relieved DUb- ESCRT inhibitory effects, indicating that the mere presence of ubiquitin at Gag assembly sites allowed Gag to bypass DUb-ESCRT-mediated deubiquitination and restored robust virus budding further emphasizing the importance of Gag ubiquitination.
- the methods disclosed herein efficiently deubiquitinated virus budding sites by delivering DUb activity in fusion with Gag or Gag-binding proteins, the ESCRT components TSG101 and ALIX.
- Deubiquitination of virus budding using either type of DUb fusion protein caused a marked interruption of virus budding as was quantified by both biochemical and electron microscopy analyses.
- deubiquitination of ESCRT components deubiquitination of Gag brought virus release to a complete and irreversible halt despite a measurable ubiquitination of ESCRT components at sites of virus assembly.
- Ubiquitin is required for virus scission from the cell
- DUb-TSGlOl incorporated in its known cellular complex ESCRT-I and retained sufficient interaction with Gag to be captured at the membrane in late- assembly complexes.
- ALIX retained the ability to homodimerize and recruit its ESCRT- III partner CHMP4b.
- Incorporation of DUb-ESCRTs had no broad adverse effect on the host ESCRT machinery as DUb-TSGlOl inhibitory effect was specifically limited to HIV, while MoMLV and EIAV, two viruses that also utilize the ESCRT pathway to exit the cell, remained insensitive.
- Gag ubiquitination at sites of budding at the membrane was sufficient to stimulate virus release. Indeed, DUb-TSGlOl inhibitory effect on HIV budding was lifted with Nedd4-2s-mediated ubiquitination and virus production correlated with the ubiquitination of Gag complexes at the membrane (FIG. 6). Gag deubiquitination, however, caused an irreversible loss of virus production despite an efficient ubiquitination of TSG101/ESCRT-I at sites of budding, indicating that ESCRTs ubiquitination was insufficient for virus production.
- the data disclosed herein support a model in which both ubiquitin conjugation to Gag and functional L domain sequences are important for HIV budding. Indeed, interference with Gag ubiquitination by cumulative mutations of lysine residues in HIV Gag (near L domain sequences) inhibited virus production and arrested budding particles at the membrane (Gottwein et al, J Virol 80:6267-6275, 2006), although Gag retained an intact L domain. Also, disruption of L domain led to the accumulation of heavily ubiquitinated Gag at the membrane and failure to release virus (Jager et al, J Virol 81:9193-9201, 2007). Thus, deubiquitination of Gag or inability to access ESCRT appears to be equally detrimental to virus budding, suggesting both Ub and ESCRT components cooperate in particle budding and separation from cells.
- Example 2 Isolation of ubiquitinated Gag proteins from HIV-1 budding sites
- HIV-1 and most enveloped viruses utilize members of the Endosomal Sorting Complex Required for Transport (ESCRT) pathway to exit the cell (Bieniasz, Cell Host Microbe 5(6), 550- 558, 2009; Demirov and Freed, Virus Res 106(2), 87-102, 2004; Morita et al., Annu Rev Cell Dev Biol 20, 395-425, 2004; Votteler and Sundquist, Cell Host Microbe 14(3), 232-241, 2013).
- the ESCRT pathway is comprised of three multi-protein complexes, named ESCRT-I, II, and III, which catalyze membrane-modeling events critical for the budding of viruses, generation of
- HIV-1 structural protein Gag recruits TSGlOl and ALIX to gain access to members of the ESCRT pathway (Garrus et al., Cell 107(1), 55-65, 2001; Martin-Serrano et al., Nat Med 7(12), 1313-1319, 2001; Strack et al., Cell 114(6), 689-699, 2003; VerPlank et al, Proc Natl Acad Sci USA 98(14), 7724-7729, 2001).
- TSGlOl functions as part of ESCRT-I, a complex that links Gag to members of ESCRT-III.
- the ALIX-driven pathway functions independently of TSGlOl and binds ESCRT-III directly.
- ubiquitin signals the recruitment of ESCRT components and initiates sorting of ubiquitinated membrane proteins through endosomes/lysosomal compartments.
- Gag and ESCRTs undergo some level of ubiquitination, prior to the present disclosure, there has been no direct evidence of a role for ubiquitin in HIV-1 budding.
- This example describes a method to capture ubiquitinated Gag proteins at the cell membrane, the site of HIV-1 budding. The approach involves fractionation of cellular membranes and the specific detection of ubiquitinated HIV-1 Gag molecules (Gag-Ub) therein.
- the protocol is a multi-step process and comprises the initial isolation of membrane-enriched fractions (PI 00 fraction) from 293T cells expressing WT HIV-1 and HA-tagged ubiquitin.
- ubiquitinated proteins bound to membrane are isolated by immunoprecipitation assays, using an antibody that specifically recognizes HA tags fused to ubiquitin molecules.
- the immune complexes are subsequently analyzed by WB and Gag-Ub complexes are specifically detected by an anti-p24CA antibody.
- the protocol can be adapted with small changes to detect ubiquitinated Gag-binding proteins, such as TSG101 and ALIX and the other ESCRT-I members at sites of virus budding.
- Gag binding proteins are purified by co-immunoprecipitation assays.
- a tagged version of Gag protein (for example, Strep tag), competent to form virus like particles (VLPs), is isolated from the P100 membrane fractions of 293T-expressing Flag-tagged ESCRT-I subunits and HA-tagged ubiquitin.
- the captured Gag-containing complexes are probed for ESCRT-I components using an anti-Flag antibody, for ubiquitinated proteins using an anti-HA antibody, and for the Gag protein itself using an anti-Gag or anti-Strep antibody.
- 293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics (Penicillin (lOOIU/ml) and Streptomycin (100 ⁇ g/ml)) at 37°C, 5% C0 2 .
- DMEM Dulbecco's Modified Eagle Medium
- FBS fetal bovine serum
- antibiotics Penicillin (lOOIU/ml) and Streptomycin (100 ⁇ g/ml)
- Trypsin-EDTA (IX) and 2.5 x 10 6 cells were seated in 4 ml of medium per T25 flask. Ten T25 flasks were seeded to detect Gag-Ub complexes at the plasma membrane.
- cell monolayers were about 60% confluent and ready for transfection.
- Cells were transfected using LIPOFECTAMINETM 2000, according to the manufacturer instructions, using 1.5 ⁇ g of HA-ubiquitin expressing plasmid and 1 ⁇ g of the HIV-1 proviral DNA (molecular clones of HIV-1 pNL4-3) per T25 flask.
- DNA was diluted in 500 ⁇ of Opti-MEM I Reduced Serum Medium without serum and mixed gently.
- the medium was removed and the cell monolayers were washed using 5ml of cold PBS and by gently rocking the flask. An additional 5 ml of cold PBS was added; the cells from all T25 flasks were collected and combined together in a 50 ml tube. The cells were pelleted at 1,000 x g for 5 minutes. Precaution was taken to minimize aerosol formation due to the presence of live virus. Rotor bucket covers were used during centrifugation steps and/or the tubes were wrapped with PARAFILMTM.
- MgCl 2 MgCl 2 ) containing 5 mM N-ethylmaleimide (NEM) and complete protease inhibitor cocktail, and kept on ice for 30 minutes to allow cells to swell.
- NEM N-ethylmaleimide
- the samples were moved to a pre-chilled 7 ml Dounce homogenizer to break the cells and release nuclei.
- the Dounce homogenizer was kept on ice and 15 strokes were performed with a tight pestle.
- the dounced cells were collected ( ⁇ 5 ml) in a cold 15 ml tube and aliquoted into five 1.5 mL cold-labeled micro-centrifuge tubes; 1 ml of the total lysate was added to each tube.
- the samples were centrifuged at 1,000 x g at 4°C for 15 minutes to pellet the nuclei fraction (P10 fraction).
- the supernatant ( ⁇ 5 ml) representing the cytoplasmic and membrane fraction (S10 fraction) was retained and placed in a 5 ml polyallomer centrifuge tube (for Beckman SW51Ti rotor or equivalent).
- the S10 fraction was centrifuged in an ultracentrifuge at 100,000 x g at 4°C for 1 hour to pellet the membrane-enriched fraction (PI 00).
- the supernatant (SI 00) was removed and the small translucent pellet corresponding to the membrane-enriched fraction (P100) was resuspended in 100 ⁇ of SDS buffer (1% SDS, 150 mM NaCl, 50 mM Tris-HCl pH 8).
- Cold RIPA buffer (900 ⁇ of 0.5% IGEPAL, 50 mM HEPES [pH 7.3], 150 mM NaCl, 2 mM EDTA, 20 mM ⁇ -glycerophosphate, 0.1 mM Na 3 V0 4 , 1 mM NaF, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 5 mM N-ethylmaleimide (NEM) and complete protease inhibitor cocktail) was added to dilute 10 times the amount of SDS. The sample was placed in a pre-chilled 1.5 ml microcentrifuge tube and the pellet was pipetted (up and down) vigorously until the membrane was completely solubilized.
- the P100 fraction samples were incubated overnight at 4°C with 200 ⁇ of anti-HA mouse antibodies conjugated to agarose beads.
- the beads were washed (at least 5 to 7 times) by adding 1 ml of RIPA buffer for each wash and centrifuged for 2 minutes at 1000 x g to recover/pellet beads.
- the samples were heated for 5 minutes and vortexed vigorously to detach proteins from beads.
- the samples were stored at -80 °C to be analyzed by SDS-PAGE and WB.
- HrV-1 Gag-Ub proteins were detected by immunoblotting.
- a 10% acrylamide gel (size 15 cm X 15 cm) was prepared for SDS-PAGE and loaded with 200 ⁇ of each immunoprecipitation sample. In the same gel, 30 ⁇ of the P100 input fraction was also loaded. The gel was run overnight at 70 Volts.
- FIG. 12 An example of ubiquitinated HIV- 1 Gag molecules captured at the site of viral budding is shown in FIG. 12.
- the membrane-enriched fraction (P100) was isolated from 293T expressing a full-length HIV-1 and HA-tagged ubiquitin molecules (FIG. 12B, lane 1).
- HA-tagged ubiquitinated proteins were purified in immunoprecipitation assays from the P100 fraction using anti-HA antibody conjugated beads.
- the captured immunocomplexes were probed with an anti-HIV hyperimmune human patient serum and a robust signal of high molecular weight bands
- Gag-Ub complexes corresponding to Gag-Ub complexes was detected with the wild-type HIV-1 sample (FIG. 12A, lane 1).
- no Gag-Ub proteins were captured from P100 fractions of 293T cells expressing HIV-1 and the catalytic domain of the HSV UL36 deubiquitinating enzyme (DUb) fused onto the N-terminus of TSGlOl (DUb-TSGlOl) (FIGS. 12A and 12D, lane 2).
- DUb-TSGlOl co-expression of DUb-TSGlOl is predicted to prevent the accumulation of ubiquitinated forms of Gag at HIV-1 budding sites and inhibit virus release (FIG. 12C, lane 2).
- Gag-Ub capture is specific since co- expression of the deubiquitin enzyme UL36, which is delivered to HIV-1 budding sites by the Gag- binding cellular partner TSG101, and prevents ubiquitin conjugation to Gag, also interferes with the capture of Gag-Ub using this protocol.
- Example 3 Evaluation of DUb vectors in a primary cell model of HIV-1 latency
- the latent reservoir is primarily made up of a small pool of CD4+ T lymphocytes that are in a resting memory state and harbor a stably integrated, replication-competent HIV-1 pro virus. These latently infected cells are very difficult to target for elimination because they are phenotypically indistinguishable from uninfected cells. Due to the stability of the latent reservoir, HIV-infected individuals must remain on antiretro viral therapy indefinitely in order to inhibit virus propagation.
- CD4+ T lymphocytes are isolated from healthy donors. The isolated cells undergo two round of HIV-1 infection following activation through T cell receptor engagement. Isolated CD4+ T lymphocytes are plated in medium containing antibodies to CD28 on a surface that is pre-coated with antibodies to CD3. Dual binding of the antibodies to CD3 and CD28 initiates intracellular signaling cascades that turn on expression of genes required for cytokine secretion, proliferation and differentiation, which are all hallmarks of T cell activation.
- CD4+ T lymphocytes are relatively non-permissive to infection, and this natural activation produces a cell state that is receptive for HIV-1 infection.
- activated CD4+ T lymphocytes are transduced with a lentivirus expressing anti-apoptotic Bcl-2.
- the expression level of Bcl-2 in these cells is similar to that in freshly isolated CD4s ( Figure 1 of Kim et al.) and extends the lifespan of the cells ex vivo.
- the cells can be infected with an HIV-1 reporter virus following another round of activation, and then cultured without exogenous cytokines for several weeks to allow a return to a resting state in which HIV-1 latency is established.
- latently infected CD4+ T lymphocytes are generated ex vivo according to the method of Kim et al or isolated from ART-treated patient(s).
- the latently infected cells are then transduced with a recombinant lentiviral/retro viral vector encoding DUb-TSGlOl, DUb-ALIX or Gag-DUb and the effect of expression of the DUb fusion proteins on virus release is assessed.
- DUb vectors can be used to capture virus at the surface of cells in which a competent viral reservoir is newly replicating. Arresting virus particles at the surface of stimulated, latently infected cells is expected to promote clearance of the virus in vivo and enable isolation of infected cells for ex vivo studies.
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Virology (AREA)
- Medicinal Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
Abstract
Vectors designed to deliver deubiquitin enzymes (DUbs) to sites of human immunodeficiency virus (HIV) production and assembly are described. The disclosed vectors encode a fusion protein that includes a DUb fused to HIV Gag or fused to an endosomal sorting complex required for transport (ESCRT) pathway protein, such as TSG101 or ALIX. It is disclosed herein that ubiquitination of Gag is critical for release of HIV particles and that expression of the DUb fusion proteins inhibits HIV budding from infected cells.
Description
COMPOSITIONS AND METHODS FOR INHIBITING HUMAN IMMUNODEFICIENCY
VIRUS BUDDING
CROSS REFERENCE TO RELATED APPLICATIONS
This application claims the benefit of U.S. Provisional Application No. 62/030,193, filed
July 29, 2014, which is herein incorporated by reference in its entirety.
FIELD
This disclosure concerns nucleic acid molecules and vectors encoding fusion proteins that inhibit budding of enveloped viruses, such as human immunodeficiency virus (HIV), from infected cells, and methods of their use.
BACKGROUND
Most enveloped viruses need to traverse the cell membrane to acquire their membrane and spread infection, a process that involves the function of the endosomal sorting complex required for transport (ESCRT) apparatus. ESCRT members facilitate membrane fission events necessary for budding of vesicles into multivesicular bodies (MVB) (Babst et ah, Traffic 1:248-258, 2000) and abscission of daughter cells at the completion of cytokinesis (Carlton and Martin-Serrano, Science 316: 1908-1912, 2007). These processes share a common topology with virus budding in that they all involve membrane scission, which severs membranous necks away from the cytoplasm (Hurley and Hanson, Nat Rev Mol Cell Biol 11:556-566, 2010; Sundquist and Krausslich, Cold Spring Harb Perspect Med 2:a006924, 2012). The ESCRT pathway is comprised of four multi-protein complexes, named ESCRT-0, 1, II and III. An ordered recruitment of ESCRT-I and a subset of ESCRT-III components are believed to facilitate membrane-scission necessary for virus budding (Morita et al. , Cell Host Microbe 9:235-242, 2011 ; Weissenhorn and Gottlinger, Cell Host & Microbe 9: 172-174, 2011). The latter and ESCRT recycling require the activity of the AAA- ATPase VPS4 (Garrus et al, Cell 107:55-65, 2001).
SUMMARY
Described herein are nucleic acid molecules and vectors for delivery of deubiquitin enzymes (DUbs) to sites of HIV assembly and production. The disclosed nucleic acid molecules and vectors encode a fusion protein that includes a DUb fused to HIV Gag or fused to an ESCRT pathway protein, such as TSG101 or ALIX. Expression of the DUb fusion proteins inhibits HIV
budding from infected cells and cell-to-cell transmission, thereby inhibiting HIV release and spread.
Provided herein are nucleic acid molecules and vectors encoding a fusion protein that includes a DUb catalytic domain fused to a targeting protein, wherein the targeting protein is a protein that targets the fusion protein to sites of HIV assembly or budding in a host cell. In some embodiments, the targeting protein is HIV Gag, or a functional fragment thereof. In other embodiments, the targeting protein is an ESCRT protein or functional fragment thereof. Also provided are isolated cells comprising the nucleic acid molecules and vectors, recombinant viruses (such as adeno-associated viruses and lentiviruses) comprising the nucleic acid molecules, and pharmaceutical compositions comprising the nucleic acid molecules and vectors.
Further provided are methods of inhibiting budding of HIV from infected host cells, and inhibiting cell-to-cell transmission of HIV, by contacting the cells with a nucleic acid molecule or vector disclosed herein. In some embodiments, the method is an ex vivo method. In other embodiments, the method is an in vivo method in which contacting the cells includes administering the nucleic acid molecule or vector to a subject infected with HIV.
Also provided is a method of treating an HIV infection in a subject by administering to the subject a therapeutically effective amount of a nucleic acid molecule, vector, recombinant virus or isolated cell disclosed herein. The foregoing and other objects, features, and advantages of the invention will become more apparent from the following detailed description, which proceeds with reference to the accompanying figures.
BRIEF DESCRIPTION OF THE DRAWINGS FIGS. 1A-1D: Fusion of the UL36 catalytic domain DUb to TSG101 inhibits ESCRT-I ubiquitination. (FIG. 1A) Schematic representation of the DUb-TSGlOl fusion proteins. DUb and catalytically inactivated DUb (DUb*) domains were fused to TSG101 as depicted. (FIG. IB) Effect of DUb fusion to TSG101 on ESCRT-I ubiquitination. 293T cells were transfected with ESCRT-I members (Flag-tagged VPS28 (800 ng), VPS37 (1.7 μg) and MVB12 (800 ng)) and either strep-TSGlOl (2.5 μg) (lanes 1 and 7), DUb-TSGlOl (lanes 3 and 9) or DUb*-TSG101 alone (600 ng) (lanes 5 and 11), or with hemagglutinin (HA)-Ub (1.5 μg) (lanes 2, 4, 6, 8, 10, 12). Immunocomplexes were analyzed by western blotting (WB) using the indicated antibodies. (FIG. 1C) DUb-TSGlOl fusion proteins bind HIV-1 NCp6 region. Glutathione S-transferase (GST) (lanes 1, 3 and 5) and GST-NCp6 (lanes 2, 4 and 6) were captured on beads and then incubated
with lysates from 293T cells expressing Flag-ESCRT-I/TsglOl (lane 2), DUb-TSGlOl (lane 4) or DUb*-TSG101 (lane 6). Captured proteins and cell lysates were analyzed by WB using the anti- Flag antibody. GST fusion proteins were visualized by Coomassie blue staining. (FIG. ID) DUb- TSG101 deubiquitinated Gag assembly complexes. 293T cells were co-transfected with HIV-1 YP- mutant (1 μg) and HA-Ub alone (lanes 1, 4 and 7), with strep-DUb-TSG-101 (lanes 2, 4 and 6) or strep- DUb*-TSG-101 (lanes 3, 6 and 9). Insoluble Gag-enriched fractions were isolated and solubilized to Strep-Tactin-capture DUb-TSGlOl or DUb*-TSG101 containing complexes. Gag proteins associated with these complexes and their ubiquitination status assessed by antibodies to p24 and HA, respectively, and input fractions were probed with the indicated antibodies.
FIGS. 2A-2C: DUb-TSGlOl potently inhibits HIV-1 release. (FIG. 2A) Co-expression of DUb-TSGlOl inhibits HIV-1 release. 293T cells were transfected with expression plasmids of HIV-1 YP- (lane 1), or co-expressing Flag-TSGlOl, Flag-DUb-TSGlOl or Flag-DUb*-TSG101 (lanes 2, 3, 4, respectively). (FIG. 2B) DUb-TSGlOl failed to replace functionally cellular
TSG101. 293T cells were transfected twice with RNA interference (RNAi) to TSG101 (lanes 2-5) at 36-hour intervals. At the second transfection, cells were co-transfected with expression plasmids of HIV-1 YP- alone (lanes 1 and 2) or either Flag-TSG101RR (250 ng) (RNAi Resistant form), Flag- DUb-TSGlOl RR or Flag-DUb*-TSG101RR (15 ng) (lanes 3, 4, 5, respectively). Cells and viruses were collected 24 hours post-transfection and their protein content was analyzed by WB using the indicated antibodies. Virus release efficiency was also quantified using HeLa TZM-bl assays from 3 independent experiments and expressed relative to wild type (WT) HIV (FIG. 2A) or WT
TSG101 RR (FIG. 2B). (FIG. 2C) DUb-TSGlOl inhibits late steps of HIV-1 budding. Shown are electron microscopy (EM) images of thin-sectioned 293T cells co-transfected with HIV-1 and DUb-TSGlOl (panels a and b) or with DUb*-TSG101 (panel c). A high-magnification image of budding virus particles from panel (a) (rectangle) is shown in panel (b); black arrows indicate particles tethered to the plasma membrane or to each other. Quantification of budding defects was performed and approximately >250 virus particles from 2 independent experiments were examined and categorized as immature budding particles, or mature released particles; the results are shown in the graphs (±SD).
FIGS. 3A-3D: Fusion with DUb had no effect on ALIX known protein-protein interactions in the cell. (FIG. 3 A) Schematic representation of the DUb-ALIX fusion proteins. The active or inactive UL36 DUb catalytic domain was fused to the ALIX N-terminal region as depicted. (FIG. 3B) Effect of DUb fusion on ALIX ubiquitination. 293T cells were transfected with Flag-ALIX (500 ng), Flag-DUb-ALIX (500 ng) or Flag-DUb*-ALIX (500 ng) (lanes 1, 3, 5, 7, 9 and 11; respectively) or in combination with HA-Ub (lines 2, 4, 6, 8, 10 and 12; respectively).
Immunocomplexes were analyzed by western blot using the indicated antibodies. (FIG. 3C) DUb- ALIX fusion proteins bind HIV-1 NCp6 and equine infectious anemia virus (EIAV) NCp9 proteins. GST, GST-NCp6 (right panel) or GST-NCp9 (left panel) fusion proteins were purified on glutathione beads and then incubated with lysates from 293T cells expressing 1.5 g of Flag-ALIX (lanes 2 and 8), Flag-DUb-ALIX (lanes 4 and 10) or Flag-DUb*-ALIX (lanes 6 and 12). Captured proteins and cell lysates were analyzed by WB using an anti-Flag antibody and GST fusion proteins visualized by Coomassie blue staining. (FIG. 3D) DUb-ALIX fusion proteins retain binding to CHMP4B. 293T cells were co-transfected with HA-CHMP4B alone (2 μg) (control), or in combination with tyg of Flag-ALIX (lane 2), Flag-ALIXI212D (lane 3), Flag-DUb-ALIX (lane 4) or Flag-DUb*-ALIX (lane 5). Cell lysates were incubated with anti-Flag antibody-conjugated beads and both input and immunocomplexes were analyzed by WB using the indicated antibodies.
FIGS. 4A-4D: DUb-ALIX interferes with ALIX mediated virus release. (FIG. 4A) Co- expression of DUb-ALIX inhibits EIAV release. 293T cells were transfected with EIAV proviral DNA alone (500 ng) (lane 1), with Flag-ALIX, Flag-DUb-ALIX, Flag-DUb-ALIXF676D or Flag- DUb*-ALIX (lanes 2, 3, 4, 5; respectively). (FIG. 4B) The active DUb-ALIX fusion protein failed to replace cellular ALIX to promote EIAV release. 293T cells were transfected twice with ALIX RNAi oligonucleotides at 36-hour intervals. At the second transfection, cells were transfected with EIAV pro virus alone (lanes 1 and 2) or with 100 ng of RR versions of Flag-ALIX, Flag-DUb- ALIX or Flag-DUb*-ALIX (lanes 3, 4, 5; respectively). (FIG. 4C) DUb-ALIX fails to rescue HIV- 1 PTAP- budding. 293T cells were transfected with expression plasmids of HIV-1 PTAP- alone (1 μg) (lane 1), or in combination with Flag-ALIX (500 ng), Flag-DUb-ALIX (100 ng) or Flag-DUb*- ALIX (100 ng) (lanes 2, 3, 4; respectively). (FIG. 4D) Co-expression of DUb-ALIX has no effect on Moloney murine leukemia virus (MoMLV) release. 293T cells were transfected with MoMLV provirus alone (1 μg) (lane 1), with Flag-DUb-ALIX (100 ng) (lane 2) or Flag-DUb*-ALIX (100 ng) (lane 3). Protein content of pelleted virions and cell lysates was analyzed 24 hours later by WB with the indicated antibodies. Release ratio (%) was calculated using the formula described in Example 1. Error bars represent standard deviations (SD).
FIGS. 5A-5D: Fusion to DUb suppresses Gag ubiquitination and ability to release virus. (FIG. 5 A) Schematic representation of DUb-Gag fusion proteins. DUb catalytic domain was fused to Gag C-terminal end. (FIG. 5B) DUb fusion to Gag suppresses ubiquitination. 293T cells were transfected with strep-tagged Gag, Gag-DUb or Gag-DUb* fusion proteins (lanes 1, 3, 5, 7, 9, 11; respectively) or in combination with HA-Ub (lanes 2, 4, 6, 8, 10, 12; respectively). Cells and virus pellets were collected 24 hours post-transfection and incubated with Strep-Tactin beads and captured complexes were probed with the indicated antibodies. (FIG. 5C) Gag-DUb* fusion
protein co-assembled with WT Gag and restored the release HIV-1 PTAP-/YP-. 293T cells were transfected with HIV-1 PTAP-/YP- alone (lane 1), or Gag-DUb*Strep (lane 2), Gag-DUbStrep (lane 3), or with HIV-1 PTAP-/YP- and increasing amounts of either Gag-DUbStrep (500 ng, 1 μg or 2 μg) (lane 4, 5, 6) or Gag-DUb*Strep (500 ng, 1 μg or 2 μg) (lane 7, 8, 9). (FIG. 5D) Gag-DUb fusion failed to release virus particles and inhibited HIV-1 release in trans. 293T cells were transfected with HIV-1 alone (1 μg) (lane 1), in combination with either Gag-DUbStrep (1.5 μg) (lane 4), or Gag-DUb*Strep (1.5 μg) (lane 5), or with Gag-DUbStrep or Gag-DUB*Strep alone (1.5 μg) (lanes 2, 3; respectively). Cells and virions were harvested as above and their protein contents were analyzed by WB using an anti-p24 antibody.
FIGS. 6A-6D: Nedd4-2s mediated Gag ubiquitination correlates with virus release.
(FIG. 6A) Gag fusion with DUb inhibits virus budding. EM images of thin-sectioned 293T cells co-transfected with HIV-1 and either Gag-DUb and (panel a) or Gag-DUb* (panel b). Insets in both panels show high-magnification images of a budding or released virus particle and black arrows indicate arrested assembly sites (panel a) or virions (panel b). Quantification of budding defects was performed on >250 virus particles from 2 independent experiments. Particles were categorized as immature budding or mature released virus; the results are shown in the graph.
(FIG. 6B) Nedd4-2s-mediated Gag-ubiquitination relieves DUb-TSGlOl inhibitory effect on HIV- 1 release. Cells were transfected with HA-Ub (lane 1) as a control or HIV-1 YP- alone (lane 2), or with both alone (lane 3), in combination with Strep-DUb-TSGlOl (200 ng) (lanes 4) or with the 3 precedent plasmids in addition to Nedd4-2s (150 ng) (lane 5). Cells and virus were harvested at 24 hours; cell lysates were incubated with Strep-Tactin beads (StrepPD) and the captured complexes (upper panel), virus pellets (middle panel) and input fractions (lower panels) were probed with the indicated antibodies. Ubiquitination status of proteins was assessed using anti-HA antibodies (lanes 1-5, middle). (FIG. 6C) Ectopic expression of Nedd4-2s ubiquitinates Gag at the membrane. 293T cells expressing HIV YP- were co-transfected with either HA-Ub expression plasmid alone (lane 1), with DUb-TSGlOl (200 ng) (lane 2) or with DUb-TSGlOl (200 ng) and Nedd4-2s (150 ng) (lane 3). Cells were lysed and their membrane-enriched fractions (P100) were isolated. P100 fractions were re-suspended and were either analyzed directly by SDS-PAGE and western blotting using anti-p24CA antibody (second panel from top) or incubated with anti-HA antibody coated beads to capture HA-Ub modified proteins at the membrane. Immunoprecipitation (IP)-eluates were subsequently analyzed by SDS-PAGE and probed with anti-p24CA monoclonal antibodies to detect ubiquitinated Gag molecules, a method also used to evaluate virus release (third panel from top). Expression of DUb-TSGlOl and Nedd4-2s was analyzed using anti-TSGlOl and Nedd4-2s monoclonal antibodies, respectively. (FIG. 6D) Co-expression of Nedd4-2s failed to relieve the
inhibitory effect of DUb-Gag. 293T cells were transfected with expression plasmids of HIV-1 (1 μg) (lane 1), Gag-DUb*Strep (1.5 μg) (lane 2) or with both (lane 3), with Gag-DUbStrep alone (1.5 μg) (lane 4) or with increasing amounts of Nedd4.2s (100 and 200 ng) (lanes 5 and 6). Cells were also transfected with Gag-DUbStrep in combination with HIV-1 (lane 7) or with increasing amount of Nedd4-2s (lanes 8 and 9). In parallel, 293T cells were transfected with HIV-1 PTAP- mutant alone (lane 10) or with increasing amount of Nedd4-2s plasmid (100 and 200 ng) (lanes 11 and 12). Cell lysates (two lower panels) and virus pellet (upper panel) were harvested and analyzed by WB using the indicated antibodies. Triangles indicate lanes where increasing amounts of Nedd4-2s are expressed.
FIGS. 7A and 7B : Ubiquitination of ESCRT-I is not sufficient for HIV-1 release.
(FIGS. 7 A and 7B) 293T cells were co-transfected with HA-Ub plasmid and a Flag-tagged version of ESCRT-I components (TSG101 (2.5 μg), VPS28 (800 ng), VPS37B (1.7 μg), MVB12B (800 ng); these amounts express comparable levels of ESCRT-I proteins) alone, or in addition to the following plasmids: either Gag-Strep (1.5 μg) (lanes 2, 7, 12) or Gag-DUbStrep alone (1.5 μg) (lanes 3, 8, 13) or in combination with the Nedd4-2s expression plasmid (150 ng) (lanes 4, 9, 14) and with Gag-DUb*Strep alone (1.5 μg) (lanes 5, 10, 15). Sequential centrifugations were performed to separate membrane-enriched PI 00 fractions from which Gag molecules were immunoprecipitated using Strep-Tactin beads. The protein content of captured complexes (FIG. 7A), input (lower left and center panels) and virus (lower right panel) fractions were analyzed by WB with the indicated antibodies. FIG. 7B shows a darker exposure of samples analyzed in lanes 6-10.
FIGS. 8A and 8B: Incorporation of Gag-Ubiquitin fusion protein into virus assembly sites alleviates DUb-ESCRT inhibitory effects. (FIG. 8 A) 293T cells expressing EIAV (lane 1) were also transfected with increasing amounts of EIAV Gag-Ub expression vector (500 ng and 1 μg) (lanes 2 and 3), with Flag-DUb-ALIX alone (100 ng) (lane 4), in combination with increasing amounts of Gag-Ub (500 ng and 1 μg) (lanes 5 and 6), or with inactive DUb*-ALIX alone (100 ng) (lane 7), whereas lane 8 shows expression of Gag-Ub alone. Virions and cells were harvested 24 hours post-transfection and their protein contents analyzed by WB using an anti-EIAV antibody. ALIX and DUb/DUb*-ALIX fusion proteins were detected by an anti-ALIX antibody. (FIG. 8B) 293T cells expressing HIV-1 YP- (lane 1), were also transfected with increasing amounts of HIV Gag-Ub expression vector (1 and 2 μg) (lanes 2 and 3), with DUb-TSGlOl alone (200 ng) (lane 4), or in combination with increasing amounts of HIV Gag-Ub expression vector (1 and 2 μg) (lanes 5 and 6), whereas lane 7 shows expression of HIV Gag-Ub alone (1 μg). Virions and cells were harvested 24 hours post-transfection and their protein contents analyzed by WB using an anti-
p24CA antibody. TSG101 and DUb-TSGlOl fusion protein were detected with an anti-TSGlOl antibody.
FIGS. 9A-9D: DUb-TSGlOl inhibition of HIV-1 production is highly specific. (FIG. 9A) DUb-TSGlOl interferes with HIV-1 release. 293T cells were transfected with expression plasmids of HIV-1 (lane 1) and Flag-TSGlOl, Flag-DUb-TSGlOl or Flag-DUb*-TSG101 expression plasmids (lanes 2, 3, 4, respectively). (FIG. 9B) DUb-TSGlOl had no effect on
MoMLV release. 293T cells were transfected with MoMLV pro viral DNA alone (lane 1), with Flag-DUb-TSGlOl (lane 2) or Flag-DUb*-TSG101 (lane 3). (FIG. 9C) EIAV budding is immune to DUb-TSGlOl inhibitory effects. 293T cells were transfected with EIAV pro viral DNA alone (lane 1), with Flag-DUb-TSGlOl (lane 2) or Flag-DUb*-TSG101 (lane 3). (FIG. 9D) DUb-
TSG101 M95A mutant fails to inhibit HIV-1 release. 293T cells were transfected with expression plasmids of HIV-1 YP- alone (lane 1), or with Flag-TSGlOl (lane 2), DUb-TSGlOl (lane 3), DUb- TSG101 M95A mutant (lane 4) or the inactive form DUb*-TSG101 (lane 5). Cells and viruses were collected 24 hours post-transfection and their protein content was analyzed by WB using the indicated antibodies. Virus release was quantified from 3 independent experiments and expressed relative to WT virus.
FIG. 10: DUb-ALIX and DUb*-ALIX fusion proteins retain ability to dimerize in cells.
293T cells were transfected with HA-tagged ALIX, DUb-ALIX or DUb*-ALIX expression vectors alone (first panel, lanes 1, 5 and 9) or in combination with Flag- ALIX (lanes 2, 6 and 10), Flag-V- PRD (lanes 3, 7 and 11) or Flag-Brol (lanes 4, 8 and 12). HA-tagged proteins were
immunoprecipitated on HA-antibody conjugated beads and captured protein complexes (second panel) were probed for their ability to interact with Flag-ALIX and ALIX fragments V-PRD and Brol. Protein complexes and cell lysates (input fractions) were analyzed by WB using the indicated antibodies.
FIG. 11: Low doses of DUb-ALIX have no detectable effect on HIV-1 production.
293T cells were transfected with HIV-1 pro virus DNA alone (lane 1), or in combination with either the Flag-DUb-ALIX (lane 2) or DUb*- ALIX (lane 3). Twenty-four hours later, cells and virus were harvested, viral particles pelleted and their protein content analyzed by WB using the indicated antibodies. Relative virus release efficiencies were calculated from three independent experiments and expressed relative to the WT provirus and shown under panels. Error bars represent SD.
FIGS. 12A-12D: Detection of ubiquitinated Gag proteins at the plasma membrane: a tool to specifically monitor DUb activity at HIV-1 production sites. 293T cells expressing HIV proviral DNA were co-transfected with HA-tagged Ub-expression plasmid alone (lane 1) or with
DUb-TSGlOl (lane 2). The PI 00 fractions were isolated and analyzed directly by WB using an HIV hyperimmune human patient serum (FIG. 12B) or incubated with an anti-HA antibody coated beads to capture HA-Ub modified proteins at the membrane. The captured immunocomplexes were subsequently analyzed by WB using a hyperimmune human patient serum to detect ubiquitinated Gag molecules (FIG. 12A). Expression of DUb-TSGlOl was assessed using an anti- TSG101 monoclonal antibody (FIG. 12D) and inhibition of virus released was confirmed using an anti-p24CA antibody (FIG. 12C, lane 2).
SEQUENCE LISTING
The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. The Sequence Listing is submitted as an ASCII text file, created on July 16, 2015, 36.4 KB, which is incorporated by reference herein. In the accompanying sequence listing:
SEQ ID NO: 1 is the nucleotide sequence of the DUb-TSGlOl vector insert having the following features:
nucleotides 1-69 - 3X Flag tag
nucleotides 70-75 - HindlH cloning site
nucleotides 76-813 - UL36 coding sequence
nucleotides 814-903 - Linker sequence
nucleotides 904-911 - Notl cloning site
nucleotides 912-2081 - TSGlOl coding sequence
nucleotides 2082-2087 - EcoRI cloning site
SEQ ID NO: 2 is the nucleotide sequence of the DUb-ALIX vector insert having the following features:
nucleotides 1-69 - 3X Flag tag
nucleotides 70-77 - First Notl cloning site
nucleotides 78-815 - UL36 coding sequence
nucleotides 816-905 - Linker sequence
nucleotides 906-913 - Second No tl cloning site
nucleotides 914-3517 - ALIX coding sequence
nucleotides 3518-3523 - EcoRI cloning site
SEQ ID NO: 3 is the nucleotide sequence of the Gag-DUb vector insert having the following features:
nucleotides 1-6 - EcoRI cloning site
nucleotides 7-1506 - Gag coding sequence
nucleotides 1507-1514 - First Notl cloning site
nucleotides 1515-1604 - Linker sequence
nucleotides 1605-2342 - UL36 coding sequence
nucleotides 2343-2423 - Strep-Tag
nucleotides 2324-2431 - Second Notl cloning site
SEQ ID NO: 4 is the nucleotide sequence of the inactive form of the UL36 DUb.
SEQ ID NO: 5 is the nucleotide sequence of the human TSGlOl transcript (GENBANK1 Accession No. NM_006292) with the following features designated:
nucleotides 141-1313 - complete coding sequence
nucleotides 141-575 - UEV domain coding sequence
nucleotides 576-791 - proline-rich domain (PRD) coding sequence
nucleotides 792-1091 - coiled-coil domain coding sequence
nucleotides 1092-1310 - SBOX domain coding sequence
SEQ ID NO: 6 is the amino acid sequence of human TSGlOl (GENBANK™ Accession No. NP_006283) with the following features designated:
residues 1-145 - UEV domain
residues 146-217 - PRD
residues 218-317 - coiled-coil domain
residues 318-390 - SBOX domain
SEQ ID NO: 7 is the nucleotide sequence of the human isoform 1 ALIX transcript (GENBANK™ Accession No. NM_013374) with the following features designated:
nucleotides 159-2765 - complete coding sequence
nucleotides 159-1259 - Brol domain coding sequence
nucleotides 1260-2264 - V domain coding sequence
nucleotides 2265-2762 - proline-rich domain (PRD) coding sequence
SEQ ID NO: 8 is the amino acid sequence of human isoform 1 ALIX (GENBANK™ Accession No. NP_037506.2) with the following features designated:
residues 1-367 - Brol domain
residues 368-702 - V domain
residues 703-868 - PRD
SEQ ID NO: 9 is the amino acid sequence of the dimerization domain of the yeast transcription factor GCN4.
SEQ ID NOs: 10-12 are amino acid sequence motifs that mediate protein-protein interactions.
DETAILED DESCRIPTION
I. Abbreviations
AAV adeno-associated vims
Ad adenovirus
ALIX apoptosis-linked gene 2-interacting protein X
ART anti-retroviral therapy
CA capsid
CHMP charged multivesicular protein
CYLD cylindromatosis
DUb deubiquitinating enzyme or deubiquitinase
EIAV equine infectious anemia virus
EM electron microscopy
ESCRT endosomal sorting complex required for transport
FIV feline immunodeficiency virus
GST glutathione S-transferase
HA hemagglutinin
HAART highly active anti-retroviral therapy
HIV human immunodeficiency virus
HSV herpes simplex virus
IP immunoprecipitation
ITR inverted terminal repeat
LTR long terminal repeat
MA matrix
MoMLV Moloney murine leukemia virus
MVB multivesicular body
NC nucleocapsid
ORF open reading frame
PRD proline-rich domain
rAAV recombinant AAV
RIPA radioimmunoprecipitation assay
RNAi RNA interference
RR RNAi Resistant
SD standard deviation
SIV simian immunodeficiency virus
TSG101 tumor susceptibility gene 101
Ub ubiquitin
UBPY ubiquitin- specific processing protease Y
UEV ubiquitin E2 variant
USP7 ubiquitin- specific protease 7
WB western blot
WT wild type
II. Terms and Methods
Unless otherwise noted, technical terms are used according to conventional usage.
Definitions of common terms in molecular biology may be found in Benjamin Lewin, Genes V, published by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al. (eds.), The Encyclopedia of Molecular Biology , published by Blackwell Science Ltd., 1994 (ISBN 0-632- 02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).
In order to facilitate review of the various embodiments of the disclosure, the following explanations of specific terms are provided:
Adeno-associated virus (AAV): A small, replication-defective, non-enveloped virus that infects humans and some other primate species. AAV is not known to cause disease and elicits a very mild immune response. Gene therapy vectors that utilize AAV can infect both dividing and quiescent cells and can persist in an extrachromosomal state without integrating into the genome of the host cell. These features make AAV an attractive viral vector for gene therapy. There are currently 11 recognized serotypes of AAV (AAVl-11).
Adenovirus: A non-enveloped virus with a liner, double- stranded DNA genome and an icosahedral capsid. There are currently 68 known serotypes of human adenovirus (Adl to Ad68), which are divided into seven species (species A, B, C, D, E, F and G). Different serotypes of adenovirus are associated with different types of disease, with some serotypes causing respiratory disease (primarily species B and C), conjunctivitis (species B and D) and/or gastroenteritis (species F and G).
Administration: To provide or give a subject an agent, such as a therapeutic agent (for example, a recombinant vector or virus), by any effective route. Exemplary routes of
administration include, but are not limited to, injection (such as subcutaneous, intramuscular, intradermal, intraperitoneal, and intravenous), oral, intraductal, sublingual, rectal, transdermal, intranasal, vaginal and inhalation routes.
Anti-retroviral agent: An agent that specifically inhibits a retrovirus from replicating or infecting cells. Non-limiting examples of antiretroviral drugs include entry inhibitors (for example, enfuvirtide), CCR5 receptor antagonists (for example, aplaviroc, vicriviroc, maraviroc), reverse transcriptase inhibitors (for example, lamivudine, zidovudine, abacavir, tenofovir, emtricitabine, efavirenz), protease inhibitors (for example, lopivar, ritonavir, raltegravir, darunavir, atazanavir) and maturation inhibitors (for example, alpha interferon, bevirimat and vivecon).
Anti-retroviral therapy (ART): A therapeutic treatment for HIV infection involving administration of at least one anti-retroviral agent (for example, one, two, three or four anti- retroviral agents) to an HIV infected individual during a course of treatment. Non-limiting examples of antiretroviral agents include entry inhibitors (for example, enfuvirtide), CCR5 receptor antagonists (for example, aplaviroc, vicriviroc, maraviroc), reverse transcriptase inhibitors (for example, lamivudine, zidovudine, abacavir, tenofovir, emtricitabine, efavirenz), protease inhibitors (for example, lopivar, ritonavir, raltegravir, darunavir, atazanavir) and maturation inhibitors (for example, alpha interferon, bevirimat and vivecon). One example of an ART regimen includes treatment with a combination of tenofovir, emtricitabine and efavirenz. In some examples, ART includes Highly Active Anti-Retro viral Therapy (HAART).
Apoptosis-linked gene 2- interacting protein X (ALIX): A protein that functions within the ESCRT pathway in the abscission stage of cytokinesis, in intraluminal endosomal vesicle formation and in enveloped virus budding. ALIX is also known as programmed cell death 6 interacting protein (PDCD6IP), AIP1, HP95 and DRIP4. Nucleotide and amino acid sequences for ALIX are publically available, such as under NCBI Gene ID 10015 (human ALIX). Exemplary human sequences are deposited under GENBANK™ Accession No. NM_013374.5 (isoform 1 transcript; SEQ ID NO: 7) and Accession No. NP_037506.2 (isoform 1 protein; SEQ ID NO: 8). The ALIX coding sequence used in exemplary vectors disclosed herein is set forth as nucleotides 914-3517 of SEQ ID NO: 2. In the context of the present disclosure, a "functional fragment" of
ALIX is a portion of ALIX that retains the capacity to bind to HIV Gag. In some embodiments, the functional fragment of ALIX comprises or consists of the Brol domain of ALIX (residues 1-367 of SEQ ID NO: 8). In some examples, the functional fragment of ALIX comprises or consists of the Brol and V domains of ALIX (residues 1-702 of SEQ ID NO: 8).
Budding: The process by which enveloped viruses, such as HIV, acquire their host-derived envelope and exit from an infected host cell.
Catalytic domain: The portion of protein that forms the active or functional site of the protein.
Chimeric: Composed of at least two parts having different origins. In the context of the present disclosure, a "chimeric adenovirus" is an adenovirus having genetic material and/or proteins derived from at least two different serotypes (such as from Ad5 and a second serotype of adenovirus).
Contacting: Placement in direct physical association; includes both in solid and liquid form.
Degenerate variant: In the context of the present disclosure, a "degenerate variant" refers to a polynucleotide encoding a peptide that includes a sequence that is degenerate as a result of the genetic code. There are 20 natural amino acids, most of which are specified by more than one codon. Therefore, all degenerate nucleotide sequences encoding a peptide are included as long as the amino acid sequence of the peptide encoded by the nucleotide sequence is unchanged.
Deubiquitinase or deubiquitin enzyme (DUb): A protease that cleaves ubiquitin from proteins and other molecules. In humans, there are nearly 100 DUb genes, which are classified into two main groups - cysteine proteases and metalloproteases - consisting of 58 ubiquitin- specific proteases (USPs), 4 ubiquitin C-terminal hydrolases (UCHs), 5 Machado-Hosephin domain proteases (MJDs), 14 ovarian tumor proteases (OTUs), and 14 Jabl/Mov34/Mprl Padl N- terminal+ (MPN+) (JAMM) domain-containing genes. In some embodiments of the present disclosure, the DUb is a human DUb, such as, but not limited to, USP7 (NCBI Gene ID 7874), CYLD (NCBI Gene ID 1540), AMSH (also known as STAMBP; Gene ID 10617) or UBPY (also known as USP8; Gene ID 9101). In other embodiments, the DUb is a viral DUb, such as, but not limited to, UL36 (from HSV- 1 ; NCBI Gene ID 2703357) or M48 (from gamma herpesvirus).
Domain: A protein structure which retains its tertiary structure independently of the remainder of the protein. In some cases, domains have discrete functional properties and can be added, removed or transferred to another protein without a loss of function.
Endosomal sorting complex required for transport (ESCRT): Cellular machinery that enables membrane remodeling that results in membranes budding away from the cytoplasm. The ESCRT machinery is made up of cytosolic protein complexes known as ESCRT-0, ESCRT-I, ESCRT-II and ESCRT- III. ESCRT proteins play a vital role in a variety of cellular processes, including multivesicular body biogenesis, cellular abscission and viral budding (such as HIV budding).
Enhancer: A nucleic acid sequence that increases the rate of transcription by increasing the activity of a promoter.
Fusion protein: A protein containing amino acid sequence from at least two different (heterologous) proteins or peptides. In some examples herein, the fusion protein comprises a DUb and HIV-1 Gag, TSG101 or ALIX. Fusion proteins can be generated, for example, by expression of a nucleic acid sequence engineered from nucleic acid sequences encoding at least a portion of two different (heterologous) proteins. To create a fusion protein, the nucleic acid sequences must be in the same reading frame and contain no internal stop codons. Fusion proteins, particularly short fusion proteins, can also be generated by chemical synthesis.
Gag: The retrovirus gene encoding the core structural proteins of the virus. The HIV Gag polyprotein includes in the N-terminal to C-terminal direction: matrix (MA; pl7), capsid (CA; p24), SP1, nucleocapsid (NC), SP2 and p6. The p6 domain, which includes the highly conserved PTAP (Pro-Thr- Ala-Pro; SEQ ID NO: 10) and LYPXnL (Leu-Tyr-Pro-Xn-Leu; SEQ ID NO: 11) sequence motifs, plays a critical role in virus release. As used herein, a "functional fragment" of Gag is a fragment of the Gag protein that retains the capacity to incorporate into an HIV particle. Numerous HIV Gag proteins are publically available. Exemplary HIV-1 Gag sequences are deposited under GENBANK™ Accession No. AF033819.3 (HIV-1 complete genome) and Accession No. ACV94674.1 (HIV-1 Gag protein). The HIV-1 Gag nucleotide sequence used in exemplary vectors disclosed herein is set forth as nucleotides 7-1506 of SEQ ID NO: 3.
Heterologous: A heterologous protein or polypeptide refers to a protein or polypeptide derived from a different source or species.
Human immunodeficiency virus (HIV): A retrovirus that causes immunosuppression in humans (HIV disease), and leads to a disease complex known as the acquired immunodeficiency syndrome (AIDS). "HIV disease" refers to a well-recognized constellation of signs and symptoms (including the development of opportunistic infections) in persons who are infected by HIV, as determined by antibody or western blot studies. Laboratory findings associated with this disease include a progressive decline in T cells. HIV includes HIV type 1 (HIV-1) and HIV type 2 (HIV- 2). Related viruses that are used as animal models include simian immunodeficiency virus (SIV), and feline immunodeficiency virus (FIV). Treatment of HIV-1 with HAART has been effective in reducing the viral burden and ameliorating the effects of HIV-1 infection in infected individuals.
Isolated: An "isolated" biological component (such as a nucleic acid molecule, protein, virus or cell) has been substantially separated or purified away from other biological components in the cell or tissue of the organism, or the organism itself, in which the component naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA, proteins and cells. Nucleic
acid molecules and proteins that have been "isolated" include those purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acid molecules and proteins.
Late (L) domain: A type of domain that plays a critical role in the pinching off of virus particles from the plasma membrane of an infected cell. L domains are found, for example, in retroviral Gag proteins. L domains contain highly conserved motifs known to mediate protein- protein interactions between cellular proteins (Freed, J Virol 76(10):4679-4687, 2002). L domain motifs include PTAP (which binds TSG101; VerPlank et al, Proc Natl Acad Sci USA 98(14), 7724-7729, 2001), LYPXnL (which binds ALIX) and PPXY (Pro-Pro-X-Tyr (SEQ ID NO: 12) which binds Nedd4-like ubiquitin ligases; Kikonyogo et al., Proc Natl Acad Sci USA
98(20): 11199-11204, 2001).
Lentivirus: A genus of retroviruses characterized by a long incubation period and the ability to infect non-dividing cells. Lentiviruses typically cause chronic, progressive, and often fatal disease in humans and other animals. Examples of lentiviruses include HIV, SIV, FIV and EIAV.
Linker: One or more nucleotides or amino acids that serve as a spacer between two molecules, such as between two nucleic acid molecules or two peptides (such as in a fusion protein).
Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein-coding regions, in the same reading frame.
Pharmaceutically acceptable carrier: The pharmaceutically acceptable carriers (vehicles) useful in this disclosure are conventional. Remington's Pharmaceutical Sciences, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compounds, molecules or agents.
In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can
include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.
Preventing, treating or ameliorating a disease: "Preventing" a disease refers to inhibiting the full development of a disease. "Treating" refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. "Ameliorating" refers to the reduction in the number or severity of signs or symptoms of a disease.
Promoter: A region of DNA that directs/initiates transcription of a nucleic acid (for example, a gene). A promoter includes necessary nucleic acid sequences near the start site of transcription. Typically, promoters are located near the genes they transcribe. A promoter also optionally includes distal enhancer or repressor elements which can be located as much as several thousand base pairs from the start site of transcription. A "constitutive promoter" is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an "inducible promoter" is regulated by an external signal or molecule (for example, a transcription factor or tetracycline).
Purified: The term "purified" does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified peptide, protein, virus, or other active compound is one that is isolated in whole or in part from naturally associated proteins and other contaminants. In certain embodiments, the term "substantially purified" refers to a peptide, protein, virus or other active compound that has been isolated from a cell, cell culture medium, or other crude preparation and subjected to fractionation to remove various components of the initial preparation, such as proteins, cellular debris, and other components.
Recombinant: A recombinant nucleic acid molecule, protein or virus is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination can be accomplished by chemical synthesis or by the artificial manipulation of isolated segments of nucleic acid molecules, such as by genetic engineering techniques. The term "recombinant" also includes nucleic acids, proteins and viruses that have been altered solely by addition, substitution, or deletion of a portion of the natural nucleic acid molecule, protein or virus.
Retroviruses: Enveloped viruses that replicate in a host cell through the process of reverse transcription. Retroviruses are positive sense, single-stranded RNA viruses with a spherical particle of about 80 to about 120 nm in diameter. Retrovirus particles contain two copies of the
positive strand RNA genome. The retrovirus genome includes three primary genes coding for the viral proteins - gag-pol-env, and two regulatory genes - tat and rev. Retroviruses also have additional accessory proteins, depending on the particular virus. For example, the HIV genome includes the vif, vpr, vpu and nef genes.
Sequence identity: The identity or similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are. Sequence similarity can be measured in terms of percentage similarity (which takes into account conservative amino acid substitutions); the higher the percentage, the more similar the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods. This homology is more significant when the orthologous proteins or cDNAs are derived from species which are more closely related (such as human and mouse sequences), compared to species more distantly related (such as human and C. elegans sequences).
Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5: 151-3, 1989; Corpet et al, Nuc. Acids Res. 16: 10881-90, 1988; Huang et al. Computer Appls. in the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.
The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. Mol. Biol.
215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI) and on the internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.
Serotype: A group of closely related microorganisms (such as viruses) distinguished by a characteristic set of antigens.
Subject: Living multi-cellular vertebrate organisms, a category that includes human and non-human mammals.
Synthetic: Produced by artificial means in a laboratory, for example a synthetic nucleic acid can be chemically synthesized in a laboratory.
T lymphocyte: A type of lymphocyte that expresses a T-cell receptor (TCR) and plays a role in cell-mediated immunity. Most T cells mature in the thymus. T lymphocytes include, for
example, T helper cells (CD4+), cytotoxic T cells (CD8+), regulatory T cells (CD4+) and memory T cells (CD4+ or CD8+). HIV infects T cells, particularly CD4+ T helper cells.
Targeting protein: In the context of the present disclosure, a "targeting protein" is any protein or peptide capable of targeting a fusion protein (such as the fusion proteins disclosed herein) to sites of HIV assembly or budding in a host cell. Exemplary targeting proteins include, but are not limited to, ESCRT pathway proteins, such as TSGlOl and ALIX, and HIV Gag.
Therapeutically effective amount: A quantity of a specified pharmaceutical or therapeutic agent (for example, a recombinant vector) sufficient to achieve a desired effect in a subject, or in a cell, being treated with the agent. The effective amount of the agent will be dependent on several factors, including, but not limited to the subject or cells being treated, and the manner of administration of the therapeutic composition.
Tumor susceptibility gene 101 (TSGlOl): A protein that functions in the ESCRT pathway. TSGlOl is also known as VPS23. Nucleotide and amino acid sequences for TSGlOl are publically available, such as under NCBI Gene ID 7251 (human TSGlOl). Exemplary human sequences are deposited under GENBANK™ Accession No. NM_006292 (transcript; SEQ ID NO: 5) and Accession No. NP_006283 (protein; SEQ ID NO: 6). The TSGlOl coding sequence used in exemplary vectors disclosed herein is set forth as nucleotides 912-2081 of SEQ ID NO: 1. In the context of the present disclosure, a "functional fragment" of TSGlOl is a portion of TSGlOl that retains the capacity to bind to HIV Gag. In some embodiments, the functional fragment of TSGlOl comprises or consists of the ubiquitin E2 variant (UEV) domain (residues 1-145 of SEQ ID NO: 6). The domain structure and functional interactions of TSGlOl are described in Pornillos et al.
(EMBO J 21(10):2397-2406, 2002).
Ubiquitin (Ub): A small regulatory protein of eukaryotic organisms. The ubiquitin protein is 76 amino acids in length. Ubiquitination is a post-translational modification where ubiquitin is attached to a substrate protein. The addition of ubiquitin to a protein can signal for its degradation via the proteosome, alter its cellular location, alter its activity, and promote or prevent protein interactions.
Vector: A vector is a nucleic acid molecule allowing insertion of foreign nucleic acid without disrupting the ability of the vector to replicate and/or integrate in a host cell. A vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. A vector can also include one or more selectable marker genes and other genetic elements. An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of inserted gene or genes. In some embodiments herein, the vector is a lentivirus vector, an adenovirus vector or an AAV vector.
Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. The singular terms "a," "an," and "the" include plural referents unless context clearly indicates otherwise. "Comprising A or B" means including A, or B, or A and B. It is further to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are
incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting. III. Introduction
Gag proteins carry highly conserved sequences called "Late" or "L" domains to recruit ESCRT components to sites of virus budding. Three types of L domains have been identified so far, and they carry the PTAP, LYPXnL and PPXY motifs, which bind TsglOl, ALIX and members of the Nedd4-like ligase family, respectively. TsglOl functions as part of ESCRT-I (Martin- Serrano et al., J Virol 77:4794-4804, 2003) and requires specific isoforms of ESCRT-III to promote human immunodeficiency virus (HIV) budding (Morita et al., Cell Host Microbe 9:235-242, 2011); however, mechanisms of recruitment are not known. In contrast, ALIX binds directly to ESCRT- III members, including charged multivesicular protein 4 (CHMP4) isoforms to sever HIV away from cells (Fisher et al., Cell 128:841-852, 2007; Katoh et al., J Biol Chem 278:39104-39113, 2003). The reliance of the PPPY/Nedd4-like pathway on ESCRT-III function has been
demonstrated (Bouamr et al., J Virol 77: 11882-11895, 2003; Jadwin et al, J Virol 84:704-715, 2010; Martin-Serrano et al., J Cell Biol 168:89-101, 2005), although factors bridging interactions between Nedd4-like ligases and ESCRT-III are not yet known. Nedd4-like ubiquitin (Ub) ligase loss of enzymatic activity correlated with inability to function in virus release revealing the importance for Ub conjugation to components of virus budding sites. Early studies suggested that Ub also plays a role in HIV budding (Patnaik et al, Proc Natl Acad Sci USA 97: 13069-13074, 2000; Schubert et al., Proc Natl Acad Sci USA 97: 13057-13062, 2000; Strack et al., Proc Natl Acad Sci USA 97: 13063-13068, 2000). Despite the absence in Gag of canonical sequences that mediate interactions with Nedd4-like ligases, HIV-1 is sensitive to their stimulatory effects (Chung
et al, J Virol 82:4884-4897, 2008; Sette et al, J Virol 84:8181-8192, 2010; Usami et al, J Virol 82:4898-4907, 2008).
At the endosome, ESCRT-0, 1, II and III are believed to act collectively and concertedly to sort ubiquitinated cargo proteins into MVB (Babst et al., Traffic 1:248-258, 2000; Babst et al., Dev Cell 3:271-282, 2002). Indeed, covalent Ub conjugation is necessary and sufficient for the entry of cargo into the degradative MVB/lysosomal pathway (Raiborg and Stenmark, Nature 458:445-452, 2009). The ESCRT pathway is necessary for trafficking of cell surface membrane proteins through the MVB, supporting the notion that Ub conjugation to cargo signals an ESCRT-dependent entry and sorting in MVB compartments (Shields and Piper, Traffic 12: 1306-1317, 2011). Evidence of a role for Ub in ESCRT- mediated virus budding is supported by several findings (Chung et al., J
Virol 82:4884-4897, 2008; Joshi et al, Traffic 9: 1972-1983, 2008; Okumura et al, Proc Natl Acad Sci USA 103: 1440-1445, 2006; Patnaik et al., J Virol 76:2641-2647, 2002; Weiss et al., PLoS Pathog 6:el001107, 2010; Zhadina et al., PLoS Pathog 6:el001153, 2010), although a direct role for such function has not been shown.
HIV-1 Gag is ubiquitinated near the nucleocapsid (NC) and p6 regions (Ott et al., Virology
278: 111-121, 2000) and preventing Ub conjugation to Gag, or cumulative mutation of lysine residues, inhibits virus release (Gottwein et al., J Virol 80:6267-6275, 2006). Both free Ub and ubiquitinated Gag molecules are found in virions (Ott et al., J Virol 72:2962-2968, 1998) and Gag ubiquitination is highly dependent on its association with the plasma membrane (Jager et al., J Virol 81:9193-9201, 2007), implying functional significance for Ub in late assembly events. Prior studies suggested that in a certain context, Gag ubiquitination might be dispensable for virus budding (Zhadina et al., Proc Natl Acad Sci USA 104:20031-20036, 2007). However, Zhadina et al. used spumavirus, which may be using different mechanisms from those used by HIV-1 and other enveloped viruses to produce virus. Alleviation of HIV budding defects by deposition of Ub in the vicinity of Gag (Weiss et al., PLoS Pathog 6:el001107, 2010; Zhadina et al., PLoS Pathog 6:el001153, 2010) suggested a role for ubiquitination of Gag-binding proteins in ΗΓ budding.
Both TSG101 and ALIX are ubiquitinated (Sette et al., J Virol 84:8181-8192, 2010; Amit et al., Genes Dev 18: 1737-1752, 2004) and bind Ub themselves (Joshi et al., Traffic 9: 1972-1983, 2008; Keren-Kaplan et al., EMBO J 32:538-551, 2013; Pashkova et al, Dev Cell 25:520-33, 2013; Pornillos et al., Nat Struct Biol 9:812-817, 2002). ALIX loss of Ub binding sites suppressed function in virus release (Dowlatshahi et al., Dev Cell 23: 1247-54, 2012). Interferon-induced inhibition of Gag ubiquitination interfered with TSG101 recruitment (Okumura et al., Proc Natl Acad Sci USA 103: 1440-1445, 2006), suggesting a role for Ub-conjugation to Gag in virus release in vivo. Appending Gag with a Ub molecule alleviated virus budding defects due to lack of access
to the ESCRT pathway, suggesting that Ub fusion to Gag substitutes for the absence of L domain function(s) (Joshi et al, Traffic 9: 1972-1983, 2008; Patnaik et al, J Virol 76:2641-2647, 2002). Similarly, covalent conjugation of Ub to Gag correlated with ESCRT-dependent virus budding (Jadwin et al, J Virol 84:704-715, 2010), implying ubiquitination of Gag might be involved in the recruitment/utilization of ESCRT members. A natural and necessary role for Ub conjugation to either component of particle assembly sites in virus budding has not previously been demonstrated.
HIV-1 relies on the host ESCRTs for release from cells. HIV-1 Gag engages ESCRTs by directly binding TSG101 or ALIX. ESCRTs also sort ubiquitinated membrane proteins through endosomes to facilitate their lysosomal degradation. The ability of ESCRTs to recognize and process ubiquitinated proteins suggests that ESCRT-dependent viral release may also be controlled by ubiquitination. Although both Gag and ESCRTs undergo some level of ubiquitination, definitive demonstration that ubiquitin is required for viral release has previously been lacking. The present disclosure describes suppression of ubiquitination at viral budding sites by fusing the catalytic domain of the herpes simplex virus (HSV) UL36 deubiquitinating enzyme (DUb) onto TSG101, ALIX, or Gag.
Disclosed herein is the generation of ubiquitination-resistant virus assembly sites. The studies described herein demonstrate that Gag, TSG101 and ALIX became ubiquitination-resistant following fusion with the HSV UL36 (DUb) catalytic domain. DUb fusion proteins retained their known protein-protein interactions and efficiently inhibited virus budding in a DUb enzymatic activity-dependent manner. DUb inhibitory effects were alleviated and virus release was restored upon incorporation of Ub molecules into sites of budding as Gag-Ub fusion proteins. In the absence of ESCRTs ubiquitination, Gag ubiquitination at the membrane was sufficient to mediate virus production. Conversely, budding defects due to Gag deubiquitination were irreversible despite Gag-association with detectably hyperubiquitinated ESCRT complexes at the membrane. The data disclosed herein provide a direct demonstration that ubiquitin conjugation to sites of virus assembly plays an important and necessary role in ESCRT-mediated viral budding and indicate that it is ubiquitination of Gag itself that plays the critical role.
IV. Overview of Several Embodiments
Described herein are nucleic acid molecules and vectors for delivery of deubiquitin enzymes (DUbs) to sites of HIV production and assembly. The disclosed nucleic acid molecules and vectors encode a fusion protein that includes a DUb fused to HIV Gag or fused to an ESCRT pathway protein, such as TSG101 or ALIX. Expression of the DUb fusion proteins suppresses ubiquitination at viral budding sites, thereby inhibiting HIV budding from infected cells.
Nucleic acid molecules encoding DUb fusion proteins are provided herein. The DUb fusion proteins include a DUb catalytic domain fused to a targeting protein, wherein the targeting protein is a protein that targets the fusion protein to sites of HIV assembly or budding in a host cell. In some embodiments, the DUb is a human DUb, such as, but not limited to, ubiquitin- specific protease 7 (USP7), cylindromatosis (CYLD), AMSH (also known as STAM binding protein or STAMBP) or ubiquitin- specific processing protease Y (UBPY; also known as USP8). In other embodiments, the DUb is a viral DUb, for example herpes simplex virus- 1 (HSV-1) UL36 or gamma herpesvirus M48. In some examples, the DUb portion of the fusion protein includes only the DUb catalytic domain. In other examples, the DUb portion of the fusion protein includes more than the DUb catalytic domain, such as the full-length DUb.
In specific examples, the DUb is UL36 and the nucleotide sequences of the catalytic domain of the DUb is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 76-813 of SEQ ID NO: 1. In one non-limiting example, the nucleotide sequence of the catalytic domain of the DUb comprises or consists of nucleotides 76-813 of SEQ ID NO: 1.
In some embodiments, the targeting protein is an ESCRT pathway protein, or a functional fragment thereof. In the context of the present disclosure, a "functional fragment" of an ESCRT pathway protein is a portion of the protein that retains the capacity to bind to HIV Gag.
In some examples, the targeting protein is TSG101 or a functional fragment thereof. In particular examples, the functional fragment of TSG101 comprises the UEV domain of TSG101. In specific examples, the nucleotide sequence of TSG101 is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 5. In one non-limiting example, the nucleotide sequence of TSG101 comprises or consists of SEQ ID NO: 5. In other specific examples, the functional fragment of TSG101 comprises the UEV domain and the nucleotide sequence of the UEV domain is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 141- 575 of SEQ ID NO: 5. In one non-limiting example, the nucleotide sequence of the UEV domain comprises of consists of nucleotides 141-575 of SEQ ID NO: 5.
In other examples, the targeting protein is ALIX or a functional fragment thereof. In particular examples, the functional fragment of ALIX comprises the Brol domain of ALIX. In specific examples, the nucleotide sequence of ALIX is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 159-2765 of SEQ ID NO: 7. In one non-limiting example, the nucleotide sequence of ALIX comprises or consists of nucleotides 159-2765 of SEQ ID NO: 7. In other specific examples, the functional
fragment of ALIX comprises the Brol domain and the nucleotide sequence of the Brol domain is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 159-1259 of SEQ ID NO: 7. In one non-limiting example, the nucleotide sequence of the Brol domain comprises of consists of nucleotides 159-1259 of SEQ ID NO: 7. In other particular examples, the functional fragment of ALIX comprises the Brol and V domains and the nucleotide sequence of the Brol and V domains is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 159-2264 of SEQ ID NO: 7. In one non-limiting example, the nucleotide sequence of the Brol-V domains comprises of consists of nucleotides 159-2264 of SEQ ID NO: 7.
In other embodiments, the targeting protein is HIV Gag or a functional fragment thereof. In the context of the present disclosure, a "functional fragment" of Gag is a portion of Gag that retains the capacity to incorporate into viral particles. In some examples, the functional fragment of HIV Gag lacks the matrix (MA) domain, the N-terminal half of the capsid (CA) domain, or both. In some examples, the nucleocapsid (NC) domain is replaced with a leucine zipper sequence (for example, replaced with the dimerization domain of the yeast transcription factor GCN4, an RNA binding peptide comprising the sequence RMKQLED KVEELLS KN YHLENEV ARLKKLVGER, set forth herein as SEQ ID NO: 9). In one non-limiting example, the functional fragment of Gag is a truncated Gag lacking the MA domain and the N-terminal half of CA, and wherein NC is replaced with SEQ ID NO: 9, or another suitable leucine zipper sequence. In some examples, the Gag protein is an HIV-1 Gag. In particular examples, the nucleotide sequence encoding Gag is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 7-1506 of SEQ ID NO: 3. In one non-limiting example, the nucleotide sequence encoding Gag comprises or consists of nucleotides 7-1506 of SEQ ID NO: 3.
In some embodiments, the nucleic acid molecules further include a linker sequence between the DUb and targeting protein. The length and composition of the linker may vary. In some examples, the linker is about 18 to about 180 nucleotides in length, such as about 36 to about 150 nucleotides in length, about 54 to about 120 nucleotides in length, or about 72 to about 102 nucleotides in length. In particular examples, the linker is about 90 nucleotides in length. In some examples, the linker encodes a peptide of about 6 to about 60 amino acids in length, such as about 12 to about 50 amino acids in length, about 18 to about 40 amino acids in length, or about 24 to about 34 amino acids in length. In particular examples, the linker encodes a peptide of about 10, about 20, about 30, about 40 or about 50 amino acids in length. In non-limiting examples, the linker encodes a peptide of about 30 amino acids in length. In particular examples, the nucleotide sequence of the linker is at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least
97%, at least 98% or at least 99% identical to nucleotides 814-903 of SEQ ID NO: 1. In one non- limiting examples, the nucleotide sequence of the linker comprises or consists of nucleotides 814- 903 of SEQ ID NO: 1.
In some embodiments, the encoded DUb is N-terminal to the targeting protein. In particular examples, the DUb is N-terminal to TSG101 or ALIX. Thus, in non-limiting embodiments, the fusion protein comprises in the N-terminal to C-terminal direction a DUb catalytic domain (or full- length DUB), a linker peptide and an ESCRT protein (such as TSG101 or ALIX) or functional fragment thereof. In other embodiments, the DUb is C-terminal to the targeting protein. In particular examples, the DUb is C-terminal to Gag. Thus, in non-limiting embodiments, the fusion protein comprises in the N-terminal to C-terminal direction, a Gag protein or functional fragment thereof, a linker peptide and a DUb catalytic domain (or full-length DUb). The encoded fusion proteins may further include a tag. The tag can be at the N-terminus or the C-terminus. Exemplary tags include, but are not limited to, Flag, Strep, Myc, His, HA, chitin binding protein (CBP), maltose binding protein (MBP) and glutathione-S-transferase (GST).
In particular examples, the nucleic acid molecule comprises a nucleotide sequence at least
80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to nucleotides 79-2081 of SEQ ID NO: 1, nucleotides 70-2087 of SEQ ID NO: 1, nucleotides 78-3517 of SEQ ID NO: 2, nucleotides 70-3523 of SEQ ID NO: 2, nucleotides 7-2342 of SEQ ID NO: 3 or nucleotides 7-2342 of SEQ ID NO: 3. In specific examples, the nucleic acid molecule comprises a nucleotide sequence at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% identical to SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3. In non-limiting examples, the nucleic acid molecule comprises SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 3.
Also provided are vectors comprising a DUb fusion protein-encoding nucleic acid molecule disclosed herein. In some embodiments, the vector is an expression vector, such as a mammalian expression vector, for example pCDNA3. In other embodiments, the vector is a lentiviral vector. In some examples, the lentiviral vector is an HIV vector (for example, an HIV-1 or HIV-2 vector), a simian immunodeficiency virus (SIV) vector, a feline immunodeficiency virus (FIV) vector, a bovine immunodeficiency virus (BIV) vector, a caprine arthritis encephalitis virus (CAEV) vector or an equine infectious anemia virus (EIAV) vector. In particular examples, the lentiviral vector specifically targets CD4+ T cells. Exemplary lentivirus vectors are well-known in the art (see also section VI below). In other embodiments, the vector is an adeno-associated virus (AAV) vector. The AAV vector can be of any suitable or desired serotype. In some examples, the AAV vector is an AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11 or
AAV12 vector. In yet other examples, the AAV vector is a hybrid of two or more AAV serotypes, such as, but not limited to, AAV2/1, AAV2/7, AAV2/8 or AAV2/9. AAV vectors are well-known in the art (see also section VII below). In other embodiments, the vector is an adenovirus vector. The adenovirus vector can be any suitable type, such as any one of the 57 human adenovirus types (Adl to Ad57). In some examples, the adenovirus Ad2 or Ad5. In other examples, the adenovirus is a chimeric adenovirus encoding proteins from at least two different adenovirus types.
In some embodiments of the vector, the nucleic acid molecule encoding the DUb fusion protein is operably linked to a promoter. The particular promoter selected will depend upon, for example, the level of expression desired and/or the cell or tissue types targeted for expression. In some examples, the promoter is a constitutive promoter. In particular examples, the promoter is a CMV promoter (see for example, Hermida-Matsumoto and Resh, J Virol 74: 8670-8679, 2000). In some cases, the CMV promoter is attenuated. In other examples, the promoter is an inducible promoter. In specific non-limiting examples, the inducible promoter is a tetracycline (Tet) responsive promoter.
In some embodiments, the vector is a lentiviral vector with a Tet-inducible promoter.
Further provided are isolated cells comprising a nucleic acid molecule or vector disclosed herein. In some embodiments, the cell is a T lymphocyte, such as a CD4+ T lymphocyte. T lymphocytes, particularly autologous T lymphocytes, expressing DUb fusion proteins can be used to treat a subject infected with HIV.
Also provided are recombinant lentiviruses, adenoviruses and AAVs expressing the DUb fusion proteins disclosed herein.
Methods of inhibiting budding of HIV from an infected cell, and methods of inhibiting cell- to-cell transmission of HIV, are also provided. The methods include contacting the cell(s) with a DUb fusion protein-encoding nucleic acid molecule or vector disclosed herein or with a
recombinant lentivirus, adenovirus or AAV expressing a DUb fusion protein disclosed herein. In some embodiments, the method is an ex vivo method. In other embodiments, the method is an in vivo method in which contacting the cell includes administering a DUb fusion protein-encoding nucleic acid molecule or vector, administering an isolated cell comprising the nucleic acid molecule or vector, or administering a recombinant lentivirus, adenovirus or AAV expressing the DUb fusion protein, to a subject infected with HIV. In some examples, the nucleic acid molecule, vector, virus or cell is administered by an intravenous or intramuscular route.
Also provided is a method of treating an HIV infection in a subject. The method includes administering to the subject a therapeutically effective amount of a nucleic acid molecule or vector disclosed herein, administering an isolated cell comprising the nucleic acid molecule or vector, or
administering a recombinant lentivirus, adenovirus or AAV expressing the DUb fusion protein. In some examples, the nucleic acid molecule, vector, virus or cell is administered by an intravenous or intramuscular route.
In some embodiments, the methods further include administering anti-retroviral therapy (ART) or highly active anti-retroviral therapy (HAART) to the subject, and/or any other therapy suitable for treatment of a patient with an HIV infection or AIDS.
In some embodiments of the methods, the DUb fusion protein-encoding nucleic acid molecule is incorporated into the genome of target cells ex vivo, or target cells in the subject. In some examples, the target cells are T lymphocytes, such as CD4+ T lymphocytes.
V. Vector Insert Sequences
The vector insert sequences encoding the disclosed DUb-TSGlOl, DUb-ALIX and Gag- DUb fusion proteins are provided below and set forth herein as SEQ ID NOs: 1-3. The nucleic acid sequences can be inserted into any suitable vector, such as a mammalian expression vector (for example, pCDNA3), a lentivirus vector, an adenovirus vector, an adenovirus vector or an AAV vector. The exemplary constructs provided below include a tag (for example, Flag tag or Strep- Tag), a 90-nucleotide linker sequence, and specific restriction sites. However, one of skill in the art will understand that the tags, restriction sites and linkers can be removed, replaced or modified to suit particular cloning and vector requirements.
Features of DUb-TSGlOl (listed in the 5' to 3' direction):
3X Flag tag (upper case letters; nucleotides 1-69)
HindlH cloning site (upper case letters, underlined; nucleotides 70-75)
UL36 coding sequence (lower case letters; nucleotides 76-813)
Linker sequence (upper case letters, bold; nucleotides 814-903)
Notl cloning site (upper case letters, underlined; nucleotides 904-911)
TSG101 coding sequence (upper case letters; nucleotides 912-2081)
EcoRI cloning site (upper case letters, underlined; nucleotides 2082-2087) DUb-TSGlOl (SEQ ID NO: 1)
ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGAT GACAAGAAGCTTggggatcgcgacatcgtggtcaccggtgctcgggaccagttcgcgcccgacctggagccgggggggtcggtatcgtgcat gcgctcgtcgctgtcctttctcagcctcatatttgatgtgggccctcgcgacgttctgtccgcggaggccatcgagggttgtttggtcgaggggggcgagtgga cgcgcgcgaccgcgggccctgggccgccgcgcatgtgttcgatcgtcgagctccccaacttcctcgagtacccaggggcgcgcggcggactgcgctgtg tcttctcgcgcgtatacggcgaggtgggcttcttcggggagcccgcggcgggcctgctggagacacaatgccccgcacacacgttcttcgccggcccgtgg
gccctgcgccccctgtcgtacacgctcctaaccattggccccctagggatggggctgttcagggacggcgacaccgcatacctttttgacccgcacggcctt ccggagggcacccccgcgttcatcgccaaagtgcgggcgggggacatgtatccatacctgacgtattacacccgcgatcgcccggacgtacggtgggcg ggagccatggtgtttttcgtgccgtcgggcccggaacccgcggctcctgcggacttgacggccgcggctctgcatctttacggggccagcgagacttacctg caggacgaagcgttcagcgaacggcgcgtggccatcacgcaccccctgcggGAACAACTTAACTCCAATGAAATTATTCA AAGAAAAAGACAGCACCAGCATCAGCATTACGACCAACAAATATTACAACCGCAAAGGGC GGCGGCCGCGCGGTGTCGGAGAGCCAGCTCAAGAAAATGGTGTCCAAGTACAAATACAGAGA CCTAACTGTACGTGAAACTGTCAATGTTATTACTCTATACAAAGATCTCAAACCTGTTTTGGAT
CTTATAGAGGTAATACATACAATATTCCAATATGCCTATGGCTACTGGACACATACCCATATAA TCCCCCTATCTGTTTTGTTAAGCCTACTAGTTCAATGACTATTAAAACAGGAAAGCATGTTGAT GCAAATGGGAAGATATATCTTCCTTATCTACATGAATGGAAACACCCACAGTCAGACTTGTTGG GGCTTATTCAGGTCATGATTGTGGTATTTGGAGATGAACCTCCAGTCTTCTCTCGTCCTATTTCG GCATCCTATCCGCCATACCAGGCAACGGGGCCACCAAATACTTCCTACATGCCAGGCATGCCA GGTGGAATCTCTCCATACCCATCCGGATACCCTCCCAATCCCAGTGGTTACCCAGGCTGTCCTT ACCCACCTGGTGGTCCATATCCTGCCACAACAAGTTCTCAGTACCCTTCTCAGCCTCCTGTGAC CACTGTTGGTCCCAGTAGGGATGGCACAATCAGCGAGGACACCATCCGAGCCTCTCTCATCTCT GCGGTCAGTGACAAACTGAGATGGCGGATGAAGGAGGAAATGGATCGTGCCCAGGCAGAGCT CAATGCCTTGAAACGAACAGAAGAAGACCTGAAAAAGGGTCACCAGAAACTGGAAGAGATGG TTACCCGTTTAGATCAAGAAGTAGCCGAGGTTGATAAAAACATAGAACTTTTGAAAAAGAAGG ATGAAGAACTCAGTTCTGCTCTGGAAAAAATGGAAAATCAGTCTGAAAACAATGATATCGATG AAGTTATCATTCCCACAGCTCCCTTATACAAACAGATCCTGAATCTGTATGCAGAAGAAAACGC TATTGAAGACACTATCTTTTACTTGGGAGAAGCCTTGAGAAGGGGCGTGATAGACCTGGATGT CTTCCTGAAGCATGTACGTCTTCTGTCCCGTAAACAGTTCCAGCTGAGGGCACTAATGCAAAAA GCAAGAAAGACTGCCGGTCTCAGTGACCTCTACTGAGAATTC
Features of DUb-ALIX (listed in the 5' to 3' direction):
3X Flag tag (upper case letters; nucleotides 1-69)
First Notl cloning site (upper case letters, underlined; nucleotides 70-77)
UL36 coding sequence (lower case letters; nucleotides 78-815)
Linker sequence (upper case letters, bold; nucleotides 816-905)
Second Notl cloning site (upper case letters, underlined; nucleotides 906-913)
ALIX coding sequence (upper case letters; nucleotides 914-3517)
EcoRI cloning site (upper case letters, underlined; nucleotides 3518-3523)
DUb-ALIX (SEQ ID NO: 2)
ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTACAAGGATGACGAT GACAAGGI jG jCggggatcgcgacatcgtggtcaccggtgctcgggaccagttcgcgcccgacctggagccgggggggtcggtatcgt gcatgcgctcgtcgctgtcctttctcagcctcatatttgatgtgggccctcgcgacgttctgtccgcggaggccatcgagggttgtttggtcgaggggggcgag tggacgcgcgcgaccgcgggccctgggccgccgcgcatgtgttcgatcgtcgagctccccaacttcctcgagtacccaggggcgcgcggcggactgcgc tgtgtcttctcgcgcgtatacggcgaggtgggcttcttcggggagcccgcggcgggcctgctggagacacaatgccccgcacacacgttcttcgccggccc gtgggccctgcgccccctgtcgtacacgctcctaaccattggccccctagggatggggctgttcagggacggcgacaccgcatacctttttgacccgcacgg ccttccggagggcacccccgcgttcatcgccaaagtgcgggcgggggacatgtatccatacctgacgtattacacccgcgatcgcccggacgtacggtgg gcgggagccatggtgtttttcgtgccgtcgggcccggaacccgcggctcctgcggacttgacggccgcggctctgcatctttacggggccagcgagactta cctgcaggacgaagcgttcagcgaacggcgcgtggccatcacgcaccccctgcggGAACAACTTAACTCCAATGAAATTATT CAAAGAAAAAGACAGCACCAGCATCAGCATTACGACCAACAAATATTACAACCGCAAAGG GCGGCGGCCGCGCGACATTCATCTCGGTGCAGCTGAAAAAGACCTCAGAGGTGGACCTGGCCA AGCCGCTGGTGAAGTTCATCCAGCAGACTTACCCAAGCGGCGGGGAAGAGCAGGCCCAGTACT GCCGCGCGGCGGAGGAGCTCAGCAAGCTGCGCCGCGCCGCAGTCGGTCGTCCGCTGGACAAGC ACGAGGGCGCGCTCGAGACGCTCCTGAGATATTATGATCAGATTTGTTCTATTGAACCCAAATT CCCATTTTCTGAAAATCAGATCTGCTTGACATTTACCTGGAAGGATGCTTTCGATAAAGGTTCA
TCAATTGTGCAGCCTTAGCTAGCCAAATTGCAGCAGAACAGAACCTGGATAATGATGAAGGAT TGAAAATCGCTGCTAAACATTACCAGTTTGCTAGTGGTGCCTTTTTACATATTAAAGAGACGGT TTTATCTGCCTTAAGTCGAGAGCCGACCGTGGACATATCTCCAGATACTGTTGGGACCCTCAGT CTTATTATGCTGGCACAGGCTCAAGAAGTATTTTTTTTAAAAGCCACAAGAGATAAAATGAAA GATGCCATCATAGCTAAATTGGCTAATCAGGCTGCAGATTATTTTGGTGATGCTTTCAAACAGT GTCAATACAAAGATACTCTCCCCAAGGAGGTGTTCCCTGTCTTGGCTGCAAAGCACTGTATCAT GCAGGCCAATGCTGAGTACCATCAGTCTATCCTGGCAAAACAGCAGAAGAAATTTGGAGAAGA AATTGCAAGGTTACAGCATGCAGCAGAACTGATTAAAACAGTGGCATCTCGCTATGATGAATA TGTTAATGTGAAGGATTTTTCTGACAAAATCAATCGTGCCCTTGCTGCAGCAAAGAAGGATAAT GACTTCATTTATCATGATCGAGTTCCAGACCTTAAAGATCTAGATCCTATTGGCAAAGCCACAC TTGTGAAATCTACCCCGGTCAATGTACCCATCAGTCAGAAATTTACTGATCTGTTTGAGAAGAT GGTTCCCGTGTCAGTACAGCAGTCTTTGGCTGCCTATAATCAGAGGAAAGCCGATTTGATTAAC AGATCAATTGCTCAGATGAGAGAAGCCACCACTTTGGCAAATGGGGTGCTAGCTTCCCTTAATC TTCCAGCAGCAATTGAAGATGTGTCTGGAGACACTGTACCTCAGTCTATATTGACTAAATCCAG ATCTGTGATTGAACAGGGAGGCATCCAGACTGTTGATCAGTTGATTAAAGAACTGCCTGAATT ACTGCAACGAAATAGAGAAATCCTAGATGAGTCATTAAGGTTGTTGGATGAAGAAGAAGCAAC CGATAATGATTTAAGAGCAAAATTTAAGGAACGTTGGCAAAGGACACCATCCAATGAACTGTA TAAGCCTTTAAGAGCAGAGGGAACCAACTTCAGAACAGTTTTAGATAAAGCTGTGCAGGCAGA
CCTGAGCTGAATGCTGCCATCCCTTCTGCTAATCCAGCAAAGACCATGCAGGGCAGTGAGGTT
GTAAATGTCTTAAAATCCTTATTGTCAAATCTTGATGAAGTAAAGAAGGAAAGAGAGGGTCTG
ATGGTGTGATAAATGAAGAAGCTCTTTCTGTTACTGAACTAGATCGAGTCTATGGAGGTCTTAC AACTAAAGTCCAAGAATCTCTAAAGAAACAGGAGGGACTTCTTAAAAATATTCAGGTCTCACA TCAGGAATTTTCAAAAATGAAACAATCTAATAATGAAGCTAACTTAAGAGAAGAAGTTTTGAA GAATTTAGCTACTGCATATGACAACTTTGTTGAACTTGTAGCTAATTTGAAGGAAGGCACAAAG
CACGGAAGACAGAAAGAGATGAACTCTTAAAGGACTTGCAACAAAGCATTGCCAGAGAACCT AGTGCTCCTTCAATTCCTACACCTGCGTATCAGTCCTCACCAGCAGGAGGACATGCACCAACTC CTCCAACTCCAGCGCCAAGAACCATGCCGCCTACTAAGCCCCAGCCCCCAGCCAGGCCTCCAC CACCTGTGCTTCCAGCAAATCGAGCTCCTTCTGCTACTGCTCCATCTCCAGTGGGGGCTGGGAC TGCTGCGCCAGCTCCATCACAAACGCCTGGCTCAGCTCCTCCTCCACAGGCGCAGGGACCACCC TATCCCACCTATCCAGGATATCCTGGGTATTGCCAAATGCCCATGCCCATGGGCTATAATCCTT ATGCGTATGGCCAGTATAATATGCCATATCCACCAGTGTATCACCAGAGTCCTGGACAGGCTCC ATACCCGGGACCCCAGCAGCCTTCATACCCCTTCCCTCAGCCCCCACAGCAGTCTTACTATCCA CAGCAGTAAGAATTC
Features of Gag-DUb (listed in the 5' to 3' direction):
EcoRI cloning site (upper case letters, underlined; nucleotides 1-6)
Gag coding sequence (upper case letters; nucleotides 7-1506)
First Notl cloning site (upper case letters, underlined; nucleotides 1507- 1514)
Linker sequence (upper case letters, bold; nucleotides 1515- 1604)
UL36 coding sequence (lower case letters; nucleotides 1605-2342)
Strep-Tag (upper case letters; nucleotides 2343-2423)
Second Notl cloning site (upper case letters, underlined; nucleotides 2324-2431)
Gag-DUb (SEQ ID NO: 3)
GAATTCATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATT CGGTTAAGGCCAGGGGGAAAGAAGAAGTACAAGCTAAAGCACATCGTATGGGCAAGCAGGGA GCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACT GGGACAGCTACAACCATCCCTTCAGACAGGATCAGAGGAGCTTCGATCACTATACAACACAGT AGCAACCCTCTATTGTGTGCACCAGCGGATCGAGATCAAGGACACCAAGGAAGCTTTAGACAA GATAGAGGAAGAGCAAAACAAGTCCAAGAAGAAGGCCCAGCAGGCAGCAGCTGACACAGGA CACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACAT CAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGC
ATGTTGAACACCGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAG GAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATG AGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATG GATGACAAATAATCCACCTATCCCAGTAGGAGAGATCTACAAGAGGTGGATAATCCTGGGATT GAACAAGATCGTGAGGATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAAG AACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCTGAGCAAGCTTCACAGG AGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACCA TCCTGAAGGCTCTCGGCCCAGCGGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAG GAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCTA CCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTG
ACCAGAAGAGAGCTTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCGA TAGACAAGGAACTGTATCCTTTAACTTCCCTCAGATCACTCTTTGGCAACGACCCCTCGTCACA AGCGGCCGCGAACAACTTAACTCCAATGAAATTATTCAAAGAAAAAGACAGCACCAGCAT CAGCATTACGACCAACAAATATTACAACCGCAAAGGGCGggggatcgcgacatcgtggtcaccggtgctcggg accagttcgcgcccgacctggagccgggggggtcggtatcgtgcatgcgctcgtcgctgtcctttctcagcctcatatttgatgtgggccctcgcgacgttctg tccgcggaggccatcgagggttgtttggtcgaggggggcgagtggacgcgcgcgaccgcgggccctgggccgccgcgcatgtgttcgatcgtcgagctc cccaacttcctcgagtacccaggggcgcgcggcggactgcgctgtgtcttctcgcgcgtatacggcgaggtgggcttcttcggggagcccgcggcgggcc tgctggagacacaatgccccgcacacacgttcttcgccggcccgtgggccctgcgccccctgtcgtacacgctcctaaccattggccccctagggatgggg ctgttcagggacggcgacaccgcatacctttttgacccgcacggccttccggagggcacccccgcgttcatcgccaaagtgcgggcgggggacatgtatcc atacctgacgtattacacccgcgatcgcccggacgtacggtgggcgggagccatggtgtttttcgtgccgtcgggcccggaacccgcggctcctgcggact tgacggccgcggctctgcatctttacggggccagcgagacttacctgcaggacgaagcgttcagcgaacggcgcgtggccatcacgcaccccctgcggT CGTGGAGCCACCCGCAGTTCGAAAAATCGTGGAGCCACCCGCAGTTCGAAAAATCGTGGAGCC ACCCGCAGTTCGAAAAAGCGGCCGC
VI. Lentiviral Vectors
Lentiviruses are a genus of retroviruses characterized by a long incubation period and the ability to infect non-dividing cells. Lentiviruses are complex retroviruses, which, in addition to the common retroviral genes gag, pol, and env, contain other genes with regulatory or structural function. The higher complexity enables the virus to modulate its life cycle, as in the course of latent infection. Examples of lentiviruses include HIV, SIV, FIV and EIAV. In some cases, the lentiviral vector specifically targets CD4+ T cells.
Lentiviral vectors have been generated by multiply attenuating the HIV virulence genes, for example, the genes env, vif, vpr, vpu and nef have been deleted to make lentiviral vectors safe as
gene therapy vectors for human use. Lentiviral vectors provide several advantages for gene therapy. They integrate stably into chromosomes of target cells, which is required for long-term expression, and they do not transfer viral genes, therefore avoiding the problem of generating transduced cells that can be destroyed by cytotoxic T lymphocytes. In addition, lentiviral vectors have a relatively large cloning capacity, sufficient for most envisioned clinical applications.
Furthermore, lentiviruses (in contrast to other retroviruses) are capable of transducing non-dividing cells. This is very important in the context of gene therapy for some tissue types, particularly hematopoietic cells, brain, liver, lungs and muscle. For example, vectors derived from HIV-1 allow efficient in vivo and ex vivo delivery, integration and stable expression of transgenes into cells such a neurons, hepatocytes, and myocytes (Blomer et al., J Virol 71:6641-6649, 1997; Kafri et al, Nat Genet 17:314-317, 1997; Naldini et al, Science 272:263-267, 1996; Naldini et al, Curr Opin Biotechnol 9:457-463, 1998).
The lentiviral genome and the pro viral DNA have the three genes found in retroviruses: gag, pol and env, which are flanked by two long terminal repeat (LTR) sequences. The gag gene encodes the internal structural (matrix, capsid and nucleocapsid) proteins; the pol gene encodes the RNA-directed DNA polymerase (reverse transcriptase), a protease and an integrase; and the env gene encodes viral envelope glycoproteins. The 5' and 3'LTR's serve to promote transcription and polyadenylation of the virion RNA's. The LTR contains all other cis-acting sequences necessary for viral replication. Lentiviruses also have additional genes, including vif, vpr, tat, rev, vpu, nef and vpx.
Adjacent to the 5' LTR are sequences necessary for reverse transcription of the genome (the tRNA primer binding site) and for efficient encapsidation of viral RNA into particles (the Psi site). If the sequences necessary for encapsidation (or packaging of retroviral RNA into infectious virions) are missing from the viral genome, the cis defect prevents encapsidation of genomic RNA. However, the resulting mutant remains capable of directing the synthesis of all virion proteins.
A number of different lentiviral vectors, packaging cell lines and methods of generating lentiviral gene therapy vectors are known in the art (see, for example, Escors and Breckpot, Arch Immunol The r Exp 58(2): 107-119, 2010; Naldini et al, Science 272:263-267, 1996; Naldini et al, Proc Natl Acad Sci USA 93: 11382-11388, 1996; Naldini et al, Curr Opin Biotechnol 9:457-463, 1998; Zufferey et al., Nat Biotechnol, 15:871-875,1997; Dull et al., J Virol 72: 8463-8471, 1998; Ramezani et al., Mol Ther 2:458-469, 2000; and U.S. Patent Nos. 5,994,136; 6,013,516; 6,165,782; 6,207,455; 6,218,181; 6,218,186; 6,277,633; 7,901,671; 8,551,773; 8,709,799; and 8,748,169, which are herein incorporated by reference). Thus, one of skill in the art is capable of selecting an
appropriate lentiviral vector for cloning and expression of the DUb fusion protein-encoding nucleic acid molecules disclosed herein.
Also provided herein are isolated cells comprising the nucleic acid molecules or vectors disclosed herein. For example, the isolated cell can be a cell (or cell line) appropriate for production of lentiviral gene therapy vectors, such as a packaging cell line. In some examples, the cell is a HeLa cell, 293 cell or PERC.6 cell.
Compositions comprising a lentiviral vector encoding a DUb fusion protein and a pharmaceutically acceptable carrier, as well as recombinant lenti viruses expressing a DUb fusion protein or isolated cells (such as T cells, for example autologous T cells) transformed with the recombinant lenti virus and a pharmaceutically acceptable carrier, are also provided by the present disclosure. In some embodiments, the compositions are formulated for intravenous or
intramuscular administration.
VII. Adeno-Associated Virus (AAV) Vectors
AAV belongs to the family Parvoviridae and the genus Dependovirus. AAV is a small, non-enveloped virus that packages a linear, single- stranded DNA genome. Both sense and antisense strands of AAV DNA are packaged into AAV capsids with equal frequency.
The AAV genome is characterized by two inverted terminal repeats (ITRs) that flank two open reading frames (ORFs). In the AAV2 genome, for example, the first 125 nucleotides of the ITR are a palindrome, which folds upon itself to maximize base pairing and forms a T-shaped hairpin structure. The other 20 bases of the ITR, called the D sequence, remain unpaired. The ITRs are ds-acting sequences important for AAV DNA replication; the ITR is the origin of replication and serves as a primer for second-strand synthesis by DNA polymerase. The double- stranded DNA formed during this synthesis, which is called replicating-form monomer, is used for a second round of self -priming replication and forms a replicating-form dimer. These double- stranded intermediates are processed via a strand displacement mechanism, resulting in single- stranded DNA used for packaging and double-stranded DNA used for transcription. Located within the ITR are the Rep binding elements and a terminal resolution site. These features are used by the viral regulatory protein Rep during AAV replication to process the double- stranded intermediates. In addition to their role in AAV replication, the ITR is also essential for AAV genome packaging, transcription, negative regulation under non-permissive conditions, and site- specific integration (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).
The left ORF of AAV contains the Rep gene, which encodes four proteins - Rep78, Rep 68, Rep52 and Rep40. The right ORF contains the Cap gene, which produces three viral capsid
proteins (VP1, VP2 and VP3). The AAV capsid contains 60 viral capsid proteins arranged into an icosahedral symmetry. VP1, VP2 and VP3 are present in a 1: 1: 10 molar ratio (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).
AAV is currently one of the most frequently used viruses for gene therapy. Although AAV infects humans and some other primate species, it is not known to cause disease and elicits a very mild immune response. Gene therapy vectors that utilize AAV can infect both dividing and quiescent cells and persist in an extrachromosomal state without integrating into the genome of the host cell. Because of the advantageous features of AAV, the present disclosure contemplates the use of AAV for the DUb fusion protein-encoding nucleic acid molecules and methods disclosed herein.
AAV possesses several desirable features for a gene therapy vector, including the ability to bind and enter target cells, enter the nucleus, the ability to be expressed in the nucleus for a prolonged period of time, and low toxicity. However, the small size of the AAV genome limits the size of heterologous DNA that can be incorporated. To minimize this problem, AAV vectors have been constructed that do not encode Rep and the integration efficiency element (IEE). The ITRs are retained as they are cis signals required for packaging (Daya and Berns, Clin Microbiol Rev 21(4):583-593, 2008).
Methods for producing recombinant AAV (rAAV) suitable for gene therapy are well known in the art (see, for example, U.S. Patent Application Nos. 2012/0100606; 2012/0135515;
2011/0229971; and 2013/0072548; and Ghosh et al, Gene Ther 13(4):321-329, 2006, which are incorporated herein by reference), and can be utilized with the nucleic acid molecules and methods disclosed herein.
The fusion proteins described herein can be delivered and expressed using an AAV vector. The AAV serotype can be any suitable serotype for delivery of heterologous nucleic acids to a cell or a subject. In some embodiments, the AAV vector is a serotype a serotype 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 or 12 vector {i.e. AAVl, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAVl 1 or AAV12). In other examples, the AAV vector is a hybrid of two or more AAV serotypes (such as, but not limited to AAV2/1, AAV2/7, AAV2/8 or AAV2/9). The selection of AAV serotype will depend in part on the cell type(s) that are targeted for gene therapy.
Also provided herein are isolated cells comprising the nucleic acid molecules or vectors disclosed herein. For example, the isolated cell can be a cell (or cell line) appropriate for production of rAAV. In some examples, the cell is a mammalian cell, such as a HEK-293, BHK, Vero, RD, HT-1080, A549, Cos-7, ARPE-19, or MRC-5 cell.
Compositions comprising an AAV vector encoding a DUb fusion protein and a pharmaceutically acceptable carrier are also provided by the present disclosure. In some embodiments, the compositions are formulated for intravenous or intramuscular administration. Suitable pharmaceutical formulations for administration of rAAV can be found, for example, in U.S. Patent Application Publication No. 2012/0219528.
VIII. Adenovirus Vectors
Adenoviruses are commonly used as vectors for the delivery of genetic material into human cells. Adenoviruses have been isolated from a large number of different species, and more than 100 different serotypes have been reported. There are currently 68 known human adenovirus serotypes. The overall organization of the adenoviral genome is conserved among serotypes, such that specific functions are similarly positioned. Most adults have been exposed to the adenovirus serotypes most commonly used in gene therapy (Ad2 and Ad5).
The adenovirus genome is a linear, non-segmented, double stranded DNA that is approximately 34-43 kb in length. The adenovirus genome is flanked on both sides by inverted terminal repeat (ITR) sequences, which are essential to the replication of adenoviruses. The virus infectious cycle is divided into an early and a late phase. In the early phase, the virus is uncoated and the genome transported to the nucleus, after which the early gene regions E1-E4 become transcriptionally active. The early region-1 (El) contains two transcription regions named EIA and E1B. The EIA region (sometimes referred to as immediate early region) encodes two major proteins that are involved in modification of the host-cell cycle and activation of the other viral transcription regions. The E1B region encodes two major proteins, 19K and 55K, that prevent, via different routes, the induction of apoptosis resulting from the activity of the EIA proteins. In addition, the E1B-55K protein is required in the late phase for selective viral mRNA transport and inhibition of host protein expression. Early region-2 (E2) is also divided into an E2A and E2B region that together encode three proteins, DNA binding protein, viral polymerase and pre-terminal protein, all involved in replication of the viral genome. The E3 region is not necessary for replication in vitro but encodes several proteins that subvert the host defense mechanism towards viral infection. The E4 region encodes at least six proteins involved in several distinct functions related to viral mRNA splicing and transport, host-cell mRNA transport, viral and cellular transcription and transformation.
The late proteins necessary for formation of the viral capsids and packaging of viral genomes, are all generated from the major late transcription unit (MLTU) that becomes fully active after the onset of viral DNA replication. A complex process of differential splicing and
polyadenylation gives rise to more than 15 mRNA species that share a tripartite leader sequence. The early proteins E1B-55K and E4-ORF3 and ORF6 play a pivotal role in the regulation of late viral mRNA processing and transport from the nucleus.
Adenovirus vectors are classified, for example, as first, second, third and/or fourth generation adenoviral vectors or gutless adenoviral vectors. The use of adenovirus vectors provides several advantages as they can be generated to very high titers of infectious particles; infect a great variety of cells; efficiently transfer genes to cells that are not dividing; and are seldom integrated in the host genome, which avoids the risk of cellular transformation by insertional mutagenesis (Douglas and Curiel, Science and Medicine, March/ April 1997, pages 44-53; Zern and Kresinam, Hepatology 25(2), 484-491, 1997). Representative adenoviral vectors are described by Stratford- Perricaudet et al. (J. Clin. Invest. 90: 626-630, 1992); Graham and Prevec (In Methods in
Molecular Biology: Gene Transfer and Expression Protocols 7: 109-128, 1991); and Barr et al. (Gene Therapy, 2: 151-155, 1995). One of skill in the art is capable of selecting an appropriate adenoviral vector for cloning and expression of the DUb fusion protein-encoding nucleic acid molecules disclosed herein.
Also provided herein are isolated cells comprising the nucleic acid molecules or vectors disclosed herein. For example, the isolated cell can be a cell (or cell line) appropriate for production of recombinant adenovirus.
Compositions comprising an adenoviral vector encoding a DUb fusion protein and a pharmaceutically acceptable carrier, as well as recombinant adenoviruses expressing a DUb fusion protein or isolated cells (such as T cells, for example autologous T cells) transformed with the recombinant adenovirus and a pharmaceutically acceptable carrier, are also provided by the present disclosure. In some embodiments, the compositions are formulated for intravenous or
intramuscular administration.
The following examples are provided to illustrate certain particular features and/or embodiments. These examples should not be construed to limit the disclosure to the particular features or embodiments described.
EXAMPLES
Example 1: Ubiquitin conjugation to Gag is essential for ESCRT-mediated HIV-1 budding METHODS
Proviral and expression vectors
The wild-type molecular clones of HIV-1 pNL4-3 (Adachi et al, J Virol 1986, 59:284-291)
MoMLV (Colicelli and Goff, J Virol 62:633-636, 1988) and EIAVUK (Li et al, J Virol 76: 1569- 1577, 2002) were used. The HIV-1 L-domain mutants PTAP-, YP- and the PTAP-/YP- were previously described in Huang et al (J Virol 69:6810-6818, 1995). ALIX full length (SEQ ID NO: 8) and the Brol (residues 1-367 of SEQ ID NO: 8) and VPRD (residues 364-868 of SEQ ID NO: 8) fragments were descried in Dussupt et al. (PLoS Pathog 5:el000339, 2009) and subcloned into p3XFLAG-myc-CMV-26 vector (Sigma, St. Louis, MO) between the NotUEcoRl restriction sites. The Flag-TSGlOl expression vector was previously described in Dussupt et al. (J Virol 85:2304- 2315, 2011). TSG101 cDNA was also subcloned into the pEXPR-IBA105 vector (IBA
BioTAGnology, IBA US Distribution Center, St. Louis, MO, USA) between EcoRUNotl to generate an N-terminally tagged Strep-TSGIOI. Nedd4.2s lacking the first 121 residues of
Nedd4.2 was amplified from the full-length Nedd4.2 (Sette et al, J Virol 84:8181-8192, 2010) and subcloned in pcDNA3 (Invitrogen life technologies, Grand Island, NY) using HindWJKpnl sites. The CHMP4B expression vector was generated by PCR amplification from CHMP4B cDNA (GeneCopoeia, Germantown, MD, USA) and subcloned into pHM6 (Roche, Indianapolis, Indiana, USA) to obtain an N-terminally tagged HA-CHMP4B. The N-terminal residues 15-260 (UL36) of the type I HSV VPl/2 tegument protein (Kattenhorn et al, Mol Cell 19:547-557, 2005) was cloned in-frame with the 5' end of ALIX and TSG101 cDNA in the p3xFlag-myc-CMV-26 and pEXPR- IBA105 vectors using the Notl site (Stringer and Piper, J Cell Biol 192:229-242, 2011) to generate DUB-ALIX and DUB-TSG101 fusion proteins. The respective cDNA for VPS28, VPS37 and MVB12 genes were inserted in the p3xFlag-myc-CMV-26. The Rev-independent HIV-1 Gag- Strep construct was amplified by PCR from the HIV- 1 Gag-EGFP construct described in Hermida- Matsumoto and Resh (J Virol 74:8670-8679, 2000) using a reverse primer containing the Strep tag sequence and cloned in pcDNA3 vector between BamHVNotl restriction sites. Additionally, the UL36 and ubiquitin sequences were inserted at the C-terminal end of Gag to generate the Gag- DUBStrep and Gag-Ub fusion proteins, respectively. To generate GST expression vectors, the HIV-1 NC-pl-p6 and the EIAV NC-p9 coding regions were subcloned in pGEX-5X-2 (GE
Healthcare Biosciences, Piscataway, NJ) between BamHVEcoRI sites.
Virus release analysis
293T cells were maintained and transfected as previously described (Sette et al. , J Virol 84:8181-8192, 2010) . Twenty-four hours after transfection, cells and culture media were harvested and their protein content was analyzed using a previously described protocol (Sette et al., Structure 19: 1485-1495, 2011). HIV-1 proteins were detected using anti-HIV-1 p24 monoclonal antibody clone 183-H12-5C (NIH AIDS Reagent Program; Chesebro et al, J Virol 66:6547-6554, 1992) or NEA-9306 (NEN Life Science, Boston, MA). MoMLV and EIAV proteins were detected using a goat anti-p30CA antibody and horse anti-EIAV serum (Montelaro et al., J Biol Chem 259: 10539-10544, 1984), respectively. Other proteins were detected using anti-HA, anti-Flag or anti-tubulin monoclonal antibodies (Sigma, St. Louis, MO). EIAV release ratio (values in percentage) was calculated using the following: release ratio = virus-associated Gag/cell associated Gag, as determined by densitometry analysis of Western blot films using ImageJ software. ALIX and TSG101 proteins were detected using a polyclonal anti-ALIX antibody and a mouse anti- TSG101 antibody (BD Biosciences, San Jose, CA).
Infectivity assay
Viral infectivity was quantified using the TZM-bl cells assay (Wei et al., Antimicrob Agents Chemother 46: 1896-1905, 2002) as described in Sette et al. (J Virol 86: 11608-11615, 2012).
Briefly, HeLa TZM-bl cells were seeded (2 x 104 cells) in 96- well plates and the following day infected in triplicate with HIV-1 YP- or HIV-1 PTAP-rescued virus stocks in the presence of 20 μg/ml DEAE-dextran (Sigma, St. Louis, MO). After 48 hours, cells were assayed for luciferase activity using the STEAD Y-GLO™ Reagent kit (Promega, Madison, WI) according to the manufacturer's instructions. Immunoprecipitation assays
These assays were conducted as previously described (Sette et al., Structure 19: 1485-1495, 2011; Sette et al., J Virol 86: 11608-11615, 2012). Immunoprecipitation complexes and cell lysates (input fractions) were analyzed by SDS-PAGE and Western blot using anti-HA and anti- Flag M2 antibodies (Sigma, St. Louis, MO).
GST pull-down assays
The empty pGEX vector or pGEX vector carrying the coding sequences of NC-p6 and NC were expressed in BL21(DE3) pLysS E. coli (Stratagene) and their interactions with Flag-ALIX or Flag-DUb-ALIX were examined in GST pull-down assays following the protocol previously
described (Sette et al, Structure 19: 1485-1495, 2011). Eluate complexes and cell lysates (input fractions) were analyzed by SDS-PAGE and Western blot using the indicated antibodies.
RNAi knockdown
293T cells (2.5 x 106 cells/ml) were transfected with 250 pmol of a mixture of two RNAi oligonucleotides or with 75 pmol of an RNAi oligonucleotide against cellular ALIX and cellular TSG101, respectively (Invitrogen Life Technologies, Grand Island, NY). After 36 hours, cells were co-transfected with the same amount of RNAi oligos to ALIX, 500 ng of EIAVUK proviral DNA and RNAi resistant (RR) versions of 150 ng of Flag-ALIX or RR Flag-ALIXDUB expressing plasmids. When inhibitory effects were assessed with HIV-1, cells were first transfected with RNAi oligos against TSG101 (to eliminate cellular TSG101), then were next co-transfected with 1 μg of HIV-1 YP- proviral DNA and RR 50 ng of Flag-TSGlOl or RR Flag-TSGIOIDUB constructs. Cells and virus were harvested and processed as described above. Cell fractionation
Forty-eight hours post-transfection, 293T cells were harvested and washed twice with cold PBS. The cells were resuspended in cold hypotonic buffer (10 mM Tris pH 7.5, 1 mM MgCl2) and kept on ice for 30 minutes. Cells were broken to release nuclei using a pre-chilled 7 ml Dounce homogenizer. The samples were centrifuged at 1,000 x g at 4°C for 15 minutes to pellet nuclei and the supernatant representing the cytoplasmic fraction was centrifuged at 100,000 x g at 4°C for 1 hour to collect the membrane fraction. The pellet was solubilized in radioimmunoprecipitation assay (RIPA) buffer (0.5% IGEPAL™, 50 mM HEPES [pH 7.3], 150 mM NaCl, 2 mM EDTA, 20 mM β-glycerophosphate, 0.1 mM Na3V04, 1 mM NaF, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, and complete protease inhibitor cocktail) and used to perform
immunoprecipitation assays.
Electron microscopy
293T cells were seeded at 6 x 105/well of a 6- well plate and transfected the following day with 2 μg of HIV-1 YP- mutant and DUB-TSG101 expression vectors, or with EIAVuk provirus and DUB-ALIX plasmids. At 36 hours post-transfection, the supernatants were removed and the cells were fixed for 15 minutes at room temperature in 2% (v/v) glutaraldehyde in 0.1 M cacodylate buffer (pH 7.4). The cells were then rinsed in cacodylate buffer and postfixed in 1% (v/v) osmium tetroxide in the same buffer. The samples were subsequently rinsed again in 0.1 N sodium acetate buffer (pH 4.2), stained in 0.5% uranyl acetate (v/v) in the same buffer, dehydrated in graded
ethanol, then infiltrated overnight in pure epoxy resin. The wells were embedded in fresh resin the next day and cured at 55°C. Blocks were cut from the cured samples and mounted appropriately for ultramicrotomy. Thin sections were stained in uranyl acetate and lead citrate and stabilized by carbon evaporation. Images were obtained with a Hitachi H7600 electron microscope equipped with an AMT XL41M digital camera. Approximately 600 cells were examined for each sample and arrested budding structures attached to the cell as well as released virions were enumerated to determine the release efficiency.
RESULTS
Multiple lines of evidence implicate a role for ubiquitin (Ub) in the process of viral budding and release (Patnaik et al, Proc Natl Acad Sci USA 97:13069-13074, 2000; Schubert et al, Proc Natl Acad Sci USA 97: 13057-13062, 2000; Strack et al, Proc Natl Acad Sci USA 97: 13063-13068, 2000; Chung et al, J Virol 82:4884-4897, 2008; Joshi et al, Traffic 9: 1972-1983, 2008; Weiss et al., PLoS Pathog 6:el001107, 2010; Zhadina et al., PLoS Pathog 6:el001153, 2010; Gottwein et al., J Virol 80:6267-6275, 2006). For instance, both ESCRTs and Gag undergo some level of ubiquitination. Experimental manipulations such as overexpression of Ub ligases that increase ubiquitination of Gag and Gag- associated proteins promote viral release (Chung et al., J Virol 82:4884-4897, 2008; Sette et al., J Virol 84:8181-8192, 2010; Weiss et al., PLoS Pathog
6:el001107, 2010; Zhadina et al., PLoS Pathog 6:el001153, 2010) and fusion of Ub directly to Gag can promote fusion and circumvent requirement for directly binding ESCRT components via L domain sequences (Joshi et al., Traffic 9: 1972-1983, 2008). Despite these indications, two fundamental questions remained regarding the potential role for Ub in ESCRT-dependent viral release. While most of these studies established that Ub can be sufficient to mediate viral budding, it had not previously been shown that Ub provides a natural and necessary role in the process. Rather, the presence of Ub in these experimental settings could have simply represented an artificial means of recruiting ESCRT-components that are known to harbor multiple Ub-binding domains. The other issue was identifying the specific protein(s) in the viral budding process that require ubiquitination given that either ubiquitination of Gag or some other non-Gag protein can be sufficient for release (Jadwin et al., J Virol 84:704-715, 2010; Weiss et al., PLoS Pathog
6:el001107, 2010; Zhadina et al., PLoS Pathog 6:el001153, 2010). In order to directly assess the role of Ub in HIV-1 budding, a method recently described by (Stringer and Piper, / Cell Biol 192:229-242, 2011), which relies on fusing the catalytic domain of a deubiquitinating enzyme (DUb) onto a protein of interest, was used. This approach blocks the ability of that protein, as well as other tightly-associated interacting proteins, from accumulating in ubiquitinated form. This
simple approach to converting a given protein into an ubiquitination-resistant form provides a complementary control in the form of the same fusion but with an inactivating Cys-Ser mutation in the catalytic site of the DUb. To exploit this approach, fusion proteins in which DUb was fused to ALIX, TSGlOl or HIV Gag were generated and assessed for their effect on virus release.
Effect of DUb-TSGlOl on viral release
The ESCRT-I component TSGlOl binds directly to PTAP motifs within the HIV-1 Gag protein and eliminating the PTAP motif or the ability of TSGlOl to bind Gag reduces viral release by -80%. TSGlOl can also non-covalently bind Ub via its UEV domain and undergoes ubiquitination (Pornillos et al, EMBO J 21:2397-2406, 2002). First, a DUb fusion to TSGlOl was constructed by creating a protein comprised of the catalytic domain from the HSV UL36 DUb fused onto the N-terminus of TSGlOl (FIG. 1A). The DUb-TSGlOl also contained an N-terminal bivalent Strep tag for affinity purification. As a complementary control, a version of TSGlOl fused to UL36 that was catalytically inactivated by a single point mutation (DUb*) was constructed. Active and inactive DUb-TSGlOl and DUb*-TSG101, respectively, were co-expressed in 293T cells along with HA-Ub and affinity isolated from cell lysates on Strep-ta.ct beads (FIG. IB, upper panel). Complexes with inactive DUb*-TSG101 showed high levels of ubiquitinated proteins revealed by anti-HA Western blot. In contrast, the active DUb-TSGlOl fusion protein had dramatically less ubiquitinated proteins (compare lanes 4-6) even though the levels of DUb- TSGlOl and DUb*-TSG101 were comparable (compare lanes 10 and 12). Affinity-isolated TSGlOl, DUb-TSGlOl and DUb*-TSG101 also showed similar levels of association with the other ESCRT-I components MVB12B, VPS37B and VPS28, indicating that the fusion of active or inactive UL36 catalytic domain did not interfere with the ability of TSGlOl to assemble into its native ESCRT-I complex (FIG. IB lower, compare lanes 1, 3 and 5).
Lysates from cells expressing Flag-tagged TSGlOl, DUb-TSGlOl or DUb*-TSG101 in combination with the other Flag-tagged ESCRT-I subunits were also subjected to GST pull-down assays with GST alone or GST fused to a fragment encompassing the NC and p6 regions of the HIV-1 Gag protein that contains binding sites for ALIX and the PTAP binding site for TSGlOl. FIG. 1C shows that GST-NCp6 captured ESCRT-I containing either TSGlOl, DUb-TSGlOl or DUb*-TSG101 comparably. Interestingly, while the levels of GST-NCp6 bound to MVB12B, VPS37B, and VPS28 were similar, a greater proportion of DUb*-TSG101 was bound by GST- NCp6 than WT TSGlOl or active DUb-TSGlOl. Together, these data show that both active and inactive DUb-TSGlOl and DUb*-TSG101 retain their ability to assemble into ESCRT-I complexes and interact with HIV-1 Gag proteins.
To examine the effect of DUb-TSGlOl on Gag assembling complexes, DUb-TSGlOl fusion proteins recruited to the membrane by nascent virus particles were captured and checked for ubiquitination status. DUb-TSGlOl was affinity captured on Strep-tactin beads from cells expressing a divalent strep-tagged TSGIOI, HA-Ub, and co-expressing HIV-1YP-. The captured TSGlOl-containing complexes were immunoprecipitated from cell fractions known to be enriched in membrane- associated insoluble Gag assembling proteins (Jager et ah, J Virol 2007, 81:9193- 9201). Immunocomplexes were immunoblotted for Gag using anti-p24 antibodies (FIG. ID, lanes 1-3), levels of ubiquitinated proteins using an anti-HA antibody (FIG. ID, lanes 4-6), and for the TSGIOI protein itself using an anti-Strep antibody (FIG. ID, lanes 7-9). Complexes containing DUb-TSGlOl had greatly diminished levels of ubiquitinated proteins compared with complexes of inactive DUb*-TSG101 (lanes 5 and 6). No high molecular weight forms of Gag were observed in the anti-p24 (lanes 2 and 3) or the anti-HA immunoblots when Gag was co-expressed with DUb- TSG101 in contrast to complexes of DUb*-TSG101 (compare lane 5 to 6 and lane 8 to 9). These data indicate that direct association with DUb-TSGlOl generated ubiquitination-resistant
TSG101/ESCRT complexes and protected Gag complexes against ubiquitination.
Next, the impact of fusing active and inactive DUb onto TSGIOI was assessed for HIV-1 release since TSGIOI and other ESCRT-I subunits are required for efficient scission of HIV-1 from the cell surface (Martin-Serrano et al, J Virol 77:4794-4804, 2003). Expressing DUb-TSGlOl inhibited Gag processing as demonstrated by the accumulation of the CA-pl (p25CA form) and caused a 70% reduction in virus release (FIG. 9A, lane 3). The remaining 30% could either be due to incomplete compromise of endogenous TSGIOI function or instead be due to the alternative use of ALIX, which is mediated by a LYPXnL motif within the HIV-1 Gag protein that mediates direct binding to ALIX and has been shown to be sufficient for viral release. To distinguish between these possibilities, the impact of DUb-TSGlOl on the release of mutant HIV-1 that lacks its ALIX- binding motif (HIV-1 YP-) was assessed. DUb-TSGlOl blocked over 95% of release of HIV-1 YP- (FIG. 2A, lane 3). These data suggest that the inhibitory effects of DUb-TSGlOl on HIV-1 release are specific for the interaction between HIV Gag and TSGIOI. As further demonstration of this specificity, it was found that DUb-TSGlOl had no effect on release of MoMLV or EIAV, which use TSGlOl-independent pathways for budding (FIG. 9B and 9C). Furthermore, a mutant DUb-TSGlOl that lost the ability to bind HIV Gag (M95A) had no effect on HIV budding (FIG. 9D, lane 3) demonstrating that DUb-TSGlOl inhibitory effect requires specific recruitment to Gag assembly sites. No effect on viral release of HIV- 1, HIV-1 YP-, MoMLV or EIAV was found upon expressing inactive DUb*-TSG101 at comparable levels, suggesting that the inhibitory effect of DUb-TSGlOl was due to the enzymatic activity of the fused UL36-DUb. Remarkably, Flag-
tagged DUb*-TSG101 could functionally replace endogenous TSGlOl depleted by RNAi just as well as WT Flag-tagged TSGlOl in facilitating the release of HIV-1 (FIG. 2B, lanes 3 and 5). As expected, enzymatically active DUb-TSGlOl failed to drive release of virus when endogenous TSGlOl was depleted (FIG. 2B, lane 4). These data further demonstrate the specificity of the inhibitory effect of DUb-TSGlOl, indicating that it is mediated by deubiquitination rather than mere fusion of a globular domain to the TSGlOl N-terminus.
To better characterize how DUb-TSGlOl inhibited HIV-1 release, cells co-expressing HIV-1 and DUb-TSGlOl were examined by transmission electron microscopy (FIG. 2C). Cells expressing DUb-TSGlOl showed multiple viral particles that were tethered to each other or to the cell surface with elongated budding necks, indicating a severe defect in membrane scission (FIG. 2C panels a and b). In contrast, cells expressing inactive DUb*-TSG101 were able to produce mature HIV-1 particles that were clearly detached from the cell surface (FIG. 2C, panels c). These data were confirmed in duplicate experiments and quantified by counting >200 viral particles within multiple fields (FIG. 2C). Taken together these results indicated that deubiquitination of TSGlOl prevented HIV-1 budding and separation from cells. This effect is similar to that observed when viral Gag proteins are unable to engage an active ESCRT apparatus.
Effect of DUb-ALIX on viral release
Several viral Gag proteins directly bind ESCRT-associated ALIX as a means to interact with the ESCRT apparatus to induce viral budding and release. Like TSGlOl, ALIX undergoes ubiquitination and also binds Ub suggesting its function or regulation is Ub-dependent. However the functional significance of these properties in virus budding has not previously been determined. To determine whether there is a role for Ub in ALIX-dependent viral budding, the effect of expressing DUb-ALIX and DUb*-ALIX comprised of ALIX fused to the C-terminus of active or inactive UL36 DUb, respectively, was assessed. These proteins were also tagged with the Flag epitope (FIG. 3A). When co-expressed in 293T cells with HA-Ub and immunoprecipitated with anti-Flag antibodies, WT Flag- ALIX as well as DUb*-ALIX were readily found to be ubiquitinated as revealed by immunoblotting samples with anti-HA. In stark contrast, Ub conjugates were completely absent from immunoprecipitates of active DUb-ALIX, thus demonstrating the effectiveness of the DUb domain in eliminating ubiquitination from ALIX (FIG. 3B). Both active and inactive DUb-ALIX and DUb*-ALIX retained their ability to interact with GST-fusion proteins encompassing the NC and p6 late domain region of HIV-1 or the NC and p9 late domain of EIAV, both of which are known to interact with ALIX and which are capable of using an ALIX-dependent pathway for viral budding (FIG. 3C). In addition, immunoprecipitation experiments (FIG. 3D)
demonstrated that DUb-ALIX and DUb*- ALIX retained their ability to interact with CHMP4B. Immunoprecipitation experiments also showed that both DUb-ALIX and DUb*-ALIX could oligomerize with full-length WT ALIX or a fragment of ALIX containing the middle V domain and the proline-rich C-terminal tail (FIG. 10). Together, these data demonstrate the fusion of the UL36 DUb domain to the N-terminus of ALIX did not interfere with its ability to interact with its known- binding partners.
It was next assessed whether DUb-ALIX had an effect on the release of two viruses that require ALIX for their budding and release. These were EIAV and a mutant HIV-1 (HIV PTAP-) where the PTAP motif within its Gag protein that mediates binding to TSG101 was eliminated (FIG. 4). It was found that expressing DUb-ALIX dramatically inhibited EIAV virus production by 90%. This effect required the interaction of EIAV Gag with DUb-ALIX since this inhibitory effect was suppressed when the EIAV binding site within the V domain of ALIX was compromised by a F676D point mutation (Fisher et al, Cell 128:841-852, 2007; Lee et al, Nat Struct Mol Biol 14: 194-199, 2007) (FIG. 4A, lane 4). The level of specificity demonstrated by the DUb-ALIX F676D mutant is important since it indicates that the inhibitory effect of DUb-ALIX is not due to recruiting DUb activity to CHMP4B or to other proteins that associate with other regions of ALIX. Specificity was also demonstrated by the observation that inactive DUb*-ALIX expressed to the same levels of active DUb-ALIX had no effect on release of EIAV (FIG. 4A, lane 5). In addition, DUb*-ALIX, but not the active DUb-ALIX, was able to restore release of EIAV from cells depleted of endogenous ALIX by RNAi (FIG. 4B, lane 5).
DUb-ALIX had a similar inhibitory effect on budding of HIV-1 PTAP- virus. Normally, production of HIV-1 PTAP- virus is low in 293T cells (Demirov et al., Proc Natl Acad Sci USA 99:955-960, 2002; Huang et al, J Virol 69:6810-6818, 1995), but can be greatly stimulated by overexpression of WT ALIX. However, not only did DUb-ALIX lack the ability to stimulate release of HIV-1 PTAP- virus (FIG. 4C), it also inhibited 90% of virus release supported by endogenous levels of ALIX (FIG. 4C, compare lanes 1 and 3). The inhibitory effect of DUb-ALIX on release of HIV-1 PTAP- was eliminated when the DUb activity was inactivated (lane 4). Little effect of DUb-ALIX was observed on release of MoMLV (FIG. 4D), which exits cells
independently of ALIX (Jadwin et al, J Virol 84:704-715, 2010). Similarly ALIX caused only a minor (20%) reduction in the release of WT HIV-1, which more readily utilizes a TSG101- dependent release pathway than it does an ALIX-dependent pathway (FIG. 11). Together these data demonstrate that the inhibitory effects of DUb-ALIX are mediated by the enzyme activity of the fused UL36 DUb and emphasize that inhibition requires DUb-ALIX to directly interact with viral Gag protein.
DUb-Gag co-assembles with HIV-1 nascent particles and inhibits virus budding
It was found that fusion of UL36 DUb to TSGlOl or ALIX dominantly interfered with release of viruses that utilize TSGlOl or ALIX dependent budding pathways. Release of HIV-1 by DUb-TSGlOl was halted specifically at the plasma membrane, which caused the accumulation of arrested budding viral particles with remarkable efficiency. While these data demonstrate a role for Ub in virus release, it remained unclear whether such defects result from deubiquitination of TSGlOl or ALIX or rather the Gag proteins with which they interact. It was reasoned that if Gag ubiquitination is important for virus exit, fusing DUb to Gag should instigate a very powerful block on HIV-1 exit, regardless of the ubiquitination status of TSGlOl or ALIX.
Enzymatically active and inactive UL36 were fused to the C-terminus of HIV-1 Gag protein that also contained a divalent strep tag (FIG. 5A). Normally, expression of HIV-1 Gag results in the production and release of viral-like particles and a portion of the Gag protein contained within them is ubiquitinated. Expression of strep-tagged WT HIV-1 Gag resulted in release of Gag particles from cells (FIG. 5B lanes 7 and 8, upper). Similarly, expression of a catalytically dead Gag-DUb* was also efficiently released from cells (lane 9 and 10). In addition, affinity isolation of released Gag from cells showed that both released WT Gag and Gag-DUb* were ubiquitinated (lanes 2 and 4). In contrast, Gag-DUb containing enzymatically active UL36 was not released from cells (lanes 11 and 12), despite a level of expression comparable to Gag- DUb* (lanes 11 and 12, lower). Additionally, the intracellular Gag-DUb was not ubiquitinated as would be predicted by the presence of the active UL36, whereas a modest signal was detected for Gag-DUb* (FIG. 5B, lower). Further experiments showed that Gag-DUb could also dominantly interfere with budding of HIV-1 demonstrating the Gag-DUb inhibits in trans. For instance, Gag- DUb* was able to drive release of mutant HIV-1 lacking both ALIX and TSGlOl binding sites (HIV-1 PTAP-/YP-) (FIG. 5C, lanes 7-9) indicating that this Gag fusion protein could co-assemble with the mutant HrV-l Gag-containing budding virus and provide functional late domain PTAP (TSGlOl) and LYPXnL (ALIX) binding sites for interaction and scission by ESCRTs. In contrast, enzymatically active Gag-DUb did not rescue budding of HIV-1 PTAP-/YP- virus (lanes 4-6). In addition, Gag-DUb also dominantly interfered with the release of WT HIV-1 virus (FIG. 5D, lane 4), which retained the ability to interact with cellular TSGlOl and ALIX. Inhibition of HIV-1 budding by Gag-DUb was greater than 90%, demonstrating that viral particles were unable to use either the ALIX-dependent or TSGlOl-dependent release pathways. Further characterization of Gag-DUb inhibitory effect on virus release revealed arrested budding structures at the plasma membrane when HIV-1 was co-expressed with Gag-DUb (FIG. 6A, panel a). In contrast, cells co-
expressing Gag-DUb* and HIV displayed almost exclusively mature free virions around them (FIG. 6 A, panel b and quantification panel). Together, these data emphasize the idea that Ub plays an important and necessary role in viral budding and indicate that it is ubiquitination of Gag proteins themselves that plays the critical role.
Ubiquitination of Gag correlates with virus release
A variety of studies have demonstrated that overexpressing Nedd4-2s can compensate for some defects in ESCRTs or viral Gag proteins that otherwise lead to inefficient budding.
However, it has always been difficult to determine what the relevant targets of those ubiquitination events are. It was assessed whether co-expression of Nedd4-2s (Chung et ah, J Virol 82:4884-
4897, 2008; Usami et al, J Virol 82:4898-4907, 2008) would have an effect on the ability of DUb- TSG101 to inhibit budding of mutant HIV-1 YP- virus that relies exclusively on TSG101 for budding (FIG. 6B). Remarkably, ectopic expression of Nedd4-2s (FIG. 6B, lane 5) suppressed much of the inhibitory effect of DUb-TSGlOl on HIV-1 release (FIG. 6B, compare lanes 9 and 10, middle). Interestingly, Nedd4-2s expression also restored a detectable measure (-50%) of ubiquitinated Gag that was readily identified in released virus (compare lanes 3 and 5) where higher molecular weight Gag bands (labeled 1, 2 and 3) were also detected with the anti-p24 antibody (lanes 7-10, darker exposure). Conversely, ubiquitination of DUb-TSGlOl in cells remained undetectable (FIG. 6B, lanes 4 and 5, upper panel). To ascertain that Gag is the target of ubiquitination at sites of virus budding, ubiquitinated proteins were isolated using agarose beads coated with anti-HA monoclonal antibodies from PI 00 membrane fraction prepared from transfected cells, which has been shown to be enriched in Gag-containing complexes undergoing assembly into nascent virions (Goff et ah, J Virol 77:9173-9182, 2003) and probed for Gag with an anti-p24 antibody. It was reasoned that if ubiquitinated Gag can be captured in these fractions, it might be possible to detect clear differences in Gag ubiquitination levels in the absence or presence of DUb-TSGlOl (deubiquitination) and upon co-expression with Nedd4-2s (re-ubiquitination). Using an anti-p24 antibody, a robust signal of high molecular weight bands were detected with WT Gag (FIG. 6C lane 1, upper panel) in stark contrast to Gag co-expressed with DUb-TSGlOl (lane 2). Loss of ubiquitinated Gag signal at the membrane coincided with strong inhibition of virus release (FIG. 6C, third panel from top, compare lanes 1 and 2). Interestingly distinct high molecular weight Gag proteins (labeled 1, 2 and 3) reappeared in the PI 00 fraction upon ectopic expression of Nedd4-2s (lane 3, upper panel). These bands were also prominently detected in the WT Gag fraction (lane 1) but remained absent from cells expressing DUb-TSGlOl in multiple experiments. Differences in detection of ubiquitinated Gag proteins (upper panel) were not due to
variability in amounts of Gag captured at the membrane, since P100 fractions exhibited identical levels of p55Gag for all samples (FIG. 6C, second panel, lanes 1-3). Importantly, appearance of ubiquitinated Gag at the membrane following co-expression with Nedd4-2 was accompanied with the recovery of about 50% of virus release (FIG. 6C, third panel, compare lanes 1 and 3) and a Gag processing pattern that is near indistinguishable from that of WT Gag (no p25-24CA doublet).
Only a partial recovery of Gag ubiquitination was observed following ectopic expression of Nedd4- 2s. This was expected because Gag at these sites is also associated with DUb-TSGlOl, which although itself permanently deubiquitinated continues to also deubiquitinate Gag as Nedd4-2s is overcoming such activity. Together these findings indicate that WT Gag is robustly ubiquitinated at the membrane, the site of HIV budding. Inhibition of Gag ubiquitination following co- expression with DUb-TSGlOl was accompanied with loss of virus release. Remarkably, a detectable Nedd4-2s-mediated recovery of Gag ubiquitination at the membrane that was
qualitatively identical to that of WT Gag (same bands appear in both samples) correlated with restoration of virus release further emphasizing the importance of Gag ubiquitination in HIV budding.
Altogether, the data described above suggest that ubiquitination of TSG101 is dispensable for HrV - 1 budding and that ubiquitination of the Gag protein itself better correlates with the ability to undergo viral release. As a correlate, overexpression of Nedd4-2s did not restore budding activity to Gag-DUb when expressed alone (FIG. 6D, lanes 4-6) nor did Nedd4-2s suppress the inhibitory effect imposed by Gag-DUb on HIV-1 budding (lanes 7-9). As expected, co-expression of Nedd4- 2s in these conditions did suppress the budding defect of the HIV-1 PTAP- mutant virus lacking its ability to bind TSG101 (lanes 10-12, PTAP-). Thus, Gag-DUb, which would represent the most powerful and proximal way of eliminating Gag ubiquitination, was resistant to the stimulatory effects of Nedd4-2s co-expression. These data therefore suggest that ubiquitination of Gag is important for HIV-1 release.
To better ascertain the key target of ubiquitination during viral budding, the ubiquitination status of proteins participating in the defective budding of Gag-Dub was examined. Gag-DUb was affinity captured on Strep-tactin beads from cells expressing Flag-tagged ESCRT-I subunits, HA- Ub, and co-expressing Nedd4-2s. Gag-DUb was isolated from a P100 membrane fraction known to be enriched in Gag-containing complexes undergoing assembly into virus-like particles (Goff et ah, J Virol 77:9173-9182, 2003). The captured Gag-containing complexes were immunoblotted for ESCRT-I components using an anti-Flag antibody (FIG. 7A, lanes 6-10), for levels of ubiquitinated proteins using an anti-HA antibody (FIG. 7A, lanes 1-5), and for the Gag protein itself using anti- p24 antibodies (FIG. 7A, lanes 11-15). All Gag proteins retain the ability to associate with
ESCRT-I members regardless of whether Gag was fused to active or inactive DUb forms. However, lower amounts of TSGlOl were captured with Gag-DUb in comparison to the WT or the enzymatically inactive Gag-DUb (lanes 7, 8 and 10). In the absence of Nedd4-2s, complexes containing Gag-DUb had greatly diminished levels of ubiquitinated proteins compared with complexes of WT Gag or inactive Gag-DUb*. Importantly, overexpression of Nedd4-2s markedly increased the level of Ub-conjugates in Gag-DUb complexes and enhanced their ability to capture TSG101/ESCRT- complexes (compare lanes 8 and 9). These ubiquitinated proteins correspond to modified ESCRT-I subunits as verified by the high molecular weight smear observed in the anti- Flag probed immunoblot for ESCRT-I subunits themselves (lanes 6-10 and panel B showing a darker exposure of this blot). The intensity of these bands also correlates with levels of
ubiquitination seen with the anti-HA antibody probed immunoblot (lanes 1-5). No high molecular weight forms of Gag-DUb were observed in the anti-p24 immunoblot as expected since fusion of DUb directly to Gag should constitute the most potent protection of Gag against ubiquitination. Despite restoration of Ub to ESCRT-I associated with Gag-DUb containing assembling particles, release of these particles was not restored (FIG. 7A, lower, right panel). These data indicate that while Gag proteins and ESCRTs both undergo ubiquitination, ubiquitination of ESCRT-I is not sufficient for completion of HIV-budding and release. Rather, the inhibitory effects of Gag-DUb, DUb-TSGlOl and DUb-ALIX are mediated by blocking ubiquitination of Gag proteins they associate with.
Incorporation of Gag-Ub into assembly sites alleviates DUb-ALIX inhibitory effect
Ectopic expression of DUb-TSGlOl or DUb-ALIX with HIV and EIAV, respectively, caused severe budding defects. Association of DUb-fusion proteins with Gag led to a clear loss of Gag ubiquitination at virus assembly sites (FIG. 7), a defect that was alleviated with ectopic expression of Nedd4-2s and was accompanied with the appearance of ubiquitinated Gag proteins at the membrane. In contrast, fusion of DUb to Gag led to a permanent deubiquitination and an irreversible adverse effect on HIV release despite a robust and detectable ubiquitination of ESCRT- I components. These findings strongly supported a model in which ubiquitin conjugation to Gag is central to ESCRT mediated virus release. To further evaluate this model, it was reasoned that incorporation of ubiquitin molecules to assembly sites in fusion with Gag (Gag-Ub) should recapitulate Nedd4-2s ubiquitination of Gag and restore virus release. To examine this possibility, EIAV, which relies on the ESCRT machinery to leave the cell and is sensitive to the inhibitory effect of DUb-ALIX, was utilized. In cells expressing EIAV and DUb-ALIX in conditions where no virus release was detected, increasing amounts of EIAV Gag-Ub (Joshi et ah, Traffic 9:1972-
1983, 2008) were co-expressed and it was hypothesized that the latter' s incorporation into Gag assembly sites would rescue virus release if ubiquitin conjugation or presence in the vicinity of Gag is important for ESCRT mediated virus release. Co-expression of Gag-Ub restored robust virus production (FIG. 8A, compare lanes 4 and 5) and virus stimulation was proportional to the levels of Gag-Ub expressed in trans (lanes 5-7).
To test whether DUb-TSGlOl inhibitory effect on HIV budding can be reversed with the incorporation of ubiquitin at Gag assembly sites, an HIV Gag-Ub fusion protein was constructed. ALIX-independent HIV-1 release became insensitive to DUb-TSGlOl inhibitory effect upon co- expression with Gag-Ub (FIG. 8B, compare lanes 4 and 5) and virus stimulation was proportional to the levels of Gag-Ub expressed in trans (lane 6). Gag-Ub also enhanced budding of WT virus (compare lane 1 to lanes 2 and 3), further supporting a stimulatory role for Ub conjugation to Gag at assembly sites during HIV exit. Thus, incorporation of Gag-Ub into nascent virus relieved DUb- ESCRT inhibitory effects, indicating that the mere presence of ubiquitin at Gag assembly sites allowed Gag to bypass DUb-ESCRT-mediated deubiquitination and restored robust virus budding further emphasizing the importance of Gag ubiquitination.
DISCUSSION
The methods disclosed herein efficiently deubiquitinated virus budding sites by delivering DUb activity in fusion with Gag or Gag-binding proteins, the ESCRT components TSG101 and ALIX. Deubiquitination of virus budding using either type of DUb fusion protein caused a marked interruption of virus budding as was quantified by both biochemical and electron microscopy analyses. In stark contrast with deubiquitination of ESCRT components, deubiquitination of Gag brought virus release to a complete and irreversible halt despite a measurable ubiquitination of ESCRT components at sites of virus assembly. These data support a central role for Gag ubiquitination in virus budding and provide the first direct demonstration of a critical role for Ub in facilitating this process.
Ubiquitin is required for virus scission from the cell
The generation of a tool that deubiquitinated virus assembly sites without disruption of function of both viral and cellular proteins involved in virus budding was helpful to address the role of Ub in virus production. Indeed, DUb-TSGlOl incorporated in its known cellular complex ESCRT-I and retained sufficient interaction with Gag to be captured at the membrane in late- assembly complexes. Similarly, ALIX retained the ability to homodimerize and recruit its ESCRT- III partner CHMP4b. Incorporation of DUb-ESCRTs had no broad adverse effect on the host
ESCRT machinery as DUb-TSGlOl inhibitory effect was specifically limited to HIV, while MoMLV and EIAV, two viruses that also utilize the ESCRT pathway to exit the cell, remained insensitive. DUb delivery led to the generation of ubiquitination-resistant assembly sites and arrested nascent viral particles in late steps of budding from the plasma membrane, indicating that Ub conjugation is involved in virus scission from cells. Interference with virus production required the delivery of an enzymatically active DUb since loss of virus budding was observed only when an active DUb was fused to Gag or ESCRT proteins. As DUb fusion proteins retained their known protein-protein interactions and inhibited virus release only if they retained the ability to incorporate into Gag assembly complexes (FIG. 4), it became clear that it is the suppression of Ub conjugation to Gag assembly complexes at the membrane that caused disruption of virus budding and not the mere physical fusion of the DUb catalytic domain to viral or cellular proteins, or a broad toxic and debilitating effect on the cell ESCRT pathway. These data revealed a central role for Ub in ESCRT-mediated natural scission of virus from the cell. Ubiquitination of ESCRTs is insufficient for virus budding
The mere presence of ubiquitin at sites of virus budding alleviates virus exit dysfunction, whether ubiquitin was conjugated to Gag, ESCRT components or physically fused to Gag (Chung et al, J Virol 82:4884-4897, 2008; Joshi et al, Traffic 9: 1972-1983, 2008; Patnaik et al., J Virol 76:2641-2647, 2002; Weiss et al, PLoS Pathog 6:el001107, 2010; Zhadina et al, PLoS Pathog 6:el001153, 2010). The data disclosed herein demonstrate that the ubiquitination of Gag itself is critical for virus release. In the absence of ESCRT ubiquitination, Gag ubiquitination at sites of budding at the membrane was sufficient to stimulate virus release. Indeed, DUb-TSGlOl inhibitory effect on HIV budding was lifted with Nedd4-2s-mediated ubiquitination and virus production correlated with the ubiquitination of Gag complexes at the membrane (FIG. 6). Gag deubiquitination, however, caused an irreversible loss of virus production despite an efficient ubiquitination of TSG101/ESCRT-I at sites of budding, indicating that ESCRTs ubiquitination was insufficient for virus production.
The data disclosed herein support a model in which both ubiquitin conjugation to Gag and functional L domain sequences are important for HIV budding. Indeed, interference with Gag ubiquitination by cumulative mutations of lysine residues in HIV Gag (near L domain sequences) inhibited virus production and arrested budding particles at the membrane (Gottwein et al, J Virol 80:6267-6275, 2006), although Gag retained an intact L domain. Also, disruption of L domain led to the accumulation of heavily ubiquitinated Gag at the membrane and failure to release virus (Jager et al, J Virol 81:9193-9201, 2007). Thus, deubiquitination of Gag or inability to access
ESCRT appears to be equally detrimental to virus budding, suggesting both Ub and ESCRT components cooperate in particle budding and separation from cells.
Conclusions
The studies described herein determined that disruption of either L domain sequences or interference with Gag ubiquitination is equally detrimental to virus release, indicating that although Ub molecules conjugated to Gag are not essential for ESCRT recruitment, Ub conjugation to Gag carrying intact L domains is necessary for Gag utilization of ESCRTs at budding sites to separate virus from cells. Gag exhibits a dual and strict requirement for both ubiquitin conjugation and L domain recruitment of TSGlOl and ALIX to promote ESCRT- mediated HIV budding.
Example 2: Isolation of ubiquitinated Gag proteins from HIV-1 budding sites
HIV-1 and most enveloped viruses utilize members of the Endosomal Sorting Complex Required for Transport (ESCRT) pathway to exit the cell (Bieniasz, Cell Host Microbe 5(6), 550- 558, 2009; Demirov and Freed, Virus Res 106(2), 87-102, 2004; Morita et al., Annu Rev Cell Dev Biol 20, 395-425, 2004; Votteler and Sundquist, Cell Host Microbe 14(3), 232-241, 2013). The ESCRT pathway is comprised of three multi-protein complexes, named ESCRT-I, II, and III, which catalyze membrane-modeling events critical for the budding of viruses, generation of
multivesicular bodies (Babst et al., Dev Cell 3(2), 271-282, 2002; Saksena et al., Cell 136(1), 97- 109, 2009; Wollert and Hurley, Nature 464(7290), 864-869, 2010; Wollert et al, Nature
458(7235), 172-177, 2009) and completion of cytokinesis (Carlton and Martin-Serrano, Science 316(5833), 1908-1912, 2007; Elia ei al, Proc Natl Acad Sci USA 108(12), 4846-4851, 2011;
Guizetti et al., Science 331(6024), 1616-1620, 2011; Morita et al., EMBO J 26(19), 4215-4227, 2007). HIV-1 structural protein Gag recruits TSGlOl and ALIX to gain access to members of the ESCRT pathway (Garrus et al., Cell 107(1), 55-65, 2001; Martin-Serrano et al., Nat Med 7(12), 1313-1319, 2001; Strack et al., Cell 114(6), 689-699, 2003; VerPlank et al, Proc Natl Acad Sci USA 98(14), 7724-7729, 2001). TSGlOl functions as part of ESCRT-I, a complex that links Gag to members of ESCRT-III. The ALIX-driven pathway functions independently of TSGlOl and binds ESCRT-III directly.
In the cell, ubiquitin signals the recruitment of ESCRT components and initiates sorting of ubiquitinated membrane proteins through endosomes/lysosomal compartments. Although both Gag and ESCRTs undergo some level of ubiquitination, prior to the present disclosure, there has been no direct evidence of a role for ubiquitin in HIV-1 budding.
This example describes a method to capture ubiquitinated Gag proteins at the cell membrane, the site of HIV-1 budding. The approach involves fractionation of cellular membranes and the specific detection of ubiquitinated HIV-1 Gag molecules (Gag-Ub) therein. The protocol is a multi-step process and comprises the initial isolation of membrane-enriched fractions (PI 00 fraction) from 293T cells expressing WT HIV-1 and HA-tagged ubiquitin. Next, ubiquitinated proteins bound to membrane are isolated by immunoprecipitation assays, using an antibody that specifically recognizes HA tags fused to ubiquitin molecules. The immune complexes are subsequently analyzed by WB and Gag-Ub complexes are specifically detected by an anti-p24CA antibody.
The protocol can be adapted with small changes to detect ubiquitinated Gag-binding proteins, such as TSG101 and ALIX and the other ESCRT-I members at sites of virus budding. In this case, Gag binding proteins are purified by co-immunoprecipitation assays. A tagged version of Gag protein (for example, Strep tag), competent to form virus like particles (VLPs), is isolated from the P100 membrane fractions of 293T-expressing Flag-tagged ESCRT-I subunits and HA-tagged ubiquitin. The captured Gag-containing complexes are probed for ESCRT-I components using an anti-Flag antibody, for ubiquitinated proteins using an anti-HA antibody, and for the Gag protein itself using an anti-Gag or anti-Strep antibody.
PROTOCOL
Capture of ubiquitinated HIV-1 Gag molecules at the plasma membrane
Cell preparation and transfection
293T cells were cultured in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and antibiotics (Penicillin (lOOIU/ml) and Streptomycin (100 μg/ml)) at 37°C, 5% C02.
A day before transfection, cells were detached from nearly confluent flasks using 0.05%
Trypsin-EDTA (IX) and 2.5 x 106 cells were seated in 4 ml of medium per T25 flask. Ten T25 flasks were seeded to detect Gag-Ub complexes at the plasma membrane.
On the next day, cell monolayers were about 60% confluent and ready for transfection. Cells were transfected using LIPOFECTAMINE™ 2000, according to the manufacturer instructions, using 1.5 μg of HA-ubiquitin expressing plasmid and 1 μg of the HIV-1 proviral DNA (molecular clones of HIV-1 pNL4-3) per T25 flask. For each T25 flask, DNA was diluted in 500 μΐ of Opti-MEM I Reduced Serum Medium without serum and mixed gently.
LIPOFECTAMINE™ 2000 was mixed gently before use, 20 μΐ was diluted in 500 μΐ of Opti-MEM I medium and incubated for 5 minutes at room temperature. The diluted DNA was combined with
diluted LIPOFECTAMINE 2000 (total volume = 1 ml), mixed gently and incubated for 20 minutes at room temperature. One ml of the transfection mixture was added drop-wise to each T25 flask and gently swirled to mix. The cells were incubated at 37°C, 5% C02 for 24 hours.
The transfection of HIV-1 proviral DNA into 293T cells resulted in the production of a replication-competent human immunodeficiency virus.
Cellular fractionation
Twenty four hours post transfection, the medium was removed and the cell monolayers were washed using 5ml of cold PBS and by gently rocking the flask. An additional 5 ml of cold PBS was added; the cells from all T25 flasks were collected and combined together in a 50 ml tube. The cells were pelleted at 1,000 x g for 5 minutes. Precaution was taken to minimize aerosol formation due to the presence of live virus. Rotor bucket covers were used during centrifugation steps and/or the tubes were wrapped with PARAFILM™.
Cells were resuspended in 5 ml of cold hypotonic buffer (10 mM Tris pH 7.5, 1 mM
MgCl2) containing 5 mM N-ethylmaleimide (NEM) and complete protease inhibitor cocktail, and kept on ice for 30 minutes to allow cells to swell.
The samples were moved to a pre-chilled 7 ml Dounce homogenizer to break the cells and release nuclei. The Dounce homogenizer was kept on ice and 15 strokes were performed with a tight pestle.
The dounced cells were collected (~ 5 ml) in a cold 15 ml tube and aliquoted into five 1.5 mL cold-labeled micro-centrifuge tubes; 1 ml of the total lysate was added to each tube.
The samples were centrifuged at 1,000 x g at 4°C for 15 minutes to pellet the nuclei fraction (P10 fraction).
The supernatant (~ 5 ml) representing the cytoplasmic and membrane fraction (S10 fraction) was retained and placed in a 5 ml polyallomer centrifuge tube (for Beckman SW51Ti rotor or equivalent).
The S10 fraction was centrifuged in an ultracentrifuge at 100,000 x g at 4°C for 1 hour to pellet the membrane-enriched fraction (PI 00).
The supernatant (SI 00) was removed and the small translucent pellet corresponding to the membrane-enriched fraction (P100) was resuspended in 100 μΐ of SDS buffer (1% SDS, 150 mM NaCl, 50 mM Tris-HCl pH 8). Cold RIPA buffer (900 μΐ of 0.5% IGEPAL, 50 mM HEPES [pH 7.3], 150 mM NaCl, 2 mM EDTA, 20 mM β-glycerophosphate, 0.1 mM Na3V04, 1 mM NaF, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 5 mM N-ethylmaleimide (NEM) and complete protease inhibitor cocktail) was added to dilute 10 times the amount of SDS. The sample
was placed in a pre-chilled 1.5 ml microcentrifuge tube and the pellet was pipetted (up and down) vigorously until the membrane was completely solubilized.
Fifty μΐ was saved and placed in a 1.5 ml labeled microcentrifuge tube. Fifty μΐ of Laemmli Sample Buffer 2X was added and the sample was heated and stored at -80 °C. This sample represented total lysate of the P100 fraction (input fraction). The sample was stored at -80 °C and analyzed by SDS-PAGE
Immunoprecipitation of ubiquitinated Gag proteins
The P100 fraction samples were incubated overnight at 4°C with 200 μΐ of anti-HA mouse antibodies conjugated to agarose beads.
The following day, the beads were washed (at least 5 to 7 times) by adding 1 ml of RIPA buffer for each wash and centrifuged for 2 minutes at 1000 x g to recover/pellet beads.
At the last wash, all washing buffer was carefully aspirated and 200 μΐ of Laemmli Sample Buffer 2X was added.
The samples were heated for 5 minutes and vortexed vigorously to detach proteins from beads. The samples were stored at -80 °C to be analyzed by SDS-PAGE and WB.
Protein analysis
HrV-1 Gag-Ub proteins were detected by immunoblotting. A 10% acrylamide gel (size 15 cm X 15 cm) was prepared for SDS-PAGE and loaded with 200 μΐ of each immunoprecipitation sample. In the same gel, 30 μΐ of the P100 input fraction was also loaded. The gel was run overnight at 70 Volts.
RESULTS
An example of ubiquitinated HIV- 1 Gag molecules captured at the site of viral budding is shown in FIG. 12. The membrane-enriched fraction (P100) was isolated from 293T expressing a full-length HIV-1 and HA-tagged ubiquitin molecules (FIG. 12B, lane 1). HA-tagged ubiquitinated proteins were purified in immunoprecipitation assays from the P100 fraction using anti-HA antibody conjugated beads. The captured immunocomplexes were probed with an anti-HIV hyperimmune human patient serum and a robust signal of high molecular weight bands
corresponding to Gag-Ub complexes was detected with the wild-type HIV-1 sample (FIG. 12A, lane 1). In contrast, no Gag-Ub proteins were captured from P100 fractions of 293T cells expressing HIV-1 and the catalytic domain of the HSV UL36 deubiquitinating enzyme (DUb) fused onto the N-terminus of TSGlOl (DUb-TSGlOl) (FIGS. 12A and 12D, lane 2). As discussed
in Example 1, co-expression of DUb-TSGlOl is predicted to prevent the accumulation of ubiquitinated forms of Gag at HIV-1 budding sites and inhibit virus release (FIG. 12C, lane 2). Consistent with this, differential detection of ubiquitinated Gag proteins were not due to a difference in amounts of Gag captured at the membrane, since PI 00 fractions exhibited identical levels of p55Gag for both WT HIV-1 and HIV-1 co-expressed with DUb-TSGlOl samples (FIG. 12B, lanes 1 and 2). Collectively these data show the efficient capture of ubiquitinated HIV-1 Gag proteins at the membrane, the site of HIV-1 budding. Gag-Ub capture is specific since co- expression of the deubiquitin enzyme UL36, which is delivered to HIV-1 budding sites by the Gag- binding cellular partner TSG101, and prevents ubiquitin conjugation to Gag, also interferes with the capture of Gag-Ub using this protocol.
Example 3: Evaluation of DUb vectors in a primary cell model of HIV-1 latency
One of the major barriers to curing HIV-1 infection is the existence of a reservoir of latently infected cells. The latent reservoir is primarily made up of a small pool of CD4+ T lymphocytes that are in a resting memory state and harbor a stably integrated, replication-competent HIV-1 pro virus. These latently infected cells are very difficult to target for elimination because they are phenotypically indistinguishable from uninfected cells. Due to the stability of the latent reservoir, HIV-infected individuals must remain on antiretro viral therapy indefinitely in order to inhibit virus propagation.
A primary cell model that closely approximates the condition of latently infected CD4+ T lymphocytes in HIV-1 infected patients has been described (Kim et ah, Nat Protoc 9(12):2755- 2770, 2014). In this model system, CD4+ T lymphocytes are isolated from healthy donors. The isolated cells undergo two round of HIV-1 infection following activation through T cell receptor engagement. Isolated CD4+ T lymphocytes are plated in medium containing antibodies to CD28 on a surface that is pre-coated with antibodies to CD3. Dual binding of the antibodies to CD3 and CD28 initiates intracellular signaling cascades that turn on expression of genes required for cytokine secretion, proliferation and differentiation, which are all hallmarks of T cell activation. Resting CD4+ T lymphocytes are relatively non-permissive to infection, and this natural activation produces a cell state that is receptive for HIV-1 infection. In the first round of infection, activated CD4+ T lymphocytes are transduced with a lentivirus expressing anti-apoptotic Bcl-2. The expression level of Bcl-2 in these cells is similar to that in freshly isolated CD4s (Figure 1 of Kim et al.) and extends the lifespan of the cells ex vivo. Thus, the cells can be infected with an HIV-1 reporter virus following another round of activation, and then cultured without exogenous
cytokines for several weeks to allow a return to a resting state in which HIV-1 latency is established.
To evaluate the effect of DUb vectors on latently HIV-infected T cells, latently infected CD4+ T lymphocytes are generated ex vivo according to the method of Kim et al or isolated from ART-treated patient(s). The latently infected cells are then transduced with a recombinant lentiviral/retro viral vector encoding DUb-TSGlOl, DUb-ALIX or Gag-DUb and the effect of expression of the DUb fusion proteins on virus release is assessed. It is expected that DUb vectors can be used to capture virus at the surface of cells in which a competent viral reservoir is newly replicating. Arresting virus particles at the surface of stimulated, latently infected cells is expected to promote clearance of the virus in vivo and enable isolation of infected cells for ex vivo studies.
In view of the many possible embodiments to which the principles of the disclosed invention may be applied, it should be recognized that the illustrated embodiments are only preferred examples of the invention and should not be taken as limiting the scope of the invention. Rather, the scope of the invention is defined by the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.
Claims
1. A nucleic acid molecule encoding a fusion protein comprising a deubiquitinase (DUb) catalytic domain fused to a targeting protein, wherein the targeting protein is a protein that targets the fusion protein to sites of human immunodeficiency virus (HIV) assembly or budding in a host cell.
2. The nucleic acid molecule of claim 1, wherein the DUb is a human DUb.
3. The nucleic acid molecule of claim 2, wherein the human DUb is ubiquitin- specific protease 7 (USP7), cylindromatosis (CYLD), AMSH or ubiquitin- specific processing protease Y (UBPY).
4. The nucleic acid molecule of claim 1, wherein the DUb is a viral DUb.
5. The nucleic acid molecule of claim 4, wherein the viral DUb is herpes simplex virus- 1 (HSV-1) UL36 or a gamma herpesvirus M48.
6. The nucleic acid molecule of any one of claims 1-5, wherein the targeting protein comprises an endosomal sorting complex required for transport (ESCRT) pathway protein, or a functional fragment thereof.
7. The nucleic acid molecule of claim 6, wherein the targeting protein is TSG101 or a functional fragment thereof.
8. The nucleic acid molecule of claim 7, wherein the functional fragment comprises the ubiquitin E2 variant (UEV) domain of TSG101.
9. The nucleic acid molecule of claim 6, wherein the targeting protein is ALIX or a functional fragment thereof.
10. The nucleic acid molecule of claim 9, wherein the functional fragment comprises the Brol domain of ALIX, or comprises the Brol and V domains of ALIX.
11. The nucleic acid molecule of any one of claims 1-5, wherein the targeting protein comprises HIV Gag or a functional fragment thereof.
12. The nucleic acid molecule of claim 11, wherein HIV Gag is HIV-1 Gag.
13. The nucleic acid molecule of claim 11 or claim 12, wherein the functional fragment lacks the matrix (MA) domain and the N-terminal half of the capsid (CA) domain.
14. The nucleic acid molecule of any one of claims 1-13, comprising a linker between the DUb and targeting protein.
15. A vector comprising the nucleic acid molecule of any one of claims 1-14.
16. The vector of claim 15, which is an expression vector.
17. The vector of claim 15, which is a lenti viral vector.
18. The vector of claim 15, which is an adeno-associated virus (AAV) vector.
19. The vector of any one of claims 15-18, wherein the nucleic acid molecule is operably linked to a promoter.
20. The vector of claim 19, wherein the promoter is a constitutive promoter.
21. The vector of claim 20, wherein the promoter is a cytomegalovirus promoter.
22. The vector of claim 19, wherein the promoter is an inducible promoter.
23. A recombinant lentivirus comprising the nucleic acid molecule of any one of claims 1-14.
24. A recombinant AAV comprising the nucleic acid molecule of any one of claims 1-
14.
25. An isolated cell comprising the nucleic acid molecule of any one of claims 1-14, the vector of any one of claims 15-22, the recombinant lentivirus of claim 23 or the recombinant AAV of claim 24.
26. The isolated cell of claim 25, wherein the cell is a T lymphocyte.
27. The isolated cell of claim 26, wherein the T lymphocyte is a CD4+ T lymphocyte.
28. A method of inhibiting budding of HIV from an infected host cell, comprising contacting the cell with the nucleic acid molecule of any one of claims 1-14, the vector of any one of claims 15-22, the recombinant lentivirus of claim 23 or the recombinant AAV of claim 24.
29. The method of claim 28, which is an ex vivo method.
30. The method of claim 28, which is an in vivo method, wherein contacting the cell comprises administering the nucleic acid molecule, vector, recombinant lentivirus or recombinant AAV to a subject infected with HIV.
31. A method of treating an HIV infection in a subject, comprising administering to the subject a therapeutically effective amount of the nucleic acid molecule of any one of claims 1-14, vector of any one of claims 15-22, the recombinant lentivirus of claim 23, the recombinant AAV of claim 24 or the isolated cell of any one of claims 25-27.
32. The method of claim 31, wherein the nucleic acid molecule, vector, recombinant lentivirus, recombinant AAV or isolated cell is administered intramuscularly or intravenously.
33. The method of any one of claims 30-32, further comprising administering anti- retroviral therapy (ART) or highly active anti-retroviral therapy (HAART) to the subject.
34. The method of any one of claims 30-33, wherein the nucleic acid molecule is incorporated into the genome of target cells in the subject.
35. The method of claim 34, wherein the target cells are T lymphocytes.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462030193P | 2014-07-29 | 2014-07-29 | |
| US62/030,193 | 2014-07-29 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016018921A1 true WO2016018921A1 (en) | 2016-02-04 |
Family
ID=53836231
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/042492 Ceased WO2016018921A1 (en) | 2014-07-29 | 2015-07-28 | Compositions and methods for inhibiting human immunodeficiency virus budding |
Country Status (1)
| Country | Link |
|---|---|
| WO (1) | WO2016018921A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019090234A1 (en) * | 2017-11-06 | 2019-05-09 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for using engineered deubiquitinases for probing ubiquitin-dependent cellular processes |
| WO2019210249A1 (en) * | 2018-04-26 | 2019-10-31 | Oregon Health & Science University | Methods of aav vector production by modulating deubiquitinating enzyme activity |
-
2015
- 2015-07-28 WO PCT/US2015/042492 patent/WO2016018921A1/en not_active Ceased
Non-Patent Citations (5)
| Title |
|---|
| BENEDIKT M. KESSLER ET AL: "Proteome Changes Induced by Knock-Down of the Deubiquitylating Enzyme HAUSP/USP7", JOURNAL OF PROTEOME RESEARCH, vol. 6, no. 11, 1 November 2007 (2007-11-01), pages 4163 - 4172, XP055212234, ISSN: 1535-3893, DOI: 10.1021/pr0702161 * |
| DAVID KOMANDER ET AL: "Breaking the chains: structure and function of the deubiquitinases", NATURE REVIEWS MOLECULAR CELL BIOLOGY, vol. 10, no. 8, 1 August 2009 (2009-08-01), pages 550 - 563, XP055212230, ISSN: 1471-0072, DOI: 10.1038/nrm2731 * |
| PAOLA SETTE ET AL: "Ubiquitin conjugation to Gag is essential for ESCRT-mediated HIV-1 budding", RETROVIROLOGY, BIOMED CENTRAL LTD., LONDON, GB, vol. 10, no. 1, 29 July 2013 (2013-07-29), pages 79, XP021160436, ISSN: 1742-4690, DOI: 10.1186/1742-4690-10-79 * |
| TAVASSOLI ALI ET AL: "Inhibition of HIV Budding by a Genetically Selected Cyclic Peptide Targeting the Gag-TSG101 Interaction", ACS CHEMICAL BIOLOGY, AMERICAN CHEMICAL SOCIETY, WASHINGTON, DC, US, vol. 3, no. 12, 1 December 2008 (2008-12-01), pages 757 - 764, XP002604780, ISSN: 1554-8929, DOI: 10.1021/CB800193N * |
| W. I. SUNDQUIST ET AL: "HIV-1 Assembly, Budding, and Maturation", COLD SPRING HARBOR PERSPECTIVES IN MEDICINE, vol. 2, no. 7, 13 March 2012 (2012-03-13), pages a006924 - a006924, XP055211838, DOI: 10.1101/cshperspect.a006924 * |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019090234A1 (en) * | 2017-11-06 | 2019-05-09 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for using engineered deubiquitinases for probing ubiquitin-dependent cellular processes |
| CN111787940A (en) * | 2017-11-06 | 2020-10-16 | 纽约市哥伦比亚大学理事会 | Compositions and methods for probing ubiquitin-dependent cellular processes using engineered deubiquitinating enzymes |
| US11845967B2 (en) | 2017-11-06 | 2023-12-19 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for using engineered deubiquitinases for probing ubiquitin-dependent cellular processes |
| CN111787940B (en) * | 2017-11-06 | 2024-09-10 | 纽约市哥伦比亚大学理事会 | Compositions and methods for probing ubiquitin-dependent cellular processes using engineered deubiquitinating enzymes |
| US12084696B2 (en) | 2017-11-06 | 2024-09-10 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for using engineered deubiquitinases for probing ubiquitin-dependent cellular processes |
| US12091695B2 (en) | 2017-11-06 | 2024-09-17 | The Trustees Of Columbia University In The City Of New York | Compositions and methods for using engineered deubiquitinases for probing ubiquitin-dependent cellular processes |
| WO2019210249A1 (en) * | 2018-04-26 | 2019-10-31 | Oregon Health & Science University | Methods of aav vector production by modulating deubiquitinating enzyme activity |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Sette et al. | Ubiquitin conjugation to Gag is essential for ESCRT-mediated HIV-1 budding | |
| Popov et al. | Human immunodeficiency virus type 1 Gag engages the Bro1 domain of ALIX/AIP1 through the nucleocapsid | |
| Javanbakht et al. | Characterization of TRIM5α trimerization and its contribution to human immunodeficiency virus capsid binding | |
| Schubert et al. | The two biological activities of human immunodeficiency virus type 1 Vpu protein involve two separable structural domains | |
| US11371061B2 (en) | Compositions and methods for improving viral vector efficiency | |
| AU711126B2 (en) | Protein targeting into HIV virions based on HIV-1 VPR fusion molecules | |
| Ao et al. | Contribution of the C-terminal tri-lysine regions of human immunodeficiency virus type 1 integrase for efficient reverse transcription and viral DNA nuclear import | |
| Mamede et al. | Heterogeneous susceptibility of circulating SIV isolate capsids to HIV-interacting factors | |
| Wight et al. | The gammaretroviral p12 protein has multiple domains that function during the early stages of replication | |
| Grewe et al. | Cytoplasmic utilization of human immunodeficiency virus type 1 genomic RNA is not dependent on a nuclear interaction with gag | |
| Kinomoto et al. | Amino acid 36 in the human immunodeficiency virus type 1 gp41 ectodomain controls fusogenic activity: implications for the molecular mechanism of viral escape from a fusion inhibitor | |
| Bello et al. | Budding of retroviruses utilizing divergent L domains requires nucleocapsid | |
| Maegawa et al. | Contribution of RING domain to retrovirus restriction by TRIM5α depends on combination of host and virus | |
| Schmitt et al. | Lentivirus restriction by diverse primate APOBEC3A proteins | |
| Maegawa et al. | Silencing of tripartite motif protein (TRIM) 5α mediated anti-HIV-1 activity by truncated mutant of TRIM5α | |
| Zhang et al. | Inhibitory effect of human TRIM5α on HIV-1 production | |
| Popov et al. | Human immunodeficiency virus type 1 and related primate lentiviruses engage clathrin through Gag-Pol or Gag | |
| WO2012118092A1 (en) | Fusion protein | |
| Salzwedel et al. | Complementation of diverse HIV-1 Env defects through cooperative subunit interactions: a general property of the functional trimer | |
| Douglas et al. | A comparative mutational analysis of HIV-1 Vpu subtypes B and C for the identification of determinants required to counteract BST-2/Tetherin and enhance viral egress | |
| Dorjbal et al. | The role of ITCH protein in human T-cell leukemia virus type 1 release | |
| Guo et al. | The R362A mutation at the C-terminus of CA inhibits packaging of human immunodeficiency virus type 1 RNA | |
| Ruiz et al. | BST-2 mediated restriction of simian–human immunodeficiency virus | |
| Liu et al. | Mutagenesis of N-terminal residues of feline foamy virus Gag reveals entirely distinct functions during capsid formation, particle assembly, Gag processing and budding | |
| Chen et al. | Chimeric HIV-1 containing SIV matrix exhibit enhanced assembly in murine cells and replicate in a cell-type-dependent manner in human T cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15750198 Country of ref document: EP Kind code of ref document: A1 |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15750198 Country of ref document: EP Kind code of ref document: A1 |