WO2016007196A1

WO2016007196A1 - Biomass conversion to butadiene

Info

Publication number: WO2016007196A1
Application number: PCT/US2015/011371
Authority: WO
Inventors: Michael E. Wright; Andrew D. MEYER; Andrew Shaw; Stacy M. Burns-Guydish; Erin E. FETSCH; Jeanette M. Mucha; Pavan KAMBAM
Original assignee: Cobalt Technologies, Inc.
Priority date: 2014-07-07
Filing date: 2015-01-14
Publication date: 2016-01-14

Abstract

The present invention relates to the fermentation of lignocellulosic sugars to afford crotyl alcohol that is then separated and converted to butadiene using a dehydration catalyst and a method and apparatus for converting alkenols or diols to dienes with high selectivity and conversion. The dienes are useful in preparing synthetic rubber, copolymers, and fuels.

Description

BIOMASS CONVERSION TO BUTADIENE

CROSS-REFERENCE TO RELATED APPLICATIONS

[01] This application claims the benefit of U.S. Provisional Application No. 62/021,651, filed on July 7, 2014, which is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

[02] The invention generally relates to conversion of biomass to dienes, especially butadiene, by dehydration of alkenols or diols. The dienes, including butadiene, are useful in the preparation of synthetic rubbers, plastics, fuels, and additional chemical intermediates incorporated into valuable commercial products.

BACKGROUND

[03] The energy and cost-efficient conversion of non-food biomass to strategic chemical intermediates is one major step in securing a sustainable future. Lignocellulosic materials and the mixed sugars (C5 and C6) that can be obtained from this non-food source (e.g., corn stover, a waste product from food production) are an ideal feedstock for anaerobic fermentations of certain bacteria. Of particular value are Clostridium species that possess a robust and naturally-occurring ability to ferment C5 and/or C6 sugars into many useful products.

[04] The acetone, butanol, and ethanol (ABE) biosynthetic pathways in Clostridium include well-established bio-catalytic steps where the key intermediates in the pathway are well-characterized (Fig. 8). Interestingly, in the Clostridium ABE process/pathway to bio- 1 -butanol, a key intermediate is crotonyl-CoA (Fig. 9).

[05] A number of renewable butadiene processes have been proposed. These include construction of metabolic pathways to produce butadiene or intermediates thereof in a host organism. This requires introduction of multiple exogenous polynucleotides encoding multiple enzymes into a host organism. This in turn requires subsequent optimization of the expression of the multiple introduced genes and co-optimization of the kinetic profiles of the expressed genes to maximize flow of substrate to product. This is very time-consuming and has a low probability of success. Moreover, host organisms that produce butadiene will require the design and deployment of new fermenter types, which is expensive and introduces additional risk. Therefore, there is a need in the art to develop strategies for renewable butadiene production that require minimal genetic manipulation of a host organism, minimal additional capital expenditure and minimal risk.

[06] a-Olefins are useful intermediates in preparing dienes, including 1,3 -butadiene, diesel and jet/turbine fuels, and polymers. 1-Butene is an especially useful precursor to 1,3- butadiene, which is used in preparing synthetic rubber and other useful polymeric elastomers. a-Olefins are also useful in preparing poly-a-olefins (PAOs) and copolymers with ethylene to form low-density plastics and elastomeric materials. Renewable a-olefins are useful in preparing the corresponding renewable products, including renewable fuels, polymers, elastomers, PAOs, and other chemical intermediates. Currently, the production of ethylene from natural gas is rapidly replacing the steam cracking of naphthas and as a consequence, the four-carbon feedstocks (byproducts like C4-raffinate, a mixture of butane, 1-butene, and 2-butenes) are rapidly shrinking in availability and rising in cost. Thus, the traditional source of petroleum-based and non-renewable C4-feedstock typically used for preparing butadiene is vanishing. It is this shortage of the petroleum feedstock that establishes a need for a renewable and sustainable pathway to butadiene.

[07] Obtaining a-olefins and dienes (e.g., 1,3 -butadiene) from renewable and sustainable resources requires a significantly different approach than currently used in petroleum processes. Since alcohols can be produced in large scale by fermentation processes, they are an attractive feedstock for a-olefin and diene preparations, provided they can be dehydrated at high conversion rates and with high selectivity. This requires achieving high selectivity in forming the alkene bonds and avoiding formation of carbon-oxygen double bonds (i.e., ketones or aldehydes) or the cleavage of carbon-carbon single bonds.

[08] The conversion of oxygen-containing derivatives to butadiene has received considerable attention over the past seven-plus decades with several reviews written on the topic. One example is the article written by Egloff & Hulla [UOP, Chem. Rev. 1945, 36(1), pp 63-141]. Perhaps the most outstanding results to date in fact go back to the work reported by Reppe et al. in 1943 [US patent 2310809]. This work indicated that 1, 3- butanediol and/or 1, 4-butanediol could be doubly dehydrated over a combination of phosphoric acid, conjugate bases, and additional organic components to give butadiene in yields of greater than 90%. However, the WHSV is low relative to that acceptable for a viable industrial process and the lifetime of the catalyst is placed in weeks rather than years. The latter is a typical requirement for a viable commercial catalyst. Thus, there exists a need for a catalyst with sufficient activity, selectivity, and lifetime on stream. [09] Over the last decade, work from the Sato laboratory at Chiba University, Japan has explored the dehydration of diols to alkenols, diols to butadiene, and the dehydration of alkenols to butadiene in significant detail. This work has focused on using inorganic oxide catalysts. One result of particular relevance is the work Ichikawa et al. reported [J. Mol. Catal. A: Chem. 2006, 256, pp 106-1 12] on the dehydration of petroleum-derived 2-buten- l-ol (i.e., crotyl alcohol). The best inorganic oxide catalyst was based on a S1O2-AI2O3 composition where the dehydration of crotyl alcohol gave a 76% conversion with a 93% selectivity (i.e., 71% yield) (Fig. 10).

[10] Commercial production of bio- 1 -butanol has a rich history of successful large-scale production since the discovery by Louis Pasteur in 1861 of bacteria that could ferment sugars to a mixture of acetone, 1 -butanol, and ethanol (ABE). Since Pasteur's initial discovery of the ABE process, many advances have been made in the fermentation process to optimize bio- 1 -butanol production and to reduce ethanol and acetone co-production. Most notable are the successful efforts using Clostridium bacteria in commercial plants that can produce bio- 1 -butanol at a cost competitive to and even less than current petroleum- derived 1 -butanol.

[11] Since fermentations are carried out in aqueous medium, separation of the fermentation products of interest from the multi-component mixture ("fermentation broth") of water, bacteria, media components, and other metabolic byproducts is energy- and time- intensive. In the case of bio- 1 -butanol, several methods have been reported for isolating the butanol component. One method that has found commercial success is use of a sparging gas (e.g., carbon dioxide or steam) that carries the more volatile bio-l-butanol/water azeotrope away from the fermentation broth. Other more academic approaches involve pervaporation. In these cases, a selective membrane material is used that permits bio-1- butanol to pass through, thus leaving the bacteria and water behind. Regardless of the method, it is evident to those skilled in the art that removing the last traces of impurities and water are costly in energy and time. The available methods vary significantly in capabilities. However, water and impurities are a direct and unavoidable consequence of bio-alcohol fermentation processing.

[12] Ruwet et al. (Bull. Soc. Chim. 1987, 96, pp 281-292) discuss the problems associated with using a wet ABE bio- 1 -butanol feed in a dehydration reaction to afford a mixture of olefins. More recently, D'Amore et al. (US2008/0015395 Al) reported extreme difficulty in dehydrating aqueous solutions of 1 -butanol using a variety of acid catalysts to afford a mixture of olefins and other oxygenated products (e.g., ethers), including high amounts of unreacted 1 -butanol. Improved methods are needed to dehydrate bio-alcohols, in particular methods for dehydration of wet bio-alkenols to bio-dienes.

[13] Other alternative catalysts include silica and alumina solid phase catalysts as well as standard mineral acid catalysts. D'Amore et al. (US2009/0030239) disclose the contact of water and alcohols with acid catalysts to afford a mixture of alkene products. Mixtures are typical of acid catalysis and previous work in the field discloses that complicated mixtures of alkene products are formed. The lack of regioselectivity for terminal olefin occurs when isomerization to the more thermodynamically stable internal olefin occurs. In some cases the internal olefins can be formed directly via an acid catalyzed mechanism, typically denoted as El. These results clearly show that dehydration results can be severally complicated by the addition of water in acid-catalyzed dehydrations of bioalcohols.

[14] Internal alkenes are far less effective in Ziegler-Natta polymerization chemistry and are not of direct use in preparing high- flashpoint diesel and jet fuels and for making lubricants. Interestingly, butadiene can be an effective route to bio-l-butene by selective hydrogenation (Fig. 11).

[15] As a feedstock, it is highly desirable to have a selective process that affords rapid and high conversion to a terminal-olefin (e.g., bio-l-butene) and is accompanied by no carbon skeletal rearrangement (e.g., to isobutylene). Furthermore, bio-dienes such as bio- 1,3 -butadiene can be oligomerized/polymerized using a variety of sophisticated methods known in the art. Products prepared from butadiene are useful intermediates in forming reactive end-capped oligomers, lubricants, and fuels. 1,3-butadiene is also a useful intermediate for preparing several 6-carbon chemical intermediates useful in preparing polymers like nylon6,6 (Fig. 12).

BRIEF SUMMARY OF THE INVENTION

[16] Systems and methods are described for catalytic conversion of alkenols or diols to diene products. In some embodiments, the alkenol or diol reactant feed contains water. For example, the alkenol or diol may be produced in a microbial fermentation, and the feed for the catalytic conversion to diene may contain aqueous liquid from the fermentation medium.

[17] In some embodiments, a microorganism is engineered such that it produces crotyl alcohol from lignocellulosic biomass. In other embodiments, a non-engineered

microorganism produces crotyl alcohol.

[18] In some embodiments, microbial production of crotyl alcohol is achieved through the deletion or inactivation of the bed gene from a Clostridium organism (e.g., which results in stopping formation of butyryl-CoA). In some embodiments this is achieved through the ability of the native promiscuous alcohol dehydrogenase (adhE, adhe2) to convert crotonyl- CoA to crotonaldehyde. In some embodiments this is achieved through the ability of the native promiscuous alcohol dehydrogenases (adhE, adhE2, bdhAB) to convert the crotonaldehyde to crotyl alcohol. In some embodiments the production of crotyl alcohol from an engineered Clostridium is enhanced through treatment of the engineered

Clostridium (e.g., engineered to delete or inactivate the bed gene) with one or more chemical mutagen followed by selection in the presence of conditions that bias the selection towards strains with increased crotyl alcohol production.

[19] A strategy is described herein whereby a microorganism which produces w-butanol is converted into a microorganism that produces crotyl alcohol, by deletion, inhibition, and/or inactivation of the activity of one, and possibly two, enzyme(s) (e.g., bed). With this microorganism, crotyl alcohol can be produced by fermentation using existing fermenter designs. Said crotyl alcohol can rapidly and inexpensively be converted to butadiene using a novel catalyst, also disclosed herein, thereby minimizing capital expenditure.

[20] Other strategies are described herein in which non-engineered microorganisms (e.g., microorganisms that produce w-butanol) may produce crotyl alcohol by adjustment of culture conditions to favor production of this product.

[21] In some embodiments, catalyst systems and processes are provided to convert alcohols (e.g., bio-alcohols) to the corresponding dienes (e.g., bio-dienes). In some embodiments, the alcohols (e.g., bio-alcohols) described herein are alkenols (e.g., bio- alkenols) or diols, which are converted to the corresponding dienes (e.g., bio-dienes). In additional embodiments, alkenols (e.g., bio-alkenols) are converted to the corresponding - α,ω-dienes (e.g., bio-a,co-dienes). In certain embodiments, 4-carbon alkenols (e.g., bio- alkenols) are converted to 1,3-butadiene (e.g., bio-l,3-butadiene). In specific embodiments, crotyl alcohol is converted to 1,3-butadiene. In some embodiments the feedstock (alcohol (e.g., bio-alcohol), alkenol (e.g., bio-alkenol), 4-carbon alkenol (e.g., bio-alkenol), crotyl alcohol, or diol) contains from about 0.1 wt-% to about 90 wt-% water and, using systems and processes disclosed herein, delivers a product stream containing the corresponding diene (e.g., bio-diene) and water. In some embodiments, the diene (e.g., bio-diene) is produced with about 90% to about 99% chemical selectivity. In some embodiments, a single pass over the catalyst system affords a chemical conversion of greater than about 95%, about 98%, or about 99%. In some embodiments, the diene (e.g., bio-diene) is produced employing WHSV values greater than about 0.3 hr¹, e.g., greater than about 1 and less than about 10 h ¹, or about 0.3 hr¹ to about 10 hr¹. In some embodiments of the methods disclosed herein, at least one solid phase catalyst is maintained at a temperature of about 200 °C to about 440 °C, or about 200 °C to about 320 °C, with the feed a solution containing alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) and water at a pressure of about 1 psig to about 1000 psig to produce a diene (e.g., bio-diene) in high chemical selectivity at high alcohol conversion. In one embodiment, bio-crotyl alcohol that is obtained from a fermentation broth (e.g., after removal of minor acidic contaminants) is dehydrated to bio-1, 3 -butadiene in a yield of greater than about 80%, or greater than 85%, or greater than 90%.

[22] In one aspect, a method is provided for dehydrating an alkenol or a diol to a diene, including: contacting and heating the alkenol or diol with at least one catalyst that includes an inorganic support, one or more promoter(s) selected from one or more Group 1 element(s), one or more Group 2 element(s), and combinations thereof, and one or more buffer-adjusted anion(s) at a WHSV at least about 0.3 hr¹, thereby producing a diene product that includes one or more diene(s) at a one-pass yield greater than about 72 mol%, or greater than about 73 mol%. In some embodiments, the WHSV is about 0.3 hr¹ to about 10 hr¹. In some embodiments, the alkenol or diol is in a mixture with about 1 ppm to about 93 wt% water, or about 15 wt% to about 70 wt% water. In some embodiments, the selectivity of diene production is at least about 75%, at least about 80%, at least about 85%, at least about 90%, for example, greater than 95%, or about 90% to about 99%.

[23] In some embodiments, the alkenol is a bio-alkenol. In one embodiment, the alkenol is crotyl alcohol. In an embodiment, the crotyl alcohol is bio-crotyl alcohol. In some embodiments, the alkenol is a C₄ to Ce alkenol. In some embodiments, 1,3 -butadiene is produced in a method for dehydrating an alkenol or diol as disclosed herein.

[24] In some embodiments, the inorganic support includes γ-alumina, for example, in the form of an extrudate. In some embodiments, the catalyst is further modified with at least one organosilane, for example, an alkoxysilane, such as a chlorosilane.

[25] In some embodiments of the catalytic dehydration methods disclosed herein, at least one carrier gas is provided, for example, but not limited to, nitrogen and/or argon, or a mixture thereof.

[26] In some embodiments of the catalytic dehydration methods disclosed herein, heating is performed at a temperature of about 200° C to about 400° C. In some embodiments, the temperature is about 250° C to about 320° C. [27] In some embodiments, the method further includes separating water from the diene product(s), thereby producing dry diene product(s).

[28] In some embodiments, the product of the dehydration reaction is 1,3 -butadiene, and the method further includes contacting the 1,3-butadiene product with a second catalyst under conditions sufficient to produce 1-butene. In some embodiments, the 1-butene is contacted with a third catalyst, e.g., a Ziegler-Natta catalyst, a mesoporous oligomerization catalyst, or an acid catalyst, under conditions sufficient to produce oligomers. In some embodiments, the oligomers are used to produce a fuel, e.g., a diesel fuel or a jet fuel. In some embodiments, a diesel fuel is produced that has a flashpoint of about 38° C to about 100° C, a Cetane rating of about 45 to about 60, and aromatic content of less than about 0.5 wt-%. In some embodiment, a jet fuel is produced that has a flashpoint of about 38° C to about 100° C, a cold flow viscosity of less than about 8.0 cSt at -20 C, and aromatic content of less than about 0.5 wt-%.

[29] In some embodiments, the promoter(s) is(are) selected from Mg, Ca, Sr, Ba, and combinations thereof. In one embodiment, the promoter is Ca. In some embodiments, the buffer-adjusted anion is selected from S0₄ ^~2, H2PO4^"1, and mixtures thereof.

[30] In another aspect, a method is provided for dehydrating an alkenol or a diol to a diene, including: contacting and heating the alkenol or diol with at least one catalyst that includes a calcium-modified inorganic support and one or more buffer-adjusted anion(s), thereby producing a diene product that includes one or more diene(s) at a one-pass yield greater than about 80 mol%. In some embodiments, diene product(s) is(are) produced with greater than about 90 mol% selectivity and greater than about 90 mol% conversion. In some embodiments, the alkenol is a bio-alkenol. In one embodiment, the alkenol is crotyl alcohol, e.g., bio-crotyl alcohol. In some embodiments the alkenol is a C₄ to Ce alkenol. In some embodiments, the diene product is 1,3-butadiene. In some embodiments, the alkenol is in a mixture with about 1 ppm to about 93 wt-% water. In some embodiments, the contacting of the alkenol or diol with the at least one catalyst is performed at a WHSV of about 0.3 hr¹ to about 10 hr¹. In some embodiments, the catalyst is modified by treatment with at least one organosilane.

[31] In another aspect, a method is provided for dehydrating crotyl alcohol to a diene product, including: contacting and heating the crotyl alcohol with at least one catalyst that includes an inorganic support, one or more promoter(s) selected from one or more Group 1 element(s), one or more Group 2 element(s), and combinations thereof, and one or more buffer-adjusted anion(s) at a WHSV at least about 0.3 hr¹, thereby producing a diene product that includes one or more diene(s) at a one-pass yield greater than about 73 mol%. In some embodiments, the Group 2 element is Ca. In some embodiments, the buffer- adjusted anion is selected from S0₄ ^~2, Η₂Ρ0₄ ^_1, and mixtures thereof. In some

embodiments, the crotyl alcohol is in a mixture that includes about 1 ppm to about 93 wt-% water. In some embodiments, the mixture includes about 5 wt-% to about 70 wt-% water. In some embodiments, the crotyl alcohol is bio-crotyl alcohol. In some embodiments, the diene product is 1,3 -butadiene. In some embodiments, the molar selectivity of diene production is greater than about 95%, about 90% to about 99%. In some embodiments, the inorganic support includes γ-alumina. In some embodiments, the catalyst is further modified by treatment with at least one organosilane, for example an alkoxysilane. In some embodiments, the method includes providing at least one carrier gas.

[32] In another aspect, catalyst compositions are provided herein for producing dienes from alkenols or diols with high selectivity, including: an inorganic support that is modified with at least one Group 1 element, at least one Group 2 element, or a combination thereof; one or more buffer-adjusted anion(s); and optionally, at least one organosilane. In some embodiments, the catalyst composition includes at least one Group 2 element selected from Mg, Ca, Sr, and Ba. In one embodiment, the Group 2 element is Ca. In some

embodiments, the buffer-adjusted anion is selected from S0₄ ^2~, Η₂Ρ0₄ ^_1, and mixtures thereof. In some embodiment, the buffer-adjusted anion is Η₂Ρ0₄ ^_1, wherein H₂P0₄ ^_1 is a component of a mixture that further optionally includes one or more additional anions selected form HP0₄ ^~2, and P0₄ ^"3, and one or more additional charge balancing counter cations selected from H⁺, Li⁺¹, Na⁺¹, K⁺¹, Mg⁺², Ca⁺², Sr⁺², and Ba⁺², and combinations thereof. In some embodiments, the catalyst composition includes an organosilane, for example, diethoxydiphenylsilane. In some embodiments, the inorganic support includes γ- alumina, silica, titanium oxide, zinc oxide, zinc aluminate, or zirconium oxide.

[33] In some embodiments, catalyst compositions disclosed herein contain an inorganic support modified by a Ca⁺² compound. In one embodiment, modification may be accomplished via treatment of the support with a mixture of calcium compounds, for example calcium bis(hydrogensulfate) and calcium sulfate, dissolved in a solvent. In some embodiments Ca⁺² is the modifier and the Ca⁺² compound is calcium bis(hydrogensulfate) [Ca(HS0₄)2] . The solvent may be water, or an organic solvent, or a mixture of the two. In some embodiments, a solvent is used that is capable of completely dissolving the Ca⁺² compounds used for preparation of the catalyst. In some embodiments, an "Incipient Wetness Impregnation" (IWP) process is used for catalyst preparation. In one embodiment, the catalyst composition includes Ca⁺² (as wt-% of the modified inorganic support) at about 0.8 to about 6.0 wt-%. In one embodiment, y-alumina is used as the inorganic support. In some embodiments, y-alumina is modified with binder, physically formed (e.g., extruded) to a preselected shape (e.g., rods), calcined, and then modified with a mixture of Ca⁺² compounds as noted above in this paragraph. In some embodiments, calcium is preferred over Group 1 metals such as sodium and potassium when used at similar wt-% loading values.

[34] In one aspect, a method of making a catalyst composition described herein is provided. The method includes: a) modifying an inorganic support with at least one Group 2 element and at least one buffer-adjusted anion (e.g., a buffer mixture of anions) to produce a first modified inorganic support, wherein the first modified inorganic support includes the at least one Group 2 element and at least one buffer-adjusted anion; b) calcining the first modified inorganic support to produce a calcined first modified inorganic support; c) optionally contacting the calcined first modified inorganic support with at least one organosilane to produce a second modified inorganic support, wherein the second modified inorganic support includes the at least one Group 2 element, the at least one buffer-adjusted anion, and the at least one organosilane or a fragment thereof; and d) calcining the second modified inorganic support to produce the catalyst composition.

[35] In another aspect, a catalyst composition as described herein is provided, that is produced by a method that includes: a) modifying an inorganic support with at least one Group 2 element and at least one buffer-adjusted anion (e.g., a buffer mixture of anions) to produce a first modified inorganic support, wherein the first modified inorganic support includes the at least one Group 2 element and at least one buffer-adjusted anion; b) calcining the first modified inorganic support to produce a calcined first modified inorganic support; c) optionally contacting the calcined first modified inorganic support with at least one organosilane to produce a second modified inorganic support, wherein the second modified inorganic support includes the at least one Group 2 element, the at least one buffer-adjusted anion, and the at least one organosilane or a fragment thereof; and d) calcining the second modified inorganic support to produce the catalyst composition.

[36] Promoter (e.g. Group 2 or Group 1 metal) modified and calcined catalysts may optionally be further modified by treatment with at least one organosilane to create new catalysts that are especially useful for the dehydration of alkenols (e.g., bio-alkenols) or diols (e.g., bio-diols) mixed with a high wt-% of steam. In some embodiments, buffer- adjusted organosilane-modified catalysts afford high selectivity in forming diene (e.g., bio- diene) products and can perform for extended periods of time on stream with little loss in selectivity.

[37] In some embodiments, methods disclosed herein for producing terminal olefins include using calcium or calcium-organosilane modified alumina catalysts, as described herein, for example, in isothermal continuous flow reactors or in a series of one or more adiabatic reactors. In some embodiments, some of the heat necessary for the dehydration reaction is carried into the reactor in the form of a gaseous diluent, such as steam. This creates a very water rich gas phase in the reactor making some embodiments of the methods disclosed herein beneficial for commercial applications.

[38] Some embodiments of the methods and systems described herein relate to fuels (e.g., alternative and/or renewable fuels) and the production of dienes (e.g., bio-dienes (e.g., biodiesels)) that can be utilized to prepare a drop-in and full performance diesel fuel (e.g., diesel biofuel), jet (e.g., biojet) fuel, lubricant (e.g., biolubricant), or other chemical products and/or intermediates useful in the production of commercial products.

[39] Embodiments also include such processes starting from cellulosic and/or hemicellulosic biomass material, as are shown schematically in FIG 1. Bio-alkenols or bio- diols can also be generated feeding a carbon-source of carbon dioxide and/or carbon monoxide to at least one biological organism. Typically the biological organism is suspended in water or it may be attached to at least one support system and then placed in contact with water and a carbon-source.

[40] In one aspect, methods are provided for dehydrating an alkenol (e.g., bio-alkenol) to a diene (e.g., bio-diene). In some embodiments, the method includes contacting and heating an alkenol (e.g., bio-alkenol) with at least one catalyst that includes a calcium-modified (and optionally silanized) inorganic support at a WHSV of about 0.3 hr¹ to about 10 hr¹, wherein the alkenol (e.g., bio-alkenol) is in a mixture with about 1 ppm to about 93 wt% water, thereby producing the corresponding diene (e.g., bio-diene) with greater than about 90% selectivity and greater than 98% conversion.

[41] In some embodiments of the methods disclosed herein, the alcohol (e.g., bio- alcohol) is a C₄ to Ce bio-alcohol. In one embodiment, the alcohol (e.g. , bio-alcohol) is butanediol (e.g., 1,3-butanediol). The diene (e.g., bio-diene) produced in some

embodiments of the methods disclosed herein is 1, 3 -butadiene. In some embodiments of the methods disclosed herein, the alcohol (e.g., bio-alcohol) is a diol (e.g., bio-diol) such as 2,3 -butanediol or 1,3-butanediol. [42] In some embodiments of the methods disclosed herein, the alcohol (e.g., bio- alcohol) is an alkenol (e.g., bio-alkenol) such as 2-butene-l-ol (e.g., bio-2-buten-l-ol). For example, in some embodiments, the alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) may be a C3 to C12 alcohol (e.g., bioalcohol), e.g., 1, 12-decanediol (e.g., bio-l, 12-decanediol). The diene produced in some embodiments of the methods disclosed herein may be 1,3- butadiene (e.g., bio-l,3-butadiene).

[43] In some embodiments of the methods disclosed herein, the 1 -alkenol is an alcohol of general formula

where R¹ and R² are independently H or a Ci to C20 alkyl radical, or contain one or more aromatic rings containing exclusively carbon or a mixture of carbon and heteroatoms, or a nitrile, or an alkene, or a carboxylic acid, or ketone functional group, or a combination thereof.

[44] In some embodiments, the selectivity of diene (e.g., bio-diene) production is greater than about 95%. In some embodiments, the selectivity of diene (e.g., bio-diene) production is about 90% to about 99%. In some embodiments, the diene (e.g., bio-diene) product includes < about 5% unreacted 1 -alcohol.

[45] In some embodiments, water is present in the feed reaction mixture at about 15 to about 70 wt%.

[46] In some embodiments, the inorganic support includes one or more phases of alumina (e.g., γ-alumina), silica, titanium oxide, zirconium oxide, or zinc aluminate. In some embodiments, the inorganic support includes a combination of more than one of one or more phases of alumina, silica, titanium oxide, zirconium oxide, and zinc aluminate. The surface area of the inorganic support may be in the range of about 50 to about 400 m²/g before modification and in the range of about 40 to about 440 m²/g after modifications to form the catalyst.

[47] In some embodiments, the catalyst is further modified by treatment with at least one organosilane, for example, an alkoxysilane. In one embodiment, the organosilane is a chlorosilane. In one embodiment, the organosilane is diethoxydiphenylsilane. The organosilane may be dissolved in a solvent sufficient to form a homogeneous solution when combined with the organosilane and to wet the inorganic support.

[48] In some embodiments, the catalyst is further modified by treatment with at least one organosilane dissolved in an alcohol solvent. In some embodiments the alcohol solvent is M-propanol, 2-propanol, ethanol, or methanol. In one embodiment, the organosilane is diethoxydiphenylsilane and the alcohol solvent is ethanol. In another embodiment, the organosilane is diethoxydiphenylsilane and the alcohol solvent is methanol. The alcohol solvent can contain from about 1 ppm water up to about 50 wt-% of the alcohol. For selected organosilane reagents with sufficient water solubility, water alone can be used to deliver the organosilane to the catalyst surface.

[49] In some embodiments of the methods of use of the catalysts, e.g., for dehydration of alkenols or diols, at least one purge (e.g., carrier) gas is provided, e.g., nitrogen and/or argon.

[50] In some embodiments, the reaction mixture is heated to a temperature of about 200° C to about 440° C. In some embodiments, the temperature is about 260 °C to about 340 °C. In some embodiments, the temperature is about 250 °C to about 320 °C.

[51] In some embodiments, the method further includes separating water from 1, 3- butadiene product. In some embodiments, the method includes contacting the 1,3-butadiene product from which water has been removed with a second catalyst (hydrogenation type, e.g., palladium on carbon) and hydrogen gas to form 1-butene (e.g., bio-l-butene) in greater than 80% yield. Other more selective hydrogenation catalysts may also be used. The 1-butene (e.g., bio-l-butene) is oligomerized with a third catalyst. In some

embodiments, the third catalyst may be a Ziegler-Natta catalyst, a mesoporous

oligomerization catalyst, or another catalyst that is capable of producing oligomers from dienes (e.g., bio-dienes). In various embodiments, the oligomers may be used to produce a diesel fuel (e.g., with a flashpoint of about 38 to about 100 °C, a Cetane rating of about 45 to about 60, and aromatic content of less than about 0.5 wt-%), a jet fuel (e.g., with a flashpoint of about 38 to about 100 °C, a cold flow viscosity of less than about 8.0 cSt at -20 °C, and aromatic content of less than about 0.5 wt-%), or a lubricant (e.g., with a viscosity of about 1 to about 10,000 cSt at 25 °C).

[52] In some embodiments, the method includes contacting and heating an alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) with at least one catalyst that includes a calcium- modified inorganic support and at least one buffer-mixture, thereby producing the corresponding diene (e.g., bio-diene) with greater than about 90% selectivity and greater than about 90% conversion. Optionally, the alcohol (e.g., bioalcohol) or diol (e.g., bio-diol) is in a mixture with about 1 ppm to about 93 wt% water. Optionally, the catalyst is contacted with the alkenol at a WHSV of greater than 0.3 (e.g., about 0.3 hr¹ to about 10 hr ^l). Optionally, the catalyst is further modified by treatment with at least one organosilane.

[53] In some embodiments, the method includes contacting and heating an alcohol (e.g., bioalcohol, e.g., alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol)) with at least one catalyst that includes an inorganic support that is modified by a Group 2 element, an acid component, and at least one organosilane, thereby producing the corresponding diene with greater than about 90% selectivity. For example, the Group 2 element may include at least one of Mg, Ca, Ba, and Sr. Optionally, the alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) is in a mixture with about 1 ppm to about 93 wt% water. Optionally, the catalyst is contacted with an alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) at a WHSV of greater than 0.3 (e.g., about 0.3 hr¹ to about 10 hr¹). In some embodiments Group 1 metals can be used in place of Group 2 elements. This includes Li, Na, and K and mixtures of Group 1 and Group 2 metals can be used in one embodiment.

[54] In some embodiments, dehydration of crotyl alcohol (a bio-alkenol) using the catalyst compositions and methods described herein provides 1,3-butadiene (e.g., bio-1,3- butadiene) in greater than 90% yield, and, in some embodiments, 90-99% selectivity for 1,3-butadiene or 95-99% selectivity. In some embodiments, the catalyst can be used continuously for at least 1 to 3 months, or about 6 months and in some embodiments, up to about 12 months, or up to about 18 months, or up to about 24 months or up to about 30 months, or about 36 months, or up to 48 months while producing -1,3-butadiene without significant loss in selectivity for the terminal diene.

[55] In another aspect, the charge of the Group 2 element is balanced with at least one counter anion (i.e., X^", where "X" represents a generalized counter anion, not limited to a halide ion) that is a component of the mixture of anions, and charge balancing counter cations, used for the buffer-adjustment. In some embodiments, the pKa for at least one respective conjugate acid (i.e., XH) is in the range of about 0 to about 3, or about 1.5 to about 2.5. The composition of the Group 2 element may use a mixture of counter anions having one or more pKa values for each respective conjugate acid. In one embodiment then the Group 2 element is matched with counter anions that effectively form a buffer- adjusted surface on the inorganic support. For example, a mixture containing both Ca(HS04)2 and Ca(S0₄) can be used to deliver a buffered-adjusted promoter to the inorganic oxide surface. Another embodiment employs a mixture of phosphates (H3PO4, and counter anions H2PO4^"1, and HPO4^"2, and/or P0₄ ^"3), when modifying with calcium or other Group 2 metals. In another embodiment the mixture of phosphates can be used with one or more Group 1 metal cation promoters. In some embodiments, the Group 2 or Group 1 metal is added to the inorganic oxide support in the amount of about 0.3 to about 4 wt-%, and buffering counter anions are used to balance the positive charge of the Group 1 and/or Group 2 cations selected. [56] In one aspect, a method is provided for producing crotyl alcohol, including growing a microorganism in a growth medium under fermentation conditions suitable for production of crotyl alcohol. In some embodiments, the microorganism expresses one or more native enzyme(s) that can produce crotyl alcohol from a substrate in the growth medium and/or via a metabolic pathway in the microorganism. In some embodiments, the enzyme is an alcohol and/or aldehyde dehydrogenase. In some embodiments, the enzyme is an acyl-CoA reductase. In some embodiments, the substrate is crotonaldehyde. In some embodiments, crotyl alcohol is produced via a series of biosynthetic intermediates that include crotonic acid, crotonyl-CoA and/or other intermediates in the butanol/butanoate pathway. In some embodiments, the native enzyme(s) is(are) enzyme(s) in a native butanoate/butanol, fatty acid, amino acid degradation, or related metabolic pathway in the microorganism. In some embodiments, the metabolic pathway includes one or more of an enzyme of a glycolytic or pentose phosphate pathway that converts glucose and/or xylose to acetyl-CoA, a thiolase enzyme that converts acetyl-CoA to acaetoacetyl-CoA, a 3 -hydroxy butyryl CoA dehydrogenase enzyme that converts acetoacetyl-CoA to 3-hydroxybutyryl-CoA, a crotonase enzyme that converts 3-hydroxybutyryl-CoA to crotonyl-CoA, an aldehyde dehydrogenase enzyme that converts crotonyl-CoA to crotonaldehyde, and an alcohol dehydrogenase enzyme that converts crotonaldehyde to crotyl alcohol. In some

embodiments, the microorganism is engineered to produce crotyl alcohol or for improved crotyl alcohol production in comparison to the parent microorganism from which it is derived.

[57] In some embodiments, the microorganism is a Clostridium strain. In some embodiments, the Clostridium microorganism expresses an enzyme, e.g., a native enzyme, that converts crotonaldehyde to crotyl alcohol, for example, an alcohol and/or aldehyde dehydrogenase. In some embodiments, the Clostridium microorganism expresses an enzyme, e.g., a native enzyme, that converts crotonyl-CoA to crotonaldehyde or crotyl alcohol, for example, an acyl-CoA reductase, for example, that converts crotonyl-CoA to crotyl alcohol without additional intervening enzymatic activities.

[58] In some embodiments, the growth medium includes one or more substance(s) that increase production of crotyl alcohol in comparison to a growth medium that does not comprise the one or more substance(s). In some embodiment, the one or more substance(s) includes one or more co-factors of enzyme(s) in a butanoate/butanol metabolic pathway in the microorganism, e.g., Mn, Fe, NADPH, and/or NADP. In some embodiments, the one or more substance(s) modifies (e.g., activates or inhibits) the activity of one or more enzyme(s), e.g. , one or more native enzyme(s), in the microorganism, thereby increasing crotyl alcohol production. In one embodiment bed is inhibited by the one or more substance(s) in the growth medium. In one embodiment, adhE and/or adh2 are activated by the one or more substance(s) in the growth medium. In one embodiment, bed is inhibited by one or more substance(s) in the growth medium and adhE and/or adh2 are activated by one or more substance(s) in the growth medium. In some embodiments, the one or more substance(s) in the growth medium includes one or more divalent metal ion(s) (e.g., from selected from Ca, Co, Zn, and Mn, and combinations thereof), iodoacetamide, myristoyl- CoA, N-ethylmaleimide, and/or palmitoyl-CoA. In some embodiments, the growth medium comprises carbohydrate molecules produced by hydrolysis of lignocellulosic biomass.

[59] In one aspect, an engineered microorganism is provided that produces a greater amount of crotyl alcohol than the parent strain from which it was derived. In some embodiments, the microorganism is a genetically engineered Clostridium strain. In some embodiments, the microorganism (e.g., Clostridium strain) has been engineered to comprise a reduced level or activity of butyryl-CoA dehydrogenase in comparison to the parent strain from which it was derived. In some embodiments, the microorganism (e.g., Clostridium strain) includes overexpression of one or more enzyme(s) of a crotyl alcohol biosynthetic pathway. In some embodiments, the one or more enzyme(s) of crotyl alcohol biosynthesis includes one or more of an enzyme of a glycolytic or pentose phosphate pathway that converts glucose and/or xylose to acetyl-CoA, a thiolase enzyme that converts acetyl-CoA to acaetoacetyl-CoA, a 3 -hydroxy butyryl CoA dehydrogenase enzyme that converts acetoacetyl-CoA to 3-hydroxybutyryl-CoA, a crotonase enzyme that converts 3- hydroxybutyryl-CoA to crotonyl-CoA, an aldehyde dehydrogenase enzyme that converts crotonyl-CoA to crotonaldehyde, and an alcohol dehydrogenase enzyme that converts crotonaldehyde to crotyl alcohol. In some embodiments, the one or more enzyme(s) of crotyl alcohol biosynthesis includes at least one alcohol dehydrogenase. In some embodiments, the microorganism (e.g., Clostridium strain) is an SiHybrid in which butyryl- CoA dehydrogenase activity is downregulated in comparison to the parent strain from which it was derived. In some embodiments, the microorganism (e.g., Clostridium strain) includes a butyryl-CoA dehydrogenase that has been inactivated using a targetron gene knockout system.

[60] In some embodiments, methods are provided for producing crotyl alcohol in an engineered microorganism, e.g., genetically engineered microorganism, e.g., engineered Clostridium strain, as described herein, including growing the microorganism in a growth medium under fermentation conditions suitable for production of crotyl alcohol. In some embodiments, the growth medium includes carbohydrate molecules produced by hydrolysis of lignocellulosic biomass.

BRIEF DESCRIPTION OF THE DRAWINGS

[61] FIG. 1 illustrates an overall process for converting biomass to dienes

[62] FIG. 2 illustrates a high process flow diagram showing the preparation of a promoter and buffer-adjusted dehydration catalyst.

[63] FIG. 3 illustrates a high process flow diagram showing the preparation of a promoter and buffer-adjusted dehydration catalyst that is also silanized.

[64] FIG. 4 illustrates a high level process flow diagram showing the dehydration of an alkenol or diol using the promoter and buffer-adjusted dehydration catalyst in a single reactor system to afford a diene.

[65] FIG. 5 illustrates a high level process flow diagram showing the dehydration of an alkenol or diol using the promoter and buffer-adjusted dehydration catalyst in a two reactor system (i.e. adiabatic) to afford a diene.

[66] FIG. 6 illustrates the acid-catalyzed isomerization of crotyl alcohol to 3-buten-2-ol, and isomerization of 3-buten-2-ol to crotyl alcohol, and dehydration of both crotyl alcohol and 3-buten-2-ol to 1,3-butadiene.

[67] FIG. 7 illustrates a high level process diagram for the conversion of a four carbon alkenol or diol to six carbon monomers.

[68] FIG. 8 illustrates schematically catalytic dehydration of an alkenol to a diene.

[69] FIG. 9 illustrates the chemical structure of crotonyl-CoA.

[70] FIG. 10 illustrates schematically catalytic dehydration of crotyl alcohol to 1,3- butadiene.

[71] FIG. 1 1 illustrates schematically catalytic hydrogenation of 1,3-butadiene to 1- butene.

[72] FIG. 12 illustrates schematically conversion of 1,3-butadiene to other useful products.

[73] FIG. 13 illustrates schematically catalytic dehydration of an alkenol to a diene.

[74] FIG. 14 illustrates schematically catalytic dehydration of a diol to a diene.

[75] FIG. 15 shows the effect of crotyl alcohol addition on w-butanol production in Clostridium fermentations. [76] FIG. 16 shows the effect of crotyl alcohol addition on w-butanol production in Clostridium fermentations.

[77] FIG. 17 shows the effect of crotyl alcohol addition on total solvent production in Clostridium fermentations.

[78] FIG. 18 shows the effect of crotonic acid addition on glucose consumption over time in Clostridium fermentations.

[79] FIG. 19 shows consumption of crotonic acid over time in Clostridium fermentations.

[80] FIG. 20 shows the effect of crotonic acid addition on w-butanol production over time in Clostridium fermentations.

[81] FIG. 21 illustrates schematically biosynthetic pathways in Clostridium.

[82] FIG. 22 illustrates schematically biosynthetic production of crotyl alcohol.

[83] FIG. 23 illustrates schematically a system for genetic engineering.

[84] FIG. 24 shows production of crotyl alcohol from crotonaldehyde in a butanol- producing Clostridium strain.

[85] FIG. 25 shows production of w-butanol with crotonaldehyde spiking at different concentrations in a butanol-producing Clostridium strain.

[86] FIG. 26 shows production of crotyl alcohol from crotonaldehyde in a butanol- producing Clostridium strain.

DETAILED DESCRIPTION

[87] It is to be understood that the foregoing general description and the following detailed description are exemplary and explanatory only and are not to be viewed as being restrictive of the invention, as claimed. Further advantages of this invention will be apparent after a review of the following detailed description of the disclosed embodiments, which are illustrated schematically in the accompanying drawings and in the appended claims.

[88] Methods and catalyst compositions are provided herein for conversion of alkenols (e.g., bio-alkenols) or diols (e.g., bio-diols) to dienes (e.g., bio-dienes). In methods disclosed herein, an aqueous mixture (e.g., a mixture that contains at least one alkenol or diol and water) is contacted with a solid phase catalyst, which produces a product stream containing a diene with high selectivity (e.g., greater than about 90%) and an amount of water equal to the input water (e.g., steam) plus the stoichiometric amount of water (e.g., steam) produced from the dehydration reaction, shown schematically in Fig. 13. [89] Typically, the catalytic reaction is performed at an elevated temperature (e.g., from about 200 °C to about 440 °C). Catalysts that may be used in the methods described herein include but are not limited to Ca⁺² modified inorganic supports, such as Ca⁺²-modified γ- alumina, and can optionally include an organosilane component. Catalyst compositions for use in the methods herein typically include at least one acid component. In some embodiments, Ca⁺² is present at about 0.8 to about 4.0 wt-% of the modified inorganic support.

[90] Catalyst systems and methods of use are provided that effect highly specific regioselective dehydration of alcohols (e.g., bio-alcohols), e.g., alkenols (e.g., bio-alkenols) and diols (e.g., bio-diols), in water-containing mixtures, with retention of selectivity over extended periods of use, commonly referred to as Time On Stream (TOS).

Definitions

[91] The terms "terminal alkene," "a-olefin," "terminal olefin," and "1-olefin" are used interchangeably herein to refer to an alkene with a double bond between the terminal carbon (carbon at the end of a hydrocarbon chain) and the adjacent carbon in the hydrocarbon chain.

[92] The terms "internal alkene," and "internal olefin," are used interchangeably herein to refer to an alkene which is not terminal, i.e., the carbon-carbon double bond is not at the end of the hydrocarbon chain. A "2-alkene" is one example of an "internal alkene".

[93] A "diol," of which 1,3-butanediol is one example, refers to a molecule having two hydroxyl groups (alcohol functional groups) attached to different carbon atoms in the molecule. In one embodiment, a "bio-diol," e.g., "bio-l,4-butanediol" is a diol that is biologically produced (e.g., via a microbial fermentation process). In another embodiment, a "bio-diol," e.g., "bio- 1,3-butanediol" is a diol that is produced from a starting molecule that is biologically produced (e.g., via a microbial fermentation process).

[94] A "diene," of which 1,3 -butadiene is one example, refers to a molecule having two olefinic (carbon-carbon double) bonds. The olefinic bonds may be isolated (e.g., as in 1,5- hexadiene), conjugated (e.g., as in 1,3 -butadiene), or adjacent (allenic, e.g., as in 1,2- butadiene). In one embodiment, a "bio-diene," e.g., "bio-l,3-butadiene" is a diene that is produced from a starting molecule (e.g., an alkenol) that is biologically produced (e.g., via a microbial fermentation process). In some embodiments, a bio-olefin, bio-diene, or biobutadiene is produced from a bio-alkenol that has been produced in a microbial fermentation process from cellulosic biomass (e.g., lignocellulosic biomass) as a starting material.

[95] A "1 -alcohol" or "terminal alcohol" refers, interchangeably, to an alcohol with a hydroxyl group attached to a terminal, primary carbon in the hydrocarbon chain (i.e., a - CH2OH group).

[96] "w-Butanol" and "w-propanol" refer, respectively, to 1-butanol and 1-propanol.

[97] "Bio-M-butanol" or "bio- 1 -butanol" refers to w-butanol that is produced biologically (e.g., via microbial fermentation). In some embodiments, the bio-l-butanol is produced in a microbial fermentation process from cellulosic biomass (e.g., lignocellulosic biomass) as a starting material.

[98] An "alkenol" refers to an olefinic alcohol, i.e., a molecule containing at least one olefinic (carbon-carbon double) bond and at least one alcohol functional group. A "bio- alkenol" is produced biologically (e.g., via microbial fermentation). In some embodiments, the bio-alkenol is produced in a microbial fermentation process from cellulosic biomass (e.g., lignocellulosic biomass) as a starting material. For example 2-buten-l-ol, if derived from biomass, would be considered a bio-alkenol.

[99] 2-Buten-l-ol refers to crotyl alcohol. No assignment of double bond geometry or stereochemistry is assumed or implied. As used herein, "2-buten-l-ol" or "crotyl alcohol" refers to any/all of: cz^'s-2-buten- 1 -ol (Z-2-buten-l-ol), trans-2-butene- 1 -ol (is-2-buten-l-ol), or/and the combination of cis- and ?ra¾s-2-buten-l-ol in any proportion. In some embodiments "bio-2-buten-l-ol" or "bio-crotyl alcohol" refers to biologically produced bio- 2-butene-l-ol (crotyl alcohol), e.g., via microbial fermentation, including via microbial fermentation of biomass (e.g., lignocellulosic biomass). In other embodiments "bio-2-buten- 1 -ol" or "bio-crotyl-alcohol" refers to crotyl alcohol that is produced by a chemical dehydration of a bio-diol that is first obtained from a microbial fermentation process from biomass (e.g., lignocellulosic biomass) feedstock. For example, bio-l,3-butanediol can be dehydrated to form bio-2-buten-l-ol.

[100] For alpha-olefins, alkenes, alcohols, solvents, alkenols, bio-alkenols, and all chemical reagents used in descriptions within this document, IUPAC and/or standard organic chemical nomenclature accepted by the American Chemical Society (ACS) takes priority and is used to the best ability to match common nomenclature.

[101] "Biofuel," "biolubricant," or "bio-l,3-butadiene" refers to a fuel, a lubricant, or 1,3- butadiene, respectively, that is produced from at least one biologically-produced starting molecule or at least one starting molecule in which at least one carbon atom is derived from a biological material, for example, cellulosic (e.g., lignocellulosic) biomass. Also the direct biological conversion of carbon dioxide and/or carbon monoxide is considered also defined as a viable route to bio-alkenols or bio-diols. In one embodiment, a biofuel, biolubricant, or bio- 1,3 -butadiene may be produced from a bio-alkenol that is produced by a biological process as described herein.

[102] A "bio-" prefix is used to indicate a molecule or class of molecules, for example bio-alkenes or bio-alkenols, that are produced from at least one starting molecule in which at least one carbon atom is derived from a biological material, for example, cellulosic (e.g., lignocellulosic) biomass.

[103] "Regioselectivity" refers to selective formation of one olefin product over another. For example, formation of 90 mol-% terminal (1 -olefin) and 10 mol-% internal (e.g., 2- olefin) would be described as 90% regioselectivity for the terminal olefin product.

[104] "Selectivity" refers to product selectivity if not otherwise defined.

[105] "Chemical Yield" and "Yield" refer to are calculated by multiplying the conversion (percent) by the selectivity (percent). For example, if reaction A that has a 90% conversion with a 90% selectivity for product X, then product X has a 81% yield in reaction A.

[106] "Incipient Wetness Impregnation" (IWP) is a technique that is used to modify a support material by treating the solid material with a predetermined amount of a solution containing at least one desired modifier (e.g., calcium acetate), sufficient to wet the solid surface and fill the pore-volume, this followed by removal of some or all of the solvent (e.g., by some method of evaporation) thus depositing the modifier uniformly on the support material.

[107] "Weight Hourly Space Velocity" (WHSV) is determined by dividing the weight of alcohol feed delivered per hour by the weight of catalyst used. For example, if 1.5 kg/hr of terminal alcohol are fed to a reactor containing 500 grams of catalyst, the WHSV is 3.0 hr¹. The alcohol feed rate, in units of WHSV, as defined herein, is independent of the amount of water, or other components that may be in the feed, or co-fed to the catalyst bed.

[108] "Buffer-Adjusted Anions" refers to a mixture of anions in a pH buffer solution. For example a sulfuric acid buffer will contain HSO4^"1 and SO4^"2 anions as part of the buffer solution. The required cations are chosen in the process of making the buffer solution.

[109] "Ph" herein refers to a phenyl (C6H5-) group.

[110] "Me" herein refers to an methyl (CH3-) group.

[Ill] "Et" herein refers to an ethyl (CH3CH2-) group.

[112] "Ac" herein refers to an acetate (CH3COO-) group. [113] "EFT X" in Figs. 24-26 refers to elapsed fermentation time of X hours. Catalyst compositions and methods of preparation

[114] One embodiment for the dehydration catalysts disclosed herein is an inorganic support modified by contact with one or more promoter-containing compound(s), e.g., a Ca²⁺-containing compound. In one embodiment, a promoter (e.g., a calcium-containing compound) is delivered as a solution to the inorganic support using incipient wetness impregnation. In another embodiment, a promoter (e.g., a calcium-containing compound) is delivered by spraying a promoter-containing (e.g., calcium compound-containing) solution onto an inorganic support while the latter is carried on a belt system or is mixed in a rotating drum. In a further embodiment, vapor phase deposition is used to deposit promoter(s) on an inorganic support. Solvents used to prepare the promoter solution may be aqueous, or one or more organic solvent(s), or a mixture thereof. Nonlimiting examples of calcium-containing compounds that may be used for production of the catalysts described herein include Ca(S0₄), Ca(HS0₄)₂, Ca₃(P0₄)₂, Ca(HP0₄), or Ca(H₂P0₄)₂, any one of which may be available and used in more hydrated, or more dehydrated, or more condensed forms, than suggested by the chemical formulas cited here. Other calcium and Group 2 compounds, or Group 1 compounds, or Group 3 compounds, or Group 4 compounds, or rare earth compounds may be employed for this purpose as promoters.

[115] In addition to one or more promoter(s), the catalyst compositions disclosed herein include one or more "Buffer-Adjusted Anion(s)" (BAA). The selected anion, or mixture of anions, incorporated into the catalyst with the chosen promoter or mixture of promoters, improves the selectivity of the dehydration. The counter cations that accompany one or more BAA may include promoter(s) that are advantageous for the dehydration reaction, for example Ca⁺², or they can include a mixture of solely Group 2 or solely Group 1 metal cations, or a mixture of both Group 1 and Group 2 ions. In some embodiments, the BAA includes phosphate-containing ions or sulfate-containing ions, which have a well- established history of use in preparing aqueous buffer solutions. Nonlimiting examples of BAA include sulfate (S0₄ ^~2) and dihydrogenphosphate (H₂P0₄ ^_1) anions.

[116] In another embodiment, BAA is added as counter anion to the promoter using at least one Group 1 or Group 2 metal counter cation, in which case provision is also made to provide a buffering quantity of the conjugate acid of the BAA. For example, where the BAA is dihydrogenphosphate (H₂P0₄ ^_1), the conjugate acid (H3P0₄), is also supplied, as exemplified by "Catalyst 4," described in Example 10, infra. The promoter metal ion concentration may be maintained at about 0.5 wt-% to about 4 wt-% of the inorganic (e.g., oxide) support. Suitable BAA include those anions wherein the pKa of the conjugate acid of the BAA falls in the range of zero to about 3. One non-limiting example of a suitable BAA for this embodiment is sulfate ion, whose conjugate acid, hydrogen sulfate ion (HSO4^" ^l), has a pKa of about 2, between zero and about 3. Having selected SO4 ² according to the criterion that the pKa of the conjugate acid falls within the range of zero to about 3, the conjugate acid (HSO4 ¹), and the corresponding free acid (H2SO4), in combination with the selected anion(s), may be used to prepare the catalyst.

[117] The BAA may be delivered I the form of its conjugate acid. For example, in a catalyst where sulfate (SO4 ²) is among the selected BAA(s), the catalyst may be formulated using NaHS04 (where HSO4^"1 is the conjugate acid of SO4 ²), as in "Catalyst 2," described in Example 8, infra. Regardless, for a selected BAA, the catalyst is formulated using a source of the conjugate acid of the BAA, or another acid with a pKl within the range of zero to about 3. For example, in the case that the selected BAA is SO4 ², a source of the conjugate acid, HSO4^"1, may be supplied, or H3PO4, another acid with a pKa within the range zero to about 3, may be supplied. The conjugate acid of the BAA may be supplied directly, or by a suitable combination of anions, and corresponding charge balancing cations. For example, where the BAA is SO4^2", the conjugate acid may be delivered directly as a HSO4^"1 salt (including Group 1 or Group 2 elements, such as NaHSCn or Ca(HS04)2), or by a combination of H2SO4 and a SO4^2" salt (including Group 1 or Group 2 elements, such as L12SO4 or CaSCn).

[118] In some embodiments the free-acid, for example, H3PO4 or H2S04, is added as part of the BAA solution. Further, it is understood that, depending upon several factors, including the relative ratios of selected BAAs, the relative amounts of selected promotors, the surface properties of the selected inorganic support, and the composition of the diol or alkenol feed to the dehydration catalyst, during catalyst operation a portion of the BAAs present in the original catalyst formulation may be present as the corresponding free acid, i.e., the counter cation(s) will be protons (H⁺ ions). There is no requirement that all the BAAs, or their corresponding conjugate acids, are charge-balanced exclusively by promotor cations, either in the catalyst as-synthesized, as-formulated, as-charged to the dehydration reactor, or in-use. For example, even though the BAA SO4^"2 ion may be delivered using the sodium salt of the conjugate acid, HSO4^"1 (NaHSCn), as described above, in which case the counter cation is a promoter (Group 1), alternatively the HSO4^"1 may be delivered as H2SO4 or (NH4)HS04. It is understood and expected that a portion of the BAAs may be effectively present in the buffered catalyst as the corresponding free acid, e.g., H2SO4, if HSO4^"1 or SO4^"2 are among the anions in the catalyst formulation.

[119] In one embodiment of a catalyst composition disclosed herein, the inorganic support is γ-alumina, the Group I element is Na, the buffer-adjusted anion is sulfate (SO4 ²), and the catalyst is formulated using the sodium salt of the conjugate acid of the buffer-adjusted anion, NaHSC .

[120] In one embodiment of a catalyst composition disclosed herein, the inorganic support is γ -alumina, the Group 2 element is Ca, the buffer-adjusted anion is dihydrogenphosphate (H2PO4 ¹), and the catalyst is formulated using a mixture of the Ca salt of the buffer- adjusted anion [Ca(H2P04^_1)2xH20] and the conjugate acid of the buffer-adjusted anion

[121] In one embodiment of a catalyst composition disclosed herein, the inorganic support is γ -alumina, the Group 2 element is Ca, the buffer-adjusted anion is dihydrogenphosphate (H2PO4 ¹), the catalyst is formulated using a mixture of the Ca salt of the buffer-adjusted anion [Ca(H2P04^_1)2xH20] and the conjugate acid of the buffer-adjusted anion (H3PO4), and organosilane is diethoxydiphenylsilane, delivered to the catalyst from a solution in ethanol.

[122] In some embodiments, a promoter (e.g. , Ca⁺²) buffer-adjusted mixture is dissolved in one or more solvent(s) to create a solution, the promoter (e.g., Ca⁺²) solution is placed in contact with the carrier (e.g., x-alumina), and the solvent(s) is (are) then removed, e.g., with heat and/or reduced pressure. Those experienced in the methods of surface modification know that one technique to accomplish this is referred to as incipient wetness impregnation (IWP). IWP is typically followed by a calcination process of some time, as shown schematically in FIG 2. The inorganic support (200) is added to vessel 201 and then addition of the IWP solution 202, which includes promoter (e.g., Ca²⁺) and BAA, is done in such a way as to provide even distribution. This can be done, for example, by adding solution 202 by a spraying method. Mechanical mixing in apparatus 203 can also be used facilitate even distribution of the promoter solution. The wetted material in 203 is then heated to remove some or all of the IWP solvent. This material 204 can be further heated in a second apparatus (205) to provide calcination of the catalyst. The calcination can be carried out in vessel 203 or 205 at temperatures of about 100 °C to about 900 °C, or about 200 °C to 600 °C, for a time period of about 1 hour to about 8 hours, or about 2 hours to 6 hours. The removal of the solvent can be done in air or under an inert atmosphere. In one embodiment the wetting solution is removed under a reduced pressure. The catalyst removed from 203 or 205 can be sized by sifting or other methods common to solid phase catalyst processing, thus producing finished catalyst 206. The concentration of Ca⁺² in the solution is predetermined in such a way that a targeted amount of Ca⁺² is deposited on the carrier (e.g., alumina) surface. In some embodiments, the Ca⁺² is deposited in the range of about 0.8 wt-% to about 4.0 wt-% or about 1.0 wt-% to 1.7 wt-% of the total catalyst {weight of Ca⁺²/(weight of inorganic support + weight of Ca⁺²) x 100 = wt-%}. Delivery of the calcium and the buffer-adjusted anions can also be made using other techniques such as, non-IW impregnation or, for example, vapor deposition followed by calcination in air or under an inert atmosphere. In some embodiments, all of the modifications are carried out on the final shape or sized support material.

[123] In some embodiments, the promoter-doped (e.g., Ca⁺²) and buffer-adjusted inorganic support (e.g., γ-alumina) can be further modified by treatment with one or more organosilane(s). Treatment with organosilane(s) may provide a catalyst with improved stability for the dehydration of alcohols. In some embodiments, the organosilane(s) can be delivered to the inorganic support (e.g., a Ca⁺² and buffer-adjusted modified y-alumina carrier) using IWP, as shown in a high level and general view in FIG 3. In this

embodiment the calcium-modified buffer-adjusted inorganic support 206 is treated with the IWP solution 301 in such a way as to provide even distribution. This can be accomplished by spraying the organosilane(s) or a solution containing organosilane(s) 301 while mechanically mixing the promoted carrier in vessel 302. The mixing process can greatly facilitate achieving an even distribution of the organosilane(s). However, it is not always necessary. The wetted material in apparatus 302 is then heated to remove some or all of the IWP solution and/or can be transferred to vessel 303 for further drying under ambient or reduced pressure. The catalyst (304) can be formulated, shaped, and sized by sifting or other methods common to solid phase catalyst processing. In one embodiment, a shaped or sized support (e.g., 206) may be used in the modification process, hence providing the catalyst 304 in an advantageous physical state (e.g., shape or particle distribution).

[124] An organosilane solution 301 used to modify the carrier, e.g., by IWP, can be made using water, one or more organic solvent(s), or a mixture of water and organic solvent(s) with or without additional additives. In one embodiment, the solvent is selected so that sufficient organosilane is soluble in the chosen solvent to deliver the required amount of organosilane to the solid by incipient wetness. Typical concentration of organosilane(s) when used in a IWP solvent is about 0.05 wt-% to about 4 wt-%, about 0.1 wt-% to about 0.2 wt-%, about 0.15 wt-% to 1.5 wt-%, or 0.3 wt-% to 1.3 wt-% total organosilane concentration. In another embodiment, the organosilane(s) can be delivered in neat form, for example, as a liquid or in the vapor phase. Contact time for the neat organosilane(s) or organosilane-IWP solution with modified carrier may be about 5 minutes to about 6 hours, about 1 hour to about 6 hours, or about 2 hours to about 4 hours, thus allowing for complete dispersion and reaction, at or about ambient temperature (e.g., about 20 °C to about 30 °C). Solvent(s) removal may be accomplished by the application of heat and/or reduced pressure. The typical final temperature reached is about 40 ° C to about 200 °C, about 300 °C, or about 400 °C. Removal of the solvent(s), if used, can be done in air or under an inert atmosphere (e.g., nitrogen or argon).

[125] Typical organosilanes for use in the catalyst preparation methods disclosed herein include, but are not limited to, chlorosilanes, for example, Ph2SiCh and PhsSiCl. In some embodiments, alkoxysilanes may be used. For example, organosilanes such as PhsSiOEt and Ph2Si(OEt)2 can also be used to create a silanized-dehydration catalyst. Furthermore, R3S1X, R2S1X2, and RS1X3 organosilanes can be used, where R is a mixture of aryl and alkyl radicals and X represents a leaving group. The R-groups can be the same or a combination of alkyl, aryl, or organic functionalized substituents. Typical leaving groups include, but are not limited to, halide, alkyl carboxylate (e.g., acetate), alkoxy (e.g.

methoxy), or alkyl di- (e.g., oxalate) and tri-carboxylates (e.g., citrate).

[126] In some embodiments, water soluble organosilane(s) are employed in the silanization process (e.g., treatment of the support with an organosilane solution and calcining). For these embodiments, the organosilane(s) may be soluble in water, for example, at levels of up to about 3 wt-%. The water solubility can be achieved by the use of hydrogen bonding groups attached to the silicon atom [e.g. PhSi(OH)3] or by

incorporation of a hydrogen bonding group or a dipolar functional group to one or more of the groups attached to the silicon atom. Examples could include, but are not limited to, an alkyl amine, ether, epoxide, or other dipolar or hydrogen bonding functional groups. In some embodiments, solubility of the organosilane(s) can be increased by heating a water solution to at least about 40 °C, about 50 °C, about 60 °C, or about 90 °C.

[127] The effect and benefit of silanization is dependent upon the carrier used, alkenol or diol feed, and the wt-% of water content added or contained in the alcohol feed. Typically, reaction conditions employing high water concentrations ( e.g., >50 wt-%) in the feed may exhibit the greatest benefit from silanization of the catalyst and afford very stable dehydration catalysts. Silanization of calcium promoted, or Group 1, or Group 2, or other promoted modified aluminas provides a catalyst that provides enhanced stability, which is reflected in retention of selective diene (e.g., bio-diene) production as disclosed herein. The process of silanization can be applied to aluminas (e.g., γ-alumina) or other inorganic supports (e.g., zinc aluminate) modified with Group 3, or Group 4, or Group 5, or Group 6, or Group 7, or Group 8, or Group 9, or Group 10 metals.

[128] Catalyst products 206 and 304 may be left as powders, for example, in the range of about 10 to about 1000 microns, or about 50 to about 200 microns, or they can be pelletized or shaped using techniques common to those skilled in the art. In some embodiments, pellets and shaped particles may provide advantages in controlling the pressure drop across the catalyst reactor bed. This may be important where physical process requirements require long reaction tubes or where low head-pressures are desirable. Pellets may be any shape or size. In some embodiments, pellet diameters are about 1/16 inch to about ¼ inch, with lengths about 1 to about 10 times the diameter, or about 2 to about 4 times the diameter. One embodiment includes first shaping, or pelletizing, or crushing with size selection (e.g. sieving), of the support, followed by the addition of at least one promoter as described herein.

Dehydration Methods

[129] The catalyst compositions described herein may be used to dehydrate alkenols (e.g., bio-alkenols) or diols (e.g., bio-diols), to produce diene (e.g., bio-diene) products. In one embodiment, catalyst compositions disclosed herein may be used to dehydrate crotyl alcohol (e.g., bio-crotyl alcohol) to 1,3-butadiene (e.g., 1,3-bio-butadiene). In some embodiments, the catalyst compositions disclosed herein may be used to dehydrate alkenols or diols in the presence of water.

[130] In methods for dehydration of a alkenol or diol using the catalyst compositions disclosed herein, the water content in the initial alkenol (e.g., bio-alkenol) or diol (e.g., bio- diol) mixture (alkenol-water or diol-water mixture) that is fed to the catalyst can be from about 0.1 wt-% to about 93 wt-%, about 1 wt-% to about 70 wt-%, about 10 wt-% to about 50 wt-%, about 15 wt-% to about 19 wt-%, or about 17 wt-%. The water in the alkenol or diol feed can be contained in an alkenol-water mixture or diol-water mixture, or added using a second and separate feed, or may be a combination of the two {e.g., total water in feed = (alkenol or diol + water mixture) + water feed}. In some embodiments, additional water is added to the alkenol-water or diol-water mixture prior to contact with the catalyst, thereby producing an alkenol or diol feed that contains about 30 wt-% to about 93 wt-% of water, or about 45 wt-% to about 70 wt-% of water. The use of high water content in the alkenol or diol feed is especially well tolerated with catalysts prepared as disclosed herein. In some embodiments, the alkenol or diol feed in contact with the catalyst (e.g., optionally including additional water added to the alkenol-water or diol-water mixture prior to entering the reactor and/or water added separately into the reactor) includes about 1 wt-% to about 70 wt-% water for optimum production of diene (e.g., bio-diene), e.g., 1,3-butadiene (e.g., bio- 1, 3 -butadiene). In some embodiments, the alkenol or diol feed includes >90 wt-% water. In some embodiments, the water content in the alkenol or diol feed is about 1, about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, or about 93 wt-% or more. In some embodiments, the water content in the alkenol or diol feed is about 15 to about 20 wt-%, about 15 to about 70 wt-%, or about 50 to about 80 wt-%. The diene (e.g., bio-diene) product stream of the reaction may contain an amount of water as described above in this paragraph (e.g., about 0.1 wt-% to about 93 wt-%), or values or subranges described above that are greater than the stoichiometric amount of water that is produced in the dehydration reaction.

[131] Catalysts disclosed herein may dehydrate wet alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) mixtures that contain large amounts of water. In some embodiments, steam may be added prior to contact with the catalyst to afford high selectivity for the diene (e.g., bio-diene) dehydration product. Furthermore, in some embodiments, a high selectivity may be maintained for extended periods of time on stream, for example, about 1 month to about 3 months, about 6 months, about 12 months, about 18 months, about 24 months, about 30 months, about 36 months, about 42 months, about 48 months, or longer.

[132] Catalysts disclosed herein may also dehydrate an alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) mixture that contains water at levels as low as 1 ppm to 1000 ppm where equal performance of catalyst to afford diene (e.g., bio-diene) product is observed throughout the entire range of low water content and the catalyst can maintain high selectivity for extended periods of time on stream, for example, about 1 month to about 3 months, about 6 months, about 12 months, about 18 months, about 24 months, about 30 months, about 36 months, about 42 months, about 48 months, or longer.

[133] In one embodiment of a method for dehydrating an alkenol or diol to a diene as described herein, the alkenol is crotyl alcohol, the diene is 1,3-butadiene, the inorganic support is γ-alumina, the Group 1 element is Na, the buffer-adjusted anion is sulfate (SO4² ), and the catalyst is formulated using the sodium salt of the conjugate acid of the buffer- adjusted anion, NaHS0₄.

[134] In one embodiment of a method for dehydrating an alkenol or diol to a diene as described herein, the alkenol is crotyl alcohol, the diene is 1,3 -butadiene, the inorganic support is γ -alumina, the Group 2 element is Ca, the buffer-adjusted anion is

dihydrogenphosphate (Η₂Ρ0₄ ^_1), and the catalyst is formulated using a mixture of the Ca salt of the buffer-adjusted anion [Ca(H₂P0₄ ^_1)₂xH₂0] and the conjugate acid of the buffer- adjusted anion (H3P0₄).

[135] In one embodiment of a method for dehydrating an alkenol or diol to a diene as described herein, the alkenol is crotyl alcohol, the diene is 1,3 -butadiene, the inorganic support is γ -alumina, the Group 2 element is Ca, the buffer-adjusted anion is

dihydrogenphosphate (Η₂Ρ0₄ ^_1), the catalyst is formulated using a mixture of the Ca salt of the buffer-adjusted anion [Ca(H2P0₄ ^_1)2xH20] and the conjugate acid of the buffer-adjusted anion (H3P0₄), and organosilatne is diethoxydiphenylsilane, delivered to the catalyst from a solution in ethanol.

[136] An example of a catalytic alkenol or diol dehydration process as disclosed herein is shown schematically in FIG 4. An alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) feed 400 is introduced to the vaporization/mixing vessel (401) to which a water feed is added at some preselected amount. The output of 401 is transferred to vessel 403, which contains the dehydration catalyst (e.g., 206 or 304 prepared above) at an elevated temperature, for example, about 200 °C to about 440 °C, or about 250 °C to about 420 °C. Optionally, a purge (e.g., carrier) gas, e.g., an inert gas such as argon and/or nitrogen, may used to control dwell time in the reactor chamber. Temperature may be modified to optimize diene (e.g., bio-diene), e.g., 1,3-butadiene (e.g., bio-l,3-butadiene), production for a particular alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) feedstock. In some embodiments, the rate of alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) feedstock passage is about 0.3 to about 10 mass units of feedstock per mass unit of catalyst/h (i.e., 0.3 to 10 WHSV), or about 1.2 to about 2.0 WHSV, or may be greater than about 1 and less than about 6 WHSV in some embodiments. In some embodiments, water content in the alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) feedstock in contact with the catalyst in the reactor 403 (water in the alcohol (alkenol or diol) feed entering the reactor, and optionally additional water added to the feed and/or added separately into the reactor) is about 1 ppm (i.e., 0.0001 wt-%) to about 93 wt- %. The output from apparatus 403 is fed to a cooling/condenser system 404. The output from 404 is transferred to a decanter where an aqueous solution 407 separates from the diene product 405. The isolated water product 407 (after decanting or distillation to create the isolated alkene 406) may be optionally passed through a filter material, and/or one or more other unit operations 408 to remove traces of organic acids or other unwanted byproducts that may be produced during the dehydration reaction, thereby producing a purified water stream 402. Optionally, the water stream 402 may be added to the alkenol or diol feed in 401.

[137] In some embodiments, the alcohols (e.g., bio-alcohols) (alkenols (e.g., bio-alkenols) or diols (e.g., bio-diols)) that may be selectively dehydrated to produce dienes (e.g., bio- dienes) with the catalyst compositions and methods disclosed herein may include at least one additional organic functional group. Non-limiting examples of such organic functional groups include, but are not limited to, aromatic (e.g., with an aromatic ring that consists of carbon atoms or contains a mixture of carbon and heteroatoms), nitrile, alkene, or ketone functional groups. In some embodiments, the alcohol is a terminal alcohol. In other embodiments, the alcohol is not a terminal alcohol (e.g., 2,3-butanediol).

[138] In some embodiments, diols are used in the dehydration methods disclosed herein. Nonlimiting examples include 1,3-butanediol, 1 ,4-butanediol, 2,3-butanediol, 1,4- pentanediol, 1,3-pentanediol, 2,4-pentanediol, 1,6-hexanediol, 1,5-hexandiol, 2,4- hexanediol, 1,3-hexanediol. In one embodiment, an aqueous solution of 1,3-butanediol (e.g., containing from about 5 to about 95 wt-% of the diol) is dehydrated in a double dehydration to afford 1,3 -butadiene, shown schematically in Fig. 14.

[139] In some embodiments, alkenols are used in the dehydration methods disclosed herein. A nonlimiting example is 2-butene-l-ol. In some embodiments of the methods disclosed herein, the 1-alkenol is an alcohol of general formula R^CF^CHCEkOH, where R¹ and R² are independently H or a Ci to C20 alkyl radical, or contain one or more aromatic rings containing exclusively carbon or a mixture of carbon and heteroatoms, or a nitrile, or an alkene, or a carboxylic acid, or ketone functional group, or a combination thereof.

[140] In some embodiments, the alkenol or diol may be a C3 to C12 alcohol, e.g., 1,12- decanediol.

[141] The diene produced in some embodiments of the methods disclosed herein may be 1,3-butadiene (e.g., bio- 1,3 -butadiene).

[142] The input steam may be useful in double dehydration reactions that form a terminal olefin that is in conjugation with a second olefin bond (e.g. 1, 3 -butadiene). Conjugated dienes are generally more reactive and thus less stable. Dilution with solvent is commonly used to slow their decomposition/polymerization chemistry.

[143] In some embodiments of the dehydration methods disclosed herein, the alkenol or diol and water are heated to about 200 °C to 400 °C and then contacted with the dehydration catalyst. In some embodiments, the alkenol is crotyl alcohol. In one embodiment, the catalyst is "Catalyst 2," described infra in Example 8. In one embodiment, the catalyst is "Catalyst 2," described infra in Example 8, and the alkenol is crotyl alcohol. In one embodiment, the catalyst is "Catalyst 4," described infra in Example 10. In one embodiment, the catalyst is "Catalyst 4," described infra in Example 10, and the alkenol is crotyl alcohol. In one embodiment, the catalyst is "Catalyst 5," described infra in Example 12. In one embodiment, the catalyst is "Catalyst 5," described infra in Example 12, and the alkenol is crotyl alcohol. The exiting product stream may be at a temperature of about 150 °C to about 350 °C. In embodiments of the dehydration methods disclosed herein, the final product stream may contain about 10 mol% alkenol or diol or less (based on alkenol or diol fed; corresponding to about 90 mol%, or greater, alkenol or diol conversion), about 5 mol% alkenol or diol or less (based on alkenol or diol fed; corresponding to about 95mol%, or greater, alkenol or diol conversion), or less than about 0.5 mol% alkenol or diol (based on alkenol or diol fed; corresponding o about 99.5 mol%, or greater, alkenol or diol conversion). Embodiments of the methods disclosed herein may produce the diene product with about 90% to about 98% or greater selectivity for the diene.

[144] The alkenol or diol dehydration methods disclosed herein may be operated in either isothermal or adiabatic configurations.

[145] In a further embodiment, the dehydration method may include at least two reactors in sequence, with the same, similar, or better performance and yield as the single reactor system. Having the catalyst in more than one reactor can eliminate the need for external heating of the commercial reactors. Heating large commercial reactors in an isothermal manner can be cost prohibitive. In some embodiments, the product stream from the catalytic dehydration reaction (e.g., 403) is then heated again to about 200 °C to about 400 °C and contacted with a second reaction vessel containing dehydration catalyst. An example of a two-reactor process is shown schematically in FIG 5. The alkenol or diol feed 500 is added to the vaporization/mixing vessel 501 and a water feed is also added at some preselected amount. The output of 501 is transferred to the first catalyst vessel 503 which contains the dehydration catalyst (e.g., 206 or 304, prepared as described above). The output from 503 is reheated in inter-stage heater 504 and fed to a second catalyst vessel 505. Vessel 503 and 505 typically do not have an external source of heat applied. The product stream from 505 is taken to a cooling/condenser system 506. The output from 506 is transferred to a decanter where an aqueous solution 508 separates from the diene product 507. The product diene 509 may be removed, and the aqueous solution 508 can be passed through a filter and/or one or more other unit operations 510 to remove traces of organic acids or other unwanted byproducts that can be produced during the dehydration reaction, thereby producing a purified water stream 502. Optionally, the water stream 502 may be added to the alkenol or diol feed in 501. For those skilled in the art, this process is commonly denoted as an "adiabatic reactor" and, in some embodiments, provides the most economical and energy efficient means of dehydrating a bio-alkenol. In calculating a WHSV, the weight of alcohol feed per hour is divided by the weight of catalyst contained in both reactors. Thus in the system described above with two reactors, each separate reactor will appear to have a WHSV equaling twice that of the overall process WHSV (feed to process/total catalyst, where total catalyst is reactor 1 + reactor 2; assuming, for the explanatory case described here, that each of reactor 1 and reactor 2 is charged with the same amount of catalyst).

[146] In some embodiments of the methods disclosed herein, a device for separation of the diene product from water (e.g., an aqueous solution that contains water and other components, for example, trace organic acids and/or other byproducts) is provided. For example, water may be separated from the diene product stream by fractionation through a distillation column. In some embodiments distillation may include injecting nitrogen, steam, or other volatile inert (e.g., steam-stripping of the product stream as part of the separation process). In some embodiments where the product stream includes 1,3- butadiene, the diene is recovered using methods that include steam- or nitrogen-stripping of the product stream. Alternatively, physical separation of layers can be used under conditions where the diene is a liquid, for example, when the diene product contains a sufficiently high boiling point, for example, boiling at a temperature above about 30°C. In this case, separation may optionally be achieved with a decanter (405/407 or 507/508, as shown schematically in FIG 4 or FIG 5, respectively). The diene product will typically be the top layer formed upon condensation and is typically siphoned from the top of the decanter vessel with the separated aqueous layer (i.e., typically bottom layer) drained (e.g., continuously drained) from the bottom layer (e.g., 407, 508). The separated aqueous layer (e.g., 407, 508) can optionally be filtered to remove impurities and the water recycled for addition to the alkenol or diol feed. Alternatively, the diene may be recovered by liquid- liquid extraction techniques known in the art. In some embodiments where the product stream includes 1,3 -butadiene, the diene is recovered using methods that include liquid- liquid extraction.

[147] In some embodiments, the alkenol or diol/input steam is introduced to the catalyst reactor (e.g., 503 or 403) at about 1 psig to about 200 psig, about 5 psig to about 150 psig, or about 15 psig to about 100 psig. In certain embodiments, the exit pressure from the catalyst reactor(s) can be controlled by at least one back pressure regulator located on the exit side of the reactor. An increase in pressure can be useful although in some embodiments, this does not lead to an increase in the rate of dehydration (e.g., an increase in WHSV at a given temperature).

[148] Although not wishing to be bound by theory, it is well known that under certain conditions, crotyl alcohol may undergo isomerization to form 3-buten-2-ol [see, e.g., U.S. Patent No. 2,373,956]. In catalytic dehydration of crotyl alcohol, isomerization of crotyl alcohol may be concurrent with dehydration. Under conditions of contact with the dehydration catalyst, isomerization of crotyl alcohol to 3-buten-2-ol may occur, in which case some of the diene product will be a result of the direct dehydration of 3-buten-2-ol, in the case that the dehydration catalyst is competent for 3-buten-2-ol dehydration to diene(s). These reaction pathways are shown schematically in FIG 6.

[149] In some embodiments a diene product produced as described herein can be utilized to make a drop-in diesel or jet fuel (e.g., biofuel) or a lubricant (e.g., biolubricant) in an energy-efficient manner. The term "drop-in" is used to indicate the new fuel prepared from the diene product can be used in commercial or military applications without the need for equipment changes or modifications. For example, the new fuels can meet the requirements of ASTM D1655 (via ASTM D7566), the standard for turbine fuels. Thus, the new fuels can be fully compatible with existing petroleum fuel standards, be used in commercial aircraft, and therefore be considered "drop-in fuels."

[150] In one embodiment, the methods taught herein may be utilized for conversion of an alkenol (e.g., crotyl alcohol) or a diol that is produced biologically, for example, in a microbial fermentation process (e.g., bio-crotyl alcohol), containing small to large amounts of water, for example, water from the fermentation broth and optionally additional added water, to a diene (e.g., 1,3 -butadiene) with high selectivity and chemical conversion. The 1,3 -butadiene in turn is useful in preparing products that are environmentally beneficial and reduce greenhouse gases compared to petroleum equivalents by virtue of the biological production of the alcohol and an energy efficient process of making the downstream products.

[151] An example of a method for making 6-carbon monomers from a four-carbon alkenol or diol as the starting material is shown schematically in FIG 7. The alkenol or diol feed 700 is added to the vaporization/mixing vessel 701 to which water feed 702 is added at some preselected amount. The output of 701 is transferred to the catalyst vessel 703 which contains the dehydration catalyst (e.g., 206 or 304, prepared as described above). The output from 703 is fed to a cooling/condenser system (704). The output from 704 is transferred to a decanter where an aqueous solution 707 separates from the diene or bio- diene product 705. The aqueous solution 707 can be passed through a filter 708 and/or one or more unit operations to remove traces of organic acids or other unwanted byproducts that can be produced during the dehydration reaction, thereby producing a purified water stream 702. Optionally, the water stream 702 may be added to the alcohol feed in 701. The diene product 705 is fed to a dryer (709) (e.g., a vessel charged with a dessicant medium, such as molecular sieves or similar inorganic drying agent) and subsequently undergoes a catalyzed double hydrocyanation to afford a product stream of adipoylnitrile (710). The product in 710 is fed to a hydrolysis reactor (712) to afford adipic acid (713) or reduced with hydrogen using a catalyst in reactor (713) to afford the products hexamethylene diamine (714).

[152] In embodiments of the dehydration methods disclosed herein in which the alkenol or diol is produced biologically (e.g., bio-l-alkenol or bio-diol), contaminants (e.g., organic contaminants) may be present in the alcohol-water mixture (e.g. , from fermentation broth), including but not limited to, esters, aldehydes, and/or ketones. Such contaminants can be tolerated in the dehydration reactions disclosed herein at various levels depending upon the alkenol (e.g., bio-alkenol) or diol (e.g., bio-diol) feedstock used. In some embodiments, up to about 0.5 wt-%, or up to about 5 wt-% contaminants (e.g., organic contaminants) may be tolerated, for example, when crotyl alcohol (e.g., bio-crotyl alcohol) is the starting material.

[153] In some embodiments of the methods disclosed herein, removal of final traces of water and oxygenated organics (e.g., ethers, aldehydes, and/or aldol-type products) from the diene (e.g., bio-diene) product can be accomplished by passing the diene stream through a fixed bed of separation media, for example, activated alumina, molecular sieves, Celite, activated charcoal, size-exclusion type of media (e.g., selective gas permeation membranes), or a combination thereof. For example, the media may be contained in a vessel shown schematically in FIG 7 as dryer 709. In some embodiments, reactivation of the fixed-bed materials may be possible by heating under a purge of hydrocarbon or inert gas while heating to temperature of about 50° to about 200° C, or about 100° C. In one embodiment, a series of membranes and/or bed of ionic-liquids that are well known for permitting selective passage of non-polar molecules and retaining more polar organics (e.g., ethers and alcohols) can be used to dewater the diene product.

Biological production of alkenols and diols

[154] In some embodiments, alkenols and/or diols may be produced via microbial fermentation. The alkenol and/or diol products may be catalytically converted to diene products as described herein. In some embodiments, alkenol and/or diol products may be at least partially separated from the fermentation medium and dehydrated to produce diene products using catalyst compositions as described herein.

[155] In some embodiments, a microorganism that is used for production of alkenol(s) and/or diol(s) has been modified to produce a greater amount of the alkenol(s)and/or diol(s) than the parent microorganism from which it is derived. In other embodiments, a microorganism is used that produces the alkenol(s) and/or diol(s) via existing (e.g., native) enzyme(s) and/or biosynthetic pathways. In some embodiments, the microorganism is a Clostridium strain.

[156] In some embodiments, microbial production of crotyl alcohol is achieved through the ability of the native promiscuous alcohol dehydrogenase (adhE, adhe2) in a

microorganism, e.g., a Clostridium strain, to convert crotonyl-CoA to crotonaldehyde. In some embodiments, microbial production of crotyl alcohol is achieved through the ability of the native promiscuous alcohol dehydrogenases (adhE, adhE2, bdhAB) to convert the crotonaldehyde to crotyl alcohol.

[157] In some embodiments, microbial production of crotyl alcohol is achieved through the deletion or inactivation of the butyryl-CoA dehydrogenase (bed) and/or crotonyl-CoA reductase gene, or similar genes that are a part of butanoate/butanol, fatty acid, and amino acid degradation pathways in a microorganism., e.g., a Clostridium organism.

[158] In some embodiments, the production of crotyl alcohol from an engineered microorganism, e.g, a Clostridium microorganism, is enhanced through treatment of the engineered Clostridium (e.g., engineered to delete or inactivate the bed gene) with one or more chemical mutagen(s), followed by selection under that bias the selection towards strains with increased crotyl alcohol production, selection in the presence of crotyl alcohol.

[159] In some embodiments, the production of crotyl alcohol from a non-engineered or non-modified microorganism, e.g., a Clostridium microorganism, is enhanced by treatment with one or more chemical mutagen(s), followed by selection under conditions that bias the selection towards strains with increased crotyl alcohol production, for example, but not limited to, selection in the presence of crotyl alcohol and/or another related alcohol, e.g., propanol, pentenol, pentanol.

[160] A strategy is described herein whereby a microorganism, e.g., a Clostridium microorganism, that produces w-butanol is converted into a microorganism that produces crotyl alcohol, for example, by deletion, inhibition, and/or inactivation of the activity of one or more enzyme(s) (e.g., bed, phosphotransbutyrylase (ptb), butyrate kinase (bk), CoT (CoA transferase), acetoacetate decarboxylase (aad)). In some embodiments, deletion, inhibition, and/or inactivation of CoT and/or aad reduces or eliminates production of acetone in an ABE producing microorganism, e.g., a Clostridium microorganism, which improves crotyl alcohol yield. Other strategies include converting a microorganism, e.g., a Clostridium microorganism, into a microorganism that produces crotyl alcohol by overexpression of one or more enzyme(s) (e.g., an enzyme of a glycolytic or pentose phosphate pathway that converts glucose and/or xylose to acetyl-CoA, a thiolase enzyme that converts acetyl-CoA to acaetoacetyl-CoA, a 3-hydroxy butyryl CoA dehydrogenase enzyme that converts acetoacetyl-CoA to 3-hydroxybutyryl-CoA, a crotonase enzyme that converts 3- hydroxybutyryl-CoA to crotonyl-CoA, an aldehyde dehydrogenase enzyme that converts crotonyl-CoA to crotonaldehyde, an alcohol dehydrogenase enzyme that converts crotonaldehyde to crotyl alcohol)._In some embodiments, at least one enzyme of a butanol/butanoate pathway (e.g., bed) is deleted, inhibited, or inactivated, and at least one enzyme of a crotyl alcohol pathway (e.g., an alcohol dehydrogenase enzyme) is

overexpressed.

[161] Other strategies are described herein in which non-engineered microorganisms (e.g., microorganisms that produce w-butanol) may produce crotyl alcohol by adjustment of culture conditions to favor production of this product. For example, one or more substance(s), including but not limited to, one or more divalent metal ion(s) (e.g., Ca²⁺, Co²⁺, Zn²⁺, and/or Mn²⁺), iodoacetamide, myristoyl-CoA, N-ethylmaleimide, and/or palmitoyl-CoA may be included in the growth medium, thereby increasing production of crotyl alcohol versus a growth medium that does not include the substance(s). Such substance(s) may serve as inhibitors of one or more enzyme(s), including but not limited to, bed, thereby increasing production of crotyl alcohol by the microorganism. In some embodiments, an SiHybrid may downregulate the activity of one or more enzyme(s), such as bed. [162] Methods are provided for producing one or more alkenol(s) or diol(s) in a microbial fermentation. The methods include culturing a microorganism that produces the alkenol(s) and/or diol(s) of interest (e.g., crotyl alcohol) in a medium that contains a carbon source, such as, but not limited to, soluble sugar molecules produced from biomass (e.g., in an acid and/or enzymatic hydrolysate of biomass) to support microbial growth for production of the alkenol(s) and/or diol(s).

[163] The methods for production of alkenol(s) and/or diol(s) (e.g., crotyl alcohol) herein include fermentation with an engineered, mutagenized, or non-engineered, non-mutagenized microorganism (e.g., Clostridium microorganism) as described herein in a bioreactor in a growth medium that contains a carbon source, such as, but not limited to, a liquid sugar- containing extract from biomass, such as a hydrolysate or conditioned hydrolysate (e.g., conditioned to remove at least a portion of one or more inhibitor(s) of microbial growth and/or bioproduct (e.g., alkenol and/or diol) production), prepared from biomass (e.g., lignocellulosic biomass). In some embodiments, a liquid sugar containing extract such as cane juice and/or molasses is included in the growth medium.

[164] In some embodiments, the bioproduct production includes fermentation with a microorganism as described herein in an immobilized cell bioreactor (i.e., a bioreactor containing cells that are immobilized on a support, e.g., a solid support). In some embodiments, an immobilized cell bioreactor provides higher productivity due to the accumulation of increased productive cell mass within the bioreactor compared with a stirred tank (suspended cell) bioreactor. In some embodiments, the microbial cells form a biofilm on the support and/or between support particles in the growth medium.

[165] In other embodiments, for example but not limited to, embodiments in which a hydrolysate composition containing both liquid hydrolysate and solid residues is used, microorganisms may be grown in a non-immobilized system, such as an agitated fermentation reactor, e.g., designed to provide adequate conditions for fermentation, including but not limited to mixing of components, gas removal, temperature control, and/or the ability to add and/or remove material from the reactor. Several fermentation operational moieties exist, including but not limited to batch, fed-batch, and continuous in single or multiple reactor configurations. Exemplar reactor types include but are not limited to agitated tanks, e.g., where agitation is effected by a mechanical impeller, the addition and withdrawal of material, the addition of gas, and/or the recirculation of fermentation gas; corn and/or cane ethanol fermentation tanks; pharmaceutical fermentation vessels; vacuum fermentation systems; air-lift type reactors; fluidized bed reactors; anaerobic digestors; and activated sludge reactors. In some embodiments, an extractive fermentation process is used (e.g., gas stripping, liquid extraction, vacuum fermentation, extraction by absorption and/or adsorption by a solid material such as a polymeric material).

[166] In some embodiments, the alkenol and/or diol (e.g., crotyl alcohol) production process herein includes continuous fermentation of a microorganism (continuous addition of conditioned hydrolyzed feedstock and withdrawal of product stream). Continuous fermentation minimizes the unproductive portions of the fermentation cycle, such as lag, growth, and turnaround time, thereby reducing capital cost, and reduces the number of inoculation events, thus minimizing operational costs and risk associated with human and process error.

[167] Fermentation may be aerobic or anaerobic, depending on the requirements of the bioproduct-producing microorganism.

[168] As known in the art, in addition to an appropriate carbon source, fermentation media must contain suitable nitrogen source(s), mineral salts, cofactors, buffers, and other components suitable for the growth of the cultures and promotion of the enzymatic pathway necessary for the production of the desired bioproduct. In some embodiments, salts and/or vitamin B12 or precursors thereof are included in the fermentation media. In some cases, hydrolyzed biomass may contain some or all of the nutrients required for growth, minimizing or obviating the need for additional supplemental material.

[169] One or more microorganism that is capable of producing one or more alkenol(s) or diol(s) of interest (e.g., crotyl alcohol) may used in the fermentation methods described herein. In embodiments in which two or more microorganisms are used, the

microorganisms may be the same or different microbial species and/or different strains of the same species.

[170] In some embodiments, the microorganisms are bacteria or fungi. In some embodiments, the microorganisms are a single species. In some embodiments, the microorganisms are a mixed culture of strains from the same species. In some

embodiments, the microorganisms are a mixed culture of different species. In some embodiments, the microorganisms are an environmental isolate or strain derived therefrom.

[171] The following examples are intended to illustrate, but not limit, the invention. EXAMPLES

Example 1

Testing the effect of crotyl alcohol on Clostridium H-butanol fermentations

[172] The effect of crotyl alcohol in the growth medium of a Clostridium fermentation was investigated. Production of w-butanol by a butanol-producing Clostridium strain was determined at various concentrations of crotyl alcohol in the fermentation medium. Seed culture and growth media were J2 for JR22. J2 media: A liquid yeast based media containing 6% glucose as a carbohydrate source. Crotyl alcohol was added to the J2 media to the following final concentrations: 0, 0.1, 1,2,4,6, and 8g/L. Crotyl alcohol concentration in the culture media was confirmed by submitting samples for HPLC analysis prior to inoculation. All cultures were inoculated at 10% volume from a seed cultured in J2 with 0 g/L crotyl alcohol. Culture volumes were 4 mL, grown in 10 mL conical tubes. Media and culture vials were deoxygenated prior to growth in an anaerobic chamber. Typically small scale cultures are grown in 15 mL conical tubes, where there are screw thread caps in place to reduce butanol evaporation but pressure from gas generated during the fermentation can be released. Conical tubes were used to reduce the possibility of evaporation of the crotyl alcohol during the fermentation. Time points were taken at 24 and 48 h, a single time point per vial. At each time point the absorbance at 600 nm was measured and a sample was submitted for HPLC analysis. Results for crotyl alcohol addition are shown as a percent of the control (no crotyl alcohol addition) in Fig. 15.

[173] Butanol tolerance of JR22 was investigated, for comparison with crotyl alcohol tolerance. The seed culture and growth media used were molasses media. (Molasses media: A liquid yeast based media containing 6% molasses as a carbohydrate source). Butanol was added to the molasses media to the following final concentrations: 0, 3, 4.5, 6.5, 8, 10, 12, 13, and 15 g/L. Butanol concentration in the culture media was confirmed by submitting samples for HPLC analysis prior to inoculation. All cultures were inoculated at 10% volume from a seed cultured in molasses media with 0 g/L butanol added to the media. Cultures volumes, growth conditions and sampling were performed as described for the crotyl alcohol samples above. Results for w-butanol addition are shown in Fig. 16.

[174] Data showing total solvent production (butanol, acetone, and ethanol) as a function of added crotyl alcohol are shown in Fig. 17.

[175] Data showing the uptake of crotyl alcohol, accounting for the increased total solvent production above the maximum theoretical based on sugar uptake, are shown in Table 1. TABLE 1

[176] The data above demonstrate that the enzymatic steps are indeed non-selective for the substrate. These data provide direct evidence the enzymatic steps (adhE and adh2) are promiscuous in nature.

Example 2

Testing the effect of crotonic acid on Clostridium H-butanol fermentations

[177] The effect of crotyl alcohol in the growth medium of a Clostridium fermentation was investigated. Production of w-butanol by Clostridium was determined at various concentrations of crotyl alcohol in the fermentation medium. Seed culture and growth media were J2 for JR22. J2 media: A liquid yeast based media containing 6% glucose as a carbohydrate source. Crotonic acid was added to the J2 media to the following final concentrations: 0, 3, 6 g/L. Crotonic acid concentration in the culture media was confirmed by submitting samples for HPLC analysis prior to inoculation (data shown in tables below for crotonic acid added indicates the actual amount present as measured by HPLC). All cultures were inoculated at 20% volume from a seed cultured in J2 (strain JR22) with 0 g/L crotonic acid. Culture volumes were 100 mL, grown in 250 mL shake flasks. Shake flasks were deoxygenated prior to growth in an anaerobic chamber. Typically small scale cultures are grown in 250 mL shake flasks where there are screw thread and pressure releasing valves. At each time point the pH and absorbance at 600 nm was measured and a sample was submitted for HPLC analysis.

[178] Results for crotonic acid addition demonstrates Glucose uptake over time are shown in Fig. 18. Data showing the consumption of crotonic acid as a function of time are shown in Fig. 19. Plots showing the n-butanol titer as a function of crotonic acid added are shown in Fig. 20. Example 3

Downregulation of the bed gene by siHybrids in Clostridium for the production of crotyl alcohol from lignocellulosic hydrolysate or other fermentable feedstock with subsequent conversion of crotyl alcohol to butadiene via a dehydration catalyst

[179] This example demonstrates the engineering of a Clostridium strain that has the native genes shown in Fig. 21. The butanol production pathway in Clostridium

acetobutylicum includes Ack, acetate kinase; Pta, phosphotransacetylase; AdhE, aldehyde/alcohol dehydrogenase; Thl, thiolase; Hbd, 3-hydroxybutyryl-CoA

dehydrogenase; Crt, crotonase; Bed, butyryl-CoA dehydrogenase; Ptb,

phosphotransbutyrylase; Buk, butyrate kinase; CtfA/B, CoA transferase; Adc, acetoacetate decarboxylase; NADH, nicotinamide adenine dinucleotide (reduced form). The single reactions do not represent stoichiometric fermentation balances. (Scheme from Mazzoli (2012) www.ncbi.nlm.nih.gov/pmc/articles/PMC3962139/).

[180] A bed siHybrid is designed to downregulate butyryl-CoA dehydrogenase without the need for time consuming plasmid production and transformation. With the bed (butyryl- CoA dehydrogenase) gene silenced utilizing siHybrids to downregulate the bed gene, the native promiscuous alcohol dehydrogenase (adhE, adhe2) can convert crotonyl-CoA to crotonaldehyde. In addition, the native promiscuous alcohol dehydrogenases (adhE, adhE2, bdhAB) can also convert the crotonaldehyde to crotyl alcohol as shown in Fig. 22. The Crotyl Alcohol Production Pathway in an engineered Clostridium species with inactivation of the bed gene includes Ack, acetate kinase; Pta, phosphotransacetylase; AdhE, AdhE2, aldehyde/alcohol dehydrogenase; BdhA, BdhB, butanol dehydrogenase; Thl, thiolase; Hbd, 3-hydroxybutyryl-CoA dehydrogenase; Crt, crotonase; Bed, butyryl-CoA dehydrogenase; Ptb, phosphotransbutyrylase; Buk, butyrate kinase; CtfA/B, CoA transferase; Adc, acetoacetate decarboxylase; NADH, nicotinamide adenine dinucleotide (reduced form). The single reactions do not represent stoichiometric fermentation balances.

First, a siHybrid is constructed using a random twenty-one base pair sequence from the published bed gene sequence of C beijerinckii (NCIMB 8052). The amino acid sequence of the bed gene, Cbei_0322, is depicted in SEQ ID NO: l . The siHybrid is constructed with a random 7 amino acid length segment from this sequence. The region chosen for SiHybrid construction is highlighted. 10 2 0 30 40 5 0 60

MNFQLTREQQ LVQQMVREFA ¾¾E¥KPIAAE IDESERFPME NVEKMAKLKM MGIPFSKEFG

70 80 90 100 110 120

GAGGDVLSYI ISVEELSKVC GTTGVILSAH TSLCASVINE NGTNEQRAKY LPDLCSGKKI

130 140 150 160 170 180

GAFGLTEPGA GTDAAGQQTT AVLEGDHYVL NGSKIFITNG GVAETFI IFA MTDKSQGTKG

190 200 210 220 230 240

ISAFIVEKSF PGFSIGKLEN KMGIRASSTT ELVMENCIVP KENLLSKEGK GFGIAMKTLD

250 260 270 280 290 300

GGRIGIAAQA LGIAEGAFEE AVNYMKERKQ FGKPLSAFQG LQWYIAEMDV KIQAAKYLVY

310 320 330 34£ 350 360

LAATKKQAGE PYSVDAARAK LFAADVAMEV TTKAVQIFGG YGYTKEYPVE RMMRDAKICE

370

IYEGTSEVQK MVIAGSILR

(SEQ ID NO: 1)

[181] Region sense and antisense strands are constructed with two nucleotide 3 ' uridine over hangs (GenScript, Piscataway, NJ). The region from amino acids 18-24 of the bed gene, Cbei_0322 was chosen for its DNA homology to C. beijerinckii strain NRRL B593 and C. saccharobutylicum DSM 13864. The sequence was queried for homology with other unrelated genes using the BLAST (basic local alignment search tool) bioinformatics tool. The closest additional sequence shares only 14 of the 21 base pairs from amino acid region 18-24. Therefore, the siHybrid should not interfere with the translation of any additional genes. The sense strand is composed of RNA of the sequence 5' CUU CAU UUA CUG CGA AUU CUC UU 3'. (SEQ ID NO:2) The antisense strand is composed of DNA of the sequence 5' GAG AAT TCG CAG TAA ATG AAG TT 3'. (SEQ ID NO:3). Sense and antisense strands are annealed together in equimolar amounts in the presence of 10 mM Tris-HCl (pH 8.0) by denaturing for 5 minutes at 94° C and then reannealed at 53° C for 3 hours.

Annealed strands are then slowly cooled to room temperature. This siHybrid is added to the fermentation medium at a concentration of 4 μg/ml.

[182] A culture of C. beijerinckii is started overnight from glycerol stock in minimal medium absent of bed siHybrid strands. When cultures reach an optical density at 600nm of 1.0, a 10% inoculation is performed into a fermentataion medium (e.g., lignocellulosic hydrolysate), for example, with defined added nutrients under anaerobic conditions in a bioreactor containing either 4 μg/ml of the bed siHybrid, or medium absent of siHybrid. Cultures are incubated anaerobically, shaking at 100 rpm, at 32 C for 48 hours, with time points taken at 24, 48, and 72 hours. Fermenation broth is filtered and analyzed by HPLC for butanol, butyric acid, crotyl alcohol, and crotonic acid. If bed activity is downregulated, HPLC results from siHybrid-containing medium will show higher amounts of crotyl alcohol and crotonic acid, while producing less butanol and butyric acid than the control.

Fermenation broth is also analyzed for protein suppression (e.g., Bed protein expression levels) by Western blot.HPLC is used to monitor the crotyl alcohol production during fermentation. Western blot analysis is also performed to evaluate the Bed protein expression levels.

[183] At the end of fermentation, crotyl alcohol may be collected from the fermentation broth and is converted with a dehydration catalyst to bio-l,3-butadiene as described herein.

[184] The DNA sequence of Cbei_0322 from NCIMB 8052 is depicted in SEQ ID NO:4. The region chosen for SiHybrid construction is highlighted.

atgaatttccaattaactagagaacaacaattagtacaacaaatggttagagaattcgcagtaaatgaagttaagccaatagctgctga aatcgacgaatcagaaagattccctatggaaaacgttgaaaaaatggctaagcttaaaatgatgggtatcccattttctaaagaatttgg tggagcaggcggagatgttctttcatatataatatctgtggaagaattatcaaaagtttgtggtactacaggagttattctttcagcgcata catcattatgtgcatcagtaattaatgaaaatggaactaacgaacaaagagcaaaatatttgccagatctttgtagtggtaagaaaatcg gtgctttcggattaacagaaccaggcgctggtacagatgctgcaggacaacaaacaactgctgtattagaaggagaccattatgtatt aaatggttcaaaaatcttcataacaaatggtggagttgctgaaactttcataatatttgctatgacagataagagtcaaggaacaaaagg aatttctgcattcatagtagaaaagtcattcccaggattctcaataggaaaattagaaaacaagatggggatcagagcatcttcaacta ctgagttagttatggaaaactgtatagtaccaaaagaaaacctacttagcaaagaaggtaagggatttggtatagcaatgaaaactctt gatggaggaagaattggtatagctgctcaagctttaggtattgcagaaggagcttttgaagaagctgttaactatatgaaagaaagaa aacaatttggtaaaccattatcagcattccaaggattacaatggtatatagctgaaatggatgttaaaatccaagctgctaaatacttagt atacctagctgcaacaaagaagcaagctggtgagccttactcagtggatgctgcaagagctaaattatttgcggcagatgttgcaatg gaagttacaactaaagcagttcaaatctttggtggatatggttacactaaggaataccagtagaaagaatgatgagagatgctaaaata tgcgaaatctacgaaggaacttcagaagttcaaaagatggttatcgcaggaagcattttaagatag (SEQ ID NO:4)

[185] The DNA sequence of the bed gene from C. beijerinckii strain NRRL B593 is depicted in SEQ ID NO:5. The region chosen for siHybrid construction is highlighted, atgaatttccaattaactagagaacaacaattagtacaacaaatggttagagaattcgcagtaaatgaagttaagccaat agctgctgaaatcgacgaaacagaaagattccctatggaaaacgttgaaaaaatggctaagcttaaaatgatgggtatc ccattttctaaagaatttggtggagcaggcggagatgttctttcatatataatagctgtggaagaattatcaaaagtttgtg gtactacaggagttattctttcagcgcatacatcattatgtgcatcagtaattaatgaaaatggaactaacgaacaaagag caaaatatttacctgatctttgcagcggtaaaaagatcggtgctttcggattaactgaaccaggtgctggtacagatgctgc aggacaacaaacaactgctgtattagaaggggatcattatgtattaaatggttcaaaaatcttcataacaaatggtggagt tgctgaaactttcataatatttgctatgacagataagagtcaaggaacaaaagaatttctgcattcatagtagaaaagtca ttcccaggattctcaataggaaaattagaaaataagatggggatcagagcatcttcaactactgagttagttatggaaaac tgcatagtaccaaaagaaaacctacttagcaaagaaggtaagggatttggtatagcaatgaaaactcttgatggaggaa gaattggtatagctgctcaagctttaggtattgcagaaggagcttttgaagaagctgttaactatatgaaagaaagaaaac aatttggtaaaccattatcagcattccaaggattacaatggtatatagctgaaatggatgttaaaatccaagctgctaaata cttagtatacctagctgcaacaaagaagcaagctggtgagccttactcagtagatgctgcaagagctaaattatttgctgc agatgttgcaatggaagttacaactaaagcagttcaaatctttggtggatatggttacactaaagaatacccagtagaaag aatgatgagagatgctaaaatatgcgaaatctacgaaggaacttcagaagttcaaaagatggttatcgcaggaagcattt taagata

(SEQ ID N0:5)

[186] The DNA sequence of the bed gene from C. saccharobutylicum DSM 13864 is depticted in SEQ ID NO: 6. The region chosen for siHybrid construction is highlighted. atgaattttaagttaactagagaacaagaattaatacaacaaatggttagagaattcgcagtaaatgaagttaaaccaat agctgctgaaatcgatgagacagaacaatttccgatggaaaatgttaaaaaaatggctgaattaggaatgatgggtattc cattttctaaagaagtaggaggagcaggcggagatgttctttcttatataatagctgtagaagaattatcaaaagtgtgtg gtactacaggtgttatactttcagcacatacatcattatgtgcatcagtaattaacgaaaatggtactccagctcaaaaaga aaaat att tagcagatctttgt agtggtaagaaaattggtgctttt ggtttaact gaacc aggtget ggt ac agatget gc tg gacaacaaacaacagcaacattagaaggagatcattatgtattaaatgggtcaaaaatattcataacaaatggtggagtt gctgaaactttcataatttttgctatgacagataagagccaaggaactagaggaatttctgcatttgtagtagaaaaatcat tccctggattctcagtaggaaaattagaaaacaagatgggtattagagcatcttcaactactgaattagttatggaaaact gtatagtaccaaaagaaaacttacttggtaaagaaggtaagggatttggtatagcaatgaagactcttgatggaggaag aattggtatagctgctcaagctttaggtattgcagaaggagcttttgaagaagcagttgcatacatgaaagaaagaaaac aatttaataaaccactttcagcattccaaggattacaatggtatattgctgaaatggacgttaagatagacgctgctaagc atttagtatataaagcagcatgcaagaaacaagcgggtcaaccttattcagttgatgcggctagagctaagttgtttgcag cagacgttgcaatggaagttacaactaaggcagtacaaatctttggtggatatggttacactaaggaatacccagtagaa agaatgatgagagatgctaagataactgaaatctatgaaggaacttcagaagttcaaaagatggttattgcaggaagcat tttaagatagg

(SEQ ID NO:6)

Example 4

Engineered Clostridium via bed inactivation for the production of crotyl alcohol from lignocellulosic hydrolysate or other fermentable feedstock with subsequent conversion of crotyl alcohol to butadiene via a dehydration catalyst

[187] Example 3 describes the engineering of a Clostridium strain that has the native genes with the bed (butyryl-CoA dehydrogenase) gene inactivated via an intron. The native promiscuous alcohol dehydrogenase (adhE, adhe2) can convert crotonyl-CoA to crotonaldehyde. In addition, the native promiscuous alcohol dehydrogenases (adhE, adhE2, bdhAB) can also convert the crotonaldehyde to crotyl alcohol.

[188] Preliminary inactivation of bed is done using targetron, a gene knockout system with proven efficacy in Clostridium species (available from Sigma Aldrich). The targetron system works by inserting a group II intron via the activity of an RNA-protein complex into the gene of interest. Primers are generated for specific targeting of the group II intron into the bed gene. The re-targeted intron is generated by PCR, and this segment of the group II intron is ligated into a linearized vector that contains the rest of the group II intron components, as well as an antibiotic resistance gene that is flanked by Flp recombinase recognition sites. The vector is transformed by methods known in the art into the

Clostridium host and the RNA-protein complex is expressed. This RNA-protein complex locates the genomic target, inserts RNA and reverse transcribes cDNA. Host enzymes repair and create a permanent insertion into the bed gene of the group II intron. Chromosomal insertion mutants are selected with the antibiotic marker. The antibiotic resistance marker is removed by transformation with a vector that expresses Flp, excising the antibiotic resistance marker. Verification of disruption of the bed gene is performed by colony PCR using gene and intron specific primers.

[189] Gene disruption using targetron is performed with pJIR750ai containing a group II intron that has been retargeted to the bed gene in Clostridium beijerinckii, as shown in Fig. 23. The intron is expressed from a beta-2-p promoter. This intron contains a Kanamycin resistance (KanR) marker with its promoter (PI) inserted in the orientation opposite that of the intron transcription. This KanR marker is disrupted by a self-splicing td group I intron inserted in the forward orientation. During retrotransposition via an RNA intermediate, the td intron is spliced, activating the KanR marker, which is then selected after the intron has integrated into the DNA target site. Flp recombinase recognition (FRT) sites flank the KanR marker gene. Expression of the Flp protein from a separate plasmid leads to efficient excision of the KanR marker from the integrated targetron, enabling multiple sequential disruptions.

[190] The engineered Clostridium strain is cultivated from a glycerol stock and inoculated into a lignocellulosic hydrolysate or other growth medium with nutrients for growth of the microorganism under anaerobic conditions in a bioreactor. HPLC is used to monitor the crotyl alcohol production during fermentation. At the end of fermentation, crotyl alcohol in the fermentation broth, optionally separated from the fermentation broth, is converted to 1,3-butadiene with a dehydration catalyst as disclosed herein Example 5

Inactivation of bed gene by homologous recombination to insert a selectable marker or deletion of a portion of the bed gene

[191] The bed gene and approximately lkb of flanking regions (sequence homology upstream and downstream) is cloned into a suicide vector. A selectable marker, such as erythromycin resistance, is used to replace all or a portion of the bed gene while preserving the integrity of the operon with an in frame deletion. The plasmid is transformed into Clostridium by methods known in the art. Since the plasmid is unable to replicate in Clostridium, Clostridium with resistance to the selectable marker undergoes homologous recombination at the upstream, downstream, or at both upstream and downstream sequences. Selectable marker resistant transformants are screened by PCR to identify double recombinant events. The selectable marker maybe removed using strategies known in the art to create a markerless knockout.

[192] The resulting engineered strain has an inactivated bed gene and is able to produce crotyl alcohol. The engineered Clostridium strain is cultivated from a glycerol stock and inoculated into a lignocellulosic hydrolysate or other growth medium with nutrients for growth of the microorganism under anaerobic conditions in a bioreactor. HPLC can be used to monitor the crotyl alcohol production during fermentation. At the end of fermentation, crotyl alcohol in the fermentation broth, optionally separated from the fermentation broth, is converted to 1,3 -butadiene with a dehydration catalyst as disclosed herein..

Example 6

Engineered and optimized Clostridium via bed inactivation for production of crotyl alcohol, followed by directed evolution to optimize crotyl alcohol production from lignocellulosic hydrolysate or other fermentable feedstock with subsequent conversion of crotyl alcohol to butadiene via a dehydration catalyst

[193] Methods described in Example 4 will be followed to engineer Clostridium with an inactivated bed gene. After inactivation of the bed gene the production of crotyl alcohol will be optimized via directed evolution. The bed knockout Clostridium is treated with mutagen (e.g., both ethyl methanesulfonate (EMS) and N-methyl-N^" -nitro-N- nitrosoguanidine (NTG) have proven efficacy for mutagenesis in Clostridium).

Mutagenized bacteria are then grown in the presence of selection to bias the bacterial pool toward the desired outcome. Growth in the presence of crotyl alcohol is employed to select organisms with increased tolerance to crotyl alcohol. Growth in the presence of

lignocellulosic compounds typically found to be inhibitory may also be employed, to select for increased tolerance to these compounds found in hydrolysates containing lignin.

Selections for increased productivity may also be employed.

[194] In addition or alternatively, metabolic flux analysis (MFA) is used for the determination of metabolic pathway fluxes in order to 1) verify that deletion of bed leads to a significant accumulation of crotyl alcohol, 2) identify nodes that are potential bottlenecks to crotyl alcohol biosynthesis, and 3) identify competing biochemical pathways that direct carbon flow away from crotyl alcohol for further engineering. In this approach, the intracellular fluxes are calculated by using a stoichiometric model constructed from major pathway reactions and mass balances around intracellular metabolites. Intracellular fluxes are estimated based on measurable quantities, in particular, the rate of formation of extracellular metabolites. A set of measured extracellular fluxes including uptake rates of substrates and secretion rates of metabolites are used as inputs. The resulting flux calculation is a metabolic flux map showing biochemical reactions along with an estimate of the steady state rate at which each reaction occurs. This information is used to further engineer and optimize the strain for crotyl alcohol production.

[195] The resulting engineered Clostridium strain optimized for crotyl alcohol tolerance is cultivated from a glycerol stock and inoculated into a growth medium under anaerobic conditions in a bioreactor. HPLC can be used to monitor the crotyl alcohol production during fermentation. At the end of fermentation, crotyl alcohol in the fermentation broth, optionally separated from the fermentation broth, is converted to 1,3-butadiene with a dehydration catalyst as disclosed herein.

[196] The γ-alumina used for preparation of Catalysts 1 - 5 (Examples 7 - 10, 12, infra) was supplied by Strem Chemicals (min. 97%; surface area 210 m²/g; product number 13-2525; lot number 23996900).

Example 7

[197] Catalyst 1 was made by scaling the following method sufficient to prepare about 50g of finished catalyst: 1.5 wt-% of NaOH was loaded onto γ-alumina by incipient wetness impregnation. The NaOH solution contained 0.06 g of NaOH dissolved in water to make 4 mL of solution. The clear solution was added to 4 g of γ-alumina and mixed for about 5 min. The impregnated carrier was then dried at 200°C for 16 h to obtain the final catalyst.

Example 8

[198] Catalyst 2. γ-Alumina (60 g) was slurried in water (a portion, sufficient to create a slurry, taken from a total of 100 mL); NaHS0₄ (5 g) was dissolved in the remainder of the total of 100 mL of water to give a clear solution; the alumina slurry and NaHS0₄ solution were combined and stirred well; and the resulting mixture was taken to free- flowing dryness, by drying (ambient to about 200°C) overnight under a blanket of dry nitrogen with a slow nitrogen purge.

Example 9

[199] Catalyst 3 was made by loading 5.0g Ca(H2P0₄)2-H20 onto 45g γ-alumina by incipient wetness impregnation. The impregnated carrier was then calcined at 300°C for 24 h to obtain the final catalyst.

Example 10

[200] Catalyst 4. γ-Alumina (49 g) was slurried in 40 mL of water; Ca(H₂P0₄)2-H₂0 (4.30 g, 17.1 mmol) and H3PO4 (0.5 mL of 85%, 0.425 g of H3PO4, 4.34 mmol) were dissolved in 50 mL of water to give a clear solution; the alumina slurry and Ca(H2P0₄)2/H3P0₄ solution were combined and stirred well; and the resulting mixture was taken to free-flowing dryness, by drying (ambient to about 200°C) overnight under a blanket of dry nitrogen with a slow nitrogen purge.

Example 11

Catalytic performance in dehydration of crotyl alcohol to 1,3-butadiene.

[201] Catalyst examples 1-4 prepared above were tested in a fixed-bed test unit. In the test, a crotyl alcohol feed (either neat, or diluted as indicated in Table 2, below) was passed over a catalyst bed (42 - 54g) at 1 atm and a WHSV ([g crotyl alcohol]/[g catalyst]/hour) and bed temperature, as indicated in Table 2, below. The reaction products at the reactor outlet were trapped in serial traps, the first, initially empty, and maintained at 0 - 5°C, the second, initially toluene-filled, and maintained at -78°C, and then sampled and analyzed offline by gas chromatography with flame ionization detection. TABLE 2. Crotyl Alcohol Dehydration Results.

Example 12

[202] Catalyst 5. γ-Alumina (80 g) was slurried in 70 mL of water; Ca(H₂P04)2-H20 (6.8 g, 27.0 mmol) was dissolved in 50 mL of water; H3PO4 (0.82 mL of 85%, 0.694 g of H3PO4, 7.09 mmol) was diluted in 10 mL of water; the Ca(H2P04)2 and H3PO4 solutions were combined to give a clear solution; the alumina slurry and Ca(H2P04)2/H3P04 solution were combined and stirred well; and the resulting mixture was taken to free- flowing dryness, by drying (ambient to about 200°C) overnight under a blanket of dry nitrogen with a slow nitrogen purge. The resulting material was thoroughly wetted with ethanol (a portion, sufficient to wet the solid, taken from a total of 150 mL); diethoxydiphenylsilane (1 g) was dissolved in the remainder of the total of 150 mL of ethanol to give a clear solution; the ethanol-wet Ca(H2P04)2/H3P04-treated alumina and diethoxydiphenylsilane solution were combined and stirred well; and the resulting mixture was taken to free-flowing dryness, by drying (ambient to about 200°C) overnight under a blanket of dry nitrogen with a slow nitrogen purge.

Example 13

[203] Catalyst 6 is made by adding 3.3 wt-% of Ca⁺² onto alumina by incipient wetness impregnation. The impregnation solution is prepared by dissolving Ca(HS04)2 and Ca(S04) in water. The solution contains 0.066 g of Ca⁺² in 1.3 mL solution. The clear solution is added to 2 g of alumina and mixed for about 5 min. The impregnated carrier is then calcined at 200 °C for 6 h to obtain the final catalyst.

Example 14

[204] This invention Catalyst 7 is made by adding 2 wt-% of Ca⁺² onto γ-alumina (powder, surface area >250 m²/g) by incipient wetness impregnation. The carrier is first calcined at 600 °C for 2 h. The impregnation solution is prepared by dissolving Ca(S0₄) (136 mg) in water along with NaHS0₄ (142 mg). The solution contains 0.04 g of Ca⁺² and an equal molar concentration of hydrogen sulfate and sulfate ions in 1.3 mL solution. The clear solution is added to 2 g of alumina and mixed for about 5 min. The impregnated carrier is then calcined at about 250 to 550 °C for 6 h to obtain the final catalyst.

Example 15

[205] This invention Catalyst 8 is made by adding 2 wt-% of Ca⁺² onto γ-alumina (powder, surface area >250 m²/g) by incipient wetness impregnation. The carrier is first calcined at 600 °C for 2 h. The impregnation solution is prepared by dissolving Ca(HP0₄), Ca(H2P0₄)2 , and phosphoric acid (H3PO4) in a molar ratio of 5:5: 1 in water. The solution contains 0.04 g of Ca⁺² cations in 1.3 mL solution. The clear solution is added to 2 g of alumina and mixed for about 5 min. The impregnated carrier is then calcined at about 250 to 550 °C for 6 h to obtain the final catalyst.

Example 16

[206] This invention Catalyst 9 is made by adding 2 wt-% of Ca⁺² onto γ-alumina extrudate (1/16" diameter) by incipient wetness impregnation. The carrier is first calcined at 600 °C for 2 h. The impregnation solution is prepared by dissolving Ca(HP0₄), Ca(H2P0₄)2 , and phosphoric acid (H3PO4) in a molar ratio of 5:5: 1 in water. The solution contains 0.4 g of Ca⁺² cations in 13 mL solution. The clear solution is added to 20 g of alumina and mixed for about 5 min. The impregnated carrier is then calcined at about 250 to 550 °C for 6 h to obtain the final catalyst.

Example 17

[207] This invention Catalyst 10 is made by adding 2 wt-% of Ca⁺² onto γ-alumina extrudate (1/8" diameter) by incipient wetness impregnation. The carrier is first calcined at 600 °C for 2 h. The impregnation solution is prepared by dissolving Ca(S0₄) (1.36 g) in water along with aHS0₄ (1.42 g). The solution contains 0.4 g of Ca⁺² and an equal molar concentration of hydrogen sulfate and sulfate ions in 13 mL solution. The clear solution is added to 20 g of alumina extrudate and mixed for about 5 min. The impregnated carrier is then calcined at about 250 to 550 °C for 6 h to obtain the final catalyst. Example 18

[208] This invention Catalyst 11 is made by adding 2 wt-% of Ca⁺² onto γ-alumina extrudate (1/8" diameter) by incipient wetness impregnation. The carrier is first calcined at 600 °C for 2 hr. The impregnation solution is prepared by dissolving Ca(S0₄) (1.36 g) in water along with aHS0₄ (1.42 g). The solution contains 0.4 g of Ca⁺² and an equal molar concentration of hydrogen sulfate and sulfate ions in 13 mL solution. The clear solution is added to 20 g of alumina extrudate and mixed for about 5 min. The impregnated carrier is then calcined at about 250 to 550 °C for 6 h to obtain the final catalyst. This material is treated with an ethanol (15 mL) solution containing Ph2Si(OEf)2 (0.74 g) and mixed for 5 min and then placed under reduced pressure (400 torr) and heated to 50 °C for 2 hr and then heated to 200 °C for 4 hr.

Example 19

Conversion of crotonaldehyde to crotyl alcohol in Clostridium fermentation

Microorganism and culture medium

[209] ABE-producing Clostridium saccharobutylicum strains were used for the following experiments, including publicly available Clostridium saccharobutylicum P262, to demonstrate the fermentability of crotyl alcohol.

[210] J2 Media with 6% glucose was used to grow Clostridium cells for crotyl alcohol production. Pre-seed was inoculated with 0.4% (v/v) of cells from glycerol stock. The inoculum transfer from pre-seed to seed tank was made to achieve a final OD of 1 (equal to 0.32 g of dry cell weight per L of broth) in the seed tanks.

[211] For confirming the adh activity, the microbial cultures were spiked with different concentrations of crotonaldehyde during the solventogenesis stage. Spiking concentrations of crotonaldehyde ranged from 0 to 2 g/L. Since crotonaldehyde is very toxic to the microorganism, fed-batch fermentation was also done to test the tolerance of the microorganism. Small amount of crotonaldehyde were slowly added into fermentation to final concentration of 2 g/L over 6 hours. Samples were taken immediately and 24 hours after crotonaldehyde addition.

Alcohol Dehydrogenase Activity

[212] Fig. 24 shows the production of crotyl alcohol in the microbial cultures. The microorganism was able to take up crotonaldehyde and produce crotyl alcohol. The reaction is relatively fast because crotonaldehyde is toxic to the microorganism, which is shown in Fig. 25 with no more butanol produced after the addition of crotonaldehyde at the concentration higher than 1 g/L.

[213] Fig. 26 shows crotyl alcohol production with different concentrations of crotonaldehyde addition.

[214] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[215] While the invention has been described, disclosed, illustrated and shown in various terms of certain embodiments or modifications which it has presumed in practice, the scope of the invention is not intended to be, nor should it be deemed to be, limited thereby and such other modifications or embodiments as may be suggested by the teachings herein are particularly reserved especially as they fall within the breadth and scope of the claims here appended.

[216] Although the foregoing invention has been described in some detail by way of illustration and examples for purposes of clarity of understanding, it will be apparent to those skilled in the art that certain changes and modifications may be practiced without departing from the spirit and scope of the invention. Therefore, the description should not be construed as limiting the scope of the invention.

[217] All publications, patents, and patent applications cited herein are hereby

incorporated by reference in their entireties for all purposes and to the same extent as if each individual publication, patent, or patent application were specifically and individually indicated to be so incorporated by reference.

Claims

CLAIMS We claim:

1. A method for dehydrating an alkenol or a diol to a diene, comprising:

contacting and heating said alkenol or diol with at least one catalyst that comprises an inorganic support, one or more promoter(s) selected from one or more Group 1 element(s), one or more Group 2 element(s), and combinations thereof, and one or more buffer-adjusted anion(s) at a WHSV at least about 0.3 hr¹,

thereby producing a diene product that comprises one or more diene(s) at a one-pass yield greater than about 73 mol%.

2. A method according to claim 1 , wherein said WHSV is about 0.3 hr¹ to about 10 hr

3. A method according to claim 1 , wherein said alkenol or diol is in a mixture with about 1 ppm to about 93 wt% water.

4. A method according to claim 1, wherein the selectivity of diene production is at least about 75%.

5. A method according 5 to claim 1, wherein said alkenol is a bio-alkenol.

6. A method according 5 to claim 1, wherein said alkenol is crotyl alcohol.

7. A method according 5 to claim 1, wherein said alkenol is bio-crotyl alcohol.

8. A method according 5 to claim 1, wherein said alkenol is a C₄ to Ce alkenol

9. A method according 5 to claim 1 , wherein said one or more diene(s) is 1 ,3 -butadiene.

10. A method according 5 to claim 4, wherein the selectivity of diene production is greater than about 95%.

1 1. A method according 5 to claim 4, wherein the selectivity of diene production is about

90% to about 99%.

12. A method according 5 to claim 1, wherein one-pass conversion of said alkenol or diol is greater than about 95 mol%.

13. The method according to claim 3, wherein said mixture comprises about 15 to about 70 wt% water.

14. A method according to claim 1, wherein said inorganic support comprises γ- alumina.

15. A method according to claim 1, wherein said catalyst is further modified by treatment with at least one organosilane.

16. A method according to claim 15, wherein said organosilane comprises an alkoxysilane.

17. A method according to claim 15, wherein said organosilane comprises a

chlorosilane.

18. A method according to claim 1, further comprising providing at least one carrier gas.

19. A method according to claim 18, wherein said carrier gas comprises nitrogen and/or argon, and mixtures thereof.

20. A method according to claim 1, wherein said heating comprises a temperature of about 200° C to about 440° C.

21. The method according to claim 20, wherein said temperature comprises about 250° C to about 320° C.

22. A method according to claim 1, further comprising separating water from said diene product, thereby producing a dry diene product.

23. A method according to claim 9, comprising contacting said 1,3-butadiene product with a second catalyst under conditions sufficient to form 1-butene.

24. A method according to claim 23, wherein said 1-butene is contacted with a third catalyst selected from a Ziegler-Natta catalyst, a mesoporous oligomerization catalyst, and an acid catalyst under conditions sufficient to form oligomers.

25. A method according to claim 24, further comprising using said oligomers to produce a diesel fuel.

26. A method according to claim 25 wherein said diesel fuel comprises a flashpoint of about 38° C to about 100° C, a Cetane rating of about 45 to about 60, and aromatic content of less than about 0.5 wt-%.

27. A method according to claim 24, further comprising using said oligomers to produce a jet fuel.

28. A method according to claim 27, wherein said jet fuel comprises a flashpoint of about 38° C to about 100° C, a cold flow viscosity of less than about 8.0 cSt at -20 °C, and aromatic content of less than about 0.5 wt-%.

29. A method according to claim 1, wherein the promoter is selected from Mg, Ca, Sr, Ba, and combinations thereof.

30. A method according to claim 29, wherein the promoter is Ca.

31. A method according to claim 1 , wherein the buffer-adjusted anion is selected from SO4^"2, H2PO4^"1, and mixtures thereof.

32. A method for dehydrating an alkenol or a diol to a diene, comprising:

contacting and heating said alkenol or diol with at least one catalyst that comprises a calcium-modified inorganic support and one or more buffer-adjusted anion(s),

thereby producing a diene product that comprises one or more diene(s) at a one-pass yield greater than about 80 mol%.

33. A method according to claim 32, wherein said alkenol is a bio-alkenol.

34. A method according to claim 32, wherein said alkenol is crotyl alcohol.

35. A method according to claim 32, wherein said alkenol is bio-crotyl alcohol.

36. A method according to claim 32, wherein the alkenol is a C₄ to Ce alkenol

37. A method according to claim 32, wherein said diene product is 1,3 -butadiene.

38. A method according to claim 32, wherein said alkenol is in a mixture with about 1 ppm to about 93 wt-% water.

39. A method according to claim 32, wherein the contacting is at a WHSV of about 0.3 hr¹ to about 10 hr¹.

40. A method according to claim 32, wherein said catalyst is further modified by treatment with at least one organosilane.

41. A catalyst composition for producing dienes from alkenols or diols with high selectivity, comprising:

an inorganic support that is modified with at least one Group 1 element, at least one Group 2 element, or a combination thereof;

one or more buffer-adjusted anion; and optionally, at least one organosilane.

42. A catalyst composition according to claim 41, comprising at least one Group 2 element selected from Mg, Ca, Sr, and Ba.

43. A catalyst composition according to claim 42, wherein the Group 2 element is Ca.

44. A catalyst composition according to claim 41, wherein the buffer-adjusted anion is selected from S0₄ ^~2, H2PO4 ¹, and mixtures thereof.

45. A catalyst composition according to claim 41, wherein the buffer-adjusted anion is H2PO4^"1, wherein H2PO4^"1 is a component of a mixture that further optionally comprises one or more additional anions selected from HPO4^"2 and P0₄ ^"3 and one or more charge balancing counter cations selected from H⁺¹, Li⁺¹, Na⁺¹, K⁺¹, Mg⁺², Ca⁺², Sr⁺², Ba⁺², and combinations thereof.

46. A catalyst composition according to claim 41, comprising an organosilane, wherein the organosilane is diethoxydiphenylsilane.

47. A catalyst composition according to claim 41, wherein the inorganic support is γ- alumina or zinc aluminate.

48. A method of making a catalyst composition, comprising:

a) modifying an inorganic support with at least one Group 2 element and at least one buffer-adjusted anion to produce a first modified inorganic support, wherein the first modified inorganic support comprises said at least one Group 2 element and said at least one buffer-adjusted anion;

b) calcining the first modified inorganic support to produce a calcined first modified inorganic support;

c) contacting the calcined first modified inorganic support with at least one organosilane to produce a second modified inorganic support, wherein the second modified inorganic support comprises said at least one Group 2 element, said at least one buffer- adjusted anion, and said at least one organosilane, or fragment thereof; and

d) calcining the second modified inorganic support to produce the catalyst composition.

49. A method for dehydrating crotyl alcohol to a diene product, comprising:

contacting and heating said crotyl alcohol with at least one catalyst that comprises an inorganic support, one or more promoter(s) selected from one or more Group 1 element(s), one or more Group 2 element(s), and combinations thereof, and one or more buffer-adjusted anion(s) at a WHSV at least about 0.3 hr¹,

50. A method according to claim 49, wherein said crotyl alcohol is in a mixture comprising about 1 ppm to about 93 wt-% water.

51. The method according to claim 50, wherein said mixture comprises about 5 wt-% to about 70 wt-% water.

52. A method according to claim 49, wherein said crotyl alcohol is bio-crotyl alcohol.

53. A method according to claim 49, wherein said one or more diene(s) is 1,3-butadiene.

54. A method according to claim 49, wherein the molar selectivity of said one or more diene(s) production is greater than about 95%.

55. A method according to claim 49, wherein the molar selectivity of said one or more diene(s) production is about 90% to about 99%.

56. A method according to claim 49, wherein said inorganic support comprises γ- alumina.

57. A method according to claim 49, wherein said catalyst is further modified by treatment with at least one organosilane.

58. The method according to claim 57, wherein said organosilane comprises an alkoxysilane.

59. A method according to claim 49, further comprising providing at least one carrier gas.

60. A method according to claim 49, wherein the Group 2 element is Ca.

61. A method according to claim 49, wherein the buffer-adjusted anion is selected from SO4^"2, H2PO4^"1, and mixtures thereof.

62. A method of producing crotyl alcohol, comprising growing a microorganism in a growth medium under fermentation conditions suitable for production of crotyl alcohol.

63. A method according to claim 62, wherein the microorganism expresses a native enzyme that can produce crotyl alcohol from a substrate in the growth medium.

64. A method according to claim 63, wherein the enzyme is an alcohol and/or aldehyde dehydrogenase.

65. A method according to claim 63, wherein the enzyme is an acyl-CoA reductase.

66. A method according to claim 63, wherein the substrate is crotonaldehyde.

67. A method according to claim 63, wherein the crotyl alcohol is produced from upstream biosynthetic intermediates comprising crotonic acid, crotonyl-CoA and/or other intermediates in the butanol/butanoate pathway.

68. A method according to claim 63, wherein the native enzyme is part of a native butanoate/butanol, fatty acid, amino acid degradation, or related metabolic pathway in the microorganism.

69. A method according to claim 68, wherein the metabolic pathway comprises an enzyme of a glycolytic or pentose phosphate pathway that converts glucose and/or xylose to acetyl-CoA, a thiolase enzyme that converts acetyl-CoA to acaetoacetyl-CoA, a 3 -hydroxy butyryl CoA dehydrogenase enzyme that converts acetoacetyl-CoA to 3-hydroxybutyryl- CoA, a crotonase enzyme that converts 3-hydroxybutyryl-CoA to crotonyl-CoA, an aldehyde dehydrogenase enzyme that converts crotonyl-CoA to crotonaldehyde, and an alcohol dehydrogenase enzyme that converts crotonaldehyde to crotyl alcohol._

70. A method according to claim 62, wherein the microorganism is a Clostridium strain.

71. A method according to claim 70, wherein the Clostridium microorganism expresses an enzyme that converts crotonaldehyde to crotyl alcohol.

72. A method according to claim 70, wherein the Clostridium microorganism expresses an enzyme that converts crotonyl-CoA to crotonaldehyde or crotyl alcohol.

73. A method according to claim 71, wherein the enzyme that converts crotonaldehyde to crotyl alcohol is a native enzyme in the Clostridium microorganism.

74. A method according to claim 72, wherein the enzyme that converts crotonyl-CoA to crotonaldehyde or crotyl alcohol is a native enzyme in the Clostridium microorganism.

75. A method according to claim 71, wherein the enzyme is an alcohol and/or aldehyde dehydrogenase.

76. A method according to claim 72, wherein the enzyme is an acyl-CoA reductase that converts crotonyl-CoA to crotyl alcohol without intervening additional enzymatic activities

77. A method according to claim 62, wherein the growth medium comprises one or more substances that increase production of crotyl alcohol in comparison to a growth medium that does not comprise the one or more substances.

78. A method according to claim 77, wherein the one or more substances comprise one or more co-factors of enzymes in a butanoate/butanol pathway in the microorganism.

79. A method according to claim 78, wherein the one or more co-factors include one or more of Mn, Fe, NADPH, and NADP.

80. A method according to claim 78, wherein the one or more substances modifies the activity of one or more native enzyme(s) in the microorganism, thereby increasing crotyl alcohol production.

81. A method according to claim 80, wherein bed is inhibited by the one or more substances in the growth medium.

82. A method according to claim 80, wherein adhE and adh2 are activated by the one or more substances in the growth medium.

83. A method according to claim 77, wherein the one or more substances in the growth medium comprises one or more divalent metal ion(s), iodoacetamide, myristoyl-CoA, N- ethylmaleimide, and/or palmitoyl-CoA.

84. A method according to claim 83, wherein the one or more divalent metal ion(s) is selected from selected from Ca, Co, Zn, and Mn, and combinations thereof.

85. A method according to claim 62, wherein the growth medium comprises carbohydrate molecules produced by hydrolysis of lignocellulosic biomass.

86. An engineered Clostridium strain that produces a greater amount of crotyl alcohol than the parent strain from which it was derived.

87. A Clostridium strain according to claim 86, wherein said strain has been engineered to comprise a reduced level or activity of butyryl-CoA dehydrogenase in comparison to the parent strain from which it was derived.

88. A Clostridium strain according to claim 87, wherein one or more enzyme(s) of a crotyl alcohol biosynthetic pathway is overexpressed.

89. A Clostridium strain according to claim 88, wherein the one or more enzyme(s) of crotyl alcohol biosynthesis comprises an enzyme of a glycolytic or pentose phosphate pathway that converts glucose and/or xylose to acetyl-CoA, a thiolase enzyme that converts acetyl-CoA to acaetoacetyl-CoA, a 3 -hydroxy butyryl CoA dehydrogenase enzyme that converts acetoacetyl-CoA to 3-hydroxybutyryl-CoA, a crotonase enzyme that converts 3- hydroxybutyryl-CoA to crotonyl-CoA, an aldehyde dehydrogenase enzyme that converts crotonyl-CoA to crotonaldehyde, and/or an alcohol dehydrogenase enzyme that converts crotonaldehyde to crotyl alcohol.

90. A Clostridium strain according to claim 89, wherein the one or more enzyme(s) of crotyl alcohol biosynthesis comprises at least one alcohol dehydrogenase.

91. A Clostridium strain according to claim 87, wherein said strain is an SiHybrid in which butyryl-CoA dehydrogenase activity is downregulated in comparison to the parent strain from which it was derived.

92. A Clostridium strain according to claim 87, wherein butyryl-CoA dehydrogenase has been inactivated using a targetron gene knockout system.

93. A method of producing crotyl alcohol, comprising growing the Clostridium strain according to claim 86 in a growth medium under fermentation conditions suitable for production of crotyl alcohol.

94. A method according to claim 93, wherein the growth medium comprises carbohydrate molecules produced by hydrolysis of lignocellulosic biomass.