WO2016007355A1 - Anthelmintic probiotic compositions and methods - Google Patents
Anthelmintic probiotic compositions and methods Download PDFInfo
- Publication number
- WO2016007355A1 WO2016007355A1 PCT/US2015/038881 US2015038881W WO2016007355A1 WO 2016007355 A1 WO2016007355 A1 WO 2016007355A1 US 2015038881 W US2015038881 W US 2015038881W WO 2016007355 A1 WO2016007355 A1 WO 2016007355A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- crystal protein
- bacterium
- truncated
- seq
- protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
- A61K31/425—Thiazoles
- A61K31/429—Thiazoles condensed with heterocyclic ring systems
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/155—Amidines (), e.g. guanidine (H2N—C(=NH)—NH2), isourea (N=C(OH)—NH2), isothiourea (—N=C(SH)—NH2)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/33—Heterocyclic compounds
- A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
- A61K31/495—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
- A61K31/505—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
- A61K31/506—Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim not condensed and containing further heterocyclic rings
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/742—Spore-forming bacteria, e.g. Bacillus coagulans, Bacillus subtilis, clostridium or Lactobacillus sporogenes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K35/66—Microorganisms or materials therefrom
- A61K35/74—Bacteria
- A61K35/741—Probiotics
- A61K35/744—Lactic acid bacteria, e.g. enterococci, pediococci, lactococci, streptococci or leuconostocs
- A61K35/747—Lactobacilli, e.g. L. acidophilus or L. brevis
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- A61K38/164—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
- A61K45/06—Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/32—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Bacillus (G)
- C07K14/325—Bacillus thuringiensis crystal peptides, i.e. delta-endotoxins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K35/00—Medicinal preparations containing materials or reaction products thereof with undetermined constitution
- A61K2035/11—Medicinal preparations comprising living procariotic cells
Definitions
- the presently disclosed invention embodiments relate to delivery by probiotic bacteria of anthelmintic proteins to the lower gastrointestinal (GI) 20 tracts of mammals to treat, reduce the severity of, or reduce the likelihood of occurrence of infection by parasitic soil-transmitted helminthes (STHs).
- GI lower gastrointestinal
- STHs parasitic soil-transmitted helminthes
- compositions that comprise probiotic bacteria (e.g., Bacillus subtilis,
- Lactobacillus, Lactococcus, and/or others) and heterologous Bacillus thuringiensis pesticidal crystal (Cry) proteins including recombinantly engineered probiotic bacteria that are capable of expressing such heterologous Cry proteins and additionally or alternatively, mixtures of probiotic bacteria with heterologous purified B. thuringiensis Cry proteins, that effectively deliver 5 protein anthelmintics to the small and large intestines of mammals to protect against the acquisition, progression, and transmission of STH infections, including gastrointestinal (GI) nematode parasites known as hookworm, whipworm, Ascaris, and Strongyloides.
- GI gastrointestinal
- Soil-transmitted helminthes that parasitize the GI tract of humans infect 2.3 billion of the poorest peoples and 400,000,000 of the poorest children worldwide.
- STHs Soil-transmitted helminthes
- Infected children can exhibit growth stunting, retarded cognitive development, lethargy, malnutrition, increased school absenteeism, and 15 vulnerability to secondary infections.
- Pregnant women who are infected are at increased risk for low birth-weight babies and for maternal and infant mortality.
- Brooker et al., PLoS Negl Trop Dis 2, e291 (2008) Infected individuals have lower energy, lower productivity, and
- STHs thus trap large populations of the developing world in poverty.
- the common link of STH transmission is poor sanitation, which requires a massive
- benzimidazoles e.g., albendazole, mebendazole
- nAChR nicontinic acetylcholine receptor
- Crystal (Cry) proteins made by the soil bacterium Bacillus thuringiensis (Bt) may be candidate agents that provide safe and effective 15 treatment of STHs. Cry proteins have been in use for 60+ years as safe,
- transgenic food e.g., corn, potato.
- Cry5B and Cry21 A are highly potent anthelmintics in vivo.
- Cry5B is effective against three intestinal nematodes, Ancylostoma ceylanicum hookworms in hamsters, Heligmosomoides bakeri in mice, and Ascaris suum parasites in pigs, and is 3X - 60,0000X more potent than known chemical anthelmintics in a 5 single dose.
- Cry proteins Despite the established anthelmintic biological activity of Cry proteins, significant challenges remain with respect to effective delivery of intact, biologically active Cry proteins into the gastrointestinal (GI) tract for 15 treating STHs. These proteins typically have molecular weights of ⁇ 135 kDa in their protoxin (unprocessed) forms and ⁇ 70 kDa in their active (processed) forms, creating technical difficulties for delivery to the GI lumen via known routes of administration, including problems arising from degradation, poor absorption, clearance mechanisms and other impediments. Clearly there 20 remains a need for new approaches to delivering protein therapeutics such as anthelmintic proteins to the GI tract. The presently disclosed embodiments address this need by providing anthelmintic probiotic compositions and methods, and offer other related advantages. BRIEF SUMMARY
- Generally Recognized as Safe (GRAS) probiotic lactobacilli and/or bacillus strains may be used for delivery of crystal (Cry) proteins (such as one or more B. thuringiensis Cry proteins) to the mammalian GI tract. Delivery may be effected by administration to the GI tract of GRAS probiotic bacteria that have been artificially engineered to express one or more heterologous Cry protein(s) before, during, or after administration to the GI tract.
- Crystal (Cry) proteins such as one or more B. thuringiensis Cry proteins
- GRAS 5 probiotic bacteria that have not been genetically engineered, such as GRAS lactobacilli and/or bacillus, may be combined with purified crystal (Cry) proteins from a heterologous source to obtain a mixture that can be administered to the GI tract.
- GRAS lactobacilli and/or bacillus may be combined with purified crystal (Cry) proteins from a heterologous source to obtain a mixture that can be administered to the GI tract.
- a method of treating a parasitic worm or 10 helminth infection in a subject includes administering to the subject a therapeutically effective amount of a recombinant bacterium (Gram-positive or Gram-negative) that is capable of expressing a crystal (Cry) protein.
- a recombinant bacterium Gram-positive or Gram-negative
- methods of treating a parasitic worm or 15 helminth infection in a subject are described.
- the method includes
- a medicament comprising an amount of a crystal protein-producing genetically modified bacterium (Gram-positive or Gram- negative).
- compositions comprising a non-invasive20 or non-pathogenic bacterium are described.
- the non-invasive or non- pathogenic bacterium has a nucleic acid construct or vector having one or more constitutive promoters and coding sequences for the expression of one or more crystal proteins.
- a recombinant microorganism for 25 delivering a crystal protein in vivo is described.
- the recombinant microorganism for 25 delivering a crystal protein in vivo is described.
- microorganism includes a coding sequence of the crystal protein under the control of a suitable promoter sequence.
- a probiotic bacterium that is not recombinant is combined with a purified crystal protein and delivered in vivo.
- the crystal proteins may be full length, truncated, variants, or subvariants.
- the truncated crystal protein may include any truncation of the N- and C-termini that still retains toxin activity.
- the truncated form is not full-length but retains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or 5 more of the toxic activity of a corresponding full-length Bt toxin protein.
- the truncated portion may be truncated between the end of conserved block 5 and the C-terminus of the full length protein.
- the truncated crystal protein may contain the toxin domain of the crystal protein and optionally include up to 5, 10, or 20 10 additional amino acids.
- the truncated crystal protein may be truncated after a conserved amino acid sequence of block 5 and optionally include up to 5, 10, or 20 additional amino acids.
- the conserved amino acid sequence of block 5 may contain the motif DRIEF (SEQ ID NO: 23), DRLEF (SEQ ID NO: 24), or some other related sequence as well as surrounding amino acid residues, e.g., three 15 amino acids upstream and two amino acids downstream of this motif. Table 1 shows the block 5 sequences for various Cry proteins.
- the truncated crystal protein may not contain the first about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids at the N-terminus.
- "Variants” or“subvariants” of Cry proteins 25 include polypeptides with one or more substitutions, e.g., no more than 20
- substitutions alternatively no more than 10 substitutions, or substitutions at 10% or fewer of the residues, relative to a corresponding wild-type polypeptide or truncated version thereof.
- Cry protein variants that exhibit at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent amino acid sequence identity to a known Cry protein sequence such as any that are disclosed in Crickmore et al., 1998 Microbiology and Molecular Biology
- the truncated crystal protein may be a truncated form of Cry5B such as B. thuringiensis Cry5B (Fig. 2).
- Truncated Cry5B may extend from 5 about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 693.
- the truncated form of Cry5B may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C- terminus after conserved block 5, e.g., through about 698, 703, 713, 723, 733, or 743.
- the truncated crystal protein may be a truncated form of Cry13A such as B. thuringiensis Cry13A (Fig. 3).
- Truncated Cry13A may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 688.
- the truncated form of Cry13A may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C- 15 terminus after conserved block 5, e.g., through about 693, 698, 708, 718, 728, or 738.
- the truncated crystal protein may be a truncated form of B.
- Truncated Cry14A may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about 20 amino acid 675.
- the truncated form of Cry14A may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C-terminus after conserved block 5, e.g., through about 680, 685, 695, 705, 715, or 725.
- the truncated crystal protein may be a truncated form of Cry21 A such as B. thuringiensis Cry21 Aa1 (Fig. 5A) or Cry21 Aa2 (Fig. 5B).
- Truncated 25 Cry21 A may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 685.
- the truncated form of Cry21 A may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C-terminus after conserved block 5, e.g., through about 690, 695, 705, 715, 725, or 735.
- the bacterium may be a recombinant food- grade bacterium.
- the bacterium may in certain embodiments be a lactic acid fermenting bacterium, e.g., a member of the Lactococcus or Lactobacillus 5 species.
- the bacterium may be a strain of Bacillus subtilis.
- the bacterium may be Bacillus subtilis natto.
- the crystal proteins may in certain embodiments be delivered through in situ synthesis in the subject by the gram-positive bacterium, but the 10 present disclosure is not intended to be so limited and also contemplates, by way of non-limiting example, embodiments in which bacterial synthesis of a Cry protein may have occurred prior to administration of the composition which comprises at least one Cry protein and at least one non-toxic, non-invasive or non-pathogenic bacterium.
- the Cry protein may in certain embodiments be 15 present within the administered bacterium or exposed on the surface of the administered bacterium or present as a crystalline inclusion produced during stationary phase/sporulation and separate from the bacterium, and may in certain embodiments be secreted by the administered bacterium prior to, during, and/or following administration.
- the Cry protein may be synthesized prior to administration and recovered as an isolated protein or polypeptide, for example, as a spore-crystal lysate or in another form, such that the recovered Cry protein may be admixed with the bacterium prior to simultaneous administration of the Cry protein and the bacterium, or alternatively, such that 25 the Cry protein and the bacterium may be administered sequentially and in either order (i.e., Cry protein followed by bacterium or vice versa).
- “isolated” or“purified” may refer to the Cry protein being removed or otherwise physically separated from the intact cell in which it has been synthesized, as is the case for a Cry protein that is present in a spore-crystal 30 lysate as described herein and known in the art.
- the Cry protein is heterologous to the administered bacterium, which refers to any situation in which the Cry protein is not encoded by a polynucleotide sequence that is found naturally in the bacterium.
- the recombinant bacterium may also be administered with at 5 least one additional therapeutic agent.
- the at least one additional therapeutic agent may be a nicotinic acetylcholine receptor agonist. Nicotinic acetylcholine receptor agonists include, but are not limited to, levamisole (or members of the levamisole family), pyrantel, or tribendimidine.
- the parasitic worm or helminth infection may be caused by a 10 parasitic worm or helminth that includes but is not limited to Roundworm,
- the methods may be used to treat mammals including but not limited to humans. Other mammals that can be treated by the methods can be used to treat mammals including but not limited to humans. Other mammals that can be treated by the methods
- a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject comprising administering to the subject a therapeutically effective amount of a composition comprising a recombinant bacterium that has expressed or that is capable of expressing a crystal protein.
- the crystal protein is selected from the group consisting of Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
- the recombinant 25 bacterium is a Gram-positive bacterium and in certain other embodiments the recombinant bacterium is a Gram-negative bacterium.
- the recombinant bacterium is a recombinant food grade Gram-positive bacterium.
- the recombinant bacterium is a lactic acid fermenting bacterium, which in certain further embodiments is a Lactococcus or 30 Lactobacillus species, which in certain still further embodiments is Lactococcus lactis.
- the Lactobacillus species is selected from Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
- the recombinant bacterium is administered in combination with at least one additional therapeutic agent, 5 which in certain embodiments is a nicotinic acetylcholine receptor agonist.
- the at least one additional therapeutic agent is
- the nicotinic acetylcholine receptor 10 agonist is from the levamisole family of nicotinic acetylcholine receptor
- the nicotinic acetylcholine receptor agonist is levamisole.
- the levamisole is administered in an amount of about 0.1 mg/kg to about 5.0 mg/kg.
- the nicotinic acetylcholine receptor agonist is pyrantel or tribendimidine.
- the pyrantel is administered in an amount of about 1.0 mg/kg to about 15.0 mg/kg.
- the tribendimidine is administered in an amount of about 0.25 mg/kg to about 10 mg/kg.
- the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from 20 Roundworm, Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides,
- the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from hookworm Ancylostoma duodenale, hookworm Necator americanus, whipworm Trichuris trichiura, roundworm Ascaris lumbricoides, threadworm Strongyloides 25 stercoralis, and pinworm Enterobius vermiculari.
- the subject is a human being.
- the subject is a mammal selected from feline, rodent, canine, bovine, equine, swine, caprine, ovine, and primate.
- the crystal protein is delivered through in 30 situ synthesis in the subject by the bacterium. In certain embodiments the
- crystal protein is a truncated crystal protein. In certain embodiments the crystal protein is a variant crystal protein. In certain embodiments the truncated crystal protein is truncated after a conserved amino acid sequence of block 5. In certain embodiments the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is 5 truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24).
- the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain 10 embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus. In certain embodiments the truncated crystal protein is truncated at the C-terminus. In certain embodiments the crystal protein is Cry5B and the Cry5B includes at least amino acids 30 through about 15 693 of SEQ ID NO:1. In certain embodiments the crystal protein is Cry13A and the Cry13A includes at least amino acids 30 through about 688 of SEQ ID NO:2.
- the crystal protein is Cry14A and the Cry14A includes at least amino acids 30 through about 675 of SEQ ID NO:3. In certain embodiments at least one of (a) the crystal protein is Cry21 A and the Cry21 A 20 includes at least amino acids 30 through about 685 of SEQ ID NO:4, (b) the crystal protein is Cry21 A and the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or the crystal protein is Cry6A and the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID 25 NO:6.
- a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject comprising administering to the subject a composition that comprises (a) a therapeutically 30 effective amount of a first recombinant bacterium that has expressed or that is capable of expressing a first crystal protein; and (b) a therapeutically effective amount of a second recombinant bacterium that has expressed or that is capable of expressing a second crystal protein.
- the first and second recombinant bacteria are Gram-positive bacteria.
- the first and second recombinant bacteria are Gram-negative bacteria.
- the first and second recombinant bacteria are 5 administered simultaneously.
- the first and second recombinant bacteria are 5 administered simultaneously.
- the bacterium is a recombinant food grade Gram-positive bacterium.
- the bacterium is a lactic acid fermenting bacterium.
- the lactic acid fermenting bacterium is a Lactococcus or Lactobacillus species.
- the Lactoccocus species is Lactococcus lactis.
- the Lactobacillus 15 species is selected from Lactobacillus acidophilus, Lactobacillus gasseri,
- Lactobacillus johnsonii Lactobacillus reuteri.
- a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject comprising 20 administering to the subject a medicament comprising a therapeutically
- the crystal protein- producing genetically modified bacterium is a Gram-positive bacterium. In certain embodiments the crystal protein-producing genetically modified
- 25 bacterium is a Gram-negative bacterium.
- the crystal protein is selected from Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
- the bacterium is a recombinant food grade Gram-positive bacterium.
- the bacterium is a lactic acid fermenting bacterium.
- the lactic acid fermenting bacterium is a 30 Lactococcus or Lactobacillus species.
- the Lactoccocus species is Lactococcus lactis.
- the Lactobacillus species is Lactobacillus selected from Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
- the crystal protein-producing genetically modified bacterium is administered in combination with at least one additional therapeutic agent, which in a further embodiment is a nicotinic acetylcholine receptor agonist.
- the at least one additional therapeutic agent is a nicotinic acetylcholine receptor agonist.
- the at least one additional therapeutic agent is administered sequentially (and in either order) with the therapeutically effective amount of the 10 crystal protein-producing genetically modified bacterium.
- the nicotinic acetylcholine receptor agonist is from the levamisole family of nicotinic acetylcholine receptor agonists. In certain embodiments the nicotinic acetylcholine receptor agonist is levamisole. In certain embodiments the levamisole is administered in an amount of about 0.1 mg/kg to about 5.0 15 mg/kg. In certain embodiments the nicotinic acetylcholine receptor agonist is pyrantel or tribendimidine. In certain embodiments the pyrantel is administered in an amount of about 1.0 mg/kg to about 15.0 mg/kg. In certain embodiments the tribendimidine is administered in an amount of about 0.25 mg/kg to about 10 mg/kg.
- the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from Roundworm, Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides, Schistosome, and Trematodes.
- the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from 25 hookworm Ancylostoma duodenale, hookworm Necator americanus, whipworm Trichuris trichiura, roundworm Ascaris lumbricoides, threadworm Strongyloides stercoralis, and pinworm Enterobius vermiculari.
- the subject is a human being, and in certain embodiments the subject is a mammal selected from feline, rodent, canine, bovine, equine, swine, caprine, ovine, and 30 primate.
- the heterologous crystal protein is
- the crystal protein is a truncated crystal protein. In certain embodiments the crystal protein is a variant crystal protein. In certain embodiments the truncated crystal protein is truncated after a conserved amino acid sequence of block 5. In certain embodiments the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is 5 truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24).
- the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain 10 embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus. In certain embodiments the truncated crystal protein is truncated at the C-terminus.
- the crystal 15 protein is Cry5B and the Cry5B includes at least amino acids 1 through about 693 of SEQ ID NO:1. In certain other embodiments the crystal protein is Cry13A and the Cry13A includes at least amino acids 1 through about 688 of SEQ ID NO:2. In certain embodiments the crystal protein is Cry14A and the Cry14A includes at least amino acids 1 through about 675 of SEQ ID NO:3.
- compositions comprising a non-invasive or non-pathogenic bacterium having a nucleic acid construct or vector comprising one or more 30 constitutive promoters operably linked to coding sequences for expression of one or more heterologous crystal proteins.
- the one or more crystal proteins is selected from Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
- the one or more crystal proteins is a truncated crystal protein.
- the one or more crystal proteins is a variant crystal protein.
- the truncated crystal protein is truncated after a conserved amino acid sequence of block 5.
- the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24). In certain 10 embodiments the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus.
- the truncated crystal 15 protein is truncated at the C-terminus.
- the one or more crystal proteins is Cry5B and the Cry5B includes at least amino acids 1 through about 693 of SEQ ID NO:1.
- the one or more crystal proteins is Cry13A and the Cry13A includes at least amino acids 1 through about 688 of SEQ ID NO:2.
- the one or more crystal 20 proteins is Cry14A and the Cry14A includes at least amino acids 1 through about 675 of SEQ ID NO:3.
- the non- invasive or non-pathogenic bacterium is a lactic acid fermenting bacterium.
- the lactic acid fermenting bacterium is a Lactococcus or 30 Lactobacillus species, which in certain further embodiments is Lactococcus lactis.
- the Lactobacillus species is selected from Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
- a recombinant microorganism for delivering a crystal protein in vivo, wherein 5 said microorganism comprises a coding sequence of the crystal protein under the control of a suitable promoter sequence.
- the microorganism is a gram-positive bacterium.
- the microorganism is a Gram-negative bacterium.
- the bacterium is a food grade bacterium.
- the food grade 10 bacterium is a lactic acid fermenting bacterium.
- the lactic acid fermenting bacterium is Lactococcus or Lactobacillus.
- the Lactococcus is Lactococcus lactis.
- the Lactobacillus species is selected from Lactobacillus acidophilus,
- the crystal protein is selected from Cry5B, Cry21 A,
- the crystal protein is a truncated crystal protein. In certain embodiments the crystal protein is a variant crystal protein. In certain embodiments the truncated crystal protein is truncated after a conserved amino acid sequence of block 5. In certain
- the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24). In certain 25 embodiments the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus. In certain embodiments the truncated crystal 30 protein is truncated at the C-terminus. In certain embodiments the crystal
- the crystal protein is Cry5B and the Cry5B includes at least amino acids 30 through about 693 of SEQ ID NO:1.
- the crystal protein is Cry13A and the Cry13A includes at least amino acids 30 through about 688 of SEQ ID NO:2.
- the crystal protein is Cry14A and the Cry14A includes at least amino acids 30 through about 675 of SEQ ID NO:3.
- At least one of (a) the crystal protein is Cry21 A and the Cry21 A 5 includes at least amino acids 30 through about 685 of SEQ ID NO:4, (b) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or (c) the crystal protein is Cry6A and wherein the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ 10 ID NO:6.
- the bacterium is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, 15 Lactobacillus casei, and Lactococcus lactis.
- the bacterium is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, 15 Lactobacillus casei, and Lactococcus lactis.
- first and second recombinant bacteria are administered and each of the first and second recombinant bacterium is independently selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus 20 var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.
- composition as described herein which comprises a non-invasive or non-pathogenic bacterium wherein the non-invasive or non-pathogenic bacterium is selected from B. 25 subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi
- Toyocerin B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.
- a recombinant microorganism as described herein which is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. 30 Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus
- an artificial probiotic composition comprising (a) an isolated
- composition comprising (a) an isolated polypeptide that is selected from a
- the isolated polypeptide is heterologous to and admixed with the probiotic bacterium.
- a method of 30 treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a gastrointestinal tract of a mammalian subject, the method comprising administering to the gastrointestinal tract of the subject a therapeutically effective amount of an artificial probiotic composition comprising (a) an isolated polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent amino acid sequence identity to a Bacillus thuringiensis crystal protein that is selected from 5 Cry5B comprising the amino acid sequence set forth in SEQ ID NO:1 , Cry21 A comprising the amino acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5, Cry14A comprising the amino acid sequence set forth in SEQ ID NO:3, Cry13A comprising the amino acid sequence set forth in SEQ ID NO:
- the Bacillus subtilis is B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, 15 B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis
- the Lactobacillus is Lactobacillus rhamnosus or Lactobacillus casei
- the Lactococcus is Lactococcus lactis.
- the artificial probiotic composition comprises (a) an isolated polypeptide that is selected from a Bacillus thuringiensis Cry5B protein and a Bacillus thuringiensis Cry14A 20 protein; and (b) a non-invasive, non-pathogenic probiotic bacterium that is
- the probiotic bacterium being selected from Bacillus subtilis, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, and B.
- the isolated polypeptide is heterologous to the probiotic bacterium and is admixed with the probiotic bacterium prior to the step of administering.
- a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth 30 infection in a gastrointestinal tract of a mammalian subject the method
- an artificial probiotic composition comprising (a) an isolated Bacillus thuringiensis Cry5B protein; and (b) Bacillus subtilis natto probiotic bacteria, wherein the isolated Cry5B protein is heterologous to the probiotic bacteria and is admixed with the probiotic bacteria prior to the step of administering.
- the isolated Bacillus thuringiensis 5 Cry5B protein comprises a polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:1.
- FIG. 1 A illustrates the positions of
- Figure 1 B illustrates the positions of conserved blocks among certain Cry proteins.
- Figure 2 illustrates the amino acid sequence of Cry5Ba1 [SEQ ID NO:1 ].
- Figure 3 illustrates the amino acid sequence of Cry13Aa1 [SEQ 30 ID NO:2].
- Figure 4 illustrates the amino acid sequence of Cry14Aa1 [SEQ ID NO:3].
- FIG. 5A-5C illustrates the amino acid sequence of Cry21 Aa1 [SEQ ID NO:4].
- Fig. 5B illustrates the amino acid 5 sequence of Cry21 Aa2 (98% identical to Cry21 Aa1 ) [SEQ ID NO:5].
- Fig. 5C illustrates the amino acid sequence of Cry6A [SEQ ID NO:6].
- Figure 6 illustrates the design of an expression system for heterologous protein secretion in LAB (Lactic Acid Bacteria).
- Expression cassettes for heterologous protein CV-N for intracellular expression pTSV1 - 10 CVN
- secretion into the medium pTSV1 -CVN
- Figure 7 illustrates secretion of HIV-1 fusion inhibitors by
- Figure 8 shows an example of cloning the pag gene into the pgm promoter system.
- Figure 9 illustrates recombinant L. lactis MG1363 strains in which the thyA gene is replaced by the respective full-length or truncated cry gene, with or without a leader sequence, via double homologous recombination.
- FIGs. 10A-10B illustrate a cloning strategy with an inducible nisin promoter that uses a combination of vector-backbone exchange 20 (VBEx) and ligation independent cloning (LIC).
- VBEx vector-backbone exchange 20
- LIC ligation independent cloning
- Figure 11 depicts PY79-Cry5B bioactivity in vitro against C.
- Figure 12 shows that PY79-Cry5B had a dose- dependent therapeutic effect against hookworm infection in hamsters.
- A 30 Intestinal hookworm burdens in nine hamsters following treatment with PY79- vector or PY79-Cry5B (10 mg/kg Cry5B) (error bars in all panels show standard errors). The average worm burdens were 18.6+ 2.6 and 1.3+0.3 for PY79- vector and PY79-Cry5B, respectively.
- B Fecal egg counts on day-1 , day +1 , and day +3 relative to the day of treatment.
- the actual egg counts for PY79- 5 vector and PY79-Cry5B were 965 + 193 and 1 ,044 + 99, respectively, on day - 1 , 1 ,055 + 230 and 94 + 60, respectively, on day +1 , and 1 ,055 + 227 and 100 + 42, respectively, on day +3.
- EPG eggs per gram of feces.
- C In vivo dose- response experiment with 12 hamsters. The average worm burdens for PY79- vector and PY79-Cry5B at Cry5B concentrations of 0.4 mg/kg, 1.4 mg/kg, and 4 10 mg/kg were 27.0 + 3.2, 15.7 + 7.0, 8.3 + 0.9, and 5.7 + 0.9, respectively.
- Figure 13 shows results from an in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms as described by Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal.pntd.0001900).
- Figure 14 shows dose-response results for indicated dosages of unfractionated Cry5B-containing spore-crystal lysates (SCL) in the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms.
- the assay was performed according to Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900.
- Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase, at which point the cells lysed releasing spores, crystals, 5 and bacterial lysate (spore crystal lysate, SCL).
- gavaged were determined by taking known volumes of spore crystal lysates, resolving full length Cry5B protein by SDS PAGE, and quantitating the amount of protein in the Cry5B band relative to known amounts of bovine serum albumin (BSA) standards on the gel.
- BSA bovine serum albumin
- Figure 15 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/ journal. pntd.0001900) following treatment with two different dosages of Cry5B spore- crystal lysates obtained from cultured Bacillus thuringiensis natto cells that were 15 transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase.
- Figure 16 shows data obtained in vitro using the C. elegans mortality assay described in Figure 11 to evaluate the effects on C. elegans of purified Cry5B protein (prepared according to Griffitts et al., 2001 Science 20 293:860; for sequence see Fig. 2) when combined in a mixture either with
- Figure 17 shows the effects of Cry14A on an in vivo bioassay of 25 intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms.
- compositions and methods will thus find a wide variety of uses, such as for treating or reducing the severity or likelihood of occurrence of STH infections.
- anthelmintic 10 properties of bacterial Cry proteins effective therapeutic delivery of such
- orally administering the combination of a 15 bacterial Cry protein with a non-pathogenic, non-toxic, non-invasive bacterium such as a probiotic bacterium surprisingly provides delivery of effective anthelmintic activity to the lower GI tract, where STH parasites reside.
- Artificial probiotic microbes that are engineered to express heterologous Cry proteins are thus hereby contemplated for anthelmintic therapy according to certain 20 embodiments, which may include oral delivery of one or more of live
- unexpectedly 25 superior anthelmintic potency may be achieved by administering the
- certain herein disclosed embodiments relate to unexpectedly advantageous anthelmintic activity of orally administered artificial probiotic bacteria that have been engineered to express heterologous Cry proteins
- certain other herein disclosed embodiments relate to surprisingly potent anthelmintic effects that reside in a composition which comprises a mixture of certain unmodified probiotic bacteria (e.g., in preferred embodiments Bacillus subtilis natto or Bacillus subtilis PY79) with isolated heterologous Cry proteins (e.g., Cry5A, Cry14A, etc.).
- Bacillus subtilis e.g., Bacillus subtilis natto, Bacillus subtilis PY79, or other strains described herein and known in the art
- Lactobacillus are present in the human gastrointestinal tract at densities of up to 10 8 /gram (Wells and Mercenier, NAT REV MICROBIOL 6:349-362 (2008)).
- Bacillus subtilis has 10 been extensively characterized as a safely ingested food additive in humans (see Example 14, infra, references 15-27). Braat et al., (2006) CLIN
- Lactobacillus species are human commensal bacteria that naturally reside in the human mouth, intestine, and vagina.
- Bacillus subtilis and Lactobacillus are acid tolerant and bile resistant and therefore survive passage 20 through the stomach and remain viable in the small intestine, where the Cry protein can be expressed and secreted to the intestinal mucosa.
- production of a Bacillus subtilis or Lactobacillus or other probiotic bacterial strain capable of expression and secretion of Cry proteins in the small and large intestines will according to certain herein disclosed embodiments provide a 25 valuable delivery vehicle for Cry proteins.
- Lactobacilli or Bacillus subtilis are human commensal bacteria that naturally reside in the human mouth, intestine, and vagina.
- Bacillus subtilis and Lactobacillus are acid tolerant and bile resistant and therefore survive passage 20 through the stomach and remain viable in the small intestine, where the Cry protein can be expressed and secreted to the intestinal mucosa.
- 5 bacteria e.g., Bacillus subtilis
- Bacillus subtilis maybe combined with a Cry protein to achieve a surprisingly effective and synergistic anthelmintic effect.
- a probiotic microbe e.g., Lactobacillus or Bacillus subtilis (e.g., B. subtilis strain PY79 or Bacillus subtilis natto), which is known to survive gastric transit and which can act as a live oral delivery vector, may be used in certain 10 embodiments for delivery of Cry proteins in the GI tract. Cry proteins may be cloned, expressed, and ultimately secreted in active form in the GI tract of the subject after administration. Recombinant probiotic bacteria that can
- probiotic bacteria are generally safe; and 2) probiotic bacteria may be genetically modified to synthesize and secrete therapeutic proteins to the mammalian GI tract.
- Probiotic bacteria are particularly applicable to the control of STHs 25 because 1 ) probiotic bacteria can transiently (up to 3 weeks) pass through the small and large intestines, thereby secreting anthelmintics into the region where substantially all the STHs reside, 2) recombinant probiotic bacteria can cheaply express large amounts of Cry proteins prior to administration into the GI tract of a mammalian subject, and Cry proteins so expressed, independent of any Cry 30 proteins that may be secreted by probiotic bacteria in the GI tract, have been shown to have a significant impact on STHs, and 3) studies using purified Cry protein to treat hookworms, whipworms, and H. bakeri, all in infected rodents, demonstrated that STHs in the mammalian GI tract can ingest and be
- Probiotic bacterium for use in this invention include but are not limited to Lactococcus sp., Lactobacillus sp., Bifidobacterium sp.,
- Lactococcus sp. includes but is not limited to L. lactis. Lactobacillus sp. includes but is not limited to L. casei, L. paracasei, L.
- Bifidobacterium sp. includes but is not limited to B. animalis, B. bifidum, B. breve, B. infantis, and B. longum.
- Streptococcus sp. includes but is not limited to S. thermophilus.
- Bacillus sp. includes but is not limited to B. subtilis, B. subtilis natto, B. cereus, 15 B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, B. toyonensis, B.
- Escherichia sp. includes but is not limited to E. coli.
- Probiotic yeast for use in certain contemplated embodiments of this invention include but are not limited to Saccharomyces sp., e.g., Saccharomyces sp., e.g., Saccharomyces sp., e.g., Saccharomyces sp., e.g., Saccharomyces sp., e.g., Saccharomyces sp., e.g.,
- One goal according to certain herein disclosed embodiments is expression of anthelmintic Cry proteins (e.g., Crickmore et al., 1998
- helminth e.g., roundworm
- the Cry protein may be expressed intracellularly in the bacterium, allowing access to the anthelmintic protein after the bacterium lyses or opens up either due to digestion within the gastrointestinal tract, sporulation 5 of certain bacteria, death of bacteria, ingestion and digestion of bacteria by the parasitic helminths (e.g., roundworms such as hookworms, whipworms, Ascaris, Strongyloides, veterinary parasitic roundworms of the intestine), etc.
- the Cry protein may also be expressed and secreted extracellularly by the probiotic bacterium so that the protein would be deposited directly into the GI 10 tract where it could be accessed and ingested by any helminth (e.g.,
- the Cry proteins may also be expressed in such a way that they are exposed to the extracellular environment of the bacterium and remain anchored to the cell wall of the probiotic bacterium.
- a probiotic bacterium as provided herein 15 (which may in certain embodiments be LAB as described herein for certain
- probiotic bacteria such as Bacillus subtilis and others
- multiple 20 probiotic bacteria may be introduced, each of which expresses either a different individual Cry protein or simultaneously expresses multiple Cry proteins.
- the GI tract may be seeded with probiotic bacteria that express either one Cry protein or multiple Cry proteins at the same time. For example, due to the lack of cross-resistance 25 between Cry5B-resistant roundworms and Cry21 A-resistant roundworms,
- simultaneous expression of Cry5B and Cry21 A in the gastrointestinal tract may inhibit the development of parasite resistance to the combination therapy.
- a probiotic bacterium as provided herein (which may in certain embodiments be LAB as described herein for certain 30 illustrative purposes but which may in certain other embodiments be another probiotic bacterium such as Bacillus subtilis and others) which has not been genetically modified to express a heterologous Cry protein may be admixed and introduced into a mammalian GI tract along with purified Cry5B protein, e.g., heterologous Cry5B that has been expressed and purified from Bacillus
- composition so formed by such admixture exhibited heretofore unpredicted biological activity, in a manner such that the specific probiotic bacterium (e.g., Bacillus subtilis natto, Bacillus subtilis PY79) synergized with Cry5B protein to enhance its anthelmintic properties.
- the specific probiotic bacterium e.g., Bacillus subtilis natto, Bacillus subtilis PY79
- genetic selection markers from the plasmids that are employed to introduce heterologous Cry protein-encoding sequences, as well as using probiotic (e.g., lactobacillus or LAB) strains that are unable to replicate outside the vertebrate host, may be desirable in order to environmentally contain the genetically 15 modified bacteria.
- probiotic e.g., lactobacillus or LAB
- LAB bacteria have been engineered to be
- Cry-transformed probiotic bacteria such as Bacilli or LAB may be cultured and expression of intracellular, membrane-anchored, or secreted Cry protein by such bacteria may be confirmed using antibodies raised against each Cry protein and standard Western blotting or ELISA techniques.
- recombinant LAB- expressing Cry protein (full length, truncated, or variants) may be fed to the free-living nematode, C. elegans.
- Cry protein toxicity on C. elegans using LC50, brood-size, developmental inhibition assays on solid media and in liquid wells may then be quantitated.
- C. elegans can access the Cry proteins either 30 via protein secreted onto the solid media/into the liquid well or by their ability to grind, open and digest bacteria. Confirmation that the lactobacilli are making bioactive Cry proteins may be obtained.
- the bioactivity e.g., LC 50 in ⁇ g/mL
- the crystal proteins may be truncated to enhance their
- Bt toxins e.g., crystal proteins
- STHs protein size that STHs can ingest.
- Some parasitic roundworms poorly ingest proteins larger than about 40 kD.
- a truncated toxin may be easier to express in probiotic bacteria or yeast.
- Truncated toxin 20 may also express at a higher level in probiotic bacteria or yeast because
- truncated toxins are soluble and less likely to form insoluble inclusions in the cell expressing them, which could be toxic to the cell or which could make the toxin fold incorrectly. Accordingly, it is desirable to produce truncated Bt toxin fragments (e.g., crystal protein fragments). Moreover, fragments of certain Bt 25 toxins have been tested and shown to retain toxic activity and have improved biological properties.
- truncated when referring to a Bt toxin protein (crystal protein) is meant a Bt toxin protein that is not full-length but retains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the toxic activity of a corresponding full-length Bt toxin protein.
- “Variants” or“subvariants” of Cry proteins include polypeptides with one or more substitutions, e.g., no more than 20 substitutions, alternatively no more than 10 substitutions, or substitutions at 10% or fewer of the residues, relative to a corresponding wild-type polypeptide or truncated version thereof.
- the variant, subvariant, or truncated polypeptide has at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the activity, e.g., toxic activity, of the corresponding wild-type polypeptide or truncated version.
- Conservative substitutions include substitutions within the following groups: glycine, alanine, threonine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, 10 glutamine; serine, cysteine; lysine, arginine; aspartic acid, glutamic acid; serine, threonine; asparagine, glutamine; phenylalanine, tyrosine.
- Nucleic acid molecules encoding amino acid sequence variants, truncated versions, or both, of a Cry protein are prepared by a variety of methods known in the art. These methods include, but are not limited to, 15 isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by, for example, oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of protein.
- the invention includes synthetic nucleic acid molecules where nucleotides are 20 modified to include codons preferred in a particular organism, remove codons rarely used in a particular organism, or remove sequences that may inhibit transcription or RNA processing and the like.
- Cry protein truncations may at least include conserved blocks 1 -5.
- conserved blocks 1 -5 As seen in Figures 1 A and 1 B, alignment of known Cry toxins reveals five 25 conserved sequence blocks (blocks 1 -5) that are common to a majority of the proteins and are thought to be located in the active toxin domain. See de Maagd, R.A., et al. “How Bacillus thuringiensis has evolved specific toxins to colonize the insect world.” TRENDS IN GENETICS 17(4): 193-99 (April 2001 ). Comparison of the carboxy-terminal halves of the sequences have suggested 30 the presence of three additional blocks that lie outside of the active toxic core. See Schnepf, E., et al. “Bacillus thuringiensis and Its Pesticidal Crystal
- Cry protein truncations may be truncated after the conserved amino acid sequence of block 5 (e.g., DRIEF (SEQ ID NO: 23) or 5 DRLEF (SEQ ID NO: 24)).
- Cry protein truncations may be truncated after the conserved amino acid sequence of block 5 (e.g., DRIEF (SEQ ID NO: 23) or 5 DRLEF (SEQ ID NO: 24)).
- DRIEF SEQ ID NO: 23
- 5 DRLEF SEQ ID NO: 24
- DRIEF conserved amino acid sequence of block 5
- DRLEF conserved amino acid sequence of block 5
- an additional about 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids of the c-terminal domain e.g., DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24)
- a truncated form of Cry5B may include at least amino acids 50 through about 693.
- a truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 693.
- a truncated form of Cry5B may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
- a truncated form of Cry13A 20 may include at least amino acids 50 through about 688.
- a truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 688.
- a truncated form of Cry13A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
- a truncated form of Cry14A may include at least amino acids 50 through about 675.
- a truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 30, 35, 40, 45, or 50 to at least about amino acid 675.
- a truncated form of Cry14A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
- a truncated form of Cry21 A may include at least amino acids 50 through about 685.
- a truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at 10 least about amino acid 685.
- a truncated form of Cry21 A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
- the modified bacteria may be used for curative-type and preventative-type anthelmintic experiments.
- the Bacillus or LAB strain expressing heterologous Cry protein may be any of the Bacilli or LAB mentioned above expressing either full length or truncated heterologous Cry protein (e.g., B. thuringiensis Cry5B, 20 Cry13A, Cry14A, or Cry21 A) with that Cry protein expressed intracellularly, anchored at the membrane, or secreted.
- Antibodies against recombinant Cry proteins may be produced and purified according to standard methodologies 25 (e.g., Current Protocols in Immunology, John Wiley & Sons, New York,
- Bioactivity tests To assess the bioactivity of all constructs, recombinant bacilli or lactobacilli expressing heterologous Cry proteins are fed to the free-living nematode, C. elegans. C. elegans can access the Cry proteins either via protein secreted onto the solid media/into the liquid well or by their ability to grind and digest bacteria to open the bacterial cells.
- Rodent and parasite tests Three intestinal parasitic nematodes— H. bakeri (small intestine nematode parasite) in mice, and Trichuris muris 5 (whipworm) in mice, and A. ceylanicum (hookworm) in hamsters are tested.
- mice are gavaged with high doses of heterologous Cry-expressing Bacillus subtilis, Lactobacillus or Lactococcus (10 9 cfu). A portion of the mice are periodically (twice/week up to one month) euthanized.
- Small and large intestinal homogenates can be prepared after washing intact tissue with Hanks’ balanced salt solution twice 15 and after removing the mucous layer and epithelium by 1 mM DTT twice and then 10 mM EDTA. Plating of these homogenates on medium plates , such as GM17 agar supplemented with an antibiotic appropriate to the selectable marker used on the expression system, will select for the bacterium. In addition, immunoblotting of plate colonies, transferred to nitrocellulose
- mice Na ⁇ ve (uninfected mice) are gavaged with the best heterologous Cry-protein expressing Bacillus, Lactobacillus or Lactococcus strain(s) based on expression and bioactivity.
- Protect against acquisition test Control mice receive the native (unmodified) Bacillus, Lactobacillus or 30 Lactococcus which is incapable of Cry protein expression. A few days later, both groups of mice are then challenged with H. bakeri. Two weeks later, intestinal worm burdens and fecal egg counts are used to determine if the probiotics protect the mice against a challenge with infectious parasites.
- mice are infected with H. bakeri. Two weeks 5 later, infected mice are treated with heterologous Cry-protein expressing or control bacilli, lactobacilli, or lactococci, respectively. Intestinal worm burdens and fecal egg counts are used to determine if the probiotics provide
- mice with pre-existing nematode infections mice with pre-existing nematode infections.
- the present invention relates in certain preferred embodiments to the control of parasitic worms, e.g., nematodes and platyhelminths, using crystal proteins from Bacillus and their derivatives.
- parasitic worms e.g., nematodes and platyhelminths
- Crystal proteins from Bacillus and their derivatives e.g., Bacillus and their derivatives.
- Parasitic worms within the scope of the invention include but are not limited to those in Class
- Adenophorea e.g., Order Mononchida, Family Plectidae, and Order
- Rhabditidae Steinernematidae, Syrphonematidae, Syrphonematidae, or Thelastomatidae; Order Spirurida, Family Filariidae, Onchocercidae,
- Trichostrongylidae or Class Secernentea, Order Spirurida, Family
- the parasite may be a helminth.
- Helminths within the scope of the invention include but are not limited to those from Phylum Annelida, Class Polychaetae, Class Myzostomida, Class Clitellata, Subclass Hirudinea, Order Gnathobdellidae, Order Rhynchobdellidae; Phylum Platyhelminthes
- Schistosomatidae Subfamily Schistosomatinae, Genus Schistosoma, Order Echinostomatida, Family Fasciolidae, Family Paramphistomatidae, Family 10 Echinostomatidae; Super Order Epitheliocystida, Order Plagiorchiida, Family Dicrocoeliidae, Family Troglotrematidae, Order Opisthorchiida, Family
- Cry proteins with the scope of the invention may be employed to prevent, inhibit or treat Roundworm, Whipworm, Hookworm, Schistosome, or Trematodes.
- the parasite may also be a gastrointestinal tract parasitic
- roundworms/nematodes may include but are not limited to the following species: Haemonochus, Cooperia, Ostertagia, Trichostrongylus, Teladorsagia, Nematodirus, Ancylostoma, Cyathostominea/Cyathostomin/Cyathostome, Strongylus, Parascaris, Ascaris, Trichuris,
- Haemonochus species includes but is not limited to Haemonchus contortus and Haemonchus placei
- Cooperia species includes but is not limited to Cooperia oncophora, Cooperia pectinata, and Cooperia curticei.
- Ostertagia 30 species includes but is not limited to Ostertagia ostertagi, Ostertagia (Teladorsagia) circumcincta, and Ostertagia trifurcate.
- Trichostrongylus species includes but is not limited to Trichostrongylus axei, Trichostrongylus colubriformis, and T. circumcincta.
- Teladorsagia species includes but is not limited to Teladorsagia (Ostertagia) circumcincta.
- Nematodirus species 5 includes but is not limited to Nematodirus spathiger.
- Ancylostoma species includes but is not limited to Ancylostoma caninum, Ancylostoma braziliense, and Ancylostoma tubaeforme. Cyathostominea/Cyathostomin/Cyathostome nematodes are also included. Strongylus species (small and large) includes but is not limited to Strongylus vulgaris, Strongylus equinus, and Strongylus 10 edentatus. Parascaris species includes but is not limited to Parascaris
- Strongyloides species includes but is not limited to Strongyloides westeri.
- Ascaris species includes but is not limited to Ascaris suum.
- Trichuris species includes but is not limited to Trichuris globulosa, Trichuris suis, Trichuris campanula, and Trichuris vulpis. Oesophagostomum/
- Oesophagustomum species includes but is not limited to Oesophagustomum dentatum, Oesophagustomum quadrispinulatum, Oesophagostomum columbianum, and Oesophagostomum venulosum.
- Trichiuris species includes but is not limited to Trichiuris ovis.
- Bunostomum species includes but is not limited to Bunostomum trigonocephalum.
- Oxyuris species includes but is not 20 limited to Oxyuris equi (pin worms).
- Chabertia species includes but is not limited to Chabertia ovina.
- Habronema species includes but is not limited to Habronema microstoma and Habronema muscae.
- Draschia species includes but is not limited to Draschia megastoma.
- Triodontophorus species includes but is not limted to Triodontophorus minor and Triodontophorus serrates.
- Toxocara species includes but is not limted to Toxocara canis and Toxocara cati.
- Toxascaris species includes but is not limted to Toxascaris leonine.
- Uncinaria species includes but is not limted to Uncinaria stenocephala.
- Human parasitic roundworms of the gastrointestinal tract include but are not limited to the hookworms Ancylostoma duodenale and Necator americanus, the whipworm Trichuris trichiura, the roundworm Ascaris lumbricoides, the threadworm Strongyloides stercoralis, and the pinworm Enterobius vermiculari.
- treatment indicates an 5 approach for obtaining beneficial or desired results, including and preferably clinically desirable results.
- Treatment can involve optionally either the amelioration of symptoms of the disease or condition, or the delaying of the progression of the disease or condition.
- 10 “reducing the likelihood of occurrence,” “prevention,” and similar words such as “prevented,”“preventing” etc. include approaches for preventing, inhibiting, or decreasing the likelihood of the onset or recurrence of a disease or condition, in a manner that exhibits statistical significance, for example, when compared to the results obtained when the indicated method steps are omitted.
- 15 also included are preventing, inhibiting, or decreasing the likelihood of the
- “prevention” and similar words also include reducing 20 the intensity, effect, symptoms and/or burden of a disease or condition prior to onset or recurrence of the disease or condition.
- Methods according to these and related embodiments may be practiced using an effective amount or a therapeutically effective amount of an agent that substantially eradicates, reduces the severity of, or reduces the likelihood of occurrence of a soil- 25 transmitted helminth (STH) infection.
- an“effective amount” or a“therapeutically effective amount” of a composition, agent or substance is that amount sufficient to obtain a desired biological effect, such as beneficial results, including clinical results.
- compositions for treating or reducing the severity or likelihood of occurrence of an STH infection will be formulated as pharmaceutical compositions, which will preferably be formulated for oral delivery.
- Pharmaceutical compositions are formulated so as to allow the agent(s) contained therein to be bioavailable upon administration of the composition to a human.
- Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection).
- Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly 25 accomplished in the art or as described herein.
- These and related techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. Unless specific definitions are provided, the nomenclature utilized 30 in connection with, and the laboratory procedures and techniques of, molecular biology, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and
- Standard techniques may be used for recombinant technology, molecular biological, microbiological, chemical syntheses, chemical 5 analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
- 10 codon optimization can be employed in which the codon use of a given Cry protein is altered to match that of the most frequently used codons found in the probiotic bacterium of interest.
- An example of successful application of this technique is given in Pusch et al., J Acquir Immune Defic Syndr 40:512-520 (2005).
- An example of a codon optimization tool that can be found by simple 15 googling“codon optimization tool” is the website http://www.jcat.de/, which includes genome information from probiotic bacteria. Thus, this website can be used to codon optimize a Cry protein for expression in a particular probiotic bacterium.
- Cry proteins e.g., Cry5B and Cry21 A
- levels of product and/or secretion of Cry proteins are determined using Western blotting with antibodies.
- the use of 20 different probiotic species, different Cry proteins (e.g., Cry5B and Cry21 A), and different versions of each (full length and truncated constructs) will maximize likelihood of success in Cry protein expression.
- the genetic constructs may also include a genetic strategy for containment of genetically modified bacterium, e.g., a thymidine auxotroph. (Steidler, L. et al., Nat. Biotechnol. 21 : 25 785-89 (2003))
- Anthelmintic Cry proteins are expressed, as both intracellularly expressed and secreted forms, in lactic acid bacteria (LAB) such as Lactobacillus
- pTSV1 and pTSV2 vectors includes derivatives of the pTREX1 broad Gram-positive host range vector as well as the pUC origin of replication and ampicillin resistance gene to enable them to be used as shuttle vectors in E. coli. Expression is driven by the phage promoter LPS2 followed 10 by the translation initiation region from L. lactis promoter 11. These elements contain Shine-Dalgarno as well as ATG and ATGA start/stop translation inititaiton codons. Figures 6 and 7 describe these vectors and their use for heterologous expression of other proteins. The vectors are assembled using PCR and restriction sites and common molecular biology techniques. See id. 15 Figure 6 depicts the design of an expression system for
- TT1 and TT2 indicate transcription
- LPS2 P LPS2 bacteriophage promoter
- SD Shine-Dalgarno motif
- ATG and ATGA start/stop
- translation initiation start codons P11 TIR, translation initiation region from L. lactis promoter 11 See Pusch, O. et al., “Bioengineering Lactic Acid Bacteria to Secrete the HIV-1 Virucide Cyanovirin” 30 J Acquir Immune Defic Syndr 40(5): 512-20 (Dec 15, 2005).
- Figure 7 depicts a pTSV2 expression and secretion cassette. Fusion inhibitor sequences are codon adjusted to the codon usage of L.
- the Cry gene is fused downstream in-frame of the 10 ATGA sequence in the P11 TIR region.
- this pTSV1 vector system is sufficient.
- the lactococcal signal leader derived from the usp45 gene of L. lactis is fused just downstream of the ATGA sequence (vector pTSV2) and upstream of the Cry gene, which will allow the Cry protein to be fused to the 15 signal sequence.
- the TT2 transcription terminator is placed
- lactis Usp435 protein may be fused (using recombinant DNA techniques) to the N-terminus of the Cry protein. See id.
- the codon usage of the 25 Cry protein can be optimized using codon usage found in each LAB to permit higher levels of expression in that LAB. See id.
- the vectors are modified to allow expression of Cry protein
- bifidum ATCC 15696 using a vector system (pESH46, pESH47, pESH86) that employs the promoter/TIR and terminator regions of the hup gene or the promoter/TIR region of the gap gene along with the terminator of the hup gene. Expression under these promoters allows for intracellular 25 production of Cry proteins (full length and truncated). To allow for secretion, the first 11 N-terminal amino acids of a mature polypeptide of the bifidobacterial Sec2 secreted protein is fused to the N-terminus of the Cry proteins. These constructs are transformed into Bifidobacteria and are tested for expression and bioactivity as described below.
- Bacillus cereus e.g., var. toyoi, var. toyoii
- Bacillus toyonensis 5 Bacillus thuringiensis (e.g., var. HD1 ), or Bacillus subtilis (e.g., var. PY79, var. natto; can be used as a probiotic) is used to express Cry proteins using either sporulation promoters (early sporulation Cry3A, late sporulation Cry5B) or a constitutive promoter (e.g., the mbg promoter). See, e.g., Shao X, et al.
- polynucleotide construct and situated in a manner that permits them to exert the desired function, such as promotion of specific gene transcription (See, e.g. 20 Phan TT, et al.“Novel plasmid-based expression vectors for intra- and
- NCK56 NCK56
- LACTOBACILLUS REUTERI NCK932
- Cry proteins (Cry5B, Cry13A, Cry14A, Cry21 A, full length and truncated) are expressed on the pTRK882 shuttle vector, which uses the operably linked strong constitutive expression promoter Ppgm and terminator Term908. See, e.g., Mohamadzadeh M, et al.“Dendritic cell targeting of 10 Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice from lethal challenge.” PROC NATL ACAD SCI U S A 106: 4331 - 4336 (2009). This vector is made by using recombinant DNA techniques to clone the pgm promoter and terminator into the pTRK563 shuttle vector.
- a genetically modified Lactococcus lactis MG1363 is created by replacing the thymidylate synthase gene (thyA) with the full length coding sequence of Cry5B, Cry21 A, Cry14A, or Cry13A and truncated derivatives of each (e.g. residues 1 -697 for Cry5B). Because thyA is required for L. lactis to propagate, replacement of the gene with any of the mentioned cry genes will 10 disallow the bacterium from growing without a source of thymidine or thymine.
- thyA thymidylate synthase gene
- 1 , 2 and 3 represent PCR primer pairs (F and R), designed in such a way that PCR using primer pair 1 shows collinearity between chromosomal DNA located 5′ of the target area and cry5B (PCR1 ), that PCR using primer pair 2 shows collinearity between chromosomal DNA 10 located 3′ of the target area and cry5B (PCR2), and that PCR using primer pair 3 shows the presence of thyA (PCR3).
- Stages include (1 ) introduction of the nonreplicative vector; (2) 5′ crossover, forced by erythromycin selection and identified by PCR1 ; (3) second crossover in the absence of Em, identified through screening by PCR2; and (4) acquisition of desired transgenic
- Chromosomal mutants of L. lactis that are selected for the testing of the biological activity of expressed Cry proteins are those that contain the least amount of foreign DNA and contain an intact thyA promoter region directly 20 upstream of the insertional deletion. Mutants of this sort are detected by
- NICE DRIVEN EXPRESSION OF CRY PROTEINS IN LACTOCOCCUS LACTIS An alternative expression system for multidomain proteins in L. 30 lactis is the highly inducible Nisin-controlled gene expression system sold by MoBiTec GmbH, Germany. Nisin is a natural food preservative produced by L. lactis and is nontoxic to humans. In fact, it has been show that 30% of consumer milk products contain substantial amounts of nisin. See Beasley SS and Saris PE“Nisin-producing Lactococcus lactis strains isolated from human 5 milk.” APPL ENVIRON MICROBIOL 70: 5051 -5053 (2004). L.
- lactis NZ9000 a derivative of MG1363 in which the transduction signals nisR and nisK were inserted into the chromosome
- the full CDS or truncated forms of either Cry5B, Cry21 A, Cry14A, or Cry13A will be placed downstream of the inducible nisin promoter by using a 10 combination of vector-backbone exchange (VBEx) and ligation independent cloning (LIC), a cloning strategy that has been well characterized and shown in Figure 10.
- VBEx vector-backbone exchange
- LIC ligation independent cloning
- cry5B is amplified using primers containing LIC-specific overhangs.
- the plasmid is linearized by SwaI restriction in the LIC cassette. Single-stranded overhangs of the PCR product 15 and vector are generated using T4 DNA polymerase. The complementary overhangs of PCR product and vector anneal upon mixing. The resulting heteroduplex is transformed efficiently into E. coli.
- the L. lactis expression vector pNZxLIC is cut at the two introduced SFiI sites.
- Plasmid pERL consists of the pSH71 replicon from pNZxLIC fused 20 to an erythromycin marker.
- Plasmid pRExLIC consists of the cat marker and LIC sequence from pNZxLIC, fused to the E.
- each respective full length or truncated cry gene is amplified and cloned into the 30 appropriate vectors in Table 2 below for the VBEx procedure. See id. Expression, secretion, and bioactivity of Cry proteins in each recombinant L. lactis NZ9000 strain is then characterized. Expression and bioactivity are tested as described below. Nisin is included either in the growth medium (bacterial growth) or in the water/food (mice) to induce expression.
- EXPRESSION OF CRY PROTEINS IN PROBIOTIC E. COLI USING THE ARABINOSE OPERON The VBEx procedure also extends to other host organisms with 5 plasmids.
- Escherichia coli Nissle 1917 EcN
- Schroeder B et al.“Preventive effects of the probiotic Escherichia coli strain Nissle 1917 on acute secretory diarrhea in a pig model of intestinal infection.”
- DIG DIS SCI 51 : 724-731 (2006) Using the appropriate E. coli LIC/VBEx vectors in Table 2, probiotic EcN strains
- Cry5B, Cry21 A, Cry14A, or Cry13A are generated in the same fashion as described above for L. lactis. Expression of these proteins is dependent upon arabinose, with the genes being placed downstream of the arabinose operon (pBAD). Expression and bioactivity are tested as described below.
- mice Six week old female Swiss Webster mice are infected per os with a suspension of 200 ⁇ 10 Heligmosomoides bakeri infective third-stage larvae in 0.1 mL of distilled water.
- the outbred strain Swiss Webster is used to better “mimic” treating a genetically diverse host (like humans). Each mouse is 25 gavaged on day 15 post-infection (PI) with 0.1 mL of buffer, 0.1 mL of high dose LAB control (transformed with empty vector) or 0.1 mL of high dose LAB expressing Cry protein (6-10 animals/group). Progression of the infection is determined by fecal egg counts every other day beginning 3 days before treatment.
- mice are placed individually in empty plastic cages for 1 h each 30 morning, and the fecal pellets are collected into 50mL centrifuge tubes. The number of eggs present is counted using the modified McMaster technique. See Hu Y, et al.“Bacillus thuringiensis Cry5B protein is highly efficacious as a single-dose therapy against an intestinal roundworm infection in mice.” PLOS NEGL TROP DIS 4: e614 (2010). At 1 , 2, or 3 weeks after treatment, the animals 5 from all three groups are euthanized and the intestinal worm burdens are
- mice Twenty-one (21 ) 6-8 week old female AKR mice are infected per 15 os with 200 infectious-staged T. muris eggs. Thirty (30) days post-infection, the mice are treated per os (7/group) with a single 0.1 mL dose of buffer, 0.1 mL high dose of LAB control (transformed with empty vector), or 0.1 mL of high dose LAB expressing Cry protein. Fecal egg counts are taken three days before treatment and then every other day until necropsy (same protocol to 20 collect eggs as per H. bakeri). The mice are euthanized either 1 , 2 or 3 weeks after treatment and worm burdens in the large intestine are determined. Using fecal egg counts and intestinal worm burdens, the ability of Cry-expressing LAB to cure large intestinal roundworm infections are ascertained. 25 EXAMPLE 10
- FEEDING, SMALL INTESTINAL ROUNDWORM PARASITE Twenty one (21 ) 4-week old Syrian hamsters are infected per os 30 with 150 infectious staged L3 A. ceylanicum hookworm larvae. Fourteen (14) days post-infection, the hamsters are treated per os with a single 0.1 mL dose of buffer, 0.1 mL high dose of LAB control (transformed with empty vector), or 0.1 mL of high dose LAB expressing Cry protein.
- Body weight, hemoglobin levels, and fecal egg counts are 5 monitored every other day until day 21 , 28, or 35, at which point the animals are euthanized and worm burdens in the small intestine are determined.
- fecal egg counts, hemoglobin levels, and intestinal worm burdens the ability of Cry-expressing LAB to cure blood-feeding small intestinal roundworm infections are ascertained.
- mice as above (6-10 each group, three groups) 15 receive either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry protein expression, or 0.1 mL high dose vector-transformed LAB with Cry protein expression.
- Some (about 2-21 ) days later all groups of mice are then challenged with 200 H. bakeri infectious larvae as described above.
- fecal egg counts are determined 20 every other day for one to two weeks, after which time the mice are euthanized to determine intestinal roundworm burdens. Fecal egg counts and intestinal roundworm burdens are used to determine if the probiotics protected the mice against a challenge with a small intestine roundworm parasite (i.e., prevented infection).
- mice as above (6-10 each group, three groups) receive 30 either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry protein expression, or 0.1 mL high dose vector-transformed LAB with Cry protein expression. Some (about 2-21 ) days later, all groups of mice are then challenged with 200 T. muris infectious eggs as above. Thirty (30) days after infection challenge, fecal egg counts are determined every other day for one to 5 two weeks, after which time the mice are euthanized to determine intestinal roundworm burdens. Fecal egg counts and intestinal roundworm burdens are used to determine if the probiotics protected the mice against a challenge with a large intestine roundworm parasite (i.e., prevented infection). 10 EXAMPLE 13
- PREVENTATIVE-TYPE EXPERIMENT C Hamsters as above (6-10 each group, three groups) receive either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry 15 protein expression, or 0.1 mL high dose vector-transformed LAB with Cry
- the B. subtilis strain PY79 was transformed with the plasmid vector pHT3101 (PY79-vector) or with a pHT3101 -derived cry5B plasmid (PY79-Cry5B) (29). Natural competence was generated in PY79 by use of a standard medium shift protocol (30). To generate spore lysates and spore crystal lysates, PY79 strains were sporulated for 96 h at 37°C, spun down, washed once with prechilled 0.5MNaCl, and washed again with prechilled sterile double-distilled 5 water. Final pellets were stored at -80°C until use.
- Transformants were screened by PCRs using the following primers on all three strains (PY79, PY79-vector, and PY79-Cry5B): Cry5B primer forward 1 (CGTTCAAAATCATCCGTAAATG) (SEQ ID NO: 26) with Cry5B primer reverse 1 (AAATGCATGAACCACTTCCAC) (SEQ ID NO: 27) 10 (predicted product of 586 nucleotides [nt]), Cry5B primer forward 2
- Feces were collected on days 1 and 3 post-treatment to determine fecal egg counts (13). The hamsters were sacrificed on day 22 p.i., and intestinal parasite burdens were determined as described previously (14). 10 The one-tailed Mann-Whitney test was performed to compare the two groups for significance in the experiment using a dose of 10 mg/kg of body weight (data were calculated and plotted using Prism 5 [GraphPad Software Inc., La Jolla, CA]). Fecal egg counts were compared using one-tailed Student’s t test. For the dose-response experiment, results for each treatment group were 15 compared to those for the control group by one-way analysis of variance and Dunnett’s method.
- cry5B plasmid engineered for B. thuringiensis (29) was purified 20 from B. thuringiensis and transformed into B. subtilis strain PY79 by standard transformation techniques. This plasmid, based upon the E. coli-B.
- thuringiensis shuttle vector pHT3101 (36), contained the endogenous Cry5B promoter and 3’-untranslated region driving expression of the wild-type cry5B gene (29).
- empty vector pHT310125 was also transformed into PY79.
- the presence of the cry5B gene in the PY79- Cry5B strain and its absence from both the parent PY79 strain and the control strain (PY79-vector) were confirmed by PCR. PCR detection of the plasmid in the PY79-vector strain and its absence from the parent PY79 strain were also confirmed.
- PY79 was able to maintain both the cry5B plasmid and pHT3101 30 under standard antibiotic selection with erythromycin, indicating that the origin of replication for B. thuringiensis functioned in B. subtilis, as demonstrated previously (37).
- the PY79-Cry5B and PY79-vector strains were sporulated.
- Crystal proteins expressed during sporulation of B. thuringiensis assemble into crystalline inclusions in the mother cell compartment that are often bipyramidal in shape (39). This assembling is also true of Cry5B
- Cry5B made by PY79 was bioactive.
- dose-dependent mortality assays were set up using the laboratory roundworm C. elegans in a standard 48-well format (13, 41 ).
- the Cry5B component of PY79- Cry5B spore crystal lysates was
- PY79-Cry5B was therapeutic against experimental hookworm 5 infection in hamsters.
- Nine hamsters were infected with the hookworm parasite A. ceylanicum.
- five hamsters were treated per os with a single dose of PY9-vector spore lysate, and four were treated with a single dose of PY79- Cry5B spore crystal lysate (equivalent spore counts were used in both treatment groups; the amount of Cry5B was determined relative to 10 BSA standards on protein gels).
- the single dose of Cry5B used was 10 mg/kg, chosen based on published doses of clinical anthelmintics used in the same model of hookworm disease (Table 3).
- Cry5B in B. subtilis employed the endogenous BtCry5B promoter and may have been influenced at least partly by two putative sigma E elements upstream of the cry5B start codon.
- Sigma E is a sporulation- specific promoter that is active in B. subtilis and is also known to be involved in 10 crystal protein production in B. thuringiensis (43, 44).
- the engineered strain used for the present study included antibiotic resistance genes associated with the cry5B plasmid. Given the genetic tools associated with B. subtilis (45), a Cry5B-expressing B. subtilis therapeutic product for humans is contemplated that includes the cry5B gene integrated into the genome and that lacks any 15 antibiotic resistance genes
- Cry5B had a different mechanism of action from that of chemical anthelmintics; Cry5B has been shown to be a pore-forming protein that binds to invertebrate-specific glycolipids and attacks the plasma membrane of the nematode intestine (34, 35, 48–50).
- PY79-Cry5B was comparable to many 30 current drugs in its efficacy on a mg/kg basis, and on a molar level, it appeared to be superior (e.g., the molar dose of Cry5B used in the present experiments was 66 times lower than the molar dose of albendazole mentioned above).
- the present results validated the B. subtilis-Cry5B approach.
- B. subtilis-Cry5B specific activity e.g., by Cry5B point mutations that increase roundworm-killing activity 5 (51 ) and by optimization of fermentation conditions that can also increase
- BIOACTIVITY OF COMPOSITIONS COMPRISING CRY5B AND PROBIOTIC BACTERIA 15 This example describes additional data that were obtained using the above–described bioassays for anthelmintic activity.
- Figure 13 shows results from an in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms as described by Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. 20 doi:10.137/journal.pntd.0001900).
- Figure 14 shows dose-response results for indicated dosages of unfractionated Cry5B-containing spore-crystal lysates (SCL) in the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms.
- the assay was performed according to 5 Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900.
- Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown 10 to sporulation phase.
- the amounts of Cry5B gavaged were determined by taking known volumes of spore crystal lysates, resolving full length Cry5B protein by SDS PAGE, and quantitating the amount of protein in the Cry5B band relative to known amounts of bovine serum albumin (BSA) standards on the gel.
- BSA bovine serum albumin
- Figure 15 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/ journal. pntd.0001900) following treatment with two different dosages of Cry5B spore- crystal lysates obtained from cultured Bacillus thuringiensis natto cells that were 20 transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase.
- subtilis natto was transformed with the same Cry5B expressing plasmid described in Example 14 (Hu et al. Appl. Environ. Microbiol. 2013, 79(18):5527). Because B. subtilis natto is not naturally competent, B. subtilis natto cells were made competent by artificially 25 introducing the ComK competency plasmid into the B. subtilis natto strain via protoplast transformation (Ashikaga et al., J Bacteriol. 2000;182(9):2411 -5; Romero, D., et al J Microbiol Meth. 2006;66(3):556-9).
- Figure 16 shows data obtained in vitro using the C. elegans mortality assay described in Figure 11 to evaluate the effects on C. elegans of purified Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see Fig. 2) when combined in a mixture either with 5 sporulated B. thuringiensis HD1 or with sporulated B. subtilis PY79. For each data point, the number of spores (HD1 or PY79) was held constant and the quantity of Cry5B was titrated (x-axis).
- Figure 17 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum 10 hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/ journal. pntd.0001900) following treatment (5 mg/kg) by gavage on day 18 P.I. with either B. thuringiensis strain HD1 spore lysates transformed with empty vector (“control”, spore lysates from the acrystaliferous mutant B. thuringiensis strain HD1 , which does not produce any Cry proteins) or spore crystal lysates from B. 15 thuringiensis strain HD1 that has been engineered to express Cry14A (for
- thymidylate synthetase encodes thymidylate synthetase.
- B. subtilis natto was transformed with this construct in a single step.
- Transformants simultaneously acquired two properties: auxotrophy for thymine nucleotides and the production of Cry5B protein. Because thymine 30 auxotrophs in B. subtilis are known to be naturally resistant to trimethoprim and other antifolate compounds, selection for growth in the presence of trimethoprim plus thymine selected for the desired integration event without the introduction of an antibiotic resistance marker.
- the construct contained no foreign DNA at all except for the cry5B gene itself.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Gastroenterology & Hepatology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biophysics (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Virology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Crystallography & Structural Chemistry (AREA)
- Peptides Or Proteins (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
Compositions and methods for treating or reducing the severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject are described. The methods include administering to the subject a therapeutically effective amount of a recombinant bacterium expressing a crystal protein such as a Bacillus thuringiensis crystal protein (Cry). The crystal proteins may be full length, truncated, variant, or sub-variant Cry proteins. Examples of crystal proteins include Cry5B, Cry21, Cry14A, Cry6A, and Cry13A. The recombinant bacterium may be, for example, a Bacillus subtilis or other Gram-positive bacterium, for instance, a lactic acid fermenting bacterium such as Lactococcus or Lactobacillus. Related compositions and recombinant microorganisms are also described.
Description
ANTHELMINTIC PROBIOTIC COMPOSITIONS AND METHODS CROSS REFERENCE TO RELATED APPLICATION This application claims the benefit under 35 U.S.C. § 119(e) to U.S. Provisional Application No. 62/021 ,576 filed July 07, 2014, which application is hereby 5 incorporated by reference in its entirety. STATEMENT OF GOVERNMENT INTEREST
This invention was made with government support under Grant No. AI056189 awarded by the National Institutes of Health. The government has certain rights in this invention. 10 STATEMENT REGARDING SEQUENCE LISTING
The Sequence Listing associated with this application is provided in text format in lieu of a paper copy, and is hereby incorporated by reference into the specification. The name of the text file containing the Sequence Listing is 780093_401 WO_SEQUENCE_LISTING.txt. The text file is 50.6 KB, was 15 created on June 30, 2015, and is being submitted electronically via EFS-Web. BACKGROUND Technical Field
The presently disclosed invention embodiments relate to delivery by probiotic bacteria of anthelmintic proteins to the lower gastrointestinal (GI) 20 tracts of mammals to treat, reduce the severity of, or reduce the likelihood of occurrence of infection by parasitic soil-transmitted helminthes (STHs).
More specifically, the present disclosure relates to artificial compositions that comprise probiotic bacteria (e.g., Bacillus subtilis,
Lactobacillus, Lactococcus, and/or others) and heterologous Bacillus
thuringiensis pesticidal crystal (Cry) proteins, including recombinantly engineered probiotic bacteria that are capable of expressing such heterologous Cry proteins and additionally or alternatively, mixtures of probiotic bacteria with heterologous purified B. thuringiensis Cry proteins, that effectively deliver 5 protein anthelmintics to the small and large intestines of mammals to protect against the acquisition, progression, and transmission of STH infections, including gastrointestinal (GI) nematode parasites known as hookworm, whipworm, Ascaris, and Strongyloides. Description of the Related Art
10 Soil-transmitted helminthes (STHs) that parasitize the GI tract of humans infect 2.3 billion of the poorest peoples and 400,000,000 of the poorest children worldwide. (Hall, A., et al. Matern Child Nutr 4 Suppl 1 , 118-236 (2008)) Infected children can exhibit growth stunting, retarded cognitive development, lethargy, malnutrition, increased school absenteeism, and 15 vulnerability to secondary infections. (Bethony, J. et al. Lancet 367, 1521 -32 (2006); Hotez, P.J. Forgotten people, Forgotten diseases. (2008)) Pregnant women who are infected are at increased risk for low birth-weight babies and for maternal and infant mortality. (Brooker et al., PLoS Negl Trop Dis 2, e291 (2008)). Infected individuals have lower energy, lower productivity, and
20 immune defects that result in increased virulence of HIV/AIDS and a higher likelihood of contracting malaria and tuberculosis (Stothard et al., Ann Trop Med Parasitol 103, 357-60 (2009); Moran, M. et al., G-finder Report (2009)); STHs thus trap large populations of the developing world in poverty. The common link of STH transmission is poor sanitation, which requires a massive
25 investment in infrastructure and public health.
Conventional chemotherapy approved by the World Health Organization for STH infections in humans involves treatment with
benzimidazoles (e.g., albendazole, mebendazole) or nicontinic acetylcholine receptor (nAChR) agonists (pyrantel, levamisole). (Keiser and Utzinger, JAMA
299, 1937-48 (2008)). These compounds, however, lack full efficacy against most human STH parasites. Reports in humans of resistance to both classes of drugs are increasing (e.g., Tanzania, 2010 (Stothard et al., Ann Trop Med Parasitol 103, 357-60 (2009)), potentially rendering ineffective current
5 strategies for controlling STH infections. A notable challenge in this field is that the infected populations are among the poorest in the world, and economic incentives to develop new drugs are low (~$700,000/year is spent to develop new drugs against human STHs (Moran, M. et al. G-finder Report (2009)). The poverty of infected populations demands that STH therapeutics be safe, 10 effective, and also inexpensive; highly stable; transportable through distribution routes to infected populations; and amenable to culturally acceptable delivery systems.
Crystal (Cry) proteins made by the soil bacterium Bacillus thuringiensis (Bt) may be candidate agents that provide safe and effective 15 treatment of STHs. Cry proteins have been in use for 60+ years as safe,
natural, organic insecticides for control of crop pests, mosquitoes, and black flies. (Roh, J.Y., et al. J MICROBIOL BIOTECHNOL 17, 547-59 (2007)). They are also effective against nematodes. (Wei, J.Z. et al. PROC NATL ACAD SCI 100, 2760-5 (2003)). Cry proteins are non-toxic to vertebrates and are EPA
20 approved for expression in transgenic food (e.g., corn, potato).
(Mohamadzadeh et al. PNAS 106,4331 -6 (2009) ; Betz F.S., et al. REGUL TOXICOL PHARMACOL 32, 156-73 (2000)). They are stable and cheap to mass- produce. Activity of Cry proteins against nematode plant parasites and against helminthes has been described, e.g., in WO2007/062064; US2010/0024075; 25 WO2010/053517; and US2011 /0263489; see also, e.g., Li, X.-Q. et al., 2008 Biol. Control 47:97-102, which describes activity of a Cry5B protein truncated at amino acid residue 698 against C. elegans and plant parasitic nematodes.
Two Cry proteins, Cry5B and Cry21 A, are highly potent anthelmintics in vivo. (See Cappello, M. et al. PROC NATL ACAD SCI USA 103, 30 15154-9 (2006); Hu, Y., et al. PLOS NEGL TROP DIS 4, e614 (2010); and Hu, Y.,
et al. PROC NATL ACAD SCI USA 107, 5955-60 (2010)). Cry5B is effective against three intestinal nematodes, Ancylostoma ceylanicum hookworms in hamsters, Heligmosomoides bakeri in mice, and Ascaris suum parasites in pigs, and is 3X - 60,0000X more potent than known chemical anthelmintics in a 5 single dose. (See Cappello, M. et al. PROC NATL ACAD SCI 103, 15154-9 (2006);
Hu, Y., et al. PLOS NEGL TROP DIS 4, e614 (2010); Hu, Y., et al. PLOS NEGL TROP DIS 6(11 ), e1900 (2012); and Urban, J., et al PLOS NEGL TROP DIS 7(6), e2263 (2013)). Importantly, screens for Cry-resistance mutations in the nematode Caenorhabditis elegans indicate that nematodes are 3 - 20X less 10 likely to develop resistance to Cry proteins than to benzimidazoles or nAChR agoinsts. (Hu, Y., et al. PROC NATL ACAD SCI 107, 5955-60 (2010)).
Despite the established anthelmintic biological activity of Cry proteins, significant challenges remain with respect to effective delivery of intact, biologically active Cry proteins into the gastrointestinal (GI) tract for 15 treating STHs. These proteins typically have molecular weights of ~135 kDa in their protoxin (unprocessed) forms and ~70 kDa in their active (processed) forms, creating technical difficulties for delivery to the GI lumen via known routes of administration, including problems arising from degradation, poor absorption, clearance mechanisms and other impediments. Clearly there 20 remains a need for new approaches to delivering protein therapeutics such as anthelmintic proteins to the GI tract. The presently disclosed embodiments address this need by providing anthelmintic probiotic compositions and methods, and offer other related advantages. BRIEF SUMMARY
25 In certain embodiments of the presently disclosed invention, there are provided methods for delivering crystal proteins to the GI tract of subjects for the treatment of STHs using probiotic bacteria. In particular, Generally Recognized as Safe (GRAS) probiotic lactobacilli and/or bacillus strains may be used for delivery of crystal (Cry) proteins (such as one or more B. thuringiensis
Cry proteins) to the mammalian GI tract. Delivery may be effected by administration to the GI tract of GRAS probiotic bacteria that have been artificially engineered to express one or more heterologous Cry protein(s) before, during, or after administration to the GI tract. Alternatively, GRAS 5 probiotic bacteria that have not been genetically engineered, such as GRAS lactobacilli and/or bacillus, may be combined with purified crystal (Cry) proteins from a heterologous source to obtain a mixture that can be administered to the GI tract.
In another embodiment, a method of treating a parasitic worm or 10 helminth infection in a subject is provided. The method includes administering to the subject a therapeutically effective amount of a recombinant bacterium (Gram-positive or Gram-negative) that is capable of expressing a crystal (Cry) protein.
In another embodiment, methods of treating a parasitic worm or 15 helminth infection in a subject are described. The method includes
administering to the subject a medicament comprising an amount of a crystal protein-producing genetically modified bacterium (Gram-positive or Gram- negative).
In another embodiment, compositions comprising a non-invasive20 or non-pathogenic bacterium are described. The non-invasive or non- pathogenic bacterium has a nucleic acid construct or vector having one or more constitutive promoters and coding sequences for the expression of one or more crystal proteins.
In another embodiment, a recombinant microorganism for 25 delivering a crystal protein in vivo is described. The recombinant
microorganism includes a coding sequence of the crystal protein under the control of a suitable promoter sequence.
In another embodiment, a probiotic bacterium that is not recombinant is combined with a purified crystal protein and delivered in vivo.
The crystal proteins may be full length, truncated, variants, or subvariants. The truncated crystal protein may include any truncation of the N- and C-termini that still retains toxin activity. The truncated form is not full-length but retains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or 5 more of the toxic activity of a corresponding full-length Bt toxin protein. For example, the truncated portion may be truncated between the end of conserved block 5 and the C-terminus of the full length protein.
In one embodiment, the truncated crystal protein may contain the toxin domain of the crystal protein and optionally include up to 5, 10, or 20 10 additional amino acids. The truncated crystal protein may be truncated after a conserved amino acid sequence of block 5 and optionally include up to 5, 10, or 20 additional amino acids. The conserved amino acid sequence of block 5 may contain the motif DRIEF (SEQ ID NO: 23), DRLEF (SEQ ID NO: 24), or some other related sequence as well as surrounding amino acid residues, e.g., three 15 amino acids upstream and two amino acids downstream of this motif. Table 1 shows the block 5 sequences for various Cry proteins. See e.g., Schnepf, E., et al., Bacillus thuringiensis and Its Pesticidal Crystal Proteins, Microbiology and Molecular Biology Reviews 62(3): 775-806, (e.g., at p. 781 , Figure 3) (Sept. 1998); and Crickmore et al., Revision of the Nomenclature for the Bacillus 20 thuringiensis Pesticidal Crystal Proteins, Microbiology and Molecular Biology Reviews 62(3): 807-813 (Sept. 1998). The truncated crystal protein may also be truncated at the N-terminus. For example, the truncated crystal protein may not contain the first about 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids at the N-terminus. "Variants" or“subvariants” of Cry proteins 25 include polypeptides with one or more substitutions, e.g., no more than 20
substitutions, alternatively no more than 10 substitutions, or substitutions at 10% or fewer of the residues, relative to a corresponding wild-type polypeptide or truncated version thereof.
Also contemplated according to certain presently disclosed 30 embodiments are Cry protein variants that exhibit at least 50, 55, 60, 65, 70, 75,
80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, or 99 percent amino acid sequence identity to a known Cry protein sequence such as any that are disclosed in Crickmore et al., 1998 Microbiology and Molecular Biology
Reviews 62(3): 807-813, or in Schnepf et al., 1998 Microbiology and Molecular 5 Biology Reviews 62(3): 775-806, including full length Cry proteins and truncated Cry proteins, Cry protein variants or subvariants thereof. Also contemplated according to certain embodiments are polynucleotides encoding such Cry proteins and truncations and variants thereof. 10 Table 1
In Table 1 , the consensus sequence denotes the positions at which at least 75% of the aligned proteins in the group have an identical or conserved amino acid sequence. An uppercase letter in the sequence
15 indicates that at least 75% of the residues at that position are identical. A
lowercase letter indicates that at least 75% of the residues at that position are
conserved. Conserved amino acids fall into the following groups: a (A, G, S, T, or P); d (D, E, N, or Q); f (F, W, or Y)l I (I, L, M, or V), and k (K or R).
The truncated crystal protein may be a truncated form of Cry5B such as B. thuringiensis Cry5B (Fig. 2). Truncated Cry5B may extend from 5 about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 693. The truncated form of Cry5B may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C- terminus after conserved block 5, e.g., through about 698, 703, 713, 723, 733, or 743.
10 The truncated crystal protein may be a truncated form of Cry13A such as B. thuringiensis Cry13A (Fig. 3). Truncated Cry13A may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 688. The truncated form of Cry13A may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C- 15 terminus after conserved block 5, e.g., through about 693, 698, 708, 718, 728, or 738.
The truncated crystal protein may be a truncated form of B.
thuringiensis Cry14A (Fig. 4). Truncated Cry14A may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about 20 amino acid 675. The truncated form of Cry14A may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C-terminus after conserved block 5, e.g., through about 680, 685, 695, 705, 715, or 725.
The truncated crystal protein may be a truncated form of Cry21 A such as B. thuringiensis Cry21 Aa1 (Fig. 5A) or Cry21 Aa2 (Fig. 5B). Truncated 25 Cry21 A may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 685. The truncated form of Cry21 A may optionally include up to an additional 5, 10, 20, 30, 40, or 50 amino acids from the C-terminus after conserved block 5, e.g., through about 690, 695, 705, 715, 725, or 735.
In certain embodiments of the herein-described methods, compositions, and microorganisms, the bacterium may be a recombinant food- grade bacterium. The bacterium may in certain embodiments be a lactic acid fermenting bacterium, e.g., a member of the Lactococcus or Lactobacillus 5 species. In certain preferred embodiments the bacterium may be a strain of Bacillus subtilis. In certain preferred embodiments the bacterium may be Bacillus subtilis natto.
The crystal proteins may in certain embodiments be delivered through in situ synthesis in the subject by the gram-positive bacterium, but the 10 present disclosure is not intended to be so limited and also contemplates, by way of non-limiting example, embodiments in which bacterial synthesis of a Cry protein may have occurred prior to administration of the composition which comprises at least one Cry protein and at least one non-toxic, non-invasive or non-pathogenic bacterium. The Cry protein may in certain embodiments be 15 present within the administered bacterium or exposed on the surface of the administered bacterium or present as a crystalline inclusion produced during stationary phase/sporulation and separate from the bacterium, and may in certain embodiments be secreted by the administered bacterium prior to, during, and/or following administration.
20 In certain embodiments the Cry protein may be synthesized prior to administration and recovered as an isolated protein or polypeptide, for example, as a spore-crystal lysate or in another form, such that the recovered Cry protein may be admixed with the bacterium prior to simultaneous administration of the Cry protein and the bacterium, or alternatively, such that 25 the Cry protein and the bacterium may be administered sequentially and in either order (i.e., Cry protein followed by bacterium or vice versa). In this context,“isolated” or“purified” may refer to the Cry protein being removed or otherwise physically separated from the intact cell in which it has been synthesized, as is the case for a Cry protein that is present in a spore-crystal 30 lysate as described herein and known in the art. In preferred embodiments the
Cry protein is heterologous to the administered bacterium, which refers to any situation in which the Cry protein is not encoded by a polynucleotide sequence that is found naturally in the bacterium.
The recombinant bacterium may also be administered with at 5 least one additional therapeutic agent. The at least one additional therapeutic agent may be a nicotinic acetylcholine receptor agonist. Nicotinic acetylcholine receptor agonists include, but are not limited to, levamisole (or members of the levamisole family), pyrantel, or tribendimidine.
The parasitic worm or helminth infection may be caused by a 10 parasitic worm or helminth that includes but is not limited to Roundworm,
Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides, Schistosome, and Trematodes.
The methods may be used to treat mammals including but not limited to humans. Other mammals that can be treated by the methods
15 described herein include but are not limited to feline, rodent, canine, bovine, equine, swine, caprine, ovine, and primate.
Accordingly, in certain embodiments of the presently disclosed invention there is provided a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject, 20 the method comprising administering to the subject a therapeutically effective amount of a composition comprising a recombinant bacterium that has expressed or that is capable of expressing a crystal protein. In certain embodiments the crystal protein is selected from the group consisting of Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A. In certain embodiments the recombinant 25 bacterium is a Gram-positive bacterium and in certain other embodiments the recombinant bacterium is a Gram-negative bacterium. In certain embodiments the recombinant bacterium is a recombinant food grade Gram-positive bacterium. In certain embodiments the recombinant bacterium is a lactic acid fermenting bacterium, which in certain further embodiments is a Lactococcus or 30 Lactobacillus species, which in certain still further embodiments is Lactococcus
lactis. In certain embodiments the Lactobacillus species is selected from Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri. In certain embodiments the recombinant bacterium is administered in combination with at least one additional therapeutic agent, 5 which in certain embodiments is a nicotinic acetylcholine receptor agonist. In certain embodiments the at least one additional therapeutic agent is
administered simultaneously or sequentially (and in either order) with the therapeutically effective amount of the recombinant bacterium expressing the crystal protein. In certain embodiments the nicotinic acetylcholine receptor 10 agonist is from the levamisole family of nicotinic acetylcholine receptor
agonists, and in certain embodiments the nicotinic acetylcholine receptor agonist is levamisole. In certain embodiments the levamisole is administered in an amount of about 0.1 mg/kg to about 5.0 mg/kg. In certain embodiments the nicotinic acetylcholine receptor agonist is pyrantel or tribendimidine. In certain 15 embodiments the pyrantel is administered in an amount of about 1.0 mg/kg to about 15.0 mg/kg. In certain embodiments the tribendimidine is administered in an amount of about 0.25 mg/kg to about 10 mg/kg.
In certain embodiments of the present methods the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from 20 Roundworm, Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides,
Schistosome, and Trematodes. In certain embodiments the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from hookworm Ancylostoma duodenale, hookworm Necator americanus, whipworm Trichuris trichiura, roundworm Ascaris lumbricoides, threadworm Strongyloides 25 stercoralis, and pinworm Enterobius vermiculari. In certain embodiments the subject is a human being. In certain embodiments the subject is a mammal selected from feline, rodent, canine, bovine, equine, swine, caprine, ovine, and primate.
In certain embodiments the crystal protein is delivered through in 30 situ synthesis in the subject by the bacterium. In certain embodiments the
crystal protein is a truncated crystal protein. In certain embodiments the crystal
protein is a variant crystal protein. In certain embodiments the truncated crystal protein is truncated after a conserved amino acid sequence of block 5. In certain embodiments the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is 5 truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24). In certain embodiments the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain 10 embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus. In certain embodiments the truncated crystal protein is truncated at the C-terminus. In certain embodiments the crystal protein is Cry5B and the Cry5B includes at least amino acids 30 through about 15 693 of SEQ ID NO:1. In certain embodiments the crystal protein is Cry13A and the Cry13A includes at least amino acids 30 through about 688 of SEQ ID NO:2. In certain embodiments the crystal protein is Cry14A and the Cry14A includes at least amino acids 30 through about 675 of SEQ ID NO:3. In certain embodiments at least one of (a) the crystal protein is Cry21 A and the Cry21 A 20 includes at least amino acids 30 through about 685 of SEQ ID NO:4, (b) the crystal protein is Cry21 A and the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or the crystal protein is Cry6A and the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID 25 NO:6.
Turning to another embodiment of the present disclosure there is provided a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject, the method comprising administering to the subject a composition that comprises (a) a therapeutically 30 effective amount of a first recombinant bacterium that has expressed or that is capable of expressing a first crystal protein; and (b) a therapeutically effective amount of a second recombinant bacterium that has expressed or that is
capable of expressing a second crystal protein. In certain embodiments the first and second recombinant bacteria are Gram-positive bacteria. In certain embodiments the first and second recombinant bacteria are Gram-negative bacteria. In certain embodiments the first and second recombinant bacteria are 5 administered simultaneously. In certain embodiments the first and second
recombinant bacteria are administered sequentially and in either order. In certain embodiments the first and second crystal proteins are different crystal proteins. In certain embodiments the first and second crystal proteins are independently selected from Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A. In 10 certain embodiments the bacterium is a recombinant food grade Gram-positive bacterium. In certain embodiments the bacterium is a lactic acid fermenting bacterium. In certain embodiments the lactic acid fermenting bacterium is a Lactococcus or Lactobacillus species. In certain embodiments the Lactoccocus species is Lactococcus lactis. In certain embodiments the Lactobacillus 15 species is selected from Lactobacillus acidophilus, Lactobacillus gasseri,
Lactobacillus johnsonii, and Lactobacillus reuteri.
According to certain other embodiments described herein there is provided a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject, the method comprising 20 administering to the subject a medicament comprising a therapeutically
effective amount of a bacterium that has been genetically modified to produce a heterologous crystal protein. In certain embodiments the crystal protein- producing genetically modified bacterium is a Gram-positive bacterium. In certain embodiments the crystal protein-producing genetically modified
25 bacterium is a Gram-negative bacterium. In certain embodiments the crystal protein is selected from Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A. In certain embodiments the bacterium is a recombinant food grade Gram-positive bacterium. In certain embodiments the bacterium is a lactic acid fermenting bacterium. In certain embodiments the lactic acid fermenting bacterium is a 30 Lactococcus or Lactobacillus species. In certain embodiments the Lactoccocus species is Lactococcus lactis. In certain embodiments the Lactobacillus species is Lactobacillus selected from Lactobacillus acidophilus, Lactobacillus
gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri. In certain embodiments the crystal protein-producing genetically modified bacterium is administered in combination with at least one additional therapeutic agent, which in a further embodiment is a nicotinic acetylcholine receptor agonist. In 5 certain embodiments the at least one additional therapeutic agent is
administered simultaneously with the therapeutically effective amount of the crystal protein-producing genetically modified bacterium. In certain
embodiments the at least one additional therapeutic agent is administered sequentially (and in either order) with the therapeutically effective amount of the 10 crystal protein-producing genetically modified bacterium. In certain
embodiments the nicotinic acetylcholine receptor agonist is from the levamisole family of nicotinic acetylcholine receptor agonists. In certain embodiments the nicotinic acetylcholine receptor agonist is levamisole. In certain embodiments the levamisole is administered in an amount of about 0.1 mg/kg to about 5.0 15 mg/kg. In certain embodiments the nicotinic acetylcholine receptor agonist is pyrantel or tribendimidine. In certain embodiments the pyrantel is administered in an amount of about 1.0 mg/kg to about 15.0 mg/kg. In certain embodiments the tribendimidine is administered in an amount of about 0.25 mg/kg to about 10 mg/kg.
20 In certain related embodiments the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from Roundworm, Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides, Schistosome, and Trematodes. In certain other related embodiments the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from 25 hookworm Ancylostoma duodenale, hookworm Necator americanus, whipworm Trichuris trichiura, roundworm Ascaris lumbricoides, threadworm Strongyloides stercoralis, and pinworm Enterobius vermiculari. In certain embodiments the subject is a human being, and in certain embodiments the subject is a mammal selected from feline, rodent, canine, bovine, equine, swine, caprine, ovine, and 30 primate. In certain embodiments the heterologous crystal protein is
synthesized by the bacterium in situ in the subject. In certain embodiments the crystal protein is a truncated crystal protein. In certain embodiments the crystal
protein is a variant crystal protein. In certain embodiments the truncated crystal protein is truncated after a conserved amino acid sequence of block 5. In certain embodiments the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is 5 truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24). In certain embodiments the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain 10 embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus. In certain embodiments the truncated crystal protein is truncated at the C-terminus.
In certain embodiments of the methods just described, the crystal 15 protein is Cry5B and the Cry5B includes at least amino acids 1 through about 693 of SEQ ID NO:1. In certain other embodiments the crystal protein is Cry13A and the Cry13A includes at least amino acids 1 through about 688 of SEQ ID NO:2. In certain embodiments the crystal protein is Cry14A and the Cry14A includes at least amino acids 1 through about 675 of SEQ ID NO:3. In 20 certain embodiments at least one of: (a) the crystal protein is Cry21 A and the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:4, (b) the crystal protein is Cry21 A and the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or (c) the crystal protein is Cry6A and the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or 25 includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID
NO:6.
Turning to certain other embodiments of the present invention there is provided a composition comprising a non-invasive or non-pathogenic bacterium having a nucleic acid construct or vector comprising one or more 30 constitutive promoters operably linked to coding sequences for expression of one or more heterologous crystal proteins. In certain embodiments the one or more crystal proteins is selected from Cry5B, Cry21 A, Cry14A, Cry13A, and
Cry6A. In certain embodiments the one or more crystal proteins is a truncated crystal protein. In certain embodiments the one or more crystal proteins is a variant crystal protein. In certain embodiments the truncated crystal protein is truncated after a conserved amino acid sequence of block 5. In certain
5 embodiments the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24). In certain 10 embodiments the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus. In certain embodiments the truncated crystal 15 protein is truncated at the C-terminus. In certain embodiments the one or more crystal proteins is Cry5B and the Cry5B includes at least amino acids 1 through about 693 of SEQ ID NO:1. In certain embodiments the one or more crystal proteins is Cry13A and the Cry13A includes at least amino acids 1 through about 688 of SEQ ID NO:2. In certain embodiments the one or more crystal 20 proteins is Cry14A and the Cry14A includes at least amino acids 1 through about 675 of SEQ ID NO:3. In certain embodiments at least one of: (a) the crystal protein is Cry21 A and the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:4, (b) the crystal protein is Cry21 A and the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or 25 (c) the crystal protein is Cry6A and the Cry6A comprises the amino acid
sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID NO:6. In certain embodiments the non- invasive or non-pathogenic bacterium is a lactic acid fermenting bacterium. In certain embodiments the lactic acid fermenting bacterium is a Lactococcus or 30 Lactobacillus species, which in certain further embodiments is Lactococcus lactis. In certain embodiments the Lactobacillus species is selected from
Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
In another embodiment of the present invention there is provided a recombinant microorganism for delivering a crystal protein in vivo, wherein 5 said microorganism comprises a coding sequence of the crystal protein under the control of a suitable promoter sequence. In certain embodiments the microorganism is a gram-positive bacterium. In certain embodiments the microorganism is a Gram-negative bacterium. In certain embodiments the bacterium is a food grade bacterium. In certain embodiments the food grade 10 bacterium is a lactic acid fermenting bacterium. In certain embodiments the lactic acid fermenting bacterium is Lactococcus or Lactobacillus. In certain embodiments the Lactococcus is Lactococcus lactis. In certain embodiments the Lactobacillus species is selected from Lactobacillus acidophilus,
Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri. In 15 certain embodiments the crystal protein is selected from Cry5B, Cry21 A,
Cry14A, Cry13A, and Cry6A. In certain embodiments the crystal protein is a truncated crystal protein. In certain embodiments the crystal protein is a variant crystal protein. In certain embodiments the truncated crystal protein is truncated after a conserved amino acid sequence of block 5. In certain
20 embodiments the truncated crystal protein is missing the last 10 amino acids of the C-terminus. In certain embodiments the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein. In certain embodiments the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24). In certain 25 embodiments the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein. In certain embodiments the truncated crystal protein is truncated at the N-terminus. In certain embodiments the truncated crystal protein does not contain the first 5 amino acids of the N-terminus. In certain embodiments the truncated crystal 30 protein is truncated at the C-terminus. In certain embodiments the crystal
protein is Cry5B and the Cry5B includes at least amino acids 30 through about 693 of SEQ ID NO:1. In certain embodiments the crystal protein is Cry13A and
the Cry13A includes at least amino acids 30 through about 688 of SEQ ID NO:2. In certain embodiments the crystal protein is Cry14A and the Cry14A includes at least amino acids 30 through about 675 of SEQ ID NO:3. In certain embodiments at least one of (a) the crystal protein is Cry21 A and the Cry21 A 5 includes at least amino acids 30 through about 685 of SEQ ID NO:4, (b) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or (c) the crystal protein is Cry6A and wherein the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ 10 ID NO:6.
According to certain embodiments of the herein described invention there is provided a method wherein the bacterium is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, 15 Lactobacillus casei, and Lactococcus lactis. According to certain herein
described embodiments there is provided a method wherein first and second recombinant bacteria are administered and each of the first and second recombinant bacterium is independently selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus 20 var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.
In certain embodiments there is provided a composition as described herein which comprises a non-invasive or non-pathogenic bacterium wherein the non-invasive or non-pathogenic bacterium is selected from B. 25 subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi
(Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis. In certain embodiments there is provided a recombinant microorganism as described herein which is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. 30 Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus
rhamnosus, Lactobacillus casei, and Lactococcus lactis.
According to certain other herein disclosed embodiments there is provided an artificial probiotic composition, comprising (a) an isolated
polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent amino acid sequence identity to a 5 Bacillus thuringiensis crystal protein that is selected from Cry5B comprising the amino acid sequence set forth in SEQ ID NO:1 , Cry21 A comprising the amino acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5, Cry14A comprising the amino acid sequence set forth in SEQ ID NO:3, Cry13A comprising the amino acid sequence set forth in SEQ ID NO:2, and Cry6A comprising the10 amino acid sequence set forth in SEQ ID NO:6; and (b) a non-invasive, non- pathogenic probiotic bacterium that is capable of remaining viable in a mammalian gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, Lactobacillus and Lactococcus. In certain 15 embodiments the Bacillus subtilis is B. subtilis, B. subtilis PY79, B. subtilis
natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, (ii) the Lactobacillus is Lactobacillus rhamnosus or Lactobacillus casei, and (iii) the Lactococcus is Lactococcus lactis. According to certain presently disclosed embodiments there is provided an artificial probiotic
20 composition, comprising (a) an isolated polypeptide that is selected from a
Bacillus thuringiensis Cry5B protein and a Bacillus thuringiensis Cry14A protein; and (b) a non-invasive, non-pathogenic probiotic bacterium that is capable of remaining viable in a mammalian gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, 25 the probiotic bacterium being selected from Bacillus subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, and B. toyonensis. In certain further embodiments the isolated polypeptide is heterologous to and admixed with the probiotic bacterium.
In another embodiment there is presently provided a method of 30 treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a gastrointestinal tract of a mammalian subject, the method comprising administering to the gastrointestinal tract of the subject a
therapeutically effective amount of an artificial probiotic composition comprising (a) an isolated polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent amino acid sequence identity to a Bacillus thuringiensis crystal protein that is selected from 5 Cry5B comprising the amino acid sequence set forth in SEQ ID NO:1 , Cry21 A comprising the amino acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5, Cry14A comprising the amino acid sequence set forth in SEQ ID NO:3, Cry13A comprising the amino acid sequence set forth in SEQ ID NO:2, and Cry6A comprising the amino acid sequence set forth in SEQ ID NO:6; and (b) a non- 10 invasive, non-pathogenic probiotic bacterium that is capable of remaining viable in the gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, Lactobacillus and Lactococcus. In certain further embodiments (i) the Bacillus subtilis is B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, 15 B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, (ii) the Lactobacillus is Lactobacillus rhamnosus or Lactobacillus casei, and (iii) the Lactococcus is Lactococcus lactis. In certain embodiments the artificial probiotic composition comprises (a) an isolated polypeptide that is selected from a Bacillus thuringiensis Cry5B protein and a Bacillus thuringiensis Cry14A 20 protein; and (b) a non-invasive, non-pathogenic probiotic bacterium that is
capable of remaining viable in the mammalian gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, and B.
25 toyonensis. In certain embodiments the isolated polypeptide is heterologous to the probiotic bacterium and is admixed with the probiotic bacterium prior to the step of administering.
In certain embodiments there is provided a method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth 30 infection in a gastrointestinal tract of a mammalian subject, the method
comprising administering to the gastrointestinal tract of the subject a
therapeutically effective amount of an artificial probiotic composition comprising
(a) an isolated Bacillus thuringiensis Cry5B protein; and (b) Bacillus subtilis natto probiotic bacteria, wherein the isolated Cry5B protein is heterologous to the probiotic bacteria and is admixed with the probiotic bacteria prior to the step of administering. In a further embodiment, the isolated Bacillus thuringiensis 5 Cry5B protein comprises a polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:1.
These and other aspects and embodiments of the herein
10 described invention will be evident upon reference to the following detailed
description and attached drawings. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference in their 15 entirety, as if each was incorporated individually. Aspects and embodiments of the invention can be modified, if necessary, to employ concepts of the various patents, applications and publications to provide yet further embodiments. BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS
Figure 1 (Figs. 1 A-1 B). Fig. 1 A illustrates the positions of
20 conserved blocks among certain Cry proteins. de Maagd, R.A., et al. “How Bacillus thuringiensis has evolved specific toxins to colonize the insect world.” TRENDS in Genetics 17(4): 193-99, 195 (Figure 2a) (April 2001 ). Figure 1 B illustrates the positions of conserved blocks among certain Cry proteins.
Schnepf, E., et al. “Bacillus thuringiensis and Its Pesticidal Crystal Proteins.” 25 Microbiology and Molecular Biology Reviews 62(3): 775-806, 781 (Figure 3) (Sept. 1998).
Figure 2 illustrates the amino acid sequence of Cry5Ba1 [SEQ ID NO:1 ].
Figure 3 illustrates the amino acid sequence of Cry13Aa1 [SEQ 30 ID NO:2].
Figure 4 illustrates the amino acid sequence of Cry14Aa1 [SEQ ID NO:3].
Figure 5 (Figs. 5A-5C). Fig. 5A illustrates the amino acid sequence of Cry21 Aa1 [SEQ ID NO:4]. Fig. 5B illustrates the amino acid 5 sequence of Cry21 Aa2 (98% identical to Cry21 Aa1 ) [SEQ ID NO:5]. Fig. 5C illustrates the amino acid sequence of Cry6A [SEQ ID NO:6].
Figure 6 illustrates the design of an expression system for heterologous protein secretion in LAB (Lactic Acid Bacteria). Expression cassettes for heterologous protein CV-N for intracellular expression (pTSV1 - 10 CVN) and secretion into the medium (pTSV1 -CVN).
Figure 7 illustrates secretion of HIV-1 fusion inhibitors by
Lactobacillus spp.
Figure 8 shows an example of cloning the pag gene into the pgm promoter system.
15 Figure 9 illustrates recombinant L. lactis MG1363 strains in which the thyA gene is replaced by the respective full-length or truncated cry gene, with or without a leader sequence, via double homologous recombination.
Figure 10 (Figs. 10A-10B) illustrate a cloning strategy with an inducible nisin promoter that uses a combination of vector-backbone exchange 20 (VBEx) and ligation independent cloning (LIC).
Figure 11 depicts PY79-Cry5B bioactivity in vitro against C.
elegans. The results shown are from dose-dependent mortality assays plotting % live C. elegans (y axis) versus Cry5B concentration (x axis). The PY79- vector strain (vector-PY79) lacked Cry5B (0 µg/ml). Each data point represents 25 the average for three independent experiments with ~75 to 90 C. elegans
organisms per experiment (~225 to 270 organisms per data point). Error bars represent standard errors.
Figure 12 (Figs. 12A-12C) shows that PY79-Cry5B had a dose- dependent therapeutic effect against hookworm infection in hamsters. (A)30 Intestinal hookworm burdens in nine hamsters following treatment with PY79-
vector or PY79-Cry5B (10 mg/kg Cry5B) (error bars in all panels show standard errors). The average worm burdens were 18.6+ 2.6 and 1.3+0.3 for PY79- vector and PY79-Cry5B, respectively. (B) Fecal egg counts on day-1 , day +1 , and day +3 relative to the day of treatment. The actual egg counts for PY79- 5 vector and PY79-Cry5B were 965 + 193 and 1 ,044 + 99, respectively, on day - 1 , 1 ,055 + 230 and 94 + 60, respectively, on day +1 , and 1 ,055 + 227 and 100 + 42, respectively, on day +3. EPG, eggs per gram of feces. (C) In vivo dose- response experiment with 12 hamsters. The average worm burdens for PY79- vector and PY79-Cry5B at Cry5B concentrations of 0.4 mg/kg, 1.4 mg/kg, and 4 10 mg/kg were 27.0 + 3.2, 15.7 + 7.0, 8.3 + 0.9, and 5.7 + 0.9, respectively.
Figure 13 shows results from an in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms as described by Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/journal.pntd.0001900). The four groups (in black, n = 7 per group) 15 shown are the intestinal worm burdens from the groups of infected hamsters treated with purified full-length B. thuringiensis Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see Fig. 2) at a single dose of 1 mg (solid circles, 10 mg/kg), 3 mg (solid upright triangles, 30 mg/kg), or 10 mg (solid inverted triangles,100 mg/kg) (715 nmoles/kg), or with 20 placebo (solid squares, ddH2O), respectively. The treatments were conducted on day 16 P.I. and intestinal worm burdens assessed on day 21 P.I. The worm burdens in each hamster are indicated with a separate symbol. Long horizontal bars represent mean worm burdens; smaller bars indicate SEM (standard error of the mean).
25 Figure 14 shows dose-response results for indicated dosages of unfractionated Cry5B-containing spore-crystal lysates (SCL) in the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms. The assay was performed according to Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900.
30 doi:10.137/journal.pntd.0001900) except instead of purified Cry5B protein the
animals received the indicated dosages, via gavage, of Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase, at which point the cells lysed releasing spores, crystals, 5 and bacterial lysate (spore crystal lysate, SCL). The amounts of Cry5B
gavaged were determined by taking known volumes of spore crystal lysates, resolving full length Cry5B protein by SDS PAGE, and quantitating the amount of protein in the Cry5B band relative to known amounts of bovine serum albumin (BSA) standards on the gel.
10 Figure 15 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/ journal. pntd.0001900) following treatment with two different dosages of Cry5B spore- crystal lysates obtained from cultured Bacillus thuringiensis natto cells that were 15 transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase.
Figure 16 shows data obtained in vitro using the C. elegans mortality assay described in Figure 11 to evaluate the effects on C. elegans of purified Cry5B protein (prepared according to Griffitts et al., 2001 Science 20 293:860; for sequence see Fig. 2) when combined in a mixture either with
sporulated B. thuringiensis HD1 or with sporulated B. subtilis PY79. For each data point, the number of spores (HD1 or PY79) was held constant and the quantity of Cry5B was titrated (x-axis).
Figure 17 shows the effects of Cry14A on an in vivo bioassay of 25 intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms.
DETAILED DESCRIPTION
Certain presently disclosed embodiments relate to unprecedented advantages, described herein for the first time, that are provided by
administering to the gastrointestinal (GI) tract of a mammalian subject a Cry 5 protein as described herein and a probiotic bacterium as also described herein, to achieve unexpectedly potent anthelmintic effects against soil-transmitted helminths (STHs). The presently provided compositions and methods will thus find a wide variety of uses, such as for treating or reducing the severity or likelihood of occurrence of STH infections. Despite recognized anthelmintic 10 properties of bacterial Cry proteins, effective therapeutic delivery of such
proteins to GI sites of STH infection and parasite residence has not previously been achieved, where in vivo degradation and poor absorptive properties have heretofore precluded useful exploitation of Cry protein anthelmintic effects.
As described herein, orally administering the combination of a 15 bacterial Cry protein with a non-pathogenic, non-toxic, non-invasive bacterium such as a probiotic bacterium surprisingly provides delivery of effective anthelmintic activity to the lower GI tract, where STH parasites reside. Artificial probiotic microbes that are engineered to express heterologous Cry proteins are thus hereby contemplated for anthelmintic therapy according to certain 20 embodiments, which may include oral delivery of one or more of live
engineered probiotic bacteria, killed bacteria, and/or bacterial spore-crystal lysates, optionally in further combination with purified Cry proteins and/or other therapeutic agents such as nicotinic acetylcholine receptor agonists or benzimidazole anthelmintic agents. In certain embodiments, unexpectedly 25 superior anthelmintic potency may be achieved by administering the
combination of sporulated probiotic bacteria and a heterologous Cry protein. Accordingly, certain herein disclosed embodiments relate to unexpectedly advantageous anthelmintic activity of orally administered artificial probiotic bacteria that have been engineered to express heterologous Cry proteins, and 30 certain other herein disclosed embodiments relate to surprisingly potent
anthelmintic effects that reside in a composition which comprises a mixture of certain unmodified probiotic bacteria (e.g., in preferred embodiments Bacillus subtilis natto or Bacillus subtilis PY79) with isolated heterologous Cry proteins (e.g., Cry5A, Cry14A, etc.).
5 Probiotic microbes, for example by way of illustration and not limitation, Bacillus subtilis (e.g., Bacillus subtilis natto, Bacillus subtilis PY79, or other strains described herein and known in the art) and Lactobacillus, are present in the human gastrointestinal tract at densities of up to 108/gram (Wells and Mercenier, NAT REV MICROBIOL 6:349-362 (2008)). Bacillus subtilis has 10 been extensively characterized as a safely ingested food additive in humans (see Example 14, infra, references 15-27). Braat et al., (2006) CLIN
GASTROENTEROL HEPATOL 4:754-759 gave human patients orally 1010
Lactococcus lactis twice daily for 7 days as part of a phase I clinical trial. Mice can be given orally 2x109 Lactococcus lactis (Waeytens et al., INFLAMM BOWL 15 DIS 14:471 -479 (2008)). Therefore, these bacteria can be ingested safely at relatively large concentrations.
These Lactobacillus species are human commensal bacteria that naturally reside in the human mouth, intestine, and vagina. Bacillus subtilis and Lactobacillus are acid tolerant and bile resistant and therefore survive passage 20 through the stomach and remain viable in the small intestine, where the Cry protein can be expressed and secreted to the intestinal mucosa. Thus, production of a Bacillus subtilis or Lactobacillus or other probiotic bacterial strain capable of expression and secretion of Cry proteins in the small and large intestines will according to certain herein disclosed embodiments provide a 25 valuable delivery vehicle for Cry proteins. Lactobacilli or Bacillus subtilis
genetically engineered to express Cry proteins can be propagated easily to high concentrations, isolated, lyophilized and stored indefinitely. These production technologies are widely used worldwide to produce“dried” starter cultures for food fermentations (e.g., dried baker’s yeast). Furthermore, certain probiotic 30 bacteria such as Lactobacillus rhamnosus and Lactobacillus casei have been
shown to reduce the burden of intestinal helminthes (McClemens, J., et al Clinical and Vaccine Immunology 20(6) p. 818–826 (2013) and Berrelli, F., et al Frontiers in Cellular and Infection Microbiology 2 Article 141 (2012). Thus, as described herein for the first time, these or other Lactobacilli or probiotic
5 bacteria, e.g., Bacillus subtilis, maybe combined with a Cry protein to achieve a surprisingly effective and synergistic anthelmintic effect.
A probiotic microbe, e.g., Lactobacillus or Bacillus subtilis (e.g., B. subtilis strain PY79 or Bacillus subtilis natto), which is known to survive gastric transit and which can act as a live oral delivery vector, may be used in certain 10 embodiments for delivery of Cry proteins in the GI tract. Cry proteins may be cloned, expressed, and ultimately secreted in active form in the GI tract of the subject after administration. Recombinant probiotic bacteria that can
successfully and safely express biotherapeutic proteins in humans for clinical benefit already exist, e.g., for secretion of the anti-inflammatory cytokine IL-10 15 for treatment of colitis. (Steidler, L. et al. Science 289, 1352-1355 (2000) ;
Braat, H. et al. Clin Gastroenterol Hepatol 4, 754-759 (2006); and Steidler, L. et al. Nat Biotechnol 21 , 785-789 (2003)). This study demonstrated the safety and tolerability of orally formulated genetically-modified bacteria in humans and also verified that the bacteria were environmentally contained (did not propagate 20 outside the human host). These and other studies indicate that: 1 ) probiotic bacteria are generally safe; and 2) probiotic bacteria may be genetically modified to synthesize and secrete therapeutic proteins to the mammalian GI tract.
Probiotic bacteria are particularly applicable to the control of STHs 25 because 1 ) probiotic bacteria can transiently (up to 3 weeks) pass through the small and large intestines, thereby secreting anthelmintics into the region where substantially all the STHs reside, 2) recombinant probiotic bacteria can cheaply express large amounts of Cry proteins prior to administration into the GI tract of a mammalian subject, and Cry proteins so expressed, independent of any Cry 30 proteins that may be secreted by probiotic bacteria in the GI tract, have been
shown to have a significant impact on STHs, and 3) studies using purified Cry protein to treat hookworms, whipworms, and H. bakeri, all in infected rodents, demonstrated that STHs in the mammalian GI tract can ingest and be
killed/intoxicated by Cry proteins.
5 Probiotic bacterium for use in this invention include but are not limited to Lactococcus sp., Lactobacillus sp., Bifidobacterium sp.,
Streptococcus sp., Leuconostoc sp., Pedicoccus sp., Enterococcus sp. Bacillus sp., and Escherichia sp. Lactococcus sp. includes but is not limited to L. lactis. Lactobacillus sp. includes but is not limited to L. casei, L. paracasei, L.
10 acidophilus, L. bulgaricus, L. delbrueckii subsp. bulgaricus, L. helveticus, L. plantarum, L. salivarius, L. reuteri, L. gasseri, and L. animalis. Bifidobacterium sp. includes but is not limited to B. animalis, B. bifidum, B. breve, B. infantis, and B. longum. Streptococcus sp. includes but is not limited to S. thermophilus. Bacillus sp. includes but is not limited to B. subtilis, B. subtilis natto, B. cereus, 15 B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, B. toyonensis, B.
thuringiensis, B. clausii, and B. pumilus. Escherichia sp. includes but is not limited to E. coli.
Probiotic yeast for use in certain contemplated embodiments of this invention include but are not limited to Saccharomyces sp., e.g.,
20 Saccharomyces boulardii.
CRYSTAL PROTEINS
One goal according to certain herein disclosed embodiments is expression of anthelmintic Cry proteins (e.g., Crickmore et al., 1998
Microbiology and Molecular Biology Reviews 62(3): 807-813; Schnepf et al., 25 1998 Microbiology and Molecular Biology Reviews 62(3): 775-806; including but not limited to the B. thuringiensis Cry proteins Cry5B (e.g., SEQ ID NO:1 ) and its subvariants, Cry13A (e.g., SEQ ID NO:2) and its subvariants, Cry14A (e.g., SEQ ID NO:3) and its subvariants, Cry21 A (e.g., SEQ ID NOS:4-5) and its subvariants, and Cry6A and its subvariants (e.g., SEQ ID NO:6)) in probiotic 30 bacterium for delivery into a helminth (e.g., roundworm)-infected vertebrate
animal gastrointestinal tract via oral dosing (gavage, drinking, eating, pill, capsule, powder, etc.). The Cry protein may be expressed intracellularly in the bacterium, allowing access to the anthelmintic protein after the bacterium lyses or opens up either due to digestion within the gastrointestinal tract, sporulation 5 of certain bacteria, death of bacteria, ingestion and digestion of bacteria by the parasitic helminths (e.g., roundworms such as hookworms, whipworms, Ascaris, Strongyloides, veterinary parasitic roundworms of the intestine), etc. The Cry protein may also be expressed and secreted extracellularly by the probiotic bacterium so that the protein would be deposited directly into the GI 10 tract where it could be accessed and ingested by any helminth (e.g.,
roundworm) inhabiting the GI tract. The Cry proteins may also be expressed in such a way that they are exposed to the extracellular environment of the bacterium and remain anchored to the cell wall of the probiotic bacterium.
In certain embodiments, a probiotic bacterium as provided herein 15 (which may in certain embodiments be LAB as described herein for certain
illustrative purposes but which may in certain other embodiments be another probiotic bacterium such as Bacillus subtilis and others) may be introduced that expresses an individual Cry protein or that simultaneously expresses multiple Cry proteins. Additionally or alternatively, in certain embodiments multiple 20 probiotic bacteria may be introduced, each of which expresses either a different individual Cry protein or simultaneously expresses multiple Cry proteins. In these and related embodiments, it is contemplated that the GI tract may be seeded with probiotic bacteria that express either one Cry protein or multiple Cry proteins at the same time. For example, due to the lack of cross-resistance 25 between Cry5B-resistant roundworms and Cry21 A-resistant roundworms,
simultaneous expression of Cry5B and Cry21 A in the gastrointestinal tract may inhibit the development of parasite resistance to the combination therapy.
In certain embodiments, a probiotic bacterium as provided herein (which may in certain embodiments be LAB as described herein for certain 30 illustrative purposes but which may in certain other embodiments be another
probiotic bacterium such as Bacillus subtilis and others) which has not been genetically modified to express a heterologous Cry protein may be admixed and introduced into a mammalian GI tract along with purified Cry5B protein, e.g., heterologous Cry5B that has been expressed and purified from Bacillus
5 thuringiensis. As described herein for the first time, a composition so formed by such admixture exhibited heretofore unpredicted biological activity, in a manner such that the specific probiotic bacterium (e.g., Bacillus subtilis natto, Bacillus subtilis PY79) synergized with Cry5B protein to enhance its anthelmintic properties.
10 In the long run, removing antibiotic selection capability (e.g.,
genetic selection markers) from the plasmids that are employed to introduce heterologous Cry protein-encoding sequences, as well as using probiotic (e.g., lactobacillus or LAB) strains that are unable to replicate outside the vertebrate host, may be desirable in order to environmentally contain the genetically 15 modified bacteria. For example, LAB bacteria have been engineered to be
autotrophic in thymidine or thymine synthesis such that they can only grow in the vertebrate intestine where thymidine or thymine is present and not in the environment where thymidine or thymine is not present. See, e.g., Steidler L, et al.“Biological containment of genetically modified Lactococcus lactis for
20 intestinal delivery of human interleukin 10.” Nat Biotechnol 21 : 785-789 (2003).
Cry-transformed probiotic bacteria such as Bacilli or LAB may be cultured and expression of intracellular, membrane-anchored, or secreted Cry protein by such bacteria may be confirmed using antibodies raised against each Cry protein and standard Western blotting or ELISA techniques.
25 To assess the bioactivity of all constructs, recombinant LAB- expressing Cry protein (full length, truncated, or variants) may be fed to the free-living nematode, C. elegans. Cry protein toxicity on C. elegans using LC50, brood-size, developmental inhibition assays on solid media and in liquid wells may then be quantitated. C. elegans can access the Cry proteins either 30 via protein secreted onto the solid media/into the liquid well or by their ability to
grind, open and digest bacteria. Confirmation that the lactobacilli are making bioactive Cry proteins may be obtained. Furthermore, the bioactivity (e.g., LC50 in μg/mL) may be quantitated and the constructs giving the highest activity determined.
5 TRUNCATIONS, VARIANTS, AND SUB-VARIANTS
The crystal proteins may be truncated to enhance their
effectiveness. The usefulness of Bt toxins (e.g., crystal proteins) for controlling STHs may be limited by the protein size that STHs can ingest. Some parasitic roundworms poorly ingest proteins larger than about 40 kD. Thus, the
10 effectiveness of any particular Bt toxin may be limited by size exclusion of
proteins that STHs take in and so should be small enough to be readily absorbed by the STH gut while retaining toxic activity. There are other compelling reasons to produce a toxin truncated from the full length version. A truncated toxin may be easier to express in probiotic bacteria or yeast.
15 Producing a truncated toxin will also alleviate the requirement that the target STH has the proper proteases present to correctly process full length protoxin (which is inactive) to a truncated, active toxin form. Thus, a truncated toxin will be immediately available for intoxication independent of whether the proper protease processing enzymes are present in the STH target. Truncated toxin 20 may also express at a higher level in probiotic bacteria or yeast because
truncated toxins are soluble and less likely to form insoluble inclusions in the cell expressing them, which could be toxic to the cell or which could make the toxin fold incorrectly. Accordingly, it is desirable to produce truncated Bt toxin fragments (e.g., crystal protein fragments). Moreover, fragments of certain Bt 25 toxins have been tested and shown to retain toxic activity and have improved biological properties. By "truncated," when referring to a Bt toxin protein (crystal protein) is meant a Bt toxin protein that is not full-length but retains at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% or more of the toxic activity of a corresponding full-length Bt toxin protein.
"Variants" or“subvariants” of Cry proteins include polypeptides with one or more substitutions, e.g., no more than 20 substitutions, alternatively no more than 10 substitutions, or substitutions at 10% or fewer of the residues, relative to a corresponding wild-type polypeptide or truncated version thereof. 5 The variant, subvariant, or truncated polypeptide has at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the activity, e.g., toxic activity, of the corresponding wild-type polypeptide or truncated version. Conservative substitutions include substitutions within the following groups: glycine, alanine, threonine, valine, isoleucine, leucine; aspartic acid, glutamic acid, asparagine, 10 glutamine; serine, cysteine; lysine, arginine; aspartic acid, glutamic acid; serine, threonine; asparagine, glutamine; phenylalanine, tyrosine.
Nucleic acid molecules encoding amino acid sequence variants, truncated versions, or both, of a Cry protein are prepared by a variety of methods known in the art. These methods include, but are not limited to, 15 isolation from a natural source (in the case of naturally occurring amino acid sequence variants) or preparation by, for example, oligonucleotide-mediated (or site-directed) mutagenesis, PCR mutagenesis, and cassette mutagenesis of an earlier prepared variant or a non-variant version of protein. Moreover, the invention includes synthetic nucleic acid molecules where nucleotides are 20 modified to include codons preferred in a particular organism, remove codons rarely used in a particular organism, or remove sequences that may inhibit transcription or RNA processing and the like.
Cry protein truncations may at least include conserved blocks 1 -5. As seen in Figures 1 A and 1 B, alignment of known Cry toxins reveals five 25 conserved sequence blocks (blocks 1 -5) that are common to a majority of the proteins and are thought to be located in the active toxin domain. See de Maagd, R.A., et al. “How Bacillus thuringiensis has evolved specific toxins to colonize the insect world.” TRENDS IN GENETICS 17(4): 193-99 (April 2001 ). Comparison of the carboxy-terminal halves of the sequences have suggested 30 the presence of three additional blocks that lie outside of the active toxic core.
See Schnepf, E., et al. “Bacillus thuringiensis and Its Pesticidal Crystal
Proteins.” MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS 62(3): 775-806 (Sept. 1998). Thus, Cry protein truncations may be truncated after the conserved amino acid sequence of block 5 (e.g., DRIEF (SEQ ID NO: 23) or 5 DRLEF (SEQ ID NO: 24)). Alternatively, Cry protein truncations may be
truncated after the conserved amino acid sequence of block 5 (e.g., DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24)) plus an additional about 2, 3, 4, 5, 10, 15, 20, 25, 30, 35, 40, 45, or 50 amino acids of the c-terminal domain.
The complete amino acid sequence of Cry5Ba1 is listed in
10 Figure 2. The conserved amino acid sequence DRIEF (SEQ ID NO: 23) in Cry5B ends at amino acid number 693. Thus, a truncated form of Cry5B may include at least amino acids 50 through about 693. A truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 693. Alternatively or in addition 15 to, a truncated form of Cry5B may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
The complete amino acid sequence of Cry13Aa1 is listed in Figure 3. The conserved amino acid sequence DRLEF (SEQ ID NO: 24) in Cry13A ends at amino acid number 688. Thus, a truncated form of Cry13A 20 may include at least amino acids 50 through about 688. A truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at least about amino acid 688. Alternatively or in addition to, a truncated form of Cry13A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
25 The complete amino acid sequence of Cry14Aa1 is listed in
Figure 4. The conserved amino acid sequence DRIEF (SEQ ID NO: 23)in Cry14A ends at amino acid number 675. Thus, a truncated form of Cry14A may include at least amino acids 50 through about 675. A truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30 30, 35, 40, 45, or 50 to at least about amino acid 675. Alternatively or in
addition to, a truncated form of Cry14A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
The complete amino acid sequence of Cry21 Aa1 and Cry21 Aa2 are listed in Figures 5A and 5B, respectively. The amino acid sequence of 5 Cry21 Aa2 is about 98% identical to the sequence of Cry21 Aa1. The conserved amino acid sequence DRIEF (SEQ ID NO: 23) in Cry21 A ends at amino acid number 685. Thus, a truncated form of Cry21 A may include at least amino acids 50 through about 685. A truncated form of Cry5B may extend from about amino acid 1 , 2. 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 to at 10 least about amino acid 685. Alternatively or in addition to, a truncated form of Cry21 A may include about 5, 10, 15, 20, 25, 30, 35, or 40 additional amino acids of the c-terminal domain.
ANTHELMINTIC EXPERIMENTS
Once heterologous Cry protein expression and bioactivity are 15 confirmed in a desired probiotic bacterium, the modified bacteria may be used for curative-type and preventative-type anthelmintic experiments. By way of non-limiting example, the Bacillus or LAB strain expressing heterologous Cry protein may be any of the Bacilli or LAB mentioned above expressing either full length or truncated heterologous Cry protein (e.g., B. thuringiensis Cry5B, 20 Cry13A, Cry14A, or Cry21 A) with that Cry protein expressed intracellularly, anchored at the membrane, or secreted.
Antibody production: Antibodies against recombinant Cry proteins (e.g., Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A, full length and truncated proteins) may be produced and purified according to standard methodologies 25 (e.g., Current Protocols in Immunology, John Wiley & Sons, New York,
N.Y.(2009).
Bioactivity tests: To assess the bioactivity of all constructs, recombinant bacilli or lactobacilli expressing heterologous Cry proteins are fed to the free-living nematode, C. elegans. C. elegans can access the Cry
proteins either via protein secreted onto the solid media/into the liquid well or by their ability to grind and digest bacteria to open the bacterial cells.
Rodent and parasite tests: Three intestinal parasitic nematodes— H. bakeri (small intestine nematode parasite) in mice, and Trichuris muris 5 (whipworm) in mice, and A. ceylanicum (hookworm) in hamsters are tested.
The tests address: 1 ) where in the GI tract do heterologous Cry-expressing bacilli or lactobacilli reside and for how long; and 2) how do these bacilli or lactobacilli affect the acquisition and progression of intestinal nematode parasites.
10 Bacillus, Lactobacillus or Lactococcus tests: Mice are gavaged with high doses of heterologous Cry-expressing Bacillus subtilis, Lactobacillus or Lactococcus (109 cfu). A portion of the mice are periodically (twice/week up to one month) euthanized. Small and large intestinal homogenates can be prepared after washing intact tissue with Hanks’ balanced salt solution twice 15 and after removing the mucous layer and epithelium by 1 mM DTT twice and then 10 mM EDTA. Plating of these homogenates on medium plates ,such as GM17 agar supplemented with an antibiotic appropriate to the selectable marker used on the expression system, will select for the bacterium. In addition, immunoblotting of plate colonies, transferred to nitrocellulose
20 membrane, with anti-Crystal protein antibodies will be used to reveal which of the colonies on the plate are Cry-expressing bacteria. From these experiments, the colony forming units from the homogenates can be determined, indicative of how well the Cry-transformed bacteria are able to colonize the gastrointestinal tract over time (For an example, see Waeytens et al., Inflamm Bowel Dis 2008: 25 14:471 -479).
Parasite tests: Naïve (uninfected mice) are gavaged with the best heterologous Cry-protein expressing Bacillus, Lactobacillus or Lactococcus strain(s) based on expression and bioactivity. Protect against acquisition test: Control mice receive the native (unmodified) Bacillus, Lactobacillus or 30 Lactococcus which is incapable of Cry protein expression. A few days later,
both groups of mice are then challenged with H. bakeri. Two weeks later, intestinal worm burdens and fecal egg counts are used to determine if the probiotics protect the mice against a challenge with infectious parasites.
Protest against progression test: Mice are infected with H. bakeri. Two weeks 5 later, infected mice are treated with heterologous Cry-protein expressing or control bacilli, lactobacilli, or lactococci, respectively. Intestinal worm burdens and fecal egg counts are used to determine if the probiotics provide
anthelmintic therapy in mice with pre-existing nematode infections.
Exemplary Parasites
10 The present invention relates in certain preferred embodiments to the control of parasitic worms, e.g., nematodes and platyhelminths, using crystal proteins from Bacillus and their derivatives. Parasitic worms within the scope of the invention include but are not limited to those in Class
Adenophorea, e.g., Order Mononchida, Family Plectidae, and Order
15 Stichosomida, Family Mermithidae and Tetradonematidae; Class Secernentea, e.g., Order Rhabditida, Family Carabonematidae, Cephalobidae,
Chambersiellidae, Heterorhabditidae, Oxyuridae, Panagrolaimidae,
Rhabditidae, Steinernematidae, Syrphonematidae, Syrphonematidae, or Thelastomatidae; Order Spirurida, Family Filariidae, Onchocercidae,
20 Physalopteridae, Syngamidae, Spiruridae, Subuluridae, or Thelaziidae; Order Diplogasterida, Family Diplogasteridae; and Order Tylenchida, Family
Allantonematidae, Aphelenchidae, Aphelenchoididae, Entaphelenchidae, Fergusobiidae, Phaenopsitylenchidae, Sphaerulariidae, Anguinidae,
Dolichodoridae, Belonolaimidae, Pratylenchidae, Hoplolamidae, Heteroderidae, 25 Criconematidae, Tylenchulidae or Tylenehidae. In one embodiment, the
parasite is from Class Secernentea, Order Ascaridida, Family Ascarididae; Class Adenophorea, Order Trichurida, Family Trichuridae; Class Secernentea, Order Strongylida, Family Ancylostomatidae (ancylostomidae) or
Trichostrongylidae; or Class Secernentea, Order Spirurida, Family
30 Dracunculidae, Filariidae, or Onchocercidae.
The parasite may be a helminth. Helminths within the scope of the invention include but are not limited to those from Phylum Annelida, Class Polychaetae, Class Myzostomida, Class Clitellata, Subclass Hirudinea, Order Gnathobdellidae, Order Rhynchobdellidae; Phylum Platyhelminthes
5 (Flatworms), Class Turbellaria, Class Monogenea, Order Monopisthocotylea, Order Polyopisthocotylea, Class Trematoda, Subclass Aspidogasrea, Subclass Digenea; Super Order Anepitheliocystida, Order Strigeatida, Family
Schistosomatidae, Subfamily Schistosomatinae, Genus Schistosoma, Order Echinostomatida, Family Fasciolidae, Family Paramphistomatidae, Family 10 Echinostomatidae; Super Order Epitheliocystida, Order Plagiorchiida, Family Dicrocoeliidae, Family Troglotrematidae, Order Opisthorchiida, Family
Heterophyidae, Family Opisthorchiidae, Class Cestoda, Subclass Cestodaria, Subclass Eucestoda, Order Pseudophyllidea, Family Diphyllobothriidae, Order Cyclophyllidea, Family Taeniidae, Family Hymenolepididae, Family Dilepididae, 15 Family Mesocestoididae, Order Tetraphyllidea, Order Proteocephalata, or
Order Spatheobothridea. For example, Cry proteins with the scope of the invention may be employed to prevent, inhibit or treat Roundworm, Whipworm, Hookworm, Schistosome, or Trematodes.
The parasite may also be a gastrointestinal tract parasitic
20 roundworms/nematodes. The gastrointestinal tract parasitic
roundworms/nematodes may include but are not limited to the following species: Haemonochus, Cooperia, Ostertagia, Trichostrongylus, Teladorsagia, Nematodirus, Ancylostoma, Cyathostominea/Cyathostomin/Cyathostome, Strongylus, Parascaris, Ascaris, Trichuris,
25 Oesophagostomum/Oesophagustomum, Trichiuris, Bunostomum, Oxyuris, Chabertia, Habronema, Draschia, Triodontophorus, Toxocara, Toxascaris, and Uncinaria. Haemonochus species includes but is not limited to Haemonchus contortus and Haemonchus placei, Cooperia species includes but is not limited to Cooperia oncophora, Cooperia pectinata, and Cooperia curticei. Ostertagia 30 species includes but is not limited to Ostertagia ostertagi, Ostertagia
(Teladorsagia) circumcincta, and Ostertagia trifurcate. Trichostrongylus species includes but is not limited to Trichostrongylus axei, Trichostrongylus colubriformis, and T. circumcincta. Teladorsagia species includes but is not limited to Teladorsagia (Ostertagia) circumcincta. Nematodirus species 5 includes but is not limited to Nematodirus spathiger. Ancylostoma species includes but is not limited to Ancylostoma caninum, Ancylostoma braziliense, and Ancylostoma tubaeforme. Cyathostominea/Cyathostomin/Cyathostome nematodes are also included. Strongylus species (small and large) includes but is not limited to Strongylus vulgaris, Strongylus equinus, and Strongylus 10 edentatus. Parascaris species includes but is not limited to Parascaris
equorum. Strongyloides species includes but is not limited to Strongyloides westeri. Ascaris species includes but is not limited to Ascaris suum. Trichuris species includes but is not limited to Trichuris globulosa, Trichuris suis, Trichuris campanula, and Trichuris vulpis. Oesophagostomum/
15 Oesophagustomum species includes but is not limited to Oesophagustomum dentatum, Oesophagustomum quadrispinulatum, Oesophagostomum columbianum, and Oesophagostomum venulosum. Trichiuris species includes but is not limited to Trichiuris ovis. Bunostomum species includes but is not limited to Bunostomum trigonocephalum. Oxyuris species includes but is not 20 limited to Oxyuris equi (pin worms). Chabertia species includes but is not limited to Chabertia ovina. Habronema species includes but is not limited to Habronema microstoma and Habronema muscae. Draschia species includes but is not limited to Draschia megastoma. Triodontophorus species includes but is not limted to Triodontophorus minor and Triodontophorus serrates.
25 Toxocara species includes but is not limted to Toxocara canis and Toxocara cati. Toxascaris species includes but is not limted to Toxascaris leonine.
Uncinaria species includes but is not limted to Uncinaria stenocephala. Human parasitic roundworms of the gastrointestinal tract include but are not limited to the hookworms Ancylostoma duodenale and Necator americanus, the
whipworm Trichuris trichiura, the roundworm Ascaris lumbricoides, the threadworm Strongyloides stercoralis, and the pinworm Enterobius vermiculari.
As used herein, unless the context makes clear otherwise, "treatment," and similar words such as“treated,”“treating” etc., indicates an 5 approach for obtaining beneficial or desired results, including and preferably clinically desirable results. Treatment can involve optionally either the amelioration of symptoms of the disease or condition, or the delaying of the progression of the disease or condition.
As used herein, unless the context makes clear otherwise, 10 “reducing the likelihood of occurrence,” "prevention," and similar words such as “prevented,”“preventing” etc., include approaches for preventing, inhibiting, or decreasing the likelihood of the onset or recurrence of a disease or condition, in a manner that exhibits statistical significance, for example, when compared to the results obtained when the indicated method steps are omitted. Similarly, 15 also included are preventing, inhibiting, or decreasing the likelihood of the
occurrence or recurrence of the symptoms of a disease or condition, or optionally delaying the onset or recurrence of a disease or condition, or delaying the occurrence or recurrence of the symptoms of a disease or condition. As used herein,“prevention” and similar words also include reducing 20 the intensity, effect, symptoms and/or burden of a disease or condition prior to onset or recurrence of the disease or condition. Methods according to these and related embodiments may be practiced using an effective amount or a therapeutically effective amount of an agent that substantially eradicates, reduces the severity of, or reduces the likelihood of occurrence of a soil- 25 transmitted helminth (STH) infection. As used herein, an“effective amount” or a“therapeutically effective amount” of a composition, agent or substance is that amount sufficient to obtain a desired biological effect, such as beneficial results, including clinical results.
In certain preferred embodiments, the herein described
30 compositions for treating or reducing the severity or likelihood of occurrence of
an STH infection will be formulated as pharmaceutical compositions, which will preferably be formulated for oral delivery. Pharmaceutical compositions are formulated so as to allow the agent(s) contained therein to be bioavailable upon administration of the composition to a human.
5 It will be appreciated that the practice of the several embodiments of the present invention will employ, unless indicated specifically to the contrary, conventional methods in virology, immunology, microbiology, molecular biology and recombinant DNA techniques that are within the skill of the art, and many of which are described below for the purpose of illustration. 10 Such techniques are explained fully in the literature. See, e.g., Current
Protocols in Molecular Biology or Current Protocols in Immunology, John Wiley & Sons, New York, N.Y.(2009); Ausubel et al., Short Protocols in Molecular Biology, 3rd ed., Wiley & Sons, 1995; Sambrook and Russell, Molecular
Cloning: A Laboratory Manual (3rd Edition, 2001 ); Maniatis et al. Molecular 15 Cloning: A Laboratory Manual (1982); DNA Cloning: A Practical Approach, vol. I & II (D. Glover, ed.); Oligonucleotide Synthesis (N. Gait, ed., 1984); Nucleic Acid Hybridization (B. Hames & S. Higgins, eds., 1985); Transcription and Translation (B. Hames & S. Higgins, eds., 1984); Animal Cell Culture (R.
Freshney, ed., 1986); Perbal, A Practical Guide to Molecular Cloning (1984) 20 and other like references.
Standard techniques may be used for recombinant DNA, oligonucleotide synthesis, and tissue culture and transformation (e.g., electroporation, lipofection). Enzymatic reactions and purification techniques may be performed according to manufacturer's specifications or as commonly 25 accomplished in the art or as described herein. These and related techniques and procedures may be generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification. Unless specific definitions are provided, the nomenclature utilized 30 in connection with, and the laboratory procedures and techniques of, molecular
biology, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well known and
commonly used in the art. Standard techniques may be used for recombinant technology, molecular biological, microbiological, chemical syntheses, chemical 5 analyses, pharmaceutical preparation, formulation, and delivery, and treatment of patients.
As used in this specification and the appended claims, the singular forms“a,”“an” and“the” include plural references unless the content clearly dictates otherwise. Throughout this specification, unless the context 10 requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers. Each embodiment in this specification is to be applied mutatis mutandis to every other embodiment 15 unless expressly stated otherwise. Equivalents
While particular steps, elements, embodiments and applications of the present invention have been shown and described herein for purposes of illustration, it will be understood, of course, that the invention is not limited 20 thereto since modifications may be made by persons skilled in the art,
particularly in light of the foregoing teachings, without deviating from the spirit and scope of the invention. Accordingly, the invention is not limited except as by the appended claims.
The following Examples are presented by way of illustration and 25 not limitation. EXAMPLE 1
EXPRESSION OF CRY PROTEINS IN LACTOBACILLUS (LAB)
Cry proteins (full length protoxins and truncated toxins; 4 constructs total) are cloned and expressed in two Lactobacilli, L. acidophilus and L. gasseri. The Klaenhammer group at North Carolina State University has sequenced the genome of L. acidophilus NCFM and L. gasseri ATCC33323 5 and developed numerous genetic tools for gene cloning and expression of proteins, enzymes, and vaccines in these microbes. See, e.g.,
Mohamadzadeh, et al. PNAS 106,4331 -6 (2009)) and Goh, Y.J. et al. APPL ENVIRON MICROBIOL 75, 3093-105 (2009))
To enhance translation efficiency and Cry protein expression, 10 codon optimization can be employed in which the codon use of a given Cry protein is altered to match that of the most frequently used codons found in the probiotic bacterium of interest. An example of successful application of this technique is given in Pusch et al., J Acquir Immune Defic Syndr 40:512-520 (2005). An example of a codon optimization tool that can be found by simple 15 googling“codon optimization tool” is the website http://www.jcat.de/, which includes genome information from probiotic bacteria. Thus, this website can be used to codon optimize a Cry protein for expression in a particular probiotic bacterium. Level of product and/or secretion of Cry proteins (e.g., Cry5B and Cry21 A) are determined using Western blotting with antibodies. The use of 20 different probiotic species, different Cry proteins (e.g., Cry5B and Cry21 A), and different versions of each (full length and truncated constructs) will maximize likelihood of success in Cry protein expression. The genetic constructs may also include a genetic strategy for containment of genetically modified bacterium, e.g., a thymidine auxotroph. (Steidler, L. et al., Nat. Biotechnol. 21 : 25 785-89 (2003))
Anthelmintic Cry proteins (including and not limited to Cry5B and its subvariants, Cry13A and its subvariants, Cry14A and its subvariants, and Cry21 A and its subvariants) are expressed, as both intracellularly expressed and secreted forms, in lactic acid bacteria (LAB) such as Lactobacillus
30 plantarum NCIMB8826 or ATCC 14917, Lactococcus lactis MG1363, and
Lactobacillus gasseri ATCC 9857 using the pTSV1 and pTSV2 vectors. (See Pusch O, et al.“Bioengineering lactic acid bacteria to secrete the HIV-1 virucide cyanovirin.” J ACQUIR IMMUNE DEFIC SYNDR 40: 512-520 (2005) and Pusch O, et al. “An anti-HIV microbicide engineered in commensal bacteria: secretion of 5 HIV-1 fusion inhibitors by lactobacilli.” AIDS 20: 1917-1922 (2006)) This
expression system (pTSV1 and pTSV2 vectors) includes derivatives of the pTREX1 broad Gram-positive host range vector as well as the pUC origin of replication and ampicillin resistance gene to enable them to be used as shuttle vectors in E. coli. Expression is driven by the phage promoter LPS2 followed 10 by the translation initiation region from L. lactis promoter 11. These elements contain Shine-Dalgarno as well as ATG and ATGA start/stop translation inititaiton codons. Figures 6 and 7 describe these vectors and their use for heterologous expression of other proteins. The vectors are assembled using PCR and restriction sites and common molecular biology techniques. See id. 15 Figure 6 depicts the design of an expression system for
heterologous protein secretion in LAB - expression cassettes for Cry5B for intracellular expression (pTSV1 -Cry5B) and secretion into the medium (pTSV2- Cry5B). Restriction sites used for cloning are in bold. Usp45 leader indicates gene fusions with the leader sequence of the lactococcal secreted protein 20 Usp45, followed by its original signal peptidase cleavage site DTNSD (SEQ ID NO: 25) (D) for enhanced secretion (pTSV2-Cry5B). Vertical black arrows indicate the signal peptidase cleavage site (SPCS), followed by Cry5B directly (pTSV2- Cry5B) or propeptide sequence DTNSD (SEQ ID NO: 25) (pTSV2- Cry5B / pTSV2-D- Cry5Bco). Cry5B co indicates codon optimization of Cry5B 25 for expression in recombinant LAB. TT1 and TT2 indicate transcription
terminators; LPS2 P, LPS2 bacteriophage promoter; SD, Shine-Dalgarno motif; ATG and ATGA (start/stop), translation initiation start codons; P11 TIR, translation initiation region from L. lactis promoter 11 See Pusch, O. et al., “Bioengineering Lactic Acid Bacteria to Secrete the HIV-1 Virucide Cyanovirin” 30 J Acquir Immune Defic Syndr 40(5): 512-20 (Dec 15, 2005).
Figure 7 depicts a pTSV2 expression and secretion cassette. Fusion inhibitor sequences are codon adjusted to the codon usage of L.
plantarum and are introduced into unique EcoRI and BamHI restriction sites. Expression is driven by the phage promoter LPS2. See Pusch, O et al., “An 5 anti-HIV microbicide engineered in commensual bacteria: secretion of HIV-1 fusion inhibitors by lactobacilli.” AIDS 20: 1917-22 (2006).
Using either a unique engineered restriction site (e.g., Bcl 1 , Nae 1 , or other appropriate restriction site compatible with each Cry gene and the vectors) or PCR sewing, the Cry gene is fused downstream in-frame of the 10 ATGA sequence in the P11 TIR region. In the case of intracellular Cry protein expression, this pTSV1 vector system is sufficient. In the case of secreted Cry protein expression, the lactococcal signal leader derived from the usp45 gene of L. lactis is fused just downstream of the ATGA sequence (vector pTSV2) and upstream of the Cry gene, which will allow the Cry protein to be fused to the 15 signal sequence. In all cases, the TT2 transcription terminator is placed
downstream of the Cry gene sequence. Both full-length (pro-toxin) and truncated (e.g., amino acids 1 -697 of Cry5B and similar truncations in Cry13A, Cry14A, and Cry21 A, which removes the protoxin domain just after conserved block 5 (or box V)) Cry proteins are expressed this way. The advantage of 20 truncated Cry proteins is that they may be easier to express or secrete due to their smaller size. To aid in secretion of the Cry protein, the negatively charged peptide DTNSD (SEQ ID NO: 25) (the first five amino acids of the secreted L. lactis Usp435 protein) may be fused (using recombinant DNA techniques) to the N-terminus of the Cry protein. See id. In addition, the codon usage of the 25 Cry protein can be optimized using codon usage found in each LAB to permit higher levels of expression in that LAB. See id. Once assembled, the vectors (each Cry protein, full length and truncated versions, intracellular expression and extracellular secretion versions) are transformed into L. lactis, L. plantarum, L. gasseri, or other LAB using standard techniques. See id. It has been found
that expression from these vectors are compatible with these three (and likely many more) LAB. See id.
In addition to expression of intracellular Cry protein and secreted Cry protein, the vectors are modified to allow expression of Cry protein
5 anchored in the membrane of the LAB. For these studies, the Cry proteins (either full length or truncated) are fused at their C-termini to the C-terminal membrane anchoring domain of lactococcal cell surface-associated proteinase (PrtP). See Norton PM, et al.“Factors affecting the immunogenicity of tetanus toxin fragment C expressed in Lactococcus lactis.” FEMS IMMUNOL MED
10 MICROBIOL 14: 167-177 (1996). The domain is fused to the Cry protein using standard DNA recombinant techniques. EXAMPLE 2
EXPRESSION OF CRY PROTEINS IN BIFIDOBACTERIA
15
An expression system for Bifidobacteria has been described. See Shkoporov AN, et al.“Production of human basic fibroblast growth factor (FGF- 2) in Bifidobacterium breve using a series of novel expression/secretion vectors.” BIOTECHNOL LETT 30: 1983-1988 (2008). Cry proteins are cloned and 20 expressed in Bifidobacteria such as B. breve UCC2003, B. longum VMKB44, and B. bifidum ATCC 15696 using a vector system (pESH46, pESH47, pESH86) that employs the promoter/TIR and terminator regions of the hup gene or the promoter/TIR region of the gap gene along with the terminator of the hup gene. Expression under these promoters allows for intracellular 25 production of Cry proteins (full length and truncated). To allow for secretion, the first 11 N-terminal amino acids of a mature polypeptide of the bifidobacterial Sec2 secreted protein is fused to the N-terminus of the Cry proteins. These constructs are transformed into Bifidobacteria and are tested for expression and bioactivity as described below.
30
EXAMPLE 3
EXPRESSION OF CRY PROTEINS IN BACILLUS Bacillus cereus (e.g., var. toyoi, var. toyoii), Bacillus toyonensis, 5 Bacillus thuringiensis (e.g., var. HD1 ), or Bacillus subtilis (e.g., var. PY79, var. natto; can be used as a probiotic) is used to express Cry proteins using either sporulation promoters (early sporulation Cry3A, late sporulation Cry5B) or a constitutive promoter (e.g., the mbg promoter). See, e.g., Shao X, et al.
“Surface display of heterologous proteins in Bacillus thuringiensis using a 10 peptidoglycan hydrolase anchor.” MICROB CELL FACT 8: 48 (2009). In the latter case, a secretion signal is added to the Cry protein constructs to allow for secretion of the proteins (full length or truncated). These constructs are transformed into B. cereus, B. toyonensis, B. thuringiensis, and B. subtilis strains and are tested for expression and bioactivity as described below. In, 15 addition, strong expression promoters (constitutive and inducible) have been made for B. Subtilis, and these and other genetic elements described herein are referred to as being“operably linked” when they are present in a
polynucleotide construct and situated in a manner that permits them to exert the desired function, such as promotion of specific gene transcription (See, e.g. 20 Phan TT, et al.“Novel plasmid-based expression vectors for intra- and
extracellular production of recombinant proteins in Bacillus subtilis.” PROTEIN EXPR PURIF 46: 189-195 (2006). Secreted versions of proteins are made by addition of the signal peptide of the amyQ gene. See id. Thus, similar expression/curative experiments are carried out using Bacillus subtilis as the 25 probiotic strain.
EXAMPLE 4
EXPRESSION OF CRY PROTEINS IN LACTOBACILLUS GASSERI (E.G., NCK334), LACTOBACILLUS JOHNSONII (E.G., NCK89), LACTOBACILLUS ACIDOPHILUS (E.G.,
NCK56), AND LACTOBACILLUS REUTERI (E.G., NCK932)
5
Cry proteins (Cry5B, Cry13A, Cry14A, Cry21 A, full length and truncated) are expressed on the pTRK882 shuttle vector, which uses the operably linked strong constitutive expression promoter Ppgm and terminator Term908. See, e.g., Mohamadzadeh M, et al.“Dendritic cell targeting of 10 Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice from lethal challenge.” PROC NATL ACAD SCI U S A 106: 4331 - 4336 (2009). This vector is made by using recombinant DNA techniques to clone the pgm promoter and terminator into the pTRK563 shuttle vector. See, e.g., Russell WM and Klaenhammer TR“Identification and cloning of gusA, 15 encoding a new beta-glucuronidase from Lactobacillus gasseri ADH.” APPL ENVIRON MICROBIOL 67: 1253-1261 (2001 ). Figure 8 depicts plasmids for expression of rPA peptide fusions. Schematic for expression of Cry protein in the pTRK895/896 expression system is shown. Determinants of replication are shown as black arrows; transcriptional terminators as black boxes. erm = 20 erythromycin resistance gene. Ppgm is the strong constitutive promoter for the pgm gene of L. acidophilus. Mohamadzadeh M, et al. PROC NATL ACAD SCI U S A 106: 4331 -4336 (2009). The genes are cloned into the vector using restriction sites such as BamHI and/or NotI. A secreted version of the Cry proteins is obtained as per example 1 above (fusing the lactococcal signal 25 leader derived from the usp45 gene of L. lactis). Codon optimization and use of the negatively charged peptide DTNSD (SEQ ID NO: 25) are employed to improve expression as in example 1. These constructs are transformed into bacteria. See, e.g., Walker DC, et al.“Electrotransformation of lactobacillus acidophilus group A1.” FEMS MICROBIOL LETT 138: 233-237 (1996). Expression 30 and bioactivity will be tested as described below.
EXAMPLE 5
GENE REPLACEMENT AND GENERATION OF A LACTOCOCCUS THYMIDINE AUXOTROPH 5 A genetically modified Lactococcus lactis MG1363 is created by replacing the thymidylate synthase gene (thyA) with the full length coding sequence of Cry5B, Cry21 A, Cry14A, or Cry13A and truncated derivatives of each (e.g. residues 1 -697 for Cry5B). Because thyA is required for L. lactis to propagate, replacement of the gene with any of the mentioned cry genes will 10 disallow the bacterium from growing without a source of thymidine or thymine.
This prevents its buildup in the environment where thymidine sources are scarce; however allow the bacterium to proliferate in the GI tract. See, e.g., Steidler L, et al. NAT BIOTECHNOL 21 : 785-789 (2003). Using synthetic oligonucleotides, 1.5 or 2 kb regions immediately upstream and downstream of 15 the thyA start and stop codons from L. lactis MG1363 genomic DNA are
amplified. These amplicons are fused to the 5’ and 3’ ends of a full-length or truncated cry gene by overlap extension PCR. Similarly, these thyA-flanking regions are also fused to cry genes that have been modified to contain the sequences allowing for partial or complete secretion of the Cry protein directly 20 downstream of it. To the 5’ end of the respective full-length or truncated cry gene, a 27 residue Usp45 leader peptide is added for secretion of the expressed Cry protein. For the anchorage of expressed Cry proteins outside the membrane, a 201 -residue leader and pro-sequence of PrtP from L. casei will be added. See Holck A and Naes H“Cloning, sequencing and expression 25 of the gene encoding the cell-envelope-associated proteinase from
Lactobacillus paracasei subsp. paracasei NCDO 151.” J GEN MICROBIOL 138: 1353-1364 (1992). These fusion products are cloned into conditionally non- replicative plasmids (see Law J, et al.“A system to generate chromosomal mutations in Lactococcus lactis which allows fast analysis of targeted genes.” J 30 BACTERIOL 177: 7011 -7018 (1995)) to produce recombinant L. lactis MG1363
strains in which the thyA gene is replaced by the respective full-length or truncated cry gene, with or without a leader sequence, via double homologous recombination. Exchange between thyA and cry5B genes is depicted in Figure 9. Gray lines represent target areas for recombination, thick black lines 5 represent nontarget MG1363 chromosome fragments and thin black lines
represent the exchange vector. 1 , 2 and 3 represent PCR primer pairs (F and R), designed in such a way that PCR using primer pair 1 shows collinearity between chromosomal DNA located 5′ of the target area and cry5B (PCR1 ), that PCR using primer pair 2 shows collinearity between chromosomal DNA 10 located 3′ of the target area and cry5B (PCR2), and that PCR using primer pair 3 shows the presence of thyA (PCR3). Stages include (1 ) introduction of the nonreplicative vector; (2) 5′ crossover, forced by erythromycin selection and identified by PCR1 ; (3) second crossover in the absence of Em, identified through screening by PCR2; and (4) acquisition of desired transgenic
15 chromosome organization. Steidler L, et al. NAT BIOTECHNOL 21 : 785-789
(2003).
Chromosomal mutants of L. lactis that are selected for the testing of the biological activity of expressed Cry proteins are those that contain the least amount of foreign DNA and contain an intact thyA promoter region directly 20 upstream of the insertional deletion. Mutants of this sort are detected by
southern blotting using a combination of thyA and cry gene probes. The ability of each strain to produce intracellular, secretory or membrane-bound Cry5B, Cry21 A, Cry14A, or Cry13A and their truncated forms respectively are then tested in vivo. Expression and bioactivity are tested as described below.
25
EXAMPLE 6
NICE DRIVEN EXPRESSION OF CRY PROTEINS IN LACTOCOCCUS LACTIS An alternative expression system for multidomain proteins in L. 30 lactis is the highly inducible Nisin-controlled gene expression system sold by
MoBiTec GmbH, Germany. Nisin is a natural food preservative produced by L. lactis and is nontoxic to humans. In fact, it has been show that 30% of consumer milk products contain substantial amounts of nisin. See Beasley SS and Saris PE“Nisin-producing Lactococcus lactis strains isolated from human 5 milk.” APPL ENVIRON MICROBIOL 70: 5051 -5053 (2004). L. lactis NZ9000, a derivative of MG1363 in which the transduction signals nisR and nisK were inserted into the chromosome, is used as a host for the expression of Cry proteins. The full CDS or truncated forms of either Cry5B, Cry21 A, Cry14A, or Cry13A will be placed downstream of the inducible nisin promoter by using a 10 combination of vector-backbone exchange (VBEx) and ligation independent cloning (LIC), a cloning strategy that has been well characterized and shown in Figure 10. In Figure 10A, in the LIC procedure, cry5B is amplified using primers containing LIC-specific overhangs. The plasmid is linearized by SwaI restriction in the LIC cassette. Single-stranded overhangs of the PCR product 15 and vector are generated using T4 DNA polymerase. The complementary overhangs of PCR product and vector anneal upon mixing. The resulting heteroduplex is transformed efficiently into E. coli. In Figure 10B, in the VBEx strategy, the L. lactis expression vector pNZxLIC is cut at the two introduced SFiI sites. Plasmid pERL consists of the pSH71 replicon from pNZxLIC fused 20 to an erythromycin marker. Plasmid pRExLIC consists of the cat marker and LIC sequence from pNZxLIC, fused to the E. coli pBR322 replicon and the bla marker. This vector is subjected to the LIC procedure (a); then the pNZxLIC vector is restored by mixing pERL and pRExLIC-cry5B, digestion with SfiI, ligation and selection on the ability to replicated in L. lactis in the presence of 25 chloramphenical. Geertsma ER and Poolman B“High-throughput cloning and expression in recalcitrant bacteria.” NAT METHODS 4: 705-707 (2007). This strategy eliminates the use of large shuttle vectors and generates genuine expression plasmids for recalcitrant bacteria. Using nLIC or cLIC primers, each respective full length or truncated cry gene is amplified and cloned into the 30 appropriate vectors in Table 2 below for the VBEx procedure. See id.
Expression, secretion, and bioactivity of Cry proteins in each recombinant L. lactis NZ9000 strain is then characterized. Expression and bioactivity are tested as described below. Nisin is included either in the growth medium (bacterial growth) or in the water/food (mice) to induce expression.
5
TABLE 2
Other vectors for the expression of the full length or truncated forms of either Cry5B, Cry21 A, Cry14A, or Cry13A include the E.
10 coli/Lactococcus shuttle vector pMSP3535H3, which incorporates the nisin immunity gene (nisI) and the NICE expression system on the same plasmid. See Oddone GM, et al.“Incorporation of nisI-mediated nisin immunity improves vector-based nisin-controlled gene expression in lactic acid bacteria.” Plasmid 61 : 151 -158 (2009). This system has been used to express recombinant 15 proteins in a variety of gram-positive organisms including L. lactis, Lactobacillus paracasei, Streptococcus mutans, Enterococcus faecalis, Streptococcus gordonii. See id. Full length or truncated forms of either Cry5B, Cry21 A, Cry14A, or Cry13A, with and without leader peptide sequences for partial or full secretion, are cloned into pMSP3535H3 downstream of the nisin promoter. 20 The constructs are transformed into plasmid free L. lactis MG1363 recombinant strains and are characterized for expression, secretion and bioactivity of Cry proteins. Expression and bioactivity are tested as described below.
EXAMPLE 7
EXPRESSION OF CRY PROTEINS IN PROBIOTIC E. COLI USING THE ARABINOSE OPERON The VBEx procedure also extends to other host organisms with 5 plasmids. One of the most intensively studied probiotics is Escherichia coli Nissle 1917 (EcN). See, e.g., Schroeder B, et al.“Preventive effects of the probiotic Escherichia coli strain Nissle 1917 on acute secretory diarrhea in a pig model of intestinal infection.” DIG DIS SCI 51 : 724-731 (2006). Using the appropriate E. coli LIC/VBEx vectors in Table 2, probiotic EcN strains
10 expressing the full length or truncated forms of either Cry5B, Cry21 A, Cry14A, or Cry13A are generated in the same fashion as described above for L. lactis. Expression of these proteins is dependent upon arabinose, with the genes being placed downstream of the arabinose operon (pBAD). Expression and bioactivity are tested as described below.
15
EXAMPLE 8
CURATIVE EXPERIMENT A - PROTOCOL FOR INFECTIONS, ANTHELMINTIC TREATMENT, AND DETERMINATION OF TREATMENT EFFICACY (SMALL INTESTINE ROUNDWORM
PARASITE)
20
Six week old female Swiss Webster mice are infected per os with a suspension of 200 ± 10 Heligmosomoides bakeri infective third-stage larvae in 0.1 mL of distilled water. The outbred strain Swiss Webster is used to better “mimic” treating a genetically diverse host (like humans). Each mouse is 25 gavaged on day 15 post-infection (PI) with 0.1 mL of buffer, 0.1 mL of high dose LAB control (transformed with empty vector) or 0.1 mL of high dose LAB expressing Cry protein (6-10 animals/group). Progression of the infection is determined by fecal egg counts every other day beginning 3 days before treatment. Mice are placed individually in empty plastic cages for 1 h each 30 morning, and the fecal pellets are collected into 50mL centrifuge tubes. The
number of eggs present is counted using the modified McMaster technique. See Hu Y, et al.“Bacillus thuringiensis Cry5B protein is highly efficacious as a single-dose therapy against an intestinal roundworm infection in mice.” PLOS NEGL TROP DIS 4: e614 (2010). At 1 , 2, or 3 weeks after treatment, the animals 5 from all three groups are euthanized and the intestinal worm burdens are
counted. Using fecal egg counts and intestinal worm burdens, the ability of Cry-expressing LAB to cure small intestinal roundworm infections are ascertained. 10 EXAMPLE 9
CURATIVE EXPERIMENT B - TRICHURIS MURIS: WHIPWORM
(LARGE INTESTINE ROUNDWORM PARASITE). Twenty-one (21 ) 6-8 week old female AKR mice are infected per 15 os with 200 infectious-staged T. muris eggs. Thirty (30) days post-infection, the mice are treated per os (7/group) with a single 0.1 mL dose of buffer, 0.1 mL high dose of LAB control (transformed with empty vector), or 0.1 mL of high dose LAB expressing Cry protein. Fecal egg counts are taken three days before treatment and then every other day until necropsy (same protocol to 20 collect eggs as per H. bakeri). The mice are euthanized either 1 , 2 or 3 weeks after treatment and worm burdens in the large intestine are determined. Using fecal egg counts and intestinal worm burdens, the ability of Cry-expressing LAB to cure large intestinal roundworm infections are ascertained. 25 EXAMPLE 10
CURATIVE EXPERIMENT C - ANCYLOSTOMA CEYLANICUM: HOOKWORM (BLOOD
FEEDING, SMALL INTESTINAL ROUNDWORM PARASITE). Twenty one (21 ) 4-week old Syrian hamsters are infected per os 30 with 150 infectious staged L3 A. ceylanicum hookworm larvae. Fourteen (14)
days post-infection, the hamsters are treated per os with a single 0.1 mL dose of buffer, 0.1 mL high dose of LAB control (transformed with empty vector), or 0.1 mL of high dose LAB expressing Cry protein. Body weight, hemoglobin levels, and fecal egg counts (beginning three days before treatment) are 5 monitored every other day until day 21 , 28, or 35, at which point the animals are euthanized and worm burdens in the small intestine are determined. Using fecal egg counts, hemoglobin levels, and intestinal worm burdens, the ability of Cry-expressing LAB to cure blood-feeding small intestinal roundworm infections are ascertained.
10
EXAMPLE 11
PREVENTATIVE-TYPE EXPERIMENT A Swiss Webster mice as above (6-10 each group, three groups) 15 receive either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry protein expression, or 0.1 mL high dose vector-transformed LAB with Cry protein expression. Some (about 2-21 ) days later, all groups of mice are then challenged with 200 H. bakeri infectious larvae as described above. Two weeks later after infection challenge, fecal egg counts are determined 20 every other day for one to two weeks, after which time the mice are euthanized to determine intestinal roundworm burdens. Fecal egg counts and intestinal roundworm burdens are used to determine if the probiotics protected the mice against a challenge with a small intestine roundworm parasite (i.e., prevented infection).
25
EXAMPLE 12
PREVENTATIVE-TYPE EXPERIMENT B AKR mice as above (6-10 each group, three groups) receive 30 either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without
Cry protein expression, or 0.1 mL high dose vector-transformed LAB with Cry protein expression. Some (about 2-21 ) days later, all groups of mice are then challenged with 200 T. muris infectious eggs as above. Thirty (30) days after infection challenge, fecal egg counts are determined every other day for one to 5 two weeks, after which time the mice are euthanized to determine intestinal roundworm burdens. Fecal egg counts and intestinal roundworm burdens are used to determine if the probiotics protected the mice against a challenge with a large intestine roundworm parasite (i.e., prevented infection). 10 EXAMPLE 13
PREVENTATIVE-TYPE EXPERIMENT C Hamsters as above (6-10 each group, three groups) receive either 0.1 mL buffer, 0.1 mL high dose empty vector-transformed LAB without Cry 15 protein expression, or 0.1 mL high dose vector-transformed LAB with Cry
protein expression. Some (about 2-21 ) days later, all groups of hamsters are then challenged with 150 A. ceylanicum infectious larvae as above. Two weeks after infection challenge, fecal egg counts are determined every other day for one to two weeks, after which time the hamsters are euthanized to determine 20 intestinal roundworm burdens. Fecal egg counts and intestinal roundworm
burdens are used to determine if the probiotics protected the hamsters against a challenge with a small intestine blood-feeding roundworm parasite (i.e., prevented infection). In addition to experiments with rodents described above, similar experiments could be carried out with other mammals, e.g., felines, 25 canines, bovines, equines, swines, caprines, ovines, and primates. EXAMPLE 14
BACILLUS SUBTILIS STRAIN ENGINEERED FOR TREATMENT OF STHS
Construction and verification of strains and preparation of lysates. 30 The B. subtilis strain PY79 was transformed with the plasmid vector pHT3101 (PY79-vector) or with a pHT3101 -derived cry5B plasmid (PY79-Cry5B) (29).
Natural competence was generated in PY79 by use of a standard medium shift protocol (30). To generate spore lysates and spore crystal lysates, PY79 strains were sporulated for 96 h at 37°C, spun down, washed once with prechilled 0.5MNaCl, and washed again with prechilled sterile double-distilled 5 water. Final pellets were stored at -80°C until use.
Transformants were screened by PCRs using the following primers on all three strains (PY79, PY79-vector, and PY79-Cry5B): Cry5B primer forward 1 (CGTTCAAAATCATCCGTAAATG) (SEQ ID NO: 26) with Cry5B primer reverse 1 (AAATGCATGAACCACTTCCAC) (SEQ ID NO: 27) 10 (predicted product of 586 nucleotides [nt]), Cry5B primer forward 2
(TGGCAACAATTAATGAGT TGTATCCAG) (SEQ ID NO: 28) with Cry5B primer reverse 2 (CTGCCTTGACAAATGG CTACT) (SEQ ID NO: 29)
(predicted product of 497 nt), and pHT3101 primer forward
(CACCCCAGGCTTTACACTTTA) (SEQ ID NO: 30) with pHT3101 primer 15 reverse (AGG CGATTAAGTTGGGTAACG) (SEQ ID NO: 31 ) (predicted
product of 220 nt with empty vector pHT3101 and 6.5 kb with the cry5B insert). Templates were prepared as follows.
Single colonies of PY79, PY79-vector, and PY79-Cry5B were picked from plates and suspended in 50 µl of sterile double-distilled water. 20 These bacterial solutions were boiled for 3 min and then snap-frozen in liquid nitrogen for 3 min. The procedure was repeated for a total of three cycles of boiling-freezing. Supernatants were collected and used as PCR templates. Cycles were carried out using Taq polymerase under the following conditions: 94°C for 3 min and then 35 cycles of 94°C for 30 s, 54°C for 45 s, and 72°C for 25 1 min, followed by 72°C for 10 min. All amplified products were sequenced to confirm identities. To determine putative transcription factor binding sites, 1.5 kb of the region upstream of the cry5B start codon was entered into the DBTBS database (31 ; http: //dbtbs.hgc.jp/), and the P value was set to 0.05. Two putative sigma E binding sites were revealed, 43 and 712 bases upstream of 30 the start codon.
The identity of the strains was further confirmed by analysis of selected proteins. Cell lysates were fractionated by 8% SDS-PAGE, and
protein bands were excised from the gels. Proteins were prepared for mass spectrometric sequencing by in-gel digestion with trypsin and then analyzed by high-pressure liquid chromatography (HPLC) in combination with tandem mass spectroscopy (MS/MS) using electrospray ionization as described previously 5 (32). The collected data were analyzed using MASCOT (Matrix Sciences) and Protein Pilot 4.0 (AB Sciex) for peptide identifications.
SEM. In preparation for scanning electron microscopy (SEM) imaging, the samples were drop-cast on a polished Si chip and dried in a vacuum. The samples were then sputter coated with iridium in an Emitech 10 K575X sputter coater. The sputter current was 85 mA, the argon pressure was 2 Pa, and the deposition time was 7 s, resulting in a film thickness of <10 nm. The samples were imaged with an FEI XL30 ESEM FEG instrument, using a 10-kV beam energy and a spot size of 3.
C. elegans bioassays and A. ceylanicum curative experiments. 15 Ancylostoma ceylanicum hookworms were maintained in golden Syrian
hamsters (14). All animal experiments were carried out under protocols approved by the UCSD Institutional Animal Care and Use Committees
(IACUC). All housing and care of laboratory animals used in this study conformed to the Guide for the Care and Use of Laboratory Animals (33) and all 20 requirements and regulations issued by the USDA, including regulations
implementing the Animal Welfare Act (P.L. 89-544) as amended (see 18-F23). Caenorhabditis elegans was maintained according to standard procedures (34).
The concentration of Cry5B protein in PY79-Cry5B spore crystal lysates was determined as previously described for BtCry5B spore crystal 25 lysates (13). Dose-dependent C. elegans mortality bioassays (three
independent trials) were carried out as previously described (13), including use of tetracycline at 30 µg/ml, except that the assays were carried out for 6 days and each well contained~25 to 30 animals (with triplicate wells per experiment and three independent experiments). The 50% lethal concentration (LC50) was 30 calculated using PROBIT (35).
For in vivo curative experiments, male hamsters were infected per os with 150 A. ceylanicum infectious larvae. On day 17 postinoculation (p.i.), a
fecal sample was collected from each hamster, and the number of eggs was counted using the modified McMaster technique (13). On the basis of these fecal egg counts, the hamsters were segregated to ensure that the groups (control and treatment) had roughly equivalent infection levels. On day 18 p.i., 5 hamsters were weighed individually and given either PY79- Cry5B spore lysate or a spore dose equivalent of PY79-vector spore lysate per os through a blunt- ended gavage needle. Feces were collected on days 1 and 3 post-treatment to determine fecal egg counts (13). The hamsters were sacrificed on day 22 p.i., and intestinal parasite burdens were determined as described previously (14). 10 The one-tailed Mann-Whitney test was performed to compare the two groups for significance in the experiment using a dose of 10 mg/kg of body weight (data were calculated and plotted using Prism 5 [GraphPad Software Inc., La Jolla, CA]). Fecal egg counts were compared using one-tailed Student’s t test. For the dose-response experiment, results for each treatment group were 15 compared to those for the control group by one-way analysis of variance and Dunnett’s method.
RESULTS
Cry5B was well produced in Bacillus subtilis PY79. A
recombinant cry5B plasmid engineered for B. thuringiensis (29) was purified 20 from B. thuringiensis and transformed into B. subtilis strain PY79 by standard transformation techniques. This plasmid, based upon the E. coli-B.
thuringiensis shuttle vector pHT3101 (36), contained the endogenous Cry5B promoter and 3’-untranslated region driving expression of the wild-type cry5B gene (29). To generate an empty vector control strain, empty vector pHT310125 was also transformed into PY79. The presence of the cry5B gene in the PY79- Cry5B strain and its absence from both the parent PY79 strain and the control strain (PY79-vector) were confirmed by PCR. PCR detection of the plasmid in the PY79-vector strain and its absence from the parent PY79 strain were also confirmed. PY79 was able to maintain both the cry5B plasmid and pHT3101 30 under standard antibiotic selection with erythromycin, indicating that the origin of replication for B. thuringiensis functioned in B. subtilis, as demonstrated previously (37).
The PY79-Cry5B and PY79-vector strains were sporulated.
Robust expression of a protein of the size of Cry5B was detected by PAGE only in the PY79-Cry5B strain. Mass spectroscopy confirmed that the protein was indeed Cry5B. On the basis of quantitation relative to bovine serum albumin 5 (BSA) standards on polyacrylamide gels, Cry5B was expressed at 10 mg/liter culture, which was ~7.5-fold lower than the Cry5B expression level in B.
thuringiensis (75 mg/liter) (29). Two other bands common to both PY79-vector and PY79-Cry5B were identified by mass spectroscopy as the 60- kDa chaperonin protein and an oligopeptide-binding protein from B. subtilis 168, the 10 parent strain of PY79 (38). These assays confirmed that Cry5B was expressed in the PY79-Cry5B strain and that the strain was B. subtilis PY79.
Crystal proteins expressed during sporulation of B. thuringiensis assemble into crystalline inclusions in the mother cell compartment that are often bipyramidal in shape (39). This assembling is also true of Cry5B
15 produced in B. thuringiensis (40). Whereas no crystals were detected by SEM upon sporulation of the PY79-vector strain, many SEM-detectable small crystalline inclusions were present upon sporulation of the PY79-Cry5B strain. Some of these crystals were bipyramidal in shape; others appeared to be truncated versions of such crystals. Thus, Cry5B not only was expressed in 20 PY79 but also assembled into crystalline inclusions.
Cry5B made by PY79 was bioactive. To test whether or not Cry5B made by PY79 was bioactive, dose-dependent mortality assays were set up using the laboratory roundworm C. elegans in a standard 48-well format (13, 41 ). The Cry5B component of PY79- Cry5B spore crystal lysates was
25 quantitated relative to BSA standards on polyacrylamide gels. Fourth-stage larvae were incubated for 6 days in wells containing PY79-Cry5B spore crystal lysates containing fixed amounts of Cry5B. Antibiotics were included to prevent infection of the roundworms by bacteria (42). Cry5B made by PY79 was found to kill C. elegans, with an LC50 of 4.3 µg/ml (95% confidence interval, 3.6 to 5.0 30 µg/ml) (Fig. 11 ). This LC50 was similar to the LC50 of Cry5B purified from B. thuringiensis (7 to 9 µg/ml) (35) under comparable conditions (25°C, 6 days). Conversely, C. elegans exposed to PY79-vector spore lysates (with a spore
count equivalent to the highest dose used with PY79- Cry5B) was>99% viable (122/123 worms were alive). Thus, PY79 spore lysates were not lethal to C. elegans, and PY79 was able to produce bioactive Cry5B.
PY79-Cry5B was therapeutic against experimental hookworm 5 infection in hamsters. Nine hamsters were infected with the hookworm parasite A. ceylanicum. At 18 days post-inoculation, five hamsters were treated per os with a single dose of PY9-vector spore lysate, and four were treated with a single dose of PY79- Cry5B spore crystal lysate (equivalent spore counts were used in both treatment groups; the amount of Cry5B was determined relative to 10 BSA standards on protein gels). The single dose of Cry5B used was 10 mg/kg, chosen based on published doses of clinical anthelmintics used in the same model of hookworm disease (Table 3). Feces were collected before and after treatment in order to determine worm loading and changes to parasite egg output. At 22 days post-infection, animals were sacrificed and intestinal worm 15 burdens determined. With a single dose, hookworm burdens were reduced 93% relative to those of the control group (P = 0.009) (Fig. 12A). Strong effects could also be seen in the reduction of parasite eggs excreted into feces (91 % reduction) (Fig. 12B). To determine if there was an effective dose-response relationship and if significant therapy could be provided at lower doses, another 20 experiment was carried out with three hamsters per group and Cry5B doses of 0.4, 1.4, and 4 mg/kg. Significant clearance of parasites was seen at 1.4 and 4 mg/kg Cry5B in PY79 (69% and 79% reductions, with P values of 0.023 and 0.012, respectively).
The experiments in this Example demonstrated for the first time 25 that Bacillus subtilis can be engineered to provide a significant therapeutic
effect against an existing parasitic disease. This pilot study employed PY79, a laboratory strain of B. subtilis that has been used as a model for the delivery of viable bacterial therapies in humans and livestock and that is closely related to a food-grade B. subtilis species. PY79 was made to express and correctly 30 present the BtCry5B protein in a manner that was bioactive against the
laboratory roundworm C. elegans. A single 10-mg/kg dose (71 nmol/kg) of Cry5B administered as a Cry5B-PY79 spore crystal lysate reduced A.
ceylanicum hookworm burdens in hamsters by 93%, and a dose as small as 1.4 mg/kg was able to provide significant therapy. In previously published data, purified Cry5B delivered at 10 mg/kg reduced hookworm burdens by 65% (14); the data disclosed herein suggest that delivery of Cry5B via PY79 spore crystal 5 lysates was superior to delivery via purified protein.
The expression of Cry5B in B. subtilis employed the endogenous BtCry5B promoter and may have been influenced at least partly by two putative sigma E elements upstream of the cry5B start codon. Sigma E is a sporulation- specific promoter that is active in B. subtilis and is also known to be involved in 10 crystal protein production in B. thuringiensis (43, 44). The engineered strain used for the present study included antibiotic resistance genes associated with the cry5B plasmid. Given the genetic tools associated with B. subtilis (45), a Cry5B-expressing B. subtilis therapeutic product for humans is contemplated that includes the cry5B gene integrated into the genome and that lacks any 15 antibiotic resistance genes
The 93% elimination (P = 0.0.009) of A. ceylanicum hookworm parasites from hamsters by use of a single 10-mg/kg (71 nmol/kg) dose compared favorably to the results of anthelmintics used clinically (Table 3). For example, a 10-mg/kg (49 µmol/kg) dose of levamisole resulted in a 60%
20 reduction of A. ceylanicum burdens in hamsters, a 10-mg/kg (17 µmol/ kg) dose of pyrantel resulted in an 87% reduction in A. ceylanicum burdens, a 10-mg/kg (22 µmol/kg) dose of tribendimidine resulted in a 75% reduction of A.
ceylanicum burdens, and a 1.25-mg/kg (4.7 µmol/kg) dose of albendazole resulted in an 88% reduction of A. ceylanicum burdens (46, 47). In addition to 25 high efficacy, Cry5B had a different mechanism of action from that of chemical anthelmintics; Cry5B has been shown to be a pore-forming protein that binds to invertebrate- specific glycolipids and attacks the plasma membrane of the nematode intestine (34, 35, 48–50).
As described herein PY79-Cry5B was comparable to many 30 current drugs in its efficacy on a mg/kg basis, and on a molar level, it appeared to be superior (e.g., the molar dose of Cry5B used in the present experiments
was 66 times lower than the molar dose of albendazole mentioned above). The present results validated the B. subtilis-Cry5B approach.
Also contemplated are increasing B. subtilis-Cry5B specific activity, e.g., by Cry5B point mutations that increase roundworm-killing activity 5 (51 ) and by optimization of fermentation conditions that can also increase
crystal protein specific activity (52). Given that Bacillus bacteria can be produced and stored cheaply and in large quantities (53), the present results demonstrated the feasibility of Cry5B delivery by food-grade B. subtilis for the treatment of STH diseases.
10
TABLE 3. Comparison of efficacies of PY79-Cry5B and clinically used anthelmintics against A. ceylanicum infections in hamsters
a Treatments were administered at 10 mg/kg unless otherwise stated. 15 REFERENCES
1. Bethony J, Brooker S, Albonico M, Geiger SM, Loukas A, Diemert D, Hotez PJ. 2006. Soil-transmitted helminth infections: ascariasis, trichuriasis, and hookworm. Lancet 367:1521–1532.
2. Hall A, Hewitt G, Tuffrey V, de Silva N. 2008. A review and 20 metaanalysis of the impact of intestinal worms on child growth and nutrition.
Matern. Child Nutr. 4(Suppl 1 ):118–236.
3. Knopp S, Steinmann P, Keiser J, Utzinger J. 2012. Nematode infections: soil-transmitted helminths and trichinella. Infect. Dis. Clin. North Am. 26:341–358.
4. Tchuem Tchuente LA. 2011. Control of soil-transmitted
5 helminths in sub-Saharan Africa: diagnosis, drug efficacy concerns and
challenges. Acta Trop. 120(Suppl 1 ):S4–S11.
5. Hotez PJ. 2008. Forgotten people, forgotten diseases: the neglected tropical diseases and their impact on global health and development. ASM Press, Washington, DC.
10 6. Keiser J, Utzinger J. 2010. The drugs we have and the drugs we need against major helminth infections. Adv. Parasitol. 73:197–230.
7. Humphries D, Mosites E, Otchere J, Twum WA, Woo L, Jones- Sanpei H, Harrison LM, Bungiro RD, Benham-Pyle B, Bimi L, Edoh D,
Bosompem K, Wilson M, Cappello M. 2011. Epidemiology of hookworm
15 infection in Kintampo North Municipality, Ghana: patterns of malaria coinfection, anemia, and albendazole treatment failure. Am. J. Trop. Med. Hyg. 84:792– 800.
8. Soukhathammavong PA, Sayasone S, Phongluxa K, Xayaseng V, Utzinger J, Vounatsou P, Hatz C, Akkhavong K, Keiser J, Odermatt P. 2012. 20 Low efficacy of single-dose albendazole and mebendazole against hookworm and effect on concomitant helminth infection in Lao PDR. PLoS Negl. Trop. Dis. 6:e1417. doi:10.1371 /journal.pntd.0001417.
9. Stothard JR, Rollinson D, Imison E, Khamis IS. 2009. A spot- check of the efficacies of albendazole or levamisole, against soil-transmitted 25 helminthiases in young Ungujan children, reveals low frequencies of cure. Ann.
Trop. Med. Parasitol. 103:357–360.
10. Geary TG, Woo K, McCarthy JS, Mackenzie CD, Horton J, Prichard RK, de Silva NR, Olliaro PL, Lazdins-Helds JK, Engels DA, Bundy DA. 2010. Unresolved issues in anthelmintic pharmacology for helminthiases of 30 humans. Int. J. Parasitol. 40:1–13.
11. Holden-Dye L, Walker RJ. 2007. Anthelmintic drugs.
WormBook 2007: 1–13.
12. Cappello M, Bungiro RD, Harrison LM, Bischof LJ, Griffitts JS, Barrows BD, Aroian RV. 2006. A purified Bacillus thuringiensis crystal protein with therapeutic activity against the hookworm parasite Ancylostoma
ceylanicum. Proc. Natl. Acad. Sci. U. S. A. 103:15154–15159.
5 13. Hu Y, Georghiou SB, Kelleher AJ, Aroian RV. 2010. Bacillus thuringiensis Cry5B protein is highly efficacious as a single-dose therapy against an intestinal roundworm infection in mice. PLoS Negl. Trop. Dis.
4:e614. doi:10.1371 /journal.pntd.0000614.
14. Hu Y, Zhan B, Keegan B, Yiu YY, Miller MM, Jones K, Aroian 10 RV. 2012. Mechanistic and single-dose in vivo therapeutic studies of Cry5B anthelmintic action against hookworms. PLoS Negl. Trop. Dis. 6:e1900.
doi:10.1371 /journal.pntd.0001900.
15. Cutting SM. 2011. Bacillus probiotics. Food Microbiol. 28:214– 220.
15 16. Casula G, Cutting SM. 2002. Bacillus probiotics: spore
germination in the gastrointestinal tract. Appl. Environ. Microbiol. 68:2344– 2352.
17. Duc LH, Hong HA, Barbosa TM, Henriques AO, Cutting SM. 2004. Characterization of Bacillus probiotics available for human use. Appl. 20 Environ. Microbiol. 70:2161–2171.
18. Hoa NT, Baccigalupi L, Huxham A, Smertenko A, Van PH, Ammendola S, Ricca E, Cutting AS. 2000. Characterization of Bacillus species used for oral bacteriotherapy and bacterioprophylaxis of gastrointestinal disorders. Appl. Environ. Microbiol. 66:5241–5247.
25 19. Hoa TT, Duc LH, Isticato R, Baccigalupi L, Ricca E, Van PH, Cutting SM. 2001. Fate and dissemination of Bacillus subtilis spores in a murine model. Appl. Environ. Microbiol. 67:3819–3823.
20. Hong HA, Huang JM, Khaneja R, Hiep LV, Urdaci MC, Cutting SM. 2008. The safety of Bacillus subtilis and Bacillus indicus as food probiotics. 30 J. Appl. Microbiol. 105:510–520.
21. D’Arienzo R, Maurano F, Mazzarella G, Luongo D, Stefanile R, Ricca E, Rossi M. 2006. Bacillus subtilis spores reduce susceptibility to
Citrobacter rodentium-mediated enteropathy in a mouse model. Res. Microbiol. 157: 891–897.
22. Duc LH, Hong HA, Fairweather N, Ricca E, Cutting SM. 2003. Bacterial spores as vaccine vehicles. Infect. Immun. 71 :2810–2818.
5 23. Hoang TH, Hong HA, Clark GC, Titball RW, Cutting SM. 2008.
Recombinant Bacillus subtilis expressing the Clostridium perfringens alpha toxoid is a candidate orally delivered vaccine against necrotic enteritis. Infect. Immun. 76:5257–5265.
24. La Ragione RM, Casula G, Cutting SM, Woodward MJ. 2001. 10 Bacillus subtilis spores competitively exclude Escherichia coli O78:K80 in
poultry. Vet. Microbiol. 79:133–142.
25. La Ragione RM, Woodward MJ. 2003. Competitive exclusion by Bacillus subtilis spores of Salmonella enterica serotype Enteritidis and Clostridium perfringens in young chickens. Vet. Microbiol. 94:245–256.
15 26. Permpoonpattana P, Hong HA, Phetcharaburanin J, Huang JM, Cook J, Fairweather NF, Cutting SM. 2011. Immunization with Bacillus spores expressing toxin A peptide repeats protects against infection with Clostridium difficile strains producing toxins A and B. Infect. Immun. 79: 2295– 2302.
20 27. Song M, Hong HA, Huang JM, Colenutt C, Khang DD, Nguyen TV, Park SM, Shim BS, Song HH, Cheon IS, Jang JE, Choi JA, Choi YK, Stadler K, Cutting SM. 2012. Killed Bacillus subtilis spores as a mucosal adjuvant for an H5N1 vaccine. Vaccine 30:3266–3277.
28. Conlan JV, Khamlome B, Vongxay K, Elliot A, Pallant L, Sripa 25 B, Blacksell SD, Fenwick S, Thompson RC. 2012. Soil-transmitted
helminthiasis in Laos: a community-wide cross-sectional study of humans and dogs in a mass drug administration environment. Am. J. Trop. Med. Hyg.
86:624–634.
29. Marroquin LD, Elyassnia D, Griffitts JS, Feitelson JS, Aroian 30 RV. 2000. Bacillus thuringiensis (Bt) toxin susceptibility and isolation of
resistance mutants in the nematode Caenorhabditis elegans. Genetics
155:1693– 1699.
30. Dubnau D, Davidoff-Abelson R. 1971. Fate of transforming DNA following uptake by competent Bacillus subtilis. I. Formation and properties of the donor-recipient complex. J. Mol. Biol. 56:209–221.
31. Sierro N, Makita Y, de Hoon M, Nakai K. 2008. DBTBS: a 5 database of transcriptional regulation in Bacillus subtilis containing upstream intergenic conservation information. Nucleic Acids Res. 36:D93–D96.
32. Shevchenko A, Wilm M, Vorm O, Mann M. 1996. Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal. Chem. 68:850–858.
10 33. National Research Council. 1996. Guide for the care and use of laboratory animals. National Academies Press, Washington, DC.
34. Hu Y, Xiao SH, Aroian RV. 2009. The new anthelmintic tribendimidine is an L-type (levamisole and pyrantel) nicotinic acetylcholine receptor agonist. PLoS Negl. Trop. Dis. 3:e499.
15 doi:10.1371 /journal.pntd.0000499.
35. Hu Y, Platzer EG, Bellier A, Aroian RV. 2010. Discovery of a highly synergistic anthelmintic combination that shows mutual
hypersusceptibility. Proc. Natl. Acad. Sci. U. S. A. 107:5955–5960.
36. Lereclus D, Arantes O, Chaufaux J, Lecadet M. 1989.
20 Transformation and expression of a cloned delta-endotoxin gene in Bacillus thuringiensis. FEMS Microbiol. Lett. 51 :211–217.
37. Yang Y, Qi Y, Huang Y. 1996. Cloning and expression of full- length delta-endotoxin cryIA(c) gene in three kinds of prokaryotic systems using shuttle vector pHT3101. Wei Sheng Wu Xue Bao 36:173–180.
25 38. Youngman P, Perkins JB, Losick R. 1984. Construction of a cloning site near one end of Tn917 into which foreign DNA may be inserted without affecting transposition in Bacillus subtilis or expression of the
transposonborne erm gene. Plasmid 12:1–9.
39. Cannon RJC. 1996. Bacillus thuringiensis use in agriculture: a 30 molecular perspective. Biol. Rep. 71 :561–636.
40. Hu Y, Aroian RV. 2012. Promise of Bacillus thuringiensis crystal proteins as anthelmintics, p 267–281. In Caffrey CR (ed), Parasitic
helminths: targets, screens, drugs, and vaccines. Wiley-VCH Verlag Gmh & Co, KGaA, Weinheim, Germany.
41. Bischof LJ, Huffman DL, Aroian RV. 2006. Assays for toxicity studies in C. elegans with Bt crystal proteins. Methods Mol. Biol. 351 :139–154. 5 42. Kho MF, Bellier A, Balasubramani V, Hu Y, Hsu W, Nielsen- LeRoux C, McGillivray SM, Nizet V, Aroian RV. 2011. The pore-forming protein Cry5B elicits the pathogenicity of Bacillus sp. against Caenorhabditis elegans. PLoS One 6:e29122. doi:10.1371 /journal.pone.0029122.
43. Baum JA, Malvar T. 1995. Regulation of insecticidal crystal 10 protein production in Bacillus thuringiensis. Mol. Microbiol. 18:1–12.
44. Buasri W, Panbangred W. 2012. Large crystal toxin formation in chromosomally engineered Bacillus thuringiensis subsp. aizawai due to sigmaE accumulation. Appl. Environ. Microbiol. 78:1682–1691.
45. Brans A, Filee P, Chevigne A, Claessens A, Joris B. 2004. 15 New integrative method to generate Bacillus subtilis recombinant strains free of selection markers. Appl. Environ. Microbiol. 70:7241–7250.
46. Tritten L, Nwosu U, Vargas M, Keiser J. 2012. In vitro and in vivo efficacy of tribendimidine and its metabolites alone and in combination against the hookworms Heligmosomoides bakeri and Ancylostoma ceylanicum. 20 Acta Trop. 122:101–107.
47. Tritten L, Silbereisen A, Keiser J. 2011. In vitro and in vivo efficacy of monepantel (AAD 1566) against laboratory models of human intestinal nematode infections. PLoS Negl. Trop. Dis. 5:e1457.
doi:10.1371 /journal .pntd.0001457.
25 48. Griffitts JS, Aroian RV. 2005. Many roads to resistance: how invertebrates adapt to Bt toxins. Bioessays 27:614–624.
49. Griffitts JS, Haslam SM, Yang T, Garczynski SF, Mulloy B, Morris H, Cremer PS, Dell A, Adang MJ, Aroian RV. 2005. Glycolipids as receptors for Bacillus thuringiensis crystal toxin. Science 307:922–925.
30 50. Los FC, Kao CY, Smitham J, McDonald KL, Ha C, Peixoto CA, Aroian RV. 2011. RAB-5- and RAB-11 -dependent vesicle-trafficking
pathways are required for plasma membrane repair after attack by bacterial poreforming toxin. Cell Host Microbe 9:147–157.
51. Wang F, Liu Y, Zhang F, Chai L, Ruan L, Peng D, Sun M. 2012. Improvement of crystal solubility and increasing toxicity against
5 Caenorhabditis elegans by asparagine substitution in block 3 of Bacillus
thuringiensis crystal protein Cry5Ba. Appl. Environ. Microbiol. 78:7197–7204.
52. el-Bendary MA. 2006. Bacillus thuringiensis and Bacillus sphaericus biopesticides production. J. Basic Microbiol. 46:158–170.
53. Schallmey M, Singh A, Ward OP. 2004. Developments in the 10 use of Bacillus species for industrial production. Can. J. Microbiol. 50:1–17.
EXAMPLE 15
BIOACTIVITY OF COMPOSITIONS COMPRISING CRY5B AND PROBIOTIC BACTERIA 15 This example describes additional data that were obtained using the above–described bioassays for anthelmintic activity.
Figure 13 shows results from an in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms as described by Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900. 20 doi:10.137/journal.pntd.0001900). The four groups (in black, n = 7 per group) shown are the intestinal worm burdens from the groups of infected hamsters treated with purified full-length B. thuringiensis Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see Fig. 2) at a single dose of 1 mg (solid circles, 10 mg/kg), 3 mg (solid upright triangles, 30 25 mg/kg), or 10 mg (solid inverted triangles,100 mg/kg) (715 nmoles/kg), or with placebo (solid squares, ddH2O), respectively. The treatments were conducted on day 16 P.I. and intestinal worm burdens assessed on day 21 P.I. The worm burdens in each hamster are indicated with a separate symbol. Long horizontal bars represent mean worm burdens; smaller bars indicate SEM (standard error 30 of the mean).
Figure 14 shows dose-response results for indicated dosages of unfractionated Cry5B-containing spore-crystal lysates (SCL) in the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms. The assay was performed according to 5 Hu et al. (2012 PLoS Negl. Trop. Dis. 6:e1900.
doi:10.137/journal.pntd.0001900) except instead of purified Cry5B protein the animals received the indicated dosages, via gavage, of Cry5B spore-crystal lysates obtained from cultured Bacillus thuringiensis cells that were transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown 10 to sporulation phase. The amounts of Cry5B gavaged were determined by taking known volumes of spore crystal lysates, resolving full length Cry5B protein by SDS PAGE, and quantitating the amount of protein in the Cry5B band relative to known amounts of bovine serum albumin (BSA) standards on the gel.
15 Figure 15 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/ journal. pntd.0001900) following treatment with two different dosages of Cry5B spore- crystal lysates obtained from cultured Bacillus thuringiensis natto cells that were 20 transformed with a low copy plasmid that expressed B. thuringiensis Cry5B and then grown to sporulation phase. B. subtilis natto was transformed with the same Cry5B expressing plasmid described in Example 14 (Hu et al. Appl. Environ. Microbiol. 2013, 79(18):5527). Because B. subtilis natto is not naturally competent, B. subtilis natto cells were made competent by artificially 25 introducing the ComK competency plasmid into the B. subtilis natto strain via protoplast transformation (Ashikaga et al., J Bacteriol. 2000;182(9):2411 -5; Romero, D., et al J Microbiol Meth. 2006;66(3):556-9). The resultant strain was able to take up any DNA and the ComK plasmid, being unstable, was readily lost by growing under non-selective pressure).
Figure 16 shows data obtained in vitro using the C. elegans mortality assay described in Figure 11 to evaluate the effects on C. elegans of purified Cry5B protein (prepared according to Griffitts et al., 2001 Science 293:860; for sequence see Fig. 2) when combined in a mixture either with 5 sporulated B. thuringiensis HD1 or with sporulated B. subtilis PY79. For each data point, the number of spores (HD1 or PY79) was held constant and the quantity of Cry5B was titrated (x-axis).
Figure 17 shows results from the in vivo bioassay of intestinal worm burdens in golden Syrian hamsters infected with Ancylostoma ceylanicum 10 hookworms (Hu et al., 2012 PLoS Negl. Trop. Dis. 6:e1900. doi:10.137/ journal. pntd.0001900) following treatment (5 mg/kg) by gavage on day 18 P.I. with either B. thuringiensis strain HD1 spore lysates transformed with empty vector (“control”, spore lysates from the acrystaliferous mutant B. thuringiensis strain HD1 , which does not produce any Cry proteins) or spore crystal lysates from B. 15 thuringiensis strain HD1 that has been engineered to express Cry14A (for
sequence see Fig. 4) using a plasmid encoding Cry14A under the control of the operably linked Cry3A promoter. Hookworm burdens were assessed on day 20 post-infection (P.I.). 20 EXAMPLE 16
GENE REPLACEMENT AND GENERATION OF A BACILLUS SUBTILIS AUXOTROPH cry5B gene was integrated into the B. subtilis genome by a strategy that simultaneously deleted the chromosomal thyA gene, which
25 encodes thymidylate synthetase. A cry5B cassette, flanked by the upstream and downstream regions of B. subtilis thyA, was assembled in vitro by standard PCR techniques. B. subtilis natto was transformed with this construct in a single step. Transformants simultaneously acquired two properties: auxotrophy for thymine nucleotides and the production of Cry5B protein. Because thymine 30 auxotrophs in B. subtilis are known to be naturally resistant to trimethoprim and
other antifolate compounds, selection for growth in the presence of trimethoprim plus thymine selected for the desired integration event without the introduction of an antibiotic resistance marker. The construct contained no foreign DNA at all except for the cry5B gene itself. The auxotroph permitted 5 easy replication under laboratory conditions but the strain was environmentally dead and unable to replicate in the wild (e.g., following defecation by a human). All publications and patent applications cited in this specification are herein incorporated by reference as if each individual publication or patent 10 application were specifically and individually indicated to be incorporated by reference. Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to those of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto 15 without departing from the spirit or scope of the appended claims. The various embodiments described above can be combined to provide further embodiments. All of the U.S. patents, U.S. patent application publications, U.S. patent applications, foreign patents, foreign patent
20 applications and non-patent publications referred to in this specification and/or listed in the Application Data Sheet are incorporated herein by reference, in their entirety. Aspects of the embodiments can be modified, if necessary to employ concepts of the various patents, applications and publications to provide yet further embodiments.
25
These and other changes can be made to the embodiments in light of the above-detailed description. In general, in the following claims, the terms used should not be construed to limit the claims to the specific
embodiments disclosed in the specification and the claims, but should be 30 construed to include all possible embodiments along with the full scope of
equivalents to which such claims are entitled. Accordingly, the claims are not limited by the disclosure.
Claims
1. A method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject, the method comprising:
administering to the subject a therapeutically effective amount of a composition comprising a recombinant bacterium that has expressed or that is capable of expressing a crystal protein.
2. The method of claim 1 , wherein the crystal protein is selected from the group consisting of Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
3. The method of claim 1 or claim 2, wherein the recombinant bacterium is a Gram-positive bacterium.
4. The method of claim 1 or claim 2, wherein the recombinant bacterium is a Gram-negative bacterium.
5. The method of claim 1 or claim 2, wherein the recombinant bacterium is a recombinant food grade Gram-positive bacterium.
6. The method of claim 1 or claim 2, wherein the recombinant bacterium is a lactic acid fermenting bacterium.
7. The method of claim 6, wherein the lactic acid fermenting bacterium is a Lactococcus or Lactobacillus species.
8. The method of claim 7, wherein the Lactoccocus species is Lactococcus lactis.
9. The method of claim 7, wherein the Lactobacillus species is selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
10. The method of claim 1 or claim 2, wherein the recombinant bacterium is administered in combination with at least one additional
therapeutic agent.
11. The method of claim 10, wherein the at least one additional therapeutic agent is a nicotinic acetylcholine receptor agonist.
12. The method of claim 11 , wherein the at least one additional therapeutic agent is administered simultaneously with the therapeutically effective amount of the recombinant bacterium expressing the crystal protein.
13. The method of claim 11 , wherein the at least one additional therapeutic agent is administered sequentially with the therapeutically effective amount of the recombinant bacterium expressing the crystal protein.
14. The method of claim 11 , wherein the nicotinic acetylcholine receptor agonist is from the levamisole family of nicotinic acetylcholine receptor agonists.
15. The method of claim 14, wherein the nicotinic acetylcholine receptor agonist is levamisole.
16. The method of claim 15, wherein the levamisole is administered in an amount of about 0.1 mg/kg to about 5.0 mg/kg.
17. The method of claim 11 , wherein the nicotinic acetylcholine receptor agonist is pyrantel or tribendimidine.
18. The method of claim 17, wherein the pyrantel is administered in an amount of about 1.0 mg/kg to about 15.0 mg/kg.
19. The method of claim 17, wherein the tribendimidine is administered in an amount of about 0.25 mg/kg to about 10 mg/kg.
20. The method of claim 1 or claim 2, wherein the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from the group consisting of Roundworm, Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides, Schistosome, and Trematodes.
21. The method of claim 1 or claim 2, wherein the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from the group consisting of hookworm Ancylostoma duodenale, hookworm Necator americanus, whipworm Trichuris trichiura, roundworm Ascaris lumbricoides, threadworm Strongyloides stercoralis, and pinworm Enterobius vermiculari.
22. The method of claim 1 or claim 2, wherein the subject is a human being.
23. The method of claim 1 or claim 2, wherein the subject is a mammal selected from the group consisting of feline, rodent, canine, bovine, equine, swine, caprine, ovine, and primate.
24. The method of claim 1 or claim 2, wherein the crystal protein is delivered through in situ synthesis in the subject by the bacterium.
25. The method of claim 1 or claim 2, wherein the crystal protein is a truncated crystal protein.
26. The method of claim 1 or claim 2, wherein the crystal protein is a variant crystal protein.
27. The method of claim 25, wherein the truncated crystal protein is truncated after a conserved amino acid sequence of block 5.
28. The method of claim 27, wherein the truncated crystal protein is missing the last 10 amino acids of the C-terminus.
29. The method of claim 27, wherein the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein.
30. The method of claim 27, wherein the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24).
31. The method of claim 25, wherein the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein.
32. The method of claim 25, wherein the truncated crystal protein is truncated at the N-terminus.
33. The method of claim 32, wherein the truncated crystal protein does not contain the first 5 amino acids of the N-terminus.
34. The method of claim 25, wherein the truncated crystal protein is truncated at the C-terminus.
35. The method of claim 1 , wherein the crystal protein is Cry5B and wherein the Cry5B includes at least amino acids 30 through about 693 of SEQ ID NO:1.
36. The method of claim 1 , wherein the crystal protein is Cry13A and wherein the Cry13A includes at least amino acids 30 through about 688 of SEQ ID NO:2.
37. The method of claim 1 , wherein the crystal protein is Cry14A and wherein the Cry14A includes at least amino acids 30 through about 675 of SEQ ID NO:3.
38. The method of claim 1 , wherein at least one of: (a) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:4,
(b) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or
(c) the crystal protein is Cry6A and wherein the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID NO:6.
39. A method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject, the method comprising:
administering to the subject a composition that comprises (a) a therapeutically effective amount of a first recombinant bacterium that has expressed or that is capable of expressing a first crystal protein; and (b) a therapeutically effective amount of a second recombinant bacterium that has expressed or that is capable of expressing a second crystal protein.
40. The method of claim 39, wherein the first and second recombinant bacteria are Gram-positive bacteria.
41. The method of claim 39, wherein the first and second recombinant bacteria are Gram-negative bacteria.
42. The method of claim 39, wherein the first and second recombinant bacteria are administered simultaneously.
43. The method of claim 39, wherein the first and second recombinant bacteria are administered sequentially.
44. The method of claim 39, wherein the first and second crystal proteins are different crystal proteins.
45. The method of any one of claims 39-44, wherein the first and second crystal proteins are independently selected from the group consisting of Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
46. The method of any one of claims 39-44, wherein the bacterium is a recombinant food grade Gram-positive bacterium.
47. The method of any one of claims 39-44, wherein the bacterium is a lactic acid fermenting bacterium.
48. The method of claim 47, wherein the lactic acid fermenting bacterium is a Lactococcus or Lactobacillus species.
49. The method of claim 48, wherein the Lactoccocus species is Lactococcus lactis.
50. The method of claim 48, wherein the Lactobacillus species is selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
51. A method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a subject, the method comprising:
administering to the subject a medicament comprising a
therapeutically effective amount of a bacterium that has been genetically modified to produce a heterologous crystal protein.
52. The method of claim 51 , wherein the crystal protein- producing genetically modified bacterium is a Gram-positive bacterium.
53. The method of claim 51 , wherein the crystal protein- producing genetically modified bacterium is a Gram-negative bacterium.
54. The method of any one of claims 51 -53, wherein the crystal protein is selected from the group consisting of Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
55. The method of claim 51 , wherein the bacterium is a recombinant food grade Gram-positive bacterium.
56. The method of claim 51 , wherein the bacterium is a lactic acid fermenting bacterium.
57. The method of claim 56, wherein the lactic acid fermenting bacterium is a Lactococcus or Lactobacillus species.
58. The method of claim 57, wherein the Lactoccocus species is Lactococcus lactis.
59. The method of claim 57, wherein the Lactobacillus species is Lactobacillus selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
60. The method of any one of claims 51 -53, wherein the crystal protein-producing genetically modified bacterium is administered in combination with at least one additional therapeutic agent.
61. The method of claim 60, wherein the at least one additional therapeutic agent is a nicotinic acetylcholine receptor agonist.
62. The method of claim 61 , wherein the at least one additional therapeutic agent is administered simultaneously with the therapeutically effective amount of the crystal protein-producing genetically modified
bacterium.
63. The method of claim 61 , wherein the at least one additional therapeutic agent is administered sequentially with the therapeutically effective amount of the crystal protein-producing genetically modified bacterium.
64. The method of claim 61 , wherein the nicotinic acetylcholine receptor agonist is from the levamisole family of nicotinic acetylcholine receptor agonists.
65. The method of claim 64, wherein the nicotinic acetylcholine receptor agonist is levamisole.
66. The method of claim 65, wherein the levamisole is administered in an amount of about 0.1 mg/kg to about 5.0 mg/kg.
67. The method of claim 61 , wherein the nicotinic acetylcholine receptor agonist is pyrantel or tribendimidine.
68. The method of claim 67, wherein the pyrantel is administered in an amount of about 1.0 mg/kg to about 15.0 mg/kg.
69. The method of claim 67, wherein the tribendimidine is administered in an amount of about 0.25 mg/kg to about 10 mg/kg.
70. The method of any one of claims 51 -54, wherein the parasitic worm or helminth infection is caused by a parasitic worm or helminth selected from the group consisting of Roundworm, Whipworm, Hookworm, Ascaris, Pinworm, Strongyloides, Schistosome, and Trematodes.
71. The method of any one of claims 51 -54, wherein the parasitic worm or helminth infection is caused by a parasitic worm or helminth
selected from the group consisting of hookworm Ancylostoma duodenale, hookworm Necator americanus, whipworm Trichuris trichiura, roundworm Ascaris lumbricoides, threadworm Strongyloides stercoralis, and pinworm Enterobius vermiculari.
72. The method of any one of claims 51 -54, wherein the subject is a human being.
73. The method of any one of claims 51 -54, wherein the subject is a mammal selected from the group consisting of feline, rodent, canine, bovine, equine, swine, caprine, ovine, and primate.
74. The method of any one of claims 51 -54, wherein the heterologous crystal protein is synthesized by the bacterium in situ in the subject.
75. The method of any one of claims 51 -54, wherein the crystal protein is a truncated crystal protein.
76. The method of any one of claims 51 -54, wherein the crystal protein is a variant crystal protein.
77. The method of claim 75, wherein the truncated crystal protein is truncated after a conserved amino acid sequence of block 5.
78. The method of claim 77, wherein the truncated crystal protein is missing the last 10 amino acids of the C-terminus.
79. The method of claim 77, wherein the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein.
80. The method of claim 77, wherein the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24).
81. The method of claim 75, wherein the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein.
82. The method of claim 75, wherein the truncated crystal protein is truncated at the N-terminus.
83. The method of claim 82, wherein the truncated crystal protein does not contain the first 5 amino acids of the N-terminus.
84. The method of claim 75, wherein the truncated crystal protein is truncated at the C-terminus.
85. The method of claim 51 , wherein the crystal protein is Cry5B and wherein the Cry5B includes at least amino acids 1 through about 693 of SEQ ID NO:1.
86. The method of claim 51 , wherein the crystal protein is Cry13A and wherein the Cry13A includes at least amino acids 1 through about 688 of SEQ ID NO:2.
87. The method of claim 51 , wherein the crystal protein is Cry14A and wherein the Cry14A includes at least amino acids 1 through about 675 of SEQ ID NO:3.
88. The method of claim 51 , wherein at least one of:
(a) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:4,
(b) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or
(c) the crystal protein is Cry6A and wherein the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID NO:6.
89. A composition comprising a non-invasive or non- pathogenic bacterium having a nucleic acid construct or vector comprising one or more constitutive promoters operably linked to coding sequences for expression of one or more heterologous crystal proteins.
90. The composition of claim 89, wherein the one or more crystal proteins is selected from the group consisting of Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
91. The composition of claim 89 or claim 90, wherein the one or more crystal proteins is a truncated crystal protein.
92. The composition of claim 89 or claim 90, wherein the one or more crystal proteins is a variant crystal protein.
93. The composition of claim 91 , wherein the truncated crystal protein is truncated after a conserved amino acid sequence of block 5.
94. The composition of claim 93, wherein the truncated crystal protein is missing the last 10 amino acids of the C-terminus.
95. The composition of claim 93, wherein the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein.
96. The composition of claim 93, wherein the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24).
97. The composition of claim 91 , wherein the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein.
98. The composition of claim 91 , wherein the truncated crystal protein is truncated at the N-terminus.
99. The composition of claim 98, wherein the truncated crystal protein does not contain the first 5 amino acids of the N-terminus.
100. The composition of claim 91 , wherein the truncated crystal protein is truncated at the C-terminus.
101. The composition of claim 89, wherein the one or more crystal proteins is Cry5B and wherein the Cry5B includes at least amino acids 1 through about 693 of SEQ ID NO:1.
102. The composition of claim 89, wherein the one or more crystal proteins is Cry13A and wherein the Cry13A includes at least amino acids 1 through about 688 of SEQ ID NO:2.
103. The composition of claim 89, wherein the one or more crystal proteins is Cry14A and wherein the Cry14A includes at least amino acids 1 through about 675 of SEQ ID NO:3.
104. The composition of claim 89, wherein at least one of: (a) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:4,
(b) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or
(c) the crystal protein is Cry6A and wherein the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID NO:6.
105. The composition of claim 89 or claim 90, wherein the non- invasive or non-pathogenic bacterium is a lactic acid fermenting bacterium.
106. The composition of claim 105, wherein the lactic acid fermenting bacterium is a Lactococcus or Lactobacillus species.
107. The composition of claim 106, wherein the Lactoccocus species is Lactococcus lactis.
108. The composition of claim 106, wherein the Lactobacillus species is selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
109. A recombinant microorganism for delivering a crystal protein in vivo, wherein said microorganism comprises a coding sequence of the crystal protein under the control of a suitable promoter sequence.
110. The recombinant microorganism of claim 109, wherein the microorganism is a gram-positive bacterium.
111. The recombinant microorganism of claim 109, wherein the microorganism is a Gram-negative bacterium.
112. The recombinant microorganism of claim 110, wherein the bacterium is a food grade bacterium.
113. The recombinant microorganism of claim 112, wherein the food grade bacterium is a lactic acid fermenting bacterium.
114. The recombinant microorganism of claim 113, wherein the lactic acid fermenting bacterium is Lactococcus or Lactobacillus.
115. The recombinant microorganism of claim 114, wherein the Lactococcus is Lactococcus lactis.
116. The recombinant microorganism of claim 115, wherein the Lactobacillus species is selected from the group consisting of Lactobacillus acidophilus, Lactobacillus gasseri, Lactobacillus johnsonii, and Lactobacillus reuteri.
117. The recombinant microorganism of any one of claims 109- 116, wherein the crystal protein is selected from the group consisting of Cry5B, Cry21 A, Cry14A, Cry13A, and Cry6A.
118. The recombinant microorganism of any one of claims 109- 116, wherein the crystal protein is a truncated crystal protein.
119. The recombinant microorganism of any one of claims 109- 116, wherein the crystal protein is a variant crystal protein.
120. The recombinant microorganism of claim 118, wherein the truncated crystal protein is truncated after a conserved amino acid sequence of block 5.
121. The recombinant microorganism of claim 120, wherein the truncated crystal protein is missing the last 10 amino acids of the C-terminus.
122. The recombinant microorganism of claim 120, wherein the truncated crystal protein is truncated between the end of conserved block 5 and the C-terminus of the full length protein.
123. The recombinant microorganism of claim 120, wherein the conserved amino acid sequence of block 5 is DRIEF (SEQ ID NO: 23) or DRLEF (SEQ ID NO: 24).
124. The recombinant microorganism of claim 118, wherein the truncated crystal protein has toxic activity that is at least 10% or more of the toxic activity of a corresponding full-length protein.
125. The recombinant microorganism of claim 118, wherein the truncated crystal protein is truncated at the N-terminus.
126. The recombinant microorganism of claim 125, wherein the truncated crystal protein does not contain the first 5 amino acids of the N- terminus.
127. The recombinant microorganism of claim 118, wherein the truncated crystal protein is truncated at the C-terminus.
128. The recombinant microorganism of any one of claims 109- 116, wherein the crystal protein is Cry5B and wherein the Cry5B includes at least amino acids 30 through about 693 of SEQ ID NO:1.
129. The recombinant microorganism of any one of claims 109- 116, wherein the crystal protein is Cry13A and wherein the Cry13A includes at least amino acids 30 through about 688 of SEQ ID NO:2.
130. The recombinant microorganism of any one of claims 109- 116, wherein the crystal protein is Cry14A and wherein the Cry14A includes at least amino acids 30 through about 675 of SEQ ID NO:3.
131. The recombinant microorganism of any one of claims 109- 116, wherein at least one of:
(a) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:4,
(b) the crystal protein is Cry21 A and wherein the Cry21 A includes at least amino acids 30 through about 685 of SEQ ID NO:5, or
(c) the crystal protein is Cry6A and wherein the Cry6A comprises the amino acid sequence set forth in SEQ ID NO:6 or includes at least amino acids 30 through about 395, 415 or 435 of SEQ ID NO:6.
132. The method of any one of claims 1 , 2, 51 or 53 wherein the bacterium is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B.
cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.
133. The method of claim 39 or claim 45 wherein each of the first and second recombinant bacterium is independently selected from B.
subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.
134. The composition of claim 89 or claim 90 wherein the non- invasive or non-pathogenic bacterium is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.
135. The recombinant microorganism of claim 109 or claim 117 which is selected from B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis, Lactobacillus rhamnosus, Lactobacillus casei, and Lactococcus lactis.
136. An artificial probiotic composition, comprising: (a) an isolated polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent amino acid sequence identity to a Bacillus thuringiensis crystal protein that is selected from Cry5B comprising the amino acid sequence set forth in SEQ ID NO:1 , Cry21 A comprising the amino acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5, Cry14A comprising the amino acid sequence set forth in SEQ ID
NO:3, Cry13A comprising the amino acid sequence set forth in SEQ ID NO:2, and Cry6A comprising the amino acid sequence set forth in SEQ ID NO:6; and
(b) a non-invasive, non-pathogenic probiotic bacterium that is capable of remaining viable in a mammalian gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, Lactobacillus and Lactococcus.
137. The artificial probiotic composition of claim 136 wherein: the Bacillus subtilis is B. subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B.
toyonensis,
(ii) the Lactobacillus is Lactobacillus rhamnosus or Lactobacillus casei, and
(iii) the Lactococcus is Lactococcus lactis.
138. An artificial probiotic composition, comprising:
(a) an isolated polypeptide that is selected from a Bacillus thuringiensis Cry5B protein and a Bacillus thuringiensis Cry14A protein; and
(b) a non-invasive, non-pathogenic probiotic bacterium that is capable of remaining viable in a mammalian gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, B. subtilis PY79, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, and B. toyonensis.
139. The artificial probiotic composition of any one of claims 136-138 wherein the isolated polypeptide is heterologous to and admixed with the probiotic bacterium.
140. A method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a gastrointestinal tract of a mammalian subject, the method comprising:
administering to the gastrointestinal tract of the subject a therapeutically effective amount of an artificial probiotic composition comprising
(a) an isolated polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100 percent amino acid sequence identity to a Bacillus thuringiensis crystal protein that is selected from Cry5B comprising the amino acid sequence set forth in SEQ ID NO:1 , Cry21 A comprising the amino acid sequence set forth in SEQ ID NO:4 or SEQ ID NO:5, Cry14A comprising the amino acid sequence set forth in SEQ ID NO:3, Cry13A comprising the amino acid sequence set forth in SEQ ID NO:2, and Cry6A comprising the amino acid sequence set forth in SEQ ID NO:6; and
(b) a non-invasive, non-pathogenic probiotic bacterium that is capable of remaining viable in the gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, Lactobacillus and Lactococcus.
141. The method of claim 140 wherein:
(i) the Bacillus subtilis is B. subtilis, B. subtilis PY79, B.
subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, or B. toyonensis,
(ii) the Lactobacillus is Lactobacillus rhamnosus or Lactobacillus casei, and
(iii) the Lactococcus is Lactococcus lactis.
142. The method of claim 140 wherein the artificial probiotic composition comprises:
(a) an isolated polypeptide that is selected from a Bacillus thuringiensis Cry5B protein and a Bacillus thuringiensis Cry14A protein; and
(b) a non-invasive, non-pathogenic probiotic bacterium that is capable of remaining viable in the mammalian gastrointestinal tract following passage through a mammalian stomach and into mammalian small intestine, the probiotic bacterium being selected from Bacillus subtilis, B. subtilis natto, B. cereus, B. cereus var. Toyoi (Toyocerin), B. cereus var. toyoii, and B.
toyonensis.
143. The method of any one of claims 140-142 wherein the isolated polypeptide is heterologous to the probiotic bacterium and is admixed with the probiotic bacterium prior to the step of administering.
144. A method of treating or reducing severity or likelihood of occurrence of a parasitic worm or helminth infection in a gastrointestinal tract of a mammalian subject, the method comprising:
administering to the gastrointestinal tract of the subject a therapeutically effective amount of an artificial probiotic composition comprising
(a) an isolated Bacillus thuringiensis Cry5B protein; and (b) Bacillus subtilis natto probiotic bacteria,
wherein the isolated Cry5B protein is heterologous to the probiotic bacteria and is admixed with the probiotic bacteria prior to the step of administering.
145. The method of claim 144 wherein the isolated Bacillus thuringiensis Cry5B protein comprises a polypeptide having at least 50, 55, 60, 65, 70, 75, 80, 85, 86, 87, 88, 89, 90, 91 , 92, 93, 94, 95, 96, 97, 98, 99, or 100
percent amino acid sequence identity to the amino acid sequence set forth in SEQ ID NO:1.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US15/321,642 US10940170B2 (en) | 2014-07-07 | 2015-07-01 | Anthelmintic probiotic compositions and methods |
| US17/160,030 US20210268045A1 (en) | 2014-07-07 | 2021-01-27 | Anthelmintic probiotic compositions and methods |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US201462021576P | 2014-07-07 | 2014-07-07 | |
| US62/021,576 | 2014-07-07 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US15/321,642 A-371-Of-International US10940170B2 (en) | 2014-07-07 | 2015-07-01 | Anthelmintic probiotic compositions and methods |
| US17/160,030 Division US20210268045A1 (en) | 2014-07-07 | 2021-01-27 | Anthelmintic probiotic compositions and methods |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2016007355A1 true WO2016007355A1 (en) | 2016-01-14 |
Family
ID=55064708
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2015/038881 Ceased WO2016007355A1 (en) | 2014-07-07 | 2015-07-01 | Anthelmintic probiotic compositions and methods |
Country Status (2)
| Country | Link |
|---|---|
| US (1) | US20210268045A1 (en) |
| WO (1) | WO2016007355A1 (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2019139108A1 (en) | 2018-01-12 | 2019-07-18 | 花王株式会社 | Production method for protein |
| CN111148524A (en) * | 2017-05-23 | 2020-05-12 | 马萨诸塞大学 | Purified anthelmintic compositions and related methods |
| US10940170B2 (en) | 2014-07-07 | 2021-03-09 | University Of Massachusetts | Anthelmintic probiotic compositions and methods |
| WO2025090606A1 (en) * | 2023-10-27 | 2025-05-01 | Basf Agricultural Solutions Us Llc | Use of novel genes for the control of nematode pests |
| US12576129B2 (en) | 2016-01-15 | 2026-03-17 | University Of Massachusetts | Anthelmintic compositions and methods |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4865981A (en) * | 1985-08-16 | 1989-09-12 | Mycogen Corporation | Cloning and expression of Bacillus Thuringiensis toxin gene toxic to bettles of the order coleoptera |
| US5596071A (en) * | 1991-05-22 | 1997-01-21 | Mycogen Corporation | Bacillus thuringiensis toxins active against hymenopteran pests |
| US7351881B2 (en) * | 2003-02-20 | 2008-04-01 | Athenix Corporation | AXMI-008, a delta-endotoxin gene and methods for its use |
| US7923602B2 (en) * | 2006-06-14 | 2011-04-12 | Athenix Corp. | AXMI-031, AXMI-039, AXMI-040 and AXMI-049, a family of novel delta endotoxin genes and methods for their use |
| US20110263489A1 (en) * | 2008-10-29 | 2011-10-27 | The Regents Of The University Of California Office Of Technology Transfer | Combination therapy to combat helminth resistance |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1993017117A1 (en) * | 1992-02-27 | 1993-09-02 | Lynxvale Limited | Heterologous gene expression in lactococcus, and the expression products therefrom |
| WO2006123157A2 (en) * | 2005-05-18 | 2006-11-23 | University Of Bath | Nematistatic protein |
| WO2007062064A2 (en) * | 2005-11-23 | 2007-05-31 | Regents Of The University Of California, San Diego | Methods and compositions for controlling parasitic infections with bt crystal proteins |
-
2015
- 2015-07-01 WO PCT/US2015/038881 patent/WO2016007355A1/en not_active Ceased
-
2021
- 2021-01-27 US US17/160,030 patent/US20210268045A1/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4865981A (en) * | 1985-08-16 | 1989-09-12 | Mycogen Corporation | Cloning and expression of Bacillus Thuringiensis toxin gene toxic to bettles of the order coleoptera |
| US5596071A (en) * | 1991-05-22 | 1997-01-21 | Mycogen Corporation | Bacillus thuringiensis toxins active against hymenopteran pests |
| US7351881B2 (en) * | 2003-02-20 | 2008-04-01 | Athenix Corporation | AXMI-008, a delta-endotoxin gene and methods for its use |
| US7923602B2 (en) * | 2006-06-14 | 2011-04-12 | Athenix Corp. | AXMI-031, AXMI-039, AXMI-040 and AXMI-049, a family of novel delta endotoxin genes and methods for their use |
| US20110263489A1 (en) * | 2008-10-29 | 2011-10-27 | The Regents Of The University Of California Office Of Technology Transfer | Combination therapy to combat helminth resistance |
Non-Patent Citations (3)
| Title |
|---|
| DATABASE NCBI 23 September 2008 (2008-09-23), Database accession no. ACI01644.1 * |
| HU , YAN ET AL.: "Bacillus subtilis strain engineered for treatment of soil- transmitted helminth diseases", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 79, no. 18, 2013, pages 5527 - 5532 * |
| LI, XIANG-QIAN ET AL.: "Expression of Cry5B protein from Bacillus thuringiensis in plant roots confers resistance to root-knot nematode", BIOLOGICAL CONTROL, vol. 47, no. 1, 2008, pages 97 - 102, XP025425935, DOI: doi:10.1016/j.biocontrol.2008.06.007 * |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10940170B2 (en) | 2014-07-07 | 2021-03-09 | University Of Massachusetts | Anthelmintic probiotic compositions and methods |
| US12576129B2 (en) | 2016-01-15 | 2026-03-17 | University Of Massachusetts | Anthelmintic compositions and methods |
| CN111148524A (en) * | 2017-05-23 | 2020-05-12 | 马萨诸塞大学 | Purified anthelmintic compositions and related methods |
| US11844815B2 (en) | 2017-05-23 | 2023-12-19 | University Of Massachusetts | Purified anthelmintic compositions and related methods |
| US12290539B2 (en) | 2017-05-23 | 2025-05-06 | University Of Massachusetts | Purified anthelmintic compositions and related methods |
| WO2019139108A1 (en) | 2018-01-12 | 2019-07-18 | 花王株式会社 | Production method for protein |
| US11661605B2 (en) | 2018-01-12 | 2023-05-30 | Kao Corporation | Production method for protein |
| WO2025090606A1 (en) * | 2023-10-27 | 2025-05-01 | Basf Agricultural Solutions Us Llc | Use of novel genes for the control of nematode pests |
Also Published As
| Publication number | Publication date |
|---|---|
| US20210268045A1 (en) | 2021-09-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20210268045A1 (en) | Anthelmintic probiotic compositions and methods | |
| US12576129B2 (en) | Anthelmintic compositions and methods | |
| US11826389B2 (en) | Purified anthelmintic compositions and related methods | |
| Parker et al. | Microcins reveal natural mechanisms of bacterial manipulation to inform therapeutic development | |
| EP2693887A2 (en) | Modulating bacterial mam polypeptides in pathogenic disease | |
| Poroś-Głuchowska et al. | Antimicrobial resistance of Listeria monocytogenes | |
| EP2787003A1 (en) | Antimicrobial peptide produced by marine sponge-derived Bacillus subtilis | |
| US8852917B2 (en) | Thuricin CD, an antimicrobial for specifically targeting Clostridium difficile | |
| US10940170B2 (en) | Anthelmintic probiotic compositions and methods | |
| US20240269199A1 (en) | Compositions for control of human and animal parasitic nematodes and methods of use | |
| Jiang et al. | FlgN plays important roles in the adhesion of Aeromonas hydrophila to host mucus | |
| Łasica et al. | Campylobacter protein oxidation influences epithelial cell invasion or intracellular survival as well as intestinal tract colonization in chickens | |
| US20210052679A1 (en) | Probiotic delivery of guided antimicrobial peptides | |
| WO2025245028A2 (en) | Novel anthelmintic cry proteins and uses thereof | |
| Monnerat et al. | Bacillus subtilis Strain Engineered for | |
| OA20578A (en) | Probiotic delivery of guided antimicrobial peptides. |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 15819118 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 15321642 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| 122 | Ep: pct application non-entry in european phase |
Ref document number: 15819118 Country of ref document: EP Kind code of ref document: A1 |


