WO2016016826A1 - Methods and materials for manipulating phloridzin production - Google Patents

Methods and materials for manipulating phloridzin production Download PDF

Info

Publication number
WO2016016826A1
WO2016016826A1 PCT/IB2015/055743 IB2015055743W WO2016016826A1 WO 2016016826 A1 WO2016016826 A1 WO 2016016826A1 IB 2015055743 W IB2015055743 W IB 2015055743W WO 2016016826 A1 WO2016016826 A1 WO 2016016826A1
Authority
WO
WIPO (PCT)
Prior art keywords
plant
chi
construct
phloridzin
expression
Prior art date
Application number
PCT/IB2015/055743
Other languages
French (fr)
Inventor
Andrew Patrick Dare
David R GREENWOOD
Roger Paul Hellens
Original Assignee
Andrew Patrick Dare
Greenwood David R
Roger Paul Hellens
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Andrew Patrick Dare, Greenwood David R, Roger Paul Hellens filed Critical Andrew Patrick Dare
Publication of WO2016016826A1 publication Critical patent/WO2016016826A1/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
    • C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine

Definitions

  • the present invention relates to compositions and methods for producing plants with altered altered phloridzin content.
  • the dihydrochalcone phlordizin (phloretin 2'-glucoside, see Fig. 1) is the major phenolic glucoside found in apple trees. Phlorizin has a bitter taste that contributes to the characteristic flavour of cider, and its dimerised oxidation products contribute to the colour of apple juices. However, since it was isolated from the bark of the apple tree in 1835, phlorizin has attracted most scientific interest through its use as a pharmaceutical and tool for physiology research.
  • Phloridzin and its derivatives have also been shown to be extremely effective antioxidants in vitro, and to have a range of bioactive functions such as inhibition of lipid peroxidation, prevention of bone loss, enhancement of memory, and inhibition of cancer cell growth.
  • phlorizin was believed to exist only in Malus species.
  • phloretin glycosides have been reported in the leaves of Australian native sarsaparilla (Smilax glyciphylla), sweet tea (Lithocarpus polystachyus) and at very low levels in strawberry fruit.
  • phlorizin In apple trees, phlorizin is found primarily in the young shoots, roots, leaves and bark. In fruit, phloridzin is most abundant in the seeds, with intermediate levels in both the core and the skin, and the lowest level in the cortex. Variation has been assessed within apple trees, between orchards, between different cultivars and among mutants). Despite this information, relatively little is known of the in planta function of phloridzin in apple tree physiology, although it has been suggested that it might act in apple tree growth and development or be an inhibitor of bacterial or fungal growth. The molecular basis for production of phloridzin in planta has not been fully described.
  • Phloretin is a product of the phenylpropanoid pathway, with conversion to its glucoside, phlorizin, likely to be catalysed by the action of a uridine diphosphate (UDP) glycosyltransferase (UGT).
  • UGTs mediate the transfer of a sugar residue from an activated nucleotide sugar to acceptor molecules (aglycones). Plants contain large families of UGTs with over 100 genes being described in Arabidopsis. These genes have a common signature motif of 42 amino acids thought to be involved in binding of the UDP moiety of the activated sugar.
  • MpUGT88Al mediates the glycosylation of the dihydrochalcone phloretin to phlorizin.
  • Altering phloridzin by altering CHI provides a method for producing a plant, or part thereof, with altered levels of phloridzin, the method comprising altering expression of at least one chalcone isomerase (CHI) protein in the plant or part thereof.
  • CHI chalcone isomerase
  • CHI chalcone isomerase
  • CHI chalcone isomerase
  • the method comprises introducing a construct into the plant, or part thereof, to affect the altering expression of the at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • the method comprises introducing a construct into the plant or part thereof to affect the reducing expression of the at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • the construct contains a promoter sequence operably linked to at least part of a chalcone isomerase (CHI) gene, wherein the part of the gene is in an antisense orientation relative to the promoter sequence.
  • CHI chalcone isomerase
  • the part of the gene is at least 21 nucleotides in length.
  • the construct is an antisense construct.
  • the construct is an RNA interference (RNAi) construct.
  • RNAi RNA interference
  • the construct is a CRISPR-CAS construct.
  • the invention provides a plant, or part thereof, produced by the method of the invention.
  • the plant, or part thereof comprises the construct. Reducing or eliminating CHI
  • the invention provides a method for producing a plant, or part thereof, with increased levels of phloridzin, the method comprising reducing, or eliminating, expression of a chalcone isomerase (CHI) protein in the plant or part thereof.
  • CHI chalcone isomerase
  • Non-GM selection method for reduced or eliminated chalcone isomerase CHI
  • the invention provides a method for identifying a plant with a genotype indicative of producing increased levels of phloridzin, the method comprising testing a plant for at least one of: a) reduced, or eliminated, expression of at least one chalcone isomerase
  • CHI chalcone isomerase
  • presence of any of a) to d) indicates that the plant will produce increased levels of phloridzin.
  • the invention provides a method for producing a plant that produces with increased levels of phloridzin, the method comprising crossing one of: a) a plant of the invention, b) a plant produced by a method of the invention, and c) a plant selected by a method of the invention with another plant, wherein the off-spring produced by the crossing is a plant that produces increased levels of phloridzin.
  • the plant of a), b, or c) is a plant with reduced, or eliminated, expression of at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • the invention provides a method for producing a fruit with increased levels of phloridzin, the method comprising cultivating at least one of: a) a plant of the invention, b) a plant produced by a method of the invention, and c) a plant selected by a method of the invention wherein the cultivated plant produces fruit with increased levels of phloridzin.
  • the plant produces a fruit with increased levels of phloridzin as a result of the plant having reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • Plant with altered levels of phloridzin In a further aspect the invention provides a plant, or part thereof, with altered levels of phloridzin produced by a method of the invention.
  • the plant, or part thereof, has decreased levels of phloridzin.
  • the plant, or part thereof has increased levels of phloridzin.
  • the plant, or part thereof comprises a construct of the invention.
  • the invention provides a plant, or part thereof, with altered levels of phloridzin, wherein the plant has altered expression of at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • the plant, or part thereof has decreased levels of phloridzin and increased expression of at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • the plant, or part thereof has increased levels of phloridzin and decreased expression of at least one chalcone isomerase (CHI) protein.
  • the plant, or part thereof, comprises a construct of the invention.
  • the altered expression of the at least one chalcone isomerase (CHI) protein is affected by the construct of the invention.
  • CHI chalcone isomerase
  • the invention provides a plant, or part thereof, with increased levels of phloridzin, wherein the plant, or part thereof, has reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • the plant, or part thereof, comprises a construct of the invention.
  • the invention provides a fruit with altered levels of phloridzin produced by a method of the invention.
  • the invention provides fruit with altered levels of phloridzin with altered expression of at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • altered is decreased.
  • the invention provides a fruit with increased levels of phloridzin produced by a method of the invention.
  • the invention provides fruit with increased levels of phloridzin with reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
  • Construct for reducing or eliminating expression of a chalcone isomerase (CHI) protein in a plant
  • the invention provides a construct for reducing the expression of an chalcone isomerase (CHI) protein in a plant.
  • the construct is contains a promoter sequence operably linked to at least part of an chalcone isomerase (CHI) gene, wherein the part of the gene is in an antisense orientation relative to the promoter sequence.
  • CHI chalcone isomerase
  • the part of the gene is at least 21 nucleotides in length.
  • the construct is an antisense construct. In a further embodiment the construct is an RNA interference (RNAi) construct.
  • RNAi RNA interference
  • the plant, or fruit may be from any species.
  • the plant is from a gymnosperm plant species.
  • the plant is from an angiosperm plant species. In a further embodiment the plant is from a from dicotyledonuous plant species.
  • the plant is from monocotyledonous species.
  • the plant, or fruit is from a Rosaceae species.
  • Preferred Rosaceae genera include Exochorda, Maddenia, Oemleria, Osmaronia, Prinsepia, Prunus, Maloideae, Amelanchier, Aria, Aronia, Chaenomeles,
  • Prunus Maloideae, Amelanchier, Aria, Aronia, Chaenomeles, Chamaemespilus, Cormus, Cotoneaster, Crataegu, Cydonia, Dichotomanthes, Docynia, Docyniopsis, Eriobotrya, Eriolobus, Heteromeles, Kageneckia, Lindleya, Malacomeles, Malus, Mespilus, Osteomeles, Peraphyllum, Photinia, Pseudocydonia, Pyracantha, Pyrus, Rhaphiolepis, Sorbus, Stranvaesia, Torminalis, Vauquelinia, Rosoideae, Acaena, Acomastylis, Agrimonia, Alchemilla, Aphanes, Aremonia, Bencomia, Chamaebatia, Cliffortia, Coluria, Cowania, Dalibarda, Dendriopoterium, Drya
  • Preferred Rosaceae species include Exochorda giraldii, Exochorda racemosa, Exochorda,Exochorda giraldii, Exochorda racemosa, Exochorda serratifolia, Maddenia hypoleuca, Oemleria cerasiformis, Osmaronia cerasiformis, Prinsepia sinensis, Prinsepia uniflora, Prunus alleghaniensis, Prunus americana, Prunus andersonii, Prunus angustifolia, Prunus apetala, Prunus argentea, Prunus armeniaca, Prunus avium, Prunus bifrons, Prunus brigantina, Prunus bucharica, Prunus buergeriana, Prunus campanulata, Prunus caroliniana, Prunus cerasifera, Prunus cerasus, Prunus choreiana, Prunus cocomili
  • BSP- 2004-1 Prunus sp. BSP-2004-2,Prunus sp. EB-2002, Amelanchier alnifolia, Amelanchier arborea, Amelanchier asiatica, Amelanchier bartramiana,
  • Amelanchier sp. 'serotina' Aria alnifolia, Aronia prunifolia, Chaenomeles cathayensis, Chaenomeles speciosa, Chamaemespilus alpina, Cormus domestica, Cotoneaster apiculatus, Cotoneaster lacteus, Cotoneaster pannosus, Crataegus azarolus, Crataegus columbiana, Crataegus crus-galli, Crataegus curvisepala, Crataegus laevigata, Crataegus mollis, Crataegus monogyna, Crataegus nigra, Crataegus rivularis, Crataegus sinaica, Cydonia oblonga, Dichotomanthes tristaniicarpa, Docynia delavayi, Docyniopsis tschonoskii, Eriobotrya japonica, Eri
  • Acomastylis rossii Acomastylis sikkimensis, Agrimonia eupatoria, Agrimonia nipponica, Agrimonia parviflora, Agrimonia pilosa, Alchemilla alpina, Alchemilla erythropoda, Alchemilla japonica, Alchemilla mollis, Alchemilla vulgaris,
  • CFRA 538 Fragaria sp.,Geum andicola, Geum borisi, Geum bulgaricum, Geum calthifolium, Geum chiloense, Geum geniculatum, Geum heterocarpum, Geum macrophyllum, Geum montanum, Geum reptans, Geum rivale, Geum schofieldii,Geum speciosum, Geum urbanum, Geum vernum, Geum sp.
  • Purshia tridentata Rhodotypos scandens, Sorbaria arborea, Sorbaria sorbifolia, Spiraea betulifolia, Spiraea cantoniensis, Spiraea densiflora, Spiraea japonica, Spiraea nipponica, Spiraea x vanhouttei, Spiraea sp., Stephanandra chinensis, Stephanandra incisa and Stephanandra tanakae.
  • Rosaceae genera include: Malus, Pyrus, Cydonia, Prunus, Eriobotrya, and Mespilus.
  • Rosaceae species include: Malus domestica, Malus sylvestris, Pyrus communis, Pyrus pyrifolia, Pyrus bretschneideri, Cydonia oblonga, Prunus salicina, Prunus cerasifera, Prunus persica, Eriobotrya japonica, Prunus dulcis, Prunus avium, Mespilus germanica and Prunus domestica.
  • Preferred species include apple and pear.
  • a preferred apple genus is Malus.
  • Preferred apple species include: Malus angustifolia, Malus asiatica, Malus baccata, Malus coronaria, Malus doumeri, Malus florentina, Malus floribunda, Malus fusca, Malus halliana, Malus honanensis, Malus hupehensis, Malus ioensis, Malus kansuensis, Malus mandshurica, Malus micromalus, Malus niedzwetzkyana, Malus ombrophilia, Malus orientalis, Malus prattii, Malus prunifolia, Malus pumila, Malus sargentii, Malus sieboldii, Malus sieversii, Malus sylvestris, Malus toringoides, Malus transitoria, Malus trilobata, Malus tschonoskii, Malus x domestica, Malus x domestica x Malus sieversii
  • a particularly preferred apple species is Malus x domestica.
  • a preferred pear genus is Pyrus.
  • Preferred pear species include: Pyrus calleryana, Pyrus caucasica, Pyrus communis, Pyrus elaeagrifolia, Pyrus hybrid cultivar, Pyrus pyrifolia, Pyrus salici folia, Pyrus ussuriensis and Pyrus x bretschneideri.
  • a particularly preferred pear species is Pyrus communis.
  • a preferred strawberry genus is Fragaria.
  • Preferred strawberry species include: Fragaria chiloensis, Fragaria daltoniana, Fragaria gracilis, Fragaria grand/flora, Fragaria iinumae, Fragaria moschata, Fragaria nilgerrensis, Fragaria nipponica, Fragaria nubicola, Fragaria orientalis, Fragaria pentaphylla, Fragaria vesca, Fragaria virginiana, Fragaria viridis and Fragaria x ananassa.
  • a particularly preferred strawberry species is Fragaria x ananassa.
  • a further preferred plant species is kiwifruit.
  • Preferred kiwifruit species include Actidinia deliciosa, A. chinensis, A. eriantha, A. arguta and hybrids of the four Actinidia species.
  • a further preferred plant species is kiwifruit.
  • a preferred lettuce genus is Lactuca.
  • a preferred lettuce species is Lactuca sativa.
  • Further preferred plants are those of the genus Vaccinium.
  • a preferred species is Vaccinium macrocarpon (cranberry).
  • Preferred plants, or parts thereof, to target for increasing phloridzin levels include those which have high levels or activity of chalcone isomerase (CHI) .
  • Preferred plants, or parts thereof, to target for increasing phloridzin levels include those which have high levels or activity of phloretin glycosyl transferase (PGT).
  • Preferred plants, or parts thereof, to target for increasing phloridzin levels include those which have high levels or activity of naringenin chalcone carbon double bond reductase (Fig 1 CBDR-2).
  • a preferred tissue is frut flesh.
  • a further preferred fruit tissue is fruit skin.
  • the fruit flesh, or fruit skin is from one of the species listed above.
  • Plant parts, propagules and progeny In a further embodiment the invention provides a part, propagule, or progeny of a plant of the invention.
  • the part, propagule or progeny has reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • part of a plant refers to any part of the plant.
  • the term “part” preferably includes any one of the following : tissue, organ, fruit, and seed.
  • the term “propagule” of a plant preferably includes any part of a plant that can be used to regenerate a new plant.
  • the term “propagule” includes seeds and cuttings.
  • progeny includes any subsequent generation of plant.
  • the progeny may be produced as a result of sexual crossing with another plant.
  • the progeny plant may also be asexually produced.
  • the part, propagule, progeny comprises a construct of the invention.
  • altered levels of phloridzin encompasses either increased or decreased levels of phloridzin.
  • the altered levels of phloridzin are increased levels of phloridzin.
  • level of phloridzin relates to the amount phloridzin present in a plant. In one embodiment the term refers to the level of phloridzin in the plant as a whole. In a further embodiment the term refers to the level of phloridzin in any particular part, tissue or organ of the plant. Altered, increased and decreased
  • altered, increased and decreased are relative terms, and refer to levels of phloridzin relative to those in a control plant, or the particular part, tissue or organ of the control plant.
  • the control plant may be at least one of: - a wild type plant
  • a control construct may be, for example, an empty vector construct.
  • CHI CHALCONE ISOMERASE
  • a chalcone isomerase (EC 5.5.1.6) is an enzyme that catalyzes the chemical reaction : a chalcone a flavanone
  • this enzyme has one substrate, a chalcone, and one product, a flavanone.
  • This enzyme belongs to the family of isomerases, specifically the class of intramolecular lyases.
  • the systematic name of this enzyme class is flavanone lyase (decyclizing).
  • This enzyme is also called chalcone-flavanone isomerase. This enzyme participates in flavonoid biosynthesis.
  • CHI is highly conserved across different plant species, presence of CHI-like enzymes is not restricted to higher plants as originally thought but found in bacteria, mosses and fungi, which suggests it is evolutionarily highly conserved (Gensheimer and Mushegian, Protein Science, 13 (2) pp540-544, 2004).
  • Four key amino acids have been implicated as being important for catalytic activity.
  • Thr48 and Tyr 106 form a hydrogen bond network with two water molecules at the base of the active site cleft and are strictly conserved in plant CHI's (Jez et al., Biochemistry, 2002, 41 (16), pp 5168-5176).
  • the Thr48 hydroxyl side chain directly interacts with ketone moiety of the flavanone molecule and is believed to directly participate in catalysis.
  • Tyrl06 stabilises a catalytic water molecule and indirectly interacts with the chalcone ketone group may also act as acidic H donor of the enolate intermediate (Jez et al., Biochemistry, 2002, 41 (16), pp 5168- 5176). Asnl l3 and Thr/Serl90 provide a second set of hydrogen bonds which provide additional stabilisation of the substrate in the transition state and are believed to interact with the 4' hydroxyl group of the substrate -which
  • CHI's isolated from legumes have a Thr at position 190 whilst CHIs from other plants have a highly conserved Ser this may relate to the difference in substrate specificity in legumes.
  • CHI Chalcone isomerase
  • the chalcone isomerase (CHI) protein according to the invention may be any chalcone isomerase (CHI) protein.
  • the chalcone isomerase (CHI) protein comprises at least one of the conserved amino acids as shown in the alignment of chalcone isomerase (CHI) sequence in Figure 9.
  • the chalcone isomerase (CHI) protein has at least 70% sequence identity to any one of the chalcone isomerase (CHI) proteins referred to in Table 1 below (and presented in the sequence listing).
  • chalcone isomerase (CHI) protein is one of the chalcone isomerase (CHI) proteins referred to in Table 1 below (and presented in the sequence listing).
  • CHI chalcone isomerase
  • the chalcone isomerase (CHI) protein has at least 70% sequence identity to the sequence of SEQ ID NO: 1.
  • chalcone isomerase (CHI) protein has the sequence of SEQ ID NO : 1.
  • Polynucleotide encoding a chalcone isomerase (CHI) protein has at least 70% sequence identity to any one of the chalcone isomerase (CHI) polynucleotides referred to in Table 1 below (and presented in the sequence listing).
  • sequence encoding the chalcone isomerase (CHI) protein is one of the chalcone isomerase (CHI) polynucleotides referred to in Table 1 below (and presented in the sequence listing).
  • sequence encoding the chalcone isomerase (CHI) protein has at least 70% sequence identity to the sequence of SEQ ID NO : 7.
  • sequence encoding the chalcone isomerase (CHI) protein has the sequence of SEQ ID NO: 7.
  • CHI chalcone isomerase
  • the chalcone isomerase (CHI) gene according to the invention may be any chalcone isomerase (CHI) gene.
  • CHI chalcone isomerase
  • the chalcone isomerase (CHI) gene encodes an chalcone isomerase (CHI) protein as herein defined.
  • a term "gene” as used herein may be the target for reducing, or eliminating, expression of a chalcone isomerase (CHI) protein or polynucleotide.
  • CHI chalcone isomerase
  • gene include the sequence encoding the protein, which may be in separate exons, any regulatory sequences (including promoter and terminator sequences) 5' and 3' untranslated sequence, and introns.
  • RNAi RNA interference
  • reduced expression is relative terms, and refer to levels of expression relative to those in a control plant, or the particular part, tissue or organ of the control plant.
  • the control plant may be at least one of: - a wild type plant
  • a control construct may be, for example, an empty vector construct.
  • a suitable promoter For example a constitutive promoter may be used to alter expression in the plant as a whole, whereas a tissue-specific or tissure-preferred promoter may be used to alter expression in any particular part, tissue or organ of the plant. Marker assisted selection
  • Marker assisted selection is an approach that is often used to identify plants that possess a particular trait using a genetic marker, or markers, associated with that trait. MAS may allow breeders to identify and select plants at a young age and is particularly valuable for hard to measure traits.
  • the best markers for MAS are the causal mutations, but where these are not available, a marker that is in strong linkage disequilibrium with the causal mutation can also be used. Such information can be used to accelerate genetic gain, or reduce trait measurement costs, and thereby has utility in commercial breeding programs.
  • Markers for use in the methods of the invention include but are not limited to nucleic acid markers, such as single nucleotide polymorphisms (SNPs), simple sequence repeats (SSRs or microsatellites), insertions, substitutions, indels and deletions.
  • SNPs single nucleotide polymorphisms
  • SSRs simple sequence repeats
  • microsatellites microsatellites
  • the marker is in linkage disequilibrium (LD) with the trait.
  • the marker is in LD with the trait at a D' value of at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5.
  • the marker is in LD with the trait at a R 2 value of at least 0.05, more preferably at least 0.075, more preferably at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5.
  • linkage disequilibrium refers to a derived statistical measure of the strength of the association or co-occurrence of two independent genetic markers.
  • Various statistical methods can be used to summarize linkage disequilibrium (LD) between two markers but in practice only two, termed D' and R 2 , are widely used.
  • Marker linked, and or in LD, with the trait may be of any type including but not limited to, SNPs, substitutions, insertions, deletions, indels, simple sequence repeats (SSRs).
  • SSRs simple sequence repeats
  • the trait in the present invention is altered levels of phloridzin in a plant or part thereof. Preferably the "altered” is "increased”.
  • polynucleotide(s), means a single or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length but preferably at least 15 nucleotides, and include as non-limiting examples, coding and non- coding sequences of a gene, sense and antisense sequences complements, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polypeptides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers and fragments.
  • polynucleotide includes both the specified sequence and its compliment.
  • a "fragment" of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides, e.g., a sequence that is at least 15 nucleotides in length.
  • the fragments of the invention comprise 15 nucleotides, preferably at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 50 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 nucleotides of contiguous nucleotides of a polynucleotide of the invention. Fragments of polynucleotides for use in silencing, in particular for RNA
  • RNAi approaches are preferably at least 21 nucleotides in length.
  • the term "primer” refers to a short polynucleotide, usually having a free 3 ⁇ group that is hybridized to a template and used for priming polymerization of a polynucleotide complementary to the target.
  • polypeptide encompasses amino acid chains of any length but preferably at least 5 amino acids, including full-length proteins, in which amino acid residues are linked by covalent peptide bonds.
  • Polypeptides of the present invention may be purified natural products, or may be produced partially or wholly using recombinant or synthetic techniques.
  • the term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof.
  • a "fragment" of a polypeptide is a subsequence of the polypeptide.
  • the fragment can perform the same function as the full length polypeptide from which it is derived, or is part of.
  • the fragment performs a function that is required for the biological activity and/or provides three dimensional structure of the polypeptide.
  • isolated as applied to the polynucleotide or polypeptide sequences disclosed herein is used to refer to sequences that are removed from their natural cellular environment. In one embodiment the sequence is separated from its flanking sequences as found in nature. An isolated molecule may be obtained by any method or combination of methods including biochemical, recombinant, and synthetic techniques.
  • recombinant refers to a polynucleotide sequence that is synthetically produced or is removed from sequences that surround it in its natural context.
  • the recombinant sequence may be recombined with sequences that are not present in its natural context.
  • a "recombinant" polypeptide sequence is produced by translation from a
  • polynucleotide sequence The term “derived from” with respect to polynucleotides or polypeptides of the invention being derived from a particular genera or species, means that the polynucleotide or polypeptide has the same sequence as a polynucleotide or polypeptide found naturally in that genera or species. The polynucleotide or polypeptide, derived from a particular genera or species, may therefore be produced synthetically or recombinantly.
  • variant refers to polynucleotide or polypeptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is deleted, substituted, or added.
  • Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogues and orthologues. In certain embodiments, variants of the polypeptides and polynucleotides disclosed herein possess biological activities that are the same or similar to those of the disclosed polypeptides or polypeptides.
  • variants of the polypeptides and polynucleotides disclosed herein possess biological activities that are the same or similar to those of the disclosed polypeptides or polypeptides.
  • the term "variant" with reference to polypeptides and polynucleotides encompasses all forms of polypeptides and polynucleotides as defined herein.
  • Variant polynucleotide sequences preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 7
  • polynucleotide of the invention Polynucleotide sequence identity can be determined in the following manner.
  • the subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174: 247-250), which is publicly available from NCBI
  • Polynucleotide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs (e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453).
  • Needleman- Wunsch global alignment algorithm is found in the needle program in the
  • EMBOSS package (Rice,P. Longden,I. and Bleasby,A. EMBOSS : The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 6. pp.276-277) which can be obtained from
  • a preferred method for calculating polynucleotide % sequence identity is based on aligning sequences to be compared using Clustal X (Jeanmougin et al., 1998, Trends Biochem. Sci. 23, 403-5.)
  • Polynucleotide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance.
  • sequence similarity with respect to polypeptides may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI ( ftp://ftp.ncbi.nih.aov/blast/ 1 ).
  • variant polynucleotides of the present invention hybridize to the specified polynucleotide sequences, or complements thereof under stringent conditions.
  • hybridize under stringent conditions refers to the ability of a polynucleotide molecule to hybridize to a target polynucleotide molecule (such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration.
  • a target polynucleotide molecule such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot
  • the ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions then increasing the stringency to the desired stringency.
  • Tm melting temperature
  • Typical stringent conditions for polynucleotide of greater than 100 bases in length would be hybridization conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65oC, 6X SSC, 0.2% SDS overnight;
  • exemplary stringent hybridization conditions are 5 to 10°C below Tm.
  • Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length) °C.
  • Tm values are higher than those for DNA-DNA or DNA-RNA hybrids, and can be calculated using the formula described in Giesen et al., Nucleic Acids Res. 1998 Nov l ; 26(21) : 5004-6.
  • Exemplary stringent hybridization conditions for a DNA-PNA hybrid having a length less than 100 bases are 5 to 10°C below the Tm.
  • Variant polynucleotides of the present invention also encompasses
  • polynucleotides that differ from the sequences of the invention but that, as a consequence of the degeneracy of the genetic code, encode a polypeptide having similar activity to a polypeptide encoded by a polynucleotide of the present invention.
  • a sequence alteration that does not change the amino acid sequence of the polypeptide is a "silent variation". Except for ATG (methionine) and TGG (tryptophan), other codons for the same amino acid may be changed by art recognized techniques, e.g., to optimize codon expression in a particular host organism.
  • Variant polynucleotides due to silent variations and conservative substitutions in the encoded polypeptide sequence may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI (ftp://ftp.ncbi.nih.gov/blast/) via the tblastx algorithm as previously described.
  • variant polypeptide sequences preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more
  • Polypeptide sequence identity can be determined in the following manner.
  • the subject polypeptide sequence is compared to a candidate polypeptide sequence using BLASTP (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq, which is publicly available from NCBI (ftp://ftp.ncbi .nih.gov/blast/).
  • BLASTP from the BLAST suite of programs, version 2.2.5 [Nov 2002]
  • bl2seq which is publicly available from NCBI (ftp://ftp.ncbi .nih.gov/blast/).
  • the default parameters of bl2seq are utilized.
  • filtering of low complexity parts should be turned off.
  • Polypeptide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs.
  • EMBOSS-needle (available at
  • a variant polypeptide includes a polypeptide wherein the amino acid sequence differs from a polypeptide herein by one or more conservative amino acid substitutions, deletions, additions or insertions which do not affect the biological activity of the peptide.
  • Conservative substitutions typically include the substitution of one amino acid for another with similar characteristics, e.g., substitutions within the following groups: valine, glycine; glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagines, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
  • Non-conservative substitutions will entail exchanging a member of one of these classes for a member of another class.
  • Evolutionary changes or substitutions in amino acid residues can be modelled by a scoring matrix also referred to as a substitution matrix.
  • a scoring matrix also referred to as a substitution matrix.
  • Such matrices are used in bioinformatics analysis to identify relationships between sequences, one example being the BLOSUM62 matrix shown below (Table 2).
  • Table 2 The BLOSUM62 matrix containing all possible substitution scores
  • the BLOSUM62 matrix shown is used to generate a score for each aligned amino acid pair found at the intersection of the corresponding column and row. For example, the substitution score from a glutamic acid residue (E) to an aspartic acid residue (D) is 2. The diagonal show scores for amino acids which have not changed. Most substitutions changes have a negative score. The matrix contains only whole numbers.
  • an appropriate scoring matrix to produce the best alignment for a given set of sequences is believed to be within the skill of in the art.
  • the BLOSUM62 matrix in table 1 is also used as the default matrix in BLAST searches, although not limited thereto.
  • Other variants include peptides with modifications which influence peptide stability. Such analogs may contain, for example, one or more non-peptide bonds (which replace the peptide bonds) in the peptide sequence. Also included are analogs that include residues other than naturally occurring L-amino acids, e.g. D-amino acids or non-naturally occurring synthetic amino acids, e.g. beta or gamma amino acids and cyclic analogs
  • the term "genetic construct” refers to a polynucleotide molecule, usually double- stranded DNA, which may have inserted into it another polynucleotide molecule (the insert polynucleotide molecule) such as, but not limited to, a cDNA molecule.
  • a genetic construct may contain the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide.
  • the insert polynucleotide molecule may be derived from the host cell, or may be derived from a different cell or organism and/or may be a recombinant polynucleotide. Once inside the host cell the genetic construct may become integrated in the host chromosomal DNA.
  • the genetic construct may be linked to a vector.
  • vector refers to a polynucleotide molecule, usually double stranded DNA, which is used to transport the genetic construct into a host cell.
  • the vector may be capable of replication in at least one additional host system, such as E. coli.
  • expression construct refers to a genetic construct that includes the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide.
  • An expression construct typically comprises in a 5' to 3' direction : a) a promoter functional in the host cell into which the construct will be transformed,
  • At least one of the promoter and terminator is heterologous with respect to the polynucleotide to be expressed.
  • the promoter is heterologous with respect to the polynucleotide to be expressed.
  • the terminator is heterologous with respect to the
  • heterologous means that the sequences, that are heterologous to each other, are not found together in nature. Preferably the sequences are not found operably linked in nature. In one embodiment, the heterologous sequences are found in different species.
  • heterologous sequences may also be synthetically produced and not found in nature at all.
  • coding region or "open reading frame” (ORF) refers to the sense strand of a genomic DNA sequence or a cDNA sequence that is capable of producing a transcription product and/or a polypeptide under the control of appropriate regulatory sequences.
  • the coding sequence is identified by the presence of a 5' translation start codon and a 3' translation stop codon.
  • a "coding sequence" is capable of being expressed when it is operably linked to promoter and terminator sequences.
  • “Operably-linked” means that the sequence of interest, such as a sequence to be expressed is placed under the control of, and typically connected to another sequence comprising regulatory elements that may include promoters, tissue- specific regulatory elements, temporal regulatory elements, enhancers, repressors and terminators, 5'-UTR sequences, 5'-UTR sequences comprising uORFs, and uORFs.
  • regulatory elements may include promoters, tissue- specific regulatory elements, temporal regulatory elements, enhancers, repressors and terminators, 5'-UTR sequences, 5'-UTR sequences comprising uORFs, and uORFs.
  • noncoding region refers to untranslated sequences that are upstream of the translational start site and downstream of the translational stop site.
  • sequences are also referred to respectively as the 5'-UTR and the 3'-UTR. These regions include elements required for transcription initiation and
  • a 5'-UTR sequence is the sequence between the transcription initiation site, and the translation start site.
  • the 5'-UTR sequence is an mRNA sequence encoded by the genomic DNA.
  • 5'-UTR sequence includes the genomic sequence encoding the 5'-UTR sequence, and the compliment of that genomic sequence, and the 5'-UTR mRNA sequence.
  • Terminators are sequences, which terminate transcription, and are found in the 3' untranslated ends of genes downstream of the translated sequence. Terminators are important determinants of mRNA stability and in some cases have been found to have spatial regulatory functions.
  • the term "promoter” refers to cis-regulatory elements upstream of the coding region that regulate gene transcription. Promoters comprise cis-initiator elements which specify the transcription initiation site and conserved boxes such as the TATA box, and motifs that are bound by transcription factors.
  • transgene is a polynucleotide that is introduced into an organism by transformation.
  • the transgene may be derived from the same species or from a different species as the species of the organism into which the transgene is introduced .
  • the transgenet may also be synthetic and not found in nature in any species.
  • a "transgenic plant” refers to a plant which contains new genetic material as a result of genetic manipulation or transformation. The new genetic material may be derived from a plant of the same species as the resulting transgenic plant or from a different species, or may be synthetic.
  • the "transgenic" is different from any plant found in nature due the the presence of the transgene.
  • An "inverted repeat” is a sequence that is repeated, where the second half of the repeat is in the complementary strand, e.g.,
  • the terms "to alter expression of” and “altered expression” of a polynucleotide or polypeptide of the invention are intended to encompass the situation where genomic DNA corresponding to a polynucleotide of the invention is modified thus leading to altered expression of a polynucleotide or polypeptide of the invention. Modification of the genomic DNA may be through genetic transformation or other methods known in the art for inducing mutations.
  • the "altered expression” can be related to an increase or decrease in the amount of messenger RNA and/or polypeptide produced and may also result in altered activity of a polypeptide due to alterations in the sequence of a polynucleotide and polypeptide produced. Methods for isolating or producing polynucleotides
  • polypeptides of the invention can be isolated by using a variety of techniques known to those of ordinary skill in the art.
  • such polypeptides can be isolated through use of the polymerase chain reaction (PCR) described in Mullis et al., Eds. 1994 The Polymerase Chain Reaction,
  • polypeptides of the invention can be amplified using primers, as defined herein, derived from the
  • Further methods for isolating polynucleotides of the invention include use of all, or portions of, the polypeptides having the sequence set forth herein as hybridization probes.
  • the technique of hybridizing labelled polynucleotide probes to polynucleotides immobilized on solid supports such as nitrocellulose filters or nylon membranes, can be used to screen the genomic or cDNA libraries.
  • hybridization and wash conditions are: hybridization for 20 hours at 65°C in 5. 0 X SSC, 0. 5% sodium dodecyl sulfate, 1 X Denhardt's solution;
  • polynucleotide fragments of the invention may be produced by techniques well-known in the art such as restriction endonuclease digestion, oligonucleotide synthesis and PCR amplification.
  • a partial polynucleotide sequence may be used, in methods well-known in the art to identify the corresponding full length polynucleotide sequence. Such methods include PCR-based methods, 5'RACE (Frohman MA, 1993, Methods Enzymol. 218 : 340-56) and hybridization- based method, computer/database -based methods. Further, by way of example, inverse PCR permits acquisition of unknown sequences, flanking the polynucleotide sequences disclosed herein, starting with primers based on a known region (Triglia et al., 1998, Nucleic Acids Res 16, 8186, incorporated herein by reference). The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene.
  • the fragment is then circularized by intramolecular ligation and used as a PCR template.
  • Divergent primers are designed from the known region.
  • standard molecular biology approaches can be utilized (Sambrook et al., Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987).
  • transgenic plant from a particular species, it may be beneficial, when producing a transgenic plant from a particular species, to transform such a plant with a sequence or sequences derived from that species.
  • the benefit may be to alleviate public concerns regarding cross-species transformation in generating transgenic organisms.
  • down- regulation of a gene it may be necessary to utilise a sequence identical (or at least highly similar) to that in the plant, for which reduced expression is desired. For these reasons among others, it is desirable to be able to identify and isolate orthologues of a particular gene in several different plant species.
  • Variants may be identified by the methods described. Methods for identifying variants
  • Variant polypeptides may be identified using PCR-based methods (Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser). Typically, the PCR-based methods (Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser). Typically, the PCR-based methods (Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser). Typically, the
  • polynucleotide sequence of a primer useful to amplify variants of polynucleotide molecules of the invention by PCR, may be based on a sequence encoding a conserved region of the corresponding amino acid sequence.
  • Polypeptide variants may also be identified by physical methods, for example by screening expression libraries using antibodies raised against polypeptides of the invention (Sambrook et al., Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987) or by identifying polypeptides from natural sources with the aid of such antibodies.
  • variant sequences of the invention may also be identified by computer-based methods well- known to those skilled in the art, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others). See, e.g., Nucleic Acids Res. 29 : 1-10 and 11-16, 2001 for examples of online resources. Similarity searches retrieve and align target sequences for comparison with a sequence to be analyzed (i.e., a query sequence). Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments.
  • An exemplary family of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [Nov 2002]) including BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX, which are publicly available from (ftp://ftp.ncbi.nih.gov/blast/) or from the National Center for Biotechnology Information (NCBI), National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894 USA.
  • NCBI National Center for Biotechnology Information
  • the NCBI server also provides the facility to use the programs to screen a number of publicly available sequence databases.
  • BLASTN compares a nucleotide query sequence against a nucleotide sequence database.
  • BLASTP compares an amino acid query sequence against a protein sequence database.
  • BLASTX compares a nucleotide query sequence translated in all reading frames against a protein sequence database.
  • tBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames.
  • tBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database.
  • the BLAST programs may be used with default parameters or the parameters may be altered as required to refine the screen.
  • the "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or a similar algorithm align and identify similar portions of sequences.
  • the hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence.
  • the BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX algorithms also produce "Expect" values for alignments.
  • the Expect value (E) indicates the number of hits one can "expect” to see by chance when searching a database of the same size containing random contiguous sequences.
  • the Expect value is used as a significance threshold for determining whether the hit to a database indicates true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted as meaning that in a database of the size of the database screened, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance.
  • the probability of finding a match by chance in that database is 1% or less using the BLASTN, BLASTP, BLASTX, tBLASTN or tBLASTX algorithm.
  • Pattern recognition software applications are available for finding motifs or signature sequences.
  • MEME Multiple Em for Motif Elicitation
  • MAST Motif Alignment and Search Tool
  • the MAST results are provided as a series of alignments with appropriate statistical data and a visual overview of the motifs found.
  • MEME and MAST were developed at the University of California, San Diego.
  • PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et al., 1999, Nucleic Acids Res. 27, 215) is a method of identifying the functions of uncharacterized proteins translated from genomic or cDNA sequences.
  • the PROSITE database www.expasy.org/prosite
  • Prosearch is a tool that can search SWISS- PROT and EMBL databases with a given sequence pattern or signature.
  • polypeptides of the invention may be prepared using peptide synthesis methods well known in the art such as direct peptide synthesis using solid phase techniques (e.g. Stewart et al., 1969, in Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco California, or automated synthesis, for example using an Applied Biosystems 431A Peptide Synthesizer (Foster City, California). Mutated forms of the polypeptides may also be produced during such syntheses.
  • peptide synthesis methods well known in the art such as direct peptide synthesis using solid phase techniques (e.g. Stewart et al., 1969, in Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco California, or automated synthesis, for example using an Applied Biosystems 431A Peptide Synthesizer (Foster City, California). Mutated forms of the polypeptides may also be produced during such syntheses.
  • polypeptides and variant polypeptides of the invention may also be purified from natural sources using a variety of techniques that are well known in the art (e.g. Deutscher, 1990, Ed, Methods in Enzymology, Vol. 182, Guide to Protein Purification,).
  • polypeptides and variant polypeptides of the invention may be expressed recombinantly in suitable host cells and separated from the cells as discussed below.
  • sequence of a protein may be conveniently be modified by altering/modifying the sequence encoding the protein and expressing the modified protein.
  • Approaches such as site-directed mutagenesis may be applied to modify existing polynucleotide sequences.
  • restriction endonucleases may be used to excise parts of existing sequences.
  • Altered polynucleotide sequences may also be conveniently synthesised in a modified form.
  • the genetic constructs of the present invention comprise one or more
  • polynucleotide sequences of the invention and/or polynucleotides encoding polypeptides of the invention may be useful for transforming, for example, bacterial, fungal, insect, mammalian or plant organisms.
  • the genetic constructs of the invention are intended to include expression constructs as herein defined. Methods for producing and using genetic constructs and vectors are well known in the art and are described generally in Sambrook et al., Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987 ; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1987). Methods for producing host cells comprising polynucleotides, constructs or vectors
  • the invention provides a host cell which comprises a genetic construct or vector of the invention.
  • Host cells may be derived from, for example, bacterial, fungal, insect, mammalian or plant organisms.
  • Host cells comprising genetic constructs, such as expression constructs, of the invention are useful in methods well known in the art (e.g. Sambrook et a/. , Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et a/. , Current Protocols in Molecular Biology, Greene Publishing, 1987) for recombinant production of polypeptides of the invention.
  • Such methods may involve the culture of host cells in an appropriate medium in conditions suitable for or conducive to expression of a polypeptide of the invention.
  • the expressed recombinant polypeptide which may optionally be secreted into the culture, may then be separated from the medium, host cells or culture medium by methods well known in the art (e.g. Deutscher, Ed, 1990, Methods in Enzymology, Vol 182, Guide to Protein Purification).
  • the invention further provides plant cells which comprise a genetic construct of the invention, and plant cells modified to alter expression of a polynucleotide or polypeptide of the invention. Plants comprising such cells also form an aspect of the invention.
  • strategies may be designed to increase expression of a polynucleotide/polypeptide in a plant cell, organ and/or at a particular developmental stage where/when it is normally expressed or to ectopically express a polynucleotide/polypeptide in a cell, tissue, organ and/or at a particular developmental stage which/when it is not normally expressed.
  • the expressed polynucleotide/polypeptide may be derived from the plant species to be transformed or may be derived from a different plant species.
  • Transformation strategies may be designed to reduce, or eliminate, expression of a polynucleotide/polypeptide in a plant cell, tissue, organ or at a particular developmental stage which/when it is normally expressed. Such strategies are known as gene silencing strategies. Genetic constructs for expression of genes in transgenic plants typically include promoters for driving the expression of one or more cloned polynucleotide, terminators and selectable marker sequences to detest presence of the genetic construct in the transformed plant.
  • the promoters suitable for use in the constructs of this invention are functional in a cell, tissue or organ of a monocot or dicot plant and include cell-, tissue- and organ-specific promoters, cell cycle specific promoters, temporal promoters, inducible promoters, constitutive promoters that are active in most plant tissues, and recombinant promoters. Choice of promoter will depend upon the temporal and spatial expression of the cloned polynucleotide, so desired.
  • the promoters may be those normally associated with a transgene of interest, or promoters which are derived from genes of other plants, viruses, and plant pathogenic bacteria and fungi.
  • promoters that are suitable for use in modifying and modulating plant traits using genetic constructs comprising the polynucleotide sequences of the invention.
  • constitutive plant promoters include the CaMV 35S promoter, the nopaline synthase promoter and the octopine synthase promoter, and the Ubi 1 promoter from maize. Plant promoters which are active in specific tissues, respond to internal developmental signals or external abiotic or biotic stresses are described in the scientific literature. Exemplary promoters are described, e.g., in WO 02/00894, which is herein incorporated by reference.
  • Exemplary terminators that are commonly used in plant transformation genetic construct include, e.g., the cauliflower mosaic virus (CaMV) 35S terminator, the Agrobacterium tumefaciens nopaline synthase or octopine synthase terminators, the Zea mays zein gene terminator, the Oryza sativa ADP-glucose
  • NPT II neomycin phophotransferase II gene
  • aadA gene which confers spectinomycin and streptomycin resistance
  • phosphinothricin acetyl transferase bar gene
  • Ignite AgrEvo
  • Basta Hoechst
  • hpt hygromycin phosphotransferase gene
  • reporter genes coding sequences which express an activity that is foreign to the host, usually an enzymatic activity and/or a visible signal (e.g., luciferase, GUS, GFP) which may be used for promoter expression analysis in plants and plant tissues are also contemplated.
  • a visible signal e.g., luciferase, GUS, GFP
  • the reporter gene literature is reviewed in Herrera-Estrella et al., 1993, Nature 303, 209, and Schrott, 1995, In : Gene Transfer to Plants (Potrykus, T.,
  • Gene silencing strategies designed to reduce, or eliminate, expression of a polynucleotide/polypeptide in a plant cell, tissue, organ, or at a particular developmental stage which/when it is normally expressed, are known as gene silencing strategies.
  • Gene silencing strategies may be focused on the gene itself or regulatory elements which effect expression of the encoded polypeptide. "Regulatory elements” is used here in the widest possible sense and includes other genes which interact with the gene of interest.
  • Genetic constructs designed to decrease or silence the expression of a polynucleotide/polypeptide of the invention may include an antisense copy of all or part a polynucleotide described herein. In such constructs the polynucleotide is placed in an antisense orientation with respect to the promoter and terminator
  • an “antisense” polynucleotide is obtained by inverting a polynucleotide or a segment of the polynucleotide so that the transcript produced will be
  • Genetic constructs designed for gene silencing may also include an inverted repeat.
  • An 'inverted repeat' is a sequence that is repeated where the second half of the repeat is in the complementary strand, e.g.,
  • the transcript formed may undergo complementary base pairing to form a hairpin structure.
  • a spacer of at least 3-5 bp between the repeated region is required to allow hairpin formation.
  • RNAi RNA interference
  • Another silencing approach involves the use of a small antisense RNA targeted to the transcript equivalent to an miRNA (Llave et al., 2002, Science 297, 2053). Use of such small antisense RNA corresponding to polynucleotide of the invention is expressly contemplated.
  • Transformation with an expression construct, as herein defined, may also result in gene silencing through a process known as sense suppression (e.g. Napoli et al., 1990, Plant Cell 2, 279; de Carvalho Niebel et al., 1995, Plant Cell, 7, 347).
  • sense suppression may involve over-expression of the whole or a partial coding sequence but may also involve expression of non-coding region of the gene, such as an intron or a 5' or 3' untranslated region (UTR).
  • Chimeric partial sense constructs can be used to coordinately silence multiple genes (Abbott et al., 2002, Plant Physiol. 128(3) : 844-53; Jones et al., 1998, Planta 204: 499-505).
  • the use of such sense suppression strategies to silence the target polynucleotides/genes is also contemplated.
  • the polynucleotide inserts in genetic constructs designed for gene silencing may correspond to coding sequence and/or non-coding sequence, such as promoter and/or intron and/or 5' or 3'-UTR sequence, or the corresponding gene.
  • the insert sequence for use in a construct comprises an insert sequence of at least 21 nucleotides in length corresponding to, or
  • Pre-transcriptional silencing may be brought about through mutation of the gene itself or its regulatory elements.
  • Such mutations may include point mutations, frameshifts, insertions, deletions and substitutions.
  • Transposon tagging approaches may also be applied.
  • peptides interacting with a polypeptide of the invention may be identified through technologies such as phase-display (Dyax Corporation). Such interacting peptides may be expressed in or applied to a plant to affect activity of a polypeptide of the invention. Use of each of the above approaches in alteration of expression of a nucleotide and/or polypeptide of the invention is specifically contemplated.
  • Methods for modifying endogenous genomic DNA sequences in plants are known to those skilled in the art. Such methods may involve the use of sequence- specific nucleases that generate targeted double-stranded DNA breaks in genes of interest. Examples of such methods for use in plants include: zinc finger nucleases (Curtin et al., 2011. Plant Physiol. 156:466-473. ; Sander, et al., 2011. Nat. Methods 8 : 67-69.), transcription activator-like effector nucleases or
  • LAGLIDADG homing endonucleases also termed
  • one of these technologies can be used to modify one or more base pairs in a target gene to disable it, so it is no longer transcribaable and/or translatable.
  • TALENs or a Zinc finger nuclease can be used to modify one or more base pairs in a target gene to disable it, so it is no longer transcribaable and/or translatable.
  • plant is intended to include a whole plant, any part of a plant, propagules and progeny of a plant.
  • 'propagule' means any part of a plant that may be used in reproduction or propagation, either sexual or asexual, including seeds and cuttings.
  • the plants of the invention may be grown and either self-ed or crossed with a different plant strain and the resulting off-spring from two or more generations also form an aspect of the present invention.
  • the off-spring Preferably retain the construct, transgene or modification according to the invention.
  • This invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, and any or all combinations of any two or more said parts, elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which this invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.
  • FIG. 1 shows the phenylpropanoid pathway in apple showing the two proposed phloridzin pathway branchpoints.
  • CBDR-1 is the carbon double bond reductase activity observed by Gosch et al (2009)
  • CBDR-2 is the new phloridzin pathway branchpint described in this research, reducing naringenin chalcone to phloretin.
  • PAL phenylalanine ammonia lyase C4H cinnamate-4-hydroxylase
  • 4CL 4-coumaroyl CoA ligase CHS chalcone synthase
  • CHI chalcone isomerase Previously identified phenylpropanoid pathway enzymes are shown; PAL phenylalanine ammonia lyase, C4H cinnamate-4-hydroxylase, 4CL 4-coumaroyl CoA ligase, CHS chalcone synthase, CHI chalcone isomerase, PGT phloretin glycosyltransferase.
  • Figure 3 shows the relative expression levels of CHI in the leaves of four apple and pear varieties. Expression levels are relative to the MdACTIN or PcACTIN reference genes. Error bars represent standard error of three replicate reactions.
  • Figure 4 shows the proposed naringenin chalcone reductase reaction
  • FIG. 5 shows. HPLC analysis of the naringenin chalcone branch point assay.
  • HPLC trace (280 nm) of the reaction products of 'Royal Gala' leaf protein extract (RG) with naringenin chalcone (N-C) and NADPH (black trace).
  • RG 'Royal Gala' leaf protein extract
  • N-C naringenin chalcone
  • NADPH black trace
  • Figure 6 shows comparative CHI activity in crude protein extracts (20 ⁇ g) from apple and pear leaves.
  • RG control 'Royal Gala' protein extract no naringenin chalcone.
  • CP control 'Conference' pear protein extract no naringenin chalcone.
  • Buffer + N-C non-enzymic cyclisation of naringenin chalcone in reaction buffer.
  • RG + N-C 'Royal Gala' protein extract with naringenin chalcone.
  • CP + N-C 'Conference' pear protein extract plus naringenin chalcone.
  • Figure 7 shows the effect of increasing amounts of CHI (At3g55120) protein extract on phloretin formation in 'Royal Gala' leaf extracts.
  • a heat inactivated CHI extract was used as a no CHI control (0 ⁇ g CHI).
  • Figures are corrected for background phloretin. Error bars represent standard error of three replicate reactions.
  • Figure 8 shows dihydrochalcone concentrations in the leaves of 5 transgenic 'Royal gala' lines over-expressing the CHI gene from Arabidopsis and a 'Royal gala' control. Error bars show the standard error for 3 biological replicates.
  • Figure 9 shows an alignment of chalcone isomerase (CHI) sequences from various species and shows (in black boxing) amino acids completely conserved between the sequences.
  • Sequence 1 SEQ ID NO: 58
  • Sequence 2 SEQ ID NO : 59
  • Sequence 3 SEQ ID NO : 60
  • Sequence 4 SEQ ID NO : 3
  • Sequence 5 SEQ ID NO: 61
  • Sequence 6 SEQ ID NO: 62
  • Sequence 7 SEQ ID NO: 61
  • Sequence 8 SEQ ID NO: 2
  • Sequence 9 SEQ ID NO: 6.
  • Figure 10 shows ESI-LC-MS/MS analysis of the tt5 seed extract.
  • the base peak plot panel A
  • panel B shows the time course from which an extracted ion chromatogram for the mass range (m/z) 437.130-437.150 is prepared
  • panel B The mass peak centered on 20.73 min
  • phloridzin insert panel C
  • m/z mass to charge ratio.
  • Figure 11 shows fragmentation of the m/z 437.14389 ion in the LTQ ion trap. This analysis produced daughter MS 2 ions (panel D) and MS 3 ions (panels E and F) that are characteristic of the phloridzin standard.
  • Figure 12 shows a map of pTK02S_262928. Position of the hairpin sequences are shown as green arrows (KO seq).
  • the dihydrochalcone phloridzin is the major phenolic compound in apple ⁇ Malus x domestica). Whilst it is found thoughout the plant it is present in particularly high concentrations in the bark, roots and leaves. Dihydrochalcones have been previously reported in small quantities in other genera but high concentrations of phloridzin are unique to apple. Phloridzin has particular relevance as a bioactive compound mainly due to its role as a potent inhibitor of sodium linked glucose transport. This ability to block renal reabsorption of glucose makes phloridzin a potential agent to treat diseases like Type II diabetes and hyperglycaemia.
  • FIG. 2 shows the relative expression levels of each of the biosynthetic pathway genes in apple (Royal gala) and Pear (Conference) . This shows that while there are considerable variations in expression levels between apple and pear the largest fold change in expression occurs at CHI.
  • Pear CHI (PcCHI) has a relative expression level of just over 1 (relative to PcACTIN expression), whereas expression of Apple CHI (MdCHI) is around 1000 fold lower at 9.5x10-4 (relative to MdACTIN expression).
  • Figure 3 shows that the pattern of gene expression for CHI is still apparent in these varieties.
  • the relative expression of MdCHI compared with the reference gene is in the 10 3 range and expression of PcCHI is variable but considerably higher (up to 440 fold) than MdCHI. 4.
  • FIG. 4 The proposed branch point reaction is shown in Figure 4 and the HPLC trace of the reaction products is shown in Figure 5.
  • Figure 5 shows the formation of phloretin from naringenin chalcone in the presence of NADPH with only naringenin forming in the minus NADPH control.
  • the background adjusted phloretin concentration was estimated at 2.8 ⁇ g/mL.
  • No dihydrochalcones have ever been reported in pear tissues, so a protein extract from 'Conference' pear was made and incubated with naringenin chalcone and NADPH to act as a negative control. Only naringenin was observed on the resulting HPLC trace indicating no reduction of naringenin chalcone had occurred.
  • CHI activity in apple leaves may lead to a metabolic bottleneck at naringenin chalcone, forming a pool of substrate for phloretin biosynthesis.
  • One way to test this hypothesis is by adding CHI enzyme to the crude "Royal Gala" protein extracts to see if less phloretin is produced in the presence of naringenin chalcone and NADPH.
  • the Arabidopsis CHI gene (At3g55120) was transiently expressed in tobacco and crude protein extracts added to the the narigenin chalcone reduction reaction.
  • Figure 7 shows that phloretin production from naringenin chalcone is inversely correlated with the amount of CHI protein present in the reaction.
  • Genotype F- ⁇ 80/acZ ⁇ M 15 ⁇ (/acZYA-argF)U169 rec A1 end A1 hsdR17 (rk- , mk+) phoA supE44 thi-1 gyr A96 rel A1 ⁇ -.
  • Arabidopsis thaliana genotypes wild-type Landsberg erecta (supplied by Sarah Moss). tt4 (N85 Nottingham Arabidopsis Stock Centre), tt5 (N86 Nottingham Arabidopsis Stock Centre).
  • Luria-Bertani (LB) media 15 (w/v) bactotryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCI, pH 7.0
  • LB plates LB media with 1.5% (w/v) bacto agar
  • CTAB RNA extraction buffer 2% (w/v) hexadecyltrimethylammonium bromide (CTAB) 2% polyvinylpyrrolidinone (PVP) 100 mM TRIS-HCI (pH 8.0), 25 mM EDTA, 2.0 M NaCI, 0.5 g/L spermidine, 2% (v/v) ⁇ -mercaptoethanol SSTE Buffer (RNA ) 1 M NaCI, lOmM TRIS-HCI, 1 mM EDTA, 0.5% SDS pH 8.0
  • Tobacco protein extraction buffer 10% glycerol (v/v), 0.25% PVP-25 (soluble), 1% PVPP (w/v), 5 mM DTT, lx complete protease inhibitor tablet solution (Roche), 100 mM BIS- TRIS Propane pH 7.5 Apple protein extraction buffer 0.2 M 3-(N-Morpholino) propanesulfonic acid (MOPS), pH 7.0, lx complete protease
  • DNA Platinum Taq (Invitrogen), Prime STAR HS polymerase (Takara, Japan), iProofTM High Fidelity DNA polymerase (BioRad) or Pwo DNA polymerase (Roche, Germany).
  • Gene specific oligonucleotide primers were designed to the At3g55120 gDNA sequence obtained from TAIR.
  • Arabidopsis genomic DNA was prepared from wild type Lansberg erecta plants using a Qiagen DNA-Easy kit (Qiagen USA) according to the manufacturer's instructions. PCR was then performed using the iproof High Fidelity DNA Polymerase (Biorad USA) according to the manufacturer's
  • DH5a subcloning efficiency cells (Invitrogen USA) were thawed on ice before adding 1 uL (for plasmid DNA) or 5 ⁇ L of ligation mix. The transformation mix was incubated on ice for 20 min before heat-shock treatment for 40 s at 42 °C. Cells were recovered on ice for 2 min before adding 0.5 ml_ of LB media to each tube and incubated for 90 min at 37 °C with shaking at 250 rpm.
  • Electrocompetent GV3101 cells (50 ⁇ L aliquots) were thawed and 1 ⁇ L of plasmid DNA was added (30-200 ng) before mixing and adding to a pre-chilled 0.2 cm electroporation cuvette (Bio-Rad Laboratories USA) Electroporation was carried out using a Gene Pulser (Bio-Rad Laboratories USA) at a voltage of 2.5 kV, capacitance 25 ⁇ Fd, and resistance set to 400 Ohms. Pulsed cells were immediately recovered with 0.5 mL LB media and incubated on a shaking incubator (70 rpm) at 28 °C for 2-3 h. Aliquots of 100 ⁇ L were spread onto LB plates containing appropriate antibiotics and incubated at 28 °C for 48 h.
  • Apple transformation was carried out by Sumathi Tomes (Plant & Food Research, Auckland) using Agrobacterium-mediated gene infection of leaf pieces according to the protocol described by Yao et.al. (1995) (Yao, Cohen et al. 1995).
  • scions of approximately 3 cm in length were grafted onto M9 rootstocks as follows.
  • 'Mailing 9' (M9) root stocks were pruned back to 10 cm before making two small cuts in the bark to allow the bark to be peeled back, scions were stripped of leaves, placed under the bark and secured in place by masking tape. Grafted scions were grown in shade for 10 to 14 days until the graft wound had healed and new leaves were being formed.
  • RNA extraction Protocol based on the method by Chang et al (1993) was used (Chang, Puryear et al. 1993).
  • Fruit tissue (5-10 g) was ground in liquid nitrogen using a mortar and pestle and added to 15 ml_ of RNA Extraction Buffer containing 2%
  • Genomic DNA was removed from RNA samples by treating with DNase (Turbo DNase Kit Applied Biosystems, USA) in accordance with the manufacturer's instructions. RNA concentration was then determined by Nanodrop® ND-1000 spectroscopy to ensure that each cDNA reaction contained uniform 1 ⁇ g amounts of template RNA. First strand synthesis of cDNA was carried out with the
  • RT-qPCR Reverse transcriptase quantative PCR
  • RT-qPCR reactions were carried out using the LightCycler 1.5 (Roche Germany) using the reagents provided in the Lightcycler ® FastStart DNA Master PLUS SYBR Green I kit using 2 ⁇ L of 5x Master Mix, 0.5 ⁇ of each primer and 1 ⁇ L of a cDNA diluted 1 : 10 with nuclease-free water. A water only (no template) control was included in each run and reactions were performed in triplicate. Melt curve analysis was performed following amplification with continual fluorescence acquisition during the 65-95°C melt.
  • Agrobacterium GV31010 containing the gene of interest cloned into the appropriate plant transformation vector were grown on LB agar plates and infiltrated into Nicotiana benthamiana as described section 2.8.4.
  • the P19 viral suppressor of silencing was included in a 1 : 1 ratio with the gene of interest and three whole leaves were infiltrated with 300-400 ⁇ L of resuspended
  • Agrobacterium cells The plants were grown for a further 7 days under greenhouse conditions and infiltrated leaves were harvested, weighed and snap frozen in liquid nitrogen. Crude protein extracts were made by grinding 1.5-2 g of leaf tissue in liquid nitrogen before adding to a pre-chilled mortar and pestle containing two volumes (w/v) of Nicotiana benthamiana protein extraction buffer. Samples were further homogenised in extraction buffer until a liquid slurry was created. The samples were then centrifuged for 10 min at 10,000 rpm at 4°C to pellet cell debris. The supernatant was de-salted using a PD-10 column (GE Healthcare UK) prequilibrated with equilibration buffer (section 2.5), according to the manufacturer's instructions.
  • a PD-10 column GE Healthcare UK
  • the protein solution was then further purified and concentrated by centrifuging through a Vivaspin 2 column (GE Healthcare UK) with a molecular weight cut-off of 10 kilodaltons at 4°C at 4000 rpm for 1 h. Protein concentration was measured using the Qubit® fluorometer (Invitrogen USA).
  • Crude protein extracts were made from young expanding leaves of 'Royal Gala' by grinding 1-2 g of leaf tissue in liquid nitrogen as described in section 2.10. Samples were homogenised in apple protein extraction buffer (described in section 2.5) until a liquid slurry was created. The homogenate was then processed as described in section 2.10. N. Extraction and identification of polyphenols by High Performace Liquid Chromatography Diode Array Detector (HPLC-DAD)
  • Arabidopsis seeds 40 mg of dried seeds were ground using a steel rod, then extracted in 500 ⁇ L of 100% methanol containing 0.1% HCI and processed as for fresh tissue.
  • the filtered 20% methanol extracts were dried to completion a second time and resuspended in a final volume of 120 ⁇ L 20% methanol for HPLC analysis.
  • HPLC-DAD was performed using a Dionex Ultimate 3000 system (Sunnyvale CA USA) equipped with a diode array detector (DAD). A 5 ⁇ L aliquot was injected onto a Dionex C18 Acclaim Polar Advantage II column (150 x 2.1 mm, 3 ⁇ particle size Sunnyvale CA USA).
  • the solvents used were water with 0.1% formic acid (solvent A) and acetonitrile with 0.1% formic acid (solvent B).
  • the flow rate was set to 0.35 mL/min and the column temperature was 35 °C.
  • the 42 min gradient was as follows; 0-5 min, 0-8% B; 5-10 min, 8- 15% B; 10-20 min, 15-20% B; 20-27 min, 20% B linear; 27-34 min, 20-100% B; 34-36 min, 100% B linear; 36-42 min, 0% B, re-equilibration time.
  • Phenolic compounds were identified by comparing their retention times and spectral data with known standards and were quantified using a five-point calibration curve. Monitoring was set at 280 nm for quantification.
  • a solid phase extraction (SPE) of methanol extracts from Arabidopsis seeds (tt5 and wild-type Ler) was performed by diluting the extracts with water to 5% methanol (v/v) and applying them to preconditioned 300 mg large pore C-18 SPE cartridges (Alltech Associates, Grace, IL, USA). Each loaded cartridge was then washed in turn with 4ml of 5%, 20%, 60% aqueous methanol (v/v) and finally 100% methanol. The three latter eluted fractions were each evaporated to one ml under a nitrogen stream and diluted to an appropriate volume with 5% aqueous acetonitrile containing 0.1% formic acid.
  • SPE solid phase extraction
  • Capillary LC-MSMS was performed on 10 ⁇ aliquots of these diluted seed extract fractions using a ThermoFinnigan LTQ-FTICR hybrid mass spectrometer operating in positive electrospray mode. The aliquots were injected onto a 2mm x 150mm Phenomenex Luna PFP chromatographic column containing a Security guard cartridge of the same adsorbent housed in a column oven of a Thermo Surveyor autosampler set at 45 °C. The column was developed with a linear gradient of 5%-95% (v/v) acetonitrile in water containing 0.1% formic acid over a 35 minute period at 100 ⁇ /min for a total run time of 60 min.
  • the column eluant entered the FTMS instrument via an IonMaxTM source with the capillary temperature set at 275 °C, a nitrogen sheath gas flow of 12 units, auxiliary gas flow of 5 units and sweep gas flow of 1 unit.
  • the source voltage was 3.8 kV, capillary voltage 13V and tube lens voltage 100V.
  • a triple top 3 tandem mass experiment was performed in parallel where a full scan in the ICR cell (accurate mass to ⁇ 2 ppm) was followed coincidently by MS 2 in the ion trap on the top three ions and then MS 3 performed on the top three daughter ions from each MS 2 scan. Dynamic exclusion was exercised with one repeat. The run started after a two minute delay during which the solvent was diverted to waste.
  • Full scan FT data were collected at a resolution of 100,000 @ m/z 400 over the range m/z 100-800 with and an externally calibrated mass accuracy of ⁇ 2 ppm.
  • An isolation width of 2 amu and normalised collision energy of 35 was used for both MS 2 and MS 3 scans and all charge states other than 1 were rejected.
  • MS n data was collected from an average of 2 microscans and the maximum ion times were 150 msec for FT and 100 msec for ion trap MS n scans.
  • CHI chalcome isomerase
  • RNAi chalcome isomerase
  • a suitable hairpin insert is produced for targeting the endogenous gene expressing the chalcone isomerase (CHI) protein.
  • CHI chalcone isomerase
  • the minimum length of homologous sequence between the target and the double strand RNA hairpin is about 20 nucleotides (Small 2007), preferably 21 nucleotides.
  • Nucleotide sequence alignments of CHI genes would be created in order to identify highly homologous genes which are likely to have redundant function. These genes can then be simultaneously silenced by a single construct. Potential target regions of 300-700 bp can then be identified from the gene alignments and each target sequence would contain at least one region of 20-30 bp of continuous identical sequence.
  • Target endogenous CHI encoding sequences/genes can be identified by methods well known to those skilled in the art, or identified from publically available sequence databases, as described herein.
  • the target sequences are those disclosed in Table 1, and presented in the sequence listing.
  • a 300-700bp target sequence can be designed from the following DNA seq
  • a 300-700bp target sequence can be designed from the following DNA seq
  • a 300-700bp target sequence can be designed from the following DNA sequence:
  • a 300-700bp target sequence can be designed from the following DNA sequence:
  • the hairpin insert can be cloned into the pDONOR221 vector (Invitrogen) using BP Clonase II (Invitrogen) and inserted into the gateway compatible pTK02 vector (Snowden, Simkin et al. 2005) as an inverted repeat using LR Clonase II (Invitrogen).
  • Targetting cassettes 'green KO seq'in Figure 12. Inserts can be verified by restriction enzyme digestion by selecting a restriction enzyme that cuts once in the target region. This will cut either side of the intron spacer and release a fragment of known size.
  • hairpin constructs can be transformed into the chosen target species by methods well known to those skilled in the art and described herein.
  • Apple may be transformed as described by (Yao, Cohen et al. 1995)
  • Pear Apple may be transformed as described by (Sun, Zhao et al. 2011)
  • Kiwifruit may be transformed as described by (Wang, Ran et al. 2006)
  • the hairpin knockout vector pTK02S_261694 (EST 261694) was constructed with pTK02 (Snowden et al 2005) using Gateway Technology (Invitrogen). Gene specific primers were designed by using the sequence alignment program Align X with the Tm of the annealing portion approximately 60°C and the primers positioned 300-700bp apart. The GatewayTM attBl forward and attB2 reverse adapter sequences were added to the 5' ends of each primer sequence to facilitate recombination with the pDONR221 and pTK02 vectors.
  • PCR fragments were generated using the proof reading polymerase ExTAQ (Takara Japan) before gel purification and quantification using the Qubit 2.0 fluorometer (Invitrogen USA).
  • the BP reaction was carried at 25°C for 3 h with 30 fmoles of PCR product, 30 fmoles of pDONR221 and 1 ⁇ L of BP Clonase (Invitrogen USA).
  • the reaction mix was Proteinase K treated and transformed into DH5a.
  • bacterial colonies were screened by colony PCR, using primers RAJ-319 (CGTTGTAAAACGACGGCCAGTC - SEQ ID NO: 56) and RAJ-320 (TGCCAGGAAACAGCTATGACCAT - SEQ ID NO : 57). Positive colonies were grown overnight in LB media at 37°C before plasmid DNA isolation using the PureLinkTM Quick plasmid miniprep kit (Invitrogen USA). The LR reaction was performed overnight at 25°C using 50 fmoles of pENTRY clone, 50 fmoles of pTK02 and 1 ⁇ L of LR clonase (Invitrogen USA) in a final volume of 5 ⁇ L.
  • the LR reaction mix was transformed into DH5a and plated on LB + spectinomycin plates and grown for 16 h at 37°C. Positive colonies were selected by restriction enzyme digestion of miniprep plasmid DNA using restriction enzymes that cut once within the expected PCR product
  • Agrobacterium transformed plant tissues can be cultured on the appropriate regeneration and selection media in accordance with published protocols, for example as described herein. Transformed shoots can then be grafted onto established rootstocks or placed on root regeneration media. Once plants have reached maturity gene silencing can be confirmed by Quantitative Reverse Transcriptase PCR and dihydrochalcone concentrations in the tissues of interest can then be measured by HPLC or LC-MS analysis (as described in Example 1). References

Landscapes

  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Zoology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Nutrition Science (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)

Abstract

The invention provides materials and methods from producing plants, or parts thereof, with altered levels of phloridzin, by altering levels of chalcone isomerase (CHI) in the plants, or parts thereof. The invention also provides plants, and parts thereof, with altered levels of phloridzin, as a result of having altered levels of chalcone isomerase (CHI). The invention also provides methods of selecting and breeding plants with altered levels of phloridzin, as a result of having altered levels of chalcone isomerase (CHI). Preferably the plants, or parts thereof, have increased levels of phloridzin, as a result of having decreased levels of chalcone isomerase (CHI).

Description

METHODS AND MATERIALS FOR MANIPULATING
PHLORIDZIN PRODUCTION
TECHNICAL FIELD
The present invention relates to compositions and methods for producing plants with altered altered phloridzin content.
BACKGROUND ART
The dihydrochalcone phlordizin (phloretin 2'-glucoside, see Fig. 1) is the major phenolic glucoside found in apple trees. Phlorizin has a bitter taste that contributes to the characteristic flavour of cider, and its dimerised oxidation products contribute to the colour of apple juices. However, since it was isolated from the bark of the apple tree in 1835, phlorizin has attracted most scientific interest through its use as a pharmaceutical and tool for physiology research.
The principal pharmacological action of phlordizin is to produce renal glycosuria and block glucose transportation by inhibition of the sodium-linked glucose transporters. Phloridzin and its derivatives have also been shown to be extremely effective antioxidants in vitro, and to have a range of bioactive functions such as inhibition of lipid peroxidation, prevention of bone loss, enhancement of memory, and inhibition of cancer cell growth. Until recently phlorizin was believed to exist only in Malus species. However, phloretin glycosides have been reported in the leaves of Australian native sarsaparilla (Smilax glyciphylla), sweet tea (Lithocarpus polystachyus) and at very low levels in strawberry fruit. In apple trees, phlorizin is found primarily in the young shoots, roots, leaves and bark. In fruit, phloridzin is most abundant in the seeds, with intermediate levels in both the core and the skin, and the lowest level in the cortex. Variation has been assessed within apple trees, between orchards, between different cultivars and among mutants). Despite this information, relatively little is known of the in planta function of phloridzin in apple tree physiology, although it has been suggested that it might act in apple tree growth and development or be an inhibitor of bacterial or fungal growth. The molecular basis for production of phloridzin in planta has not been fully described. Phloretin is a product of the phenylpropanoid pathway, with conversion to its glucoside, phlorizin, likely to be catalysed by the action of a uridine diphosphate (UDP) glycosyltransferase (UGT). UGTs mediate the transfer of a sugar residue from an activated nucleotide sugar to acceptor molecules (aglycones). Plants contain large families of UGTs with over 100 genes being described in Arabidopsis. These genes have a common signature motif of 42 amino acids thought to be involved in binding of the UDP moiety of the activated sugar. A phylogenetic analysis established the presence of distinct Groups (A-N) and Families (UGT71-92) of UGT genes in Arabidopsis and this facilitated the characterisation of many new activities. Although initially thought to be promiscuous enzymes, recent evidence suggests that their broad substrate specificity is limited by regio-specificity, and in some cases UGTS have been shown to be highly specific.
Using a functional genomics approach Judge et al (FEBS J. 2008 Aug; 275 (15) : 3804-14) identified and characterised a UGT from apple belonging to the previously uncharacterised UGT Family 88. The authors established that
MpUGT88Al mediates the glycosylation of the dihydrochalcone phloretin to phlorizin.
In spite of this research, however, comaparatively little is known about which steps in the phloridzin production pathway could potentially be manipulated to modulate production of phloridizin in plants or parts thereof.
It would be beneficial to have a further means to increase phloridzin levels in plants.
It is an object of the invention to provide novel compositions and methods for modulating phloridzin content in plants or at least to provide the public with a useful choice. SUMMARY OF THE INVENTION
METHODS
Altering phloridzin by altering CHI In one aspect the invention provides a method for producing a plant, or part thereof, with altered levels of phloridzin, the method comprising altering expression of at least one chalcone isomerase (CHI) protein in the plant or part thereof.
In one embodiment expression of chalcone isomerase (CHI) protein is increased and the level of phloridzin is decreased.
In a preferred embodiment expression of chalcone isomerase (CHI) protein is decreased and the level of phloridzin is increased.
In one embodiment the method comprises introducing a construct into the plant, or part thereof, to affect the altering expression of the at least one chalcone isomerase (CHI) protein.
In a further embodiment the method comprises introducing a construct into the plant or part thereof to affect the reducing expression of the at least one chalcone isomerase (CHI) protein.
In a further embodiment the construct contains a promoter sequence operably linked to at least part of a chalcone isomerase (CHI) gene, wherein the part of the gene is in an antisense orientation relative to the promoter sequence.
In one embodiment the part of the gene is at least 21 nucleotides in length.
In one embodiment the construct is an antisense construct. In a further embodiment the construct is an RNA interference (RNAi) construct. In a further embodiment the construct is a CRISPR-CAS construct.
In one aspect the invention provides a plant, or part thereof, produced by the method of the invention.
In one embodiment the plant, or part thereof, comprises the construct. Reducing or eliminating CHI
In one aspect the invention provides a method for producing a plant, or part thereof, with increased levels of phloridzin, the method comprising reducing, or eliminating, expression of a chalcone isomerase (CHI) protein in the plant or part thereof.
Non-GM selection method for reduced or eliminated chalcone isomerase ( CHI)
In a further aspect the invention provides a method for identifying a plant with a genotype indicative of producing increased levels of phloridzin, the method comprising testing a plant for at least one of: a) reduced, or eliminated, expression of at least one chalcone isomerase
(CHI) protein, b) reduced, or eliminated, expression of at least one polynucleotide encoding an chalcone isomerase (CHI) protein, c) presence of a marker associated with reduced expression of at least one chalcone isomerase (CHI) protein, and d) presence of a marker associated with reduced expression of at least one polynucleotide encoding an chalcone isomerase (CHI) protein.
In one embodiment presence of any of a) to d) indicates that the plant will produce increased levels of phloridzin. Methods for breeding plants with increased levels of phloridzin
In a further aspect the invention provides a method for producing a plant that produces with increased levels of phloridzin, the method comprising crossing one of: a) a plant of the invention, b) a plant produced by a method of the invention, and c) a plant selected by a method of the invention with another plant, wherein the off-spring produced by the crossing is a plant that produces increased levels of phloridzin. In one embodiment the plant of a), b, or c) is a plant with reduced, or eliminated, expression of at least one chalcone isomerase (CHI) protein.
Method of producing a fruit with increased levels of phloridzin
In a further aspect the invention provides a method for producing a fruit with increased levels of phloridzin, the method comprising cultivating at least one of: a) a plant of the invention, b) a plant produced by a method of the invention, and c) a plant selected by a method of the invention wherein the cultivated plant produces fruit with increased levels of phloridzin. In a preferred embodiment the plant produces a fruit with increased levels of phloridzin as a result of the plant having reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
PRODUCTS
Plant with altered levels of phloridzin In a further aspect the invention provides a plant, or part thereof, with altered levels of phloridzin produced by a method of the invention.
In one embodiment the plant, or part thereof, has decreased levels of phloridzin.
In a preferred embodiment the plant, or part thereof, has increased levels of phloridzin. In a further embodiment the plant, or part thereof, comprises a construct of the invention.
In a further aspect the invention provides a plant, or part thereof, with altered levels of phloridzin, wherein the plant has altered expression of at least one chalcone isomerase (CHI) protein. In one embodiment the plant, or part thereof, has decreased levels of phloridzin and increased expression of at least one chalcone isomerase (CHI) protein. In a preferred embodiment the plant, or part thereof, has increased levels of phloridzin and decreased expression of at least one chalcone isomerase (CHI) protein.
In a further embodiment the plant, or part thereof, comprises a construct of the invention.
Preferably the altered expression of the at least one chalcone isomerase (CHI) protein is affected by the construct of the invention.
Plant with increased levels of phloridzin
In a further aspect the invention provides a plant, or part thereof, with increased levels of phloridzin, wherein the plant, or part thereof, has reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
In a further embodiment the plant, or part thereof, comprises a construct of the invention.
Fruit with altered levels of phloridzin
In a further aspect the invention provides a fruit with altered levels of phloridzin produced by a method of the invention.
In a further aspect the invention provides fruit with altered levels of phloridzin with altered expression of at least one chalcone isomerase (CHI) protein.
In one embodiment altered is decreased.
In a preferred embodiment altered is increased.
Fruit with increased levels of phloridzin
In a further aspect the invention provides a fruit with increased levels of phloridzin produced by a method of the invention.
In a further aspect the invention provides fruit with increased levels of phloridzin with reduced or eliminated expression of at least one chalcone isomerase (CHI) protein. Construct (for reducing or eliminating expression of a chalcone isomerase (CHI) protein in a plant)
In a further aspect the invention provides a construct for reducing the expression of an chalcone isomerase (CHI) protein in a plant. In one embodiment the construct is contains a promoter sequence operably linked to at least part of an chalcone isomerase (CHI) gene, wherein the part of the gene is in an antisense orientation relative to the promoter sequence.
Preferably the part of the gene is at least 21 nucleotides in length.
In one embodiment the construct is an antisense construct. In a further embodiment the construct is an RNA interference (RNAi) construct.
Plant/ fruit
The plant, or fruit, may be from any species.
In one embodiment the plant is from a gymnosperm plant species.
In a further embodiment the plant is from an angiosperm plant species. In a further embodiment the plant is from a from dicotyledonuous plant species.
In a further embodiment the plant is from monocotyledonous species.
In one embodiment the plant, or fruit, is from a Rosaceae species.
Preferred Rosaceae genera include Exochorda, Maddenia, Oemleria, Osmaronia, Prinsepia, Prunus, Maloideae, Amelanchier, Aria, Aronia, Chaenomeles,
Chamaemespilus, Cormus, Cotoneaster, Crataegus, Osmaronia, Prinsepia,
Prunus, Maloideae, Amelanchier, Aria, Aronia, Chaenomeles, Chamaemespilus, Cormus, Cotoneaster, Crataegu, Cydonia, Dichotomanthes, Docynia, Docyniopsis, Eriobotrya, Eriolobus, Heteromeles, Kageneckia, Lindleya, Malacomeles, Malus, Mespilus, Osteomeles, Peraphyllum, Photinia, Pseudocydonia, Pyracantha, Pyrus, Rhaphiolepis, Sorbus, Stranvaesia, Torminalis, Vauquelinia, Rosoideae, Acaena, Acomastylis, Agrimonia, Alchemilla, Aphanes, Aremonia, Bencomia, Chamaebatia, Cliffortia, Coluria, Cowania, Dalibarda, Dendriopoterium, Dryas, Duchesnea, Erythrocoma, Fallugia, Filipendula, Fragaria, Geum, Hagenia, Horkelia, Ivesia, Kerria, Leucosidea, Marcetella, Margyricarpus, Novosieversia,Oncostylus,
Polylepis, Potentilla, Rosa, Rubus, Sanguisorba, Sarcopoterium, Sibbaldia, Sieversia, Taihangia, Tetraglochin, Waldsteinia, Rosaceae incertae sedis,
Adenostoma, Aruncus, Cercocarpus, Chamaebatiaria, Chamaerhodos, Gillenia, Holodiscus, Lyonothamnus, Neillia, Neviusia, Physocarpus, Purshia, Rhodotypos, Sorbaria, Spiraea and Stephanandra.
Preferred Rosaceae species include Exochorda giraldii, Exochorda racemosa, Exochorda,Exochorda giraldii, Exochorda racemosa, Exochorda serratifolia, Maddenia hypoleuca, Oemleria cerasiformis, Osmaronia cerasiformis, Prinsepia sinensis, Prinsepia uniflora, Prunus alleghaniensis, Prunus americana, Prunus andersonii, Prunus angustifolia, Prunus apetala, Prunus argentea, Prunus armeniaca, Prunus avium, Prunus bifrons, Prunus brigantina, Prunus bucharica, Prunus buergeriana, Prunus campanulata, Prunus caroliniana, Prunus cerasifera, Prunus cerasus, Prunus choreiana, Prunus cocomilia, Prunus cyclamina, Prunus davidiana, Prunus debilis, Prunus domestica, Prunus dulcis, Prunus emarginata, Prunus fasciculata, Prunus ferganensis, Prunus fordiana, Prunus fremontii, Prunus fruticosa, Prunus geniculata, Prunus glandulosa, Prunus gracilis, Prunus grayana, Prunus hortulana, Prunus ilicifolia, Prunus incisa, Prunus jacquemontii, Prunus japonica, Prunus kuramica, Prunus laurocerasus, Prunus leveilleana, Prunus lusitanica, Prunus maackii, Prunus mahaleb, Prunus mandshurica, Prunus maritima, Prunus maximowiczii, Prunus mexicana, Prunus microcarpa, Prunus mira, Prunus mume, Prunus munsoniana, Prunus nigra, Prunus nipponica, Prunus padus, Prunus pensylvanica, Prunus persica, Prunus petunnikowii, Prunus prostrata, Prunus pseudocerasus, Prunus pumila, Prunus rivularis, Prunus salicina, Prunus sargentii, Prunus sellowii, Prunus serotina, Prunus serrulata, Prunus sibirica, Prunus simonii, Prunus spinosa, Prunus spinulosa, Prunus subcordata, Prunus subhirtella, Prunus takesimensis, Prunus ten el la, Prunus texana, Prunus tomentosa, Prunus tschonoskii, Prunus umbellata, Prunus verecunda, Prunus virginiana, Prunus webbii, Prunus x yedoensis, Prunus zippeliana, Prunus sp. BSP- 2004-1, Prunus sp. BSP-2004-2,Prunus sp. EB-2002, Amelanchier alnifolia, Amelanchier arborea, Amelanchier asiatica, Amelanchier bartramiana,
Amelanchier canadensis, Amelanchier cusickii, Amelanchier fernaldii, Amelanchier florida, Amelanchier humilis, Amelanchier intermedia, Amelanchier laevis,
Amelanchier lucida, Amelanchier nantucketensis, Amelanchier pumila,
Amelanchier quinti-martii, Amelanchier sanguinea, Amelanchier stolonifera, Amelanchier utahensis, Amelanchier wiegandii, Amelanchier x neglecta,
Amelanchier bartramiana x Amelanchier sp. 'dentata', Amelanchier sp. 'dentata', Amelanchier sp. 'erecta', Amelanchier sp. 'erecta' x Amelanchier laevis,
Amelanchier sp. 'serotina', Aria alnifolia, Aronia prunifolia, Chaenomeles cathayensis, Chaenomeles speciosa, Chamaemespilus alpina, Cormus domestica, Cotoneaster apiculatus, Cotoneaster lacteus, Cotoneaster pannosus, Crataegus azarolus, Crataegus columbiana, Crataegus crus-galli, Crataegus curvisepala, Crataegus laevigata, Crataegus mollis, Crataegus monogyna, Crataegus nigra, Crataegus rivularis, Crataegus sinaica, Cydonia oblonga, Dichotomanthes tristaniicarpa, Docynia delavayi, Docyniopsis tschonoskii, Eriobotrya japonica, Eriobotrya prinoides, Eriolobus trilobatus, Heteromeles arbutifolia, Kageneckia angustifolia, Kageneckia oblonga, Lindleya mespiloides, Malacomeles denticulata, Malus angustifolia, Malus asiatica, Malus baccata, Malus coronaria, Malus doumeri, Malus florentina, Malus floribunda, Malus fusca, Malus halliana, Malus honanensis, Malus hupehensis, Malus ioensis, Malus kansuensis, Malus mandshurica, Malus micromalus, Malus niedzwetzkyana, Malus ombrophilia, Malus orientalis, Malus prattii, Malus prunifolia, Malus pumila, Malus sargentii, Malus sieboldii, Malus sieversii, Malus sylvestris, Malus toringoides, Malus transitoria, Malus trilobata, Malus tschonoskii, Malus x domestica, Malus x domestica x Malus sieversii, Malus x domestica x Pyrus communis, Malus xiaojinensis, Malus yunnanensis, Malus sp., Mespilus germanica, Osteomeles anthyllidifolia, Osteomeles schwerinae, Peraphyllum ramosissimum, Photinia fraseri, Photinia pyrifolia, Photinia serrulata, Photinia villosa, Pseudocydonia sinensis, Pyracantha coccinea, Pyracantha fortuneana, Pyrus calleryana, Pyrus caucasica, Pyrus communis, Pyrus elaeagrifolia, Pyrus hybrid cultivar, Pyrus pyrifolia, Pyrus salicifolia, Pyrus ussuriensis, Pyrus x bretschneideri, Rhaphiolepis indica, Sorbus americana, Sorbus aria, Sorbus aucuparia, Sorbus californica, Sorbus commixta, Sorbus hupehensis, Sorbus scopulina, Sorbus sibirica, Sorbus torminalis, Stranvaesia davidiana, Torminalis clusii, Vauquelinia californica, Vauquelinia corymbosa, Acaena anserinifolia, Acaena argentea, Acaena caesiiglauca, Acaena cylindristachya, Acaena digitata, Acaena echinata, Acaena elongata, Acaena eupatoria, Acaena fissistipula, Acaena inermis, Acaena laevigata, Acaena latebrosa, Acaena lucida, Acaena macrocephala, Acaena magellanica, Acaena masafuerana, Acaena montana, Acaena multifida, Acaena novaezelandiae, Acaena ovalifolia, Acaena pinnatifida, Acaena splendens, Acaena subincisa, Acaena x anserovina, Acomastylis elata,
Acomastylis rossii, Acomastylis sikkimensis, Agrimonia eupatoria, Agrimonia nipponica, Agrimonia parviflora, Agrimonia pilosa, Alchemilla alpina, Alchemilla erythropoda, Alchemilla japonica, Alchemilla mollis, Alchemilla vulgaris,
Aphanes arvensis, Aremonia agrimonioides, Bencomia brachystachya, Bencomia caudata, Bencomia exstipulata, Bencomia sphaerocarpa, Chamaebatia foliolosa, Cliffortia burmeana, Cliffortia cuneata, Cliffortia dentata, Cliffortia graminea, Cliffortia heterophylla, Cliffortia nitidula, Cliffortia odorata, Cliffortia ruscifolia, Cliff ortia sericea, Coluria elegans, Coluria geoides, Cowania stansburiana, Dalibarda repens, Dendriopoterium menendezii, Dendriopoterium pulidoi, Dryas drummondii, Dryas octopetala, Duchesnea chrysantha, Duchesnea indica, Erythrocoma triflora, Fallugia paradoxa, Filipendula multijuga Filipendula purpurea, Filipendula ulmaria, Filipendula vulgaris, Fragaria chiloensis, Fragaria daltoniana, Fragaria gracilis, Fragaria grand/flora, Fragaria iinumae, Fragaria moschata, Fragaria nilgerrensis, Fragaria nipponica, Fragaria nubicola, Fragaria orientalis, Fragaria pentaphylla, Fragaria vesca, Fragaria virginiana, Fragaria viridis, Fragaria x ananassa, Fragaria sp. CFRA 538, Fragaria sp.,Geum andicola, Geum borisi, Geum bulgaricum, Geum calthifolium, Geum chiloense, Geum geniculatum, Geum heterocarpum, Geum macrophyllum, Geum montanum, Geum reptans, Geum rivale, Geum schofieldii,Geum speciosum, Geum urbanum, Geum vernum, Geum sp. 'Chase 2507 K',Hagenia abyssinica, Horkelia cuneata, Horkelia fusca, Ivesia gordoni,Kerria japonica,Leucosidea sericea, Marcetella maderensis, Marcetella moquiniana,Margyricarpus pinnatus, Margyricarpus setosus, Novosieversia glacialis, Oncostylus cockaynei, Oncostylus
leiospermus, Polylepis australis, Polylepis besseri, Polylepis crista-galli, Polylepis hieronymi, Polylepis incana, Polylepis lanuginosa, Polylepis multijuga, Polylepis neglecta, Polylepis pauta, Polylepis pepei, Polylepis quadrijuga, Polylepis racemosa, Polylepis reticulata, Polylepis rugulosa, Polylepis sericea, Polylepis subsericans, Polylepis tarapacana, Polylepis tomentella, Polylepis
weberbaueri, Potentilla anserina, Potentilla arguta, Potentilla bifurca, Potentilla chinensis, Potentilla dickinsii, Potentilla erecta, Potentilla fragarioides, Potentilla fruticosa, Potentilla indica, Potentilla micrantha, Potentilla multifida, Potentilla nivea, Potentilla norvegica, Potentilla palustris, Potentilla peduncularis, Potentilla reptans, Potentilla salesoviana, Potentilla stenophylla, Potentilla tridentata, Rosa abietina, Rosa abyssinica, Rosa acicularis, Rosa agrestis, Rosa alba, Rosa alba x Rosa corymbifera, Rosa altaica, Rosa arkansana, Rosa arvensis, Rosa banksiae,Rosa beggeriana, Rosa blanda, Rosa bracteata, Rosa brunonii, Rosa caesia, Rosa californica, Rosa canina, Rosa Carolina, Rosa chinensis, Rosa cinnamomea ,Rosa columnifera, Rosa corymbifera, Rosa cymosa,Rosa davurica, Rosa dumalis, Rosa ecae, Rosa eglanteria, Rosa elliptica, Rosa fedtschenkoana, Rosa foetida, Rosa foliolosa, Rosa gallica, Rosa gallica x Rosa dumetorum, Rosa gigantea, Rosa glauca, Rosa helenae, Rosa henryi, Rosa hugonis, Rosa hybrid cultivar, Rosa inodora, Rosa jundzillii, Rosa laevigata, Rosa laxa, Rosa luciae, Rosa majalis, Rosa marretii, Rosa maximowicziana, Rosa micrantha, Rosa mollis, Rosa montana, Rosa moschata, Rosa moyesii, Rosa multibracteata, Rosa multiflora, Rosa nitida, Rosa odorata, Rosa palustris, Rosa pendulina, Rosa persica, Rosa Phoenicia, Rosa platyacantha, Rosa primula, Rosa pseudoscabriuscula, Rosa roxburghii, Rosa rubiginosa, Rosa rugosa, Rosa sambucina, Rosa sempervirens, Rosa sericea, Rosa sertata, Rosa setigera, Rosa sherardii, Rosa sicula, Rosa spinosissima, Rosa stellata, Rosa stylosa, Rosa subcanina, Rosa subcollina, Rosa suffulta, Rosa tomentella, Rosa tomentosa, Rosa tunquinensis, Rosa villosa, Rosa virginiana, Rosa wichurana, Rosa wiHmottiae, Rosa woodsii; Rosa x damascena, Rosa x fortuniana, Rosa x macrantha, Rosa xanthina, Rosa sp., Rubus alceifolius, Rubus allegheniensis, Rubus alpinus, Rubus amphidasys, Rubus arcticus, Rubus argutus, Rubus assamensis, Rubus australis, Rubus bifrons, Rubus caesius, Rubus caesius x Rubus idaeus, Rubus canadensis, Rubus canescens, Rubus caucasicus, Rubus chamaemorus, Rubus corchorifolius, Rubus crataegifolius, Rubus cuneifolius, Rubus deliciosus, Rubus divaricatus, Rubus ellipticus, Rubus flagellars, Rubus fruticosus, Rubus geoides, Rubus glabratus, Rubus glaucus, Rubus gunnianus, Rubus hawaiensis, Rubus hawaiensis x Rubus rosifolius, Rubus hispidus, Rubus hochstetterorum, Rubus humulifolius, Rubus idaeus, Rubus lambertianus, Rubus lasiococcus, Rubus leucodermis, Rubus lineatus, Rubus macraei, Rubus maximiformis, Rubus minusculus, Rubus moorei, Rubus multibracteatus, Rubus neomexicanus, Rubus nepalensis, Rubus nessensis, Rubus nivalis, Rubus niveus, Rubus nubigenus, Rubus occidentalis, Rubus odoratus, Rubus palmatus, Rubus parviflorus, Rubus parvifolius, Rubus parvus, Rubus pectinellus, Rubus pedatus, Rubus
pedemontanus, Rubus pensilvanicus, Rubus phoenicolasius, Rubus picticaulis, Rubus pubescens, Rubus rigidus, Rubus robustus, Rubus roseus, Rubus rosifolius, Rubus sanctus, Rubus sapidus, Rubus saxatilis, Rubus setosus, Rubus spectabilis, Rubus sulcatus, Rubus tephrodes, Rubus trianthus, Rubus tricolor, Rubus trifidus, Rubus trilobus, Rubus trivialis, Rubus ulmifolius, Rubus ursinus, Rubus urticifolius, Rubus vigorosus, Rubus sp. JPM-2004, Sanguisorba albiflora, Sanguisorba alpina, Sanguisorba ancistroides, Sanguisorba annua, Sanguisorba canadensis, Sanguisorba filiformis, Sanguisorba hakusanensis, Sanguisorba japonensis, Sanguisorba minor, Sanguisorba obtusa, Sanguisorba officinalis, Sanguisorba parviflora, Sanguisorba stipulata, Sanguisorba tenuifolia, Sarcopoterium spinosum, Sibbaldia procumbens, Sieversia
pentapetala, Sieversia pusilla, Taihangia rupestris, Tetraglochin cristatum, Waldsteinia fragarioides, Waldsteinia geoides, Adenostoma fasciculatum,
Adenostoma sparsifolium, Aruncus dioicus, Cercocarpus betuloides, Cercocarpus ledifolius, Chamaebatiaria millefolium, Chamaerhodos erecta, Gillenia stipulata, Gillenia trifoliata, Holodiscus discolor, Holodiscus microphyllus, Lyonothamnus floribundus, Neillia affinis, Neillia gracilis, Neillia sinensis, Neillia sparsiflora, Neillia thibetica, Neillia thyrsiflora, Neillia uekii, Neviusia alabamensis,
Physocarpus alternans, Physocarpus amurensis, Physocarpus capitatus,
Physocarpus malvaceus, Physocarpus monogynus, Physocarpus opulifolius,
Purshia tridentata, Rhodotypos scandens, Sorbaria arborea, Sorbaria sorbifolia, Spiraea betulifolia, Spiraea cantoniensis, Spiraea densiflora, Spiraea japonica, Spiraea nipponica, Spiraea x vanhouttei, Spiraea sp., Stephanandra chinensis, Stephanandra incisa and Stephanandra tanakae.
Particularly preferred Rosaceae genera include: Malus, Pyrus, Cydonia, Prunus, Eriobotrya, and Mespilus.
Particularly preferred Rosaceae species include: Malus domestica, Malus sylvestris, Pyrus communis, Pyrus pyrifolia, Pyrus bretschneideri, Cydonia oblonga, Prunus salicina, Prunus cerasifera, Prunus persica, Eriobotrya japonica, Prunus dulcis, Prunus avium, Mespilus germanica and Prunus domestica.
Preferred species include apple and pear.
A preferred apple genus is Malus. Preferred apple species include: Malus angustifolia, Malus asiatica, Malus baccata, Malus coronaria, Malus doumeri, Malus florentina, Malus floribunda, Malus fusca, Malus halliana, Malus honanensis, Malus hupehensis, Malus ioensis, Malus kansuensis, Malus mandshurica, Malus micromalus, Malus niedzwetzkyana, Malus ombrophilia, Malus orientalis, Malus prattii, Malus prunifolia, Malus pumila, Malus sargentii, Malus sieboldii, Malus sieversii, Malus sylvestris, Malus toringoides, Malus transitoria, Malus trilobata, Malus tschonoskii, Malus x domestica, Malus x domestica x Malus sieversii, Malus x domestica x Pyrus communis, Malus xiaojinensis, and Malus yunnanensis.
A particularly preferred apple species is Malus x domestica. A preferred pear genus is Pyrus.
Preferred pear species include: Pyrus calleryana, Pyrus caucasica, Pyrus communis, Pyrus elaeagrifolia, Pyrus hybrid cultivar, Pyrus pyrifolia, Pyrus salici folia, Pyrus ussuriensis and Pyrus x bretschneideri.
A particularly preferred pear species is Pyrus communis. A preferred strawberry genus is Fragaria.
Preferred strawberry species include: Fragaria chiloensis, Fragaria daltoniana, Fragaria gracilis, Fragaria grand/flora, Fragaria iinumae, Fragaria moschata, Fragaria nilgerrensis, Fragaria nipponica, Fragaria nubicola, Fragaria orientalis, Fragaria pentaphylla, Fragaria vesca, Fragaria virginiana, Fragaria viridis and Fragaria x ananassa.
A particularly preferred strawberry species is Fragaria x ananassa.
A further preferred plant species is kiwifruit. Preferred kiwifruit species include Actidinia deliciosa, A. chinensis, A. eriantha, A. arguta and hybrids of the four Actinidia species.
A further preferred plant species is kiwifruit. A preferred lettuce genus is Lactuca. A preferred lettuce species is Lactuca sativa.
Further preferred plants are those of the genus Vaccinium. A preferred species is Vaccinium macrocarpon (cranberry). Preferred plants, or parts thereof, to target for increasing phloridzin levels include those which have high levels or activity of chalcone isomerase (CHI) . Preferred plants, or parts thereof, to target for increasing phloridzin levels include those which have high levels or activity of phloretin glycosyl transferase (PGT).
Preferred plants, or parts thereof, to target for increasing phloridzin levels include those which have high levels or activity of naringenin chalcone carbon double bond reductase (Fig 1 CBDR-2).
A preferred tissue is frut flesh. A further preferred fruit tissue is fruit skin.
Preferably the fruit flesh, or fruit skin, is from one of the species listed above.
Plant parts, propagules and progeny In a further embodiment the invention provides a part, propagule, or progeny of a plant of the invention.
Preferably the part, propagule or progeny has reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
The term "part" of a plant refers to any part of the plant. The term "part" preferably includes any one of the following : tissue, organ, fruit, and seed. The term "propagule" of a plant preferably includes any part of a plant that can be used to regenerate a new plant. Preferably the term "propagule" includes seeds and cuttings.
The term "progeny" includes any subsequent generation of plant. The progeny may be produced as a result of sexual crossing with another plant. The progeny plant may also be asexually produced.
Preferably the part, propagule, progeny, comprises a construct of the invention.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
Altered levels of phloridzin
The term "altered levels of phloridzin" encompasses either increased or decreased levels of phloridzin. Preferably the altered levels of phloridzin are increased levels of phloridzin.
The term "levels of phloridzin" relates to the amount phloridzin present in a plant. In one embodiment the term refers to the level of phloridzin in the plant as a whole. In a further embodiment the term refers to the level of phloridzin in any particular part, tissue or organ of the plant. Altered, increased and decreased
The terms altered, increased and decreased are relative terms, and refer to levels of phloridzin relative to those in a control plant, or the particular part, tissue or organ of the control plant.
The control plant may be at least one of: - a wild type plant
- a non-transformed plant
- a plant transformed with a control construct
- a non selected plant
A control construct may be, for example, an empty vector construct. CHALCONE ISOMERASE (CHI)
A chalcone isomerase (EC 5.5.1.6) is an enzyme that catalyzes the chemical reaction : a chalcone
Figure imgf000017_0001
a flavanone
Hence, this enzyme has one substrate, a chalcone, and one product, a flavanone.
This enzyme belongs to the family of isomerases, specifically the class of intramolecular lyases. The systematic name of this enzyme class is flavanone lyase (decyclizing). This enzyme is also called chalcone-flavanone isomerase. This enzyme participates in flavonoid biosynthesis.
CHI is highly conserved across different plant species, presence of CHI-like enzymes is not restricted to higher plants as originally thought but found in bacteria, mosses and fungi, which suggests it is evolutionarily highly conserved (Gensheimer and Mushegian, Protein Science, 13 (2) pp540-544, 2004). Four key amino acids have been implicated as being important for catalytic activity. Thr48 and Tyr 106 form a hydrogen bond network with two water molecules at the base of the active site cleft and are strictly conserved in plant CHI's (Jez et al., Biochemistry, 2002, 41 (16), pp 5168-5176). The Thr48 hydroxyl side chain directly interacts with ketone moiety of the flavanone molecule and is believed to directly participate in catalysis. Tyrl06 stabilises a catalytic water molecule and indirectly interacts with the chalcone ketone group may also act as acidic H donor of the enolate intermediate (Jez et al., Biochemistry, 2002, 41 (16), pp 5168- 5176). Asnl l3 and Thr/Serl90 provide a second set of hydrogen bonds which provide additional stabilisation of the substrate in the transition state and are believed to interact with the 4' hydroxyl group of the substrate -which
subsequently becomes the 7' hydroxyl group of the flavanone product (Jez et al., Biochemistry, 2002, 41 (16), pp 5168-5176). CHI's isolated from legumes have a Thr at position 190 whilst CHIs from other plants have a highly conserved Ser this may relate to the difference in substrate specificity in legumes.
CHALCONE ISOMERASE (CHI) protein
Chalcone isomerase (CHI) proteins, and the genes encoding them, are well known to those skilled in the art.
The chalcone isomerase (CHI) protein according to the invention may be any chalcone isomerase (CHI) protein. In one embodiment the chalcone isomerase (CHI) protein comprises at least one of the conserved amino acids as shown in the alignment of chalcone isomerase (CHI) sequence in Figure 9.
In a further embodiment, the chalcone isomerase (CHI) protein has at least 70% sequence identity to any one of the chalcone isomerase (CHI) proteins referred to in Table 1 below (and presented in the sequence listing).
In a further embodiment the chalcone isomerase (CHI) protein is one of the chalcone isomerase (CHI) proteins referred to in Table 1 below (and presented in the sequence listing). In a preferred embodiment the chalcone isomerase (CHI) protein has at least 70% sequence identity to the sequence of SEQ ID NO: 1.
In a preferred embodiment the chalcone isomerase (CHI) protein has the sequence of SEQ ID NO : 1.
Polynucleotide encoding a chalcone isomerase ( CHI) protein In one embodiment, the sequence encoding the chalcone isomerase (CHI) protein has at least 70% sequence identity to any one of the chalcone isomerase (CHI) polynucleotides referred to in Table 1 below (and presented in the sequence listing).
In a further embodiment the sequence encoding the chalcone isomerase (CHI) protein is one of the chalcone isomerase (CHI) polynucleotides referred to in Table 1 below (and presented in the sequence listing).
In a preferred embodiment the sequence encoding the chalcone isomerase (CHI) protein has at least 70% sequence identity to the sequence of SEQ ID NO : 7.
In a preferred embodiment the sequence encoding the chalcone isomerase (CHI) protein has the sequence of SEQ ID NO: 7.
Table 1 : chalcone isomerase (CHI) sequences
Figure imgf000018_0001
Figure imgf000019_0001
Figure imgf000020_0001
CHALCONE ISOMERASE (CHI) gene
The chalcone isomerase (CHI) gene according to the invention may be any chalcone isomerase (CHI) gene. Preferably the chalcone isomerase (CHI) gene encodes an chalcone isomerase (CHI) protein as herein defined. Gene
A term "gene" as used herein may be the target for reducing, or eliminating, expression of a chalcone isomerase (CHI) protein or polynucleotide.
The term gene include the sequence encoding the protein, which may be in separate exons, any regulatory sequences (including promoter and terminator sequences) 5' and 3' untranslated sequence, and introns.
It is known by those skilled in the art that any of such features of the gene may be targeted in silencing approaches such as antisense, sense suppression and RNA interference (RNAi). Methods for reducing, or eliminating, expression of proteins/genes
The terms reduced expression, reducing expression and grammatical equivalents thereof are relative terms, and refer to levels of expression relative to those in a control plant, or the particular part, tissue or organ of the control plant.
The control plant may be at least one of: - a wild type plant
- a non-transformed plant
- a plant transformed with a control construct
- a non selected plant
A control construct may be, for example, an empty vector construct. Methods for reducing or eliminating expression of proteins/polynucleotides/genes are known in the art, and are described herein.
Those skilled in the art will know how to manipulate the expression of any given polynucleotide or polypeptide in a plant or any particular part, tissue or organ of the plant. In one embodiment this may be achieved through use a a suitable promoter. For example a constitutive promoter may be used to alter expression in the plant as a whole, whereas a tissue-specific or tissure-preferred promoter may be used to alter expression in any particular part, tissue or organ of the plant. Marker assisted selection
Marker assisted selection (MAS) is an approach that is often used to identify plants that possess a particular trait using a genetic marker, or markers, associated with that trait. MAS may allow breeders to identify and select plants at a young age and is particularly valuable for hard to measure traits. The best markers for MAS are the causal mutations, but where these are not available, a marker that is in strong linkage disequilibrium with the causal mutation can also be used. Such information can be used to accelerate genetic gain, or reduce trait measurement costs, and thereby has utility in commercial breeding programs.
Markers
Markers for use in the methods of the invention include but are not limited to nucleic acid markers, such as single nucleotide polymorphisms (SNPs), simple sequence repeats (SSRs or microsatellites), insertions, substitutions, indels and deletions.
Preferably the marker is in linkage disequilibrium (LD) with the trait.
Preferably the marker is in LD with the trait at a D' value of at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5.
Preferably the marker is in LD with the trait at a R2 value of at least 0.05, more preferably at least 0.075, more preferably at least 0.1, more preferably at least 0.2, more preferably at least 0.3, more preferably at least 0.4, more preferably at least 0.5.
The term "linkage disequilibrium" or LD as used herein, refers to a derived statistical measure of the strength of the association or co-occurrence of two independent genetic markers. Various statistical methods can be used to summarize linkage disequilibrium (LD) between two markers but in practice only two, termed D' and R2, are widely used.
Marker linked, and or in LD, with the trait may be of any type including but not limited to, SNPs, substitutions, insertions, deletions, indels, simple sequence repeats (SSRs). The trait in the present invention is altered levels of phloridzin in a plant or part thereof. Preferably the "altered" is "increased".
Methods for marker detection and marker assisted selection are well known to those skilled in the art.
Polynucleotides and fragments
The term "polynucleotide(s)," as used herein, means a single or double-stranded deoxyribonucleotide or ribonucleotide polymer of any length but preferably at least 15 nucleotides, and include as non-limiting examples, coding and non- coding sequences of a gene, sense and antisense sequences complements, exons, introns, genomic DNA, cDNA, pre-mRNA, mRNA, rRNA, siRNA, miRNA, tRNA, ribozymes, recombinant polypeptides, isolated and purified naturally occurring DNA or RNA sequences, synthetic RNA and DNA sequences, nucleic acid probes, primers and fragments. Preferably the term "polynucleotide" includes both the specified sequence and its compliment.
A "fragment" of a polynucleotide sequence provided herein is a subsequence of contiguous nucleotides, e.g., a sequence that is at least 15 nucleotides in length. The fragments of the invention comprise 15 nucleotides, preferably at least 20 nucleotides, more preferably at least 30 nucleotides, more preferably at least 50 nucleotides, more preferably at least 50 nucleotides and most preferably at least 60 nucleotides of contiguous nucleotides of a polynucleotide of the invention. Fragments of polynucleotides for use in silencing, in particular for RNA
interference (RNAi) approaches are preferably at least 21 nucleotides in length. The term "primer" refers to a short polynucleotide, usually having a free 3ΌΗ group that is hybridized to a template and used for priming polymerization of a polynucleotide complementary to the target.
Polypeptides and fragments
The term "polypeptide", as used herein, encompasses amino acid chains of any length but preferably at least 5 amino acids, including full-length proteins, in which amino acid residues are linked by covalent peptide bonds. Polypeptides of the present invention may be purified natural products, or may be produced partially or wholly using recombinant or synthetic techniques. The term may refer to a polypeptide, an aggregate of a polypeptide such as a dimer or other multimer, a fusion polypeptide, a polypeptide fragment, a polypeptide variant, or derivative thereof.
A "fragment" of a polypeptide is a subsequence of the polypeptide. In one embodiment the fragment can perform the same function as the full length polypeptide from which it is derived, or is part of. Preferably the fragment performs a function that is required for the biological activity and/or provides three dimensional structure of the polypeptide.
The term "isolated" as applied to the polynucleotide or polypeptide sequences disclosed herein is used to refer to sequences that are removed from their natural cellular environment. In one embodiment the sequence is separated from its flanking sequences as found in nature. An isolated molecule may be obtained by any method or combination of methods including biochemical, recombinant, and synthetic techniques.
The term "recombinant" refers to a polynucleotide sequence that is synthetically produced or is removed from sequences that surround it in its natural context. The recombinant sequence may be recombined with sequences that are not present in its natural context.
A "recombinant" polypeptide sequence is produced by translation from a
"recombinant" polynucleotide sequence. The term "derived from" with respect to polynucleotides or polypeptides of the invention being derived from a particular genera or species, means that the polynucleotide or polypeptide has the same sequence as a polynucleotide or polypeptide found naturally in that genera or species. The polynucleotide or polypeptide, derived from a particular genera or species, may therefore be produced synthetically or recombinantly.
Variants
As used herein, the term "variant" refers to polynucleotide or polypeptide sequences different from the specifically identified sequences, wherein one or more nucleotides or amino acid residues is deleted, substituted, or added.
Variants may be naturally occurring allelic variants, or non-naturally occurring variants. Variants may be from the same or from other species and may encompass homologues, paralogues and orthologues. In certain embodiments, variants of the polypeptides and polynucleotides disclosed herein possess biological activities that are the same or similar to those of the disclosed polypeptides or polypeptides. The term "variant" with reference to polypeptides and polynucleotides encompasses all forms of polypeptides and polynucleotides as defined herein.
Polynucleotide variants Variant polynucleotide sequences preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more preferably at least 89%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity to a sequence of the present invention. Identity is found over a comparison window of at least 20 nucleotide positions, preferably at least 50 nucleotide positions, more preferably at least 100 nucleotide positions, and most preferably over the entire length of a
polynucleotide of the invention. Polynucleotide sequence identity can be determined in the following manner. The subject polynucleotide sequence is compared to a candidate polynucleotide sequence using BLASTN (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq (Tatiana A. Tatusova, Thomas L. Madden (1999), "Blast 2 sequences - a new tool for comparing protein and nucleotide sequences", FEMS Microbiol Lett. 174: 247-250), which is publicly available from NCBI
(ftp://ftp.ncbi.nih.gov/blast/). In one embodiment the default parameters of bl2seq are utilized. In a further except the default parameters of bl2seq are utilized, except that filtering of low complexity parts should be turned off.
Polynucleotide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs (e.g. Needleman, S. B. and Wunsch, C. D. (1970) J. Mol. Biol. 48, 443-453). A full implementation of the Needleman- Wunsch global alignment algorithm is found in the needle program in the
EMBOSS package (Rice,P. Longden,I. and Bleasby,A. EMBOSS : The European Molecular Biology Open Software Suite, Trends in Genetics June 2000, vol 16, No 6. pp.276-277) which can be obtained from
http://www.hgmp.mrc.ac.uk/Software/EMBOSS/. The European Bioinformatics Institute server also provides the facility to perform EMBOSS-needle global alignments between two sequences on line at
http:/www. ebi.ac.uk/emboss/align/. Alternatively the GAP program may be used which computes an optimal global alignment of two sequences without penalizing terminal gaps. GAP is described in the following paper: Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.
A preferred method for calculating polynucleotide % sequence identity is based on aligning sequences to be compared using Clustal X (Jeanmougin et al., 1998, Trends Biochem. Sci. 23, 403-5.)
Polynucleotide variants of the present invention also encompass those which exhibit a similarity to one or more of the specifically identified sequences that is likely to preserve the functional equivalence of those sequences and which could not reasonably be expected to have occurred by random chance. Such sequence similarity with respect to polypeptides may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI ( ftp://ftp.ncbi.nih.aov/blast/1).
Alternatively, variant polynucleotides of the present invention hybridize to the specified polynucleotide sequences, or complements thereof under stringent conditions.
The term "hybridize under stringent conditions", and grammatical equivalents thereof, refers to the ability of a polynucleotide molecule to hybridize to a target polynucleotide molecule (such as a target polynucleotide molecule immobilized on a DNA or RNA blot, such as a Southern blot or Northern blot) under defined conditions of temperature and salt concentration. The ability to hybridize under stringent hybridization conditions can be determined by initially hybridizing under less stringent conditions then increasing the stringency to the desired stringency. With respect to polynucleotide molecules greater than about 100 bases in length, typical stringent hybridization conditions are no more than 25 to 30°C (for example, 10°C) below the melting temperature (Tm) of the native duplex (see generally, Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Ausubel et al., 1987, Current Protocols in Molecular Biology, Greene Publishing,). Tm for polynucleotide molecules greater than about 100 bases can be calculated by the formula Tm = 81. 5 + 0. 41% (G + C-log (Na+). (Sambrook et al., Eds, 1987, Molecular Cloning, A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press; Bolton and McCarthy, 1962, PNAS 84: 1390). Typical stringent conditions for polynucleotide of greater than 100 bases in length would be hybridization conditions such as prewashing in a solution of 6X SSC, 0.2% SDS; hybridizing at 65oC, 6X SSC, 0.2% SDS overnight;
followed by two washes of 30 minutes each in IX SSC, 0.1% SDS at 65°C and two washes of 30 minutes each in 0.2X SSC, 0.1% SDS at 65°C.
With respect to polynucleotide molecules having a length less than 100 bases, exemplary stringent hybridization conditions are 5 to 10°C below Tm. On average, the Tm of a polynucleotide molecule of length less than 100 bp is reduced by approximately (500/oligonucleotide length) °C.
With respect to the DNA mimics known as peptide nucleic acids (PNAs) (Nielsen et al., Science. 1991 Dec 6; 254(5037) : 1497-500) Tm values are higher than those for DNA-DNA or DNA-RNA hybrids, and can be calculated using the formula described in Giesen et al., Nucleic Acids Res. 1998 Nov l ; 26(21) : 5004-6.
Exemplary stringent hybridization conditions for a DNA-PNA hybrid having a length less than 100 bases are 5 to 10°C below the Tm.
Variant polynucleotides of the present invention also encompasses
polynucleotides that differ from the sequences of the invention but that, as a consequence of the degeneracy of the genetic code, encode a polypeptide having similar activity to a polypeptide encoded by a polynucleotide of the present invention. A sequence alteration that does not change the amino acid sequence of the polypeptide is a "silent variation". Except for ATG (methionine) and TGG (tryptophan), other codons for the same amino acid may be changed by art recognized techniques, e.g., to optimize codon expression in a particular host organism.
Polynucleotide sequence alterations resulting in conservative substitutions of one or several amino acids in the encoded polypeptide sequence without significantly altering its biological activity are also included in the invention. A skilled artisan will be aware of methods for making phenotypically silent amino acid
substitutions (see, e.g., Bowie et al., 1990, Science 247, 1306).
Variant polynucleotides due to silent variations and conservative substitutions in the encoded polypeptide sequence may be determined using the publicly available bl2seq program from the BLAST suite of programs (version 2.2.5 [Nov 2002]) from NCBI (ftp://ftp.ncbi.nih.gov/blast/) via the tblastx algorithm as previously described.
Polypeptide variants
The term "variant" with reference to polypeptides encompasses naturally occurring, recombinantly and synthetically produced polypeptides. Variant polypeptide sequences preferably exhibit at least 50%, more preferably at least 51%, more preferably at least 52%, more preferably at least 53%, more preferably at least 54%, more preferably at least 55%, more preferably at least 56%, more preferably at least 57%, more preferably at least 58%, more preferably at least 59%, more preferably at least 60%, more preferably at least 61%, more preferably at least 62%, more preferably at least 63%, more preferably at least 64%, more preferably at least 65%, more preferably at least 66%, more preferably at least 67%, more preferably at least 68%, more preferably at least 69%, more preferably at least 70%, more preferably at least 71%, more preferably at least 72%, more preferably at least 73%, more preferably at least 74%, more preferably at least 75%, more preferably at least 76%, more preferably at least 77%, more preferably at least 78%, more preferably at least 79%, more preferably at least 80%, more preferably at least 81%, more preferably at least 82%, more preferably at least 83%, more preferably at least 84%, more preferably at least 85%, more preferably at least 86%, more preferably at least 87%, more preferably at least 88%, more preferably at least 89%, more preferably at least 90%, more preferably at least 91%, more preferably at least 92%, more preferably at least 93%, more preferably at least 94%, more preferably at least 95%, more preferably at least 96%, more preferably at least 97%, more preferably at least 98%, and most preferably at least 99% identity to a sequences of the present invention. Identity is found over a comparison window of at least 20 amino acid positions, preferably at least 50 amino acid positions, more preferably at least 100 amino acid positions, and most preferably over the entire length of a polypeptide of the invention.
Polypeptide sequence identity can be determined in the following manner. The subject polypeptide sequence is compared to a candidate polypeptide sequence using BLASTP (from the BLAST suite of programs, version 2.2.5 [Nov 2002]) in bl2seq, which is publicly available from NCBI (ftp://ftp.ncbi .nih.gov/blast/). In one embodiment the default parameters of bl2seq are utilized. In a further except the default parameters of bl2seq are utilized, except that filtering of low complexity parts should be turned off.
Polypeptide sequence identity may also be calculated over the entire length of the overlap between a candidate and subject polynucleotide sequences using global sequence alignment programs. EMBOSS-needle (available at
http:/www. ebi.ac.uk/emboss/align/) and GAP (Huang, X. (1994) On Global Sequence Alignment. Computer Applications in the Biosciences 10, 227-235.) as discussed above are also suitable global sequence alignment programs for calculating polypeptide sequence identity. A preferred method for calculating polypeptide % sequence identity is based on aligning sequences to be compared using Clustal X (Jeanmougin et al., 1998, Trends Biochem. Sci. 23, 403-5.)
A variant polypeptide includes a polypeptide wherein the amino acid sequence differs from a polypeptide herein by one or more conservative amino acid substitutions, deletions, additions or insertions which do not affect the biological activity of the peptide. Conservative substitutions typically include the substitution of one amino acid for another with similar characteristics, e.g., substitutions within the following groups: valine, glycine; glycine, alanine; valine, isoleucine, leucine; aspartic acid, glutamic acid; asparagines, glutamine; serine, threonine; lysine, arginine; and phenylalanine, tyrosine.
Non-conservative substitutions will entail exchanging a member of one of these classes for a member of another class.
Analysis of evolved biological sequences has shown that not all sequence changes are equally likely, reflecting at least in part the differences in conservative versus non-conservative substitutions at a biological level. For example, certain amino acid substitutions may occur frequently, whereas others are very rare.
Evolutionary changes or substitutions in amino acid residues can be modelled by a scoring matrix also referred to as a substitution matrix. Such matrices are used in bioinformatics analysis to identify relationships between sequences, one example being the BLOSUM62 matrix shown below (Table 2).
Table 2 : The BLOSUM62 matrix containing all possible substitution scores
[Henikoff and Henikoff, 1992] .
Figure imgf000030_0001
The BLOSUM62 matrix shown is used to generate a score for each aligned amino acid pair found at the intersection of the corresponding column and row. For example, the substitution score from a glutamic acid residue (E) to an aspartic acid residue (D) is 2. The diagonal show scores for amino acids which have not changed. Most substitutions changes have a negative score. The matrix contains only whole numbers.
Determination of an appropriate scoring matrix to produce the best alignment for a given set of sequences is believed to be within the skill of in the art. The BLOSUM62 matrix in table 1 is also used as the default matrix in BLAST searches, although not limited thereto. Other variants include peptides with modifications which influence peptide stability. Such analogs may contain, for example, one or more non-peptide bonds (which replace the peptide bonds) in the peptide sequence. Also included are analogs that include residues other than naturally occurring L-amino acids, e.g. D-amino acids or non-naturally occurring synthetic amino acids, e.g. beta or gamma amino acids and cyclic analogs
Constructs, vectors and components thereof
The term "genetic construct" refers to a polynucleotide molecule, usually double- stranded DNA, which may have inserted into it another polynucleotide molecule (the insert polynucleotide molecule) such as, but not limited to, a cDNA molecule. A genetic construct may contain the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide. The insert polynucleotide molecule may be derived from the host cell, or may be derived from a different cell or organism and/or may be a recombinant polynucleotide. Once inside the host cell the genetic construct may become integrated in the host chromosomal DNA. The genetic construct may be linked to a vector.
The term "vector" refers to a polynucleotide molecule, usually double stranded DNA, which is used to transport the genetic construct into a host cell. The vector may be capable of replication in at least one additional host system, such as E. coli.
The term "expression construct" refers to a genetic construct that includes the necessary elements that permit transcribing the insert polynucleotide molecule, and, optionally, translating the transcript into a polypeptide. An expression construct typically comprises in a 5' to 3' direction : a) a promoter functional in the host cell into which the construct will be transformed,
b) the polynucleotide to be expressed, and
c) a terminator functional in the host cell into which the construct will be transformed.
In one embodiment at least one of the promoter and terminator is heterologous with respect to the polynucleotide to be expressed. In one embodiment the promoter is heterologous with respect to the polynucleotide to be expressed. In a further embodiment the terminator is heterologous with respect to the
polynucleotide to be expressed. The term "heterologous" means that the sequences, that are heterologous to each other, are not found together in nature. Preferably the sequences are not found operably linked in nature. In one embodiment, the heterologous sequences are found in different species.
However, one or more of the heterologous sequences may also be synthetically produced and not found in nature at all.
The term "coding region" or "open reading frame" (ORF) refers to the sense strand of a genomic DNA sequence or a cDNA sequence that is capable of producing a transcription product and/or a polypeptide under the control of appropriate regulatory sequences. The coding sequence is identified by the presence of a 5' translation start codon and a 3' translation stop codon. When inserted into a genetic construct, a "coding sequence" is capable of being expressed when it is operably linked to promoter and terminator sequences.
"Operably-linked" means that the sequence of interest, such as a sequence to be expressed is placed under the control of, and typically connected to another sequence comprising regulatory elements that may include promoters, tissue- specific regulatory elements, temporal regulatory elements, enhancers, repressors and terminators, 5'-UTR sequences, 5'-UTR sequences comprising uORFs, and uORFs.
The term "noncoding region" refers to untranslated sequences that are upstream of the translational start site and downstream of the translational stop site.
These sequences are also referred to respectively as the 5'-UTR and the 3'-UTR. These regions include elements required for transcription initiation and
termination and for regulation of translation efficiency.
A 5'-UTR sequence is the sequence between the transcription initiation site, and the translation start site.
The 5'-UTR sequence is an mRNA sequence encoded by the genomic DNA.
However as used herein the term 5'-UTR sequence includes the genomic sequence encoding the 5'-UTR sequence, and the compliment of that genomic sequence, and the 5'-UTR mRNA sequence. Terminators are sequences, which terminate transcription, and are found in the 3' untranslated ends of genes downstream of the translated sequence. Terminators are important determinants of mRNA stability and in some cases have been found to have spatial regulatory functions. The term "promoter" refers to cis-regulatory elements upstream of the coding region that regulate gene transcription. Promoters comprise cis-initiator elements which specify the transcription initiation site and conserved boxes such as the TATA box, and motifs that are bound by transcription factors. A "transgene" is a polynucleotide that is introduced into an organism by transformation. The transgene may be derived from the same species or from a different species as the species of the organism into which the transgene is introduced . The transgenet may also be synthetic and not found in nature in any species. A "transgenic plant" refers to a plant which contains new genetic material as a result of genetic manipulation or transformation. The new genetic material may be derived from a plant of the same species as the resulting transgenic plant or from a different species, or may be synthetic.
Preferably the "transgenic" is different from any plant found in nature due the the presence of the transgene.
An "inverted repeat" is a sequence that is repeated, where the second half of the repeat is in the complementary strand, e.g.,
(5')GATCTA TAGATC(3')
(3')CTAGAT ATCTAG(5') Read-through transcription will produce a transcript that undergoes
complementary base-pairing to form a hairpin structure provided that there is a 3-5 bp spacer between the repeated regions.
The terms "to alter expression of" and "altered expression" of a polynucleotide or polypeptide of the invention, are intended to encompass the situation where genomic DNA corresponding to a polynucleotide of the invention is modified thus leading to altered expression of a polynucleotide or polypeptide of the invention. Modification of the genomic DNA may be through genetic transformation or other methods known in the art for inducing mutations. The "altered expression" can be related to an increase or decrease in the amount of messenger RNA and/or polypeptide produced and may also result in altered activity of a polypeptide due to alterations in the sequence of a polynucleotide and polypeptide produced. Methods for isolating or producing polynucleotides
The polynucleotide molecules of the invention can be isolated by using a variety of techniques known to those of ordinary skill in the art. By way of example, such polypeptides can be isolated through use of the polymerase chain reaction (PCR) described in Mullis et al., Eds. 1994 The Polymerase Chain Reaction,
Birkhauser, incorporated herein by reference. The polypeptides of the invention can be amplified using primers, as defined herein, derived from the
polynucleotide sequences of the invention.
Further methods for isolating polynucleotides of the invention include use of all, or portions of, the polypeptides having the sequence set forth herein as hybridization probes. The technique of hybridizing labelled polynucleotide probes to polynucleotides immobilized on solid supports such as nitrocellulose filters or nylon membranes, can be used to screen the genomic or cDNA libraries.
Exemplary hybridization and wash conditions are: hybridization for 20 hours at 65°C in 5. 0 X SSC, 0. 5% sodium dodecyl sulfate, 1 X Denhardt's solution;
washing (three washes of twenty minutes each at 55°C) in 1. 0 X SSC, 1% (w/v) sodium dodecyl sulfate, and optionally one wash (for twenty minutes) in 0. 5 X SSC, 1% (w/v) sodium dodecyl sulfate, at 60°C. An optional further wash (for twenty minutes) can be conducted under conditions of 0. I X SSC, 1% (w/v) sodium dodecyl sulfate, at 60°C.
The polynucleotide fragments of the invention may be produced by techniques well-known in the art such as restriction endonuclease digestion, oligonucleotide synthesis and PCR amplification.
A partial polynucleotide sequence may be used, in methods well-known in the art to identify the corresponding full length polynucleotide sequence. Such methods include PCR-based methods, 5'RACE (Frohman MA, 1993, Methods Enzymol. 218 : 340-56) and hybridization- based method, computer/database -based methods. Further, by way of example, inverse PCR permits acquisition of unknown sequences, flanking the polynucleotide sequences disclosed herein, starting with primers based on a known region (Triglia et al., 1998, Nucleic Acids Res 16, 8186, incorporated herein by reference). The method uses several restriction enzymes to generate a suitable fragment in the known region of a gene. The fragment is then circularized by intramolecular ligation and used as a PCR template. Divergent primers are designed from the known region. In order to physically assemble full-length clones, standard molecular biology approaches can be utilized (Sambrook et al., Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987).
It may be beneficial, when producing a transgenic plant from a particular species, to transform such a plant with a sequence or sequences derived from that species. The benefit may be to alleviate public concerns regarding cross-species transformation in generating transgenic organisms. Additionally when down- regulation of a gene is the desired result, it may be necessary to utilise a sequence identical (or at least highly similar) to that in the plant, for which reduced expression is desired. For these reasons among others, it is desirable to be able to identify and isolate orthologues of a particular gene in several different plant species.
Variants (including orthologues) may be identified by the methods described. Methods for identifying variants
Physical methods
Variant polypeptides may be identified using PCR-based methods (Mullis et al., Eds. 1994 The Polymerase Chain Reaction, Birkhauser). Typically, the
polynucleotide sequence of a primer, useful to amplify variants of polynucleotide molecules of the invention by PCR, may be based on a sequence encoding a conserved region of the corresponding amino acid sequence.
Alternatively library screening methods, well known to those skilled in the art, may be employed (Sambrook et al., Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987). When identifying variants of the probe sequence, hybridization and/or wash stringency will typically be reduced relatively to when exact sequence matches are sought.
Polypeptide variants may also be identified by physical methods, for example by screening expression libraries using antibodies raised against polypeptides of the invention (Sambrook et al., Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987) or by identifying polypeptides from natural sources with the aid of such antibodies.
Computer based methods
The variant sequences of the invention, including both polynucleotide and polypeptide variants, may also be identified by computer-based methods well- known to those skilled in the art, using public domain sequence alignment algorithms and sequence similarity search tools to search sequence databases (public domain databases include Genbank, EMBL, Swiss-Prot, PIR and others). See, e.g., Nucleic Acids Res. 29 : 1-10 and 11-16, 2001 for examples of online resources. Similarity searches retrieve and align target sequences for comparison with a sequence to be analyzed (i.e., a query sequence). Sequence comparison algorithms use scoring matrices to assign an overall score to each of the alignments.
An exemplary family of programs useful for identifying variants in sequence databases is the BLAST suite of programs (version 2.2.5 [Nov 2002]) including BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX, which are publicly available from (ftp://ftp.ncbi.nih.gov/blast/) or from the National Center for Biotechnology Information (NCBI), National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894 USA. The NCBI server also provides the facility to use the programs to screen a number of publicly available sequence databases. BLASTN compares a nucleotide query sequence against a nucleotide sequence database. BLASTP compares an amino acid query sequence against a protein sequence database. BLASTX compares a nucleotide query sequence translated in all reading frames against a protein sequence database. tBLASTN compares a protein query sequence against a nucleotide sequence database dynamically translated in all reading frames. tBLASTX compares the six-frame translations of a nucleotide query sequence against the six-frame translations of a nucleotide sequence database. The BLAST programs may be used with default parameters or the parameters may be altered as required to refine the screen. The use of the BLAST family of algorithms, including BLASTN, BLASTP, and
BLASTX, is described in the publication of Altschul et al., Nucleic Acids Res. 25 : 3389-3402, 1997.
The "hits" to one or more database sequences by a queried sequence produced by BLASTN, BLASTP, BLASTX, tBLASTN, tBLASTX, or a similar algorithm, align and identify similar portions of sequences. The hits are arranged in order of the degree of similarity and the length of sequence overlap. Hits to a database sequence generally represent an overlap over only a fraction of the sequence length of the queried sequence.
The BLASTN, BLASTP, BLASTX, tBLASTN and tBLASTX algorithms also produce "Expect" values for alignments. The Expect value (E) indicates the number of hits one can "expect" to see by chance when searching a database of the same size containing random contiguous sequences. The Expect value is used as a significance threshold for determining whether the hit to a database indicates true similarity. For example, an E value of 0.1 assigned to a polynucleotide hit is interpreted as meaning that in a database of the size of the database screened, one might expect to see 0.1 matches over the aligned portion of the sequence with a similar score simply by chance. For sequences having an E value of 0.01 or less over aligned and matched portions, the probability of finding a match by chance in that database is 1% or less using the BLASTN, BLASTP, BLASTX, tBLASTN or tBLASTX algorithm.
Multiple sequence alignments of a group of related sequences can be carried out with CLUSTALW (Thompson, J .D., Higgins, D.G. and Gibson, TJ . (1994)
CLUSTALW: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice. Nucleic Acids Research, 22:4673-4680, http://www-igbmc.u- strasbg.fr/BioInfo/ClustalW/Top.html) or T-COFFEE (Cedric Notredame, Desmond G. Higgins, Jaap Heringa, T-Coffee: A novel method for fast and accurate multiple sequence alignment, J. Mol. Biol. (2000) 302: 205-217))or PILEUP, which uses progressive, pairwise alignments. (Feng and Doolittle, 1987, J. Mol. Evol. 25, 351).
Pattern recognition software applications are available for finding motifs or signature sequences. For example, MEME (Multiple Em for Motif Elicitation) finds motifs and signature sequences in a set of sequences, and MAST (Motif Alignment and Search Tool) uses these motifs to identify similar or the same motifs in query sequences. The MAST results are provided as a series of alignments with appropriate statistical data and a visual overview of the motifs found. MEME and MAST were developed at the University of California, San Diego.
PROSITE (Bairoch and Bucher, 1994, Nucleic Acids Res. 22, 3583; Hofmann et al., 1999, Nucleic Acids Res. 27, 215) is a method of identifying the functions of uncharacterized proteins translated from genomic or cDNA sequences. The PROSITE database (www.expasy.org/prosite) contains biologically significant patterns and profiles and is designed so that it can be used with appropriate computational tools to assign a new sequence to a known family of proteins or to determine which known domain(s) are present in the sequence (Falquet et al., 2002, Nucleic Acids Res. 30, 235). Prosearch is a tool that can search SWISS- PROT and EMBL databases with a given sequence pattern or signature. Methods for isolating polypeptides
The polypeptides of the invention, including variant polypeptides, may be prepared using peptide synthesis methods well known in the art such as direct peptide synthesis using solid phase techniques (e.g. Stewart et al., 1969, in Solid-Phase Peptide Synthesis, WH Freeman Co, San Francisco California, or automated synthesis, for example using an Applied Biosystems 431A Peptide Synthesizer (Foster City, California). Mutated forms of the polypeptides may also be produced during such syntheses.
The polypeptides and variant polypeptides of the invention may also be purified from natural sources using a variety of techniques that are well known in the art (e.g. Deutscher, 1990, Ed, Methods in Enzymology, Vol. 182, Guide to Protein Purification,).
Alternatively the polypeptides and variant polypeptides of the invention may be expressed recombinantly in suitable host cells and separated from the cells as discussed below.
Methods for modifying sequences
Methods for modifying the sequence of proteins, or the polynucleotide sequences encoding them, are well known to those skilled in the art. The sequence of a protein may be conveniently be modified by altering/modifying the sequence encoding the protein and expressing the modified protein. Approaches such as site-directed mutagenesis may be applied to modify existing polynucleotide sequences. Alternatively restriction endonucleases may be used to excise parts of existing sequences. Altered polynucleotide sequences may also be conveniently synthesised in a modified form.
Methods for producing constructs and vectors
The genetic constructs of the present invention comprise one or more
polynucleotide sequences of the invention and/or polynucleotides encoding polypeptides of the invention, and may be useful for transforming, for example, bacterial, fungal, insect, mammalian or plant organisms. The genetic constructs of the invention are intended to include expression constructs as herein defined. Methods for producing and using genetic constructs and vectors are well known in the art and are described generally in Sambrook et al., Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987 ; Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing, 1987). Methods for producing host cells comprising polynucleotides, constructs or vectors
The invention provides a host cell which comprises a genetic construct or vector of the invention. Host cells may be derived from, for example, bacterial, fungal, insect, mammalian or plant organisms.
Host cells comprising genetic constructs, such as expression constructs, of the invention are useful in methods well known in the art (e.g. Sambrook et a/. , Molecular Cloning : A Laboratory Manual, 2nd Ed. Cold Spring Harbor Press, 1987; Ausubel et a/. , Current Protocols in Molecular Biology, Greene Publishing, 1987) for recombinant production of polypeptides of the invention. Such methods may involve the culture of host cells in an appropriate medium in conditions suitable for or conducive to expression of a polypeptide of the invention. The expressed recombinant polypeptide, which may optionally be secreted into the culture, may then be separated from the medium, host cells or culture medium by methods well known in the art (e.g. Deutscher, Ed, 1990, Methods in Enzymology, Vol 182, Guide to Protein Purification).
Methods for producing plant cells and plants comprising constructs and vectors
The invention further provides plant cells which comprise a genetic construct of the invention, and plant cells modified to alter expression of a polynucleotide or polypeptide of the invention. Plants comprising such cells also form an aspect of the invention.
Methods for transforming plant cells, plants and portions thereof with
polypeptides are described in Draper et al., 1988, Plant Genetic Transformation and Gene Expression. A Laboratory Manual. Blackwell Sci. Pub. Oxford, p. 365; Potrykus and Spangenburg, 1995, Gene Transfer to Plants. Springer-Verlag, Berlin. ; and Gelvin et al., 1993, Plant Molecular Biol. Manual. Kluwer Acad. Pub. Dordrecht. A review of transgenic plants, including transformation techniques, is provided in Galun and Breiman, 1997, Transgenic Plants. Imperial College Press, London. Methods for genetic manipulation of plants
A number of plant transformation strategies are available (e.g. Birch, 1997, Ann Rev Plant Phys Plant Mol Biol, 48, 297, Hellens RP, et al (2000) Plant Mol Biol 42: 819-32, Hellens R et al (2005) Plant Meth 1 : 13). For example, strategies may be designed to increase expression of a polynucleotide/polypeptide in a plant cell, organ and/or at a particular developmental stage where/when it is normally expressed or to ectopically express a polynucleotide/polypeptide in a cell, tissue, organ and/or at a particular developmental stage which/when it is not normally expressed. The expressed polynucleotide/polypeptide may be derived from the plant species to be transformed or may be derived from a different plant species.
Transformation strategies may be designed to reduce, or eliminate, expression of a polynucleotide/polypeptide in a plant cell, tissue, organ or at a particular developmental stage which/when it is normally expressed. Such strategies are known as gene silencing strategies. Genetic constructs for expression of genes in transgenic plants typically include promoters for driving the expression of one or more cloned polynucleotide, terminators and selectable marker sequences to detest presence of the genetic construct in the transformed plant.
The promoters suitable for use in the constructs of this invention are functional in a cell, tissue or organ of a monocot or dicot plant and include cell-, tissue- and organ-specific promoters, cell cycle specific promoters, temporal promoters, inducible promoters, constitutive promoters that are active in most plant tissues, and recombinant promoters. Choice of promoter will depend upon the temporal and spatial expression of the cloned polynucleotide, so desired. The promoters may be those normally associated with a transgene of interest, or promoters which are derived from genes of other plants, viruses, and plant pathogenic bacteria and fungi. Those skilled in the art will, without undue experimentation, be able to select promoters that are suitable for use in modifying and modulating plant traits using genetic constructs comprising the polynucleotide sequences of the invention. Examples of constitutive plant promoters include the CaMV 35S promoter, the nopaline synthase promoter and the octopine synthase promoter, and the Ubi 1 promoter from maize. Plant promoters which are active in specific tissues, respond to internal developmental signals or external abiotic or biotic stresses are described in the scientific literature. Exemplary promoters are described, e.g., in WO 02/00894, which is herein incorporated by reference. Exemplary terminators that are commonly used in plant transformation genetic construct include, e.g., the cauliflower mosaic virus (CaMV) 35S terminator, the Agrobacterium tumefaciens nopaline synthase or octopine synthase terminators, the Zea mays zein gene terminator, the Oryza sativa ADP-glucose
pyrophosphorylase terminator and the Solanum tuberosum PI-II terminator.
Selectable markers commonly used in plant transformation include the neomycin phophotransferase II gene (NPT II) which confers kanamycin resistance, the aadA gene, which confers spectinomycin and streptomycin resistance, the phosphinothricin acetyl transferase (bar gene) for Ignite (AgrEvo) and Basta (Hoechst) resistance, and the hygromycin phosphotransferase gene (hpt) for hygromycin resistance.
Use of genetic constructs comprising reporter genes (coding sequences which express an activity that is foreign to the host, usually an enzymatic activity and/or a visible signal (e.g., luciferase, GUS, GFP) which may be used for promoter expression analysis in plants and plant tissues are also contemplated. The reporter gene literature is reviewed in Herrera-Estrella et al., 1993, Nature 303, 209, and Schrott, 1995, In : Gene Transfer to Plants (Potrykus, T.,
Spangenberg. Eds) Springer Verlag. Berline, pp. 325-336.
Gene silencing As discussed above, strategies designed to reduce, or eliminate, expression of a polynucleotide/polypeptide in a plant cell, tissue, organ, or at a particular developmental stage which/when it is normally expressed, are known as gene silencing strategies.
Gene silencing strategies may be focused on the gene itself or regulatory elements which effect expression of the encoded polypeptide. "Regulatory elements" is used here in the widest possible sense and includes other genes which interact with the gene of interest.
Genetic constructs designed to decrease or silence the expression of a polynucleotide/polypeptide of the invention may include an antisense copy of all or part a polynucleotide described herein. In such constructs the polynucleotide is placed in an antisense orientation with respect to the promoter and terminator
An "antisense" polynucleotide is obtained by inverting a polynucleotide or a segment of the polynucleotide so that the transcript produced will be
complementary to the mRNA transcript of the gene, e.g., 5'GATCTA 3' (coding strand) 3'CTAGAT 5' (antisense strand)
3'CUAGAU 5' mRNA 5'GAUCUCG 3' antisense RNA
Genetic constructs designed for gene silencing may also include an inverted repeat. An 'inverted repeat' is a sequence that is repeated where the second half of the repeat is in the complementary strand, e.g.,
5'-GATCTA TAGATC-3'
3'-CTAGAT ATCTAG-5'
The transcript formed may undergo complementary base pairing to form a hairpin structure. Usually a spacer of at least 3-5 bp between the repeated region is required to allow hairpin formation.
Such constructs are used in RNA interference (RNAi) approaches.
Another silencing approach involves the use of a small antisense RNA targeted to the transcript equivalent to an miRNA (Llave et al., 2002, Science 297, 2053). Use of such small antisense RNA corresponding to polynucleotide of the invention is expressly contemplated.
Transformation with an expression construct, as herein defined, may also result in gene silencing through a process known as sense suppression (e.g. Napoli et al., 1990, Plant Cell 2, 279; de Carvalho Niebel et al., 1995, Plant Cell, 7, 347). In some cases sense suppression may involve over-expression of the whole or a partial coding sequence but may also involve expression of non-coding region of the gene, such as an intron or a 5' or 3' untranslated region (UTR). Chimeric partial sense constructs can be used to coordinately silence multiple genes (Abbott et al., 2002, Plant Physiol. 128(3) : 844-53; Jones et al., 1998, Planta 204: 499-505). The use of such sense suppression strategies to silence the target polynucleotides/genes is also contemplated.
The polynucleotide inserts in genetic constructs designed for gene silencing may correspond to coding sequence and/or non-coding sequence, such as promoter and/or intron and/or 5' or 3'-UTR sequence, or the corresponding gene.
Preferably the insert sequence for use in a construct (e.g. an antisense, sense suppression or RNAi construct) for silencing of a target gene, comprises an insert sequence of at least 21 nucleotides in length corresponding to, or
complementary, to the target gene. Other gene silencing strategies include dominant negative approaches and the use of ribozyme constructs (Mclntyre, 1996, Transgenic Res, 5, 257).
Pre-transcriptional silencing may be brought about through mutation of the gene itself or its regulatory elements. Such mutations may include point mutations, frameshifts, insertions, deletions and substitutions.
Several further methods known in the art may be employed to alter, reduce or eliminate expression of a polynucleotide and/or polypeptide according to the invention. Such methods include but are not limited to Tilling (Till et al., 2003, Methods Mol Biol, 2%, 205), so called "Deletagene" technology (Li et al., 2001, Plant Journal 27(3), 235) and the use of artificial transcription factors such as synthetic zinc finger transcription factors, (e.g. Jouvenot et al., 2003, Gene Therapy 10, 513) . Additionally antibodies or fragments thereof, targeted to a particular polypeptide may also be expressed in plants to modulate the activity of that polypeptide (Jobling et al., 2003, Nat. Biotechnol., 21(1), 35). Transposon tagging approaches may also be applied. Additionally peptides interacting with a polypeptide of the invention may be identified through technologies such as phase-display (Dyax Corporation). Such interacting peptides may be expressed in or applied to a plant to affect activity of a polypeptide of the invention. Use of each of the above approaches in alteration of expression of a nucleotide and/or polypeptide of the invention is specifically contemplated.
Methods for modifying endogenous DNA sequences in plant
Methods for modifying endogenous genomic DNA sequences in plants are known to those skilled in the art. Such methods may involve the use of sequence- specific nucleases that generate targeted double-stranded DNA breaks in genes of interest. Examples of such methods for use in plants include: zinc finger nucleases (Curtin et al., 2011. Plant Physiol. 156:466-473. ; Sander, et al., 2011. Nat. Methods 8 : 67-69.), transcription activator-like effector nucleases or
"TALENs" (Cermak et al., 2011, Nucleic Acids Res. 39:e82 ; Mahfouz et al., 2011 Proc. Natl. Acad. Sci. USA 108: 2623-2628 ; Li et al., 2012 Nat. Biotechnol.
30: 390-392), and LAGLIDADG homing endonucleases, also termed
"meganucleases" (Tzfira et al., 2012. Plant Biotechnol. J. 10: 373-389).
In certain embodiments of the invention, one of these technologies (e.g. TALENs or a Zinc finger nuclease) can be used to modify one or more base pairs in a target gene to disable it, so it is no longer transcribaable and/or translatable. Those skilled in the art will thus appreciate that there are numerous ways in which expression of target gens/polynucleotides/polypeptides can be reduced or eliminated. Any such method is included within the scope of the invention. Transformation protocols
The following are representative publications disclosing genetic transformation protocols that can be used to genetically transform the following plant species: Rice (Alam et al., 1999, Plant Cell Rep. 18, 572); apple (Yao et al., 1995, Plant Cell Reports 14, 407-412); maize (US Patent Serial Nos. 5, 177, 010 and 5, 981, 840); wheat (Ortiz et al., 1996, Plant Cell Rep. 15, 1996, 877); tomato (US Patent Serial No. 5, 159, 135); potato (Kumar et al., 1996 Plant J. 9, : 821); cassava (Li et al., 1996 Nat. Biotechnology 14, 736); lettuce (Michelmore et al., 1987, Plant Cell Rep. 6, 439); tobacco (Horsch et al., 1985, Science 227, 1229); cotton (US Patent Serial Nos. 5, 846, 797 and 5, 004, 863); grasses (US Patent Nos. 5, 187, 073 and 6. 020, 539); peppermint (Niu et al., 1998, Plant Cell Rep. 17, 165); citrus plants (Pena et al., 1995, Plant Sci.104, 183); caraway (Krens et al., 1997, Plant Cell Rep, 17, 39); banana (US Patent Serial No. 5, 792, 935); soybean (US Patent Nos. 5, 416, 011 ; 5, 569, 834 ; 5, 824, 877 ; 5, 563, 04455 and 5, 968, 830); pineapple (US Patent Serial No. 5, 952, 543); poplar (US Patent No. 4, 795, 855) ; monocots in general (US Patent Nos. 5, 591, 616 and 6, 037, 522); brassica (US Patent Nos. 5, 188, 958 ; 5, 463, 174 and 5, 750, 871); cereals (US Patent No. 6, 074, 877); pear (Matsuda et al., 2005, Plant Cell Rep. 24(1) :45-51); Prunus (Ramesh et al., 2006 Plant Cell Rep. 25(8) : 821-8; Song and Sink 2005 Plant Cell Rep. 2006 ; 25(2) : 117-23; Gonzalez Padilla et al., 2003 Plant Cell Rep.22(l) : 38-45); strawberry (Oosumi et al., 2006 Planta.
223(6) : 1219-30; Folta et al., 2006 Planta Apr 14; PMID: 16614818), rose (Li et al., 2003), Rubus (Graham et al., 1995 Methods Mol Biol. 1995;44: 129-33), tomato (Dan et al., 2006, Plant Cell Reports V25:432-441), apple (Yao et al., 1995, Plant Cell Rep. 14, 407-412) and Actinidia eriantha (Wang et al., 2006, Plant Cell Rep. 25,5: 425-31). Transformation of other species is also
contemplated by the invention. Suitable other methods and protocols are available in the scientific literature.
Plants
The term "plant" is intended to include a whole plant, any part of a plant, propagules and progeny of a plant. The term 'propagule' means any part of a plant that may be used in reproduction or propagation, either sexual or asexual, including seeds and cuttings.
The plants of the invention may be grown and either self-ed or crossed with a different plant strain and the resulting off-spring from two or more generations also form an aspect of the present invention. Preferably the off-spring retain the construct, transgene or modification according to the invention.
General
In this specification where reference has been made to patent specifications, other external documents, or other sources of information, this is generally for the purpose of providing a context for discussing the features of the invention. Unless specifically stated otherwise, reference to such external documents is not to be construed as an admission that such documents, or such sources of information, in any jurisdiction, are prior art, or form part of the common general knowledge in the art. The term "comprising" as used in this specification means "consisting at least in part of". When interpreting each statement in this specification that includes the term "comprising", features other than that or those prefaced by the term may also be present. Related terms such as "comprise" and "comprises" are to be interpreted in the same manner. In certain embodiements the term "comprising" and related terms such as
"comprise" and "comprises", can be replaced with "consisting" and related terms, such as "consist" and "consists".
This invention may also be said broadly to consist in the parts, elements and features referred to or indicated in the specification of the application, individually or collectively, and any or all combinations of any two or more said parts, elements or features, and where specific integers are mentioned herein which have known equivalents in the art to which this invention relates, such known equivalents are deemed to be incorporated herein as if individually set forth.
BRIEF DESCRIPTION OF THE DRAWINGS
The present invention will be better understood with reference to the
accompanying drawings in which : Figure 1 shows the phenylpropanoid pathway in apple showing the two proposed phloridzin pathway branchpoints. CBDR-1 is the carbon double bond reductase activity observed by Gosch et al (2009), CBDR-2 is the new phloridzin pathway branchpint described in this research, reducing naringenin chalcone to phloretin. Previously identified phenylpropanoid pathway enzymes are shown; PAL phenylalanine ammonia lyase, C4H cinnamate-4-hydroxylase, 4CL 4-coumaroyl CoA ligase, CHS chalcone synthase, CHI chalcone isomerase, PGT phloretin glycosyltransferase.
Figure 2 shows the relative expression levels of phenylpropanoid pathway genes in 'Royal Gala' and 'Conference' pear leaves. Expression levels are relative to the MdActin or PcActin reference genes. * = Indicates that there is no known homolog in pear. Error bars show the standard error for three replicate reactions.
Figure 3 shows the relative expression levels of CHI in the leaves of four apple and pear varieties. Expression levels are relative to the MdACTIN or PcACTIN reference genes. Error bars represent standard error of three replicate reactions.
Figure 4 shows the proposed naringenin chalcone reductase reaction
Figure 5 shows. HPLC analysis of the naringenin chalcone branch point assay. HPLC trace (280 nm) of the reaction products of 'Royal Gala' leaf protein extract (RG) with naringenin chalcone (N-C) and NADPH (black trace). The minus NADPH and extract only controls are shown as pink and blue traces, respectively.
Retention times are offset slightly for clarity.
Figure 6 shows comparative CHI activity in crude protein extracts (20 μg) from apple and pear leaves. RG control = 'Royal Gala' protein extract no naringenin chalcone. CP control = 'Conference' pear protein extract no naringenin chalcone. Buffer + N-C = non-enzymic cyclisation of naringenin chalcone in reaction buffer. RG + N-C = 'Royal Gala' protein extract with naringenin chalcone. CP + N-C = 'Conference' pear protein extract plus naringenin chalcone.
Figure 7 shows the effect of increasing amounts of CHI (At3g55120) protein extract on phloretin formation in 'Royal Gala' leaf extracts. A heat inactivated CHI extract was used as a no CHI control (0 μg CHI). Figures are corrected for background phloretin. Error bars represent standard error of three replicate reactions. Figure 8 shows dihydrochalcone concentrations in the leaves of 5 transgenic 'Royal gala' lines over-expressing the CHI gene from Arabidopsis and a 'Royal gala' control. Error bars show the standard error for 3 biological replicates. Figure 9 shows an alignment of chalcone isomerase (CHI) sequences from various species and shows (in black boxing) amino acids completely conserved between the sequences. Sequence 1 = SEQ ID NO: 58, Sequence 2 = SEQ ID NO : 59, Sequence 3 = SEQ ID NO : 60, Sequence 4 = SEQ ID NO : 3, Sequence 5 = SEQ ID NO: 61, Sequence 6 = SEQ ID NO: 62, Sequence 7 = SEQ ID NO: 61, Sequence 8 = SEQ ID NO : 2, Sequence 9 = SEQ ID NO: 6.
Figure 10 shows ESI-LC-MS/MS analysis of the tt5 seed extract. The base peak plot (panel A) shows the time course from which an extracted ion chromatogram for the mass range (m/z) 437.130-437.150 is prepared (panel B). The mass peak centered on 20.73 min (red box panel A) is attributable to phloridzin (insert panel C) having a mass of m/z 437.14389 (C21H25O10). m/z = mass to charge ratio.
Figure 11 shows fragmentation of the m/z 437.14389 ion in the LTQ ion trap. This analysis produced daughter MS2 ions (panel D) and MS3 ions (panels E and F) that are characteristic of the phloridzin standard.
Figure 12 shows a map of pTK02S_262928. Position of the hairpin sequences are shown as green arrows (KO seq).
EXAMPLES
The invention will now be illustrated with reference to the following non-limiting examples. It is not the intention to limit the scope of the invention to the abovementioned examples only. As would be appreciated by a skilled person in the art, many variations are possible without departing from the scope of the invention.
Example 1:
1. Introduction
The dihydrochalcone phloridzin is the major phenolic compound in apple {Malus x domestica). Whilst it is found thoughout the plant it is present in particularly high concentrations in the bark, roots and leaves. Dihydrochalcones have been been previously reported in small quantities in other genera but high concentrations of phloridzin are unique to apple. Phloridzin has particular relevance as a bioactive compound mainly due to its role as a potent inhibitor of sodium linked glucose transport. This ability to block renal reabsorption of glucose makes phloridzin a potential agent to treat diseases like Type II diabetes and hyperglycaemia.
However, comaparatively little is known about the phloridzin pathway in apple. Previous research has described an as yet uncharacterised carbon double bond reductase activity in apple leaf extracts which is proposed to covert p-coumaroyl CoA to dihydro-p-coumaroyl CoA [1] . This precursor is then converted by chalcone synthase to form the aglycone compound phloretin. A final glycosylation reaction then produces the phloridzin endproduct (Fig 1).
This research describes the existence of a second phloridzin pathway branchpoint at chalcone isomerase (CHI) whereby naringenin chalcone is reduced to form phloretin. Flux through this new pathway is in turn mediated by unusally low levels of CHI expression and enzyme activity in apple leaves which allows naringenin chalcone to be diverted down the phloridzin pathway.
2. Occurence of phloridzin in Arabidopsis transparent testa 5 (tt5) mutants
An earlier metabolome study of an Arabidopsis CHALCONE ISOMERASE (CHI) mutant called transparent testa 5 (tt5) revealed the accumulation of three compounds in the seed putatively annotated as two isomers of dihydronaringenin chalcone hexoside and one dihydronaringenin chalcone dihexoside. The applicants used electrospray liquid chromatography mass spectrometry to show that these compounds were in fact phloridzin and phloretin (Fig 10 and 11) based on their mass fragmentation patterns. No evidence of phloridzin or phloretin was found in wild type seed . The applicant postulated that a pathway block at CHI and the subsequent accumulation of naringenin chalcone might be a key factor in phloridzin production in apple. To investigate this further, expression studies of apple phenylpropanoid genes were performed . 3. Ouantative PCR of Apple and Pear phenylpropanoid biosynthetic genes
By comparing the expression levels of phenylpropanoid pathway genes in apple to a closely related species that does not produce dihydrochalcones, the applicants considered that inferences may be made about the relative efficiency of each step in the apple pathway. The applicants considered that this approach may highlight where a phloridzin precursor might accumulate to be acted on by a carbon double bond reductase. Pyrus is the most closely related genus to Malus and its gene sequences share high nucleotide homology with apple. The presence of phloridzin or phloretin has never been reported in any species of pear. The absence of phloridzin and its high degree of genetic similarity to apple, make pear a useful species to look at comparative expression patterns of phenylpropanoid pathway genes. Figure 2 shows the relative expression levels of each of the biosynthetic pathway genes in apple (Royal gala) and Pear (Conference) . This shows that while there are considerable variations in expression levels between apple and pear the largest fold change in expression occurs at CHI. Pear CHI (PcCHI) has a relative expression level of just over 1 (relative to PcACTIN expression), whereas expression of Apple CHI (MdCHI) is around 1000 fold lower at 9.5x10-4 (relative to MdACTIN expression).
To investigate if the expression patterns of CHI and CHS seen in 'Royal Gala' and 'Conference' pear leaves also holds for other varieties, four additional apple and pear varieties were tested (Figure 3). Figure 3 shows that the pattern of gene expression for CHI is still apparent in these varieties. The relative expression of MdCHI compared with the reference gene is in the 10 3 range and expression of PcCHI is variable but considerably higher (up to 440 fold) than MdCHI. 4. Biochemical analysis of the narinqeninchalcone branchpoint and CHI enzyme activity
The results presented in section 3 revealed that apple CHI has a relatively low level of expression in apple leaves. This observation coupled with the finding that an Arabidopsis tt5 mutant line accumulates phloridzin in the seed (section 2), lead the applicants to postulate that naringenin chalcone could be a potential branch point for the phloridzin pathway. To further investigate this possibility, 18 nmol of naringenin chalcone was added to protein extracts of 'Royal Gala' leaves in the presence of 1.2 mM NADPH. Reactions were performed using 100 mM potassium phosphate buffer at pH 6.5 to minimise spontaneous self-cyclisation (Mol et a/. , 1985) . The proposed branch point reaction is shown in Figure 4 and the HPLC trace of the reaction products is shown in Figure 5. Figure 5 shows the formation of phloretin from naringenin chalcone in the presence of NADPH with only naringenin forming in the minus NADPH control. The background adjusted phloretin concentration was estimated at 2.8 μg/mL. No dihydrochalcones have ever been reported in pear tissues, so a protein extract from 'Conference' pear was made and incubated with naringenin chalcone and NADPH to act as a negative control. Only naringenin was observed on the resulting HPLC trace indicating no reduction of naringenin chalcone had occurred.
The RT-qPCR experiments in measured the expression level of the most abundant CHI gene in the apple EST database. It is possible that other functional CHI homologs are present in the leaf and are more highly expressed, as the number of ESTs in a library do not always reflect transcript levels in the plant. To test if the low expression level of CHI in apple leaves equated to low CHI activity, the cyclisation of naringenin chalcone to naringenin was measured. Reactions were carried out by adding 30 nmol naringenin chalcone to 20 μg protein extracts of "Royal Gala" leaves or "Conference" leaves, and the decrease in absorbance at
365 nm was monitored for 4 min. Assays were based on the method described by Mol et al. (1985) and chemical self cyclisation was measured by monitoring the decrease in absorbance at 365 nm in the reaction buffer alone (Figure 6). Figure 6 shows that the rate of conversion of naringenin chalcone to naringenin in the apple leaf protein extract is slower than for the same amount of pear leaf protein and appears to be proceeding at only a slightly faster rate than the nonenzyme mediated chemical cyclisation. This higher CHI activity in pear leaves is consistent with the transcript analysis results discussed above. The applicants considered that the comparatively low level of CHI activity in apple leaves may lead to a metabolic bottleneck at naringenin chalcone, forming a pool of substrate for phloretin biosynthesis. One way to test this hypothesis is by adding CHI enzyme to the crude "Royal Gala" protein extracts to see if less phloretin is produced in the presence of naringenin chalcone and NADPH.
To achieve this, the Arabidopsis CHI gene (At3g55120) was transiently expressed in tobacco and crude protein extracts added to the the narigenin chalcone reduction reaction. Figure 7 shows that phloretin production from naringenin chalcone is inversely correlated with the amount of CHI protein present in the reaction.
5. Over expression of Arabidopsis CHI in apple
The applicants postulated that over expressing a CHI gene in apple leaves should remove some or all of the metabolic bottleneck at his point in the pathway leading to the reduction of phloridzin levels in the leaf as metabolites are instead channelled into the synthesis of downstream products of the pathway for example, catechins, epicatechins, proanthocynidins, anthocyanins and quercetin derivatives. To test this hypothesis 'Royal gala' plants were transformed with constructs containing the Arabidopsis CHI gene (At3g55120) under the control of a 35S CaMV promoter. Five transgenic lines were created and tested for AtCHI transgene expression by reverse transcriptase PCR. All 5 lines were verified as expressing the transgene. Total dihydrochalcone levels (phloridzin and phloretin) were then measured by HPLC analysis. All 5 lines showed significant reductions in the level of total leaf dihydrochalcones with up to an 11 fold reduction present in line A2 (Figure 8). The transgenic lines provide further in-vivo support that the low CHI levels in apple leaves area key mediator of phloridzin production in the apple leaf.
7. Conclusions
Together these results provide evidence for the applicant's invention that redcution of the expression of CHI in plants, or parts thereof, will lead to altered levels of phloridzin in the plants or parts thereof. Specifically increasing CHI will lead to a decrease in phloridzin production whereas decreasing CHI will lead to an increase in phloridzin in production.
8. Materials and methods
A. Plant and Bacterial strains
Escherichia coli DH5a (subcloning efficiency Invitrogen USA)
Genotype: F- φ 80/acZΔM 15 Δ(/acZYA-argF)U169 rec A1 end A1 hsdR17 (rk- , mk+) phoA supE44 thi-1 gyr A96 rel A1 λ-.
Arabidopsis thaliana genotypes: wild-type Landsberg erecta (supplied by Sarah Moss). tt4 (N85 Nottingham Arabidopsis Stock Centre), tt5 (N86 Nottingham Arabidopsis Stock Centre).
Table 3. Reverse transcription quantative PCR primers for apple biosynthetic genes.
Figure imgf000052_0001
Figure imgf000053_0001
Figure imgf000053_0002
PcCHI and PcActin were kindly donated by Kui Lin Wang.
B. Plasmid Vectors
Table 5. Plasmid Vectors
Figure imgf000053_0003
Figure imgf000054_0002
C. Microbial Growth Media and Antibiotics
Luria-Bertani (LB) media : 15 (w/v) bactotryptone, 0.5% (w/v) yeast extract, 1% (w/v) NaCI, pH 7.0
LB plates: LB media with 1.5% (w/v) bacto agar
Table 6. Antibiotics
Figure imgf000054_0001
D. Chemicals and Solutions
CTAB RNA extraction buffer: 2% (w/v) hexadecyltrimethylammonium bromide (CTAB) 2% polyvinylpyrrolidinone (PVP) 100 mM TRIS-HCI (pH 8.0), 25 mM EDTA, 2.0 M NaCI, 0.5 g/L spermidine, 2% (v/v) β-mercaptoethanol SSTE Buffer (RNA ) 1 M NaCI, lOmM TRIS-HCI, 1 mM EDTA, 0.5% SDS pH 8.0 Tobacco protein extraction buffer: 10% glycerol (v/v), 0.25% PVP-25 (soluble), 1% PVPP (w/v), 5 mM DTT, lx complete protease inhibitor tablet solution (Roche), 100 mM BIS- TRIS Propane pH 7.5 Apple protein extraction buffer 0.2 M 3-(N-Morpholino) propanesulfonic acid (MOPS), pH 7.0, lx complete protease inhibitor tablet solution (Roche Germany), 1% (v/v) Triton X100, 5% PVPP (w/v), 2 mM DTT added just before use. Equilibration buffer (Nicotiana benthamiana) 10% glycerol (v/v), 5 mM DTT, 100 mM BIS-TRIS Propane pH 7.5
E. Chemicals used Table 7. Chemicals
Figure imgf000054_0003
Figure imgf000055_0001
F. Manipulation of DNA Enzymes used for DNA manipulation listed as below:
DNA Platinum Taq (Invitrogen), Prime STAR HS polymerase (Takara, Japan), iProof™ High Fidelity DNA polymerase (BioRad) or Pwo DNA polymerase (Roche, Germany).
DNA Ligation : Rapid DNA ligation kit (Roche, Germany) or pGEM-T easy kit (Promega USA)
Restriction enzymes: New England Biolabs
DNA dephosphorylation : Shrimp Alkaline Phosphatase (Roche, Germany)
DNA Phosphorylation : Polynucleotide Kinase (Roche, Germany)
DNase Treatment: Turbo DNase Kit (Applied Biosystems, USA)
Reverse Transcription : Transcriptor Reverse Transcriptase (Roche, Germany) SYBR Green master mix for reverse transcription quantative PCR: LightCycler® FastStart DNA Master SYBR Green I (Roche, Germany).
G. Cloning the CHI gene of Arabidopsis (At3g55120)
Gene specific oligonucleotide primers were designed to the At3g55120 gDNA sequence obtained from TAIR. Arabidopsis genomic DNA was prepared from wild type Lansberg erecta plants using a Qiagen DNA-Easy kit (Qiagen USA) according to the manufacturer's instructions. PCR was then performed using the iproof High Fidelity DNA Polymerase (Biorad USA) according to the manufacturer's
recommendations for reaction conditions and temperature cycling parameters. Full length PCR fragments were cut with BamHl and EcoRl before overnight ligation into BamHl-EcoRl cut pSAK778. Ligations were transformed into E. Coli DH5a according to section 7 and screened by colony PCR as described in section 8. Clones were sequence confirmed and then transferred to Agrobacterium cells as outlined in section 9. H. Transformation of Escherichia coli DH5a
A 50 μL aliquot of commercially available DH5a subcloning efficiency cells (Invitrogen USA) were thawed on ice before adding 1 uL (for plasmid DNA) or 5 μL of ligation mix. The transformation mix was incubated on ice for 20 min before heat-shock treatment for 40 s at 42 °C. Cells were recovered on ice for 2 min before adding 0.5 ml_ of LB media to each tube and incubated for 90 min at 37 °C with shaking at 250 rpm. For ligation transformations cells were spun down in a microfuge at 8,000 rpm for 20 s and resuspended in 100 μL of LB media before spreading onto LB agar plates containing the appropriate antibiotic. Agar plates were incubated at 37 °C for 18-20 h.
I. Bacterial Colony PCR After overnight growth on LB+antibiotic plates at 37°C, a sterile pipette tip was used to remove single bacterial colonies which were then streaked onto a new LB+antibiotic plate. The tip used to transfer colonies was then used to inoculate a PCR tube containing the PCR master mix and vectors primers flanking the multiple cloning site. Cycling conditions were as follows;
Initial denaturation : 94°C 5 min, denaturation : 94°C 30 s, annealing : 57°C 30s, elongation : 72°C 30s.
J. Transformation of Agrobacterium GV3101(MP90). Electrocompetent GV3101 cells (50 μL aliquots) were thawed and 1 μL of plasmid DNA was added (30-200 ng) before mixing and adding to a pre-chilled 0.2 cm electroporation cuvette (Bio-Rad Laboratories USA) Electroporation was carried out using a Gene Pulser (Bio-Rad Laboratories USA) at a voltage of 2.5 kV, capacitance 25 μFd, and resistance set to 400 Ohms. Pulsed cells were immediately recovered with 0.5 mL LB media and incubated on a shaking incubator (70 rpm) at 28 °C for 2-3 h. Aliquots of 100 μL were spread onto LB plates containing appropriate antibiotics and incubated at 28 °C for 48 h.
K. Apple transformation
Apple transformation was carried out by Sumathi Tomes (Plant & Food Research, Auckland) using Agrobacterium-mediated gene infection of leaf pieces according to the protocol described by Yao et.al. (1995) (Yao, Cohen et al. 1995). Following growth in tissue culture, scions of approximately 3 cm in length were grafted onto M9 rootstocks as follows. 'Mailing 9' (M9) root stocks were pruned back to 10 cm before making two small cuts in the bark to allow the bark to be peeled back, scions were stripped of leaves, placed under the bark and secured in place by masking tape. Grafted scions were grown in shade for 10 to 14 days until the graft wound had healed and new leaves were being formed.
L. Manipulation of RNA L. l Isolation of RNA from plant tissues
The method used to extract RNA varied according to the phenolic content of the tissue being used. For Arabidopsis and tobacco which have relatively low levels of phenolics, TRIZOL® reagent (Invitrogen USA) was used according to the manufacturer's instructions. For apple and pear leaves the RNeasy Plant Mini Kit (Qiagen Germany) was used according to the manufacturer's protocol. Due to the high levels of polyphenols and polysaccharides present in apple skin an RNA extraction protocol based on the method by Chang et al (1993) was used (Chang, Puryear et al. 1993). Fruit tissue (5-10 g) was ground in liquid nitrogen using a mortar and pestle and added to 15 ml_ of RNA Extraction Buffer containing 2%
(v/v) β-mercaptoethanol preheated to 65°C. Samples were vortexed for 15 s and an equal volume of chloroform : isoamyl alcohol (24: 1) was added. The
homogenate was thoroughly mixed then centrifuged at 4000 rpm for 15 min before removing the aqueous layer and transferring to a new 15 ml_ tube. This chloroform extraction was repeated twice more and the final aqueous phase was removed and the RNA precipated by adding a 25% volume of 12 M LiCI and incubating overnight at 4°C. The sample was then centrifuged at 10,000 rpm for 10 min at 4°C to pellet the RNA. The resulting supernatant was removed and the pellet was dissolved in 750 μL of SSTE buffer (see section 2.5) and transferred to a microcentrifuge tube. An equal volume of chloroform : isoamyl alcohol (24: 1) was added before centrifugation at 13,000 rpm for 15 min at 4°C. The aqueous layer was then removed and a final RNA precipitation was carried out by adding two volumes of 100% ethanol and incubating at -80°C for 2 h. The sample was centrifuged at 4°C for 15 min at 13,000 rpm to pellet the RNA before removing the supernatant and drying the pellet at room temperature for 1 h. RNA was resuspended by adding 50 μL of RNAse-free water obtained from a Nanopure water purification system (Barnsted, USA). RNA quality and quantity was assessed using agarose gel electrophoresis and a Nanodrop® ND-1000 UV-Vis spectrophotometer (Nanodrop Technologies USA).
L.2 Synthesis of cDNA
Genomic DNA was removed from RNA samples by treating with DNase (Turbo DNase Kit Applied Biosystems, USA) in accordance with the manufacturer's instructions. RNA concentration was then determined by Nanodrop® ND-1000 spectroscopy to ensure that each cDNA reaction contained uniform 1 μg amounts of template RNA. First strand synthesis of cDNA was carried out with the
Transcriptor First Strand cDNA Synthesis Kit (Roche Germany) using oligo (dT) primers according to the protocol recommended by the manufacturer.
L.3 Reverse transcriptase quantative PCR analysis
Reverse transcriptase quantative PCR (RT-qPCR) was carried out on cDNA samples isolated from apple and pear and tobacco tissues to measure relative transcript levels of native genes. Target gene sequences were identified by reference to EST sequences from the Plant & Food Apple EST database or the NCBI database. To identify regions of gene specific sequence on a target gene, BLAST searches and sequence alignments (AlignX, Invitrogen USA) were carried out. Primers were designed using Vector NT version 11.0 (Invitrogen USA) using criteria that included; an amplicon length of 100-300 bp, a Tm of 59-61°C and minimal secondary structure or primer dimer formation. All RT-qPCR reactions were carried out using the LightCycler 1.5 (Roche Germany) using the reagents provided in the Lightcycler® FastStart DNA MasterPLUS SYBR Green I kit using 2 μL of 5x Master Mix, 0.5 μΜ of each primer and 1 μL of a cDNA diluted 1 : 10 with nuclease-free water. A water only (no template) control was included in each run and reactions were performed in triplicate. Melt curve analysis was performed following amplification with continual fluorescence acquisition during the 65-95°C melt.
Lightcycler version 4 software was used to analyse the raw data by performing absolute and relative quantification on the samples. Expression levels were normalised to the relevant reference genes MdActin (Malus x domestica Actin Genbank accession CN938023) or PcActin (Pyrus communis Actin Genbank accession AF386514). For measuring transcript suppression by gene silencing, the wild-type sample acted as a calibrator and set to a nominal value of 1. For all other samples, target gene expression levels were expressed as a relative expression ratio to the transcript level of the ACTIN reference gene in that sample. L. Extraction of proteis transiently expressed in Nicotiana benthamiana leaves
Agrobacterium GV31010 containing the gene of interest cloned into the appropriate plant transformation vector were grown on LB agar plates and infiltrated into Nicotiana benthamiana as described section 2.8.4. The P19 viral suppressor of silencing was included in a 1 : 1 ratio with the gene of interest and three whole leaves were infiltrated with 300-400 μL of resuspended
Agrobacterium cells. The plants were grown for a further 7 days under greenhouse conditions and infiltrated leaves were harvested, weighed and snap frozen in liquid nitrogen. Crude protein extracts were made by grinding 1.5-2 g of leaf tissue in liquid nitrogen before adding to a pre-chilled mortar and pestle containing two volumes (w/v) of Nicotiana benthamiana protein extraction buffer. Samples were further homogenised in extraction buffer until a liquid slurry was created. The samples were then centrifuged for 10 min at 10,000 rpm at 4°C to pellet cell debris. The supernatant was de-salted using a PD-10 column (GE Healthcare UK) prequilibrated with equilibration buffer (section 2.5), according to the manufacturer's instructions. In some instances, the protein solution was then further purified and concentrated by centrifuging through a Vivaspin 2 column (GE Healthcare UK) with a molecular weight cut-off of 10 kilodaltons at 4°C at 4000 rpm for 1 h. Protein concentration was measured using the Qubit® fluorometer (Invitrogen USA).
M. Extraction of proteins from 'Royal Gala 'eeaves
Crude protein extracts were made from young expanding leaves of 'Royal Gala' by grinding 1-2 g of leaf tissue in liquid nitrogen as described in section 2.10. Samples were homogenised in apple protein extraction buffer (described in section 2.5) until a liquid slurry was created. The homogenate was then processed as described in section 2.10. N. Extraction and identification of polyphenols by High Performace Liquid Chromatography Diode Array Detector (HPLC-DAD)
Fresh tissue of up to 1 g was harvested, weighed and snap frozen in liquid nitrogen before freeze drying overnight. Tissue was then ground to a fine powder in liquid nitrogen and extracted in the dark for 2 h at room temperature with a 5x volume of 100% methanol and 0.1% HCI. Samples were centrifuged at 13,000 rpm for 5 min and 1 ml_ aliquots were dried down in a Speed Vac. Dried down pellets were resuspended in 500 μL of 20% methanol before syringe filtration with a 0.45 μΜ cellulose membrane filters (Phenomenex CA, USA) to remove undissolved cellular debris. For the extraction of polyphenols from tt5
Arabidopsis seeds, 40 mg of dried seeds were ground using a steel rod, then extracted in 500 μL of 100% methanol containing 0.1% HCI and processed as for fresh tissue. For seed extraction, the filtered 20% methanol extracts were dried to completion a second time and resuspended in a final volume of 120 μL 20% methanol for HPLC analysis. HPLC-DAD was performed using a Dionex Ultimate 3000 system (Sunnyvale CA USA) equipped with a diode array detector (DAD). A 5 μL aliquot was injected onto a Dionex C18 Acclaim Polar Advantage II column (150 x 2.1 mm, 3 μηη particle size Sunnyvale CA USA). The solvents used were water with 0.1% formic acid (solvent A) and acetonitrile with 0.1% formic acid (solvent B). The flow rate was set to 0.35 mL/min and the column temperature was 35 °C. The 42 min gradient was as follows; 0-5 min, 0-8% B; 5-10 min, 8- 15% B; 10-20 min, 15-20% B; 20-27 min, 20% B linear; 27-34 min, 20-100% B; 34-36 min, 100% B linear; 36-42 min, 0% B, re-equilibration time. Phenolic compounds were identified by comparing their retention times and spectral data with known standards and were quantified using a five-point calibration curve. Monitoring was set at 280 nm for quantification.
O. Liquid chromatography mass spectrometry (LC-MS) analysis
LC-MS of tt5 Arabidopsis seeds
A solid phase extraction (SPE) of methanol extracts from Arabidopsis seeds (tt5 and wild-type Ler) was performed by diluting the extracts with water to 5% methanol (v/v) and applying them to preconditioned 300 mg large pore C-18 SPE cartridges (Alltech Associates, Grace, IL, USA). Each loaded cartridge was then washed in turn with 4ml of 5%, 20%, 60% aqueous methanol (v/v) and finally 100% methanol. The three latter eluted fractions were each evaporated to one ml under a nitrogen stream and diluted to an appropriate volume with 5% aqueous acetonitrile containing 0.1% formic acid.
Capillary LC-MSMS was performed on 10 μΙ aliquots of these diluted seed extract fractions using a ThermoFinnigan LTQ-FTICR hybrid mass spectrometer operating in positive electrospray mode. The aliquots were injected onto a 2mm x 150mm Phenomenex Luna PFP chromatographic column containing a Security guard cartridge of the same adsorbent housed in a column oven of a Thermo Surveyor autosampler set at 45 °C. The column was developed with a linear gradient of 5%-95% (v/v) acetonitrile in water containing 0.1% formic acid over a 35 minute period at 100 μΙ/min for a total run time of 60 min. The column eluant entered the FTMS instrument via an IonMax™ source with the capillary temperature set at 275 °C, a nitrogen sheath gas flow of 12 units, auxiliary gas flow of 5 units and sweep gas flow of 1 unit. The source voltage was 3.8 kV, capillary voltage 13V and tube lens voltage 100V. A triple top 3 tandem mass experiment was performed in parallel where a full scan in the ICR cell (accurate mass to < 2 ppm) was followed coincidently by MS2 in the ion trap on the top three ions and then MS3 performed on the top three daughter ions from each MS2 scan. Dynamic exclusion was exercised with one repeat. The run started after a two minute delay during which the solvent was diverted to waste. Full scan FT data were collected at a resolution of 100,000 @ m/z 400 over the range m/z 100-800 with and an externally calibrated mass accuracy of <2 ppm. An isolation width of 2 amu and normalised collision energy of 35 was used for both MS2 and MS3 scans and all charge states other than 1 were rejected. MSn data was collected from an average of 2 microscans and the maximum ion times were 150 msec for FT and 100 msec for ion trap MSn scans.
P. DNA sequence analysis EST sequences from the Plant & Food Research database and sequenced products were analysed using Vector NTI version 11 (Invitrogen USA). DNA sequence contigs were created using ContigExpress (Invitrogen USA) and sequence alignments were compiled using AlignX (Invitrogen USA). Example 2: Increasing phloridzin production in plants, or parts thereof.
To increase phloridzin production in plants, or parts thereof, expression of at least one chalcome isomerase (CHI) protein should be reduced, or eliminated in the target plant.
In order to reduce, or eliminate, expression of chalcome isomerase (CHI) proteins in plants, and RNAi approach can be used.
Hairpin insert
A suitable hairpin insert is produced for targeting the endogenous gene expressing the chalcone isomerase (CHI) protein. For effective gene silencing the minimum length of homologous sequence between the target and the double strand RNA hairpin is about 20 nucleotides (Small 2007), preferably 21 nucleotides. Nucleotide sequence alignments of CHI genes would be created in order to identify highly homologous genes which are likely to have redundant function. These genes can then be simultaneously silenced by a single construct. Potential target regions of 300-700 bp can then be identified from the gene alignments and each target sequence would contain at least one region of 20-30 bp of continuous identical sequence.
Target endogenous CHI encoding sequences/genes, can be identified by methods well known to those skilled in the art, or identified from publically available sequence databases, as described herein. Preferably, the target sequences are those disclosed in Table 1, and presented in the sequence listing.
Hairpin insert for apple
A 300-700bp target sequence can be designed from the following DNA seq
CAAAATTGTCAAATGGCCCCAACGCCATCGCTCGCCGGACTCCAGGTCGAGACGACTGCGTTTCCACCG TCCGCCAAACCTCCGGGCTCCTCTAACACTCTGTTCCTCGGCGGCGCAGGGGTGAGGGGGCTGGAGATT CAGGGGAACTTCGTGAAGTTCACGGCGATCGGAGTGTACTTGGAGGAAAACGCCGTGCCTCTGCTCGCC GTTAAGTGGAAGGGTAAGACGGCCGAGGAGTTGACGGGGTCCGTTGAGTTCTTCAGGGACATCGTTACA GGTCCGTTTGAGAAATTCATTCAAGTGACAACGATACTGCCACTGACAGGCCAGCAATACTCTGACAAA GTTTCGGAGAATTGCGTTGCCTTTTGGAAGTCAATCGGAATTTACACTGATGCAGAAGGCAAAGCCATT GAAAAGTTCCTTGAAGTCTTCAAAGATCAAAACTTCCCACCCGGCGCCTCCATTCTTTTCACGCAATCT CCCAAAGGATCACTAACGATCAGCTTCTCTAGAGATGCATCCGTACCTAAAGCTGCAAACACGGTGATA GAAAACAAACTACTTTCCAAGGCAGTTCTAGAATCGATCGTTGGAAAGCACGGTGTTTCTCCTGCAGCA AAGCAAAGTTTGGCCACAAGGTTATCTAAATTGTTGAATGGGTGCAAGGAATCTTATGGTGCTGAAGCT CGAAATGAAAAAGTGGAGGCATGAAAACTAAGAGAGGAGAAATAAAACTTGAGAGGGATTCCTGTTCTG TGCTTAGTGAATTATTTACATACAATCTATGAAGTTATAGGAAAGTGCCATGTCTTATTTAATTTAAAG AAAAAT GAT CAT GT T T TAT GAGGAAT AT T AGT GT T GT T T T GT T AT GT T TAAT T CAAAT CAACAAAT AT G GAT GT CGAT T GGT AAAT AAAAAAAAAAAAA ( SEQ ID NO : 53 )
Hairpin insert for pear
A 300-700bp target sequence can be designed from the following DNA seq
ATGGCTCCACCACCATCGCTCGCCGGACTTCAGATCGAAACGACTACGTTTCCACCGTCCGTCAAACCT CCGGGATCCTCCAACACTTTGTTCCTCGGCGGCGGAGGGGTGAGGGGGCTGGAGATTCAGGGGAACTTT GTGAAGTTCACAGCGATCGGAGTGTACTTGGAGGATAGCGCCGTGCCTCAGCTCGCCTTTAAGTGGAAG GGTAAGACAGCCAAGGAGTTGACGGAGTCCGTTGAGTTCTTCAGAGACATCGTTACAGGTCCATTTGAG AAATTCATTCAAGTGACAACGATACTGCCACTGACAGGCCGGCAATACTCTGAGAAAGTTTCGGAGAAT TGCGTTGCCTTTTGGAAGTCAGTCGGAATTTACACTGATGCGGAAGGCAAAGCCATTGAAAAGTTCCTT GAGGTCTTCAAAGATCAAAATTTCCCACCCGGCGCCTCCATTCTTTTCACGCAATCTCCCAAAGGATCA CTAACGATTAGCTTCTCTAGAGATGCATCCGTACCTGAAGCTGCAAACGCGGTGATAGAAAACAAACTA CTTTCCGAGGCAGTTCTAGAGTCGATCATTGGAAAGCACGGTGTTTCTCCTCCAGCAAAGCAAAGTTTG GCCGCGAGGTTATCCGAATTGTTGAGTGGGTGCAAGGAATCTAATGGTGCTGAAGCCGGAAATGAAAAA GTGGAGGCATGAAAACTGAGAGGAGAAATAAAACTTG ( SEQ ID NO : 63 ) and Genbank accessions :JX403949 and EF446163
Hairpin insert for strawberry
A 300-700bp target sequence can be designed from the following DNA sequence:
ATGGCACAATCAGTCACCGGAATCCAAATTGGAGGGATGTCGTTTCCTCCCTCCGTCAAGCCACCCGGC TCCGGCAATACCTTTTTCCTCGGCGGCGCAGGGGTGAGGGGGATGGAGATACAGGGGAATTTCGTGAAG TTCACGGCGATCGGAGTCTACTTGGAGGATAAGGCCGTGCCGGCGCTTGCCGTTAAGTGGAAGGGCAAG ACGGCCGAGGAGTTGACAGAGTCGGTTGAGTTCTTCAGGGAGATCGTTACAGGTCCTTTTGAGAAATTC ACACAAGTGACAATGATACTACCGCTGACGGGCCAGCAATACTCCGAGAAGGTTTCAGAGAATTGTGTT GCCAT T T GGAAAAAGT T T GGAAT AT ACACT GAT GCAGAAGCGAAAGCCAT T GAAAAGT T CAT AGAGGT C TTCAAAGATCAGACCTTCCCACCCGGCGCTTCAATTCTCTTCACACAATCACCAAATGGATCATTGACG ATTGGCTTCTCCAAAGATGGTTGCATACCCGAAGTTGGGAATGCGGTGATTGAAAACAAGCTACTTTCA GAGTCAGTTCTCGAGTCAATTATTGGGAAGCAAGGTGTTTCTCCTGAAGCAAGGAAAAGTGTGGCTACA AGGCTATCAGAATTGTTGAAAGAGAATGATCATTGTGTGGCCGGAAATGGGAAAGTGGACGAGTGCACA AAGGAAGCAGAAGTCAAGGCATGA (SEQ ID NO : 54) and Genbank accession AB201755 Hairpin insert for kiwifruit
A 300-700bp target sequence can be designed from the following DNA sequence:
ATGTCCCCGCCGCCGGTCACCGAAGTCCAGATCGAGACCGTCGTCTTCCCTCCGACGGCGAAACCTACG GGAACAGCCAAACCCTTCTTCCTCGGCGGCGCAGGGGAGAGAGGTTTGGAGATTGAGGGCAGGTTCATA AAGTTCACGGCCATCGGGGTGTACCTCGAAGAAAGCGCCGTTCCGTCACTCGCCGTAAAGTGGAAGGGC AAGAGCGCGGAGGAGTTGACGGAATCCGTTGAGTTCTTCAGGGATATCGTCTCCGGTCCCTTTGAGAAA TTCACACAGGTGACAATGATCTTGCCGTTAACGGGCAAGCAGTACTCGGAGAAAGTGACGGAAAACTGT GTTGCATATTGGAAAGCAGTTGGAATCTACACCGATGCAGAGGCCAAAGCCGTCGAAAAGTTTATTGAG GTCTTCAAGGATGAAACCTTCCCCCCTGGTGCTTCTATTATGTTCACCCAATCACCCCATGGATCGTTA ACGATTAGCTTCTCGAAGGATTGCTCTGTACCTGAAACAGGGAATGC (SEQ ID NO : 55)
Insertion of the hairpin insert into a construct
The hairpin insert can be cloned into the pDONOR221 vector (Invitrogen) using BP Clonase II (Invitrogen) and inserted into the gateway compatible pTK02 vector (Snowden, Simkin et al. 2005) as an inverted repeat using LR Clonase II (Invitrogen). Targetting cassettes 'green KO seq'in Figure 12. Inserts can be verified by restriction enzyme digestion by selecting a restriction enzyme that cuts once in the target region. This will cut either side of the intron spacer and release a fragment of known size.
Plant transformation
The hairpin constructs can be transformed into the chosen target species by methods well known to those skilled in the art and described herein.
Apple
Apple may be transformed as described by (Yao, Cohen et al. 1995)
Pear Apple may be transformed as described by (Sun, Zhao et al. 2011)
Strawberry
Strawberry may be transformed as described by (Oosumi, Gruszewski et al. 2006)
Kiwifruit
Kiwifruit may be transformed as described by (Wang, Ran et al. 2006)
Description of hairpin knockout vector pTK02S_261694 for apple EST 261694 SEQ ID NO: 53)
The hairpin knockout vector pTK02S_261694 (EST 261694) was constructed with pTK02 (Snowden et al 2005) using Gateway Technology (Invitrogen). Gene specific primers were designed by using the sequence alignment program Align X with the Tm of the annealing portion approximately 60°C and the primers positioned 300-700bp apart. The Gateway™ attBl forward and attB2 reverse adapter sequences were added to the 5' ends of each primer sequence to facilitate recombination with the pDONR221 and pTK02 vectors.
PCR fragments were generated using the proof reading polymerase ExTAQ (Takara Japan) before gel purification and quantification using the Qubit 2.0 fluorometer (Invitrogen USA). The BP reaction was carried at 25°C for 3 h with 30 fmoles of PCR product, 30 fmoles of pDONR221 and 1 μL of BP Clonase (Invitrogen USA). The reaction mix was Proteinase K treated and transformed into DH5a.
After selection on LB + kanamycin plates bacterial colonies were screened by colony PCR, using primers RAJ-319 (CGTTGTAAAACGACGGCCAGTC - SEQ ID NO: 56) and RAJ-320 (TGCCAGGAAACAGCTATGACCAT - SEQ ID NO : 57). Positive colonies were grown overnight in LB media at 37°C before plasmid DNA isolation using the PureLink™ Quick plasmid miniprep kit (Invitrogen USA). The LR reaction was performed overnight at 25°C using 50 fmoles of pENTRY clone, 50 fmoles of pTK02 and 1 μL of LR clonase (Invitrogen USA) in a final volume of 5 μL. The LR reaction mix was transformed into DH5a and plated on LB + spectinomycin plates and grown for 16 h at 37°C. Positive colonies were selected by restriction enzyme digestion of miniprep plasmid DNA using restriction enzymes that cut once within the expected PCR product
Those skilled in the art will understand that other hairpin constructs targeting other endogenous CHI genes/polynucleotides (such as those described above) can be produced in the same way.
Agrobacterium transformed plant tissues can be cultured on the appropriate regeneration and selection media in accordance with published protocols, for example as described herein. Transformed shoots can then be grafted onto established rootstocks or placed on root regeneration media. Once plants have reached maturity gene silencing can be confirmed by Quantitative Reverse Transcriptase PCR and dihydrochalcone concentrations in the tissues of interest can then be measured by HPLC or LC-MS analysis (as described in Example 1). References
Gosch, C, et al., Biosynthesis of phloridzin in apple (Malus domestica Borkh.). Plant Science, 2009. 176(2) : p. 223-231.
Mol, J N M, Robbinst, M P, A. Dixon, R A and Veltkamp, E (1985) Spontaneous and enzymic rearrangement of naringenin chalcone to flavanone. Phytochemistry, 24, 2267-2269. Oosumi, T., H. Gruszewski, L. Blischak, A. Baxter, P. WadI, J. Shuman, R. Veilleux and V. Shulaev (2006). "High-efficiency transformation of the diploid strawberry (Fragaria vesca) for functional genomics." Planta 223(6) : 1219-1230.
Small, I. (2007). "RNAi for revealing and engineering plant gene functions."
Current Opinion in Biotechnology 18(2) : 148-153.
Snowden, K. C, A. J . Simkin, B. J. Janssen, K. R. Templeton, H. M. Loucas, J. L. Simons, S. Karunairetnam, A. P. Gleave, D. G. Clark and H. J. Klee (2005). "The Decreased apical dominancel/Petunia hybrida CAROTENOID CLEAVAGE
DIOXYGENASE8 Gene Affects Branch Production and Plays a Role in Leaf
Senescence, Root Growth, and Flower Development." The Plant Cell Online 17(3) : 746-759.
Sun, Q., Y. Zhao, H. Sun, R. W. Hammond, R. E. Davis and L. Xin (2011). "High- efficiency and stable genetic transformation of pear (Pyrus communis L.) leaf segments and regenerationof transgenic plants." Acta Physiol Plant 33: 383-390.
Wang, T., Y. Ran, R. Atkinson, A. Gleave and D. Cohen (2006). "Transformation of Actinidia eriantha : A potential species for functional genomics studies in Actinidia." Plant Cell Reports 25(5) : 425-431.
Yao, J.-L., D. Cohen, R. Atkinson, K. Richardson and B. Morris (1995).
"Regeneration of transgenic plants from the commercial apple cultivar Royal Gala." Plant Cell Reports 14(7) : 407-412.

Claims

CLAIMS:
1. A method for producing a plant, or part thereof, with altered levels of phloridzin, the method comprising altering expression of at least one chalcone isomerase (CHI) protein in the plant or part thereof.
2. The method of claim 1 wherein the plant, or part thereof, has increased levels of phloridzin, the method comprises reducing, or eliminating, expression of a chalcone isomerase (CHI) protein in the plant or part thereof.
3. The method of claim 1 comprising introducing a construct into the plant, or part thereof, to affect the altering expression of the at least one chalcone isomerase (CHI) protein.
4. The method of claim 2 comprising introducing a construct into the plant or part thereof to affect the reducing expression of the at least one chalcone isomerase (CHI) protein.
5. The method of claim 4 wherein the construct contains a promoter sequence operably linked to at least part of a chalcone isomerase (CHI) gene, wherein the part of the gene is in an antisense orientation relative to the promoter sequence.
6. The method of claim 5 wherein the part of the gene is at least 21 nucleotides in length.
7. The method of claim 5 wherein the construct is an antisense construct.
8. The method of claim 5 wherein the construct is an RNA interference (RNAi) construct.
9. The method of claim 4 wherein the construct is a CRISPR-CAS construct.
10. A plant, or part thereof, produced by the method of any preceding claim.
11. A plant, or part thereof, produced by the method of any one of claims 3 to 9, wherein the plant, or part thereof, comprises the construct.
12. The plant, or part thereof, of claim 10 with altered levels of phloridzin, wherein the plant has altered expression of at least one chalcone isomerase (CHI) protein.
13. The plant, or part thereof, of claim 10, wherein the plant, or part thereof, has decreased levels of phloridzin and increased expression of at least one chalcone isomerase (CHI) protein.
14. A method for identifying a plant with a genotype indicative of producing increased levels of phloridzin, the method comprising testing a plant for at least one of: a) reduced, or eliminated, expression of at least one chalcone isomerase (CHI) protein, b) reduced, or eliminated, expression of at least one polynucleotide encoding an chalcone isomerase (CHI) protein, c) presence of a marker associated with reduced expression of at least one chalcone isomerase (CHI) protein, and d) presence of a marker associated with reduced expression of at least one polynucleotide encoding an chalcone isomerase (CHI) protein.
15. The method of claim 14 wherein presence of any of a) to d) indicates that the plant will produce increased levels of phloridzin.
16. A construct for reducing the expression of an chalcone isomerase (CHI) protein in a plant.
17. The construct of claim 16 that contains a promoter sequence operably linked to at least part of an chalcone isomerase (CHI) gene, wherein the part of the gene is in an antisense orientation relative to the promoter sequence.
18. The construct of claim 17 wherein the part of the gene is at least 21 nucleotides in length.
19. The construct of claim 17 wherein the construct is an antisense construct.
20. The construct of claim 17 wherein the construct is an RNA interference (RNAi) construct.
21. The construct of claim 16 wherein the construct is a CRISPR-CAS construct.
22. A plant, plant part, propagule, or progeny of a plant wherein the plant, plant part, propagule, progeny, comprises a construct of any one of claims 16 to 21.
23. The plant, plant part, propagule, or progeny of a plant of claim 22 wherein the plant, plant part, propagule or progeny has reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
24. A method for producing a plant with increased levels of phloridzin, the method comprising crossing one of: a) a plant of any one of claims 10 to 13, 22 and 23, b) a plant produced by a method of any one of claims 1 to 9, and c) a plant identifed by a method of any one of claims 14 to 15, with another plant, wherein the off-spring produced by the crossing is a plant that produces increased levels of phloridzin.
25. The method of claim 24 wherein the plant of a), b, or c) is a plant with reduced, or eliminated, expression of at least one chalcone isomerase (CHI) protein.
26. A method for producing a fruit with increased levels of phloridzin, the method comprising cultivating at least one of: a) a plant of any one of claims 10 to 13, 22 and 23, b) a plant produced by a method of any one of claims 1 to 9, and c) a plant selected by a method of any one of claims 14 to 15, wherein the cultivated plant produces fruit with increased levels of phloridzin.
27. The method of claim 26 wherein the plant produces a fruit with increased levels of phloridzin as a result of the plant having reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
28. A fruit with altered levels of phloridzin produced by a method of any one of claims 26 to 27.
29. A fruit with altered levels of phloridzin with altered expression of at least one chalcone isomerase (CHI) protein.
30. A fruit with increased levels of phloridzin produced by a method of any one of claims 26 to 27.
31. A fruit with increased levels of phloridzin with reduced or eliminated expression of at least one chalcone isomerase (CHI) protein.
32. The fruit of any one of claims 28 to 31 that comprises a construct of any one of claims 16 to 21.
PCT/IB2015/055743 2014-08-01 2015-07-30 Methods and materials for manipulating phloridzin production WO2016016826A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
NZ62821414 2014-08-01
NZ628214 2014-08-01

Publications (1)

Publication Number Publication Date
WO2016016826A1 true WO2016016826A1 (en) 2016-02-04

Family

ID=55216833

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2015/055743 WO2016016826A1 (en) 2014-08-01 2015-07-30 Methods and materials for manipulating phloridzin production

Country Status (1)

Country Link
WO (1) WO2016016826A1 (en)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016185057A3 (en) * 2015-05-18 2017-08-10 Universidad De Oviedo Recombinant nucleic acid for use in the production of polyphenols
CN107974484A (en) * 2017-11-10 2018-05-01 嘉兴欣贝莱生物科技有限公司 Chalcone synthase modeling method in phloretin biosynthetic process
CN110283828A (en) * 2019-07-29 2019-09-27 浙江省林业科学研究院 T-shaped cherry Chloroplast gene and its application
CN111748532A (en) * 2020-05-25 2020-10-09 天津大学 Application of a new p-coumaroyl-CoA ligase in the biosynthesis of phloretin

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6608246B1 (en) * 1998-07-14 2003-08-19 Lipton, Division Of Conopco, Inc. Methods for modulating flavonoid content in tomato by transformation with a chalcone isomerase DNA

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6608246B1 (en) * 1998-07-14 2003-08-19 Lipton, Division Of Conopco, Inc. Methods for modulating flavonoid content in tomato by transformation with a chalcone isomerase DNA

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
DARE, A.P.D: "Understanding the Biosynthesis of Phloridzin in Apple", PHD THESIS, 23 August 2013 (2013-08-23), Retrieved from the Internet <URL:https://researchspace.auckland.ac.nz/bitstream/handle/2292/20710/whole.pdf?sequence=2> [retrieved on 20151008] *
GOSCH, C. ET AL.: "Phloridzin: Biosynthesis, distribution and physiological relevance in plants", PHYTOCHEMISTRY, vol. 71, 2010, pages 838 - 843, XP027049232 *
KOCA, U. ET AL.: "Decreasing unpalatable flavonoid components in Citrus: the effect of transformation construct", PHYSIOLOGIA PLANTARUM., vol. 137, 2009, pages 101 - 114 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2016185057A3 (en) * 2015-05-18 2017-08-10 Universidad De Oviedo Recombinant nucleic acid for use in the production of polyphenols
CN107974484A (en) * 2017-11-10 2018-05-01 嘉兴欣贝莱生物科技有限公司 Chalcone synthase modeling method in phloretin biosynthetic process
CN110283828A (en) * 2019-07-29 2019-09-27 浙江省林业科学研究院 T-shaped cherry Chloroplast gene and its application
CN111748532A (en) * 2020-05-25 2020-10-09 天津大学 Application of a new p-coumaroyl-CoA ligase in the biosynthesis of phloretin
CN111748532B (en) * 2020-05-25 2022-04-15 天津大学 Application of novel p-coumaroyl-CoA ligase in biosynthesis of phloretin

Similar Documents

Publication Publication Date Title
EP1937817B1 (en) Compositions and methods for modulating pigment production in plants
AU2013365731B2 (en) Regulation of gene expression
AU2008221696B2 (en) Transferases, epimerases, polynucleotides encoding these and uses thereof
US8859848B2 (en) Phloretin glycosyltransferases, polynucleotides encoding these and methods of use
JP2023514687A (en) Glycosyltransferases, polynucleotides encoding them and methods of use
WO2016016826A1 (en) Methods and materials for manipulating phloridzin production
WO2009061215A1 (en) Compositions and methods for altering pigment production in plants
EP2285968B1 (en) Chimeric compositions and methods for regulating plant gene expression
KR102003114B1 (en) Method for improving the resistance to drought stress using pepper protein phosphatase CaAIPP1 in plants
US20160108416A1 (en) Atsp1, an e3 ubiquitin ligase, and its use
EP3191588A1 (en) Methods and materials for producing fruit of altered size
WO2011053167A1 (en) Transcription factor polynucleotides and their use

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15827475

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15827475

Country of ref document: EP

Kind code of ref document: A1