WO2016011167A1 - Her3 inhibition in low-grade serous ovarian cancers - Google Patents
Her3 inhibition in low-grade serous ovarian cancers Download PDFInfo
- Publication number
- WO2016011167A1 WO2016011167A1 PCT/US2015/040597 US2015040597W WO2016011167A1 WO 2016011167 A1 WO2016011167 A1 WO 2016011167A1 US 2015040597 W US2015040597 W US 2015040597W WO 2016011167 A1 WO2016011167 A1 WO 2016011167A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- her3
- antibody
- amino acid
- inhibitor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/32—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
- A61K39/39533—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals
- A61K39/3955—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum against materials from animals against proteinaceous materials, e.g. enzymes, hormones, lymphokines
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P15/00—Drugs for genital or sexual disorders; Contraceptives
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/30—Immunoglobulins specific features characterized by aspects of specificity or valency
- C07K2317/34—Identification of a linear epitope shorter than 20 amino acid residues or of a conformational epitope defined by amino acid residues
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/73—Inducing cell death, e.g. apoptosis, necrosis or inhibition of cell proliferation
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/70—Immunoglobulins specific features characterized by effect upon binding to a cell or to an antigen
- C07K2317/76—Antagonist effect on antigen, e.g. neutralization or inhibition of binding
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/31—Combination therapy
Definitions
- the invention relates to the treatment of cancer and in particular to the treatment of low-grade serous ovarian cancers by inhibiting signaling of an EGFR family member.
- Ovarian cancer is the fifth leading cause of cancer death in women in the United States, with an estimated 22,000 cases and 14,000 deaths occurring in 2014 (Siegel et al. Cancer Statistics, 2014. CA Cancer J Clin. 2014 Jan-Feb; 64(1 ):9-29. Doi:10.3322/caac.21208. Epub 2014 Jan 7). Although primary treatment with surgery and platinum-based chemotherapy can be effective, the disease frequently recurs and becomes increasingly resistant to therapy
- the invention relates to treatment of low-grade serous ovarian cancer.
- methods of treating cancer are provided.
- the methods can include administering to the subject a therapeutically effective amount of an antibody or fragment thereof that specifically binds to an Epidermal Growth Factor Receptor (EGFR) family member, wherein the cancer is low-grade serous ovarian cancer.
- EGFR family member is HER3 and the antibody or fragment thereof is a Her3 antibody or fragment thereof.
- the Her3 antibody or fragment thereof binds to a conformational epitope comprising amino acid residues within domain 2 and domain 4 of HER3 and blocks both ligand- dependent and ligand-independent signal transduction.
- methods of treating cancer include administering to the subject a therapeutically effective amount of an agent that inhibits signaling of an EGFR family member in the cancer, wherein the cancer is low-grade serous ovarian cancer.
- the agent can include a small molecule, a polypeptide, an antibody, an antisense oligonucleotide, or an siRNA molecule.
- the invention relates to use of an agent that inhibits signaling of an EGFR family member the manufacture of a medicament for use in the treatment of low-grade serous ovarian cancer.
- Figure 1 illustrates the effect of the anti-Her3 monoclonal antibody MOR10703 on 21 different primary ovarian cultures.
- Four primary cell packs (DF76, DF141 , DF192, and DF225) had significant decrease in proliferation after 6 days of continuous exposure to MOR10703 at a concentration of 1 : 1000.
- FIGS 2A-2B illustrate the effect of RNAi (siRNA) directed against Her3 and NRG1 in (2A) DF76 and (2B) DF141 cells.
- siHer3 resulted in significant decrease in Her3 protein expression and decreased Her3 phosphorylation, while siNRG significantly decreased NRG1 protein expression and had a moderate effect on Her3 phosphorylation.
- siRNA against either Her3 or NRG1 resulted in significant proliferation decrease in DF76 cells.
- (2B) 3 days after initial transfection siHer3 resulted in decrease in Her3 protein expression and slight decrease in Her3 phosphorylation in DF141 cells.
- siHer3 resulted in significant decrease in Her3 protein expression and significant decrease in Her3 phosphorylation in DF141 cells.
- siRNA also resulted in significant decrease in NRG1 expression at 3 days. Effects on Her3 phosphorylation at 3 days and 6 days by siNRGI could not be observed due to insufficient lysate at those time points due to toxicity.
- Figures 3A-3B illustrate the effect on Her3 expression
- MOR10703 reduced Her3 expression and phosphorylation in both MPSC1 and HOC-7 cells.
- HEY cells had very low amounts of Her3 expression and no evidence of Her3 phosphorylation.
- MOR10703 had no effect on proliferation of HEY, MPSC1 , or HOC-7 cells.
- Figures 4A-4D illustrates the effect of monoclonal antibodies directed against EGFR, Her-2, and Her3 in primary DF low-grade serous cell packs. Although variability exists, each of the low-grade DF cell packs exhibits some degree of sensitivity against cetuximab, trastuzumab, and MOR10703. Greater effect was seen when antibodies were combined than with any given antibody in isolation.
- Figures 5A-5D illustrates the effect of monoclonal antibodies directed against EGFR, Her-2 and Her3 in two high grade primary ovarian cancer cells (DF09, DF14) and in the low-grade serous ovarian cancer cell lines (HEY, MPSC1 ).
- the present invention relates to the finding that a particular subset of ovarian cancer, low grade serous ovarian cancer, can be treated with an agent that inhibits signaling of an EGFR family member.
- an agent that inhibits signaling of an EGFR family member In particular it was found that interference in HER3 signaling can be used to treat low-grade serous ovarian cancer.
- ovarian cancer arises from epithelial cells that line the surface of the ovary. Approximately 50% of epithelial ovarian tumors are classified as serous, or tumors with glandular features, and make up approximately 80% of all ovarian tumors. Other types of ovarian cancers can arise from germ cells (e.g., cancer of the ovarian egg-making cells) and sarcomas. High-grade serous tumors denote highly aggressive, invasive tumors as compared to low malignant potential (LMP) tumors. Whether an invasive serous tumor is classified as either high or low grade is based on the clinical course of the disease.
- LMP low malignant potential
- high grade serous tumors were found to over express genes that control various cellular functions associated with cancer cells, for example genes that control cell growth, DNA stability (or lack thereof) and genes that silence other genes.
- LMP tumors were not found to overexpress these types of genes and LMP tumors were alternatively
- TP53 tumor protein 53
- low grade serous ovarian tumors are characterized based in a number of criteria, for example low grade serous tumors have low to no chromosomal instability, typically have mutated KRAS, BRAF and HER2 genes, demonstrate slow tumor development, typically have cell nuclei that are uniform, small and round and generally have low mitotic index.
- a high grade serous tumor has a high degree of chromosomal instability, has mutated TP53 gene, demonstrates very fast tumor development, typically has nuclei that are non-uniform, enlarged and irregularly shaped and has high mitotic index.
- the human epidermal growth factor receptor 3 (ErbB3, also known as HER3) is a receptor protein tyrosine kinase and belongs to the epidermal growth factor receptor (EGFR) subfamily of receptor protein tyrosine kinases, which also includes EGFR (HER1 , ErbBI), HER2 (ErbB2, Neu), and HER4 (ErbB4)
- the transmembrane receptor HER3 consists of an extracellular ligand- binding domain (ECD), a dimerization domain within the ECD, a transmembrane domain, an intracellular protein tyrosine kinase-like domain (TKD) and a C-terminal phosphorylation domain.
- ECD extracellular ligand- binding domain
- TKD intracellular protein tyrosine kinase-like domain
- C-terminal phosphorylation domain Unlike the other EGFR family members, the kinase domain of HER3 displays very low intrinsic kinase activity.
- the ligands neuregulin 1 (NRG) or neuregulin 2 bind to the extracellular domain of HER3 and activate receptor-mediated signaling pathway by promoting dimerization with other dimerization partners such as HER2. Heterodimerization results in activation and transphosphorylation of HER3's intracellular domain and is a means not only for signal diversification but also signal amplification. In addition, HER3 heterodimerization can also occur in the absence of activating ligands and this is commonly termed ligand-independent HER3 activation. For example, when HER2 is expressed at high levels as a result of gene amplification (e.g. in breast, lung, ovarian or gastric cancer) spontaneous HER2/ HER3 dimers can be formed. In this situation the HER2/ HER3 is considered the most active ErbB signaling dimer and is therefore highly transforming.
- EGFR family member refers to a subfamily of epidermal growth factor receptor (EGFR) family members which include the human epidermal growth factor receptor 3 (ErbB3, also known as HER3), EGFR (HER1 , ErbBI), HER2 (ErbB2, Neu), and HER4 (ErbB4).
- EGFR human epidermal growth factor receptor 3
- HER1 human epidermal growth factor receptor 3
- ErbBI human epidermal growth factor receptor 3
- HER2 ErbB2, Neu
- HER4 ErbB4
- HER1 HER1
- ErbBI epidermal growth factor receptor
- EGFR EGFR as disclosed, for example, in Carpenter et al. Ann. Rev. Biochem. 56:881 -914 (1987), including naturally occurring mutant forms thereof (e.g. a deletion mutant EGFR as in Humphrey et al, (1990) PNAS (USA) 87:4207-421 1 ).
- egfr refers to the gene encoding the EGFR protein product.
- HER2 and "ErbB2” and are used interchangeably herein and refer to human HER2 protein described, for example, in Semba et al, (1985) PNAS (USA) 82:6497-6501 and Yamamoto et a/.(1986) Nature 319:230-234 (Genebank accession number X03363).
- the term “her2” refers to the gene encoding human HER2 and “neu” refers to the-gene encoding rat pl85 neu .
- HER4 and ErbB4 herein refer to the receptor polypeptide as disclosed, for example, in EP Pat Appln No 599,274; Plowman et al, (1993) Proc. Natl. Acad. Sci. USA, 90: 1746-1750; and Plowman et al, (1993) Nature, 366:473-475, including isoforms thereof, e.g., as disclosed in W099/19488, published Apr. 22, 1999.
- HER3 or "HER3 receptor” also known as "ErbB3” as used herein refers to mammalian HER3 protein and "her3” or “erbB3” refers to mammalian her3 gene.
- the preferred HER3 protein is human HER3 protein present in the cell membrane of a cell.
- the human her3 gene is described in U.S. Pat. No. 5,480,968 and Plowman et al, (1990) Proc. Natl. Acad. Sci. USA, 87:4905-4909.
- Human HER3 as defined in Accession No. NP 001973 (human) and represented below as SEQ ID NO: 1. All nomenclature is for full length, immature HER3 (amino acids 1 -1342). The immature HER3 is cleaved between positions 19 and 20, resulting in the mature HER3 protein (20-1342 amino acids).
- HER ligand or "ErbB ligand” as used herein refers to polypeptides which bind and activate HER receptors such as HER1 , HER2, HER3 and HER4.
- HER ligands include, but are not limited to neuregulin 1 (NRG), neuregulin 2, neuregulin 3, neuregulin 4, betacellulin, heparin-binding epidermal growth factor, epiregulin, epidermal growth factor, amphiregulin, and transforming growth factor alpha.
- NSG neuregulin 1
- neuregulin 2 neuregulin 2
- neuregulin 4 betacellulin
- heparin-binding epidermal growth factor epiregulin
- epiregulin epidermal growth factor
- amphiregulin amphiregulin
- transforming growth factor alpha transforming growth factor alpha.
- the term includes biologically active fragments and/or variants of a naturally occurring polypeptide.
- HER3 ligand refers to polypeptides which bind and activate HER3.
- HER3 ligands include, but are not limited to neuregulin 1 (NRG) and neuregulin 2, betacellulin, heparin-binding epidermal growth factor, and epiregulin.
- NRG neuregulin 1
- neuregulin 2 betacellulin
- betacellulin betacellulin
- epiregulin epiregulin
- the term includes biologically active fragments and/or variants of a naturally occurring polypeptide.
- the "HER-HER protein complex” is a noncovalently associated oligomer containing a HER co- receptors in any combination (e.g., HER1 -HER2, HER1 -HER3, HER1 -HER4, HER2- HER3, HER3- HER4, and the like). This complex can form when a cell expressing both of these receptors is exposed to a HER ligand e.g., NRG, or when a HER receptor is active or overexpressed.
- a HER ligand e.g., NRG
- the "HER2-HER3 protein complex” is a noncovalently associated oligomer containing HER2 receptor and the HER3 receptor. This complex can form when a cell expressing both of these receptors is exposed to a HER3 ligand e.g., NRG or when HER2 is active/overexpressed
- HER3 activity or "HER3 activation” as used herein refers to an increase in oligomerization (e.g. an increase in HER3 containing complexes), HER3 phosphorylation, conformational rearrangements (for example those induced by ligands), and HER3 mediated downstream signaling.
- stabilization refers to an antibody or fragment thereof that directly maintains (locks, tethers, holds, preferentially binds, favors) the inactive state or conformation of Her3 without blocking ligand binding to HER3, such that ligand binding is no longer able to activate HER3.
- Assays can be used to measure ligand binding to a stabilized HER3 receptor, e.g., Biacore assay.
- ligand-dependent signaling refers to the activation of ErbB (e.g., HER3) via ligand.
- HER3 activation is evidenced by increased oligomerization (e.g. heterodimerization) and/or HER3 phosphorylation such that downstream signaling pathways (e.g. PI3K) are activated.
- the antibody or fragment thereof can statistically significantly reduce the amount of
- HER3 in a stimulated cell exposed to the antigen binding protein (e.g., an antibody) relative to an untreated (control) cell, as measured using the assays described in the Examples.
- the cell which expresses HER3 can be a naturally occurring cell line (e.g. MCF7) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell. Cell stimulation can occur either via the exogenous addition of an activating HER3 ligand or by the endogenous expression of an activating ligand.
- the antibody or fragment thereof which "reduces neregulin-induced HER3 activation in a cell” is one which statistically significantly reduces HER3 tyrosine phosphorylation relative to an untreated (control) cell. This can be determined based on HER3 phosphotyrosine levels following exposure of HER3 to NRG and the antibody of interest.
- the cell which expresses HER3 protein can be a naturally occurring cell or cell line (e.g. MCF7) or can be recombinantly produced.
- ligand-independent signaling refers to cellular HER3 activity (e.g. phosphorylation) in the absence of a requirement for ligand binding.
- ligand- independent HER3 activation can be a result of HER2 overexpression or activating mutations in HER3 heterodimer partners such as EGFR and HER2.
- the antibody or fragment thereof can statistically significantly reduce the amount of phosphorylated HER3 in a cell exposed to the antigen binding protein (e.g., an antibody) relative to an untreated (control) cell.
- the cell which expresses HER3 can be a naturally occurring cell line (e.g. SK-Br- 3) or can be recombinantly produced by introducing nucleic acids encoding HER3 protein into a host cell.
- blocks refers to stopping or preventing an interaction or a process, e.g., stopping ligand-dependent or ligand-independent signaling.
- the term "recognize” as used herein refers to an antibody or fragment thereof that finds and interacts (e.g., binds) with its conformational epitope.
- the phrase "concurrently binds" as used herein refers to an ErbB ligand that can bind to a ligand binding site on the ErbB receptor along with the ErbB antibody. This means that both the antibody and antibody can bind to the HER receptor together.
- the HER3 ligand NRG can bind to the HER3 receptor along with the HER3 antibody.
- teeth refers to an antibody or fragment thereof that does not do a particular event.
- an antibody or fragment thereof that "fails to activate signal transduction” is one that does not trigger signal transduction; an antibody or fragment thereof that "fails to induce a
- conformational change is one that does not cause a structural alteration in the ErbB receptor; an antibody or fragment thereof that stabilizes the ErbB receptor in an inactive state such that the ErbB receptor "fails to dimerize” is one that does not form protein- protein complexes.
- antibody refers to whole antibodies that interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an HER3 epitope and inhibit signal transduction.
- a naturally occurring “antibody” is a glycoprotein comprising at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
- Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as VH) and a heavy chain constant region.
- the heavy chain constant region is comprised of three domains, CHI, CH2 and CH3.
- Each light chain is comprised of a light chain variable region (abbreviated herein as VL) and a light chain constant region.
- the light chain constant region is comprised of one domain, CL.
- the VH and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
- CDR complementarity determining regions
- Each VH and VL is composed of three CDRs and four FRs arranged from amino-terminus to carboxy-terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4.
- the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
- the constant regions of the antibodies may mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.
- antibody includes for example, monoclonal antibodies, human antibodies, humanized antibodies, camelised antibodies, chimeric antibodies, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv), Fab fragments, F (ab') fragments, and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the invention), and epitope-binding fragments of any of the above.
- scFv single-chain Fvs
- sdFv disulfide-linked Fvs
- Fab fragments fragments
- F (ab') fragments fragments
- anti-idiotypic (anti-Id) antibodies including, e.g., anti-Id antibodies to antibodies of the invention, and epitope-binding fragments of any of the above.
- the antibodies can be of any isotype (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGI, lgG2, lgG3, lgG4, IgAI and lgA2) or subclass.
- IgG, IgE, IgM, IgD, IgA and IgY class
- IgGI, lgG2, lgG3, lgG4, IgAI and lgA2 subclass.
- Both the light and heavy chains are divided into regions of structural and functional homology.
- the terms "constant” and “variable” are used functionally.
- the variable domains of both the light (VL) and heavy (VH) chain portions determine antigen recognition and specificity.
- the constant domains of the light chain (CL) and the heavy chain (CHI, CH2 or CH3) confer important biological properties such as secretion, transplacental mobility, Fc receptor binding, complement binding, and the like.
- CL light chain
- CHI heavy chain
- CH2 or CH3 constant domains of the heavy chain
- CH3 and CL domains actually comprise the carboxy- terminus of the heavy and light chain, respectively.
- antibody fragment refers to one or more portions of an antibody that retain the ability to specifically interact with (e.g., by binding, steric hindrance, stabilizing/destabilizing, spatial distribution) an HER3 epitope and inhibit signal transduction.
- binding fragments include, but are not limited to, a Fab fragment, a monovalent fragment consisting of the VL, VH, CL and CHI domains; a F(ab) 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment consisting of the VH and CHI domains; a Fv fragment consisting of the VL and VH domains of a single arm of an antibody; a dAb fragment (Ward et al, (1989) Nature 341 :544- 546), which consists of a VH domain; and an isolated complementarity determining region (CDR).
- a Fab fragment a monovalent fragment consisting of the VL, VH, CL and CHI domains
- F(ab) 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
- a Fd fragment consisting of the VH and CHI domains
- the two domains of the Fv fragment, VL and VH are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the VL and VH regions pair to form monovalent molecules (known as single chain Fv (scFv); see e.g., Bird et al, (1988) Science 242:423-426; and Huston et al, (1988) Proc. Natl. Acad. Sci. 85:5879-5883).
- single chain Fv single chain Fv
- Such single chain antibodies are also intended to be encompassed within the term "antibody fragment”.
- Antibody fragments are obtained using conventional techniques known to those of skill in the art, and the fragments are screened for utility in the same manner as are intact antibodies.
- Antibody fragments can also be incorporated into single domain antibodies, maxibodies, minibodies, intrabodies, diabodies, triabodies, tetrabodies, v-NAR and bis-scFv (see, e.g., Hollinger and Hudson, (2005) Nature Biotechnology 23: 1 126-1 136).
- Antibody fragments can be grafted into scaffolds based on polypeptides such as Fibronectin type III (Fn3) (see U.S. Pat. No. 6,703,199, which describes fibronectin polypeptide
- Antibody fragments can be incorporated into single chain molecules comprising a pair of tandem Fv segments (VH-CH1 -VH-CH1 ) which, together with complementary light chain polypeptides, form a pair of antigen binding regions (Zapata et al., (1995) Protein Eng. 8: 1057-1062; and U.S. Pat. No.
- epitope includes any protein determinant capable of specific binding to an immunoglobulin or otherwise interacting with a molecule.
- Epitopic determinants generally consist of chemically active surface groupings of molecules such as amino acids or carbohydrate or sugar side chains and can have specific three-dimensional structural characteristics, as well as specific charge characteristics.
- An epitope may be "linear” or “conformational.”
- linear epitope refers to an epitope with all of the points of interaction between the protein and the interacting molecule (such as an antibody) occur linearly along the primary amino acid sequence of the protein (continuous).
- An epitope can comprises those residues to which the antibody binds.
- the term "conformational epitope” refers to an epitope in which discontinuous amino acids that come together in three dimensional conformation. In a conformational epitope, the points of interaction occur across amino acid residues on the protein that are separated from one another.
- the conformational epitope is defined by (i) HER3 amino acid residues 265-277 and 315 (of domain 2) and (ii) HER3 amino acid residues 571 , 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1 , or a subset thereof.
- the space that is occupied by a residue or side chain that creates the shape of a molecule helps to determine what an epitope is.
- antibodies specific for a particular target antigen will preferentially recognize an epitope on the target antigen in a complex mixture of proteins and/or macromolecules.
- Regions of a given polypeptide that include an epitope can be identified using any number of epitope mapping techniques, well known in the art. See, e.g., Epitope Mapping Protocols in Methods in Molecular Biology, Vol. 66 (Glenn E.Morris, Ed., 1996) Humana Press, Totowa, New Jersey.
- linear epitopes may be determined by e.g., concurrently synthesizing large numbers of peptides on solid supports, the peptides corresponding to portions of the protein molecule, and reacting the peptides with antibodies while the peptides are still attached to the supports. Such techniques are known in the art and described in, e.g., U.S. Patent No.
- Antigenic regions of proteins can also be identified using standard antigenicity and hydropathy plots, such as those calculated using, e.g., the Omiga version 1 .0 software program available from the Oxford Molecular Group.
- This computer program employs the Hopp/Woods method, Hopp et al, (1981 ) Proc. Natl. Acad. Sci USA 78:3824-3828; for determining antigenicity profiles, and the Kyte- Doolittle technique, Kyte et al, (1982) J.Mol. Biol. 157: 105-132; for hydropathy plots.
- paratope refers to the general structure of a binding region that determines binding to an epitope. This structure influences whether or not and in what manner the binding region might bind to an epitope.
- Paratope can refer to an antigenic site of an antibody that is responsible for an antibody or fragment thereof, to bind to an antigenic determinant.
- Paratope also refers to the idiotope of the antibody, and the complementary determining region (CDR) region that binds to the epitope.
- CDR complementary determining region
- the paratope is the region of the antibody that binds to the conformational epitope comprising (i) HER3 amino acid residues 265-277 and 315 (of domain 2), and (ii) HER3amino acid residues 571 , 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1 , or a subset thereof.
- the paratope is the region of the antibody that comprises the CDR sequences.
- the paratope comprises at least one amino acid residue that binds with HER3 residues:
- the paratope comprises at least one amino acid residue that binds with HER3 residues: Tyr265, Lys267, Leu268, Phe270, Gly582, Pro583, Lys597, Ile600, Lys602, Glu609, Arg61 1 , Pro612, Cys613, His614, Glu615.
- monoclonal antibody or “monoclonal antibody composition” as used herein refers to polypeptides, including antibodies, antibody fragments, bispecific antibodies, etc. that have substantially identical to amino acid sequence or are derived from the same genetic source. This term also includes preparations of antibody molecules of single molecular composition. A monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
- human antibody as used herein, includes antibodies having variable regions in which both the framework and CDR regions are derived from sequences of human origin.
- the constant region also is derived from such human sequences, e.g., human germline sequences, or mutated versions of human germline sequences or antibody containing consensus framework sequences derived from human framework sequences analysis, for example, as described in Knappik et al., (2000) J Mol Biol 296:57-86).
- the structures and locations of immunoglobulin variable domains, e.g., CDRs may be defined using well known numbering schemes, e.g., the Kabat numbering scheme, the Chothia numbering scheme, or a combination of Kabat and Chothia (see, e.g., Sequences of Proteins of
- the human antibodies of the invention may include amino acid residues not encoded by human sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo, or a conservative substitution to promote stability or manufacturing).
- human monoclonal antibody refers to antibodies displaying a single binding specificity which have variable regions in which both the framework and CDR regions are derived from human sequences.
- the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic nonhuman animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an
- phrase "recombinant human antibody”, as used herein, includes all human antibodies that are prepared, expressed, created or isolated by
- recombinant means such as antibodies isolated from an animal (e.g., a mouse) that is transgenic or transchromosomal for human immunoglobulin genes or a hybridoma prepared therefrom, antibodies isolated from a host cell transformed to express the human antibody, e.g., from a transfectoma, antibodies isolated from a recombinant, combinatorial human antibody library, and antibodies prepared, expressed, created or isolated by any other means that involve splicing of all or a portion of a human immunoglobulin gene, sequences to other DNA sequences.
- Such recombinant human antibodies have variable regions in which the framework and CDR regions are derived from human germline
- immunoglobulin sequences In certain embodiments, however, such recombinant human antibodies can be subjected to in vitro mutagenesis (or, when an animal transgenic for human Ig sequences is used, in vivo somatic mutagenesis) and thus the amino acid sequences of the V H and V L regions of the recombinant antibodies are sequences that, while derived from and related to human germline V H and V L sequences, may not naturally exist within the human antibody germline repertoire in vivo.
- Specific binding between two entities means a binding with an equilibrium constant (KA) (k on /koff) of at least 10 2 M J , at least 5xl0 2 M “1 , at least 10 3 M “1 , at least 5xl0 3 M “1 , at least 10 4 M “ at least 5xl0 4 M “1 , at least 10 5 M “1 , at least 5xl0 5 M “1 , at least 10 6 M “1 , at least 5xl0 6 M “1 , at least 10 7 M “1 , at least 5xl0 7 M “1 , at least 10 8 M “1 , at least 5xl0 8 M “1 , at least 10 9 M “1 , at least 5xl0 9 M “1 , at least 10 10 M “1 , at least 5xl0 10 M “1 , at least 10 n M “1 , at least 5xlO n M “1 , at least 10 12 M “1 , at least 5xl0 12 M "
- an antibody e.g., a HER3 binding antibody
- a binding reaction that is determinative of the presence of a cognate antigen (e.g., a human HER3) in a heterogeneous population of proteins and other biologies.
- an HER3 binding antibody of the invention typically also has a dissociation rate constant (KD) (k 0 ff/k on ) of less than 5x10 "2 M, less than 10 "2 M, less than 5x10 "3 M, less than 10 "3 M, less than 5x10 "4 M, less than ⁇ ⁇ , less than 5x10 "5 M, less than 10 "5 M, less than 5x10 "6 M, less than 10 "6 M, less than 5x10 "7 M, less than 10 "7 M, less than 5x10 "8 M, less than 10 "8 M, less than 5x10 "9 M, less than 10 "9 M, less than 5x10 "10 M, less than 10 "10 M, less than 10 "10 M, less than 5x10 "11 M, less than 10 "11 M, less than 5x10 "12 M, less than 10 "12 M, less than 5x10 "13 M, less than 10 "13 M, less than 5x10 "14 M, less than 10 "14 M
- the antibody or fragment thereof has dissociation constant (Ka) of less than 3000 pM, less than 2500 pM, less than 2000 pM, less than 1500 pM, less than 1000 pM, less than 750 pM, less than 500 pM, less than 250 pM, less than 200 pM, less than 150 pM, less than 100 pM, less than 75 pM, less than 10 pM, less than 1 pM as assessed using a method described herein or known to one of skill in the art (e.g., a BIAcore assay, ELISA, FACS, SET) (Biacore International AB, Uppsala, Sweden).
- Ka dissociation constant
- K a ssoc or "K a ", as used herein, refers to the association rate of a particular antibody-antigen interaction
- KiV or "K d ,” as used herein, refers to the dissociation rate of a particular antibody- antigen interaction
- KD refers to the dissociation constant, which is obtained from the ratio of Kj to K a (i.e. Kj/K a ) and is expressed as a molar concentration (M).
- KD values for antibodies can be determined using methods well established in the art. A method for determining the KD of an antibody is by using surface plasmon resonance, or using a biosensor system such as a Biacore ® system.
- the term "affinity” as used herein refers to the strength of interaction between antibody and antigen at single antigenic sites. Within each antigenic site, the variable region of the antibody “arm” interacts through weak non- covalent forces with antigen at numerous sites; the more interactions, the stronger the affinity.
- the term “avidity” as used herein refers to an informative measure of the overall stability or strength of the antibody-antigen complex. It is controlled by three major factors: antibody epitope affinity; the valence of both the antigen and antibody; and the structural arrangement of the interacting parts. Ultimately these factors define the specificity of the antibody, that is, the likelihood that the particular antibody is binding to a precise antigen epitope.
- valency refers to the number of potential target binding sites in a polypeptide. Each target binding site specifically binds one target molecule or specific site (i.e, epitope) on a target molecule. When a polypeptide comprises more than one target binding site, each target binding site may specifically bind the same or different molecules (e.g., may bind to different molecules, e.g., different antigens, or different epitopes on the same molecule).
- antigen antibody refers to an antibody that binds with HER3 and neutralizes the biological activity of HER3 signaling, e.g., reduces, decreases and/or inhibits HER3 induced signaling activity, e.g., in a phospho- HER3 or phospho-Akt assay. Accordingly, an antibody that "inhibits" one or more of these HER3 functional properties (e.g., biochemical,
- an antibody that inhibits HER3 activity effects such a statistically significant decrease by at least 10% of the measured parameter, by at least 50%>, 80%> or 90%>, and in certain embodiments an antibody of the invention may inhibit greater than 95%, 98% or 99% of HER3 functional activity as evidenced by a reduction in the level of cellular HER3 phosphorylation.
- isolated antibody refers to an antibody that is substantially free of other antibodies having different antigenic specificities (e.g. , an isolated antibody that specifically binds HER3 is substantially free of antibodies that specifically bind antigens other than HER3).
- An isolated antibody that specifically binds HER3 may, however, have cross- reactivity to other antigens.
- an isolated antibody may be substantially free of other cellular material and/or chemicals.
- nucleic acid sequences refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences.
- conservatively modified variants refers to those nucleic acids which encode identical or essentially identical amino acid sequences, or where the nucleic acid does not encode an amino acid sequence, to essentially identical sequences.
- the codons GCA, GCC, GCG and GCU all encode the amino acid alanine.
- the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
- nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a polypeptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid except AUG, which is ordinarily the only codon for methionine, and TGG, which is ordinarily the only codon for tryptophan
- TGG which is ordinarily the only codon for tryptophan
- conservatively modified variants include individual substitutions, deletions or additions to a polypeptide sequence which result in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.
- the following eight groups contain amino acids that are conservative substitutions for one another: 1 ) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins (1984)).
- the term "conservative sequence modifications” are used to refer to amino acid modifications that do not significantly affect or alter the binding characteristics of the antibody containing the amino acid sequence.
- the ability or extent to which an antibody or other binding agent is able to interfere with the binding of another antibody or binding molecule to HER3 , and therefore whether it can be said to cross-compete according to the invention, can be determined using standard competition binding assays.
- One suitable assay involves the use of the Biacore technology ⁇ e.g. by using the BIAcore 3000 instrument (Biacore, Uppsala, Sweden)), which can measure the extent of interactions using surface plasmon resonance technology.
- Another assay for measuring cross-competing uses an ELISA-based approach.
- the term "optimized” as used herein refers to a nucleotide sequence has been altered to encode an amino acid sequence using codons that are preferred in the production cell or organism, generally a eukaryotic cell, for example, a cell of Pichia, a cell of Trichoderma, a Chinese Hamster Ovary cell (CHO) or a human cell.
- the optimized nucleotide sequence is engineered to retain completely or as much as possible the amino acid sequence originally encoded by the starting nucleotide sequence, which is also known as the
- Standard assays to evaluate the binding ability of the antibodies toward HER3 of various species are known in the art, including for example, ELISAs, western blots and RIAs. Suitable assays are described in detail in the Examples.
- the binding kinetics (e.g., binding affinity) of the antibodies also can be assessed by standard assays known in the art, such as by Biacore analysis, or FACS relative affinity (Scatchard).
- Assays to evaluate the effects of the antibodies on functional properties of HER3 e.g., receptor binding assays, modulating the Her pathway
- percent identical in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same.
- Two sequences are “substantially identical” if two sequences have a specified percentage of amino acid residues or nucleotides that are the same ⁇ i.e., 60% identity, optionally 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% identity over a specified region, or, when not specified, over the entire sequence), when compared and aligned for maximum correspondence over a comparison window, or designated region as measured using one of the following sequence comparison algorithms or by manual alignment and visual inspection.
- the identity exists over a region that is at least about 50 nucleotides (or 10 amino acids) in length, or more preferably over a region that is 100 to 500 or 1000 or more nucleotides (or 20, 50, 200 or more amino acids) in length.
- sequence comparison typically one sequence acts as a reference sequence, to which test sequences are compared.
- test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters can be used, or alternative parameters can be designated.
- sequence comparison algorithm then calculates the percent sequence identities for the test sequences relative to the reference sequence, based on the program parameters.
- a “comparison window”, as used herein, includes reference to a segment of any one of the number of contiguous positions selected from the group consisting of from 20 to 600, usually about 50 to about 200, more usually about 100 to about 150 in which a sequence may be compared to a reference sequence of the same number of contiguous positions after the two sequences are optimally aligned.
- Methods of alignment of sequences for comparison are well known in the art.
- Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith and Waterman, (1970) Adv. Appl. Math. 2:482c, by the homology alignment algorithm of Needleman and Wunsch, (1970) J. Mol. Biol. 48:443, by the search for similarity method of Pearson and Lipman, (1988) Proc. Nat'l. Acad. Sci. USA 85:2444, by
- HSPs high scoring sequence pairs
- Cumulative scores are calculated using, for nucleotide sequences, the parameters M (reward score for a pair of matching residues; always > 0) and N (penalty score for mismatching residues; always ⁇ 0).
- M forward score for a pair of matching residues; always > 0
- N penalty score for mismatching residues; always ⁇ 0.
- a scoring matrix is used to calculate the cumulative score. Extension of the word hits in each direction are halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative- scoring residue alignments; or the end of either sequence is reached.
- the BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment.
- W wordlength
- E expectation
- the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, (1993) Proc. Natl. Acad. Sci. USA 90:5873-5787).
- One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance.
- P(N) the smallest sum probability
- a nucleic acid is considered similar to a reference sequence if the smallest sum probability in a comparison of the test nucleic acid to the reference nucleic acid is less than about 0.2, more preferably less than about 0.01 , and most preferably less than about 0.001 .
- the percent identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller, (1988) Comput. Appl. Biosci. 4: 1 1 -17) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
- the percent identity between two amino acid sequences can be determined using the Needleman and Wunsch (1970) J. Mol. Biol.
- PAM250 matrix and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6.
- a polypeptide encoded by the first nucleic acid is immunologically cross reactive with the antibodies raised against the polypeptide encoded by the second nucleic acid, as described below.
- a polypeptide is typically substantially identical to a second polypeptide, for example, where the two peptides differ only by conservative substitutions.
- nucleic acid sequences are substantially identical is that the two molecules or their complements hybridize to each other under stringent conditions, as described below. Yet another indication that two nucleic acid sequences are substantially identical is that the same primers can be used to amplify the sequence.
- nucleic acid is used herein interchangeably with the term “polynucleotide” and refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form.
- nucleic acids containing known nucleotide analogs or modified backbone residues or linkages which are synthetic, naturally occurring, and non- naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized in a manner similar to the reference nucleotides.
- analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-0- methyl ribonucleotides, peptide-nucleic acids (PNAs).
- nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. , degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated.
- degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., (1991 ) Nucleic Acid Res. 19:5081 ; Ohtsuka et al., (1985) J. Biol. Chem. 260:2605-2608; and Rossolini et al., (1994) Mol. Cell. Probes 8:91 -98).
- operably linked refers to a functional relationship between two or more polynucleotide (e.g., DNA) segments. Typically, it refers to the functional relationship of a transcriptional regulatory sequence to a transcribed sequence.
- a promoter or enhancer sequence is operably linked to a coding sequence if it stimulates or modulates the transcription of the coding sequence in an appropriate host cell or other expression system.
- promoter transcriptional regulatory sequences that are operably linked to a transcribed sequence are physically contiguous to the transcribed sequence, i.e., they are cis- acting.
- some transcriptional regulatory sequences, such as enhancers need not be physically contiguous or located in close proximity to the coding sequences whose transcription they enhance.
- polypeptide and "protein” are used interchangeably herein to refer to a polymer of amino acid residues.
- the terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer. Unless otherwise indicated, a particular polypeptide sequence also implicitly encompasses conservatively modified variants thereof.
- signal transduction or “signaling activity” as used herein refers to a biochemical causal relationship generally initiated by a protein-protein interaction such as binding of a growth factor to a receptor, resulting in
- the transmission involves specific phosphorylation of one or more tyrosine, serine, or threonine residues on one or more proteins in the series of reactions causing signal transduction.
- Penultimate processes typically include nuclear events, resulting in a change in gene expression.
- subject includes human and non-human animals.
- Non-human animals include all vertebrates, e.g., mammals and non-mammals, such as non-human primates, sheep, dog, cow, chickens, amphibians, and reptiles. Except when noted, the terms “patient” or “subject” are used herein
- anti-cancer agent means any agent that can be used to treat a cell proliferative disorder such as cancer, including cytotoxic agents,
- chemotherapeutic agents refers to neoplastic cell growth and proliferation, whether malignant or benign, and all pre-cancerous and cancerous cells and tissues.
- anti-tumor activity means a reduction in the rate of tumor cell proliferation, viability, or metastatic activity.
- a possible way of showing anti-tumor activity is show a decline in growth rate of abnormal cells that arises during therapy or tumor size stability or reduction.
- Such activity can be assessed using accepted in vitro or in vivo tumor models, including but not limited to xenograft models, allograft models, MMTV models, and other known models known in the art to investigate anti-tumor activity.
- malignancy refers to a non-benign tumor or a cancer.
- cancer includes a malignancy characterized by deregulated or uncontrolled cell growth.
- cancer includes primary malignant tumors (e.g., those whose cells have not migrated to sites in the subject's body other than the site of the original tumor) and secondary malignant tumors (e.g., those arising from metastasis, the migration of tumor cells to secondary sites that are different from the site of the original tumor).
- Treating means an alleviation of symptoms associated with a disorder or disease, or halt of further progression or worsening of those symptoms, or prevention or prophylaxis of the disease or disorder.
- successful treatment may include an alleviation of symptoms related to low grade serous ovarian cancer or a halting in the progression of a disease such as low grade serous ovarian cancer.
- Low grade serous ovarian tumors within the context of the present invention are characterized based in a number of criteria, for example low grade serous tumors have low to no chromosomal instability, typically have mutated KRAS, BRAF and HER2 genes, demonstrate slow tumor development, typically have cell nuclei that are uniform, small and round and generally have low mitotic index.
- the methods of the invention are directed to administering an antibody or fragment thereof that specifically binds to HER3 for the treatment of low-grade serous ovarian cancer.
- the antibody or fragment thereof blocks both ligand-dependent and ligand- independent signal transduction.
- the antibodies bind to HER3 and do not block ErbB ligand binding to the ligand binding site (i.e. both ligand and antibody can bind HER3 concurrently).
- the antibody or fragment thereof in accordance with the present invention binds to a conformational epitope comprising amino acid residues within domain 2 and domain 4 of HER3.
- the antibody or fragment thereof binds to an epitope comprising amino acid residues 208-328 within domain 2 of HER3. In yet other embodiments, the antibody or fragment thereof recognizes a non-linear epitope of HER3 comprising amino acid residues within domain 3 of HER3 and binds to at least one amino acid residue selected from binding surface B.
- HER3 antibodies are known in the art.
- the VH of the antibody or fragment thereof binds to at least one of the following HER3 residues: Asn266, Lys267, Leu268, Thr269, Gln271 , Glu273, Pro274, Asn275, Pro276, His277, Asn315, Asp571 , Pro583, His584, Ala596, Lys597.
- the VL of the antibody or fragment thereof binds to at least one of the following HER3 residues: Tyr265, Lys267, Leu268, Phe270, Gly582, Pro583, Lys597, Ile600, Lys602, Glu609, Arg61 1 , Pro612, Cys613, His614, Glu615.
- the antibody or fragment thereof binds to human HER3 protein having a conformational epitope comprising (i) HER3 amino acid residues 265-277 and 315 (of domain 2) and (ii) HER3 amino acid residues 571 , 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1 , or a subset thereof.
- the antibody or fragment thereof binds to amino acids within or overlapping amino acid residues 265-277 and 315 (of domain 2) and (ii) HER3 amino acid residues 571 , 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1.
- the antibody or fragment thereof binds to amino acids within (and/or amino acid sequences consisting of) amino acids 265-277 and 315 (of domain 2) and (ii) HER3 amino acid residues 571 , 582-584, 596-597, 600-602, 609-615 (of domain 4) of SEQ ID NO: 1 , or a subset thereof.
- the antibody or fragment thereof binds to the conformational epitope such that it restricts the mobility of domain 2 and domain 4, stabilizing it in an inactive or closed conformation. The failure to form the active conformation results in failure to activate signal transduction.
- the antibody or fragment thereof binds to the conformational epitope such that it occludes the dimerization loop within domain 2, thereby rendering it unavailable for receptor-receptor interaction.
- the failure to form homo- or heterodimers results in failure to activate signal transduction.
- the present invention can utilize HER3 antibodies that recognize a conformational epitope of HER3 such that they block both ligand-dependent and ligand- independent HER3 signal transduction pathways. Such a class of antibodies are disclosed in Table 1.
- the isolated antibody or fragment thereof can be a monoclonal antibody, a polyclonal antibody, a chimeric antibody, a humanized antibody, and a synthetic antibody.
- the isolated antibody or fragment thereof can bind to the same conformational epitope as an antibody described in Table 1.
- Table 1 Examples of HER3 Antibodies useful in the methods of the present Invention
- SEQ ID NO: 16 DNA VL GATATCCAGATGACCCAGAGCCCGTCTAGCCTGAGCGCGA
- SEQ ID NO: 17 DNA VH CAGGTGCAATTGGTGGAAAGCGGCGGCGGCCTGGTGCAAC
- SEQIDNO: 34 DNAVL GATATCCAGATGACCCAGAGCCCGTCTAGCCTGAGCGCGA
- SEQ ID NO: 52 DNA VL GATATCCAGATGACCCAGAGCCCGTCTAGCCTGAGCGCGA
- SEQ ID NO: 53 DNA VH CAGGTGCAATTGGTGGAAAGCGGCGGCGGCCTGGTGCAAC
- SEQIDNO 70 DNAVL GATATCCAGATGACCCAGAGCCCGTCTAGCCTGAGCGCGA
- SEQ ID NO: 160 DNA VL GATATCCAGATGACCCAGAGCCCCAGCAGCCTGAGCGCCA
- SEQ ID NO: 161 DNA VH GAGGTGCAATTGCTGGAAAGCGGCGGAGGCCTGGTGCAGC
- SEQ ID NO: 215 DNA VH GAGGTGCAATTGCTGGAAAGCGGCGGAGGCCTGGTGCAGC
- SEQ ID NO: 250 DNA VL GATATCCAGATGACCCAGAGCCCCAGCAGCCTGAGCGCCA
- SEQ ID NO: 251 DNA VH GAGGTGCAATTGCTGGAAAGCGGCGGAGGCCTGGTGCAGC
- SEQ ID NO: 268 DNA VL GATATCCAGATGACCCAGAGCCCCAGCAGCCTGAGCGCCA
- SEQ ID NO: 269 DNA VH GAGGTGCAATTGCTGGAAAGCGGCGGAGGCCTGGTGCAGC
- SEQ ID NO: 286 DNA VL GATATCCAGATGACCCAGAGCCCCAGCAGCCTGAGCGCCA
- SEQ ID NO: 304 DNA VL GATATCCAGATGACCCAGAGCCCCAGCAGCCTGAGCGCCA
- SEQ ID NO: 322 DNA VL GATATCCAGATGACCCAGAGCCCCAGCAGCCTGAGCGCCA
- SEQ ID NO: 358 DNA VL GATATCCAGATGACCCAGAGCCCGTCTAGCCTGAGCGCGA
- SEQ ID NO: 359 DNA VH CAGGTGCAATTGGTGGAAAGCGGCGGCGGCCTGGTGCAAC
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Biomedical Technology (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Microbiology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Immunology (AREA)
- Oncology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Epidemiology (AREA)
- Endocrinology (AREA)
- Mycology (AREA)
- Reproductive Health (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2017502620A JP6755235B2 (ja) | 2014-07-16 | 2015-07-15 | 低悪性度漿液性癌におけるher3阻害 |
| ES15747648T ES2729202T3 (es) | 2014-07-16 | 2015-07-15 | Inhibición de HER3 en cánceres ováricos serosos de grado bajo |
| CN201580046809.0A CN107257691B (zh) | 2014-07-16 | 2015-07-15 | 低级别浆液性卵巢癌中的her3抑制 |
| US15/325,336 US20170291956A1 (en) | 2014-07-16 | 2015-07-15 | HER3 Inhibition in Low-grade Serous Ovarian Cancers |
| EP15747648.2A EP3169708B1 (en) | 2014-07-16 | 2015-07-15 | Her3 inhibition in low-grade serous ovarian cancers |
| EP19155820.4A EP3539990B1 (en) | 2014-07-16 | 2015-07-15 | Her3 inhibition in low-grade serous cancers |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462025321P | 2014-07-16 | 2014-07-16 | |
| US62/025,321 | 2014-07-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016011167A1 true WO2016011167A1 (en) | 2016-01-21 |
Family
ID=53783951
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/040597 Ceased WO2016011167A1 (en) | 2014-07-16 | 2015-07-15 | Her3 inhibition in low-grade serous ovarian cancers |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20170291956A1 (https=) |
| EP (2) | EP3169708B1 (https=) |
| JP (2) | JP6755235B2 (https=) |
| CN (1) | CN107257691B (https=) |
| ES (1) | ES2729202T3 (https=) |
| WO (1) | WO2016011167A1 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10689459B2 (en) | 2014-12-12 | 2020-06-23 | Novartis Ag | Treatment of breast cancer brain metastases |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2016011167A1 (en) * | 2014-07-16 | 2016-01-21 | Dana-Farber Cancer Institute, Inc., Et Al | Her3 inhibition in low-grade serous ovarian cancers |
| WO2019185164A1 (en) | 2018-03-29 | 2019-10-03 | Hummingbird Bioscience Holdings Pte. Ltd. | Her3 antigen-binding molecules |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013003037A2 (en) * | 2011-06-30 | 2013-01-03 | Merrimack Pharmaceuticals, Inc. | Dosage and administration of anti-erbb3 antibodies in combination with paclitaxel for treatment of gynecological cancers |
Family Cites Families (48)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ATE37983T1 (de) | 1982-04-22 | 1988-11-15 | Ici Plc | Mittel mit verzoegerter freigabe. |
| US4522811A (en) | 1982-07-08 | 1985-06-11 | Syntex (U.S.A.) Inc. | Serial injection of muramyldipeptides and liposomes enhances the anti-infective activity of muramyldipeptides |
| US4708871A (en) | 1983-03-08 | 1987-11-24 | Commonwealth Serum Laboratories Commission | Antigenically active amino acid sequences |
| US5128326A (en) | 1984-12-06 | 1992-07-07 | Biomatrix, Inc. | Drug delivery systems based on hyaluronans derivatives thereof and their salts and methods of producing same |
| US5374548A (en) | 1986-05-02 | 1994-12-20 | Genentech, Inc. | Methods and compositions for the attachment of proteins to liposomes using a glycophospholipid anchor |
| MX9203291A (es) | 1985-06-26 | 1992-08-01 | Liposome Co Inc | Metodo para acoplamiento de liposomas. |
| US4880078A (en) | 1987-06-29 | 1989-11-14 | Honda Giken Kogyo Kabushiki Kaisha | Exhaust muffler |
| US5108921A (en) | 1989-04-03 | 1992-04-28 | Purdue Research Foundation | Method for enhanced transmembrane transport of exogenous molecules |
| WO1991005548A1 (en) | 1989-10-10 | 1991-05-02 | Pitman-Moore, Inc. | Sustained release composition for macromolecular proteins |
| WO1991006287A1 (en) | 1989-11-06 | 1991-05-16 | Enzytech, Inc. | Protein microspheres and methods of using them |
| US5183884A (en) | 1989-12-01 | 1993-02-02 | United States Of America | Dna segment encoding a gene for a receptor related to the epidermal growth factor receptor |
| WO1992019244A2 (en) | 1991-05-01 | 1992-11-12 | Henry M. Jackson Foundation For The Advancement Of Military Medicine | A method for treating infectious respiratory diseases |
| US5912015A (en) | 1992-03-12 | 1999-06-15 | Alkermes Controlled Therapeutics, Inc. | Modulated release from biocompatible polymers |
| CA2103323A1 (en) | 1992-11-24 | 1994-05-25 | Gregory D. Plowman | Her4 human receptor tyrosine kinase |
| US5934272A (en) | 1993-01-29 | 1999-08-10 | Aradigm Corporation | Device and method of creating aerosolized mist of respiratory drug |
| US6132764A (en) | 1994-08-05 | 2000-10-17 | Targesome, Inc. | Targeted polymerized liposome diagnostic and treatment agents |
| EP0805678B1 (en) | 1995-01-05 | 2003-10-29 | THE BOARD OF REGENTS acting for and on behalf of THE UNIVERSITY OF MICHIGAN | Surface-modified nanoparticles and method of making and using same |
| US5641870A (en) | 1995-04-20 | 1997-06-24 | Genentech, Inc. | Low pH hydrophobic interaction chromatography for antibody purification |
| US6019968A (en) | 1995-04-14 | 2000-02-01 | Inhale Therapeutic Systems, Inc. | Dispersible antibody compositions and methods for their preparation and use |
| EP0850051A2 (en) | 1995-08-31 | 1998-07-01 | Alkermes Controlled Therapeutics, Inc. | Composition for sustained release of an agent |
| DK0885002T3 (da) | 1996-03-04 | 2011-08-22 | Penn State Res Found | Materialer og fremgangsmåder til forøgelse af cellulær internalisering |
| US5985309A (en) | 1996-05-24 | 1999-11-16 | Massachusetts Institute Of Technology | Preparation of particles for inhalation |
| US5874064A (en) | 1996-05-24 | 1999-02-23 | Massachusetts Institute Of Technology | Aerodynamically light particles for pulmonary drug delivery |
| US5855913A (en) | 1997-01-16 | 1999-01-05 | Massachusetts Instite Of Technology | Particles incorporating surfactants for pulmonary drug delivery |
| US6056973A (en) | 1996-10-11 | 2000-05-02 | Sequus Pharmaceuticals, Inc. | Therapeutic liposome composition and method of preparation |
| DE69732306T2 (de) | 1997-01-16 | 2006-01-12 | Massachusetts Institute Of Technology, Cambridge | Zubereitung von partikelhaltigen arzneimitteln zur inhalation |
| EP1958962A3 (en) | 1997-06-12 | 2013-05-01 | Novartis International Pharmaceutical Ltd. | Artificial antibody polypeptides |
| US5989463A (en) | 1997-09-24 | 1999-11-23 | Alkermes Controlled Therapeutics, Inc. | Methods for fabricating polymer-based controlled release devices |
| AU9805398A (en) | 1997-10-15 | 1999-05-03 | Children's Medical Center Corporation | Novel human egf receptors and use thereof |
| SE512663C2 (sv) | 1997-10-23 | 2000-04-17 | Biogram Ab | Inkapslingsförfarande för aktiv substans i en bionedbrytbar polymer |
| CA2336139C (en) | 1998-06-24 | 2008-10-14 | Advanced Inhalation Research, Inc. | Large porous particles emitted from an inhaler |
| CA2467633C (en) | 2001-12-03 | 2012-03-27 | Abgenix, Inc. | Antibody categorization based on binding characteristics |
| JP4547911B2 (ja) | 2002-02-01 | 2010-09-22 | アリアド・ファーマシューティカルズ・インコーポレイテッド | リン含有化合物およびその用途 |
| WO2004072266A2 (en) | 2003-02-13 | 2004-08-26 | Kalobios Inc. | Antibody affinity engineering by serial epitope-guided complementarity replacement |
| US7329638B2 (en) * | 2003-04-30 | 2008-02-12 | The Regents Of The University Of Michigan | Drug delivery compositions |
| US7399865B2 (en) | 2003-09-15 | 2008-07-15 | Wyeth | Protein tyrosine kinase enzyme inhibitors |
| GB0510390D0 (en) | 2005-05-20 | 2005-06-29 | Novartis Ag | Organic compounds |
| PE20070207A1 (es) * | 2005-07-22 | 2007-03-09 | Genentech Inc | Tratamiento combinado de los tumores que expresan el her |
| AU2008298948B2 (en) | 2007-09-12 | 2014-09-04 | F. Hoffmann-La Roche Ag | Combinations of phosphoinositide 3-kinase inhibitor compounds and chemotherapeutic agents, and methods of use |
| JP2010540459A (ja) * | 2007-09-24 | 2010-12-24 | トラガラ ファーマシューティカルズ,インク. | Cox‐2阻害薬及びegfr[erbb1]とher‐2[erbb2]の二重阻害薬を用いた癌を治療するための併用療法 |
| US8354528B2 (en) | 2007-10-25 | 2013-01-15 | Genentech, Inc. | Process for making thienopyrimidine compounds |
| NZ607337A (en) * | 2010-08-20 | 2015-06-26 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (her3) |
| AU2012349735B2 (en) | 2011-12-05 | 2016-05-19 | Novartis Ag | Antibodies for epidermal growth factor receptor 3 (HER3) |
| KR20140103135A (ko) | 2011-12-05 | 2014-08-25 | 노파르티스 아게 | Her3의 도메인 ii에 대해 지시된 표피 성장 인자 수용체 3 (her3)에 대한 항체 |
| EA201491120A1 (ru) | 2011-12-05 | 2015-07-30 | Новартис Аг | Антитела к рецептору эпидермального фактора роста 3 (her3), направленные на домен iii и домен iv her3 |
| DK2971064T3 (da) * | 2013-03-12 | 2019-12-16 | Ventana Med Syst Inc | Nærhedsassay til in situ-påvisning af mål |
| US20160038516A1 (en) * | 2013-03-15 | 2016-02-11 | Mone Zaidi Consulting, Inc. | Combination cancer therapy using bisphosphonates and anti-egfr agents |
| WO2016011167A1 (en) | 2014-07-16 | 2016-01-21 | Dana-Farber Cancer Institute, Inc., Et Al | Her3 inhibition in low-grade serous ovarian cancers |
-
2015
- 2015-07-15 WO PCT/US2015/040597 patent/WO2016011167A1/en not_active Ceased
- 2015-07-15 US US15/325,336 patent/US20170291956A1/en not_active Abandoned
- 2015-07-15 JP JP2017502620A patent/JP6755235B2/ja not_active Expired - Fee Related
- 2015-07-15 ES ES15747648T patent/ES2729202T3/es active Active
- 2015-07-15 CN CN201580046809.0A patent/CN107257691B/zh not_active Expired - Fee Related
- 2015-07-15 EP EP15747648.2A patent/EP3169708B1/en not_active Not-in-force
- 2015-07-15 EP EP19155820.4A patent/EP3539990B1/en not_active Not-in-force
-
2020
- 2020-08-24 JP JP2020140568A patent/JP7094329B2/ja not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013003037A2 (en) * | 2011-06-30 | 2013-01-03 | Merrimack Pharmaceuticals, Inc. | Dosage and administration of anti-erbb3 antibodies in combination with paclitaxel for treatment of gynecological cancers |
Non-Patent Citations (4)
| Title |
|---|
| DAVID M GERSHENSON: "The life and times of low-grade serous carcinoma of the ovary", AMERICAN SOCIETY OF CLINICAL ONCOLOGY EDUCATIONAL BOOK / ASCO. AMERICAN SOCIETY OF CLINICAL ONCOLOGY. MEETING, 1 January 2013 (2013-01-01), United States, XP055213325, Retrieved from the Internet <URL:http://www.ncbi.nlm.nih.gov/pubmed/23714500> * |
| JOHN FARLEY ET AL: "Selumetinib in women with recurrent low-grade serous carcinoma of the ovary or peritoneum: an open-label, single-arm, phase 2 study", THE LANCET ONCOLOGY, vol. 14, no. 2, 1 February 2013 (2013-02-01), pages 134 - 140, XP055213332, ISSN: 1470-2045, DOI: 10.1016/S1470-2045(12)70572-7 * |
| RACHEL N. GRISHAM ET AL: "Bevacizumab Shows Activity in Patients With Low-Grade Serous Ovarian and Primary Peritoneal Cancer", INTERNATIONAL JOURNAL OF GYNECOLOGICAL CANCER, vol. 24, no. 6, 1 July 2014 (2014-07-01), pages 1010 - 1014, XP055213199, ISSN: 1048-891X, DOI: 10.1097/IGC.0000000000000190 * |
| RUSSELL VANG ET AL: "Ovarian Low-grade and High-grade Serous Carcinoma", ADVANCES IN ANATOMIC PATHOLOGY, vol. 16, no. 5, 1 September 2009 (2009-09-01), pages 267 - 282, XP055213006, ISSN: 1072-4109, DOI: 10.1097/PAP.0b013e3181b4fffa * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10689459B2 (en) | 2014-12-12 | 2020-06-23 | Novartis Ag | Treatment of breast cancer brain metastases |
Also Published As
| Publication number | Publication date |
|---|---|
| EP3169708A1 (en) | 2017-05-24 |
| JP7094329B2 (ja) | 2022-07-01 |
| EP3169708B1 (en) | 2019-03-20 |
| JP2020193221A (ja) | 2020-12-03 |
| US20170291956A1 (en) | 2017-10-12 |
| ES2729202T3 (es) | 2019-10-30 |
| JP6755235B2 (ja) | 2020-09-16 |
| EP3539990B1 (en) | 2021-09-08 |
| CN107257691A (zh) | 2017-10-17 |
| EP3539990A1 (en) | 2019-09-18 |
| JP2017520609A (ja) | 2017-07-27 |
| CN107257691B (zh) | 2021-09-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2011290672B2 (en) | Antibodies for epidermal growth factor receptor 3 (HER3) | |
| KR102080535B1 (ko) | Her3에 특이적인 결합 분자 및 이의 용도 | |
| JP6967853B2 (ja) | ErbB−2およびErbB−3に結合する抗体 | |
| US20130251703A1 (en) | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain iii and domain iv of her3 | |
| EP2331577A2 (en) | Recombinant anti-epidermal growth factor receptor antibody compositions | |
| US20130273029A1 (en) | Antibodies for epidermal growth factor receptor 3 (her3) directed to domain ii of her3 | |
| WO2016040622A1 (en) | Uses of anti-her3 antibodies for treating cancer | |
| CN104093742A (zh) | 抗her3的结构域iii和结构域iv的表皮生长因子受体3(her3)抗体 | |
| JP7094329B2 (ja) | 低悪性度漿液性癌におけるher3阻害 | |
| JP2020515594A (ja) | Erbb−2、erbb−2/erbb−3陽性腫瘍を有する個体の処置のための、erb−2及びerbb−3の細胞外部分上のエピトープに結合する抗原結合部位を含むerbb−2標的化剤及び二重特異性抗体 | |
| WO2016092508A9 (en) | Treatment of breast cancer brain metastases | |
| HK1182118A (en) | Antibodies for epidermal growth factor receptor 3 (her3) | |
| HK1182118B (en) | Antibodies for epidermal growth factor receptor 3 (her3) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15747648 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15325336 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2017502620 Country of ref document: JP Kind code of ref document: A |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| REEP | Request for entry into the european phase |
Ref document number: 2015747648 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2015747648 Country of ref document: EP |