WO2006123157A2 - Nematistatic protein - Google Patents

Nematistatic protein Download PDF

Info

Publication number
WO2006123157A2
WO2006123157A2 PCT/GB2006/001834 GB2006001834W WO2006123157A2 WO 2006123157 A2 WO2006123157 A2 WO 2006123157A2 GB 2006001834 W GB2006001834 W GB 2006001834W WO 2006123157 A2 WO2006123157 A2 WO 2006123157A2
Authority
WO
WIPO (PCT)
Prior art keywords
sequence
polypeptide
expression
polynucleotide
seq
Prior art date
Application number
PCT/GB2006/001834
Other languages
French (fr)
Other versions
WO2006123157A3 (en
Inventor
Richard Ffrench-Constant
Nicholas Waterfield
Original Assignee
University Of Bath
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from GB0510134A external-priority patent/GB0510134D0/en
Priority claimed from GB0606969A external-priority patent/GB0606969D0/en
Application filed by University Of Bath filed Critical University Of Bath
Publication of WO2006123157A2 publication Critical patent/WO2006123157A2/en
Publication of WO2006123157A3 publication Critical patent/WO2006123157A3/en

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
    • C07K14/24—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Enterobacteriaceae (F), e.g. Citrobacter, Serratia, Proteus, Providencia, Morganella, Yersinia
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
    • A01N63/50—Isolated enzymes; Isolated proteins
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2217/00—Genetically modified animals
    • A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
    • A01K2227/00—Animals characterised by species
    • A01K2227/70—Invertebrates

Definitions

  • the present invention relates to a polypeptide with nematistatic activity, a polynucleotide encoding it, methods for its production and uses thereof.
  • Nematodes are unsegmented roundworms. Whilst most nematodes are free-living, parasitic nematodes are major challenges to human and animal health and agriculture. Parasitic nematodes, including whipworm, Ascaris, hookworm and filarial worms, currently infect about 3 billion people. Plant parasitic nematodes, such as root knot nematode, cause an estimated 80 billion dollars in crop damage annually. Clearly there is an on-going need to provide new and effective means of controlling parasitic nematodes. The present invention seeks to provide such a means.
  • WO02/094867 describes the genomic sequence of the Photorhabdus luminescens strain TTOl . It describes that polypeptides from the sequence may be used: "for the preparation of biopesticides, in particular, antibiotics, antifungals or cytotoxins; for the secretion of proteins; as virulence factors; for quorum-sensing control, for the identification of targets for human disorders, of which P. luminescens is a model (in particular plague or pertussis); and for the identification of targets against pathogenic gram-negative bacteria using the subtractive genome method". However, it does not disclose the use of any of the polypeptides in the control of nematodes. Further there is no indication in WO02/094867 of which particular polypeptides may have any one of the theoretical uses described therein.
  • S 15 is a novel protein that can agglutinate (clump) a range of difference nematode species, including C. elegans, various parasitic nematodes and the Photorhabdus vector nematode Heterorhabditis. Different strains of Photorhabdus show differing abilities to clump difference nematode species.
  • S15 is temperature dependent and within biof ⁇ lms S15 is located within an intercellular matrix. Analysis of the primary amino acid sequence of the small protein suggests a novel secondary structure. Sl 5 is therefore a novel protein secreted by Photorhabdus that can specifically agglutinate a range of different nematodes.
  • the present invention describes a potent nematicide, derivable in one embodiment from Photorhabdus.
  • the present invention also extends to orthologues of such sequences.
  • the infective juvenile of Heterorhabditid nematode, an entomopathogen carries the Gram-negative insect pathogen Photorhabdus in its gut.
  • the entomopathogenic nematode seeks an insect prey and penetrates the body. It then regurgitates Photorhabdus cells into the insect open blood system of the prey. Photorhabdus rapidly sets up an infection that kills the insect, and begins to replicate.
  • Photorhabdus produces a variety of biologically active molecules that protect the insect corpse from scavenging organisms such as invertebrates, fungi, bacteria and other non-partner nematodes.
  • Photorhabdus bio-converts the insect tissue into more Photorhabdus cells, which provide a food source for the partner nematode.
  • the Heterorhabditids themselves replicate until the insect resource is used up.
  • the Photorhabdus then produces a "food signal" which informs the partner nematode to cease feeding, developmentally switch to an infective juvenile form, and repackage Photorhabdus in their guts and disperse from the cadaver.
  • S15 provides numerous advantages. For example, in the case of river blindness (filariasis), current drugs work by killing the immature stages (microfilaria), but no drugs currently work on adult stages. There is therefore an urgent need to develop drugs that kill adult worms, such as adult filarial worms.
  • the present invention fulfils such a need.
  • the macrocyclic lactones are the current chemicals of choice for nematode control and mass treatment of populations.
  • resistance to macrocyclic lactones is now becoming a serious concern in the industry and recent studies also suggest that ivermectin may have adverse effects on human immune cells.
  • the present invention provides a novel nematicidal control agent with applications both in human and animal health and in controlling nematicidal infestations in crops.
  • the novel agent of the present invention may also be useful in resistance control strategies. For example, use of S15 is compatible with continued use of macrocyclic lactones.
  • S 15 of the present invention may provide an effective resistance management strategy for prolonged use of either active ingredient.
  • Sl 5 is a small stable protein that rapidly clumps nematodes and shows a board spectrum of activity.
  • S 15 is effective against sheathed nematodes.
  • the control of sheathed nematodes is particularly problematic as it can be difficult for drugs to penetrate such nematodes.
  • the novel clumping mechanism provided by S 15, therefore, represents a break through in the control of such nematodes.
  • S15 can be produced conveniently and efficiently.
  • S15 can be produced using Photorhabdus as the expression system.
  • Photorhabdus is an organism which is already fermented at an industrial scale for use as a biocontrol in crop protection.
  • S15 represents around 30% of the total secreted protein in Photorhabdus supernatants.
  • the present invention relates to such sequences including nematistatically active fragments, variants, derivatives, homologues and orthologues thereof for use in controlling nematodes.
  • sequences are referred to herein for ease of reference as "S 15".
  • the S 15 sequence may be derived from P. asymbiotica but may also be a homologue from another Photorhabdus species, such as Photorhabdus luminescens.
  • the S15 sequence may also be an orthologue of a Photorhabdus sequence from, for example, Gibberella zeae or Bacillus thuringeinsis.
  • an isolated polypeptide comprising a sequence which has at least 92% identity to the amino acid sequence shown in SEQ ID NO:1.
  • the amino acid sequence has at least 95% identity to the amino acid sequence shown in SEQ ID NO:1.
  • the isolated polypeptide comprises the amino acid sequence shown in SEQ ID NO : 1.
  • the isolated polypeptide consists of the amino acid sequence shown in SEQ ID NO: 1.
  • a fragment comprising at least 15 contiguous residues of the isolated polypeptide according to the present invention, which fragment is capable of giving rise to a nematistatic effect.
  • an isolated polynucleotide comprising a sequence which encodes the polypeptide or fragment of the present invention.
  • an isolated polynucleotide comprising a sequence which has at least 92% identity to the sequence shown in SEQ ID NO:2; a fragment thereof comprising at least 15 contiguous residues and encoding a polypeptide which is capable of giving rise to a nematistatic effect; or a sequence which is complementary thereto, which is capable of hybridising under stringent conditions thereto, or which is degenerate as a result of the genetic code.
  • the isolated polynucleotide has at least 95% identity to the sequence shown in SEQ ID NO:2.
  • the isolated polynucleotide comprises the sequence of SEQ ID NO:2.
  • an expression sequence comprising a polynucleotide according to the invention or a portion thereof operably linked to a regulatory sequence, the regulatory sequence capable of directing expression of said polynucleotide.
  • the expression sequence is an expression vector.
  • a cell comprising an expression sequence or vector according to the invention.
  • a seventh aspect of the present invention there is provided a cell which has been modified, preferably by genetic engineering, to up-regulate the expression of a polypeptide or a polynucleotide of the invention, compared to a cell which has not been so modified.
  • a plant or transgenic non-human animal such as a nematode, comprising the cell of the invention.
  • a pharmaceutical, veterinary or agricultural composition comprising an Sl 5 polypeptide, polynucleotide, expression sequence, or cell of the present invention, together with a pharmaceutically, veterinary or agriculturally acceptable carrier, excipient or diluent, respectively.
  • a method of producing a polypeptide comprising providing a expression sequence according to the invention, allowing expression of the polypeptide from the expression sequence under control of the regulatory sequence, and optionally purifying the polypeptide.
  • the expression system comprises an expression vector which is transfected into a cell to enable expression of the polypeptide by the cell.
  • a method of producing a recombinant protein comprising providing a cell according to the invention, and causing expression of the recombinant protein in the cell, and optionally purifying the protein.
  • the cell used to produce the protein is from Photorhabdus or E. coli BL21.
  • Figure 1 shows the effect of S15-containing P. asymbiotica ATCC 43949 supernatant upon C. elegans. (A) in the absence of the supernatant; (B) in the presence of S15 after 5 minutes exposure. Note the clumped phenotype of the worms.
  • Figure 2a shows SEM analysis of S15 aggregated nematode worm mass. Increasing magnification (series 1-4) confirmed that a smooth "cement” has rapidly formed and was trapping the worms.
  • Figure 2b shows SEM analysis of S15 aggregated nematode worm mass. Increasing magnification (series 1-3) confirmed that a smooth "cement” has rapidly formed and was trapping the worms.
  • Figure 3 shows the aggregation of the mammalian parasite Haemonchus contortus by S15 confirming that Sl 5 works on both model (C. elegans) and parasitic ⁇ Hemonchus) nematodes.
  • Figures 4(A), (B) and (C) show the results of the identification and characterisation of Sl 5 clumping from Example 2.
  • FIG. 5 shows the identification of S 15 using 2D-gels of Photorhabdus asymbiotica ATCC 43949 2 day supernatants. Note the presence of S15 at 3O 0 C but not 37 0 C (arrow).
  • FIG. 6 shows the expression of S15 in E. coli EClOO [pBAD30 ⁇ 75].
  • M size marker;
  • l uninduced;
  • (2) ⁇ 2 hours;
  • (3) overnight inductions.
  • Arrow represents S15.
  • Figure 7 shows the effect of expression of S15 in E. coli EClOO [ ⁇ BAD30W5] on C. elegans.
  • Figure 8a shows four SEM views of induced E. coli EClOO ⁇ pBAD30sl5] cells after exposure to C. elegans. Note how the cells are surrounded by a smooth matrix which binds them together.
  • Figure 8b shows two SEM views of the heads of C. elegans worms that are aggregated by induced E. coli EClOO [pBAD30 ⁇ /J]. Note how the cell-matrix surrounds the worms and even extends into the mouth.
  • Figure 9 shows (a) an SEM view of induced E. coli EClOO [pBAD30 ⁇ i5] showing chains of bacterial cells, (b-d) TEM views of induced E. coli EClOO [pBAD30$15] showing that (b) bacterial chains are due to an internal scaffold (arrow) of self- assembled S15 protein, (c) that the protein is fibrilar/crystalline (arrow), (d) an S15 fibre-bundle in cross-section (arrow).
  • Figure 10 shows an alignment between P, asymbiotica ATCC43949 S15 and P. luminescens TTOl S 15.
  • Figure 11 shows an alignment between P. asymbiotica ATCC43949 S15 and Gibberella zeae PH-I predicted protein FGl 0692.1.
  • Figure 12 shows an alignment between P. asymbiotica ATCC43949 S15 and Bacillus thuringiensis 13.6kDa insecticidal crystal protein (AAG41671).
  • Figure 13 demonstrates the nematistatic activity of Sl 5 and derivatives thereof (F9, A5, E8 and c9).
  • Figure 14 shows the results of clumping experiments carried out in Example 6.
  • Figure 15 shows the results of S15 recombinant expression experiments carried out in Example 7.
  • Figure 16 shows the results of immunocytochemistry experiments carried out in Example 8.
  • Figure 17 shows the results of immuno-gold analysis carried out in Example 9.
  • Figure 18 shows sequences from various strains of Photorhabdus asymbiotica and a consensus sequence.
  • Figure 19 illustrates mutant mapping regions important in fibre formation.
  • SEQ ID NO: 1 is the sequence of amino acid sequence of P. asymbiotica S 15.
  • SEQ ID NO: 2 is the nucleic acid sequence of P. asymbiotica S 15.
  • the present invention provides generally for certain nucleic acids, polypeptides, as well as fragments, homologues, variants and derivatives thereof from the Gram- negative insect pathogen Photorhabdus, which are capable of nematistatic activity in nematodes, and preferably ultimately nematicidal activity in nematodes.
  • polypeptide sequences disclosed here are not limited to the particular sequences set forth in the Sequence Listings or Figures, or fragments thereof, or sequences obtained from S15 protein, but also include homologous sequences and orthologues thereof obtained from any source, for example related cellular homologues or orthologues, homologues or orthologues from other species, including variants or derivatives thereof, provided that they have at least one of the biological activities of S 15.
  • sequences give rise to at least one biological activity of S 15.
  • the biological activity comprises nematistatic activity, preferably assayed by a nematode-aggregation response.
  • the S 15 sequences described in this document preferably are capable of causing nematistatic activity through aggregation, which even more preferably leads to a nematicidal effect.
  • the S15 sequences when applied to a population of nematodes are capable of giving rise to aggregation of at least 10%, preferably 20%, more preferably 30%, 40% 50%, 60%, 70%, 80%, 90% or more, of the population of nematodes compared to a population to which the S 15 sequences have not been applied.
  • Methods for assaying a nematode aggregation response are described in the following Examples and may involve simply applying the S15 to a solution of test nematodes.
  • polypeptides disclosed include homologous sequences obtained from any source, for example related bacterial proteins, cellular homologues and synthetic peptides, as well as variants or derivatives thereof. Thus polypeptides also include those encoding homologues of S 15.
  • the present invention particularly relates to homologues from other Photorhabdus species, and in particular from P. luminescens.
  • the sequences identity level between P. asymbiotica and P. luminescens is 91.9%.
  • the present invention in one embodiment relates to novel S15 sequences having a sequence identity level of at least 92% to the amino acid sequence of P. asymbiotica.
  • the present invention in another embodiment the present invention relates to the use of homologues of these sequences and in which case the sequence identity level may be lower than 92%.
  • a homologous sequence or homologue is taken to include an amino acid sequence which is at least 60, 70, 80 or 90% identical, preferably at least 95 or 98% identical at the amino acid level over at least 30, preferably 50, 70, 90 or 100 amino acids with S 15, or over its entire length, for example as shown in the sequence listing herein.
  • a homologous sequence is taken to include an amino acid sequence which is at least 15, 20, 25, 30, 40, 50, 60, 70, 80 or 90% identical, preferably at least 95 or 98% identical at the amino acid level, preferably over at least 15, 25, 35, 50 or 100 amino acids with the sequence of S 15.
  • a sequence may have the stated sequence identity to S15 (preferably comprising a sequence as shown in SEQ ID NO: 1).
  • sequence identity is determined relative to the entirety of the length the relevant sequence, i.e., over the entire length or full length sequence of the relevant gene, for example.
  • Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
  • % homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues (for example less than 50 contiguous amino acids).
  • BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999 ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program.
  • a new tool called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nih.gov).
  • % homology can be measured in terms of identity
  • the alignment process itself is typically not based on an all-or-nothing pair comparison.
  • a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance.
  • An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the
  • GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62. Alternatively, percentage homologies may be calculated using the multiple alignment feature in DNASISTM (Hitachi Software), based on algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM 1988 Gene 73(1): 237-44).
  • % homology preferably % sequence identity.
  • the software typically does this as part of the sequence comparison and generates a numerical result.
  • variant or derivative in relation to the amino acid sequence as described here includes any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the sequence.
  • the resultant amino acid sequence retains substantially the same activity as the unmodified sequence, preferably having at least the same activity as the Sl 5 polypeptide shown in the Sequence Listings.
  • the key feature of the sequences namely that they are capable of giving rise to a nematode- aggregating response - is preferably retained.
  • a polypeptide having the amino acid sequence shown in the Sequence Listings or Figures, or fragments or homologues thereof, may be modified for use in the methods and compositions described here. Typically, modifications are made that maintain the biological activity of the sequence. Amino acid substitutions may be made, for example from 1, 2 or 3 to 10, 20 or 30 substitutions provided that the modified sequence retains the biological activity of the unmodified sequence. Amino acid substitutions may include the use of non-naturally occurring analogues.
  • Natural variants of S15 are likely to comprise conservative amino acid substitutions.
  • Conservative substitutions may be defined, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
  • Figure 13 Examples of variants and derivatives which are included in the scope of the present invention are shown in Figure 13.
  • the nematistatic activity of derivatives is screened.
  • Particularly preferred examples of derivatives within the scope of the invention include the amino acid sequences shown as F9 and C9 in Figure 13.
  • Orthologues of the Photorhabdus S15 which retain nematistatic activity.
  • orthologues include the Gibberella zeae PH-I predicted proteins, FG10692.1, FG00134.1 and FGl 1612.1; and the Bacillus thuringiensis 13.6kDa insecticidal protein.
  • the alignment of P. asymbiotica S15 to FG10692.1 and Bt 13.6Kda protein are shown in Figures 11 and
  • sequence identity level between such orthologues and the Photorhabdus S15 may be as low as 20%, in some instances, 21.7%, 25%, 27.9%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% and 70%.
  • functionally active orthologues may still be employed in the present invention.
  • polypeptides of the present invention also include fragments of the above mentioned full length polypeptides and variants thereof, including fragments of the sequences set out in the Sequence Listings and Figures.
  • Polypeptides also include fragments of the full length sequence of any of Sl 5 polypeptides.
  • fragments comprise at least one epitope. More preferably the fragments comprise at least one of the epitopes represented by amino acid sequences 33 to 58 and/or 93 to 118 of SEQ ID NO: 1.
  • Methods of identifying epitopes are well known in the art. Fragments will typically comprise, or comprise at least, 6 amino acids, more preferably at least 10, 15, 20, 30, 50 or 100 amino acids. In one particular embodiment, 24 or 26 amino acids or more is preferred.
  • fragments comprising, preferably consisting of, 5, 6, 7, 8, 9, 10, 11, 12,
  • Polypeptide fragments of the S15 protein and allelic and species variants thereof may contain one or more (e.g. 5, 10, 15, or 20) substitutions, deletions or insertions, including conserved substitutions. Where substitutions, deletion and/or insertions occur, for example in different species, preferably less than 50%, 40% or 20% of the amino acid residues depicted in the sequence listings are altered.
  • S 15, and their fragments, homologues, variants and derivatives may be made by recombinant means. However, they may also be made by synthetic means using techniques well known to skilled persons such as solid phase synthesis.
  • the proteins may also be produced as fusion proteins, for example to aid in extraction and purification.
  • fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and/or transcriptional activation domains) and ⁇ -galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences. Preferably the fusion protein will not hinder the function of the protein of interest sequence. Proteins may also be obtained by purification of cell extracts from animal cells.
  • the S 15 polypeptides, variants, homologues, fragments and derivatives disclosed here may be in a substantially isolated form. It will be understood that such polypeptides may be mixed with carriers or diluents which will not interfere with the intended purpose of the protein and still be regarded as substantially isolated.
  • a S15 peptide, variant, homologue, fragment or derivative may also be in a substantially purified form, in which case it will generally comprise the protein in a preparation in which more than 90%, e.g. 95%, 98% or 99% of the protein in the preparation is a protein.
  • the S15 polypeptides, variants, homologues, fragments and derivatives disclosed here may be labelled with a revealing label.
  • the revealing label may be any suitable label which allows the polypeptide, etc to be detected. Suitable labels include radioisotopes, e.g. 125 I, enzymes, antibodies, polynucleotides and linkers such as biotin. Labelled polypeptides may be used in diagnostic procedures such as immunoassays to determine the amount of a polypeptide in a sample. Polypeptides or labelled polypeptides may also be used in serological or cell-mediated immune assays for the detection of immune reactivity to said polypeptides in animals and humans using standard protocols.
  • S15 polypeptides, variants, homologues, fragments and derivatives disclosed here, optionally labelled, may also be fixed to a solid phase, for example the surface of an immunoassay well or dipstick.
  • labelled and/or immobilised polypeptides may be packaged into ldts in a suitable container along with suitable reagents, controls, instructions and the like.
  • Such polypeptides and kits may be used in methods of detection of antibodies to the polypeptides or their allelic or species variants by immunoassay.
  • Immunoassay methods are well known in the art and will generally comprise: (a) providing a polypeptide comprising an epitope bindable by an antibody against said protein; (b) incubating a biological sample with said polypeptide under conditions which allow for the formation of an antibody-antigen complex; and (c) determining whether antibody-antigen complex comprising said polypeptide is formed.
  • S15 polypeptides, variants, homologues, fragments and derivatives disclosed here may be used in in vitro or in vivo cell culture systems to study the role of their corresponding genes and homologues thereof in cell function, including their function in disease.
  • truncated or modified polypeptides may be introduced into a cell to disrupt the normal functions which occur in the cell.
  • the polypeptides may be introduced into the cell by in situ expression of the polypeptide from a recombinant expression vector (see below).
  • the expression vector optionally carries an inducible promoter to control the expression of the polypeptide.
  • host cells such as insect cells or mammalian cells
  • post-translational modifications e.g. myristolation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation
  • Such cell culture systems in which the S15 polypeptides, variants, homologues, fragments and derivatives disclosed here are expressed may be used in assay systems to identify candidate substances which interfere with or enhance the functions of the polypeptides in the cell.
  • nucleic acid sequences preferably encode the polypeptide sequences disclosed here, and particularly in the Sequence Listings and Figures.
  • the polynucleotides comprise Sl 5 nucleic acids, preferably selected from SEQ ID NO: 2.
  • nucleic acids or polynucleotides which encode any of the Photorhabdus asymbiotica polypeptides disclosed here.
  • S 15 sequence should be construed accordingly.
  • such nucleic acids or polynucleotides comprise the sequence set out as SEQ ID NO: 2, or a sequence encoding any of the corresponding polypeptides, and a fragment, homologue, variant or derivative of such a nucleic acid.
  • the above terms therefore preferably should be taken to refer to these sequences.
  • Polynucleotide As used here in this document, the terms “polynucleotide”, “nucleotide”, and “nucleic acid” are intended to be synonymous with each other. “Polynucleotide” generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
  • Polynucleotides include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-strande'd regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions.
  • polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA.
  • the term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.
  • Modified bases include, for example, tritylated bases and unusual bases such as inosine.
  • polynucleotide embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells.
  • Polynucleotide also embraces relatively short polynucleotides, often referred to as oligonucleotides.
  • the polynucleotides described here may comprise DNA or RNA. They may be single-stranded or double-stranded. They may also be polynucleotides which include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present document, it is to be understood that the polynucleotides described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of polynucleotides.
  • both strands of the duplex are encompassed by the methods and compositions described here.
  • the polynucleotide is single-stranded, it is to be understood that the complementary sequence of that polynucleotide is also included.
  • variant in relation to a nucleotide sequence include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleotides from or to the sequence.
  • the resulting sequence is capable of encoding a polypeptide which has nematode-aggregating activity.
  • a "homologue” has preferably at least 5% identity, at least 10% identity, at least 15% identity, at least 20% identity, at least 25% identity, at least 30% identity, at least 35% identity, at least 40% identity, at least 45% identity, at least 50% identity, at least 55% identity, at least 60% identity, at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, or at least 95% identity to the relevant sequence shown in the sequence listings.
  • nucleotide homology comparisons may be conducted as described above.
  • a preferred sequence comparison program is the GCG Wisconsin Bestfit program described above.
  • the default scoring matrix has a match value of 10 for each identical nucleotide and -9 for each mismatch.
  • the default gap creation penalty is -50 and the default gap extension penalty is -3 for each nucleotide.
  • a Sl 5 polynucleotide has at least 90% or more sequence identity to a sequence shown as SEQ ID NO: 2.
  • the Sl 5 polynucleotide has 91% or more, preferably 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more or 99.5% or more sequence identity to a sequence shown as SEQ ID NO: 2.
  • Nucleotide sequences are preferably 15 or at least 15 nucleotides in length, more preferably 20, 24, 26, 30, 40 or 50 nucleotides or more in length.
  • hybridisation shall include “the process by which a strand of nucleic acid joins with a complementary strand through base pairing” as well as the process of amplification as carried out in polymerase chain reaction technologies.
  • Polynucleotides capable of selectively hybridising to the nucleotide sequences presented herein, or to their complement will be generally at least 70%, preferably at least 80 or 90% and more preferably at least 95% or 98% homologous to the corresponding nucleotide sequences presented herein over a region of at least 20, preferably at least 25 or 30, for instance at least 40, 60 or 100 or more contiguous nucleotides.
  • the term "selectively hybridisable" means that the polynucleotide used as a probe is used under conditions where a target polynucleotide is found to hybridize to the probe at a level significantly above background.
  • the background hybridization may occur because of other polynucleotides present, for example, in the cDNA or genomic DNA library being screened.
  • background implies a level of signal generated by interaction between the probe and a non-specific DNA member of the library which is less than 10 fold, preferably less than 100 fold as intense as the specific interaction observed with the target DNA.
  • the intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with 32 P.
  • Hybridisation conditions are based on the melting temperature (Tm) of the nucleic acid binding complex, as taught in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, VoI 152, Academic Press, San Diego CA), and confer a defined "stringency” as explained below.
  • Maximum stringency typically occurs at about Tm-5°C (5°C below the Tm of the probe); high stringency at about 5°C to 10°C below Tm; intermediate stringency at about 1O 0 C to 2O 0 C below Tm; and low stringency at about 20°C to 25 0 C below Tm.
  • a maximum stringency hybridisation can be used to identify or detect identical polynucleotide sequences while an intermediate (or low) stringency hybridisation can be used to identify or detect similar or related polynucleotide sequences.
  • both strands of the duplex are encompassed by the present disclosure.
  • the polynucleotide is single-stranded, it is to be understood that the complementary sequence of that polynucleotide is also disclosed and encompassed.
  • Polynucleotides which are not 100% homologous to the sequences disclosed here but fall within the disclosure can be obtained in a number of ways.
  • Other variants of the sequences described herein may be obtained for example by probing DNA libraries made from a range of individuals, for example individuals from different populations.
  • other viral/bacterial, or cellular homologues may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein.
  • Such sequences may be obtained by probing cDNA libraries made from or genomic DNA libraries from other species, and probing such libraries with probes comprising all or part of SEQ ID NO: 2 under conditions of medium to high stringency.
  • the polynucleotides described here may be used to produce a primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors.
  • a primer e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors.
  • Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 30 or 40 nucleotides in length, and are also encompassed by the term polynucleotides as used herein.
  • Preferred fragments are less than 100, 50 or 20 nucleotides in length.
  • Polynucleotides such as a DNA polynucleotides and probes may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques.
  • primers will be produced by synthetic means, involving a step wise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.
  • Longer polynucleotides will generally be produced using recombinant means, for example using PCR (polymerase chain reaction) cloning techniques. This will involve making a pair of primers (e.g. of about 15 to 30 nucleotides) flanking a region of the sequence which it is desired to clone, bringing the primers into contact with mRNA or cDNA obtained from bacterial or an animal or human cell, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by purifying the reaction mixture on an agarose gel) and recovering the amplified DNA.
  • the primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector.
  • the S15 polynucleotides described here can be incorporated into a recombinant replicable vector.
  • the vector may be used to replicate the nucleic acid in a compatible host cell.
  • the vector comprising the polynucleotide sequence may be transformed into a suitable host cell.
  • Suitable hosts may include bacterial, yeast, insect and fungal cells.
  • transformed cell includes cells that have been transformed by use of recombinant DNA techniques.
  • the transformation typically occurs by insertion of one or more nucleotide sequences into a cell that is to be transformed.
  • the inserted nucleotide sequence may be a heterologous nucleotide sequence (i.e. is a sequence that is not natural to the cell that is to be transformed.
  • the inserted nucleotide sequence may be an homologous nucleotide sequence (i.e. is a sequence that is natural to the cell that is to be transformed) - so that the cell receives one or more extra copies of a nucleotide sequence already present in it.
  • the vector may be recovered from the host cell.
  • the S 15 nucleic acid may be operatively linked to transcriptional and translational regulatory elements active in a host cell of interest.
  • the S15 nucleic acid may also encode a fusion protein comprising signal sequences.
  • the S15 nucleic acid may encode a fusion protein comprising a membrane binding domain.
  • the S15 nucleic acid may be expressed at the desired levels in a host organism using an expression vector.
  • An expression vector comprising a Sl 5 nucleic acid can be any vector which is capable of expressing the gene encoding Sl 5 nucleic acid in the selected host organism, and the choice of vector will depend on the host cell into which it is to be introduced.
  • the vector can be an autonomously replicating vector, i.e. a vector that exists as an episomal entity, the replication of which is independent of chromosomal replication, such as, for example, a plasmid, a bacteriophage or an episomal element, a minichromosome or an artificial chromosome.
  • the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome.
  • the expression vector typically includes the components of a cloning vector, such as, for example, an element that permits autonomous replication of the vector in the selected host organism and one or more phenotypically detectable markers for selection purposes.
  • the expression vector normally comprises control nucleotide sequences encoding a promoter, operator, ribosome binding site, translation initiation signal and optionally, a repressor gene or one or more activator genes.
  • the expression vector may comprise a sequence coding for an amino acid sequence capable of targeting the Sl 5 variant polypeptide to a host cell organelle or to a particular host cell compartment.
  • the 'expression signal includes any of the above control sequences, repressor or activator sequences.
  • the nucleic acid sequence the Sl 5 variant polypeptide is operably linked to the control sequences in proper manner with respect to expression.
  • a polynucleotide in a vector is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector.
  • the term "operably linked” means that the components described are in a relationship permitting them to function in their intended manner.
  • a regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
  • control sequences may be modified, for example by the addition of further transcriptional regulatory elements to make the level of transcription directed by the control sequences more responsive to transcriptional modulators.
  • the control sequences may in particular comprise promoters.
  • the nucleic acid sequence encoding for the Sl 5 polypeptide is operably combined with a suitable promoter sequence.
  • the promoter can be any DNA sequence having transcription activity in the host organism of choice and can be derived from genes that are homologous or heterologous to the host organism.
  • suitable promoters for directing the transcription of the S 15 nucleotide sequence, in a bacterial host include the promoter of the lac operon of E. coli, the Streptomyces coelicolor agarase gene dagA promoters, the promoters of the Bacillus Hcheniformis ⁇ -amylase gene (amyL), the promoters of the Bacillus stearothermophilus maltogenic amylase gene (amyM), the promoters of the Bacillus amyloliquefaciens ⁇ -amylase gene (amyQ), the promoters of the Bacillus subtilis xylA and xylB genes and a promoter derived from a Lactococcus sp.-derived promoter including the P170 promoter.
  • a suitable promoter can be selected, for example, from a bacteriophage promoter including a T7 promoter and a phage lambda promoter.
  • examples of useful promoters are those derived from the genes encoding the, Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral ⁇ -amylase, A. niger acid stable ⁇ -amylase, A. niger glucoamylase, Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase or Aspergillus nidulans acetamidase.
  • Suitable promoters for the expression in a yeast species include but are not limited to the Gal 1 and Gal 10 promoters of Saccharomyces cerevisiae and the Pichia pastoris A OXl or AOX2 promoters.
  • suitable bacterial host organisms are gram positive bacterial species such as Bacillaceae including Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus lautus, Bacillus megaterium and Bacillus thuringiensis, Streptomyces species such as Streptomyces murinus, lactic acid bacterial species including Lactococcus spp. such as Lactococcus lactis, Lactobacillus spp.
  • Bacillaceae including Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus lautus, Bacillus megaterium and Bac
  • strains of a gram-negative bacterial species belonging to Enterobacteriaceae including E. coli, such as E. coli BL21, or to Pseudomonadaceae can be selected as the host organism.
  • E. coli such as E. coli BL21
  • Pseudomonadaceae can be selected as the host organism.
  • use may be made of Bacteroides species; one of the most numerous of intestinal bacteria.
  • S 15 is produced through expression in Photorhabdus. This has advantages since commercial scale fermentation techniques for Photorhabdus are already known.
  • a suitable yeast host organism can be selected from the biotechnologically relevant yeasts species such as but not limited to yeast species such as Pichia sp., Hansenula sp or Kluyveromyces, Yarrowinia species or a species of Saccharomyces including Saccharomyces cerevisiae or a species belonging to Schizosaccharomyce such as, for example, S. Pombe species.
  • yeast species such as Pichia sp., Hansenula sp or Kluyveromyces, Yarrowinia species or a species of Saccharomyces including Saccharomyces cerevisiae or a species belonging to Schizosaccharomyce such as, for example, S. Pombe species.
  • a strain of the methylotrophic yeast species Pichia pastoris is used as the host organism.
  • the host organism is a Hansenula species.
  • Suitable host organisms among filamentous fungi include species of Aspergillus, e.g. Aspergillus niger, Aspergillus oryzae, Aspergillus tubigensis, Aspergillus awamori or Aspergillus nidulans.
  • strains of a Fusarium species e.g. Fusarium oxysporum or of a Rhizomucor species such as Rhizomucor miehei can be used as the host organism.
  • Other suitable strains include Thermomyces and Mucor species.
  • sequences S15 may be driven by any of a number of promoters.
  • viral promoters such as the 35S and 19S promoters of CaMV may be used alone or in combination with the omega leader sequence from TMV.
  • plant promoters such as the small subunit of RUBISCO or heat shock promoters may be used.
  • constructs can be introduced into plant cells by direct DNA transformation or pathogen-mediated transfection. Such techniques are described in a number of generally available reviews. (See, for example, Hobbs, S. or Murray, L. E. in McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill, New York, N. Y.; pp. 191-196.).
  • An insect system may also be used to express S 15.
  • Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae.
  • the sequence encoding S15 may be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of S15 will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein.
  • the recombinant viruses may then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which S15 may be expressed.
  • Host cells comprising polynucleotides may be used to express polypeptides, such as S15 polypeptides, fragments, homologues, variants or derivatives thereof.
  • Host cells may be cultured under suitable conditions which allow expression of the proteins. Expression of the polypeptides may be constitutive such that they are continually produced, or inducible, requiring a stimulus to initiate expression. In the case of inducible expression, protein production can be initiated when required by, for example, addition of an inducer substance to the culture medium, for example dexamethasone or IPTG.
  • an inducer substance for example dexamethasone or IPTG.
  • Polypeptides can be extracted from host cells by a variety of techniques known in the art, including enzymatic, chemical and/or osmotic lysis and physical disruption. In certain systems, such as Photorhabdus, the Sl 5 is secreted in an active form from the host cells. In such cases it is not necessary to extract the polypeptide, and Sl 5 can be used in the form of a supernatant.
  • the host cell is grown at a temperature of about 3O 0 C.
  • Polypeptides may also be produced recombinantly in an in vitro cell-free system, such as the TnTTM (Promega) rabbit reticulocyte system.
  • the present invention also encompasses specific antagonists of S 15, which may be used to regulate the activity of these proteins and detect them which may include antibodies against the protein(s).
  • specific antagonists of S 15, which may be used to regulate the activity of these proteins and detect them which may include antibodies against the protein(s).
  • antibodies capable of binding to S 15, and preferably capable of inhibiting any biological activity thereof, may be useful.
  • the present polypeptides and polynucleotides are primarily useful as antiparasitic agents for the treatment of heminthiasis in animals and preferably domestic animals, such as cattle, sheep, horse, dogs, cats, goats, swine and poultry.
  • treatment includes prophylactic treatment. They are also useful in the treatment of helminthiasis in humans.
  • the disease or group of diseases described generally as helminthiasis is due to infection of an animal host with parasitic worms known as helminths, or nematodes.
  • the present invention may also be used to combat agricultural pest nematodes which attack crops either in the field or in storage.
  • Nematode parasites of vertebrates include gut roundworms, hookworms, pinworms, whipworms, and filarial worms. They can be transmitted in a variety of ways, including by water contamination, skin penetration, biting insects, or by ingestion of contaminated food.
  • nematode control or "de-worming" is essential to the economic viability of livestock producers and is a necessary part of veterinary care of companion animals.
  • Parasitic nematodes cause mortality in animals (e.g., heartworm in dogs and cats) and morbidity as a result of the parasites' inhibiting the ability of the infected animal to absorb nutrients.
  • Parasite-induced nutrient deficiency results in diseased livestock and companion animals (i.e., pets), as well as in stunted growth. For instance, in cattle and dairy herds, a single untreated infection with the brown stomach worm can permanently stunt an animal's ability to effectively convert feed into muscle mass or milk.
  • Nematode parasites of plants can inhabit all parts of plants, including the roots, developing flower buds, leaves, and stems. Plant parasites are classified on the basis of their feeding habits into the broad categories: migratory ectoparasites, migratory endoparasites, and sedentary endoparasites. Sedentary endoparasites, which include the root knot nematodes (Meloidogyne) and cyst nematodes (Globodera and Heterodera) induce feeding sites and establish long-term infections within roots that are often very damaging to crops.
  • the present invention may also find applicability in the area of "biocontrol".
  • Biocontrol is the control of living organisms, especially pests, by biological means.
  • an organisms expressing S15 may be employed to control nematode pests.
  • the organism expressing S15 will be a Photorhabdus species such as Pseudomonas fluorescens, particularly but not exclusively to control nematodes attacking roots, such as plant root nematodes.
  • S15 may be expressed as a transgene in any suitable organism. It will also be appreciated that expression of Sl 5 may be upregulated using a heterologous promoter.
  • the invention is particularly important for high value crops, such as strawberries and tomatoes, where chemicals have been used extensively to control soil pests.
  • high value crops such as strawberries and tomatoes
  • economic hardship resulting from nematode infestation is highest in strawberries, bananas, and other high value vegetables and fruits.
  • nematode damage is greatest in soybeans and cotton.
  • additional crops that suffer from nematode infestation including potato, pepper, onion, citrus, coffee, sugarcane, greenhouse ornamentals and golf course turf grasses.
  • the present invention finds applicability in all these areas.
  • the present invention may have application in connection with the control of nematodes of the following non-limiting, exemplary genera:
  • Plant parasitic nematode genera include:
  • Animal and human parasitic nematode genera include:
  • Particularly preferred nematode species include:
  • Plant parasitic Anguina tritici, Aphelenchoides fragariae, Belonolaimus longicaudatus, Bursaphelenchus xylophilus, Ditylenchus destructor, Ditylenchus dipsaci, Dolichodorus heterocephalous, Globodera pallida, Globodera rostochiensis,
  • Globodera tabacum Heterodera avenae, Heterodera cardiolata, Heterodera carotae, Heterodera cruciferae, Heterodera glycines, Heterodera major, Heterodera schachtii, Heterodera zeae, Hoplolaimus tylenchiformis, Longidorus sylphus, Meloidogyne acronea, Meloidogyne arenaria, Meloidogyne chitwoodi, Meloidogyne exigua, Meloidogyne graminicola, Meloidogyne hapla, Meloidogyne incognita, .
  • Animal & Human parasitic Ancylostoma braziliense, Ancylostoma caninum, Ancylostoma ceylanicum, Ancylostoma duodenale, Ancylostoma tubaeforme, Ascaris suum, Ascaris lumbrichoides, Brugia malayi, Capillaria bovis, Capillaria plica, Capillaria feliscati, Cooperia oncophora, Cooperia punctata, Cyathostome species, Dictyocaulus filaria, Dictyocaulus viviparus, Dictyocaulus arnfieldi, Dirofiliaria immitis, Dracunculus insignis, Enterobius vermicularis, Haemonchus contortus, Haemonchus placei, Necator americanus, Nematodirus helvetianus, Oesophagostomum racliatum, Onchocerca volvulus, Oncho
  • a nucleic acid of the invention can be used to generate a transgenic plant such as Arabidopis thaliana, a model legume Medicago truncatula, or any plant of interest.
  • a transgenic plant such as Arabidopis thaliana, a model legume Medicago truncatula, or any plant of interest.
  • Methods for the production of transgenic plants are described in general above.
  • the Sl 5 gene can be cloned into a vector under the control of the cauliflower mosaic virus (CaMV) 35S promoter/nopaline synthase terminator cassette (Baulcombe et al. (1986) Nature 321:446-449) which can then be introduced into an Agrobacterium strain by the freeze thaw method.
  • CaMV cauliflower mosaic virus
  • Agrobacterium-mediated transformation can be accomplished by the planta- vacuum-infiltration method (Bouchez et al. (1993) CR. Acad. Sci. Paris 316:1188- 1193) and transformed transgeneic plant lines can be selected (Spychalla et al. (1997) Proc. Natl. Acad. Sci. 94:1142-1147). Such a plant line can be used to generate plants with increased resistance to nematodes by providing the plant with a transgene expressing S 15.
  • polypeptides and/or polynucleotides When used as pesticides, they may be used as such; however, they are usually used after formulation into oil sprays, emulsifiable concentrates, flowables, granules, dusts, poison baits, microcapsules, or application forms by mixing with solid carriers, liquid carriers, gaseous carriers, or baits, and if necessary, by addition of surfactants or other auxiliaries and processing.
  • formulations may usually contain the present compounds in 0.01% to 95% by weight.
  • the solid carrier used in the formulation may include fine powder or granules of clay materials such as kaolin clay, diatomaceous earth, synthetic hydrated silicon oxide, bentonite, Fubasami clay, and acid clay; various kinds of talc, ceramics, and other inorganic minerals such as sericite, quartz, sulfur, activated charcoal, calcium carbonate, and hydrated silica; and chemical fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, and ammonium chloride.
  • clay materials such as kaolin clay, diatomaceous earth, synthetic hydrated silicon oxide, bentonite, Fubasami clay, and acid clay
  • various kinds of talc, ceramics, and other inorganic minerals such as sericite, quartz, sulfur, activated charcoal, calcium carbonate, and hydrated silica
  • chemical fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, and ammonium chloride
  • the liquid carrier may include water; alcohols such as methanol and ethanol; ketones such as acetone and methyl ethyl ketone; aromatic hydrocarbons such as benzene, toluene, xylene, ethylbenzene, and methylnaphthalene; aliphatic hydrocarbons such as hexane, cyclohexane, kerosene, and light oil; esters such as ethyl acetate and butyl acetate; nitriles such as acetonitrile and isobutyronitrile; ethers such as diisopropyl ether and dioxane; acid amides such as N 5 N- dimethylformamide and N,N-dimethylacetamide; halogenated hydrocarbons such as dichloromethane, trichloroethane, and carbon tetrachloride; dimethyl sulfoxide; and vegetable oils such as soybean oil and cottonseed oil.
  • the gaseous carrier or propellant may include Freon gas, butane gas, LPG (liquefied petroleum gas), dimethyl ether, and carbon dioxide.
  • the surfactant may include alkyl sulfates, alkyl sulfonates, alkyl arylsulfonates, alkyl aryl ethers and their polyoxyethylene derivatives, polyethylene glycol ethers, polyhydric alcohol esters, and sugar alcohol derivatives.
  • the auxiliaries may include fixing agents, dispersing agents, and stabilizers, specific examples of which are casein, gelatin, polysaccharides such as starch, gum arabic, cellulose derivatives, and alginic acid; lignin derivatives, bentonite, sugars, synthetic water-soluble polymers such as polyvinyl alcohol, polyvinyl pyrrolidone, and polyacrylic acid; PAP (isopropyl acid phosphate), BHT (2,6-di-tert-butyl-4- methylphenol), BHA (mixtures of 2-tert-butyl-4-methoxyphenol and 3-tert-butyl-4- methoxyphenol), vegetable oils, mineral oils, and fatty acids and their esters.
  • fixing agents such as casein, gelatin, polysaccharides such as starch, gum arabic, cellulose derivatives, and alginic acid
  • lignin derivatives bentonite
  • sugars synthetic water-soluble polymers such as polyvinyl alcohol, polyvin
  • the base material for poison baits may include bait materials such as grain powder, vegetable oils, ' sugars, and crystalline cellulose; antioxidants such as dibutylhydroxytoluene and nordihydroguaiaretic acid; preservatives such as dehydroacetic acid; substances for preventing erroneous eating, such as red pepper powder; pest attractant flavors such as cheese flavor, onion flavor, and peanut oil.
  • bait materials such as grain powder, vegetable oils, ' sugars, and crystalline cellulose
  • antioxidants such as dibutylhydroxytoluene and nordihydroguaiaretic acid
  • preservatives such as dehydroacetic acid
  • substances for preventing erroneous eating such as red pepper powder
  • pest attractant flavors such as cheese flavor, onion flavor, and peanut oil.
  • the polypeptides and/or polynucleotides may be used in a nematode trap, i.e. a location to which a nematode is lured, e.g. by an attractant.
  • the polypeptides and/or polynucleotides may be used, at least in part, to trap the nematode.
  • the polypeptides and/or polynucleotides may also be used in combination with a cyst hatching factor whereby nematode cysts are encouraged to hatch only to be entrapped by the formulation of the present invention.
  • the present polypeptides and/or polynucleotides are used as pesticides, their application amounts are usually 0.1 to 1000 g in amounts of the present compounds per 1000 m 2 .
  • these formulations are usually applied after water dilution so that the concentrations of active ingredients come to 10 to 10,000 ppm, and for granules or dusts, these formulations are usually applied as such.
  • These formulations or their water dilutions may be used in the foliar treatment of plants such as crop plants to be protected against pests, or may be applied to the nursery beds before planting of crop plant seedlings or to the planting holes or the bases of plants at the time of planting.
  • pests inhabiting the soil of a cultivated land they may be applied to the soil.
  • resin formulations processed into a sheet, string or other shapes may be applied by directly winding around crop plants, extending in the neighborhood of crop plants, or laying on the soil surface at the bases of plants.
  • the rhizosphere is the root-soil interface. It is the zone, about lmm in width, surrounding the epidermis of living root hairs and the boundary cells of mycorrhizae as well as hyphae growing out from some mycorrhizae as well as hypae growing out from some mycorrhizae.
  • a constantly changing mix of organisms, including nematodes, may inhabit the rhizosphere. It will therefore be appreciated that the present formulations may usefully be applied to the rhizosphere.
  • insecticides may be used in admixture with or separately but simultaneously with other insecticides, nematocides, acaricides, bactericides, fungicides, herbicides, plant growth regulators, synergists, fertilizers, soil conditioners and/or animal feeds.
  • the insecticide and/or nematocide and/or acaricide which can be used may include organophosphorus compounds such as Fenitrothion, Fenthion, Pyridaphenthion,
  • the instant polypeptides and/or polynucleotides may be administered internally either orally or by injection, or topically as a liquid drench or as a shampoo.
  • the polypeptides and/or polynucleotides may be administered in capsule, tablet, or drench bolus form or alternatively they can be mixed in the animals feed.
  • the capsules, tablets, and drenches boluses are comprised of the active ingredient in combination with an appropriate carrier vehicle such as starch, talc, magnesium stearate, or dicalcium phosphate.
  • unit dosage forms are prepared by intimately mixing the active ingredient with suitable finely- powdered inert ingredients including diluents, fillers, disintegrating agents, suspending agents, and/or binders such that a uniform mixture solution or suspension is obtained.
  • suitable inert ingredients including diluents, fillers, disintegrating agents, suspending agents, and/or binders such that a uniform mixture solution or suspension is obtained.
  • An inert ingredient is one that will not react with the instant compounds and which is non toxic to the animal being treated.
  • Suitable inert ingredients include starch, lactose, talc, magnesium stearate, vegetable gums and oils, and the like. These formulations may contain a widely variable amount of the active and inactive ingredients depending on numerous factors such as the size and type of the animal species to be treated and the type and severity of the infection.
  • the active ingredient may also be administered as an additive to the feed by simply mixing the compound with the feedstuff or by applying the compound to the surface of the feed. Alternatively the active ingredient may be mixed with an inert carrier and the resulting composition may then either be mixed with the feed or fed directly to the animal.
  • Suitable inert carriers include corn meal, citrus meal, fermentation residues, soya grits, dried grains and the like.
  • the active ingredients are intimately mixed with these inert carriers by grinding, stirring, milling, or tumbling such that the final composition contains from 0.001 to 5.0% by weight of the active ingredient.
  • the polypeptides and/or polynucleotides may alternatively be administered parenterally via injection of a formulation consisting of the active ingredient dissolved in an inert liquid carrier. Injection may be either intramuscular, intraruminal, intratracheal, or subcutaneous.
  • the injectable formulation consists of the active ingredient mixed with an appropriate inert liquid carrier.
  • Acceptable liquid carriers include the vegetable oils such as peanut oil, cotton seed oil, sesame oil and the like as well as organic solvents such as solketal, glycerol formal and the like.
  • aqueous parenteral formulations may also be used.
  • the vegetable oils are the preferred liquid carriers.
  • the formulations are prepared by dissolving or suspending the active ingredient in the liquid carrier such that the final formulation contains from 0.005 to 20% by weight of the active ingredient.
  • the instant polypeptide and/or polynucleotides may usefully be administered as a dried formulation, e.g. a lypholized formulation. Where pulmonary delivery is contemplated, a spray-dried formulation may be particularly useful. Where stability of a solution may be an issue, use of a suspension may be appropriate.
  • Topical application of the instant polypeptides and/or polynucleotides is possible through the use of a liquid drench or a shampoo containing the instant compounds as an aqueous solution or suspension.
  • These formulations generally contain a suspending agent such as bentonite and normally will also contain an antifoaming agent.
  • Formulations containing from 0.005 to 20% by weight of the active ingredient are acceptable.
  • Preferred formulations are those containing from 0.5 to 5% by weight of the instant compounds.
  • the instant polypeptides and/or polynucleotides are primarily useful as antiparasitic agents for the treatment and/or prevention of helminthiasis in domestic animals such as cattle, sheep, horses, dogs, cats, goats, swine, and poultry. They are also effective in the treatment of such parasitic infections of humans. In treating such infections the polypeptides and/or polynucleotides of this invention may be used individually or in combination with each other or with other unrelated antiparasitic agents. The dosage of the instant compounds required for best results depends on several factors such as the species and size of the animal, the type and severity of the infection, the method of administration and the compound used.
  • a single dose of one of the instant polypeptides and/or polynucleotides normally gives excellent control however repeat doses may be given to combat re-infection or for parasite species which are unusually persistent.
  • the techniques for administering these polypeptides and/or polynucleotides to animals are known to those skilled in the veterinary field.
  • the polypeptides and/or polynucleotides may be administered orally in a unit dosage form such as a capsule, bolus or tablet, or as a liquid drench where used as an anthelmintic in mammals.
  • the drench is normally a solution, suspension or dispersion of the active ingredient usually in water together with a suspending agent such as bentonite and a wetting agent or like excipient.
  • a suspending agent such as bentonite and a wetting agent or like excipient.
  • the drenches also contain an antifoaming agent.
  • Drench formulations generally contains from about 0.001 to 0.5% by weight of the active compound.
  • Preferred drench formulations may contain from 0.01 to 0.1% by weight.
  • the capsules and boluses comprise the active ingredient admixed with a carrier vehicle such as starch, talc, magnesium stearate, or di-calcium phosphate.
  • capsules, boluses or tablets containing the desired amount of active compound usually are employed.
  • These dosage forms are prepared by intimately and uniformly mixing the active ingredient with suitable finely divided diluents, fillers, disintegrating agents and/or binders such as starch, lactose, talc, magnesium stearate, vegetable gums and the like.
  • suitable finely divided diluents, fillers, disintegrating agents and/or binders such as starch, lactose, talc, magnesium stearate, vegetable gums and the like.
  • Such unit dosage formulations may be varied widely with respect to their total weight and content of the antiparasitic agent depending upon factors such as the type of host animal to be treated, the severity and type of infection and the weight of the host.
  • the active polypeptide and/or polynucleotide When the active polypeptide and/or polynucleotide is to be administered via an animal feedstuff, it is intimately dispersed in the feed or used as a top dressing or in the form of pellets which may then be added to the finished feed or optionally fed separately.
  • the polypeptides and/or polynucleotides of our invention may be administered to animals parenterally, for example, by intraruminal, intramuscular, intratracheal, or subcutaneous injection in which event the active ingredient is dissolved or dispersed in a liquid carrier vehicle.
  • the active material is suitably admixed with an acceptable vehicle, preferably of the vegetable oil variety such as peanut oil, cotton seed oil and the like.
  • parenteral vehicles such as organic preparation using solketal, glycerol formal, and aqueous parenteral formulations are also used.
  • the active polypeptide and/or polynucleotide is dissolved or suspended in the parenteral formulation for administration; such formulations generally contain from 0.005 to 5% by weight of the active compound.
  • compositions are provided in which the active polypeptides and/or polynucleotides are intimately dispersed in an inert carrier or diluent.
  • inert carrier is meant one that will not react with the antiparasitic agent and one that may be administered safely to animals.
  • a carrier for feed administration is one that is, or may be, an ingredient of the animal ration.
  • compositions include feed premixes or supplements in which the active ingredient is present in relatively large amounts and which are suitable for direct feeding to the animal or for addition to the feed either directly or after an intermediate dilution or blending step.
  • Typical carriers or diluents suitable for such compositions include, for example, distillers' dried grains, corn meal, citrus meal, fermentation residues, ground oyster shells, wheat shorts, molasses solubles, corn cob meal, edible bean mill feed, soya grits, crushed limestone and the like.
  • the active hydrogenated avermectin compounds are intimately dispersed throughout the carrier by methods such as grinding, stirring, milling or tumbling.
  • compositions containing from about 0.005 to 2.0% by weight of the active compound are particularly suitable as feed premixes.
  • Feed supplements which are fed directly to the animal, contain from about 0.0002 to 0.3% by weight of the active polypeptides and/or polynucleotides.
  • Such supplements are added to the animal feed in an amount to give the finished feed the concentration of active polypeptides and/or polynucleotides desired for the treatment and control of parasitic diseases.
  • the desired concentration of active polypeptides and/or polynucleotides will vary depending upon the factors previously mentioned as well as upon the particular avermectin derivative employed, the polypeptide and/or polynucleotide described in this invention is usually fed at concentrations of between 0.00001 to 0.002% in the feed in order to achieve the desired antiparasitic result.
  • polypeptide and/or polynucleotide of this invention is also useful in combatting agricultural pests that inflict damage upon crops while they are growing or while in storage.
  • the compound is applied using known techniques as sprays, dusts, emulsions and the like, to the growing or stored crops to effect protection from such agricultural pests.
  • the killing assays were performed using a Caenorhabditis elegans wild type strain.
  • the nematode was maintained on NGM agar (13.3% NaCl, 11.1% Bactopeptone, 75.5% Bactoagar and cholesterol (5mg/ml in ethanol), IM CaCl 2 , IM MgSO 4 , IM Potassium Phosphate (pH 6.0)) at 18°C.
  • E. coli strain OP50 was used as food source.
  • Nematodes were washed from NGM agar plates with M9 salts buffer (42.5% Na 2 HPO 4 , 21% KH 2 PO 4 , 35.1% NaCl 5 1.7% MgSO 4 JH 2 O). These worm suspensions were added to test solutions and the behaviour of the worms followed microscopically.
  • Haemottchus contortus and other toxicity assays were performed essentially the same as the C. elegans assays.
  • Photorhabdus asymbiotica ATCC43949 was routinely grown in either liquid Luria- Bertini (LB) or protease-peptone number 3 (PP 3 ) media at 30°C with aeration. 500 ⁇ l of overnight or four-day old Photorhabdus cultures in LB and PP 3 liquid medium were transferred into a 24-well tissue culture plate and 40 ⁇ l of nematode suspension (in M9) added. To prevent growth of bacterial contaminants, streptomycin was added to final concentration of 10 micrograms per ml for each well. Nematode response was assessed under a light microscope every 30 minutes over 3 hours, and again overnight.
  • LB liquid Luria- Bertini
  • PP 3 protease-peptone number 3
  • Escherichia coli strain EClOO (Epicentre) was used as a negative control strain in all assays and was also routinely grown in liquid Luria-Bertini media at 3O 0 C with aeration.
  • P. asymbiotica is unusual amongst Photorhabdus species in that it has only been recovered from human infections and no known nematode partner has yet been identified. We therefore sought to identify the putative clumping protein via a comparative analysis of P. asymbiotica supernatants grown at 30°C, a temperature at which interactions with invertebrates might occur, and 37°C, a temperature closer to the human host from which this strain was recovered. Importantly, nematode clumping factor was only produced at 3O 0 C and not at 37 0 C. In more detail, as shown in Figure 4(A), P. asymbiotica ATCC43949 supernatant grown at 30 0 C clumps C. elegans.
  • Figure 4(B) shows that the same strain grown at 37°C looses its ability to clump C. elegans.
  • Figure 4(C) shows that heating (50°C for 10 min.) the supernatant grown at 30 0 C also abolishes the effect.
  • asymbiotica ATC43949 was grown in LB liquid medium for 2 days at both 30°C and 37°C with aeration. Protein from cell free supernatants was concentrated by phenol-precipitation. In more detail, 0.5 volumes of TRIS-equilibrated phenol was added to 1 volume of supernatant. The aqueous phase was discarded and 5 volumes of ethanol then added. This was incubated at -2O 0 C overnight. Proteins were harvested by centrifugation at 4°C for 30 minutes at full speed in a cooled bench-top centrifuge. The supernatant was discarded and the pellet rinsed in acetone before drying.
  • Sl 5 A small protein designated Sl 5 was identified that was secreted at 30 0 C but not at 37°C [ Figure 5].
  • ORF open reading frame
  • protein sequences are detailed in SEQ ID Nos: 1 and 2. This protein spot was picked from the gel and analysed using MALDI-ToF analysis of a trypsin digest.
  • the MALDI-ToF profile allowed us to identify the si 5 gene.
  • the si 5 gene was PCR amplified from the genome using the rTth DNA polymerise kit (Perkin-Elmer). Primers were synthesised by MWG biotech
  • the resulting amplicon was restriction digested with Ec ⁇ RI and HindlU and DNA- ligated (New England Biolabs) into the equivalent sites of the arabinose inducible expression plasmid pBAD30. Representative clones were fully sequenced to confirm the correct sequence of the cloned si 5 ORF. These recombinants were designated E.coli EClOO [pBAD30W5].
  • E.coli EClOO [pBAD30 ⁇ 75] was grown overnight with aeration at 30°C in PP 3 medium supplemented with 100 micrograms/ml ampicillin. This was sub-cultured into fresh medium and grown to an optical density of 0.5 ODeoo- The culture was then split into two halves and one half was induced by the addition of sterile L- arabinose to a final concentration of 0.2% w/v. Both cultures were returned to 3O 0 C with aeration and samples taken at intervals for testing against nematodes and SDS- page analysis. SDS-page indicated significant cell-associated S15 expression by 2 hours and a slight increase after overnight expression [Figure 6]. Sl 5 could not be detected in supernatant fractions.
  • Figures 8a and b show the appearance of Sl 5 expressing E. coli. Without wishing to be bound by any theory, it is believed that Sl 5 is a self-assembling protein that makes fibrils and that these fibrils join the cells when they protrude from them.
  • FIG. 15(A) shows that the Sl 5 protein from P. asymbiotica is highly expressed in recombinant E. coli expressing the plasmid pBADmns.
  • Figure 15(B) shows recombinant E. coli EClOO expressing pBADmns (or pBADS15) can clump C. elegans, whereas E. coli expressing pBAD vector alone cannot. Note that these clumps contain E.
  • Figure 15(C) shows that recombinant P. luminescens TTOl expressing pBADmns can also clump C. elegans. In this case this effect can be reconstituted by the bacterial supernatant as P. luminescens can properly secrete S 15.
  • the results also show that recombinant P. luminescens TTOl expressing pBADmns can also clump Haemonchous.
  • Immunofluorescent labelling of the anti-S15 antibody shows that S15 is part of the clumping matrix (arrow) adhered to several C. elegans ( Figure 16B).
  • Immunogold labelling of the anti-S15 antibody shows gold particles decorating th matrix that entraps the nematodes ( Figure 16C).
  • Example 9 - Sl 5 is involved in biofllm formation
  • Figure 17(A) shows a cross section of a P. luminescens TTOl bacterial colony viewed by TEM. Note the presence of an extensively folded matrix (arrow) between the bacterial cells (P).
  • Figure 17(B) shows localisation of the S15 protein using the anti-S15 antibody labelled with gold particles. Gold particles decorate the matrix.
  • Figure 17(C) shows that the si 5 mutant bacteria show no anti-S15 antibody signal. Scale bars are 0.2 ⁇ m.
  • Figure 17(D) is a histogram showing the relative density of biofilm formed on a microtitre plate by P. asymbiotica (Pa) grown at 30°C or 37°C and by wild type P. luminescens TTOl (TTOl) and si 5 mutant bacteria ( ⁇ mns).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Organic Chemistry (AREA)
  • Agronomy & Crop Science (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Pest Control & Pesticides (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Biochemistry (AREA)
  • Dentistry (AREA)
  • Wood Science & Technology (AREA)
  • Environmental Sciences (AREA)
  • Peptides Or Proteins (AREA)

Abstract

An isolated polypeptide comprising a sequence which has at least 75% identity to the amino acid sequence shown in SEQ ID NO:1.

Description

NEMATISTATIC PROTEIN
Background of the Invention
The present invention relates to a polypeptide with nematistatic activity, a polynucleotide encoding it, methods for its production and uses thereof.
Field of the Invention
Nematodes are unsegmented roundworms. Whilst most nematodes are free-living, parasitic nematodes are major challenges to human and animal health and agriculture. Parasitic nematodes, including whipworm, Ascaris, hookworm and filarial worms, currently infect about 3 billion people. Plant parasitic nematodes, such as root knot nematode, cause an estimated 80 billion dollars in crop damage annually. Clearly there is an on-going need to provide new and effective means of controlling parasitic nematodes. The present invention seeks to provide such a means.
WO02/094867 describes the genomic sequence of the Photorhabdus luminescens strain TTOl . It describes that polypeptides from the sequence may be used: "for the preparation of biopesticides, in particular, antibiotics, antifungals or cytotoxins; for the secretion of proteins; as virulence factors; for quorum-sensing control, for the identification of targets for human disorders, of which P. luminescens is a model (in particular plague or pertussis); and for the identification of targets against pathogenic gram-negative bacteria using the subtractive genome method". However, it does not disclose the use of any of the polypeptides in the control of nematodes. Further there is no indication in WO02/094867 of which particular polypeptides may have any one of the theoretical uses described therein.
The insect pathogenic bacterium Photorhabdus is vectored by nematodes that invade and kill insects. Following their release from the nematode, the bacteria kill the insect using insecticidal proteins, and make antibiotics to keep the cadaver free of invading microbes. We have demonstrated that Photorhabdus also secretes a protein "S 15". S 15 is a novel protein that can agglutinate (clump) a range of difference nematode species, including C. elegans, various parasitic nematodes and the Photorhabdus vector nematode Heterorhabditis. Different strains of Photorhabdus show differing abilities to clump difference nematode species. Expression of S15 is temperature dependent and within biofϊlms S15 is located within an intercellular matrix. Analysis of the primary amino acid sequence of the small protein suggests a novel secondary structure. Sl 5 is therefore a novel protein secreted by Photorhabdus that can specifically agglutinate a range of different nematodes.
Summary of the Invention
The present invention describes a potent nematicide, derivable in one embodiment from Photorhabdus. However, as described above the present invention also extends to orthologues of such sequences. The infective juvenile of Heterorhabditid nematode, an entomopathogen, carries the Gram-negative insect pathogen Photorhabdus in its gut. The entomopathogenic nematode seeks an insect prey and penetrates the body. It then regurgitates Photorhabdus cells into the insect open blood system of the prey. Photorhabdus rapidly sets up an infection that kills the insect, and begins to replicate. In addition, Photorhabdus produces a variety of biologically active molecules that protect the insect corpse from scavenging organisms such as invertebrates, fungi, bacteria and other non-partner nematodes. Photorhabdus bio-converts the insect tissue into more Photorhabdus cells, which provide a food source for the partner nematode. The Heterorhabditids themselves replicate until the insect resource is used up. The Photorhabdus then produces a "food signal" which informs the partner nematode to cease feeding, developmentally switch to an infective juvenile form, and repackage Photorhabdus in their guts and disperse from the cadaver. We selected one species of Photorhabdus, namely Photorhabdus asymbiotica. The full genomic sequence of Photorhabdus asymbiotica is deposited with the Sanger Institute as ATCC 43949, but the open reading frame of S15 has not previously been identified. Furthermore, proteins that interact either with the host nematode or with invading saprophytic nematodes have not previously been identified. We have isolated a protein, S 15, which surprisingly causes a clotting-like reaction to occur between nematodes. This nematistatic activity may in due course result in nematicidal activity. Again, it will be appreciated that the present invention encompasses S15 derivable from other sources, and particularly other species of Photorhabdus such as Photorhabdus luminescens.
S15 provides numerous advantages. For example, in the case of river blindness (filariasis), current drugs work by killing the immature stages (microfilaria), but no drugs currently work on adult stages. There is therefore an urgent need to develop drugs that kill adult worms, such as adult filarial worms. The present invention fulfils such a need.
The macrocyclic lactones (avermectins and ivermectin) are the current chemicals of choice for nematode control and mass treatment of populations. However, resistance to macrocyclic lactones is now becoming a serious concern in the industry and recent studies also suggest that ivermectin may have adverse effects on human immune cells. The present invention provides a novel nematicidal control agent with applications both in human and animal health and in controlling nematicidal infestations in crops. The novel agent of the present invention may also be useful in resistance control strategies. For example, use of S15 is compatible with continued use of macrocyclic lactones. Furthermore, use of both the S15 of the present invention in combination with other agents, as mixtures or rotations, may provide an effective resistance management strategy for prolonged use of either active ingredient. We have found that Sl 5 is a small stable protein that rapidly clumps nematodes and shows a board spectrum of activity. We have found that S 15 is effective against sheathed nematodes. The control of sheathed nematodes is particularly problematic as it can be difficult for drugs to penetrate such nematodes. The novel clumping mechanism provided by S 15, therefore, represents a break through in the control of such nematodes.
Sl 5 can be produced conveniently and efficiently. For example, S15 can be produced using Photorhabdus as the expression system. Photorhabdus is an organism which is already fermented at an industrial scale for use as a biocontrol in crop protection. Furthermore, S15 represents around 30% of the total secreted protein in Photorhabdus supernatants. We have also found that S15 activity increases during storage at around 40C.
Statements of the Invention
We describe for the first time a sequence obtainable from Photorhabdus asymbiotica which is useful in controlling nematodes. The present invention relates to such sequences including nematistatically active fragments, variants, derivatives, homologues and orthologues thereof for use in controlling nematodes. Such sequences are referred to herein for ease of reference as "S 15". The S 15 sequence may be derived from P. asymbiotica but may also be a homologue from another Photorhabdus species, such as Photorhabdus luminescens. The S15 sequence may also be an orthologue of a Photorhabdus sequence from, for example, Gibberella zeae or Bacillus thuringeinsis.
According to a first aspect of the present invention there is provided an isolated polypeptide comprising a sequence which has at least 92% identity to the amino acid sequence shown in SEQ ID NO:1. In one embodiment the amino acid sequence has at least 95% identity to the amino acid sequence shown in SEQ ID NO:1.
In anther embodiment the isolated polypeptide comprises the amino acid sequence shown in SEQ ID NO : 1.
In a further embodiment the isolated polypeptide consists of the amino acid sequence shown in SEQ ID NO: 1.
According to a second aspect of the present invention there is provided a fragment comprising at least 15 contiguous residues of the isolated polypeptide according to the present invention, which fragment is capable of giving rise to a nematistatic effect.
According to a third aspect of the present invention there is provided an isolated polynucleotide comprising a sequence which encodes the polypeptide or fragment of the present invention.
According to a fourth aspect of the present invention there is provided an isolated polynucleotide comprising a sequence which has at least 92% identity to the sequence shown in SEQ ID NO:2; a fragment thereof comprising at least 15 contiguous residues and encoding a polypeptide which is capable of giving rise to a nematistatic effect; or a sequence which is complementary thereto, which is capable of hybridising under stringent conditions thereto, or which is degenerate as a result of the genetic code.
In one embodiment, the isolated polynucleotide has at least 95% identity to the sequence shown in SEQ ID NO:2.
In another embodiment, the isolated polynucleotide comprises the sequence of SEQ ID NO:2. According to a fifth aspect of the present invention there is provided an expression sequence comprising a polynucleotide according to the invention or a portion thereof operably linked to a regulatory sequence, the regulatory sequence capable of directing expression of said polynucleotide.
Preferably the expression sequence is an expression vector.
According to a sixth aspect of the present invention there is provided a cell comprising an expression sequence or vector according to the invention.
According to a seventh aspect of the present invention there is provided a cell which has been modified, preferably by genetic engineering, to up-regulate the expression of a polypeptide or a polynucleotide of the invention, compared to a cell which has not been so modified.
According to an eighth aspect of the present invention there is provided a plant or transgenic non-human animal, such as a nematode, comprising the cell of the invention.
According to a ninth aspect of the present invention there is provided a pharmaceutical, veterinary or agricultural composition comprising an Sl 5 polypeptide, polynucleotide, expression sequence, or cell of the present invention, together with a pharmaceutically, veterinary or agriculturally acceptable carrier, excipient or diluent, respectively.
According to a tenth aspect of the present invention there is provided a method of producing a polypeptide comprising providing a expression sequence according to the invention, allowing expression of the polypeptide from the expression sequence under control of the regulatory sequence, and optionally purifying the polypeptide. In one embodiment the expression system comprises an expression vector which is transfected into a cell to enable expression of the polypeptide by the cell.
According to an eleventh aspect of the present invention there is provided a method of producing a recombinant protein comprising providing a cell according to the invention, and causing expression of the recombinant protein in the cell, and optionally purifying the protein.
In one embodiment the cell used to produce the protein is from Photorhabdus or E. coli BL21.
Further particular and preferred aspects of the present invention are set out in the accompanying independent and dependent claims. Features of the dependent claims may be combined with features of the independent claims as appropriate, and in combinations other than those explicitly set out in the claims.
Brief Description of the Figures
The present invention will be described further, by way of example only, with reference to preferred embodiments thereof as illustrated in the accompanying drawings, in which:
Figure 1 shows the effect of S15-containing P. asymbiotica ATCC 43949 supernatant upon C. elegans. (A) in the absence of the supernatant; (B) in the presence of S15 after 5 minutes exposure. Note the clumped phenotype of the worms.
Figure 2a shows SEM analysis of S15 aggregated nematode worm mass. Increasing magnification (series 1-4) confirmed that a smooth "cement" has rapidly formed and was trapping the worms. Figure 2b shows SEM analysis of S15 aggregated nematode worm mass. Increasing magnification (series 1-3) confirmed that a smooth "cement" has rapidly formed and was trapping the worms.
Figure 3 shows the aggregation of the mammalian parasite Haemonchus contortus by S15 confirming that Sl 5 works on both model (C. elegans) and parasitic {Hemonchus) nematodes.
Figures 4(A), (B) and (C) show the results of the identification and characterisation of Sl 5 clumping from Example 2.
Figure 5 shows the identification of S 15 using 2D-gels of Photorhabdus asymbiotica ATCC 43949 2 day supernatants. Note the presence of S15 at 3O0C but not 370C (arrow).
Figure 6 shows the expression of S15 in E. coli EClOO [pBAD30^75]. (M)=size marker; (l)=uninduced; (2)=± 2 hours; (3)=overnight inductions. Arrow represents S15.
Figure 7 shows the effect of expression of S15 in E. coli EClOO [ρBAD30W5] on C. elegans. (A) uninduced; (B) induced. Note how induced cells clot around the nematode worms forming dense aggregates.
Figure 8a shows four SEM views of induced E. coli EClOO \pBAD30sl5] cells after exposure to C. elegans. Note how the cells are surrounded by a smooth matrix which binds them together.
Figure 8b shows two SEM views of the heads of C. elegans worms that are aggregated by induced E. coli EClOO [pBAD30^/J]. Note how the cell-matrix surrounds the worms and even extends into the mouth. Figure 9 shows (a) an SEM view of induced E. coli EClOO [pBAD30^i5] showing chains of bacterial cells, (b-d) TEM views of induced E. coli EClOO [pBAD30$15] showing that (b) bacterial chains are due to an internal scaffold (arrow) of self- assembled S15 protein, (c) that the protein is fibrilar/crystalline (arrow), (d) an S15 fibre-bundle in cross-section (arrow).
Figure 10 shows an alignment between P, asymbiotica ATCC43949 S15 and P. luminescens TTOl S 15.
Figure 11 shows an alignment between P. asymbiotica ATCC43949 S15 and Gibberella zeae PH-I predicted protein FGl 0692.1.
Figure 12 shows an alignment between P. asymbiotica ATCC43949 S15 and Bacillus thuringiensis 13.6kDa insecticidal crystal protein (AAG41671).
Figure 13 demonstrates the nematistatic activity of Sl 5 and derivatives thereof (F9, A5, E8 and c9).
Figure 14 shows the results of clumping experiments carried out in Example 6.
Figure 15 shows the results of S15 recombinant expression experiments carried out in Example 7.
Figure 16 shows the results of immunocytochemistry experiments carried out in Example 8.
Figure 17 shows the results of immuno-gold analysis carried out in Example 9.
Figure 18 shows sequences from various strains of Photorhabdus asymbiotica and a consensus sequence. Figure 19 illustrates mutant mapping regions important in fibre formation.
Sequence List
SEQ ID NO: 1 is the sequence of amino acid sequence of P. asymbiotica S 15. SEQ ID NO: 2 is the nucleic acid sequence of P. asymbiotica S 15.
The methods and compositions described here may suitably employ any one or more of the sequences shown in the Sequence Listing.
Detailed Description
The practice of the present invention will employ, unless otherwise indicated, conventional techniques of chemistry, molecular biology, microbiology, recombinant DNA and immunology, which are within the capabilities of a person of ordinary skill in the art. Such techniques are explained in the literature. See, for example, J. Sambrook, E. F. Fritsch, and T. Maniatis, 1989, Molecular Cloning: A Laboratory Manual, Second Edition, Books 1-3, Cold Spring Harbor Laboratory Press; Ausubel, F. M. et al. (1995 and periodic supplements; Current Protocols in Molecular Biology, ch. 9, 13, and 16, John Wiley & Sons, New York, N. Y.); B. Roe, J. Crabtree, and A. Kahn, 1996, DNA Isolation and Sequencing: Essential Techniques, John Wiley & Sons; J. M. Polak and James O'D. McGee, 1990, In Situ Hybridization: Principles and Practice; Oxford University Press; M. J. Gait (Editor), 1984, Oligonucleotide Synthesis: A Practical Approach, IrI Press; D. M. J. Lilley and J. E. Dahlberg, 1992, Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology, Academic Press; Using Antibodies : A Laboratory Manual : Portable Protocol NO. I by Edward Harlow, David Lane, Ed Harlow (1999, Cold Spring Harbor Laboratory Press, ISBN 0-87969-544-7); Antibodies : A Laboratory Manual by Ed Harlow (Editor), David Lane (Editor) (1988, Cold Spring Harbor Laboratory Press, ISBN 0-87969-314-2), 1855. Handbook of Drug Screening, edited by Ramakrishna Seethala, Prabhavathi B. Fernandes (2001, New York, NY, Marcel Dekker, ISBN 0-8247-0562-9); and Lab Ref: A Handbook of Recipes, Reagents, and Other Reference Tools for Use at the Bench, Edited Jane Roskams and Linda Rodgers, 2002, Cold Spring Harbor Laboratory, ISBN 0-87969-630-3. Each of these general texts is herein incorporated by reference.
PHOTORHABDUS SEQUENCES
The present invention provides generally for certain nucleic acids, polypeptides, as well as fragments, homologues, variants and derivatives thereof from the Gram- negative insect pathogen Photorhabdus, which are capable of nematistatic activity in nematodes, and preferably ultimately nematicidal activity in nematodes.
In particular, we provide for Photorhabdus asymbiotica S 15 polypeptide and nucleic acid sequences as set out in the Sequence Listings. As well as the sequences shown in the Sequence Listings from Photorhabdus asymbiotica ATCC43949 we have obtained sequences from a number of other strains of Photorhabdus asymbiotica, and also generated the consensus sequence, as shown in Figure 18. These also represent Sl 5 sequences useful in the present invention. In addition, we provide for the use of such genes, fragments, derivatives, variants, homologues and orthologues thereof, such as the mutants identified in Figure 13 and sequences listed as 2, 3, 4, 11, 16 and 20 in Figure 19. These again represent S15 sequences useful in the present invention. In a particular embodiment the Sl 5 sequence comprises amino acids 33 to 48 and/or amino acids 93 to 118 of SEQ ID NO: 1.
S15 POLYPEPTIDE
It will be understood that polypeptide sequences disclosed here are not limited to the particular sequences set forth in the Sequence Listings or Figures, or fragments thereof, or sequences obtained from S15 protein, but also include homologous sequences and orthologues thereof obtained from any source, for example related cellular homologues or orthologues, homologues or orthologues from other species, including variants or derivatives thereof, provided that they have at least one of the biological activities of S 15.
This disclosure therefore encompasses variants, homologues, orthologues or derivatives of the amino acid sequence set forth in the Sequence Listings and Figures, as well as variants, homologues or derivatives of the amino acid sequence encoded by the nucleotide sequence disclosed herein.
Biological Activity
In highly preferred embodiments, the sequences give rise to at least one biological activity of S 15.
Preferably, the biological activity comprises nematistatic activity, preferably assayed by a nematode-aggregation response. Thus, the S 15 sequences described in this document preferably are capable of causing nematistatic activity through aggregation, which even more preferably leads to a nematicidal effect.
In highly preferred embodiments, when assayed using such methods, the S15 sequences when applied to a population of nematodes are capable of giving rise to aggregation of at least 10%, preferably 20%, more preferably 30%, 40% 50%, 60%, 70%, 80%, 90% or more, of the population of nematodes compared to a population to which the S 15 sequences have not been applied.
Methods for assaying a nematode aggregation response are described in the following Examples and may involve simply applying the S15 to a solution of test nematodes.
Other assays that detect nematistatic and/or nematicidal related events can also be used, instead of, or in addition to, the assays described. Homologues
The polypeptides disclosed include homologous sequences obtained from any source, for example related bacterial proteins, cellular homologues and synthetic peptides, as well as variants or derivatives thereof. Thus polypeptides also include those encoding homologues of S 15.
The present invention particularly relates to homologues from other Photorhabdus species, and in particular from P. luminescens. As shown in Figure 10, the sequences identity level between P. asymbiotica and P. luminescens is 91.9%. Thus, the present invention in one embodiment relates to novel S15 sequences having a sequence identity level of at least 92% to the amino acid sequence of P. asymbiotica. In another embodiment the present invention relates to the use of homologues of these sequences and in which case the sequence identity level may be lower than 92%.
In the context of the present document, a homologous sequence or homologue is taken to include an amino acid sequence which is at least 60, 70, 80 or 90% identical, preferably at least 95 or 98% identical at the amino acid level over at least 30, preferably 50, 70, 90 or 100 amino acids with S 15, or over its entire length, for example as shown in the sequence listing herein. In the context of this document, a homologous sequence is taken to include an amino acid sequence which is at least 15, 20, 25, 30, 40, 50, 60, 70, 80 or 90% identical, preferably at least 95 or 98% identical at the amino acid level, preferably over at least 15, 25, 35, 50 or 100 amino acids with the sequence of S 15. For example, a sequence may have the stated sequence identity to S15 (preferably comprising a sequence as shown in SEQ ID NO: 1).
Although homology can also be considered in terms of similarity (i.e. amino acid residues having similar chemical properties/functions), in the context of the present document it is preferred to express homology in terms of sequence identity. In highly preferred embodiments, the sequence identity is determined relative to the entirety of the length the relevant sequence, i.e., over the entire length or full length sequence of the relevant gene, for example.
Homology comparisons can be conducted by eye, or more usually, with the aid of readily available sequence comparison programs. These commercially available computer programs can calculate % homology between two or more sequences.
% homology may be calculated over contiguous sequences, i.e. one sequence is aligned with the other sequence and each amino acid in one sequence directly compared with the corresponding amino acid in the other sequence, one residue at a time. This is called an "ungapped" alignment. Typically, such ungapped alignments are performed only over a relatively short number of residues (for example less than 50 contiguous amino acids).
Although this is a very simple and consistent method, it fails to take into consideration that, for example, in an otherwise identical pair of sequences, one insertion or deletion will cause the following amino acid residues to be put out of alignment, thus potentially resulting in a large reduction in % homology when a global alignment is performed. Consequently, most sequence comparison methods are designed to produce optimal alignments that take into consideration possible insertions and deletions without penalising unduly the overall homology score. This is achieved by inserting "gaps" in the sequence alignment to try to maximise local homology.
However, these more complex methods assign "gap penalties" to each gap that occurs in the alignment so that, for the same number of identical amino acids, a sequence alignment with as few gaps as possible - reflecting higher relatedness between the two compared sequences - will achieve a higher score than one with many gaps. "Affine gap costs" are typically used that charge a relatively high cost for the existence of a gap and a smaller penalty for each subsequent residue in the gap. This is the most commonly used gap scoring system. High gap penalties will of course produce optimised alignments with fewer gaps. Most alignment programs allow the gap penalties to be modified. However, it is preferred to use the default values when using such software for sequence comparisons. For example when using the GCG Wisconsin Bestfit package (see below) the default gap penalty for amino acid sequences is -12 for a gap and -4 for each extension.
Calculation of maximum % homology therefore firstly requires the production of an optimal alignment, taking into consideration gap penalties. A suitable computer program for carrying out such an alignment is the GCG Wisconsin Bestfit package (University of Wisconsin, U.S.A.; Devereux et al, 1984, Nucleic Acids Research 12:387). Examples of other software than can perform sequence comparisons include, but are not limited to, the BLAST package (see Ausubel et ah, 1999 ibid— Chapter 18), FASTA (Atschul et al, 1990, J. MoI. Biol, 403-410) and the GENEWORKS suite of comparison tools. Both BLAST and FASTA are available for offline and online searching (see Ausubel et al., 1999 ibid, pages 7-58 to 7-60). However, for some applications, it is preferred to use the GCG Bestfit program. A new tool called BLAST 2 Sequences is also available for comparing protein and nucleotide sequences (see FEMS Microbiol Lett 1999 174(2): 247-50; FEMS Microbiol Lett 1999 177(1): 187-8 and tatiana@ncbi.nih.gov).
Although the final % homology can be measured in terms of identity, the alignment process itself is typically not based on an all-or-nothing pair comparison. Instead, a scaled similarity score matrix is generally used that assigns scores to each pairwise comparison based on chemical similarity or evolutionary distance. An example of such a matrix commonly used is the BLOSUM62 matrix - the default matrix for the
BLAST suite of programs. GCG Wisconsin programs generally use either the public default values or a custom symbol comparison table if supplied (see user manual for further details). It is preferred to use the public default values for the GCG package, or in the case of other software, the default matrix, such as BLOSUM62. Alternatively, percentage homologies may be calculated using the multiple alignment feature in DNASIS™ (Hitachi Software), based on algorithm, analogous to CLUSTAL (Higgins DG & Sharp PM 1988 Gene 73(1): 237-44).
Once the software has produced an optimal alignment, it is possible to calculate % homology, preferably % sequence identity. The software typically does this as part of the sequence comparison and generates a numerical result.
Variants and Derivatives
The terms "variant" or "derivative" in relation to the amino acid sequence as described here includes any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) amino acids from or to the sequence. Preferably, the resultant amino acid sequence retains substantially the same activity as the unmodified sequence, preferably having at least the same activity as the Sl 5 polypeptide shown in the Sequence Listings. Thus, the key feature of the sequences — namely that they are capable of giving rise to a nematode- aggregating response - is preferably retained.
A polypeptide having the amino acid sequence shown in the Sequence Listings or Figures, or fragments or homologues thereof, may be modified for use in the methods and compositions described here. Typically, modifications are made that maintain the biological activity of the sequence. Amino acid substitutions may be made, for example from 1, 2 or 3 to 10, 20 or 30 substitutions provided that the modified sequence retains the biological activity of the unmodified sequence. Amino acid substitutions may include the use of non-naturally occurring analogues.
Natural variants of S15 are likely to comprise conservative amino acid substitutions. Conservative substitutions may be defined, for example according to the Table below. Amino acids in the same block in the second column and preferably in the same line in the third column may be substituted for each other:
Figure imgf000018_0001
Examples of variants and derivatives which are included in the scope of the present invention are shown in Figure 13. In this Figure the nematistatic activity of derivatives is screened. Particularly preferred examples of derivatives within the scope of the invention include the amino acid sequences shown as F9 and C9 in Figure 13.
We have also investigated functional variants by mapping mutations which are involved in fibre formation. The results of these investigations are shown in Figure 19. The dark vertical lines correspond to mutations in the S15 sequence which resulted in a loss of activity. We believe that two regions are important in forming fibre chains provided by S 15. These regions are represented by (1) amino acids 33 to 48 and (2) amino acids 93 to 118 with reference to SEQ ID NO:1. In one embodiment the S15 used in the present invention comprises at least one of these motifs.
Orthologues The present invention also extends to the use of orthologues of the Photorhabdus S15 which retain nematistatic activity. Examples of such orthologues include the Gibberella zeae PH-I predicted proteins, FG10692.1, FG00134.1 and FGl 1612.1; and the Bacillus thuringiensis 13.6kDa insecticidal protein. The alignment of P. asymbiotica S15 to FG10692.1 and Bt 13.6Kda protein are shown in Figures 11 and
12, respectively. It will be appreciated that the sequence identity level between such orthologues and the Photorhabdus S15 may be as low as 20%, in some instances, 21.7%, 25%, 27.9%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65% and 70%. However, such functionally active orthologues may still be employed in the present invention.
Fragments
The polypeptides of the present invention also include fragments of the above mentioned full length polypeptides and variants thereof, including fragments of the sequences set out in the Sequence Listings and Figures.
Polypeptides also include fragments of the full length sequence of any of Sl 5 polypeptides. Preferably fragments comprise at least one epitope. More preferably the fragments comprise at least one of the epitopes represented by amino acid sequences 33 to 58 and/or 93 to 118 of SEQ ID NO: 1. Methods of identifying epitopes are well known in the art. Fragments will typically comprise, or comprise at least, 6 amino acids, more preferably at least 10, 15, 20, 30, 50 or 100 amino acids. In one particular embodiment, 24 or 26 amino acids or more is preferred.
Included are fragments comprising, preferably consisting of, 5, 6, 7, 8, 9, 10, 11, 12,
13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 105, 110, 115, 120, or more residues from a S15 amino acid sequence. Polypeptide fragments of the S15 protein and allelic and species variants thereof may contain one or more (e.g. 5, 10, 15, or 20) substitutions, deletions or insertions, including conserved substitutions. Where substitutions, deletion and/or insertions occur, for example in different species, preferably less than 50%, 40% or 20% of the amino acid residues depicted in the sequence listings are altered.
S 15, and their fragments, homologues, variants and derivatives, may be made by recombinant means. However, they may also be made by synthetic means using techniques well known to skilled persons such as solid phase synthesis. The proteins may also be produced as fusion proteins, for example to aid in extraction and purification. Examples of fusion protein partners include glutathione-S-transferase (GST), 6xHis, GAL4 (DNA binding and/or transcriptional activation domains) and β-galactosidase. It may also be convenient to include a proteolytic cleavage site between the fusion protein partner and the protein sequence of interest to allow removal of fusion protein sequences. Preferably the fusion protein will not hinder the function of the protein of interest sequence. Proteins may also be obtained by purification of cell extracts from animal cells.
The S 15 polypeptides, variants, homologues, fragments and derivatives disclosed here may be in a substantially isolated form. It will be understood that such polypeptides may be mixed with carriers or diluents which will not interfere with the intended purpose of the protein and still be regarded as substantially isolated. A S15 peptide, variant, homologue, fragment or derivative may also be in a substantially purified form, in which case it will generally comprise the protein in a preparation in which more than 90%, e.g. 95%, 98% or 99% of the protein in the preparation is a protein.
The S15 polypeptides, variants, homologues, fragments and derivatives disclosed here may be labelled with a revealing label. The revealing label may be any suitable label which allows the polypeptide, etc to be detected. Suitable labels include radioisotopes, e.g. 125I, enzymes, antibodies, polynucleotides and linkers such as biotin. Labelled polypeptides may be used in diagnostic procedures such as immunoassays to determine the amount of a polypeptide in a sample. Polypeptides or labelled polypeptides may also be used in serological or cell-mediated immune assays for the detection of immune reactivity to said polypeptides in animals and humans using standard protocols.
S15 polypeptides, variants, homologues, fragments and derivatives disclosed here, optionally labelled, may also be fixed to a solid phase, for example the surface of an immunoassay well or dipstick. Such labelled and/or immobilised polypeptides may be packaged into ldts in a suitable container along with suitable reagents, controls, instructions and the like. Such polypeptides and kits may be used in methods of detection of antibodies to the polypeptides or their allelic or species variants by immunoassay.
Immunoassay methods are well known in the art and will generally comprise: (a) providing a polypeptide comprising an epitope bindable by an antibody against said protein; (b) incubating a biological sample with said polypeptide under conditions which allow for the formation of an antibody-antigen complex; and (c) determining whether antibody-antigen complex comprising said polypeptide is formed.
S15 polypeptides, variants, homologues, fragments and derivatives disclosed here may be used in in vitro or in vivo cell culture systems to study the role of their corresponding genes and homologues thereof in cell function, including their function in disease. For example, truncated or modified polypeptides may be introduced into a cell to disrupt the normal functions which occur in the cell. The polypeptides may be introduced into the cell by in situ expression of the polypeptide from a recombinant expression vector (see below). The expression vector optionally carries an inducible promoter to control the expression of the polypeptide.
The use of appropriate host cells, such as insect cells or mammalian cells, is expected to provide for such post-translational modifications (e.g. myristolation, glycosylation, truncation, lapidation and tyrosine, serine or threonine phosphorylation) as may be needed to confer optimal biological activity on recombinant expression products. Such cell culture systems in which the S15 polypeptides, variants, homologues, fragments and derivatives disclosed here are expressed may be used in assay systems to identify candidate substances which interfere with or enhance the functions of the polypeptides in the cell.
S15 NUCLEIC ACIDS
We provide generally for a number of Sl 5 nucleic acids, together with fragments, homologues, variants and derivatives thereof. These nucleic acid sequences preferably encode the polypeptide sequences disclosed here, and particularly in the Sequence Listings and Figures.
Preferably, the polynucleotides comprise Sl 5 nucleic acids, preferably selected from SEQ ID NO: 2.
In particular, we provide for nucleic acids or polynucleotides which encode any of the Photorhabdus asymbiotica polypeptides disclosed here. Thus, the term "S 15 sequence" should be construed accordingly. Preferably, however, such nucleic acids or polynucleotides comprise the sequence set out as SEQ ID NO: 2, or a sequence encoding any of the corresponding polypeptides, and a fragment, homologue, variant or derivative of such a nucleic acid. The above terms therefore preferably should be taken to refer to these sequences.
As used here in this document, the terms "polynucleotide", "nucleotide", and "nucleic acid" are intended to be synonymous with each other. "Polynucleotide" generally refers to any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. "Polynucleotides" include, without limitation single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-strande'd regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double-stranded regions. In addition, "polynucleotide" refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications has been made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically or metabolically modified forms of polynucleotides as typically found in nature, as well as the chemical forms of DNA and RNA characteristic of viruses and cells. "Polynucleotide" also embraces relatively short polynucleotides, often referred to as oligonucleotides.
It will be understood by a skilled person that numerous different polynucleotides and nucleic acids can encode the same polypeptide as a result of the degeneracy of the genetic code. In addition, it is to be understood that skilled persons may, using routine techniques, make nucleotide substitutions that do not affect the polypeptide sequence encoded by the polynucleotides described here to reflect the codon usage of any particular host organism in which the polypeptides are to be expressed.
Variants, Derivatives and Homologues
The polynucleotides described here may comprise DNA or RNA. They may be single-stranded or double-stranded. They may also be polynucleotides which include within them synthetic or modified nucleotides. A number of different types of modification to oligonucleotides are known in the art. These include methylphosphonate and phosphorothioate backbones, addition of acridine or polylysine chains at the 3' and/or 5' ends of the molecule. For the purposes of the present document, it is to be understood that the polynucleotides described herein may be modified by any method available in the art. Such modifications may be carried out in order to enhance the in vivo activity or life span of polynucleotides. Where the polynucleotide is double-stranded, both strands of the duplex, either individually or in combination, are encompassed by the methods and compositions described here. Where the polynucleotide is single-stranded, it is to be understood that the complementary sequence of that polynucleotide is also included.
The terms "variant", "homologue" or "derivative" in relation to a nucleotide sequence include any substitution of, variation of, modification of, replacement of, deletion of or addition of one (or more) nucleotides from or to the sequence. Preferably, the resulting sequence is capable of encoding a polypeptide which has nematode-aggregating activity.
As indicated above, with respect to sequence identity, a "homologue" has preferably at least 5% identity, at least 10% identity, at least 15% identity, at least 20% identity, at least 25% identity, at least 30% identity, at least 35% identity, at least 40% identity, at least 45% identity, at least 50% identity, at least 55% identity, at least 60% identity, at least 65% identity, at least 70% identity, at least 75% identity, at least 80% identity, at least 85% identity, at least 90% identity, or at least 95% identity to the relevant sequence shown in the sequence listings.
More preferably there is at least 95% identity, more preferably at least 96% identity, more preferably at least 97% identity, more preferably at least 98% identity, more preferably at least 99% identity. Nucleotide homology comparisons may be conducted as described above. A preferred sequence comparison program is the GCG Wisconsin Bestfit program described above. The default scoring matrix has a match value of 10 for each identical nucleotide and -9 for each mismatch. The default gap creation penalty is -50 and the default gap extension penalty is -3 for each nucleotide.
In preferred embodiments, a Sl 5 polynucleotide has at least 90% or more sequence identity to a sequence shown as SEQ ID NO: 2. Preferably, the Sl 5 polynucleotide has 91% or more, preferably 92% or more, 93% or more, 94% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more or 99.5% or more sequence identity to a sequence shown as SEQ ID NO: 2.
Hybridisation
We further describe S15 nucleotide sequences that are capable of hybridising selectively to any of the sequences presented herein, or any variant, fragment or derivative thereof, or to the complement of any of the above. Nucleotide sequences are preferably 15 or at least 15 nucleotides in length, more preferably 20, 24, 26, 30, 40 or 50 nucleotides or more in length.
The term "hybridisation" as used herein shall include "the process by which a strand of nucleic acid joins with a complementary strand through base pairing" as well as the process of amplification as carried out in polymerase chain reaction technologies.
Polynucleotides capable of selectively hybridising to the nucleotide sequences presented herein, or to their complement, will be generally at least 70%, preferably at least 80 or 90% and more preferably at least 95% or 98% homologous to the corresponding nucleotide sequences presented herein over a region of at least 20, preferably at least 25 or 30, for instance at least 40, 60 or 100 or more contiguous nucleotides.
The term "selectively hybridisable" means that the polynucleotide used as a probe is used under conditions where a target polynucleotide is found to hybridize to the probe at a level significantly above background. The background hybridization may occur because of other polynucleotides present, for example, in the cDNA or genomic DNA library being screened. In this event, background implies a level of signal generated by interaction between the probe and a non-specific DNA member of the library which is less than 10 fold, preferably less than 100 fold as intense as the specific interaction observed with the target DNA. The intensity of interaction may be measured, for example, by radiolabelling the probe, e.g. with 32P. Hybridisation conditions are based on the melting temperature (Tm) of the nucleic acid binding complex, as taught in Berger and Kimmel (1987, Guide to Molecular Cloning Techniques, Methods in Enzymology, VoI 152, Academic Press, San Diego CA), and confer a defined "stringency" as explained below.
Maximum stringency typically occurs at about Tm-5°C (5°C below the Tm of the probe); high stringency at about 5°C to 10°C below Tm; intermediate stringency at about 1O0C to 2O0C below Tm; and low stringency at about 20°C to 250C below Tm. As will be understood by those of skill in the art, a maximum stringency hybridisation can be used to identify or detect identical polynucleotide sequences while an intermediate (or low) stringency hybridisation can be used to identify or detect similar or related polynucleotide sequences.
In a preferred aspect, we disclose nucleotide sequences that can hybridise to a Sl 5 nucleic acid, or a fragment, homologue, variant or derivative thereof, under stringent conditions (e.g. 650C and 0. IxSSC { IxSSC = 0.15 M NaCl, 0.015 M Na3 Citrate pH 7.0}).
Where a polynucleotide is double-stranded, both strands of the duplex, either individually or in combination, are encompassed by the present disclosure. Where the polynucleotide is single-stranded, it is to be understood that the complementary sequence of that polynucleotide is also disclosed and encompassed.
Polynucleotides which are not 100% homologous to the sequences disclosed here but fall within the disclosure can be obtained in a number of ways. Other variants of the sequences described herein may be obtained for example by probing DNA libraries made from a range of individuals, for example individuals from different populations. In addition, other viral/bacterial, or cellular homologues, may be obtained and such homologues and fragments thereof in general will be capable of selectively hybridising to the sequences shown in the sequence listing herein. Such sequences may be obtained by probing cDNA libraries made from or genomic DNA libraries from other species, and probing such libraries with probes comprising all or part of SEQ ID NO: 2 under conditions of medium to high stringency.
The polynucleotides described here may be used to produce a primer, e.g. a PCR primer, a primer for an alternative amplification reaction, a probe e.g. labelled with a revealing label by conventional means using radioactive or non-radioactive labels, or the polynucleotides may be cloned into vectors. Such primers, probes and other fragments will be at least 15, preferably at least 20, for example at least 25, 30 or 40 nucleotides in length, and are also encompassed by the term polynucleotides as used herein. Preferred fragments are less than 100, 50 or 20 nucleotides in length.
Polynucleotides such as a DNA polynucleotides and probes may be produced recombinantly, synthetically, or by any means available to those of skill in the art. They may also be cloned by standard techniques.
In general, primers will be produced by synthetic means, involving a step wise manufacture of the desired nucleic acid sequence one nucleotide at a time. Techniques for accomplishing this using automated techniques are readily available in the art.
Longer polynucleotides will generally be produced using recombinant means, for example using PCR (polymerase chain reaction) cloning techniques. This will involve making a pair of primers (e.g. of about 15 to 30 nucleotides) flanking a region of the sequence which it is desired to clone, bringing the primers into contact with mRNA or cDNA obtained from bacterial or an animal or human cell, performing a polymerase chain reaction under conditions which bring about amplification of the desired region, isolating the amplified fragment (e.g. by purifying the reaction mixture on an agarose gel) and recovering the amplified DNA. The primers may be designed to contain suitable restriction enzyme recognition sites so that the amplified DNA can be cloned into a suitable cloning vector. EXPRESSION OF S15 NUCLEIC ACIDS AND POLYPEPTIDES
The S15 polynucleotides described here can be incorporated into a recombinant replicable vector. The vector may be used to replicate the nucleic acid in a compatible host cell. The vector comprising the polynucleotide sequence may be transformed into a suitable host cell. Suitable hosts may include bacterial, yeast, insect and fungal cells.
The term "transformed cell" includes cells that have been transformed by use of recombinant DNA techniques. The transformation typically occurs by insertion of one or more nucleotide sequences into a cell that is to be transformed. The inserted nucleotide sequence may be a heterologous nucleotide sequence (i.e. is a sequence that is not natural to the cell that is to be transformed. In addition, or in the alternative, the inserted nucleotide sequence may be an homologous nucleotide sequence (i.e. is a sequence that is natural to the cell that is to be transformed) - so that the cell receives one or more extra copies of a nucleotide sequence already present in it.
Thus in a further embodiment, we provide a method of making S15 polypeptides and polynucleotides by introducing a polynucleotide into a replicable vector, introducing the vector into a compatible host cell, and growing the host cell under conditions which bring about replication of the vector. The vector may be recovered from the host cell.
EXPRESSION CONSTRUCTS
The S 15 nucleic acid may be operatively linked to transcriptional and translational regulatory elements active in a host cell of interest. The S15 nucleic acid may also encode a fusion protein comprising signal sequences. Alternatively, the S15 nucleic acid may encode a fusion protein comprising a membrane binding domain. Expression Vector
The S15 nucleic acid may be expressed at the desired levels in a host organism using an expression vector.
An expression vector comprising a Sl 5 nucleic acid can be any vector which is capable of expressing the gene encoding Sl 5 nucleic acid in the selected host organism, and the choice of vector will depend on the host cell into which it is to be introduced. Thus, the vector can be an autonomously replicating vector, i.e. a vector that exists as an episomal entity, the replication of which is independent of chromosomal replication, such as, for example, a plasmid, a bacteriophage or an episomal element, a minichromosome or an artificial chromosome. Alternatively, the vector may be one which, when introduced into a host cell, is integrated into the host cell genome and replicated together with the chromosome.
Components of the Expression Vector
The expression vector typically includes the components of a cloning vector, such as, for example, an element that permits autonomous replication of the vector in the selected host organism and one or more phenotypically detectable markers for selection purposes. The expression vector normally comprises control nucleotide sequences encoding a promoter, operator, ribosome binding site, translation initiation signal and optionally, a repressor gene or one or more activator genes. Additionally, the expression vector may comprise a sequence coding for an amino acid sequence capable of targeting the Sl 5 variant polypeptide to a host cell organelle or to a particular host cell compartment. In the present context, the term
'expression signal" includes any of the above control sequences, repressor or activator sequences. For expression under the direction of control sequences, the nucleic acid sequence the Sl 5 variant polypeptide is operably linked to the control sequences in proper manner with respect to expression. Preferably, a polynucleotide in a vector is operably linked to a control sequence that is capable of providing for the expression of the coding sequence by the host cell, i.e. the vector is an expression vector. The term "operably linked" means that the components described are in a relationship permitting them to function in their intended manner. A regulatory sequence "operably linked" to a coding sequence is ligated in such a way that expression of the coding sequence is achieved under condition compatible with the control sequences.
The control sequences may be modified, for example by the addition of further transcriptional regulatory elements to make the level of transcription directed by the control sequences more responsive to transcriptional modulators. The control sequences may in particular comprise promoters.
Promoter
In the vector, the nucleic acid sequence encoding for the Sl 5 polypeptide is operably combined with a suitable promoter sequence. The promoter can be any DNA sequence having transcription activity in the host organism of choice and can be derived from genes that are homologous or heterologous to the host organism.
Bacterial Promoters
Examples of suitable promoters for directing the transcription of the S 15 nucleotide sequence, in a bacterial host include the promoter of the lac operon of E. coli, the Streptomyces coelicolor agarase gene dagA promoters, the promoters of the Bacillus Hcheniformis α-amylase gene (amyL), the promoters of the Bacillus stearothermophilus maltogenic amylase gene (amyM), the promoters of the Bacillus amyloliquefaciens α-amylase gene (amyQ), the promoters of the Bacillus subtilis xylA and xylB genes and a promoter derived from a Lactococcus sp.-derived promoter including the P170 promoter. When the gene encoding the S15 polypeptide is expressed in a bacterial species such as E. coli, a suitable promoter can be selected, for example, from a bacteriophage promoter including a T7 promoter and a phage lambda promoter.
Fungal Promoters
For transcription in a fungal species, examples of useful promoters are those derived from the genes encoding the, Aspergillus oryzae TAKA amylase, Rhizomucor miehei aspartic proteinase, Aspergillus niger neutral α-amylase, A. niger acid stable α-amylase, A. niger glucoamylase, Rhizomucor miehei lipase, Aspergillus oryzae alkaline protease, Aspergillus oryzae triose phosphate isomerase or Aspergillus nidulans acetamidase.
Yeast Promoters
Examples of suitable promoters for the expression in a yeast species include but are not limited to the Gal 1 and Gal 10 promoters of Saccharomyces cerevisiae and the Pichia pastoris A OXl or AOX2 promoters.
HOST ORGANISMS
(I) Bacterial Host Organisms
Examples of suitable bacterial host organisms are gram positive bacterial species such as Bacillaceae including Bacillus subtilis, Bacillus licheniformis, Bacillus lentus, Bacillus brevis, Bacillus stearothermophilus, Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus coagulans, Bacillus lautus, Bacillus megaterium and Bacillus thuringiensis, Streptomyces species such as Streptomyces murinus, lactic acid bacterial species including Lactococcus spp. such as Lactococcus lactis, Lactobacillus spp. including Lactobacillus reuteri, Leuconostoc spp., Pediococcus spp. and Streptococcus spp. Alternatively, strains of a gram-negative bacterial species belonging to Enterobacteriaceae including E. coli, such as E. coli BL21, or to Pseudomonadaceae can be selected as the host organism. In another embodiment use may be made of Bacteroides species; one of the most numerous of intestinal bacteria. In one preferred embodiment S 15 is produced through expression in Photorhabdus. This has advantages since commercial scale fermentation techniques for Photorhabdus are already known.
(II) Yeast Host Organisms
A suitable yeast host organism can be selected from the biotechnologically relevant yeasts species such as but not limited to yeast species such as Pichia sp., Hansenula sp or Kluyveromyces, Yarrowinia species or a species of Saccharomyces including Saccharomyces cerevisiae or a species belonging to Schizosaccharomyce such as, for example, S. Pombe species.
Preferably a strain of the methylotrophic yeast species Pichia pastoris is used as the host organism. Preferably the host organism is a Hansenula species.
(III) Fungal Host Organisms
Suitable host organisms among filamentous fungi include species of Aspergillus, e.g. Aspergillus niger, Aspergillus oryzae, Aspergillus tubigensis, Aspergillus awamori or Aspergillus nidulans. Alternatively, strains of a Fusarium species, e.g. Fusarium oxysporum or of a Rhizomucor species such as Rhizomucor miehei can be used as the host organism. Other suitable strains include Thermomyces and Mucor species.
(IV) Plant Host Organisms
In cases where plant expression vectors are used, the expression of sequences S15 may be driven by any of a number of promoters. For example, viral promoters such as the 35S and 19S promoters of CaMV may be used alone or in combination with the omega leader sequence from TMV. (Takamatsu, N. (1987) EMBO J. 6:307-311.) Alternatively, plant promoters such as the small subunit of RUBISCO or heat shock promoters may be used. (Coruzzi, G. et al. (1984) EMBO J. 3:1671-1680; Broglie, R. et al. (1984) Science 224:838-843; and Winter, J. et al. (1991) Results Probl. Cell Differ. 17:85-105.) These constructs can be introduced into plant cells by direct DNA transformation or pathogen-mediated transfection. Such techniques are described in a number of generally available reviews. (See, for example, Hobbs, S. or Murray, L. E. in McGraw Hill Yearbook of Science and Technology (1992) McGraw Hill, New York, N. Y.; pp. 191-196.).
(V) Insect Host Organisms
An insect system may also be used to express S 15. For example, in one such system, Autographa californica nuclear polyhidrosis virus (AcNPV) is used as a vector to express foreign genes in Spodoptera frugiperda cells or in Trichoplusia larvae. The sequence encoding S15 may be cloned into a non-essential region of the virus, such as the polyhedrin gene, and placed under control of the polyhedrin promoter. Successful insertion of S15 will render the polyhedrin gene inactive and produce recombinant virus lacking coat protein. The recombinant viruses may then be used to infect, for example, S. frugiperda cells or Trichoplusia larvae in which S15 may be expressed. (Engelhard, E. K. et al. (1994) Proc. Nat. Acad. Sci. 91:3224-3227.)
PROTEIN EXPRESSION AND PURIFICATION
Host cells comprising polynucleotides may be used to express polypeptides, such as S15 polypeptides, fragments, homologues, variants or derivatives thereof. Host cells may be cultured under suitable conditions which allow expression of the proteins. Expression of the polypeptides may be constitutive such that they are continually produced, or inducible, requiring a stimulus to initiate expression. In the case of inducible expression, protein production can be initiated when required by, for example, addition of an inducer substance to the culture medium, for example dexamethasone or IPTG.
Polypeptides can be extracted from host cells by a variety of techniques known in the art, including enzymatic, chemical and/or osmotic lysis and physical disruption. In certain systems, such as Photorhabdus, the Sl 5 is secreted in an active form from the host cells. In such cases it is not necessary to extract the polypeptide, and Sl 5 can be used in the form of a supernatant.
Preferably the host cell is grown at a temperature of about 3O0C.
Polypeptides may also be produced recombinantly in an in vitro cell-free system, such as the TnT™ (Promega) rabbit reticulocyte system.
ANTIBODIES
The present invention also encompasses specific antagonists of S 15, which may be used to regulate the activity of these proteins and detect them which may include antibodies against the protein(s). In particular, antibodies capable of binding to S 15, and preferably capable of inhibiting any biological activity thereof, may be useful.
We therefore provide in particular for anti-S15 antibodies, as well as methods of producing them.
The techniques in relation to antibodies are discussed in, for example, Kohler and Milstein, (1975) Nature 256:495-497; US 4,376,110; Harlow and Lane, Antibodies: a Laboratory Manual, (1988) Cold Spring Harbor, incorporated herein by reference. Techniques for the preparation of recombinant antibody molecules is described in the above references and also in, for example, EP 0623679; EP 0368684 and EP 0436597, which are incorporated herein by reference. USES OF S15 SEQUENCES
As shown in the Examples, we have established that S15 is involved in the aggregation of nematodes. Thus, the present polypeptides and polynucleotides are primarily useful as antiparasitic agents for the treatment of heminthiasis in animals and preferably domestic animals, such as cattle, sheep, horse, dogs, cats, goats, swine and poultry. In the present application, the term "treatment" includes prophylactic treatment. They are also useful in the treatment of helminthiasis in humans. The disease or group of diseases described generally as helminthiasis is due to infection of an animal host with parasitic worms known as helminths, or nematodes. The present invention may also be used to combat agricultural pest nematodes which attack crops either in the field or in storage.
Nematode parasites of vertebrates (e.g., humans, livestock and companion animals) include gut roundworms, hookworms, pinworms, whipworms, and filarial worms. They can be transmitted in a variety of ways, including by water contamination, skin penetration, biting insects, or by ingestion of contaminated food.
In domesticated animals, nematode control or "de-worming" is essential to the economic viability of livestock producers and is a necessary part of veterinary care of companion animals. Parasitic nematodes cause mortality in animals (e.g., heartworm in dogs and cats) and morbidity as a result of the parasites' inhibiting the ability of the infected animal to absorb nutrients. Parasite-induced nutrient deficiency results in diseased livestock and companion animals (i.e., pets), as well as in stunted growth. For instance, in cattle and dairy herds, a single untreated infection with the brown stomach worm can permanently stunt an animal's ability to effectively convert feed into muscle mass or milk.
Nematode parasites of plants can inhabit all parts of plants, including the roots, developing flower buds, leaves, and stems. Plant parasites are classified on the basis of their feeding habits into the broad categories: migratory ectoparasites, migratory endoparasites, and sedentary endoparasites. Sedentary endoparasites, which include the root knot nematodes (Meloidogyne) and cyst nematodes (Globodera and Heterodera) induce feeding sites and establish long-term infections within roots that are often very damaging to crops.
The present invention may also find applicability in the area of "biocontrol". "Biocontrol" is the control of living organisms, especially pests, by biological means. In the present invention an organisms expressing S15 may be employed to control nematode pests. In a preferred embodiment, the organism expressing S15 will be a Photorhabdus species such as Pseudomonas fluorescens, particularly but not exclusively to control nematodes attacking roots, such as plant root nematodes. However, S15 may be expressed as a transgene in any suitable organism. It will also be appreciated that expression of Sl 5 may be upregulated using a heterologous promoter.
The invention is particularly important for high value crops, such as strawberries and tomatoes, where chemicals have been used extensively to control soil pests. In the specialty crop markets, economic hardship resulting from nematode infestation is highest in strawberries, bananas, and other high value vegetables and fruits. In the high-acreage crop markets, nematode damage is greatest in soybeans and cotton. There are however, dozens of additional crops that suffer from nematode infestation including potato, pepper, onion, citrus, coffee, sugarcane, greenhouse ornamentals and golf course turf grasses. The present invention finds applicability in all these areas.
The present invention may have application in connection with the control of nematodes of the following non-limiting, exemplary genera:
Plant parasitic nematode genera include:
Afrina, Anguina, Aphelenchoides, Belonolaimus, Bursaphelenchus, Cacopaurus, Cactodera, Criconenia, Criconemoides, Cryphodera, Ditylenchus, Dolichodorus, Dorylaimus, Globodera, Helicotylenchus, Hemicriconemoides, Hemicycliophora, Heterodera, Hirschmanniella, Hoplolaimus, Hypsoperine, Longidorus, Meloidogyne, Mesoanguina, Nacobbus, Nacobbodera, Panagrellus, Paratrichodoras, Paratylenchus, Pratylenchus, Pterotylench us, Punctodera, Radopholus, Rhadinaphelenchus, Rotylenchulus, Rotylenchus, Scutellonema, Subanguina, Thecavermiculatus, Trichodorus, Turbatrix, Tylenchorhynchus, Tylenchulus, Xiphinema.
Animal and human parasitic nematode genera include:
Acanthocheilonema, Aelurostrongylus, Ancylostoma, Angiostrongylus, Anisakis, Ascaris, Ascarops, Bunostomum, Brugia, Capillaria, Chabertia, Cooperia, Crenosoma, Cyathostome species (Small Strongyles), Dictyocaulus, Dioctophyma, Dipetalonema, Dirofiliaria, Dracunculus, Draschia, Elaneophora, Enterobius, Filaroides, Gnathostoma, Gonylonema, Habronema, Haemonchus, Hyostrongylus, Lagochilascaris, Litomosoides, Loa, Mammomonogamus, Mansonella, Muellerius, Metastrongylid, Necator, Nematodirus, Nippostrongylus, Oesophagostomum, Ollulanus, Onchocerca, Ostertagia, Oxyspirura, Oxyuris, Parafilaria, Parascaris, Parastrongyloides, Parelaphostrongylus, Physaloptera, Physocephalus, Protostrongylus, Pseudoterranova, Setaria, Spirocerca, Stephanurus, Stephanofilaria, Strongyloides, Strongylus, Spirocerca, Syngamus, Teladorsagia, Thelazia, Toxascaris, Toxocara, Trichinella, Trichostrongylus, Trichuris, Uncinaria, and Wuchereria.
Particularly preferred nematode species include:
Plant parasitic: Anguina tritici, Aphelenchoides fragariae, Belonolaimus longicaudatus, Bursaphelenchus xylophilus, Ditylenchus destructor, Ditylenchus dipsaci, Dolichodorus heterocephalous, Globodera pallida, Globodera rostochiensis,
Globodera tabacum, Heterodera avenae, Heterodera cardiolata, Heterodera carotae, Heterodera cruciferae, Heterodera glycines, Heterodera major, Heterodera schachtii, Heterodera zeae, Hoplolaimus tylenchiformis, Longidorus sylphus, Meloidogyne acronea, Meloidogyne arenaria, Meloidogyne chitwoodi, Meloidogyne exigua, Meloidogyne graminicola, Meloidogyne hapla, Meloidogyne incognita, . Meloiclogynejavanica, Meloidogyne nassi, Nacobbus batatiformis, Pratylenchus brachyurus, Pratylenchus coffeae, Pratylenchus penetrans, Pratylenchus scribneri, Pratylenchus zeae, Radopholus similis, Rotylenchus reniformis, Tylenchulus semipenetrans, Xiphinema americanum.
Animal & Human parasitic: Ancylostoma braziliense, Ancylostoma caninum, Ancylostoma ceylanicum, Ancylostoma duodenale, Ancylostoma tubaeforme, Ascaris suum, Ascaris lumbrichoides, Brugia malayi, Capillaria bovis, Capillaria plica, Capillaria feliscati, Cooperia oncophora, Cooperia punctata, Cyathostome species, Dictyocaulus filaria, Dictyocaulus viviparus, Dictyocaulus arnfieldi, Dirofiliaria immitis, Dracunculus insignis, Enterobius vermicularis, Haemonchus contortus, Haemonchus placei, Necator americanus, Nematodirus helvetianus, Oesophagostomum racliatum, Onchocerca volvulus, Onchocerca cervicalis, Ostertagia ostertagi, Ostertagia circumcincta, Oxyuris equi, Parascaris equorum, Strongyloides stercoralis, Strongylus vulgaris, Strongylus edentatus, Syngamus trachea, Teladorsagia circumcincta, Toxocara cati, Trichinella spiralis, Trichostrongylus axei, Trichostrongylus colubriformis, Trichuris vulpis, Trichuris suis, Trichurs trichiura, and Wuchereria bancrofti.
In still another embodiment, a nucleic acid of the invention can be used to generate a transgenic plant such as Arabidopis thaliana, a model legume Medicago truncatula, or any plant of interest. Methods for the production of transgenic plants are described in general above. For example, the Sl 5 gene can be cloned into a vector under the control of the cauliflower mosaic virus (CaMV) 35S promoter/nopaline synthase terminator cassette (Baulcombe et al. (1986) Nature 321:446-449) which can then be introduced into an Agrobacterium strain by the freeze thaw method.
Agrobacterium-mediated transformation can be accomplished by the planta- vacuum-infiltration method (Bouchez et al. (1993) CR. Acad. Sci. Paris 316:1188- 1193) and transformed transgeneic plant lines can be selected (Spychalla et al. (1997) Proc. Natl. Acad. Sci. 94:1142-1147). Such a plant line can be used to generate plants with increased resistance to nematodes by providing the plant with a transgene expressing S 15.
AGRICULTURAL COMPOSITIONS
When the present polypeptides and/or polynucleotides are used as pesticides, they may be used as such; however, they are usually used after formulation into oil sprays, emulsifiable concentrates, flowables, granules, dusts, poison baits, microcapsules, or application forms by mixing with solid carriers, liquid carriers, gaseous carriers, or baits, and if necessary, by addition of surfactants or other auxiliaries and processing.
These formulations may usually contain the present compounds in 0.01% to 95% by weight.
The solid carrier used in the formulation may include fine powder or granules of clay materials such as kaolin clay, diatomaceous earth, synthetic hydrated silicon oxide, bentonite, Fubasami clay, and acid clay; various kinds of talc, ceramics, and other inorganic minerals such as sericite, quartz, sulfur, activated charcoal, calcium carbonate, and hydrated silica; and chemical fertilizers such as ammonium sulfate, ammonium phosphate, ammonium nitrate, urea, and ammonium chloride.
The liquid carrier may include water; alcohols such as methanol and ethanol; ketones such as acetone and methyl ethyl ketone; aromatic hydrocarbons such as benzene, toluene, xylene, ethylbenzene, and methylnaphthalene; aliphatic hydrocarbons such as hexane, cyclohexane, kerosene, and light oil; esters such as ethyl acetate and butyl acetate; nitriles such as acetonitrile and isobutyronitrile; ethers such as diisopropyl ether and dioxane; acid amides such as N5N- dimethylformamide and N,N-dimethylacetamide; halogenated hydrocarbons such as dichloromethane, trichloroethane, and carbon tetrachloride; dimethyl sulfoxide; and vegetable oils such as soybean oil and cottonseed oil.
The gaseous carrier or propellant may include Freon gas, butane gas, LPG (liquefied petroleum gas), dimethyl ether, and carbon dioxide.
The surfactant may include alkyl sulfates, alkyl sulfonates, alkyl arylsulfonates, alkyl aryl ethers and their polyoxyethylene derivatives, polyethylene glycol ethers, polyhydric alcohol esters, and sugar alcohol derivatives.
The auxiliaries may include fixing agents, dispersing agents, and stabilizers, specific examples of which are casein, gelatin, polysaccharides such as starch, gum arabic, cellulose derivatives, and alginic acid; lignin derivatives, bentonite, sugars, synthetic water-soluble polymers such as polyvinyl alcohol, polyvinyl pyrrolidone, and polyacrylic acid; PAP (isopropyl acid phosphate), BHT (2,6-di-tert-butyl-4- methylphenol), BHA (mixtures of 2-tert-butyl-4-methoxyphenol and 3-tert-butyl-4- methoxyphenol), vegetable oils, mineral oils, and fatty acids and their esters.
The base material for poison baits may include bait materials such as grain powder, vegetable oils, 'sugars, and crystalline cellulose; antioxidants such as dibutylhydroxytoluene and nordihydroguaiaretic acid; preservatives such as dehydroacetic acid; substances for preventing erroneous eating, such as red pepper powder; pest attractant flavors such as cheese flavor, onion flavor, and peanut oil.
In one embodiment, the polypeptides and/or polynucleotides may be used in a nematode trap, i.e. a location to which a nematode is lured, e.g. by an attractant. The polypeptides and/or polynucleotides may be used, at least in part, to trap the nematode. The polypeptides and/or polynucleotides may also be used in combination with a cyst hatching factor whereby nematode cysts are encouraged to hatch only to be entrapped by the formulation of the present invention. When the present polypeptides and/or polynucleotides are used as pesticides, their application amounts are usually 0.1 to 1000 g in amounts of the present compounds per 1000 m2. For emulsifiable concentrates, wettable powders, flowables, or microcapsules, these formulations are usually applied after water dilution so that the concentrations of active ingredients come to 10 to 10,000 ppm, and for granules or dusts, these formulations are usually applied as such.
These formulations or their water dilutions may be used in the foliar treatment of plants such as crop plants to be protected against pests, or may be applied to the nursery beds before planting of crop plant seedlings or to the planting holes or the bases of plants at the time of planting. For the purpose of controlling pests inhabiting the soil of a cultivated land, they may be applied to the soil. In addition, resin formulations processed into a sheet, string or other shapes may be applied by directly winding around crop plants, extending in the neighborhood of crop plants, or laying on the soil surface at the bases of plants.
The rhizosphere is the root-soil interface. It is the zone, about lmm in width, surrounding the epidermis of living root hairs and the boundary cells of mycorrhizae as well as hyphae growing out from some mycorrhizae as well as hypae growing out from some mycorrhizae. A constantly changing mix of organisms, including nematodes, may inhabit the rhizosphere. It will therefore be appreciated that the present formulations may usefully be applied to the rhizosphere.
Furthermore, they may be used in admixture with or separately but simultaneously with other insecticides, nematocides, acaricides, bactericides, fungicides, herbicides, plant growth regulators, synergists, fertilizers, soil conditioners and/or animal feeds.
The insecticide and/or nematocide and/or acaricide which can be used may include organophosphorus compounds such as Fenitrothion, Fenthion, Pyridaphenthion,
Diazinon, Chlorpyriphos, Chlorpyriphos-methyl, Acephate, Methidathion, Disulfoton, DDVP5 Sulprofos, Profenofos, Cyanophos, Dioxabenzofos, Dimethoate, Phenthoate, Malathion, Trichlorfon, Azinphos-methyl, Monocrotophos, Dicrotophos, Ethion and Fosthiazate; carbamate compounds such as BPMC, Benfuracarb, Propoxur, Carbosulfan, Carbaryl, Methomyl, Ethiofencarb, Aldicarb, Oxamyl, Fenothiocarb, Thiodicarb, and Alanycarb; pyrethroid compounds such as Etofenprox, Fenvalerate, Esfenvalerate, Fenpropathrin, Cypermethrin, α- Cypermethrin, β-Cypermethrin, Permethrin, Cyhalothrin, λ-Cyhalothrin, Cyfluthrin, β-Cyfluthrin, Deltamethrin, Cycloprothrin, τ-Fluvalinate, Flucythrinate, Bifenthrin, Acrinathrin, Tralomethrin, Silafluofen, and Halfenprox; neonicotinoid compounds such as Acetamiprid, Clothianidin, Nitenpyram, Thiamethoxam, Dinotefuran, Imidacloprid, and Thiacloprid; benzoylphenylurea compounds such as Chlorfluazuron, Teflubenzuron, Fulfenoxuron, and Lufenuron; benzoylhydrazide compounds such as Tebufenozide, Halofenozide, Methoxyfenozide, and Chromafenozide; thiadiazine derivatives such as Buprofezin; Nereistoxin derivatives such as Cartap, Thiocyclam, and Bensultap; chlorinated hydrocarbon compounds such as Endosulfan, γ-BHC, and l,l-bis(chlorophenyl)-2,2,2-trichloroethanol; formamidine derivatives such as Amitraz and Chlordimeform; thiourea derivatives such as Diafenthiuron; phenylpyrazole compounds; Chlorfenapyr, Pymetrozine, Spinosad, Indoxacarb, Pyridalyl, Pyriproxyfen, Fenoxycarb, Diofenolan, Cyromazine, Bromopropylate, Tetradifon, Quinomethionate, Propargate, Fenbutatin oxide, Hexythiazox, Etoxazole, Chlofentezine, Pyridaben, Fenpyroximate, Tebfenpyrad, Pyrimidifen, Fenazaquin, Acequinocyl, Bifenazate, Fluacrypyrim, Spirodiclofen, Milbemectin, Avermectin, Emamectin benzoate, Azadilactin [AZAD], and polynactin complexes [e.g., tetranactin, dinactin, trinactin].
PHARMACEUTICAL AND VETERINARY COMPOSITIONS
For use as an antiparasitic agent in animals, the instant polypeptides and/or polynucleotides may be administered internally either orally or by injection, or topically as a liquid drench or as a shampoo. For oral administration, the polypeptides and/or polynucleotides may be administered in capsule, tablet, or drench bolus form or alternatively they can be mixed in the animals feed. The capsules, tablets, and drenches boluses are comprised of the active ingredient in combination with an appropriate carrier vehicle such as starch, talc, magnesium stearate, or dicalcium phosphate. These unit dosage forms are prepared by intimately mixing the active ingredient with suitable finely- powdered inert ingredients including diluents, fillers, disintegrating agents, suspending agents, and/or binders such that a uniform mixture solution or suspension is obtained. An inert ingredient is one that will not react with the instant compounds and which is non toxic to the animal being treated.
Suitable inert ingredients include starch, lactose, talc, magnesium stearate, vegetable gums and oils, and the like. These formulations may contain a widely variable amount of the active and inactive ingredients depending on numerous factors such as the size and type of the animal species to be treated and the type and severity of the infection. The active ingredient may also be administered as an additive to the feed by simply mixing the compound with the feedstuff or by applying the compound to the surface of the feed. Alternatively the active ingredient may be mixed with an inert carrier and the resulting composition may then either be mixed with the feed or fed directly to the animal.
Suitable inert carriers include corn meal, citrus meal, fermentation residues, soya grits, dried grains and the like. The active ingredients are intimately mixed with these inert carriers by grinding, stirring, milling, or tumbling such that the final composition contains from 0.001 to 5.0% by weight of the active ingredient.
The polypeptides and/or polynucleotides may alternatively be administered parenterally via injection of a formulation consisting of the active ingredient dissolved in an inert liquid carrier. Injection may be either intramuscular, intraruminal, intratracheal, or subcutaneous. The injectable formulation consists of the active ingredient mixed with an appropriate inert liquid carrier. Acceptable liquid carriers include the vegetable oils such as peanut oil, cotton seed oil, sesame oil and the like as well as organic solvents such as solketal, glycerol formal and the like. As an alternative, aqueous parenteral formulations may also be used. The vegetable oils are the preferred liquid carriers. The formulations are prepared by dissolving or suspending the active ingredient in the liquid carrier such that the final formulation contains from 0.005 to 20% by weight of the active ingredient.
The instant polypeptide and/or polynucleotides may usefully be administered as a dried formulation, e.g. a lypholized formulation. Where pulmonary delivery is contemplated, a spray-dried formulation may be particularly useful. Where stability of a solution may be an issue, use of a suspension may be appropriate.
Topical application of the instant polypeptides and/or polynucleotides is possible through the use of a liquid drench or a shampoo containing the instant compounds as an aqueous solution or suspension. These formulations generally contain a suspending agent such as bentonite and normally will also contain an antifoaming agent. Formulations containing from 0.005 to 20% by weight of the active ingredient are acceptable. Preferred formulations are those containing from 0.5 to 5% by weight of the instant compounds.
The instant polypeptides and/or polynucleotides are primarily useful as antiparasitic agents for the treatment and/or prevention of helminthiasis in domestic animals such as cattle, sheep, horses, dogs, cats, goats, swine, and poultry. They are also effective in the treatment of such parasitic infections of humans. In treating such infections the polypeptides and/or polynucleotides of this invention may be used individually or in combination with each other or with other unrelated antiparasitic agents. The dosage of the instant compounds required for best results depends on several factors such as the species and size of the animal, the type and severity of the infection, the method of administration and the compound used. Oral administration of the instant polypeptides and/or polynucleotides at a dose level of from 1.0 to 150 mg per kg of animal body weight either in a single dose or in several doses spaced a few days apart, generally gives good results. A single dose of one of the instant polypeptides and/or polynucleotides normally gives excellent control however repeat doses may be given to combat re-infection or for parasite species which are unusually persistent. The techniques for administering these polypeptides and/or polynucleotides to animals are known to those skilled in the veterinary field.
The polypeptides and/or polynucleotides may be administered orally in a unit dosage form such as a capsule, bolus or tablet, or as a liquid drench where used as an anthelmintic in mammals. The drench is normally a solution, suspension or dispersion of the active ingredient usually in water together with a suspending agent such as bentonite and a wetting agent or like excipient. Generally, the drenches also contain an antifoaming agent. Drench formulations generally contains from about 0.001 to 0.5% by weight of the active compound. Preferred drench formulations may contain from 0.01 to 0.1% by weight. The capsules and boluses comprise the active ingredient admixed with a carrier vehicle such as starch, talc, magnesium stearate, or di-calcium phosphate.
Where it is desired to administer the polypeptides and/or polynucleotides in a dry, solid unit dosage form, capsules, boluses or tablets containing the desired amount of active compound usually are employed. These dosage forms are prepared by intimately and uniformly mixing the active ingredient with suitable finely divided diluents, fillers, disintegrating agents and/or binders such as starch, lactose, talc, magnesium stearate, vegetable gums and the like. Such unit dosage formulations may be varied widely with respect to their total weight and content of the antiparasitic agent depending upon factors such as the type of host animal to be treated, the severity and type of infection and the weight of the host.
When the active polypeptide and/or polynucleotide is to be administered via an animal feedstuff, it is intimately dispersed in the feed or used as a top dressing or in the form of pellets which may then be added to the finished feed or optionally fed separately. Alteratively, the polypeptides and/or polynucleotides of our invention may be administered to animals parenterally, for example, by intraruminal, intramuscular, intratracheal, or subcutaneous injection in which event the active ingredient is dissolved or dispersed in a liquid carrier vehicle. For parenteral administration, the active material is suitably admixed with an acceptable vehicle, preferably of the vegetable oil variety such as peanut oil, cotton seed oil and the like. Other parenteral vehicles such as organic preparation using solketal, glycerol formal, and aqueous parenteral formulations are also used. The active polypeptide and/or polynucleotide is dissolved or suspended in the parenteral formulation for administration; such formulations generally contain from 0.005 to 5% by weight of the active compound.
When the polypeptide and/or polynucleotide described herein is administered as a component of the feed of the animals, or dissolved or suspended in the drinking water, compositions are provided in which the active polypeptides and/or polynucleotides are intimately dispersed in an inert carrier or diluent. By inert carrier is meant one that will not react with the antiparasitic agent and one that may be administered safely to animals. Preferably, a carrier for feed administration is one that is, or may be, an ingredient of the animal ration.
Suitable compositions include feed premixes or supplements in which the active ingredient is present in relatively large amounts and which are suitable for direct feeding to the animal or for addition to the feed either directly or after an intermediate dilution or blending step. Typical carriers or diluents suitable for such compositions include, for example, distillers' dried grains, corn meal, citrus meal, fermentation residues, ground oyster shells, wheat shorts, molasses solubles, corn cob meal, edible bean mill feed, soya grits, crushed limestone and the like. The active hydrogenated avermectin compounds are intimately dispersed throughout the carrier by methods such as grinding, stirring, milling or tumbling. Compositions containing from about 0.005 to 2.0% by weight of the active compound are particularly suitable as feed premixes. Feed supplements, which are fed directly to the animal, contain from about 0.0002 to 0.3% by weight of the active polypeptides and/or polynucleotides.
Such supplements are added to the animal feed in an amount to give the finished feed the concentration of active polypeptides and/or polynucleotides desired for the treatment and control of parasitic diseases. Although the desired concentration of active polypeptides and/or polynucleotides will vary depending upon the factors previously mentioned as well as upon the particular avermectin derivative employed, the polypeptide and/or polynucleotide described in this invention is usually fed at concentrations of between 0.00001 to 0.002% in the feed in order to achieve the desired antiparasitic result.
The polypeptide and/or polynucleotide of this invention is also useful in combatting agricultural pests that inflict damage upon crops while they are growing or while in storage. The compound is applied using known techniques as sprays, dusts, emulsions and the like, to the growing or stored crops to effect protection from such agricultural pests.
Further preferred features and embodiments of the present invention will now be described by way of non-limiting Examples with reference to the accompanying Examples.
Examples
Example 1 - Nematode assays
The killing assays were performed using a Caenorhabditis elegans wild type strain. The nematode was maintained on NGM agar (13.3% NaCl, 11.1% Bactopeptone, 75.5% Bactoagar and cholesterol (5mg/ml in ethanol), IM CaCl2, IM MgSO4, IM Potassium Phosphate (pH 6.0)) at 18°C. E. coli strain OP50 was used as food source. Nematodes were washed from NGM agar plates with M9 salts buffer (42.5% Na2HPO4, 21% KH2PO4, 35.1% NaCl5 1.7% MgSO4JH2O). These worm suspensions were added to test solutions and the behaviour of the worms followed microscopically. Haemottchus contortus and other toxicity assays were performed essentially the same as the C. elegans assays.
Example 2 - Photorhabdus asymbiotica supernatant assays
Photorhabdus asymbiotica ATCC43949 was routinely grown in either liquid Luria- Bertini (LB) or protease-peptone number 3 (PP3) media at 30°C with aeration. 500 μl of overnight or four-day old Photorhabdus cultures in LB and PP3 liquid medium were transferred into a 24-well tissue culture plate and 40 μl of nematode suspension (in M9) added. To prevent growth of bacterial contaminants, streptomycin was added to final concentration of 10 micrograms per ml for each well. Nematode response was assessed under a light microscope every 30 minutes over 3 hours, and again overnight.
Cell free supernatants from overnight cultures (18 hours) exhibit a nematode aggregation-phenotype, which we found was associated with so-called "S 15" [Figure Ia and b]. Nematodes aggregated by S 15 were examined by Scanning Electron Microscopy (SEM). This confirmed that the worms were "cemented" [Figure 2a and b]. C. elegans is a recognised model for the study of parasitic nematodes. The wide applicability of the invention was confirmed when Sl 5 supernatants also caused rapid aggregation of the mammalian parasitic nematode Haemonchus contortus [Figure 3].
Escherichia coli strain EClOO (Epicentre) was used as a negative control strain in all assays and was also routinely grown in liquid Luria-Bertini media at 3O0C with aeration.
P. asymbiotica is unusual amongst Photorhabdus species in that it has only been recovered from human infections and no known nematode partner has yet been identified. We therefore sought to identify the putative clumping protein via a comparative analysis of P. asymbiotica supernatants grown at 30°C, a temperature at which interactions with invertebrates might occur, and 37°C, a temperature closer to the human host from which this strain was recovered. Importantly, nematode clumping factor was only produced at 3O0C and not at 370C. In more detail, as shown in Figure 4(A), P. asymbiotica ATCC43949 supernatant grown at 300C clumps C. elegans. Figure 4(B) shows that the same strain grown at 37°C looses its ability to clump C. elegans. Figure 4(C) shows that heating (50°C for 10 min.) the supernatant grown at 300C also abolishes the effect.
Example 3 - Identification of the small protein Sl 5
P, asymbiotica ATC43949 was grown in LB liquid medium for 2 days at both 30°C and 37°C with aeration. Protein from cell free supernatants was concentrated by phenol-precipitation. In more detail, 0.5 volumes of TRIS-equilibrated phenol was added to 1 volume of supernatant. The aqueous phase was discarded and 5 volumes of ethanol then added. This was incubated at -2O0C overnight. Proteins were harvested by centrifugation at 4°C for 30 minutes at full speed in a cooled bench-top centrifuge. The supernatant was discarded and the pellet rinsed in acetone before drying. It was re-suspended in 2D-electrophoresis loading buffer, centrifuged at 8876Og to remove any insoluble material, quantified and 15 microgram of total protein used for each gel. The 11cm 2D-gels were run on 3-10 IPG pH strips (Amersham), on 8-18 gradient SDS-gels, which separate proteins from 6.5-30OkDa. The gels were then stained with either Coomassie Brilliant blue or silver stains to visualise the protein. Further, physical properties of the dumping-factor in the supernatant samples, including size exclusion, temperature stability, and protease resistance, all suggested a protein component is required.
A small protein designated Sl 5 was identified that was secreted at 300C but not at 37°C [Figure 5]. The open reading frame (ORF) and protein sequences are detailed in SEQ ID Nos: 1 and 2. This protein spot was picked from the gel and analysed using MALDI-ToF analysis of a trypsin digest. The MALDI-ToF profile allowed us to identify the si 5 gene. The si 5 gene was PCR amplified from the genome using the rTth DNA polymerise kit (Perkin-Elmer). Primers were synthesised by MWG biotech
[primer sequences 5' to 3' forward: TT AATCTTGGAATTCATT AAACACATT; reverse: TTAAAGCTTAGGTTACAATAGTATATTCT] .
The resulting amplicon was restriction digested with EcøRI and HindlU and DNA- ligated (New England Biolabs) into the equivalent sites of the arabinose inducible expression plasmid pBAD30. Representative clones were fully sequenced to confirm the correct sequence of the cloned si 5 ORF. These recombinants were designated E.coli EClOO [pBAD30W5].
Example 4 - Activity of the pBAD30sl5 recombinants
E.coli EClOO [pBAD30^75] was grown overnight with aeration at 30°C in PP3 medium supplemented with 100 micrograms/ml ampicillin. This was sub-cultured into fresh medium and grown to an optical density of 0.5 ODeoo- The culture was then split into two halves and one half was induced by the addition of sterile L- arabinose to a final concentration of 0.2% w/v. Both cultures were returned to 3O0C with aeration and samples taken at intervals for testing against nematodes and SDS- page analysis. SDS-page indicated significant cell-associated S15 expression by 2 hours and a slight increase after overnight expression [Figure 6]. Sl 5 could not be detected in supernatant fractions.
The addition of nematodes to neat or diluted samples of induced cultures caused the cells to rapidly clot or aggregate around the worms. This reaction was visible by the eye as all turbidity was lost as a result of this clumping, with the bacterial-worm aggregate appearing as a large white mass. Light and SEM electron microscopy [Figures 7a and b; and 8a and 8b] confirmed the observations that the cells "clotted" onto the worms, trapping them in a solid matrix. This inability to move or feed is fatal for nematodes.
Example 5 -Appearance of Sl 5 expressing E. coli
Figures 8a and b show the appearance of Sl 5 expressing E. coli. Without wishing to be bound by any theory, it is believed that Sl 5 is a self-assembling protein that makes fibrils and that these fibrils join the cells when they protrude from them.
Example 6 — Spectrum ofS15 Activity
In order to investigate the activity spectrum of Sl 5, we screened supernatants, grown at 30°C, from a range of Photorhabdus species and strains. We took both model nematodes (Caenorhabditis elegans) and a range of different parasitic nematodes (Table 1) and simply added them to cell free bacterial supernatants to observe nematode behaviour. Strikingly, nematodes added to supernatants from P. asymbiotica strain ATCC34949 showed rapid agglutination around a clump of material clearly visible to the naked eye. In this clump, nematodes become stuck together by a matrix that precipitates from the cell free culture supernatant upon the addition of the worms (Figure 14). This clumping phenomenon was also observed when several different parasitic nematodes were added to the same supernatant (Figure 14, Table 1), suggesting that the clumping factor can recognise a variety of nematodes. Importantly, different strains of Photorhabdus showed differing ability to clump different species of nematodes including C. elegans and parasitic nematodes (Hemonchus contortus), confirming that supernatants from different bacterial strains show some specificity.
Example 7 - Recombinant Expression of Sl 5
When recombinant E. coli expressing Sl 5 (Figure 15A) were added to C. elegans the nematodes rapidly clumped together (Figure 15B). The recombinant E. coli expressed large quantities of Sl 5 protein (Figure 15A), most of which was deposited in fibrillar intercellular inclusion bodies (data not shown). We therefore also placed the same S15 expressing plasmid into P. luminescens strain TTOl5 the supernatant of which cannot normally clump C. elegans. Expression of Sl in TTOl did produce bacterial supernatants that were capable of clumping C. elegans suggesting that Sl 5 was being properly secreted by P. luminescens, unlike the E. coli strain. In more detail with reference to Figure 15, recombinant expression of Sl 5 in E. coli, or non- clumping P, luminescens TTOl, reconstitutes the clumping phenotype. Figure 15(A) shows that the Sl 5 protein from P. asymbiotica is highly expressed in recombinant E. coli expressing the plasmid pBADmns. Figure 15(B) shows recombinant E. coli EClOO expressing pBADmns (or pBADS15) can clump C. elegans, whereas E. coli expressing pBAD vector alone cannot. Note that these clumps contain E. coli cells, as the S 15 protein is not secreted into the supernatant. Figure 15(C) shows that recombinant P. luminescens TTOl expressing pBADmns can also clump C. elegans. In this case this effect can be reconstituted by the bacterial supernatant as P. luminescens can properly secrete S 15. The results also show that recombinant P. luminescens TTOl expressing pBADmns can also clump Haemonchous.
We injected Galleria mellonella with purified S15 produced in E. coli BL21. Toxicity occurred after 48 hours. No toxicity occurred with S16 produced in E. coli EClOO.
Example 8 - Immunocytochemistty of Sl 5
To confirm the presence of the S 15 protein in the clump we raised an anti-peptide polyclonal antibody to the predicted amino acid sequence of S 15. This antibody recognises a protein of the correct size to be S15 on a Western blot, which is not present in a knock-out strain, and also recognises protein recovered from washed nematode clumps physically removed from Photorhabdus supernatants (Figure 16A). In more detail, in Figure 16 immunocytochemistry confirms that S15 is localised within the clumping matrix. Figure 16(A) is a western blot probed with the anti-S15 polyclonal antibody. Lane correspond to P. asymbiotica supernatants grown at 30°C or 37°C (30°C and 370C), a negative control of untreated C elegans (CON) and C. elegans clumped with P. asymbiotica 3O0C supernatant (CLUMP), and sl5 knockout mutant and wild type P. luminescens TTOl (Δmns and TTOl). The arrow shows the position of the S 15 protein highlighted by the antibody.
Immunofluorescent labelling of the anti-S15 antibody shows that S15 is part of the clumping matrix (arrow) adhered to several C. elegans (Figure 16B).
Immunogold labelling of the anti-S15 antibody shows gold particles decorating th matrix that entraps the nematodes (Figure 16C).
Example 9 - Sl 5 is involved in biofllm formation
In order to understand why Photorhabdus secretes such large quantities of S 15, we used immuno-gold analysis to look at the location of the protein in bacterial colonies. Cross-sections of P. luminescens TTOl colonies show gold particles associated with an unusual intercellular matrix (Figure 17A), particles that are lacking in a similar analysis of the single gene knockout (Figure 17B). Given that S15 is found between adherent bacteria, and that it can adhere to foreign surfaces such as nematode cuticles, we reasoned that it might be involved in bacterial biofilm formation. To test this hypothesis, we grew wild type and si 5 mutant bacteria in polypropylene microtitre plates and then measured the accumulated biofilm using the crystal violet uptake assay. In this analysis, deletion of the si 5 gene significantly reduced the ability of TTOl to attach to the microtitre plate (Figure 17C). This supports the concept that Sl 5 is abundantly secreted and that by adhering to foreign substrates and the intercellular matrix between bacterial cells, it can promote biofilm formation. In more detail, Figure 17(A) shows a cross section of a P. luminescens TTOl bacterial colony viewed by TEM. Note the presence of an extensively folded matrix (arrow) between the bacterial cells (P). Figure 17(B) shows localisation of the S15 protein using the anti-S15 antibody labelled with gold particles. Gold particles decorate the matrix. Figure 17(C) shows that the si 5 mutant bacteria show no anti-S15 antibody signal. Scale bars are 0.2 μm. Figure 17(D) is a histogram showing the relative density of biofilm formed on a microtitre plate by P. asymbiotica (Pa) grown at 30°C or 37°C and by wild type P. luminescens TTOl (TTOl) and si 5 mutant bacteria (Δmns).
All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention which are apparent to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.
Table 1. Clumping specificity of different Photorhabdus culture supernatants (+ denotes clumping and — denotes no clumping)
Ul
4-
Figure imgf000055_0001

Claims

1. An isolated polypeptide comprising a sequence which has at least 92% identity to the amino acid sequence shown in SEQ ID NO:1.
2. The isolated polypeptide according to claim 1 in which the amino acid sequence has at least 95% identity to the amino acid sequence shown in SEQ ID NO:1.
3. The isolated polypeptide according to claim 1 comprising the amino acid sequence shown in SEQ ID NO: 1.
4. The isolated polypeptide according to claim 1 consisting of the amino acid sequence shown in SEQ ID NO:1.
5. A fragment of at least 15 contiguous residues of the isolated polypeptide according to any one of claims 1 to 4 in which said fragment is capable of giving rise to a nematistatic effect.
6. An isolated polynucleotide comprising a sequence which encodes the polypeptide or fragment thereof according to any one of claims 1 to 5.
7. An isolated polynucleotide comprising a sequence which has at least 92% identity to the sequence shown in SEQ ID NO:2; a fragment thereof of at least 15 contiguous residues and encoding a polypeptide which is capable of giving rise to a nematistatic effect; or a sequence which is complementary thereto, which is capable of hybridising under stringent conditions thereto, or which is degenerate as a result of the genetic code.
8. The isolated polynucleotide according to claim 7 in which the polynucleotide has at least 95% identity to the sequence shown in SEQ ID NO:2.
9. The isolated polynucleotide according to claim 7 comprising the sequence of SEQ ID NO:2.
10. An expression sequence comprising a polynucleotide which has at least 92% identity to the sequence shown in SEQ ID NO:2 or a polynucleotide according to any one of claims 6 to 9 or a portion thereof operably linked to a regulatory sequence, the regulatory sequence capable of directing expression of said polynucleotide,
11. An expression sequence according to claim 10, which is an expression vector.
12. A cell comprising an expression sequence according to claim 10 or 11.
13.A cell which has been modified, preferably by genetic engineering, to up-regulate the expression of a polypeptide having a sequence as defined in any one of claims 1 to 5 or a sequence which has at least 92% identity to the amino acid sequence shown in SEQ ID NO:1, or a polynucleotide having a sequence as defined in any one of claims 6 to 9 or a sequence which has at least 92% identity to the sequence shown in SEQ ID NO:2, compared to a cell which has not been so modified.
14. A method of producing a polypeptide comprising providing a expression sequence according to claim 10 or 11, allowing expression of the polypeptide from the expression sequence under control of the regulatory sequence, and optionally purifying the polypeptide.
15. The method according to claim 14 in which the expression sequence is in the form of an expression vector which is transfected into a cell to enable expression of the polypeptide by the cell.
57
16. A method of producing a recombinant protein comprising providing a cell according to claim 12 or 13, and causing expression of the recombinant protein in the cell, and optionally purifying the protein.
17. A plant or transgenic non-human animal comprising the cell of claim 12 or
13.
18. Use of a plant or transgenic non-human animal comprising an expression vector which comprises a polynucleotide sequence which encodes for an S15 polypeptide or fragment, variant, derivative, homologue or variant thereof having nematistatic activity as a nematistatic agent.
19. Use according to claim 18 wherein the Sl 5 polypeptide is derivable from Photorhabdus.
20. Use according to claim 18 or 19 wherein the S15 polypeptide has at least 60% identity to the amino acid sequence shown in SEQ ID NO:1.
21. Use according to claim 18 or 19 wherein when the Sl 5 polypeptide is an orthologue of a polypeptide derivable from Photorhabdus it has at least 20% identity to the amino acid sequence shown in SEQ ID NO:1.
22. A pharmaceutical, veterinary or agricultural composition comprising an S 15 polypeptide or a polynucleotide encoding therefor, an expression sequence comprising said polynucleotide sequence or a cell comprising said expression vector, together with a pharmaceutically, veterinary or agriculturally acceptable carrier, excipient or diluent respectively.
23. A composition according to claim 22 wherein the S15 polypeptide is derivable from Photorhabdus.
58
24. A composition according to claim 22 or 23 wherein the Sl 5 polypeptide has at least 60% identity to the amino acid sequence shown in SEQ ID NO:1.
25. A composition according to claim 22 or 23 wherein when the Sl 5 polypeptide is an orthologue of a polypeptide derivable from Photorhabdus it has at least 20% identity to the amino acid sequence shown in SEQ ID NO:1.
26. Use of an S15 polypeptide or a polynucleotide encoding therefor, an expression sequence comprising said polynucleotide sequence or a cell comprising said expression vector as defined in any one of claims 22 to 25 for the preparation of a pharmaceutical, veterinary or agricultural composition.
27. A method of controlling nematodes comprising applying an S15 polypeptide or a polynucleotide encoding therefor, an expression sequence comprising said polynucleotide sequence or a cell comprising said expression vector as defined in any one of claims 22 to 25 to a loci in need thereof.
59
PCT/GB2006/001834 2005-05-18 2006-05-18 Nematistatic protein WO2006123157A2 (en)

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
GB0510134.0 2005-05-18
GB0510134A GB0510134D0 (en) 2005-05-18 2005-05-18 Nematicide
GB0606969A GB0606969D0 (en) 2006-04-06 2006-04-06 Nematicide
GB0606969.4 2006-04-06

Publications (2)

Publication Number Publication Date
WO2006123157A2 true WO2006123157A2 (en) 2006-11-23
WO2006123157A3 WO2006123157A3 (en) 2007-03-15

Family

ID=37342424

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2006/001834 WO2006123157A2 (en) 2005-05-18 2006-05-18 Nematistatic protein

Country Status (1)

Country Link
WO (1) WO2006123157A2 (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012104837A1 (en) * 2011-02-01 2012-08-09 Technion Research And Development Foundation Ltd. Antinematodal methods and compositions
US20210268045A1 (en) * 2014-07-07 2021-09-02 University Of Massachusetts Anthelmintic probiotic compositions and methods
DE112014003009B4 (en) 2013-06-25 2024-04-25 Albert-Ludwigs-Universität Freiburg A polypeptide capable of glycosylating tyrosine residues of target proteins

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000042855A1 (en) * 1999-01-22 2000-07-27 Horticulture Research International Biological control of nematodes
WO2002094867A2 (en) * 2001-02-07 2002-11-28 Institut Pasteur Sequence of the photorhabdus luminescens strain tt01 genome and uses

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2000042855A1 (en) * 1999-01-22 2000-07-27 Horticulture Research International Biological control of nematodes
WO2002094867A2 (en) * 2001-02-07 2002-11-28 Institut Pasteur Sequence of the photorhabdus luminescens strain tt01 genome and uses

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
COUILLAULT C ET AL: "Diverse bacteria are pathogens of Caenorhabditis elegans" INFECTION AND IMMUNITY, vol. 70, no. 8, August 2002 (2002-08), pages 4705-4707, XP002407614 ISSN: 0019-9567 *

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012104837A1 (en) * 2011-02-01 2012-08-09 Technion Research And Development Foundation Ltd. Antinematodal methods and compositions
CN103502270A (en) * 2011-02-01 2014-01-08 技术研究及发展基金有限公司 Antinematodal methods and compositions
US9468660B2 (en) 2011-02-01 2016-10-18 Technion Research And Development Foundation Ltd. Antinematodal methods and compositions
DE112014003009B4 (en) 2013-06-25 2024-04-25 Albert-Ludwigs-Universität Freiburg A polypeptide capable of glycosylating tyrosine residues of target proteins
US20210268045A1 (en) * 2014-07-07 2021-09-02 University Of Massachusetts Anthelmintic probiotic compositions and methods

Also Published As

Publication number Publication date
WO2006123157A3 (en) 2007-03-15

Similar Documents

Publication Publication Date Title
CN116096236A (en) Insecticidal combinations
US7951929B2 (en) Insecticidal compounds and methods for selection thereof
Deng et al. Two epsilon glutathione S-transferase cDNAs from the common cutworm, Spodoptera litura: Characterization and developmental and induced expression by insecticides
EP2067787A1 (en) Method for controlling insect populations
Chen et al. Functional characterization of Aedes aegypti alkaline phosphatase ALP1 involved in the toxicity of Cry toxins from Bacillus thuringiensis subsp. israelensis and jegathesan
Phani et al. Knockdown of a mucin‐like gene in Meloidogyne incognita (Nematoda) decreases attachment of endospores of Pasteuria penetrans to the infective juveniles and reduces nematode fecundity
WO2006123157A2 (en) Nematistatic protein
WO2007142543A2 (en) Novel bacteria and uses thereof
AU778146B2 (en) Biological control of nematodes
Oestergaard et al. Binding of Cyt1Aa and Cry11Aa toxins of Bacillus thuringiensis serovar israelensis to brush border membrane vesicles of Tipula paludosa (Diptera: Nematocera) and subsequent pore formation
US7339044B2 (en) Nematode PAN and ZP receptor-like sequences
US7803603B2 (en) Nematode ATP synthase subunit E polypeptide
WO2013052536A2 (en) Exploiting host molecules to augment the virulence of mycoinsecticides
Oakeshott et al. Molecular approaches to fundamental and applied entomology
Yin et al. Identification and molecular characterization of a new member of the peritrophic membrane proteins from the meadow moth, loxostege sticticalis
WO2004098282A2 (en) Nematode atp synthase subunit e-like sequences
He et al. Xin-Mi Song1†, Lin-Ya Zhang1, 2†, Xiao-Bin Fu1†, Fan Wu1, Jing Tan1 and Hong-Liang Li1
US6743612B1 (en) Nematode MDH-like sequences
Sinnathamby Bacteria associated with Haemonchus contortus: a thesis presented in partial fulfilment of the requirements for the degree of Doctor of Philosophy at Massey University, Palmerston North, New Zealand
JP2008125378A (en) Chemical providing change to physiological state of pest related to vesicle-fusing atpase activity derived from insect
US20060281900A1 (en) Lepidoptera voltage-gated calcium channels
Lu Initiation and regulation of prophenoloxidase activation in tobacco hornworm, Manduca sexta
WO2004106489A2 (en) Nematode GS-like sequences

Legal Events

Date Code Title Description
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

NENP Non-entry into the national phase

Ref country code: RU

WWW Wipo information: withdrawn in national office

Country of ref document: RU

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 06743929

Country of ref document: EP

Kind code of ref document: A2

122 Ep: pct application non-entry in european phase

Ref document number: 06743929

Country of ref document: EP

Kind code of ref document: A2