WO2016003047A1 - Method for analyzing fetus gene information from blood or blood plasma of pregnant woman by using digital pcr - Google Patents

Method for analyzing fetus gene information from blood or blood plasma of pregnant woman by using digital pcr Download PDF

Info

Publication number
WO2016003047A1
WO2016003047A1 PCT/KR2015/002438 KR2015002438W WO2016003047A1 WO 2016003047 A1 WO2016003047 A1 WO 2016003047A1 KR 2015002438 W KR2015002438 W KR 2015002438W WO 2016003047 A1 WO2016003047 A1 WO 2016003047A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
oligonucleotide
target gene
nucleotide sequence
gene
Prior art date
Application number
PCT/KR2015/002438
Other languages
French (fr)
Korean (ko)
Inventor
황승용
김승준
연종필
김지훈
이승용
Original Assignee
바이오코아 주식회사
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 바이오코아 주식회사 filed Critical 바이오코아 주식회사
Publication of WO2016003047A1 publication Critical patent/WO2016003047A1/en

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2527/00—Reactions demanding special reaction conditions
    • C12Q2527/146—Concentration of target or template
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2531/00—Reactions of nucleic acids characterised by
    • C12Q2531/10—Reactions of nucleic acids characterised by the purpose being amplify/increase the copy number of target nucleic acid
    • C12Q2531/113—PCR
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2537/00—Reactions characterised by the reaction format or use of a specific feature
    • C12Q2537/10—Reactions characterised by the reaction format or use of a specific feature the purpose or use of
    • C12Q2537/143—Multiplexing, i.e. use of multiple primers or probes in a single reaction, usually for simultaneously analyse of multiple analysis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/112—Disease subtyping, staging or classification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays

Definitions

  • the present invention relates to a method for analyzing genetic information of a fetus from pregnant women's blood or plasma using digital PCR, and more particularly, from a fetal-derived gene present in a small amount in pregnant women's blood or plasma using digital PCR.
  • the present invention relates to a method of collecting and analyzing genetic information and applying it to diagnosis.
  • the present invention obtains the basic result of the genetic information of the fetus from the fetal-derived gene present in a small amount in the pregnant woman's blood or plasma, and performs digital PCR on a sample in which the fetal-derived gene is present in the pregnant woman's blood or plasma.
  • analyzing the genetic information of the fetus relates to a method that can be used for early diagnosis of genetic diseases caused by abnormalities in the number of genes among the genetic diseases of the fetus.
  • the present invention provides a digital PCR using a primer pair and probe specific to the target gene for the abnormal number of genes in performing the genetic analysis of the abnormal number of genes of the fetus from the blood or plasma of the pregnant woman.
  • the abnormality of the number of genes related to the fetal origin target gene present in a small amount in maternal blood or plasma is not detected by the background signal of the mother-derived gene present in a large amount or is detected as an unknown signal.
  • the present invention eliminates barriers that make it difficult to integrate genotyping techniques and digital PCR techniques using fetal-derived cell free genes, and furthermore, it is difficult to separate only signals derived from fetal-derived genes and to maternal-derived gene background signals. In order to solve the problem caused by satisfying the Poisson distribution required in the digital PCR technology to provide a reliable technology for quantitative results.
  • hereditary disease in the fetus has been increasing rapidly in recent decades due to the aging of the marriage population and the aging age of the child.
  • Early detection of pregnancy-related diseases, including fetal genetic abnormalities enables early detection of pregnancy-related diseases and fetal genetics, as early medical measures are necessary for safety while reducing pain for pregnant women and the fetus. It is very important to diagnose abnormalities early.
  • Genetic abnormalities that may occur in the fetus include abnormal gene counts, for example trisomy, translocation, deletion, duplication, and insertion of chromosomes. Structural and functional abnormalities occur. This abnormality in the number of genes is known to occur at a higher frequency as the age of pregnant women.
  • Amniotic fluid puncture method is used to diagnose the genetic abnormality of the fetus, which is a method of examining the genetic abnormality of the fetus by collecting the amniotic fluid containing fetal tissue cells and examining the chromosomes or DNA in the fetal tissue cells. to be.
  • amniotic fluid test is an invasive test that carries risks as a prenatal diagnosis, and there is a risk of bacterial infection of the amniotic membrane with a syringe, a wound problem with a syringe, a leak of amniotic fluid, etc., and in serious cases, it may be a miscarriage.
  • Non-invasive diagnosis of such genetic diseases of the fetus requires a technique capable of stably securing the genetic information of the fetus present in a small amount in the mother's blood or plasma without missing and error of information.
  • research and diagnosis are proceeding without knowing the proportion of the genetic information of the fetus present in the blood and plasma of the pregnant woman, there may be a problem in the reliability of the analysis result for the analyzed fetal-derived cell free gene. That is, there is a difficulty in separating only the cell free genes derived from the fetus from the mother's blood, and there is a risk of loss of very valuable fetal gene information in this separation process.
  • Korean Patent Publication No. 10-1387582 discloses a nucleic acid having a continuous short length starting from the 5 'end of a fetal nucleic acid to be detected in order to more effectively detect a cell free fetal nucleic acid present in a very small amount in the mother.
  • a method of designing a primer capable of amplifying a part and performing real-time PCR on the target to detect a cell free fetal nucleic acid in the mother is disclosed.
  • real-time PCR method adopted by the prior art is a non-invasive method
  • there are limitations in performing various kinds of tests at once and it is necessary to use a standard curve to detect an abnormal number of genes of the fetus and consume a sample.
  • the disadvantage is that the amount of is required more than a certain level.
  • real-time PCR adopts a method of quantifying the number of gene copies by matching the Ct or Cp value of the standard curve with the Ct or Cp value of the test sample. Secondary analysis is needed.
  • the amount of fetal-derived genes obtained from maternal blood or plasma samples is extremely low than the amount of maternal-derived genes.
  • Digital PCR Digital PCR
  • the result signal has a value of "0" or "1”
  • the digital PCR method of analysis method is a digital method.
  • Digital PCR Digital PCR
  • Digital PCR is a technique that allows absolute quantification of DNA samples by applying single molecule counting method that does not require a standard curve.It performs more accurate absolute quantification by PCR reaction on one droplet per well. There is an advantage to this (see Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol. Diagn. 4 (1), 41-47 (2004)).
  • Digital PCR distributes each droplet containing sample gene templates, amplification primers and fluorescent probes prepared to be diluted to an average of 0.5 to 1 copy number into one well and performs emulsion PCR. Samples of the number of gene copies are distributed and represent signals after amplification, so the count is "1". Wells without fluorescence signal are counted as "0" because no copies of samples are distributed and no signal occurs. Absolute quantification can be achieved by counting.
  • quantification in digital PCR uses the Poisson distribution to determine if a signal per well is present or absent as a digital value of 1 or 0 to calculate the ratio of positive (value of 1) and negative (value of 0). However, if the ratio of positive to total positive and negative sum significantly exceeds one gene copy in the Poisson distribution, it means that there is a probability that more than one gene copy per well can be guaranteed. There will be no.
  • digital PCR may be performed using primer pairs and probes specific for target genes related to the abnormal number of genes.
  • the problem that the abnormality of the number of genes related to the fetal origin target gene present in a small amount in the mother's blood or plasma is not detected by the background signal of the mother-derived gene present in a large amount or is detected as an unclear signal. Will be.
  • This problem has become a barrier that makes the integration of digital PCR technology with genotyping techniques using fetal cell free genes.
  • An object of the present invention is to provide a method that can be applied to diagnosis by collecting characteristic genetic information from a fetal-derived gene present in a small amount in pregnant women's blood or plasma using digital PCR.
  • an object of the present invention is to obtain a basic result of the genetic information of the fetus from the fetal-derived gene present in a small amount in the pregnant woman's blood or plasma, digital PCR for a sample having a fetal-derived gene present in the pregnant woman's blood or plasma
  • digital PCR for a sample having a fetal-derived gene present in the pregnant woman's blood or plasma
  • PCR is performed, abnormalities in the number of genes associated with fetal origin target genes present in a small amount in maternal blood or plasma are not detected by the background signals of maternally derived genes present in large quantities or are detected as unknown signals. It is to provide a method for solving the problem.
  • an object of the present invention is to solve the barrier that makes it difficult to integrate the genotyping technique using the fetal-derived cell free gene and the digital PCR technique, and also to prevent the problem of separating only the signal derived from the fetal-derived gene and the mother-derived gene background.
  • an object of the present invention is to solve the barrier that makes it difficult to integrate the genotyping technique using the fetal-derived cell free gene and the digital PCR technique, and also to prevent the problem of separating only the signal derived from the fetal-derived gene and the mother-derived gene background.
  • the present invention quantifies the ratio of maternal amplification gene and fetal origin gene amplification by the real-time PCR amplification of a specific target gene in a pregnant woman's blood or plasma sample to the blood and plasma
  • the present invention provides a technique for confirming the existence of fetal-derived gene fragments and stably collecting fetal genetic information based on the feasibility, thereby increasing the possibility of early diagnosis of fetal genetic diseases.
  • the present invention performs a digital PCR for the blood or plasma samples of pregnant women detected that the fetal-derived gene is present, but is not related to the number of genes, common to the maternal and fetal-derived gene set
  • amplification using digital PCR is performed on the genes to be compared (control genes) and target genes related to the number of genes, and the digital PCR quantification results of the genes to be compared (control genes) satisfy the Poisson distribution, ie
  • a technique for analyzing gene number or more is provided by comparing digital PCR quantification results of a target gene with digital PCR quantification results of a control gene.
  • real-time PCR is a fluorescent material applied to the PCR technique, and the emission of the fluorescent material together with the amplification of the target gene present in the sample during the reaction.
  • a method for rapidly and accurately analyzing the presence or absence of amplification of a target gene is divided into a method using SYBR Green and a method using a double labeled probe.
  • SYBR green technique uses the SYBR green dye in the amplified DNA during real-time PCR amplification process and binds to the double-stranded DNA synthesized by the PCR reaction to generate a fluorescence signal. It is a method that can measure the presence and the amount of amplification products produced therefrom.
  • real-time PCR using a dual labeled probe is a method using a double labeled probe labeled with a fluorescent material at the 5 'end and a quencher labeled with the 3' end. The fluorescent signal by the labeled probe can confirm whether the double-labeled probe is annealed with the PCR amplification product of the target gene, and the presence of the target gene and the amount of amplification product generated therefrom can be measured.
  • digital PCR digital PCR
  • Digital PCR can analyze up to 3,072 samples in one well plate, and can analyze up to four such well plates at the same time, so that a large amount of samples can be analyzed and various samples can be performed.
  • digital PCR is a technology that does not require an analysis process using a standard curve and can easily quantify the digital value by counting the number of wells representing a fluorescent signal (Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol.Diagn. 4 (1), 41-47 (2004)).
  • target gene refers to a gene having a useful mutation for genotyping among genes in a sample to be analyzed, for example, a marker gene used for gene identification or identification of an individual, a specific disease. Marker genes used for the diagnosis of chromosomes, genes representing more than or equal to chromosomes, genes with genetically significant mutations, genes with STR (short tandem repeat) and genes with single nucleotide polymorphism. have.
  • control gene refers to a gene known to be unrelated to the number of genes in both maternal or fetal-derived gene sets in maternal blood or plasma.
  • control genes, target genes and related chromosomes described in the embodiments of the present invention should be understood as examples, and methods for analyzing fetal genetic information from pregnant women's blood or plasma using the digital PCR of the present invention are various individuals. Or as a technology applicable to genotyping or gene count analysis of samples and various target genes and chromosomes.
  • step (b) Digital PCR is performed by distributing a sample detected as having fetal-derived genes by the analysis of step (a) to each well of the well plate, and is commonly present in the maternal and fetal-derived gene sets. Performing a digital PCR on a control gene not related to the abnormal number of genes and a target gene related to the abnormal number of genes,
  • step (c) quantifying the digital PCR amplification products of the control gene obtained in step (b), and analyzing whether the number of control gene copies per well is statistically close to one;
  • step (d) If the analysis of step (c) determines that the number of control gene copies per well is statistically greater than one, the sample is further diluted to perform steps (b) and (c). Repeating steps,
  • step (e) If the analysis result of step (c) determines that the number of control gene copies per well is statistically close to one, the digital PCR amplification product of the target gene is quantified, and the digital PCR of the control gene is performed. Calculating a ratio of the digital PCR quantitative value of the target gene to the quantitative value;
  • step (f) determining that there is more than the number of genes in the target gene derived from the fetus if the ratio calculated in step (e) is 1.5 or more.
  • the fact that the number of control gene copies per well is statistically close to 1 shows that the results of digital PCR quantification of the control gene are not. Satisfying the subson distribution means that the quantitative results of the digital PCR are statistically significant. For example, if exactly one copy per well as well as if the copy per well falls within the range of about 1.01 to 1.59, more preferably if it falls within the range of about 1.01 to 1.39 is also statistically one. To be considered close.
  • the digital PCR quantitative value of the control gene in the step (e) is the average copy number of the control gene per well
  • the target The digital PCR quantitative value of a gene can be the average copy number of the target gene per well.
  • the dilution of the sample in the step (d) is carried out step by step up to about 1000-5000 times desirable.
  • the present invention it is possible to solve the conventional problem of making it difficult to integrate the genotyping technique using the fetal-derived cell free gene and the digital PCR technique.
  • the number of copies of target genes related to the fetal genetic disease should be adjusted to 1 per well, but this is technically very difficult.
  • the digital PCR quantification result is the sum of the amplification results of the target gene template of the pregnant woman and the amplification of the target gene template of the fetus
  • the fetal target gene template may be used to identify more than the gene number of the target gene of the fetus. It is difficult to judge only the amplification result of.
  • the method of the present invention has the configuration as described above, while solving the difficult problem of separation of only the signal derived from the fetal-derived gene and the problem caused by the maternal-derived gene background signal, while the Poisson distribution required in digital PCR technology It is possible to provide a technology that can satisfy the quantitative results by satisfying the.
  • control genes and target genes and related chromosomes can be applied to the method of the present invention, and various probe pairs for detecting various primer pairs and amplification products for amplifying such control genes and target genes are also genes of interest. It can be designed using the target sequence.
  • control gene is a group consisting of a control gene having a nucleotide sequence of SEQ ID NO: 33, which is a gene on chromosome 2, and a control gene having a nucleotide sequence of SEQ ID NO: 37, a gene on chromosome 1 At least one selected from can be used.
  • primer pairs of SEQ ID NOs: 34 and 35 may be used, and as a probe for detecting a control gene amplification product having a nucleotide sequence of SEQ ID NO: 33, a sequence At least one probe selected from the group consisting of an oligonucleotide of No. 36 and an oligonucleotide complementary to such oligonucleotide can be used.
  • primer pairs of SEQ ID NOs: 38 and 39 may be used, and as a probe for detecting a control gene amplification product having the nucleotide sequence of SEQ ID NO: 37.
  • At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 40 and an oligonucleotide complementary to such oligonucleotide may be used.
  • the control gene having the nucleotide sequence of SEQ ID NO: 33 and of SEQ ID NO: 37
  • a control gene amplification product having the nucleotide sequence of SEQ ID NO: 33 and a control gene amplification product having the nucleotide sequence of SEQ ID NO: 37 are prepared.
  • the target gene may be at least one selected from the group consisting of a target gene on chromosome 21, a target gene on chromosome 13, and a target gene on chromosome 18.
  • digital PCR for at least two target genes selected from the group consisting of a target gene on chromosome 21, a target gene on chromosome 13 and a target gene on chromosome 18 simultaneously Can be done.
  • the target gene on chromosome 21 may be a target gene having the nucleotide sequence of SEQ ID NO: 21, a target gene having the nucleotide sequence of SEQ ID NO: 25, and a target gene having the nucleotide sequence of SEQ ID NO: 29 At least one selected from the group consisting of may be used.
  • a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 21 may be used a primer pair of SEQ ID NO: 22 and 23, and a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 21 At least one probe selected from the group consisting of an oligonucleotide of No. 24 and an oligonucleotide complementary to such oligonucleotide can be used.
  • primer pairs of SEQ ID NO: 26 and 27 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 25.
  • At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 and an oligonucleotide complementary to such oligonucleotide may be used.
  • primer pairs of SEQ ID NOs: 30 and 31 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 29.
  • At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 32 and an oligonucleotide complementary to such oligonucleotide can be used.
  • a base sequence of SEQ ID NO: 21 using a mixture of primer pairs of SEQ ID NOs: 22 and 23, primer pairs of SEQ ID NOs: 26 and 27, and primer pairs of SEQ ID NOs: 30 and 31 A target gene having a nucleotide sequence of SEQ ID NO: 25, and a target gene having the nucleotide sequence of SEQ ID NO: 29 are amplified together in the same well and complementary to the oligonucleotide of SEQ ID NO: 24
  • the target gene on chromosome 18 is a target gene having the nucleotide sequence of SEQ ID NO: 57, a target gene having the nucleotide sequence of SEQ ID NO: 61, a target having the nucleotide sequence of SEQ ID NO: 65 At least one selected from the group consisting of a gene and a target gene having a nucleotide sequence of SEQ ID NO: 69 may be used.
  • a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 57 may be used a primer pair of SEQ ID NO: 58 and 59, and a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 57 At least one probe selected from the group consisting of an oligonucleotide of No. 60 and an oligonucleotide complementary to such oligonucleotide can be used.
  • primer pairs of SEQ ID NOs: 62 and 63 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 61.
  • At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 64 and an oligonucleotide complementary to such oligonucleotide can be used.
  • a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 65 a primer pair of SEQ ID NOs: 66 and 67 may be used and a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 65.
  • a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 65 As the oligonucleotide of SEQ ID NO: 68 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides can be used.
  • a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 69 a primer pair of SEQ ID NOs: 70 and 71 may be used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 69. May be used at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 72 and an oligonucleotide complementary to such oligonucleotide.
  • a mixture of primer pairs of SEQ ID NOs: 58 and 59, primer pairs of SEQ ID NOs: 62 and 63, primer pairs of SEQ ID NOs: 66 and 67, and primer pairs of SEQ ID NOs: 70 and 71 are used
  • the target gene having the nucleotide sequence of SEQ ID NO: 57, the target gene having the nucleotide sequence of SEQ ID NO: 61, the target gene having the nucleotide sequence of SEQ ID NO: 65, and the target gene having the nucleotide sequence of SEQ ID NO: 69 Are amplified together in the same well and at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 60 and oligonucleotides complementary to these oligonucleotides, oligonucleotides of SEQ ID NO: 64 and oligonucleotides complementary to these oligonucleotides At least one probe selected from the group consisting
  • the target gene on chromosome 13 is a target gene having the nucleotide sequence of SEQ ID NO: 41, a target gene having the nucleotide sequence of SEQ ID NO: 45, a target having the nucleotide sequence of SEQ ID NO: 49 At least one selected from the group consisting of a gene and a target gene having a nucleotide sequence of SEQ ID NO: 53 may be used.
  • primer pairs of SEQ ID NOs: 42 and 43 may be used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 41, a sequence At least one probe selected from the group consisting of an oligonucleotide of number 44 and an oligonucleotide complementary to such oligonucleotide can be used.
  • primer pairs of SEQ ID NOs: 46 and 47 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 45.
  • At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 48 and an oligonucleotide complementary to such oligonucleotide can be used.
  • primer pairs of SEQ ID NO: 50 and 51 may be used as a primer pair for amplifying the target gene having the nucleotide sequence of SEQ ID NO: 49
  • primer pairs of SEQ ID NO: 50 and 51 may be used as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 49
  • the oligonucleotide of SEQ ID NO: 52 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides can be used as the oligonucleotide of SEQ ID NO: 52 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides can be used.
  • primer pairs of SEQ ID NOs: 54 and 55 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 53. May be used at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 56 and an oligonucleotide complementary to such oligonucleotide.
  • a mixture of primer pairs of SEQ ID NOs: 42 and 43, primer pairs of SEQ ID NOs: 46 and 47, primer pairs of SEQ ID NOs: 50 and 51, and primer pairs of SEQ ID NOs: 54 and 55 are used
  • the target gene having the nucleotide sequence of SEQ ID NO: 41, the target gene having the nucleotide sequence of SEQ ID NO: 45, the target gene having the nucleotide sequence of SEQ ID NO: 49, and the target gene having the nucleotide sequence of SEQ ID NO: 53 Are amplified together in the same well and at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 44 and oligonucleotides complementary to these oligonucleotides, oligonucleotides of SEQ ID NO: 48 and oligonucleotides complementary to these oligonucleotides At least one probe selected from the group consisting of At least one probe selected from the group consisting of At least one probe
  • control gene composition for digital PCR quantification which is common to the mother-derived and fetal-derived gene sets in a gene sample and is not associated with abnormal number of genes.
  • the control gene composition for digital PCR quantification of an embodiment of the present invention comprises at least one gene selected from the group consisting of the gene of SEQ ID NO: 37 on chromosome 1 and the gene of SEQ ID NO: 33 on chromosome 2, It is amplified and quantified to obtain a reference quantitative value for calculating a normalized value from the quantitative value obtained after amplification of a target gene related to an abnormal number of genes present. In this case, the normalization value is calculated to determine whether or not the number of genes of the target gene.
  • the present invention provides a probe composition for a control gene used to detect and quantify an amplification product of a control gene present in a gene sample.
  • Probe composition for a control gene of an embodiment of the present invention the oligonucleotide of SEQ ID NO: 36 specific to the control gene having a nucleotide sequence of SEQ ID NO: 33 and at least one selected from the group consisting of oligonucleotides complementary to such oligonucleotide
  • the present invention also provides a well plate for amplifying a genetic sample extracted from pregnant women's blood or plasma, and for detecting and quantifying amplification products.
  • two or more probes may be individually dispensed into each well or mixed together and dispensed into one well.
  • the well plate is at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 24 specific to a target gene having a nucleotide sequence of SEQ ID NO: 21 on chromosome 21 and an oligonucleotide complementary to such oligonucleotide, and 21 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 specific to a target gene having the nucleotide sequence of SEQ ID NO: 25 on chromosome No.
  • the it may further include a dispensing well. In this case, two or more probes may be individually dispensed into each well or mixed together and dispensed into one well. The probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 21. For example, the number of genes may be trisomy.
  • the well plate may include at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 60 specific to a target gene having a nucleotide sequence of SEQ ID NO: 57 on chromosome 18, and an oligonucleotide complementary to the oligonucleotide; At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 64 specific for a target gene having a nucleotide sequence of SEQ ID NO: 61 on chromosome 18 and an oligonucleotide complementary to such oligonucleotide, and a sequence on chromosome 18 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 68 specific to a target gene having a nucleotide sequence of SEQ ID NO: 65 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of S
  • two or more probes may be individually dispensed into each well or mixed together and dispensed into one well.
  • the probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 18.
  • the number of genes may be trisomy.
  • the well plate may include at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 44 specific to a target gene having a nucleotide sequence of SEQ ID NO: 41 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide; At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 48 specific to a target gene having a nucleotide sequence of SEQ ID NO: 45 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide, and a sequence on chromosome 13 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 52 specific to a target gene having a nucleotide sequence of SEQ ID NO: 49, and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID
  • two or more probes may be individually dispensed into each well or mixed together and dispensed into one well.
  • the probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 13.
  • the number of genes may be trisomy.
  • the present invention also provides probe compositions for target genes that are used to detect and quantify target gene amplification products associated with more than the number of genes present in a genetic sample.
  • the probe composition for a target gene of an embodiment of the present invention is selected from the group consisting of an oligonucleotide of SEQ ID NO: 24 specific to a target gene having a nucleotide sequence of SEQ ID NO: 21 on chromosome 21 and an oligonucleotide complementary to such oligonucleotide At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 specific to a target gene having a nucleotide sequence of SEQ ID NO: 25 on chromosome 21, and an oligonucleotide complementary to such oligonucleotide; , A group consisting of an oligonucleotide of SEQ ID NO: 32 specific to a target gene having the nucleotide sequence of SEQ ID NO: 29 on chromosome 21 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotide From comprises at least one probe selected.
  • the probe composition for a target gene of an embodiment of the present invention is a group consisting of an oligonucleotide of SEQ ID NO: 60 specific to a target gene having a nucleotide sequence of SEQ ID NO: 57 on chromosome 18 and an oligonucleotide complementary to such oligonucleotide
  • the probe composition for a target gene of an embodiment of the present invention is a group consisting of an oligonucleotide of SEQ ID NO: 44 specific to a target gene having a nucleotide sequence of SEQ ID NO: 41 on chromosome 13 and an oligonucleotide complementary to such oligonucleotide
  • one end of the probe as described above for example, the 5 'end is Cy5, Cy3, x-rhodamine, Texas red, SYBR green, SYBR green, FAM, VIC, JOE, NED, HEX And a fluorescent material such as TET, and the other end of the probe, for example, the 3 'end may be IABkFQ, DABCYL, TAMRA, ECLIPSE, BHQ (BHQ-1, BHQ-2, BHQ-3, etc.), and the like. It may be labeled with a matte material.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be used.
  • the present invention can be applied to diagnosis by collecting and analyzing characteristic genetic information from a fetal-derived gene present in a small amount in the blood or plasma of pregnant women using digital PCR.
  • the present invention obtains the basic result of the genetic information of the fetus from the fetal-derived gene present in a small amount in the pregnant woman's blood or plasma, and performs digital PCR on a sample in which the fetal-derived gene is present in the pregnant woman's blood or plasma.
  • the genetic information of the fetus can be used for early diagnosis of genetic diseases caused by abnormalities in the number of genes among the genetic diseases of the fetus.
  • the present invention is to perform a genetic analysis of the abnormality of the number of genes of the fetus from the blood of the pregnant woman from the plasma, the blood from the pregnant woman by the background signal of the mother-derived gene present in a large amount when performing the digital PCR It is possible to solve the problem that abnormalities in the number of genes related to fetal origin target genes present in small amounts in plasma are not detected or are detected as an unclear signal. That is, the present invention uses fetal-derived genes present in trace amounts in the sample obtained from the blood of the pregnant woman, but the genotyping process for specific target genes of the fetus is easy, but the test can be performed with high reliability even at very low concentrations. .
  • the present invention can solve the barriers that make it difficult to integrate genotyping techniques and digital PCR techniques using fetal-derived cell-free genes, and it is also difficult to separate only signals derived from fetal-derived genes and the mother-derived gene background. It is possible to provide a technology that can reliably quantify the results by satisfying the Poisson distribution required in the digital PCR technology while solving the signal problem.
  • FIG. 1 is a graph showing the results of real-time PCR quantification for APP genes for each sample, and dividing the results into results for short amplicons (length 67bp) and for long amplicons (length 180bp).
  • FIG. 2 is a graph showing the results of TaqMan ® Copy Number Assays analysis using CopyCaller ® software, an analysis software.
  • Figure 3 is a schematic diagram showing the location of the target gene and the control gene on chromosome 21 selected to perform genetic analysis on the gene derived from the fetus.
  • FIG. 4 is a diagram schematically showing the positions of the target gene on chromosome 13 and the target gene on chromosome 18 selected for performing genetic analysis on fetal-derived genes.
  • Example 5 is a photograph showing the results of electrophoresis after performing PCR amplification products on the corresponding target gene and control gene using each primer pair designed in Example 3-1.
  • 6 to 24 show graphs of real-time PCR of corresponding target genes and control genes using each primer pair and detection probe designed in Example 3-1.
  • Example 25 is a digital PCR layout performed in Example 4-1.
  • FIG. 26 is a diagram showing a result of performing digital PCR in Example 4-1 by a digital PCR heat map.
  • FIG. 27 is a graph quantitatively illustrating the number of copies of each target gene and the number of copies of each control gene by analyzing fluorescence values measured in each well of FIG. 26.
  • Example 28 is a digital PCR layout performed in Example 4-2.
  • Example 29 is a diagram showing the results of performing digital PCR in Example 4-2 with a digital PCR heat map.
  • FIG. 30 is a graph quantitatively illustrating the copy number of each target gene and the copy number of each control gene by analyzing the fluorescence values measured in each well of FIG. 29.
  • Example 31 is a digital PCR layout performed in Example 4-3.
  • Example 32 is a diagram showing the results of performing digital PCR in Example 4-3 with a digital PCR heat map.
  • FIG. 33 is a graph quantitatively illustrating the number of copies of each target gene and the number of copies of each control gene by analyzing the fluorescence values measured in each well of FIG. 32.
  • 35 is a diagram showing a result of performing digital PCR in Example 4-4 with a digital PCR heat map.
  • FIG. 36 is a graph quantitatively illustrating the number of copies of each target gene and the number of copies of each control gene by analyzing fluorescence values measured in each well of FIG. 35.
  • fetal derived DNA in maternal blood or plasma is smaller than maternally derived DNA. Therefore, real-time PCR amplification of small fetal-derived DNA and larger maternal-derived DNA with respect to a specific gene results in fetal-derived DNA and maternal-derived DNA present in maternal blood or plasma with respect to a specific gene. The amount of these genes can be determined from this.
  • the specific genes commonly present in fetal-derived DNA and maternal-derived DNA in maternal blood or plasma samples are APP (Amyloid Precursor protein) gene (GenBank accession No. NM_000484), ⁇ -actin gene, and SRY gene.
  • APP Amyloid Precursor protein
  • ⁇ -actin gene a gene that influences the expression of fetal-derived DNA in maternal blood or plasma samples.
  • SRY gene a gene that influences the fetal-derived DNA and maternal-derived DNA related to the specific gene.
  • a pair of primers capable of amplifying the fetal-derived DNA and maternal-derived DNA related to the specific gene, and a fluorescently labeled probe capable of confirming the result of the amplification reaction were designed (see Table 1 below). These primers and probes were synthesized by BIO Corporation (Daejeon Metropolitan City, Korea).
  • short amplicons (length 67bp) from fetal-derived DNA and maternal-derived DNA were obtained from the primer pairs of SEQ ID NOs: 2 and 3, and From the primer pairs, long amplicons (180 bp in length) from maternally derived DNA are obtained.
  • short amplicons (83 bp in length) from fetal-derived DNA and maternal-derived DNA are obtained from the primer pairs of SEQ ID NOs: 6 and 7, and maternal-derived DNA from the primer pairs of SEQ ID NOs: 6 and 8 Long amplicons (170 bp in length) are obtained.
  • short amplicons (length 67bp) from fetal-derived DNA and maternal-derived DNA were obtained from the primer pairs of SEQ ID NOs: 10 and 11, and long amplicons from the mother-derived DNA from the primer pairs of SEQ ID NOs: 10 and 12. (Length 169 bp) is obtained.
  • short amplicons (79 bp in length) from fetal-derived DNA and maternally-derived DNA are obtained from the primer pairs of SEQ ID NOs: 14 and 15, and from parental DNA from the primer pairs of SEQ ID NOs: 14 and 16.
  • a long amplicon (length 185 bp) is obtained.
  • short amplicons (length 90bp) from fetal-derived DNA and maternal-derived DNA are obtained from the primer pairs of SEQ ID NOs: 18 and 19, and long amplicons from the mother-derived DNA from the primer pairs of SEQ ID NOs: 18 and 20. (Length 189 bp) is obtained.
  • Gynecological DNA (gDNA) extracted from maternal blood or plasma, or maternal blood was provided for blind testing by a gynecological department in Korea. Each sample is given an arbitrary sample number as shown in Table 4 below, and then the same sample number is also used for the extracted gDNA sample corresponding to each sample.
  • Plasma was isolated from the maternal blood sample. For plasma samples (dose: 1 ml), gDNA was extracted using QIAamp Circulating Nucleic Acid Kit (Qiagen Cat # 55114) from QIAGEN, Germany. gDNA extraction was performed according to the QIAamp Circulating Nucleic Acid Kit manufacturer's manual. This will be described in detail as follows.
  • a vacuum pump system was used to increase the yield of gDNA extracted by improving the adsorption of the membrane on the column of QIAamp Circulating Nucleic Acid Kit.
  • a vacuum pump system Using a vacuum pump system, a QIAamp Mini column and a 20 ml tube extender were mounted to allow the ACB buffer mixture to flow into the QIAamp mini column. After operating the vacuum pump system and flushing the ACB buffer mixture, the vacuum pump system was adjusted to zero and the tube extender was removed. This process ensures that the maximum amount of reactant is bound to the membrane of the QIAamp mini column.
  • ACW1 buffer 600 ⁇ L of ACW1 buffer, the first buffer solution to wash the reactants bound to the QIAamp mini column, was run by the vacuum pump system and flowed into the QIAamp mini column, then the vacuum pump system was adjusted to zero and the tube The extender was removed. This process washes the DNA binding to the QIAamp mini column membrane.
  • a second wash operation is performed to obtain high purity DNA.
  • a second wash solution, 750 ⁇ L of ACW2 buffer was run on a vacuum pump system and flowed into the QIAamp mini column, then the vacuum pump system was adjusted to zero and the tube extender was removed. Through this process, the DNA binding to the QIAamp mini column membrane can be further washed, and high purity DNA can be obtained.
  • Real-time PCR was performed for quantification of gDNA samples provided for blind testing or gDNA samples isolated from blood or plasma samples through the above procedure.
  • real time PCR was performed using a 7900HT Fast Real Time PCR System (Life Technologies, USA).
  • Real-time PCR such as each primer pair and detection probe for obtaining and detecting each amplicon shown in Table 1, a DNA template prepared as described above, and a real-time PCR master mixture
  • the PCR amplification master mix in the PCR amplification composition includes, for example, a PCR buffer, dNTP, DNA polymerase, and the like.
  • a real-time PCR master mix is used as TaqMan ® Universal Master Mix II, no UNG ( Life Technologies, Cat. 4440040).
  • real-time PCR was repeated under the real-time PCR amplification composition of Table 2 for each DNA template prepared for the blind test under the real-time PCR amplification composition of Table 2.
  • the fluorescence value was measured at the FAM wavelength, and the fluorescence intensity of the reaction cycle was analyzed using SDS software.
  • the real-time PCR quantitative results of the APP gene are summarized for each sample, and the results are shown in FIG. 1 by dividing the results for the short amplicon (length 67bp) and the long amplicon (length 180bp). If the R2 value is 0.99 or more, it means that the result is high reliability. Therefore, it can be seen that the standard curve of FIG. 1 is high in stability and the quantitative result is high in reliability.
  • Ratio amount of short amplicons (length 67 bp) / amount of long amplicons (length 180 bp)
  • Equation 1 the content of the fetus-derived gene present in pregnant blood or plasma can be obtained for each sample.
  • Fetal-derived gene content (%) (ratio obtained from Equation 1 -1.1188) /0.065
  • the ratio of the cell free fetus-derived gene may be determined, and Equation 2 may be used to infer the content of the fetal-derived gene present in pregnant blood or plasma.
  • Table 4 shows the results of quantification of real-time PCR for short amplicons (length 67bp), quantification of real-time PCR for long amplicons (length 180bp), their ratios, and fetal-derived genes present in pregnant blood or plasma. The result of calculating the content of is summarized and shown for each sample.
  • the blind test sample (for example, F1 sample, F22 sample, G1 sample), which is calculated to contain a predetermined amount of the gene derived from the fetus, is a fetus-derived gene. It can be used for digital PCR analysis involving gene number abnormalities.
  • Copy number assays and copy number variation tests can be performed to confirm again that the content of fetal derived DNA calculated from the real-time PCR quantitative results in Example 1 is reliable.
  • TaqMan ® Copy Number Assays and copy number variation tests known in the art are performed as follows.
  • Genomic DNA (gDNA) is used as a template for TaqMan ® Copy Number Assays.
  • Quantitative PCR is used to create and use standard curves of genomic DNA or plasmid DNA templates.
  • the amount of DNA is measured using UV absorbance (A260 / A280), and in the case of human gDNA, the absorbance ratio of A260 / A280 is 1.7 or more.
  • the amount of gDNA to be assayed is determined based on the reaction amount and the number of experiments. The total amount is determined by considering the amount consumed when transferring the reaction solution (see Table 5 below).
  • TaqMan ® assay copy number (Copy Number Assays) and mix the reagents and TaqMan ® reference copy number assays (Copy Number Reference Assays) reagent. Shake lightly and centrifuge to collect the reaction solutions. Mix the TaqMan ® Genotyping Master Mix to complete the reaction solution mixture (see Table 6 below).
  • reaction solution is placed in a microcentrifuge tube to allow the entire reaction solution mixture to mix well and then dispensed into the prepared reaction well plates.
  • Diluted gDNA samples are prepared and the diluted gDNA is added to the well plates dispensed with the reaction mixture.
  • gDNA may be first dispensed and the reaction mixture may be added.
  • the gDNA and the reaction mixture are mixed well and the reaction well plate is sealed to perform centrifugation.
  • Example 3-1 Selection of target gene and design construction of primer pair and probe
  • Target gene sequence (chromosome 21): GenBank Accession No. of NCBI NC_018932.2 (SEQ ID NO: 21)
  • a primer pair for amplifying the target gene of SEQ ID NO: 21 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 21-01_73 F 5'-ATGCTGTTCATGGAGGATGCT-3 '(SEQ ID NO: 22)
  • Reverse primer 21-01_73 R 5'-TCTATCTCCCACTCTCTCCAACTAATC-3 '(SEQ ID NO: 23)
  • Detection probe 21-01_73 P 5'-AGGAAGATGAGAGAAAATTAGTA-3 '(SEQ ID NO: 24)
  • a primer pair for amplifying the target gene of SEQ ID NO: 25 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 21-03_73 F 5'-GCACTGGGAATTTATTAGCACAAA-3 '(SEQ ID NO: 26)
  • Reverse primer 21-03_73 R 5'-GCTAAGATATGGTAGAGTCCCTTCTGA-3 '(SEQ ID NO: 27)
  • Detection probe 21-03_73 P 5'-TCATTCTTTGCAACTCAAA-3 '(SEQ ID NO: 28)
  • a primer pair for amplifying the target gene of SEQ ID NO: 29 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 21-05_58 F 5'-TGATGGGCTTGCGCTTATC-3 '(SEQ ID NO: 30)
  • Detection probe 21-05_58 P 5'-TTGTCCCTTCTCCC-3 '(SEQ ID NO: 32)
  • the sequence of the control gene which is a reference for calculating the normalization value of the amplification amount of the target gene, as described above, the gene on the chromosomes 1 and 2 as follows It was set as the sequence (refer FIG. 3).
  • a primer pair for amplifying the control gene of SEQ ID NO: 33 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with VIC and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 02-03_68 F 5'-GAGGGACTCTGCCATTACTTAGCT-3 '(SEQ ID NO: 34)
  • Detection probe 02-03_68 P 5'-AGCACAGAGGAGTGCC-3 '(SEQ ID NO: 36)
  • Control gene sequence (chromosome 1): GenBank Accession No. of NCBI NC_018912.2 (SEQ ID NO: 37)
  • a primer pair for amplifying the control gene of SEQ ID NO: 37 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with VIC and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 01-05_56 F 5'-CATGGGCCCCACATGGT-3 '(SEQ ID NO: 38)
  • Detection probe 01-05_56 P 5'-CTAGTTTCCCCGGCTCA-3 '(SEQ ID NO: 40)
  • control gene, target gene and chromosome exemplified in the present embodiment should be understood as an example, and the method of the present invention for analyzing fetal genetic information from pregnant women's blood or plasma using digital PCR may be performed with various individuals or samples.
  • it should be understood as a technology applicable to genotyping or gene count analysis for various target genes and chromosomes.
  • a pair of primers for amplifying the target gene and the control gene as described above, and a probe for detecting the amplified product amplified therefrom were synthesized by Bion Corporation (Daejeon Metropolitan City, Korea).
  • PCR composition was prepared as shown in Table 8 below, and then PCR amplification of Table 9 below. PCR amplification was performed under conditions.
  • PCR amplification master mix for PCR amplification of the composition for example, PCR buffer, dNTP, DNA polymerase been made by Ajay et al., In this embodiment, TaqMan ® Universal Master Mix II, no UNG (Life Technologies to the PCR master mix , Cat. 4440040).
  • PCR amplification composition No. PCR amplification composition Volume ( ⁇ l) One Sample with DNA template or control without template (NTC) One 2 Primer (5 pM) Forward primer 0.5 Reverse primer 0.5 3 Distilled water 8 4 TaqMan ® Universal Master Mix II, no UNG 10 Sum 20
  • real time PCR was performed on the target genes and the control genes using the respective primer pairs and probes designed in Example 3-1.
  • real-time PCR was performed using a 7900HT Fast Real Time PCR System (Life Technologies, USA), and the samples prepared in Examples 1-2 (F1 sample, F22 sample confirmed to contain a certain amount of the gene derived from fetus)
  • Real-time PCR composition of DNA template, G1 sample) and real-time PCR master mixture as shown in Table 10 below, and then real-time under the real-time PCR amplification conditions of Table 11 below. PCR was performed.
  • FIGS. 6 to 24 show graphs of real-time PCR under real-time PCR compositions and conditions as described above. Normally real time for target genes and control genes for F1 sample, F22 sample, and G1 sample An amplification curve indicating PCR amplification was confirmed (FIGS. 6-19), and no significant amplification curve was observed for the control without template (NTC) (FIGS. 20-24). Therefore, it was confirmed that the primer pair and the probe designed in Example 3-1 are suitable for specific amplification and detection of the target gene and the control gene included in the sample.
  • Example 4-1 Digital PCR of Samples Found to Contain a Fetal-Derived Gene
  • F1 sample, F22 sample, G1 sample, G2 sample (a sample of DNA extraction for G1 sample) and template-free control in which gDNA samples prepared in Example 1-2 were found to contain a certain amount of fetal-derived genes (NTC) each was dispensed to each well on an assigned array of OpenArray ® well plates (Life Technologies, USA) according to the digital PCR layout of FIG. 25 and designed in Example 3-1 to each well on an array per each sample. Each primer pair and corresponding probes (5 sets in total) were dispensed (see FIG. 25). At this time, the digital PCR composition for each well was performed as shown in Table 12 below, and since 20 ng / ul of each sample was diluted 20 times because the proper concentration of the sample for digital PCR was not known.
  • digital PCR amplified digital PCR amplification master mix for one composition are, for example, PCR buffer, dNTP, as a DNA polymerase consisting of a kinase, such as, in the present embodiment, a digital PCR master mix TaqMan ® Universal Master Mix II, no UNG (Life Technologies, Cat. 4440040) was used.
  • the results of the digital PCR in the present embodiment is shown as a digital PCR heat map.
  • the target gene SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29
  • the control gene SEQ ID NO: 33 or SEQ ID NO: 37
  • FIG. 27 shows the fluorescence values measured in each well of the digital PCR layout by execution of QuantStudio 12K Flex software and DigitalSuite software provided in the QuantStudio 12K Flex device, and for each sample, each target gene (SEQ ID NO: The copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown.
  • SEQ ID NO: 33 or SEQ ID NO: 37 are quantitatively shown.
  • Example 4-2 Digital PCR of Diluted F1 Sample and F22 Sample
  • Digital PCR composition for each well was as shown in Table 14 below, and used to dilute each sample of 20 ng / ul 100 times in order to select the sweet spot of the sample for digital PCR.
  • the digital PCR instrument and PCR conditions were the same as Example 4-1.
  • the results of the digital PCR in the present embodiment are shown as a digital PCR heat map.
  • the target gene SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29
  • the control gene SEQ ID NO: 33 or SEQ ID NO: 37
  • Figure 30 shows the fluorescence values measured in each well of the digital PCR layout by the execution of QuantStudio 12K Flex software and DigitalSuite software provided in the QuantStudio 12K Flex instrument to analyze each target gene of Example 3-1 for each sample (SEQ ID NO: The copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown. As a result of the copy number analysis, a more stable result was obtained than in the case of Example 4-1. However, in order to confirm more than the number of genes of the target gene derived from the fetus, the number of control genes per well is still too high to satisfy the Poisson distribution. It was confirmed. Therefore, it was analyzed that additional sample dilution and determination of the appropriate concentration were necessary.
  • Example 4-3 Digital PCR of Diluted G1 Samples and Male Control Samples
  • Example 1-2 a G1 sample confirmed to contain a certain amount of a fetal-derived gene and a normal male genomic DNA sample (male control sample) of a normal male without genetic abnormalities provided in a domestic general hospital are shown.
  • Corresponding probes (5 sets in total) were dispensed (see FIG. 31).
  • the digital PCR composition for each well was as shown in Table 15 below, and used to dilute each sample of 20 ng / ul 100 times in order to select a sweet spot of the sample for digital PCR.
  • the digital PCR instrument and PCR conditions were the same as Example 4-1.
  • the results of the digital PCR in the present embodiment are shown as a digital PCR heat map.
  • the target gene SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29
  • the control gene SEQ ID NO: 33 or SEQ ID NO: 37
  • FIG. 33 shows the fluorescence values measured in each well of the digital PCR layout by execution of QuantStudio 12K Flex software and DigitalSuite software provided in a QuantStudio 12K Flex device.
  • the copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown.
  • SEQ ID NO: 33 or SEQ ID NO: 37 As a result of the copy number analysis, a more stable result was obtained than in the case of Example 4-1.
  • the copy number of the control gene per well is still too high. It was confirmed that the distribution was not satisfied. Therefore, it was analyzed that additional sample dilution and determination of the appropriate concentration were necessary.
  • Example 4-4 Digital PCR on Additional Diluted G1 Samples and Male Control Samples
  • gDNA samples prepared in Example 1-2 a G1 sample confirmed to contain a certain amount of a fetal-derived gene and a normal male genomic DNA sample (male control sample) of a normal male without genetic abnormalities provided in a domestic general hospital are shown.
  • Each well pair was dispensed to each well on an assigned array of OpenArray ® well plates (Life Technologies, USA) according to 34 digital PCR layouts, and each primer pair designed in Example 3-1 to each well on an array per sample The corresponding probes (5 sets in total) were dispensed (see FIG. 34).
  • the digital PCR composition for each well was as shown in Table 16 below, and used to dilute 1000 fold of each sample at 20 ng / ul to select a sweet spot of the sample for digital PCR.
  • the digital PCR instrument and PCR conditions were the same as Example 4-1.
  • FIG. 35 the results of the digital PCR in the present embodiment are shown as a digital PCR heat map.
  • the target gene SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29
  • the control gene SEQ ID NO: 33 or SEQ ID NO: 37
  • FIG. 36 shows the fluorescence values measured in each well of the digital PCR layout by execution of QuantStudio 12K Flex software and DigitalSuite software provided in the QuantStudio 12K Flex device.
  • the copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown.
  • Table 17 Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2) 1.65264 2.516783987 G1 2.112308677 1.387042 1.117781206 0.938141276 1.323355 1.110677064 1.03092 0.901134 MC 1.15633 1.181313 0.844723 1.21053 1.346902 1.17708
  • the fetus has a number of abnormalities of chromosome 21, ie, trisomy, in which chromosome 21 is a triplex (normally diploid), and the fetus of a pregnant woman who provided a G1 sample.
  • the risk of Down syndrome can be expected to be high.
  • the method of the present invention solves the problem of separation of only signals derived from fetal-derived genes and problems caused by the genetic background signal of pregnant women, while satisfying the Poisson distribution required by digital PCR technology, thereby reliably quantifying the results. It is possible to solve the conventional problem of making it difficult to integrate digital PCR technology into genotyping technology using fetal-derived cell free genes.
  • Example 5-1 Preparation of Test Samples from Pregnant Plasma Samples and Real-Time PCR
  • Pregnant women's plasma was provided for blind testing by gynecologists in Korea. Each sample is given an arbitrary sample number such as MO, M6, M7, M9, S8, S8_1, S2, S4, S5, S6, and then the same sample number is also used for the extracted gDNA sample corresponding to each sample.
  • gDNA samples are extracted from plasma samples (dose: 1 ml) subjected to trisomy analysis of fetal-derived genes. It was. The gDNA extraction procedure was performed according to the manner described in Examples 1-2.
  • Example 1-2 the gDNA extracted from each plasma sample was analyzed for fetal derived gene content in the same manner as in Example 1-2. That is, real-time PCR of the Amyloid Precursor protein (APP) gene (GenBank accession No. NM_000484), the ⁇ -actin gene, and the SRY gene using the primer pairs and the fluorescently labeled probes of Table 1 was performed in the same manner as in Example 1-2. Method and conditions were performed, and fetal-derived gene content was calculated from real-time PCR quantitative results. Fetal-derived gene content was calculated in the same manner as in Example 1-2.
  • APP Amyloid Precursor protein
  • Table 18 shows the results of quantification of real time PCR for short amplicons (length 67 bp), quantification of real time PCR for long amplicons (length 180 bp), their ratios and The results of calculating the content are shown in a summary for each sample.
  • the blind test sample for example, MO sample, M6 sample, M9 sample, S8 sample, S8_1 sample, S2 sample, S4, calculated as a result of calculating a certain amount of fetal-derived genes
  • Samples, S5 samples, and S6 samples are sufficient for the presence of fetal genes, so they were later used for digital PCR analysis involving more than the number of fetal genes, ie trisomy.
  • chromosome 13 In order to perform genetic analysis on fetal-derived genes, e.g., abnormal number of genes such as trisomy, gene sequences on chromosome 13 in addition to chromosome 21 described in Example 3-1 were added.
  • the target gene sequence was used (see FIG. 4), and primer pairs and probes were designed based on this.
  • the target gene sequence on chromosome 13, primer pairs and amplification probes for amplifying it are as follows.
  • Target gene sequence (chromosome 13): GenBank Accession No. of NCBI NC_018924.2 (SEQ ID NO: 41)
  • a primer pair for amplifying the target gene of SEQ ID NO: 41 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Reverse primer 13_1_2_62R 5'-GGCAGAGTGGATGTTTTTGCA-3 '(SEQ ID NO: 43)
  • Detection probe 13_1_2_62P 5'-AGCCAGGCAGTCTGTA-3 '(SEQ ID NO: 44)
  • Target gene sequence (chromosome 13): GenBank Accession No. of NCBI NC_018924.2 (SEQ ID NO 45)
  • a primer pair for amplifying the target gene of SEQ ID NO: 45 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 13_2_1_69F 5'-TTCTACCAGAAAGGAATGAAGAACAG-3 '(SEQ ID NO: 46)
  • Reverse primer 13_2_1_69R 5'-CCATTTGATATTTGTCTGCATTGTG-3 '(SEQ ID NO: 47)
  • Detection probe 13_2_1_69P 5'-ACCTTCAGGAATTGAG-3 '(SEQ ID NO: 48)
  • a primer pair for amplifying the target gene of SEQ ID NO: 49 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Reverse primer 13_3_1_62R 5'-TCGTCTAGCTCCTTCAGGATCTCT-3 '(SEQ ID NO: 51)
  • Detection probe 13_3_1_62P 5'-CTGTCCTTCTTGCCCC-3 '(SEQ ID NO: 52)
  • a primer pair for amplifying the target gene of SEQ ID NO: 53 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 13_4_2_69F 5'-GCAGAAAATGAATGATAGCATGGA-3 '(SEQ ID NO: 54)
  • Reverse primer 13_4_2_69R 5'-CCACCAAGGTCCTGAGATCCT-3 '(SEQ ID NO: 55)
  • Detection probe 13_4_2_69P 5'-ACCTCAAACAAGGAAGAG-3 '(SEQ ID NO: 56)
  • chromosome 13 and related target genes exemplified in the present embodiment should be understood as examples of chromosomes and related target genes to be analyzed for abnormality in the number of genes such as trisomy, using digital PCR.
  • the method of the present invention for analyzing fetal genetic information from the blood or plasma of a pregnant woman should be understood as a foundation technology applicable to genotyping or gene count analysis for various individuals or samples, and various target genes and chromosomes.
  • a primer pair for amplifying the target genes as described above, and a probe for detecting the amplified product amplified therefrom were synthesized by BIO Co., Ltd., Daejeon, Korea.
  • chromosome 18 In order to perform genetic analysis on fetal-derived genes, e.g., abnormal number of genes such as trisomy, gene sequences on chromosome 18 in addition to chromosome 21 described in Example 3-1 were added.
  • the target gene sequence was used (see FIG. 4), and primer pairs and probes were designed based on this.
  • the target gene sequence on chromosome 18, a primer pair for amplifying it, and a detection probe are as follows.
  • Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO 57)
  • a primer pair for amplifying the target gene of SEQ ID NO: 57 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 18_1_2_57F 5'-CTGCTGGGCCCCCTTT-3 '(SEQ ID NO: 58)
  • Reverse primer 18_1_2_57R 5'-GGGTTACTTGGGCAGAATGTCA-3 '(SEQ ID NO: 59)
  • Detection probe 18_1_2_57P 5'-TGCTTCATGTCCTCTTG-3 '(SEQ ID NO: 60)
  • Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO: 61)
  • a primer pair for amplifying the target gene of SEQ ID NO: 61 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 18_2_2_58F 5'-GCCCCGTTCACGTCAGTTT-3 '(SEQ ID NO: 62)
  • Reverse primer 18_2_2_58R 5'-TGGTACTGGCTTCGCTTTCTC-3 '(SEQ ID NO: 63)
  • Detection probe 18_2_2_58P 5'-ACGTCTGCAACGGG-3 '(SEQ ID NO: 64)
  • Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO: 65)
  • a primer pair for amplifying the target gene of SEQ ID NO: 65 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 18_3_2_62F 5'-AGCTGGAAGTCGAGTGTGCTACT-3 '(SEQ ID NO: 66)
  • Reverse primer 18_3_2_62R 5'-CTGCCGGAAGTTCAGTTTGTC-3 '(SEQ ID NO: 67)
  • Detection probe 18_3_2_62P 5'-AACTCAGGAGATTTGG-3 '(SEQ ID NO: 68)
  • Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO: 69)
  • a primer pair for amplifying the target gene of SEQ ID NO: 69 and a probe for detecting a signal of an amplification product are as follows.
  • the 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA.
  • the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
  • Forward primer 18_5_1_67F 5'-CAGGTCGTACAATTATGGCAAAAT-3 '(SEQ ID NO: 70)
  • Reverse primer 18_5_1_67R 5'-AGGTCTGGGTTCTCGCTGAA-3 '(SEQ ID NO: 71)
  • Detection probe 18_5_1_67P 5'-TGGCCTTATTTTGTTTTTAG-3 '(SEQ ID NO: 72)
  • chromosome 18 and the related target genes exemplified in the present embodiment should be understood as an example of chromosomes and related target genes to be analyzed for abnormality in the number of genes such as trisomy, and using digital PCR
  • the method of the present invention for analyzing fetal genetic information from the blood or plasma of a pregnant woman should be understood as a foundation technology applicable to genotyping or gene count analysis for various individuals or samples, and various target genes and chromosomes.
  • a primer pair for amplifying the target genes as described above, and a probe for detecting the amplified product amplified therefrom were synthesized by BIO Co., Ltd., Daejeon, Korea.
  • Example 5-1 Of the gDNA samples prepared in Example 5-1, M0, M6, and M9 samples identified as containing a certain amount of fetal-derived genes, and genomic DNA samples of normal males with no genetic abnormalities provided by a domestic general hospital (male Digital PCR was performed for the control sample in the same manner as described in Example 4. Sample distribution for each array of well plates, digital PCR amplification conditions, digital PCR amplification equipment, and primer pairs dispensed per well and corresponding detection probes (three target genes on chromosome 21, one on chromosome 2) Amplification primer pairs for each of the control gene and one control gene on chromosome 1 and corresponding detection probes (5 sets in total) were the same as in Example 4, and the digital PCR amplification composition was shown in Table 19 below. .
  • Example 4 The software as described in Example 4 was run, and the fluorescence values measured in each well of the digital PCR layout were analyzed in the same manner as in Example 4, and each target gene (SEQ ID NO: 21, sequence number 21) for each sample was analyzed.
  • the digital PCR amplification product of each target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) was quantified, and each of the quantified values was calculated for each control gene (SEQ ID NO: Normalized values were calculated for the digital PCR quantitative value of 33 or the gene of SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, the trisomy of chromosome 21 was confirmed (see Table 20).
  • Table 20 Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2) 1.360 1.117677348 M0 0.736625849 1.206 1.086434891 1.516032336 1.874456107 1.364799482 2.996 2.922318152 M6 2.003473315 2.111 3.323963935 2.278825941 2.742352911 2.050155311 1.632 1.440920821 M9 0.896090445 1.015 1.85241346 1.151989294 1.603982108 0.997501391
  • the normal male sample Human Male Control
  • the normalization value for the control gene gene on chromosome 1, gene on chromosome 2 closer to 1 target gene (gene on chromosome 21)
  • the normalization values for the control gene of SEQ ID NO: 37 were calculated as 2.996 and 2.111, respectively, resulting in the target gene (chromosome 21).
  • the number of chromosome 21 genes is about 1.5 times more than the number of genes of chromosome 1 and the number of chromosome 2 which are known to have no genes in the fetus. Can be.
  • the fetus has a trisomy in which the chromosome 21 is a triploid (normally a diploid), and the risk of developing Down syndrome in a fetus of a pregnant woman who provided an M6 sample is high. .
  • the number of chromosome 21 is less than 1.5 times the number of genes of chromosome 1 and the number of genes of chromosome 2, which are known to have no gene number or more.
  • Analysis of the M0 sample and the M9 sample on the basis of chromosome 21 can estimate that the chromosome 21 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing Down syndrome in the fetus of pregnant women who provided the M0 sample and the M9 sample was low.
  • M6 and M9 samples confirmed to contain a predetermined amount of fetal genes among the gDNA samples prepared in Example 5-1, and a normal male genomic DNA sample (male control sample) provided by a domestic general hospital Digital PCR was performed by the same method as described in Example 6-1.
  • the sample distribution method, digital PCR amplification composition, digital PCR amplification conditions, and digital PCR amplification equipment for each array of well plates were the same as in Example 6-1.
  • Primer pairs dispensed per well and the corresponding detection probes include primer pairs for amplification for each of four target genes on chromosome 13, one control gene on chromosome 2 and one control gene on chromosome 1, and Corresponding detection probes (6 sets in total) were used.
  • each target gene SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49 or SEQ ID NO: 53
  • each of the quantified values was normalized to the digital PCR quantitative value of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, whether the chromosome 13 was trisomy was confirmed (see Table 21).
  • Table 21 Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2) 1.3894 1.8988 M6 1.9130 1.4016 1.0001 1.0095 1.2542 1.2660 1.4046 1.4178 0.9782 3.6907 M9 3.7847 1.0033 0.0604 0.0621 0.0891 0.0916 0.0728 0.0748
  • the number of chromosome 13 is less than 1.5 times the number of genes of chromosome 1 and the number of genes of chromosome 2, which are known to have no genes or more in M6 and M9 samples.
  • Analysis of the M6 sample and the M9 sample on the basis of chromosome 13 indicates that the chromosome 13 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing trisomy 13 of the fetus of the pregnant women who provided the M6 sample and the M9 sample was low.
  • Example 5-1 M0, M6 and M9 samples, which were identified as containing a certain amount of fetal-derived genes, and genomic DNA samples of normal males with no genetic abnormalities provided by a Korean general hospital (male control) digital PCR was performed by the same method as described in Example 6-1.
  • the sample distribution method, digital PCR amplification composition, digital PCR amplification conditions, and digital PCR amplification equipment for each array of well plates were the same as in Example 6-1.
  • Primer pairs dispensed per well and corresponding detection probes include a pair of primers for amplification for each of four target genes on chromosome 18, one control gene on chromosome 2 and one control gene on chromosome 1, and Corresponding detection probes (6 sets in total) were used.
  • each target gene SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69
  • each of the quantified values was normalized to the digital PCR quantitative value of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, the trisomy of chromosome 18, was confirmed (see Table 22).
  • Table 22 Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2) 1.2205 1.5103 M0 1.4506 1.1380 1.2971 1.2459 1.0208 0.9805 1.0539 0.8752 1.1626 1.2608 M6 0.8312 0.7285 0.9659 0.6367 0.7232 0.4768 1.7006 0.9693 0.5499 0.5114 M9 1.0204 1.0563 0.6370 1.2710 0.4447 0.8874 0.6066 1.0465
  • the number of chromosome 13 is less than 1.5 times the number of genes of chromosome 1 and the number of chromosome 2 that are known to have no genes in the M0, M6 and M9 samples.
  • Analysis of the M0 sample, the M6 sample, and the M9 sample on the basis of chromosome 13 indicates that the chromosome 13 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing trisomy 18 in the fetus of pregnant women who provided the M0 sample, the M6 sample and the M9 sample is low.
  • trisomy is detected by specifically binding to an amplification product of a target gene of chromosome 21 (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) in a sample having trisomy 21.
  • the detection probe (SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32) used for the detection of the target gene of chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65) in another sample with trisomy 18
  • the presence of no reactivity to the amplification product of the gene of SEQ ID NO: 69 is possible to accurately predict trisomy.
  • Example 5-1 a sample containing a certain amount of a fetal gene derived from the gDNA samples prepared in Example 5-1 was identified, including an S8 sample having trisomy 21 and 18 Digital PCR was performed in the same manner as described in Example 6-1 on the S8_1 sample having the triple trisomy and the normal male genome DNA sample of the normal male, which was provided by a Korean general hospital. Was performed. However, in this example, the experiment was performed using two well plates at the same time in a digital PCR equipment.
  • Example 6-1 the digital PCR amplification products of three target genes on chromosome 21 were quantified for each sample distributed in the first well plate, and 18 for each sample distributed in the second well plate. Digital PCR amplification products of four target genes on chromosome were quantified. Each target gene quantitative value was normalized to the digital PCR quantitative value of each control gene (gene of SEQ ID NO: 33 or SEQ ID NO: 37) (see Table 23).
  • Table 23 Sample number Detection probe Normalized value for the control gene of SEQ ID NO: 33 (chromosome 2) Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) S8 (trisomy 21) 21-01_73 P (SEQ ID NO: 24) 1.9705 2.1385 3.1077 3.3728 21-03_73 P (SEQ ID NO: 28) 2.2469 3.5437 21-05_58 P (SEQ ID NO: 32) 2.1982 3.4669 18_1_2_57P (SEQ ID NO: 60) 1.0238 0.9401 1.6147 1.4827 18_2_2_58P (SEQ ID NO: 64) 1.0148 1.6005 18_3_2_62P (SEQ ID NO: 68) 1.0423 1.6439 18_5_1_67P (SEQ ID NO: 72) 0.6795 1.0716 S8_1 (trisomy 18) 21-01_73 P (SEQ ID NO: 24) 1.2800 1.2902 1.1388 1.1479 21-03_
  • probes for detecting amplification products of target genes of chromosome 21 (genes of SEQ ID NO: 21, SEQ ID NO: 25 and SEQ ID NO: 29) (probes of SEQ ID NO: 24, SEQ ID NO: 28 and SEQ ID NO: 32)
  • the normalized values of the digital PCR performed using the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1) are calculated as 2.1385 and 3.3728, respectively. It was confirmed that there was a variation in the number of genes of the target gene (gene on chromosome 21).
  • probes that detect amplification products of target genes of the chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69)
  • the quantitative value of the digital PCR performed using the probe of SEQ ID NO: 72 was normalized to the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1). Calculated as 0.9401 and 1.4827, respectively, it was confirmed that there was no gene number variation of the target gene (gene on chromosome 18) .
  • chromosome 21 can be predicted to have high risk of trisomy down syndrome, and chromosome 18 can be judged to be normal, so that chromosome 21 and 18 confirmed from the provider of S8 sample It was consistent with clinical results on chromosomal abnormalities.
  • probes for detecting amplification products of target genes of the chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69) (SEQ ID NO: 60, SEQ ID NO: 64, Quantitative values of digital PCR performed using SEQ ID NO: 68 or probe of SEQ ID NO: 72 for the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1) Normalized values were calculated as 3.0080 and 2.6764, respectively, confirming that there were gene number variations of the target gene (gene on chromosome 18).
  • probes probe of SEQ ID NO: 24, SEQ ID NO: 28 and SEQ ID NO: 32
  • probes probe of SEQ ID NO: 24, SEQ ID NO: 28 and SEQ ID NO: 32
  • the normalized values of the quantitative value of the digital PCR performed on the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1) were calculated as 1.2902 and 1.1479, resulting in the target gene. It was confirmed that there is no gene number variation of (gene on chromosome 21) .
  • the chromosome 18 can be predicted to have a high risk of trisomy, and the chromosome 21 can be judged normal, so that the chromosome 21 and the 18 staining confirmed from the provider of the S8_1 sample It was consistent with clinical results on chromosomal abnormalities.
  • the detection probe SEQ ID NO: 24, SEQ ID NO: 28 or SEQ ID NO: 32 probe
  • SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69 there was no reactivity with the amplification product of the target gene of the chromosome 18 chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69), so that it did not show a false positive signal.
  • a detection probe (SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68 or SEQ ID NO: 72) that specifically binds to an amplification product of a target gene for trisomy determination of chromosome 18 has a trisomy It was confirmed that there was no reactivity with the amplification product of the target gene of the chromosome 21 (the gene of SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29), and it did not show a signal of false positive.
  • Example 8 Digital PCR Quantitation Using a Mixture of Detection Probes Specific for Multiple Target Genes
  • Example 8-1 Digital PCR Quantitation After Dispensing Each Detection Probe into Each Well
  • S2 sample, S4 sample, S5 sample, and S6 sample which were found to contain a certain amount of fetal genes among gDNA samples prepared in Example 5-1, and normal males without genetic abnormalities provided by a Korean general hospital Digital PCR was performed on the genomic DNA sample (male control sample) in the same manner as described in Example 6-1.
  • the sample distribution method, digital PCR amplification composition, digital PCR amplification conditions, and digital PCR amplification equipment for each array of well plates were the same as in Example 6-1.
  • Primer pairs dispensed per well and corresponding detection probes include primer pairs for amplification for each of three target genes on chromosome 21, one control gene on chromosome 2 and one control gene on chromosome 1, and Corresponding detection probes (5 sets in total) were used.
  • each target gene SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29
  • SEQ ID NO: 33 or SEQ ID NO: 37 was normalized to the digital PCR quantitative value of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, the trisomy of chromosome 21 was confirmed (see Table 24).
  • the fetus has a trisomy in which the chromosome 21 is a triploid (normally a diploid), and there is a high risk of developing Down syndrome in a pregnant woman who provided S4 and S5 samples. can do.
  • the S2 sample and the S6 sample were found to have a normalization value of less than 1.5, inferring that the number of chromosome 21 is less than 1.5 times the number of genes of chromosome 1 and the number of chromosome 2 that are known to have no genes. Can be. Analysis of the S2 sample and the S6 sample on the basis of chromosome 21 may indicate that chromosome 21 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing Down syndrome in the fetus of pregnant women who provided S2 and S6 samples is low.
  • Detection probe mixture specific for target gene of chromosome 21 (5 pM): 0.2 ⁇ L detection probe 21-01_73 P (SEQ ID NO: 24), 0.4 ⁇ L detection probe 21-03_73 P (SEQ ID NO: 28), and detection Use 1.0 ⁇ L mixed with 0.4 ⁇ L probe 21-05_58 P (SEQ ID NO: 32);
  • Detection probe mixture specific for control genes of chromosome 2 and chromosome 1 (5 pM): 0.5 ⁇ L of detection probe 02-03_68 P (SEQ ID NO: 36), and detection probe 01-05_56 P (SEQ ID NO: 40) ) 1.0 ⁇ L mixed with 0.5 ⁇ L;

Abstract

The present invention provides a technique capable of analyzing a gene number abnormality by carrying out digital PCR for a blood or blood plasma sample of a pregnant woman in which the presence of a fetus-derived gene is detected, wherein a control gene not associated with the gene number abnormality and a target gene associated with the gene number abnormality, which are commonly preset in a mother-derived gene set and a fetus-derived gene set, are amplified by using digital PCR, and then the quantitative result of a digital PCR of the target gene is compared with the quantitative result of a digital PCR of the control gene when the quantitative result of the digital PCR with respect to the control gene satisfies the Poisson distribution, that is, when a control gene copy number per well is statistically near 1.

Description

디지털 ＰＣＲ을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법How to analyze fetal genetic information from pregnant woman's blood or plasma using digital PCR
본 발명은 디지털 PCR을 이용하여 임부의 혈액 내지 혈장으로부터 태아의 유전자 정보를 분석하는 방법에 관한 것으로서, 보다 상세하게는 디지털 PCR을 이용하여 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 유전자로부터 특징적인 유전정보를 수집하여 분석함으로써 이를 진단에 응용할 수 있는 방법에 관한 것이다. The present invention relates to a method for analyzing genetic information of a fetus from pregnant women's blood or plasma using digital PCR, and more particularly, from a fetal-derived gene present in a small amount in pregnant women's blood or plasma using digital PCR. The present invention relates to a method of collecting and analyzing genetic information and applying it to diagnosis.
또한, 본 발명은 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 유전자로부터 태아의 유전 정보에 대한 기초 결과를 얻고, 임부의 혈액 내지 혈장 내에 태아 유래 유전자가 존재하는 샘플을 대상으로 디지털 PCR을 수행하여 태아의 유전자 정보를 분석함으로써 태아의 유전 질병 중 유전자의 수에 대한 이상에 따라 발생하는 유전 질병을 조기에 진단하는데 이용할 수 있는 방법에 관한 것이다.In addition, the present invention obtains the basic result of the genetic information of the fetus from the fetal-derived gene present in a small amount in the pregnant woman's blood or plasma, and performs digital PCR on a sample in which the fetal-derived gene is present in the pregnant woman's blood or plasma. By analyzing the genetic information of the fetus relates to a method that can be used for early diagnosis of genetic diseases caused by abnormalities in the number of genes among the genetic diseases of the fetus.
추가로, 본 발명은 임부의 혈액 내지 혈장으로부터 태아의 유전자의 수에 대한 이상에 관한 유전자 분석을 수행하는데 있어서, 유전자 수 이상에 관한 표적 유전자에 대해 특이적인 프라이머 쌍과 프로브를 이용하여 디지털 PCR을 수행할 때, 다량으로 존재하는 모체 유래 유전자의 배경 신호에 의해 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 표적 유전자와 관련한 유전자의 수에 대한 이상이 검출되지 않거나 불명확한 신호로서 검출되는 문제점을 해결하기 위한 방법에 관한 것이다. In addition, the present invention provides a digital PCR using a primer pair and probe specific to the target gene for the abnormal number of genes in performing the genetic analysis of the abnormal number of genes of the fetus from the blood or plasma of the pregnant woman. When performing, the abnormality of the number of genes related to the fetal origin target gene present in a small amount in maternal blood or plasma is not detected by the background signal of the mother-derived gene present in a large amount or is detected as an unknown signal. A method for solving the problem.
나아가, 본 발명은 태아 유래 세포 유리 유전자를 이용한 유전자형 분석 기술과 디지털 PCR 기술의 접목을 어렵게 하는 장벽을 해소하고, 아울러 태아 유래 유전자로부터 유래한 신호만의 분리의 어려운 문제와 모체 유래 유전자 배경 신호에 의한 문제를 해결하면서도 디지털 PCR 기술에서 요구되는 프아송 분포를 만족시켜 정량 결과를 신뢰할 수 있는 기술의 제공에 관한 것이다. Furthermore, the present invention eliminates barriers that make it difficult to integrate genotyping techniques and digital PCR techniques using fetal-derived cell free genes, and furthermore, it is difficult to separate only signals derived from fetal-derived genes and to maternal-derived gene background signals. In order to solve the problem caused by satisfying the Poisson distribution required in the digital PCR technology to provide a reliable technology for quantitative results.
결혼 인구의 고령화 및 출산 연령대의 고령화 등의 원인으로 태아의 유전성 질병의 확률이 최근 10년간 빠르게 증가하고 있다. 태아의 유전적 이상을 포함하는 임신과 연관된 질환을 조기에 검출할 경우, 임부와 태아에게 고통을 줄이면서도 안전에 필요한 초기의 의학적 조치가 가능하기 때문에, 임신 관련 질환의 조기 검출및 태아의 유전적 이상을 조기에 진단하는 것은 매우 중요하다. 태아에게 발생할 수 있는 유전적 이상으로서는 유전자 수 이상, 예를 들어 염색체의 3염색체성(trisomy), 전좌, 결실, 중복, 삽입 등을 들 수 있으며, 이러한 염색체 이상이 있는 경우 태아의 신체 전반에 걸쳐 구조 이상과 기능 이상이 발생한다. 이러한 유전자 수의 이상은 임부의 나이가 많을수록 높은 빈도로 발생하는 것으로 알려져 있다. The probability of hereditary disease in the fetus has been increasing rapidly in recent decades due to the aging of the marriage population and the aging age of the child. Early detection of pregnancy-related diseases, including fetal genetic abnormalities, enables early detection of pregnancy-related diseases and fetal genetics, as early medical measures are necessary for safety while reducing pain for pregnant women and the fetus. It is very important to diagnose abnormalities early. Genetic abnormalities that may occur in the fetus include abnormal gene counts, for example trisomy, translocation, deletion, duplication, and insertion of chromosomes. Structural and functional abnormalities occur. This abnormality in the number of genes is known to occur at a higher frequency as the age of pregnant women.
이러한 태아의 유전적 이상을 진단하기 위해 양수 천자 방법이 사용되고 있는데, 이는 태아의 조직세포를 포함하고 있는 양수를 채취하여 태아의 조직세포의 내의 염색체나 DNA를 검사하여 태아의 유전자 이상을 검사하는 방법이다. 그러나, 양수 검사는 산전 진단으로서 위험성을 수반하고 있는 침습적 검사로서, 주사기에 의한 양막의 세균감염, 주사기에 의한 상처 문제, 양수가 새는 문제 등의 위험성이 있으며, 심각한 경우 유산이 될 수도 있다. Amniotic fluid puncture method is used to diagnose the genetic abnormality of the fetus, which is a method of examining the genetic abnormality of the fetus by collecting the amniotic fluid containing fetal tissue cells and examining the chromosomes or DNA in the fetal tissue cells. to be. However, amniotic fluid test is an invasive test that carries risks as a prenatal diagnosis, and there is a risk of bacterial infection of the amniotic membrane with a syringe, a wound problem with a syringe, a leak of amniotic fluid, etc., and in serious cases, it may be a miscarriage.
따라서, 태아의 유전자 분석 및 질병의 조기진단을 위해 임부 및 태아 모두에게 위험하지 않은 방법이 절실히 요구되는 실정이다. 이와 관련하여 임부의 혈액 내지 혈장 내 유전물질 중 5 내지 10%는 태아 유래의 유전물질인 것이 알려져 있는데, 태아의 태반세포에서 세포사멸(apoptosis)에 의해 태아 유래의 세포 유리 DNA나 RNA의 짧은 단편들이 임부의 혈액으로 유입된다. 이러한 임부의 혈액 내지 혈장 내 태아 유래 세포 유리 유전자(cell free fetal DNA or RNA)를 검출하고, 검출된 태아 유래 세포 유리 유전자를 이용하여 각종 유전자형을 분석하여 소아암이나 유전병을 연구하는 경우 비침습적 방법으로서 안전하다는 이점이 있다. 따라서, 기존의 양수 검사를 대신하거나 이를 보조하기 위하여 임부의 혈장 내 태아 유래 세포 유리 유전자를 이용한 유전자형 분석 방법으로서 마이크로어레이 방법이나 리얼타임 PCR 방법(real time PCR)이 사용되고 있다. Therefore, there is an urgent need for methods that are not dangerous for both pregnant and fetus for genetic analysis and early diagnosis of diseases. In this regard, it is known that 5-10% of the genetic material in maternal blood or plasma is genetic material derived from the fetus. Short fragments of fetal cell-free DNA or RNA from fetal placenta by apoptosis in placental cells of the fetus They enter the pregnant woman's blood. As a non-invasive method for detecting pediatric cancer or genetic diseases by detecting cell free fetal DNA or RNA in the blood or plasma of the pregnant woman and analyzing various genotypes using the detected fetal-derived cell free gene. It has the advantage of being safe. Therefore, the microarray method or the real time PCR method has been used as a genotyping method using fetal-derived cell-free genes in pregnant women's plasma to replace or support the amniotic fluid test.
이와 같은 태아의 유전성 질병을 비침습적으로 진단하기 위해서는 임부의 혈액 내지 혈장 내에 소량 존재하는 태아의 유전정보를 누락없이 그리고 정보의 오류없이 안정적으로 확보할 수 있는 기술을 필요로 한다. 그러나, 임부의 혈액 내지 혈장 내에 존재하는 태아의 유전정보에 대한 비율을 알지 못하고 연구 및 진단이 진행되고 있기 때문에 분석된 태아 유래 세포 유리 유전자에 대한 분석결과의 신뢰도에 문제가 생길 수 있다. 즉, 임부의 혈액으로부터 태아 유래의 세포 유리 유전자만을 분리하는 것 자체의 어려움이 있고, 이러한 분리 과정에서 매우 소중한 태아 유전자 정보의 소실의 위험성이 있다. 또한, 임부의 혈액 내에 다량으로 존재하는 모체 유래 유전자를 완전히 배제하고 태아 유래 유전자 만을 분리하는 것은 기술적 어려움과 비용적 문제가 있으며, 임부의 혈액 내지 혈장 내의 샘플을 증폭하는 과정에서 모체 유래 유전자 증폭에 의한 배경 신호로 인해 태아 유래 유전자에 대한 분석 결과의 신뢰도가 낮게 되고 위양성 또는 위음성의 분석 결과를 나타낼 가능성이 매우 크다.Non-invasive diagnosis of such genetic diseases of the fetus requires a technique capable of stably securing the genetic information of the fetus present in a small amount in the mother's blood or plasma without missing and error of information. However, since research and diagnosis are proceeding without knowing the proportion of the genetic information of the fetus present in the blood and plasma of the pregnant woman, there may be a problem in the reliability of the analysis result for the analyzed fetal-derived cell free gene. That is, there is a difficulty in separating only the cell free genes derived from the fetus from the mother's blood, and there is a risk of loss of very valuable fetal gene information in this separation process. In addition, it is technically difficult and costly to completely exclude maternally-derived genes and isolate only fetal-derived genes present in maternal blood, and to amplify maternally-derived genes in the process of amplifying samples in maternal blood or plasma. The background signal caused by this results in a low reliability of the analysis result for the gene derived from the fetus, and is very likely to indicate a false positive or false negative analysis result.
이와 관련하여 대한민국 등록특허공보 제10-1387582호에서는 모체 내에 극히 소량으로 존재하는 세포 유리 태아 핵산을 보다 효과적으로 검출하기 위해, 검출하고자 하는 태아 핵산의 5' 말단으로부터 시작하여 연속하는 짧은 길이를 갖는 핵산 부분을 증폭할 수 있는 프라이머를 설계하고 이를 타겟으로 리얼타임 PCR을 수행하여 모체 내 세포 유리 태아 핵산을 검출할 수 있는 방법을 개시하고 있다.In this regard, Korean Patent Publication No. 10-1387582 discloses a nucleic acid having a continuous short length starting from the 5 'end of a fetal nucleic acid to be detected in order to more effectively detect a cell free fetal nucleic acid present in a very small amount in the mother. A method of designing a primer capable of amplifying a part and performing real-time PCR on the target to detect a cell free fetal nucleic acid in the mother is disclosed.
그러나, 상기 선행기술이 채택하고 있는 리얼타임 PCR 방법은 비침습적 방법이지만, 한번에 여러 가지 종류의 검사를 하는데 한계가 있고 정확한 태아의 유전자 수 이상을 검출하기 위해서는 표준곡선의 사용이 필요하며 소모되는 시료의 양이 일정 수준 이상 필요하다는 단점이 있다. 또한, 리얼타임 PCR은 표준곡선의 Ct 또는 Cp 값과 검사 시료의 Ct 또는 Cp값을 매칭시켜 유전자 카피수를 정량하는 방식을 채택하기 때문에 아날로그 분석 방식의 한계로 인해 결과의 분석에 있어서도 전문가에 의한 2차 분석이 필요한 실정이다. However, although the real-time PCR method adopted by the prior art is a non-invasive method, there are limitations in performing various kinds of tests at once, and it is necessary to use a standard curve to detect an abnormal number of genes of the fetus and consume a sample. The disadvantage is that the amount of is required more than a certain level. In addition, real-time PCR adopts a method of quantifying the number of gene copies by matching the Ct or Cp value of the standard curve with the Ct or Cp value of the test sample. Secondary analysis is needed.
따라서, 본 발명이 속한 기술분야에서는 임부의 혈액 내지 혈장 시료에서 얻을 수 있는 태아 유래 유전자의 양은 모체 유래 유전자 양 보다 극단적으로 적은 점을 감안하여, 미량으로 존재하는 태아 유래 유전자를 이용하되 태아의 특정 표적 유전자에 대한 유전자형 분석 과정이 간편하면서도 아주 낮은 농도에서도 신뢰도가 높게 검사를 진행할 수 있는 방법이 요구되고 있다. Therefore, in the technical field to which the present invention belongs, the amount of fetal-derived genes obtained from maternal blood or plasma samples is extremely low than the amount of maternal-derived genes. There is a need for a method that allows simple genotyping of target genes and high reliability at very low concentrations.
리얼타임 PCR의 결과 분석 방식이 아날로그 방식인 점에 반해, 결과 신호가 "0" 또는 "1"의 값을 가져 분석 방식이 디지털 방식인 디지털 PCR 방법은 대용량 시료의 분석, 한번에 다양한 시료의 검사 그리고 다양한 검사 항목을 한번에 수행할 수 있는 장점이 있다. 디지털 PCR (digital PCR) 기술은 DNA 시료를 표준 곡선이 필요 없는 단일 분자 계수법을 적용하여 절대정량이 가능한 기술로서, 하나의 웰 당 하나의 액적(droplet)에 대한 PCR 반응으로 보다 정확한 절대 정량을 수행할 수 있는 장점이 있다(Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol. Diagn. 4(1), 41-47 (2004) 참조). While the result analysis method of real-time PCR is analog method, the result signal has a value of "0" or "1", and the digital PCR method of analysis method is a digital method. There is an advantage that can perform various test items at once. Digital PCR (Digital PCR) is a technique that allows absolute quantification of DNA samples by applying single molecule counting method that does not require a standard curve.It performs more accurate absolute quantification by PCR reaction on one droplet per well. There is an advantage to this (see Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol. Diagn. 4 (1), 41-47 (2004)).
디지털 PCR은 평균 0.5개 내지 1개의 카피수로 희석되도록 준비된 시료 유전자 주형, 증폭 프라이머 및 형광 프로브를 포함하는 각 액적을 하나의 웰에 분배하고 에멀젼 PCR을 수행한 후, 형광 신호가 나타나는 웰은 1개의 유전자 카피수의 시료가 분배되어 증폭 후 신호를 나타내는 것이므로 "1"의 값으로 카운트하고 형광 신호가 없는 웰은 0개의 카피수의 시료가 분배되어 증폭이 일어나지 않아 신호가 없는 것이므로 "0"으로 카운트함으로써 절대 정량을 할 수 있다. Digital PCR distributes each droplet containing sample gene templates, amplification primers and fluorescent probes prepared to be diluted to an average of 0.5 to 1 copy number into one well and performs emulsion PCR. Samples of the number of gene copies are distributed and represent signals after amplification, so the count is "1". Wells without fluorescence signal are counted as "0" because no copies of samples are distributed and no signal occurs. Absolute quantification can be achieved by counting.
디지털 PCR에서는 형광 신호가 나타나는 웰 당 유전자 카피수가 1개인 경우에만 데이터의 신뢰성이 보장된다. 즉, 디지털 PCR에서의 정량은 프아송 분포(poisson distribution)를 통해 웰 당 신호가 있거나 없는 경우 이를 디지털 값 1 또는 0으로 보고 포지티브(1의 값)와 네가티브(0의 값)의 비율을 계산하는데, 전체 포지티브와 네가티브 합에 대한 포지티브의 비율이 프아송 분포의 유전자 카피수 1개를 크게 벗어나는 경우에는 확률적으로 웰 당 유전자 카피수가 1개를 초과하는 것을 의미하는 것이므로 데이터의 신뢰성을 담보할 수 없게 된다. 이러한 이유로 디지털 PCR에서는 증폭 후 정량한 값이 프아송 분포를 만족시키지 않아 웰 당 유전자 카피수가 1개를 크게 초과하는 경우에는 유전자 시료를 희석하여 프아송 분포를 만족시키도록 하는 것이 중요하고 웰 당 유전자 카피수 1개에 근접한 경우에는 보정된 값으로 정량하는 것이 중요하다(예를 들어, Poisson9 프로그램을 이용하여 보정가능).In digital PCR, the reliability of the data is only guaranteed if there is only one copy of the gene per well in which the fluorescent signal appears. In other words, quantification in digital PCR uses the Poisson distribution to determine if a signal per well is present or absent as a digital value of 1 or 0 to calculate the ratio of positive (value of 1) and negative (value of 0). However, if the ratio of positive to total positive and negative sum significantly exceeds one gene copy in the Poisson distribution, it means that there is a probability that more than one gene copy per well can be guaranteed. There will be no. For this reason, in digital PCR, if the value quantified after amplification does not satisfy the Poisson distribution and the number of gene copies per well exceeds one, it is important to dilute the genetic sample to satisfy the Poisson distribution. If it is close to one copy, it is important to quantify it with the corrected value (for example, it can be corrected using the Poisson9 program).
그러나, 디지털 PCR 방법은 정량 분석의 용이성, 대용량 분석, 다량의 시료 처리 능력 등에도 불구하고 현재까지는 디지털 PCR의 데이터 신뢰성 확보를 위한 정량 분석의 보정 기술이 요구되고 있고, 웰 당 유전자 카피수를 1개로 맞추는데 기술적인 어려움이 존재하고 있다. However, digital PCR methods require quantitative analysis techniques to secure data reliability of digital PCR, despite the ease of quantitative analysis, large-capacity analysis, and a large amount of sample processing ability. There are technical difficulties in hitting dogs.
특히, 전술한 바와 같이 임부의 혈액 내지 혈장으로부터 태아 유래 유전자의 수에 대한 이상에 관한 유전자 분석을 수행하는데 있어서, 유전자 수 이상에 관한 표적 유전자에 대해 특이적인 프라이머 쌍과 프로브를 이용하여 디지털 PCR을 수행할 때, 다량으로 존재하는 모체 유래 유전자의 배경 신호에 의해 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 표적 유전자와 관련한 유전자의 수에 대한 이상이 검출되지 않거나 불명확한 신호로서 검출되는 문제점이 있게 된다. 이러한 문제점은 태아 유래 세포 유리 유전자를 이용한 유전자형 분석 기술과 디지털 PCR 기술의 접목을 어렵게 하는 장벽이 되고 있다.In particular, as described above, in performing genetic analysis on abnormalities in the number of fetal-derived genes from pregnant women's blood or plasma, digital PCR may be performed using primer pairs and probes specific for target genes related to the abnormal number of genes. When performing, the problem that the abnormality of the number of genes related to the fetal origin target gene present in a small amount in the mother's blood or plasma is not detected by the background signal of the mother-derived gene present in a large amount or is detected as an unclear signal. Will be. This problem has become a barrier that makes the integration of digital PCR technology with genotyping techniques using fetal cell free genes.
따라서, 디지털 PCR 기술을 기반으로 임부의 혈액 내지는 혈장 내에 미량으로 존재하는 태아 유래 유전자를 이용하여 태아의 유전자 수 이상을 분석할 때, 태아 유래 유전자로부터 유래한 신호만의 분리의 어려운 문제와 모체 유래 유전자 배경 신호에 의한 문제를 해결하면서도 디지털 PCR 기술에서 요구되는 프아송 분포를 만족시켜 정량 결과를 신뢰할 수 있는 기술의 제공이 요구되고 있다고 할 수 있다.Therefore, when analyzing more than the number of genes of the fetus using fetal-derived genes present in trace amounts in pregnant women's blood or plasma based on digital PCR technology, it is difficult to separate only the signals derived from fetal-derived genes and mother-derived. While solving the problem caused by the genetic background signal, it is required to provide a technology that can satisfy the Poisson distribution required in digital PCR technology to reliably quantitative results.
본 발명의 목적은 디지털 PCR을 이용하여 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 유전자로부터 특징적인 유전정보를 수집하여 분석함으로써 이를 진단에 응용할 수 있는 방법을 제공하는데 있다. Disclosure of Invention An object of the present invention is to provide a method that can be applied to diagnosis by collecting characteristic genetic information from a fetal-derived gene present in a small amount in pregnant women's blood or plasma using digital PCR.
또한, 본 발명의 목적은 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 유전자로부터 태아의 유전 정보에 대한 기초 결과를 얻고, 임부의 혈액 내지 혈장 내에 태아 유래 유전자가 존재하는 샘플을 대상으로 디지털 PCR을 수행하여 태아의 유전자 정보를 분석함으로써 태아의 유전 질병 중 유전자의 수에 대한 이상에 따라 발생하는 유전 질병을 조기에 진단하는데 이용할 수 있는 방법을 제공하는데 있다.In addition, an object of the present invention is to obtain a basic result of the genetic information of the fetus from the fetal-derived gene present in a small amount in the pregnant woman's blood or plasma, digital PCR for a sample having a fetal-derived gene present in the pregnant woman's blood or plasma By analyzing the genetic information of the fetus by performing the present invention to provide a method that can be used for early diagnosis of the genetic disease caused by the abnormality of the number of genes in the genetic disease of the fetus.
추가로, 본 발명의 목적은 임부의 혈액 내지 혈장으로부터 태아의 유전자의 수에 대한 이상에 관한 유전자 분석을 수행하는데 있어서, 유전자 수 이상에 관한 표적 유전자에 대해 특이적인 프라이머 쌍과 프로브를 이용하여 디지털 PCR을 수행할 때, 다량으로 존재하는 모체 유래 유전자의 배경 신호에 의해 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 표적 유전자와 관련한 유전자의 수에 대한 이상이 검출되지 않거나 불명확한 신호로서 검출되는 문제점을 해결하기 위한 방법을 제공하는데 있다.In addition, it is an object of the present invention to perform genetic analysis on abnormalities in the number of fetal genes from maternal blood or plasma, by using primer pairs and probes specific for the target genes over the number of genes. When PCR is performed, abnormalities in the number of genes associated with fetal origin target genes present in a small amount in maternal blood or plasma are not detected by the background signals of maternally derived genes present in large quantities or are detected as unknown signals. It is to provide a method for solving the problem.
나아가, 본 발명의 목적은 태아 유래 세포 유리 유전자를 이용한 유전자형 분석 기술과 디지털 PCR 기술의 접목을 어렵게 하는 장벽을 해소하고, 아울러 태아 유래 유전자로부터 유래한 신호만의 분리의 어려운 문제와 모체 유래 유전자 배경 신호에 의한 문제를 해결하면서도 디지털 PCR 기술에서 요구되는 프아송 분포를 만족시켜 정량 결과를 신뢰할 수 있는 기술을 제공하는데 있다.Furthermore, an object of the present invention is to solve the barrier that makes it difficult to integrate the genotyping technique using the fetal-derived cell free gene and the digital PCR technique, and also to prevent the problem of separating only the signal derived from the fetal-derived gene and the mother-derived gene background. In order to solve the problems caused by the signal while satisfying the Poisson distribution required in the digital PCR technology to provide a reliable technology for quantitative results.
상기한 기술적 과제를 해결하기 위해, 본 발명은 임부의 혈액 내지 혈장 샘플 내의 특정 표적 유전자에 대한 리얼타임 PCR 증폭에 의해 모체 유래 유전자 증폭량과 태아 유래 유전자 증폭량의 비율을 정량하여 임부의 혈액 내지 혈장 내에 태아 유래 유전자 단편들의 존재를 확인하고, 이를 기초로 태아의 유전 정보를 안정적으로 수집하여 태아의 유전 질환에 대한 조기 진단의 가능성을 높이는 기술을 제공한다. In order to solve the above technical problem, the present invention quantifies the ratio of maternal amplification gene and fetal origin gene amplification by the real-time PCR amplification of a specific target gene in a pregnant woman's blood or plasma sample to the blood and plasma The present invention provides a technique for confirming the existence of fetal-derived gene fragments and stably collecting fetal genetic information based on the feasibility, thereby increasing the possibility of early diagnosis of fetal genetic diseases.
또한, 본 발명은 태아 유래 유전자가 존재하는 것으로 검출된 임부의 혈액 내지 혈장 시료에 대해 디지털 PCR을 수행하되, 모체 유래 유전자 세트와 태아 유래 유전자 세트에 공통적으로 존재하는, 유전자 수 이상과 관련이 없는 비교 대상 유전자(콘트롤 유전자)와, 유전자 수 이상과 관련된 표적 유전자에 대해 디지털 PCR을 이용하여 증폭한 후, 비교 대상 유전자(콘트롤 유전자)에 대한 디지털 PCR 정량 결과가 프아송 분포를 만족시키는 경우, 즉 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개에 근접한 경우 표적 유전자의 디지털 PCR 정량 결과와 콘트롤 유전자의 디지털 PCR 정량 결과를 비교함으로써 유전자 수 이상을 분석할 수 있는 기술을 제공한다.In addition, the present invention performs a digital PCR for the blood or plasma samples of pregnant women detected that the fetal-derived gene is present, but is not related to the number of genes, common to the maternal and fetal-derived gene set When amplification using digital PCR is performed on the genes to be compared (control genes) and target genes related to the number of genes, and the digital PCR quantification results of the genes to be compared (control genes) satisfy the Poisson distribution, ie When the number of control gene copies per well is statistically close to one, a technique for analyzing gene number or more is provided by comparing digital PCR quantification results of a target gene with digital PCR quantification results of a control gene.
우선, 본 발명의 명세서에서 사용되는 용어를 설명하면 다음과 같다.First, the terms used in the specification of the present invention will be described.
본 발명의 명세서에서 사용되는 "리얼타임(real-time) PCR"이란 형광물질(fluorescent material)을 PCR 기법에 응용한 것으로 반응 중 검체 내에 존재하는 표적 유전자의 증폭과 함께 형광물질의 발광(emission) 정도를 실시간으로 검출하고 정량 분석하여 표적 유전자의 증폭 유무 및 그 양상을 신속하고 정확하게 분석할 수 있는 방법이다. 이러한 리얼타임(real-time) PCR은 SYBR 그린(SYBR Green)을 사용하는 방법과 이중 표지된 프로브를 이용하는 방법으로 나누어진다. As used in the specification of the present invention, "real-time PCR" is a fluorescent material applied to the PCR technique, and the emission of the fluorescent material together with the amplification of the target gene present in the sample during the reaction. By detecting and quantitatively analyzing the degree in real time, a method for rapidly and accurately analyzing the presence or absence of amplification of a target gene. Such real-time PCR is divided into a method using SYBR Green and a method using a double labeled probe.
SYBR 그린(SYBR green) 기법은 리얼타임 PCR 증폭 과정에서 증폭된 DNA에 SYBR 그린 염색약이 끼어들어가 PCR 반응으로 합성된 이중가닥 DNA에 결합하여 형광신호를 발생하게 되고 이러한 형광신호를 검출하여 표적 유전자의 존재 여부와 이로부터의 증폭산물의 생성량을 측정할 수 있는 방법이다. 또한, 이중 표지된 프로브(dual labeled probe)를 이용한 리얼타임 PCR 기법은 5'말단에 형광물질이 표지되어 있고 3'말단에 소광물질(Quencher)이 표지된 이중 표지된 프로브를 이용하는 방법으로서, 이중 표지된 프로브에 의한 형광신호를 통해 이중 표지된 프로브가 표적 유전자의 PCR 증폭 산물과 어닐링되었는지 여부를 확인할 수 있고, 표적 유전자의 존재 여부와 이로부터의 증폭산물의 생성량을 측정할 수 있는 방법이다. SYBR green technique uses the SYBR green dye in the amplified DNA during real-time PCR amplification process and binds to the double-stranded DNA synthesized by the PCR reaction to generate a fluorescence signal. It is a method that can measure the presence and the amount of amplification products produced therefrom. In addition, real-time PCR using a dual labeled probe is a method using a double labeled probe labeled with a fluorescent material at the 5 'end and a quencher labeled with the 3' end. The fluorescent signal by the labeled probe can confirm whether the double-labeled probe is annealed with the PCR amplification product of the target gene, and the presence of the target gene and the amount of amplification product generated therefrom can be measured.
본 발명의 명세서에서 사용되는 "디지털 PCR (digital PCR)"은 하나의 웰 당 하나의 액적(droplet) 내의 1개의 유전자 카피를 PCR 증폭한 결과에 대해 단일 분자 계수법을 적용하여 DNA 시료를 정확하게 절대 정량할 수 있는 기술이다. 디지털 PCR은 하나의 웰 플레이트에서 최대 3,072개의 시료를 분석할 수 있고 이러한 웰 플레이트를 최대 4개까지 사용하여 동시에 분석을 진행할 수 있으므로 대용량 시료의 분석 및 다양한 시료의 검사를 수행할 수 있다. 또한, 디지털 PCR은 표준 곡선을 이용한 분석과정이 필요없고 형광신호를 나타내는 웰의 개수를 카운트하여 디지털 값으로 간편하게 정량할 수 있는 기술이다(Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol. Diagn. 4(1), 41-47 (2004) 참조). As used herein, the term "digital PCR (digital PCR)" precisely absolute quantification of DNA samples by applying a single molecule counting method for PCR amplification of one copy of a gene in one droplet per well It is a technology that can be done. Digital PCR can analyze up to 3,072 samples in one well plate, and can analyze up to four such well plates at the same time, so that a large amount of samples can be analyzed and various samples can be performed. In addition, digital PCR is a technology that does not require an analysis process using a standard curve and can easily quantify the digital value by counting the number of wells representing a fluorescent signal (Gudrun Pohl and le-Ming Shih, Principle and applications of digital PCR, Expert Rev. Mol.Diagn. 4 (1), 41-47 (2004)).
본 발명의 명세서에서 사용되는 "표적 유전자"라는 용어는 분석대상이 되는 시료 내의 유전자들 중 유전자형 분석에 유용한 변이가 존재하는 유전자로서, 예를 들어 유전자 감식이나 개체 식별에 사용되는 마커 유전자, 특정 질환의 진단에 사용되는 마커 유전자, 염색체 수 이상 내지는 유전자 수 이상을 나타내는 유전자, 유전학적으로 의미가 있는 돌연변이를 갖는 유전자, STR (short tandem repeat)을 갖는 유전자 및 단일염기다형성을 갖는 유전자 등을 들 수 있다. 반면에, "콘트롤 유전자"는 임부의 혈액 내지 혈장 내의 모체 유래 유전자 세트나 태아 유래 유전자 세트 모두에 있어서 유전자 수 이상과 관련이 없는 것으로 알려진 유전자를 의미한다. As used herein, the term “target gene” refers to a gene having a useful mutation for genotyping among genes in a sample to be analyzed, for example, a marker gene used for gene identification or identification of an individual, a specific disease. Marker genes used for the diagnosis of chromosomes, genes representing more than or equal to chromosomes, genes with genetically significant mutations, genes with STR (short tandem repeat) and genes with single nucleotide polymorphism. have. On the other hand, "control gene" refers to a gene known to be unrelated to the number of genes in both maternal or fetal-derived gene sets in maternal blood or plasma.
한편, 본 발명의 실시예에서 설명되는 콘트롤 유전자, 표적 유전자 및 관련 염색체들은 예시로서 이해되어야 하며, 본 발명의 디지털 PCR을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법은 다양한 개체 또는 시료와, 다양한 표적 유전자 및 염색체에 대한 유전자형 분석 내지는 유전자 수 이상 분석에 적용가능한 기반기술로서 이해되어야 할 것이다. Meanwhile, the control genes, target genes and related chromosomes described in the embodiments of the present invention should be understood as examples, and methods for analyzing fetal genetic information from pregnant women's blood or plasma using the digital PCR of the present invention are various individuals. Or as a technology applicable to genotyping or gene count analysis of samples and various target genes and chromosomes.
본 발명의 디지털 PCR을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법은,Method for analyzing the genetic information of the fetus from the blood or plasma of pregnant women using the digital PCR of the present invention,
(a) 임부의 혈액 또는 혈장 시료 내에 태아 유래 유전자가 존재하는지 여부를 분석하는 단계와,(a) analyzing whether a fetal-derived gene is present in the maternal blood or plasma sample,
(b) 상기 (a) 단계의 분석에 의해 태아 유래 유전자가 존재하는 것으로 검출된 시료를 웰 플레이트의 각 웰에 분배하여 디지털 PCR을 수행하되, 모체 유래 유전자 세트와 태아 유래 유전자 세트에 공통적으로 존재하는, 유전자 수 이상과 관련이 없는 콘트롤 유전자와, 유전자 수 이상과 관련된 표적 유전자에 대해 디지털 PCR을 수행하는 단계와,(b) Digital PCR is performed by distributing a sample detected as having fetal-derived genes by the analysis of step (a) to each well of the well plate, and is commonly present in the maternal and fetal-derived gene sets. Performing a digital PCR on a control gene not related to the abnormal number of genes and a target gene related to the abnormal number of genes,
(c) 상기 (b) 단계에서 수득된 콘트롤 유전자의 디지털 PCR 증폭산물을 정량한 후, 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개에 근접하는지 여부를 분석하는 단계와,(c) quantifying the digital PCR amplification products of the control gene obtained in step (b), and analyzing whether the number of control gene copies per well is statistically close to one;
(d) 상기 (c) 단계의 분석 결과, 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개를 초과하는 것으로 결정되면, 상기 시료를 추가로 희석하여 상기 (b) 단계 및 (c) 단계를 반복하는 단계와,(d) If the analysis of step (c) determines that the number of control gene copies per well is statistically greater than one, the sample is further diluted to perform steps (b) and (c). Repeating steps,
(e) 상기 (c) 단계의 분석 결과, 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개에 근접하는 것으로 결정되면, 상기 표적 유전자의 디지털 PCR 증폭산물을 정량하고, 상기 콘트롤 유전자의 디지털 PCR 정량값에 대한 상기 표적 유전자의 디지털 PCR 정량값의 비율을 산출하는 단계와,(e) If the analysis result of step (c) determines that the number of control gene copies per well is statistically close to one, the digital PCR amplification product of the target gene is quantified, and the digital PCR of the control gene is performed. Calculating a ratio of the digital PCR quantitative value of the target gene to the quantitative value;
(f) 상기 (e) 단계에서 산출된 비율이 1.5 이상이면 태아 유래 표적 유전자에서 유전자 수 이상이 있는 것으로 결정하는 단계를 포함한다.(f) determining that there is more than the number of genes in the target gene derived from the fetus if the ratio calculated in step (e) is 1.5 or more.
본 발명의 일실시예의 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법에 있어서, 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개에 근접한다는 것은 콘트롤 유전자에 대한 디지털 PCR 정량 결과가 프아송 분포를 만족시켜 디지털 PCR의 정량 결과가 통계학적으로 유의미한 것을 의미한다. 예를 들어, 정확하게 웰 당 카피수가 1개인 경우 뿐만아니라 웰 당 카피수가 대략 1.01 내지 1.59의 범주 내에 들어 가는 경우, 보다 바람직하게는 대략 1.01 내지 1.39의 범주 내에 들어 가는 경우 역시 통계학적으로 1개에 근접하는 것으로 간주한다. In the method for analyzing genetic information of a fetus from blood or plasma of a pregnant woman of an embodiment of the present invention, the fact that the number of control gene copies per well is statistically close to 1 shows that the results of digital PCR quantification of the control gene are not. Satisfying the subson distribution means that the quantitative results of the digital PCR are statistically significant. For example, if exactly one copy per well as well as if the copy per well falls within the range of about 1.01 to 1.59, more preferably if it falls within the range of about 1.01 to 1.39 is also statistically one. To be considered close.
본 발명의 일실시예의 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법에 있어서, 상기 (e) 단계에서 상기 콘트롤 유전자의 디지털 PCR 정량값은 웰 당 콘트롤 유전자의 평균 카피수이고, 상기 표적 유전자의 디지털 PCR 정량값은 웰 당 표적 유전자의 평균 카피수일 수 있다.In the method of analyzing the genetic information of the fetus from the blood or plasma of a pregnant woman of an embodiment of the present invention, the digital PCR quantitative value of the control gene in the step (e) is the average copy number of the control gene per well, the target The digital PCR quantitative value of a gene can be the average copy number of the target gene per well.
또한, 본 발명의 일실시예의 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법에 있어서, 상기 (d) 단계에서 상기 시료의 희석은 약 1000배-5000배에 이르기까지 단계적으로 수행하는 것이 바람직하다.In addition, in the method of analyzing the genetic information of the fetus from the blood or plasma of the pregnant woman of one embodiment of the present invention, the dilution of the sample in the step (d) is carried out step by step up to about 1000-5000 times desirable.
이와 같은 본 발명에 따르면 태아 유래 세포 유리 유전자를 이용한 유전자형 분석 기술과 디지털 PCR 기술의 접목을 어렵게 하는 종래의 문제점을 해결할 수 있다. 종래의 방식에 따라 디지털 PCR 기술을 태아 유래 세포 유리 유전자에 대한 유전자형 분석에 적용하기 위해서는 태아의 유전 질환과 관련한 표적 유전자의 카피수를 웰 당 1개로 맞추어야 하지만 이는 기술적으로 매우 어렵다.According to the present invention, it is possible to solve the conventional problem of making it difficult to integrate the genotyping technique using the fetal-derived cell free gene and the digital PCR technique. In order to apply digital PCR techniques to genotyping of fetal-derived cell free genes according to conventional methods, the number of copies of target genes related to the fetal genetic disease should be adjusted to 1 per well, but this is technically very difficult.
예를 들어, 표적 유전자의 주형 1개를 각 웰에 분배하기 위해 임부의 혈액 내지 혈장을 희석한 후 디지털 PCR을 수행하여 정량하면 각 웰 당 1개의 표적 유전자 카피수라는 프아송 분포의 통계학적 조건을 충족시킬 수 있지만, 디지털 PCR 정량 결과는 임부의 표적 유전자 주형에 대한 증폭결과와 태아의 표적 유전자 주형의 대한 증폭결과의 합이므로 태아의 표적 유전자의 유전자 수 이상을 확인하는데 있어 태아의 표적 유전자 주형의 증폭 결과만을 분리하여 판단하기 어렵다. 또한, 태아의 표적 유전자 주형 1개를 각 웰에 분배하기 위해 시료를 희석하는 경우, 태아의 유전자 양이 미량이므로 희석 과정에서 소실되거나 분석 신호가 미약하여 유의적인 결과를 얻을 수 없게 되는 문제가 있다. 반면에, 본 발명의 방법은 전술한 바와 같은 구성을 구비함으로써 태아 유래 유전자로부터 유래한 신호만의 분리의 어려운 문제와 모체 유래 유전자 배경 신호에 의한 문제를 해결하면서도 디지털 PCR 기술에서 요구되는 프아송 분포를 만족시켜 정량 결과를 신뢰할 수 있는 기술을 제공할 수 있다.For example, dilution of maternal blood or plasma to distribute one template of target gene to each well, followed by quantification by digital PCR, results in a statistical condition of a Poisson distribution called one target gene copy number per well. Although the digital PCR quantification result is the sum of the amplification results of the target gene template of the pregnant woman and the amplification of the target gene template of the fetus, the fetal target gene template may be used to identify more than the gene number of the target gene of the fetus. It is difficult to judge only the amplification result of. In addition, when diluting a sample to distribute one fetal target gene template to each well, there is a problem that the amount of genes in the fetus is very small and thus lost during the dilution process or the analysis signal is weak, so that no significant result can be obtained. . On the other hand, the method of the present invention has the configuration as described above, while solving the difficult problem of separation of only the signal derived from the fetal-derived gene and the problem caused by the maternal-derived gene background signal, while the Poisson distribution required in digital PCR technology It is possible to provide a technology that can satisfy the quantitative results by satisfying the.
한편, 전술한 바와 같이 다양한 콘트롤 유전자 및 표적 유전자 그리고 관련 염색체들이 본 발명의 방법에 적용될 수 있고, 이러한 콘트롤 유전자 및 표적 유전자를 증폭하기 위한 다양한 프라이머 쌍 및 증폭산물을 검출하기 위한 다양한 프로브 역시 해당 유전자 표적 서열을 이용하여 설계될 수 있다. Meanwhile, as described above, various control genes and target genes and related chromosomes can be applied to the method of the present invention, and various probe pairs for detecting various primer pairs and amplification products for amplifying such control genes and target genes are also genes of interest. It can be designed using the target sequence.
본 발명을 한정하지 않은 예시로서, 상기 콘트롤 유전자는 2번 염색체 상의 유전자인 서열번호 33의 염기서열을 갖는 콘트롤 유전자와, 1번 염색체 상의 유전자인 서열번호 37의 염기서열을 갖는 콘트롤 유전자로 구성된 군으로부터 선택된 적어도 하나가 사용될 수 있다. By way of example and not limitation, the control gene is a group consisting of a control gene having a nucleotide sequence of SEQ ID NO: 33, which is a gene on chromosome 2, and a control gene having a nucleotide sequence of SEQ ID NO: 37, a gene on chromosome 1 At least one selected from can be used.
상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 34 및 35의 프라이머 쌍이 사용될 수 있고 상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 또한, 상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 38 및 39의 프라이머 쌍이 사용될 수 있고 상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다.As a primer pair for amplifying a control gene having a nucleotide sequence of SEQ ID NO: 33, primer pairs of SEQ ID NOs: 34 and 35 may be used, and as a probe for detecting a control gene amplification product having a nucleotide sequence of SEQ ID NO: 33, a sequence At least one probe selected from the group consisting of an oligonucleotide of No. 36 and an oligonucleotide complementary to such oligonucleotide can be used. As a primer pair for amplifying a control gene having the nucleotide sequence of SEQ ID NO: 37, primer pairs of SEQ ID NOs: 38 and 39 may be used, and as a probe for detecting a control gene amplification product having the nucleotide sequence of SEQ ID NO: 37. At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 40 and an oligonucleotide complementary to such oligonucleotide may be used.
본 발명의 일실시예의 방법에 있어서, 서열번호 34 및 35의 프라이머 쌍과 서열번호 38 및 39의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자 및 상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자 증폭 산물 및 상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자 증폭 산물을 동일한 웰에서 함께 검출할 수 있다. 이와 같이, 복수의 콘트롤 유전자들에 대해 특이적인 프라이머 쌍과 검출 프로브들을 혼합하여 동일한 웰에 분주하면 웰 플레이트에 분배되는 샘플의 양을 늘일 수 있고 레이아웃 설계의 불편함과 프라이머 및 프로브 분주 과정의 불편함을 개선할 수 있다.In the method of an embodiment of the present invention, using a mixture of primer pairs of SEQ ID NO: 34 and 35 and primer pairs of SEQ ID NO: 38 and 39, the control gene having the nucleotide sequence of SEQ ID NO: 33 and of SEQ ID NO: 37 Amplifying a control gene having a nucleotide sequence together in the same well, at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 36 and oligonucleotides complementary to these oligonucleotides, and oligonucleotides of SEQ ID NO: 40 and such oligos Using a mixture of at least one probe selected from the group consisting of oligonucleotides complementary to nucleotides, a control gene amplification product having the nucleotide sequence of SEQ ID NO: 33 and a control gene amplification product having the nucleotide sequence of SEQ ID NO: 37 are prepared. Detected together in the same well Can. As such, by mixing primer pairs and detection probes specific for a plurality of control genes and dispensing them in the same well, it is possible to increase the amount of sample to be distributed to the well plate, inconvenience of layout design, and inconvenience of primer and probe dispensing process. Can be improved.
또한, 본 발명을 한정하지 않은 예시로서, 상기 표적 유전자는 21번 염색체 상의 표적 유전자, 13번 염색체 상의 표적 유전자 및 18번 염색체 상의 표적 유전자로 구성된 군으로부터 선택된 적어도 하나일 수 있다. 추가로, 본 발명의 일실시예의 방법에 따르면, 21번 염색체 상의 표적 유전자, 13번 염색체 상의 표적 유전자 및 18번 염색체 상의 표적 유전자로 구성된 군으로부터 선택된 적어도 2종의 표적 유전자에 대한 디지털 PCR을 동시에 수행할 수 있다.Further, by way of example and not limitation, the target gene may be at least one selected from the group consisting of a target gene on chromosome 21, a target gene on chromosome 13, and a target gene on chromosome 18. Further, according to the method of an embodiment of the present invention, digital PCR for at least two target genes selected from the group consisting of a target gene on chromosome 21, a target gene on chromosome 13 and a target gene on chromosome 18 simultaneously Can be done.
본 발명을 한정하지 않은 예시로서, 상기 21번 염색체 상의 표적 유전자는 서열번호 21의 염기서열을 갖는 표적 유전자, 서열번호 25의 염기서열을 갖는 표적 유전자 및 서열번호 29의 염기서열을 갖는 표적 유전자로 구성된 군으로부터 선택된 적어도 하나가 사용될 수 있다.By way of example and not limitation, the target gene on chromosome 21 may be a target gene having the nucleotide sequence of SEQ ID NO: 21, a target gene having the nucleotide sequence of SEQ ID NO: 25, and a target gene having the nucleotide sequence of SEQ ID NO: 29 At least one selected from the group consisting of may be used.
상기 서열번호 21의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 22 및 23의 프라이머 쌍이 사용될 수 있고 상기 서열번호 21의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 또한, 상기 서열번호 25의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 26 및 27의 프라이머 쌍이 사용될 수 있고 상기 서열번호 25의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 그리고, 상기 서열번호 29의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 30 및 31의 프라이머 쌍이 사용될 수 있고 상기 서열번호 29의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 21 may be used a primer pair of SEQ ID NO: 22 and 23, and a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 21 At least one probe selected from the group consisting of an oligonucleotide of No. 24 and an oligonucleotide complementary to such oligonucleotide can be used. As a primer pair for amplifying a target gene having the nucleotide sequence of SEQ ID NO: 25, primer pairs of SEQ ID NO: 26 and 27 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 25. At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 and an oligonucleotide complementary to such oligonucleotide may be used. As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 29, primer pairs of SEQ ID NOs: 30 and 31 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 29. At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 32 and an oligonucleotide complementary to such oligonucleotide can be used.
본 발명의 일실시예의 방법에 있어서, 서열번호 22 및 23의 프라이머 쌍, 서열번호 26 및 27의 프라이머 쌍, 및 서열번호 30 및 31의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 21의 염기서열을 갖는 표적 유전자, 상기 서열번호 25의 염기서열을 갖는 표적 유전자, 및 상기 서열번호 29의 염기서열을 갖는 표적 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 21의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 25의 염기서열을 갖는 표적 유전자 증폭 산물, 및 상기 서열번호 29의 염기서열을 갖는 표적 유전자 증폭산물을 동일한 웰에서 함께 검출할 수 있다. 이와 같이, 21번 염색체 상의 복수의 표적 유전자들에 대해 특이적인 프라이머 쌍과 검출 프로브들을 혼합하여 동일한 웰에 분주하면 웰 플레이트에 분배되는 샘플의 양을 늘일 수 있고 레이아웃 설계의 불편함과 프라이머 및 프로브 분주 과정의 불편함을 개선할 수 있다.In the method of an embodiment of the present invention, a base sequence of SEQ ID NO: 21 using a mixture of primer pairs of SEQ ID NOs: 22 and 23, primer pairs of SEQ ID NOs: 26 and 27, and primer pairs of SEQ ID NOs: 30 and 31 A target gene having a nucleotide sequence of SEQ ID NO: 25, and a target gene having the nucleotide sequence of SEQ ID NO: 29 are amplified together in the same well and complementary to the oligonucleotide of SEQ ID NO: 24 At least one probe selected from the group consisting of oligonucleotides, oligonucleotides of SEQ ID NO: 28 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides, and oligonucleotides of SEQ ID NO: 32 and such oligonucleotides Oligonucleotides Complementary to Using a mixture of at least one probe selected from the group consisting of a target gene amplification product having the nucleotide sequence of SEQ ID NO: 21, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 25, and the sequence of Target gene amplification products having the base sequence can be detected together in the same well. As such, by mixing primer pairs and detection probes specific for a plurality of target genes on chromosome 21 and dispensing them in the same well, it is possible to increase the amount of sample to be distributed in the well plate, and the inconvenience of layout design and primers and probes. The discomfort in the dispensing process can be improved.
또한, 본 발명을 한정하지 않은 예시로서, 상기 18번 염색체 상의 표적 유전자는 서열번호 57의 염기서열을 갖는 표적 유전자, 서열번호 61의 염기서열을 갖는 표적 유전자, 서열번호 65의 염기서열을 갖는 표적 유전자 및 서열번호 69의 염기서열을 갖는 표적 유전자로 구성된 군으로부터 선택된 적어도 하나가 사용될 수 있다.Further, by way of example and not limitation, the target gene on chromosome 18 is a target gene having the nucleotide sequence of SEQ ID NO: 57, a target gene having the nucleotide sequence of SEQ ID NO: 61, a target having the nucleotide sequence of SEQ ID NO: 65 At least one selected from the group consisting of a gene and a target gene having a nucleotide sequence of SEQ ID NO: 69 may be used.
상기 서열번호 57의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 58 및 59의 프라이머 쌍이 사용될 수 있고 상기 서열번호 57의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 또한, 상기 서열번호 61의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 62 및 63의 프라이머 쌍이 사용될 수 있고 상기 서열번호 61의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 추가로, 상기 서열번호 65의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 66 및 67의 프라이머 쌍이 사용될 수 있고 상기 서열번호 65의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 그리고, 상기 서열번호 69의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 70 및 71의 프라이머 쌍이 사용될 수 있고 상기 서열번호 69의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 57 may be used a primer pair of SEQ ID NO: 58 and 59, and a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 57 At least one probe selected from the group consisting of an oligonucleotide of No. 60 and an oligonucleotide complementary to such oligonucleotide can be used. As a primer pair for amplifying a target gene having the nucleotide sequence of SEQ ID NO: 61, primer pairs of SEQ ID NOs: 62 and 63 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 61. At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 64 and an oligonucleotide complementary to such oligonucleotide can be used. In addition, as a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 65, a primer pair of SEQ ID NOs: 66 and 67 may be used and a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 65. As the oligonucleotide of SEQ ID NO: 68 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides can be used. As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 69, a primer pair of SEQ ID NOs: 70 and 71 may be used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 69. May be used at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 72 and an oligonucleotide complementary to such oligonucleotide.
본 발명의 일실시예의 방법에 있어서, 서열번호 58 및 59의 프라이머 쌍, 서열번호 62 및 63의 프라이머 쌍, 서열번호 66 및 67의 프라이머 쌍, 및 서열번호 70 및 71의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 57의 염기서열을 갖는 표적 유전자, 상기 서열번호 61의 염기서열을 갖는 표적 유전자, 상기 서열번호 65의 염기서열을 갖는 표적 유전자, 및 상기 서열번호 69의 염기서열을 갖는 표적 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 57의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 61의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 65의 염기서열을 갖는 표적 유전자 증폭 산물, 및 상기 서열번호 69의 염기서열을 갖는 표적 유전자 증폭산물을 동일한 웰에서 함께 검출할 수 있다. 이와 같이, 18번 염색체 상의 복수의 표적 유전자들에 대해 특이적인 프라이머 쌍과 검출 프로브들을 혼합하여 동일한 웰에 분주하면 웰 플레이트에 분배되는 샘플의 양을 늘일 수 있고 레이아웃 설계의 불편함과 프라이머 및 프로브 분주 과정의 불편함을 개선할 수 있다.In an embodiment of the invention, a mixture of primer pairs of SEQ ID NOs: 58 and 59, primer pairs of SEQ ID NOs: 62 and 63, primer pairs of SEQ ID NOs: 66 and 67, and primer pairs of SEQ ID NOs: 70 and 71 are used Thus, the target gene having the nucleotide sequence of SEQ ID NO: 57, the target gene having the nucleotide sequence of SEQ ID NO: 61, the target gene having the nucleotide sequence of SEQ ID NO: 65, and the target gene having the nucleotide sequence of SEQ ID NO: 69 Are amplified together in the same well and at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 60 and oligonucleotides complementary to these oligonucleotides, oligonucleotides of SEQ ID NO: 64 and oligonucleotides complementary to these oligonucleotides At least one probe selected from the group consisting of At least one probe selected from the group consisting of oligonucleotides and oligonucleotides complementary to such oligonucleotides, and mixtures of oligonucleotides of SEQ ID NO: 72 and at least one probe selected from the group consisting of oligonucleotides complementary to these oligonucleotides Using, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 57, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 61, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 65, and the sequence number Target gene amplification products having a nucleotide sequence of 69 can be detected together in the same well. As such, by mixing primer pairs and detection probes specific for a plurality of target genes on chromosome 18 and dispensing them in the same well, it is possible to increase the amount of sample to be distributed to the well plate and the inconvenience of layout design and primers and probes. The discomfort in the dispensing process can be improved.
또한, 본 발명을 한정하지 않은 예시로서, 상기 13번 염색체 상의 표적 유전자는 서열번호 41의 염기서열을 갖는 표적 유전자, 서열번호 45의 염기서열을 갖는 표적 유전자, 서열번호 49의 염기서열을 갖는 표적 유전자 및 서열번호 53의 염기서열을 갖는 표적 유전자로 구성된 군으로부터 선택된 적어도 하나가 사용될 수 있다.Further, by way of example and not by way of limitation, the target gene on chromosome 13 is a target gene having the nucleotide sequence of SEQ ID NO: 41, a target gene having the nucleotide sequence of SEQ ID NO: 45, a target having the nucleotide sequence of SEQ ID NO: 49 At least one selected from the group consisting of a gene and a target gene having a nucleotide sequence of SEQ ID NO: 53 may be used.
상기 서열번호 41의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 42 및 43의 프라이머 쌍이 사용될 수 있고 상기 서열번호 41의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 또한, 상기 서열번호 45의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 46 및 47의 프라이머 쌍이 사용될 수 있고 상기 서열번호 45의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 추가로, 상기 서열번호 49의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 50 및 51의 프라이머 쌍이 사용될 수 있고 상기 서열번호 49의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다. 그리고, 상기 서열번호 53의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 54 및 55의 프라이머 쌍이 사용될 수 있고 상기 서열번호 53의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용될 수 있다.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 41, primer pairs of SEQ ID NOs: 42 and 43 may be used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 41, a sequence At least one probe selected from the group consisting of an oligonucleotide of number 44 and an oligonucleotide complementary to such oligonucleotide can be used. In addition, as a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 45, primer pairs of SEQ ID NOs: 46 and 47 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 45. At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 48 and an oligonucleotide complementary to such oligonucleotide can be used. In addition, as a primer pair for amplifying the target gene having the nucleotide sequence of SEQ ID NO: 49, primer pairs of SEQ ID NO: 50 and 51 may be used and a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 49 As the oligonucleotide of SEQ ID NO: 52 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides can be used. As a primer pair for amplifying a target gene having the nucleotide sequence of SEQ ID NO: 53, primer pairs of SEQ ID NOs: 54 and 55 may be used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 53. May be used at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 56 and an oligonucleotide complementary to such oligonucleotide.
본 발명의 일실시예의 방법에 있어서, 서열번호 42 및 43의 프라이머 쌍, 서열번호 46 및 47의 프라이머 쌍, 서열번호 50 및 51의 프라이머 쌍, 및 서열번호 54 및 55의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 41의 염기서열을 갖는 표적 유전자, 상기 서열번호 45의 염기서열을 갖는 표적 유전자, 상기 서열번호 49의 염기서열을 갖는 표적 유전자, 및 상기 서열번호 53의 염기서열을 갖는 표적 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 41의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 45의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 49의 염기서열을 갖는 표적 유전자 증폭 산물, 및 상기 서열번호 53의 염기서열을 갖는 표적 유전자 증폭산물을 동일한 웰에서 함께 검출할 수 있다. 이와 같이, 13번 염색체 상의 복수의 표적 유전자들에 대해 특이적인 프라이머 쌍과 검출 프로브들을 혼합하여 동일한 웰에 분주하면 웰 플레이트에 분배되는 샘플의 양을 늘일 수 있고 레이아웃 설계의 불편함과 프라이머 및 프로브 분주 과정의 불편함을 개선할 수 있다.In an embodiment of the invention, a mixture of primer pairs of SEQ ID NOs: 42 and 43, primer pairs of SEQ ID NOs: 46 and 47, primer pairs of SEQ ID NOs: 50 and 51, and primer pairs of SEQ ID NOs: 54 and 55 are used Thus, the target gene having the nucleotide sequence of SEQ ID NO: 41, the target gene having the nucleotide sequence of SEQ ID NO: 45, the target gene having the nucleotide sequence of SEQ ID NO: 49, and the target gene having the nucleotide sequence of SEQ ID NO: 53 Are amplified together in the same well and at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 44 and oligonucleotides complementary to these oligonucleotides, oligonucleotides of SEQ ID NO: 48 and oligonucleotides complementary to these oligonucleotides At least one probe selected from the group consisting of At least one probe selected from the group consisting of oligonucleotides and oligonucleotides complementary to such oligonucleotides, and mixtures of oligonucleotides of SEQ ID NO: 56 with at least one probe selected from the group consisting of oligonucleotides complementary to these oligonucleotides Using, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 41, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 45, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 49, and the sequence number Target gene amplification products having the nucleotide sequence of 53 can be detected together in the same well. As such, by mixing primer pairs and detection probes specific for a plurality of target genes on chromosome 13 and dispensing them in the same well, it is possible to increase the amount of sample to be distributed to the well plate, and the inconvenience of layout design and primers and probes. The discomfort in the dispensing process can be improved.
또한, 본 발명은 유전자 시료 내의 모체 유래 유전자 세트와 태아 유래 유전자 세트에 공통적으로 존재하고 유전자 수 이상과 관련이 없는, 디지털 PCR 정량을 위한 콘트롤 유전자 조성물을 제공한다. 본 발명의 일실시예의 디지털 PCR 정량을 위한 콘트롤 유전자 조성물은 1번 염색체 상의 서열번호 37의 유전자 및 2번 염색체 상의 서열번호 33의 유전자로 구성된 군으로부터 선택된 적어도 하나의 유전자를 포함하고, 유전자 시료 내에 존재하는 유전자 수 이상과 관련된 표적 유전자의 증폭 후 얻어진 정량값으로부터 정상화값을 산출하기 위한 기준 정량값을 얻기 위해 증폭되어 정량된다. 이때, 상기 정상화값은 상기 표적 유전자의 유전자 수 이상 여부를 판별하기 위해 산출된다. In addition, the present invention provides a control gene composition for digital PCR quantification, which is common to the mother-derived and fetal-derived gene sets in a gene sample and is not associated with abnormal number of genes. The control gene composition for digital PCR quantification of an embodiment of the present invention comprises at least one gene selected from the group consisting of the gene of SEQ ID NO: 37 on chromosome 1 and the gene of SEQ ID NO: 33 on chromosome 2, It is amplified and quantified to obtain a reference quantitative value for calculating a normalized value from the quantitative value obtained after amplification of a target gene related to an abnormal number of genes present. In this case, the normalization value is calculated to determine whether or not the number of genes of the target gene.
이와 관련하여 본 발명은 유전자 시료 내에 존재하는 콘트롤 유전자의 증폭 산물을 검출하고 정량하는데 사용되는 콘트롤 유전자용 프로브 조성물을 제공한다.In this regard, the present invention provides a probe composition for a control gene used to detect and quantify an amplification product of a control gene present in a gene sample.
본 발명의 일실시예의 콘트롤 유전자용 프로브 조성물은, 서열번호 33의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 서열번호 37의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함한다.Probe composition for a control gene of an embodiment of the present invention, the oligonucleotide of SEQ ID NO: 36 specific to the control gene having a nucleotide sequence of SEQ ID NO: 33 and at least one selected from the group consisting of oligonucleotides complementary to such oligonucleotide At least one probe selected from the group consisting of a probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 40 specific to a control gene having a nucleotide sequence of SEQ ID NO: 37 and an oligonucleotide complementary to such oligonucleotide It includes.
또한, 본 발명은 임부의 혈액 내지 혈장으로부터 추출된 유전자 시료를 증폭하고, 증폭산물을 검출 및 정량하는데 사용되는 웰 플레이트를 제공한다.The present invention also provides a well plate for amplifying a genetic sample extracted from pregnant women's blood or plasma, and for detecting and quantifying amplification products.
본 발명의 일실시예의 웰 플레이트는, 서열번호 33의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 서열번호 37의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 포함한다. 이때, 2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주될 수 있다.Well plate of an embodiment of the present invention, at least one probe selected from the group consisting of oligonucleotide of SEQ ID NO: 36 specific to the control gene having a nucleotide sequence of SEQ ID NO: 33 and oligonucleotide complementary to such oligonucleotide, At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 40 specific to a control gene having a nucleotide sequence of SEQ ID NO: 37 and at least one probe selected from the group consisting of an oligonucleotide complementary to such oligonucleotide Wells. In this case, two or more probes may be individually dispensed into each well or mixed together and dispensed into one well.
상기 웰 플레이트는, 21번 염색체 상의 서열번호 21의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 25의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 29의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 더 포함할 수 있다. 이때, 2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주될 수 있다. 상기 프로브는 상기 21번 염색체 상의 표적 유전자의 증폭 산물에 특이적으로 결합하여 유전자 수 이상 여부를 검출하는데 사용된다. 예를 들어, 상기 유전자 수 이상은 3염색체성일 수 있다. The well plate is at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 24 specific to a target gene having a nucleotide sequence of SEQ ID NO: 21 on chromosome 21 and an oligonucleotide complementary to such oligonucleotide, and 21 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 specific to a target gene having the nucleotide sequence of SEQ ID NO: 25 on chromosome No. 26, and an oligonucleotide complementary to such oligonucleotide, and SEQ ID NO: 29 on Chromosome 21 At least one pro selected from the group consisting of an oligonucleotide of SEQ ID NO: 32 specific to a target gene having a nucleotide sequence of and at least one probe selected from the group consisting of an oligonucleotide complementary to such oligonucleotide The it may further include a dispensing well. In this case, two or more probes may be individually dispensed into each well or mixed together and dispensed into one well. The probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 21. For example, the number of genes may be trisomy.
또한, 상기 웰 플레이트는, 18번 염색체 상의 서열번호 57의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 61의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 65의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 69의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 더 포함할 수 있다. 이때, 2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주될 수 있다. 상기 프로브는 상기 18번 염색체 상의 표적 유전자의 증폭 산물에 특이적으로 결합하여 유전자 수 이상 여부를 검출하는데 사용된다. 예를 들어, 상기 유전자 수 이상은 3염색체성일 수 있다. The well plate may include at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 60 specific to a target gene having a nucleotide sequence of SEQ ID NO: 57 on chromosome 18, and an oligonucleotide complementary to the oligonucleotide; At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 64 specific for a target gene having a nucleotide sequence of SEQ ID NO: 61 on chromosome 18 and an oligonucleotide complementary to such oligonucleotide, and a sequence on chromosome 18 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 68 specific to a target gene having a nucleotide sequence of SEQ ID NO: 65 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 69 on chromosome 18 It may further comprise a well in which at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 72 specific to a target gene having and at least one probe selected from the group consisting of an oligonucleotide complementary to such oligonucleotide. . In this case, two or more probes may be individually dispensed into each well or mixed together and dispensed into one well. The probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 18. For example, the number of genes may be trisomy.
또한, 상기 웰 플레이트는, 13번 염색체 상의 서열번호 41의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 45의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 49의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 53의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 더 포함할 수 있다. 이때, 2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주될 수 있다. 상기 프로브는 상기 13번 염색체 상의 표적 유전자의 증폭 산물에 특이적으로 결합하여 유전자 수 이상 여부를 검출하는데 사용된다. 예를 들어, 상기 유전자 수 이상은 3염색체성일 수 있다. The well plate may include at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 44 specific to a target gene having a nucleotide sequence of SEQ ID NO: 41 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide; At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 48 specific to a target gene having a nucleotide sequence of SEQ ID NO: 45 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide, and a sequence on chromosome 13 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 52 specific to a target gene having a nucleotide sequence of SEQ ID NO: 49, and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 53 on chromosome 13 It may further include a well in which at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 56 specific to the target gene having and at least one probe selected from the group consisting of oligonucleotides complementary to the oligonucleotide. . In this case, two or more probes may be individually dispensed into each well or mixed together and dispensed into one well. The probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 13. For example, the number of genes may be trisomy.
또한, 본 발명은 유전자 시료 내에 존재하는 유전자 수 이상과 관련된 표적 유전자 증폭 산물을 검출하고 정량하는데 사용되는 표적 유전자용 프로브 조성물을 제공한다. The present invention also provides probe compositions for target genes that are used to detect and quantify target gene amplification products associated with more than the number of genes present in a genetic sample.
본 발명의 일실시예의 표적 유전자용 프로브 조성물은, 21번 염색체 상의 서열번호 21의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 25의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 29의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함한다. 상기 프로브는 상기 21번 염색체 상의 표적 유전자의 증폭 산물에 특이적으로 결합하여 유전자 수 이상 여부를 검출하는데 사용된다. 예를 들어, 상기 유전자 수 이상은 3염색체성일 수 있다. The probe composition for a target gene of an embodiment of the present invention is selected from the group consisting of an oligonucleotide of SEQ ID NO: 24 specific to a target gene having a nucleotide sequence of SEQ ID NO: 21 on chromosome 21 and an oligonucleotide complementary to such oligonucleotide At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 specific to a target gene having a nucleotide sequence of SEQ ID NO: 25 on chromosome 21, and an oligonucleotide complementary to such oligonucleotide; , A group consisting of an oligonucleotide of SEQ ID NO: 32 specific to a target gene having the nucleotide sequence of SEQ ID NO: 29 on chromosome 21 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotide From comprises at least one probe selected. The probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 21. For example, the number of genes may be trisomy.
또한, 본 발명의 일실시예의 표적 유전자용 프로브 조성물은, 18번 염색체 상의 서열번호 57의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 61의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 65의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 69의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함한다. 상기 프로브는 상기 18번 염색체 상의 표적 유전자의 증폭 산물에 특이적으로 결합하여 유전자 수 이상 여부를 검출하는데 사용된다. 예를 들어, 상기 유전자 수 이상은 3염색체성일 수 있다.In addition, the probe composition for a target gene of an embodiment of the present invention is a group consisting of an oligonucleotide of SEQ ID NO: 60 specific to a target gene having a nucleotide sequence of SEQ ID NO: 57 on chromosome 18 and an oligonucleotide complementary to such oligonucleotide At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 64 specific for a target gene having a nucleotide sequence of SEQ ID NO: 61 on chromosome 18 and an oligonucleotide complementary to such oligonucleotide At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 68 specific to a target gene having a nucleotide sequence of SEQ ID NO: 65 on chromosome 18 and an oligonucleotide complementary to such oligonucleotide, and salt 18 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 72 specific to a target gene having a nucleotide sequence of SEQ ID NO: 69 on a chromosome and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotide Include. The probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 18. For example, the number of genes may be trisomy.
또한, 본 발명의 일실시예의 표적 유전자용 프로브 조성물은, 13번 염색체 상의 서열번호 41의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 45의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 49의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 53의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함한다. 상기 프로브는 상기 13번 염색체 상의 표적 유전자의 증폭 산물에 특이적으로 결합하여 유전자 수 이상 여부를 검출하는데 사용된다. 예를 들어, 상기 유전자 수 이상은 3염색체성일 수 있다. In addition, the probe composition for a target gene of an embodiment of the present invention is a group consisting of an oligonucleotide of SEQ ID NO: 44 specific to a target gene having a nucleotide sequence of SEQ ID NO: 41 on chromosome 13 and an oligonucleotide complementary to such oligonucleotide At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 48 specific to a target gene having a nucleotide sequence of SEQ ID NO: 45 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 52 specific to a target gene having a nucleotide sequence of SEQ ID NO: 49 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide; At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 56 specific for a target gene having the nucleotide sequence of SEQ ID NO: 53 on a chromosome and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotide Include. The probe is used to specifically detect the number of genes by specifically binding to an amplification product of a target gene on chromosome 13. For example, the number of genes may be trisomy.
한편, 본 발명에 있어서 전술한 바와 같은 프로브의 한쪽 말단, 예를 들어 5'말단은 Cy5, Cy3, x-로다민, 텍사스 레드, SYBR 그린 (SYBR green), FAM, VIC, JOE, NED, HEX 및 TET 등과 같은 형광물질로 표지될 수 있고, 프로브의 다른쪽 말단, 예를 들어 3'말단은 IABkFQ, DABCYL, TAMRA, ECLIPSE, BHQ (BHQ-1, BHQ-2, BHQ-3 등) 등과 같은 소광물질로 표지될 수 있다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 사용될 수 있음은 물론이다. Meanwhile, in the present invention, one end of the probe as described above, for example, the 5 'end is Cy5, Cy3, x-rhodamine, Texas red, SYBR green, SYBR green, FAM, VIC, JOE, NED, HEX And a fluorescent material such as TET, and the other end of the probe, for example, the 3 'end may be IABkFQ, DABCYL, TAMRA, ECLIPSE, BHQ (BHQ-1, BHQ-2, BHQ-3, etc.), and the like. It may be labeled with a matte material. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be used.
본 발명은 디지털 PCR을 이용하여 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 유전자로부터 특징적인 유전정보를 수집하여 분석함으로써 이를 진단에 응용할 수 있다. The present invention can be applied to diagnosis by collecting and analyzing characteristic genetic information from a fetal-derived gene present in a small amount in the blood or plasma of pregnant women using digital PCR.
또한, 본 발명은 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 유전자로부터 태아의 유전 정보에 대한 기초 결과를 얻고, 임부의 혈액 내지 혈장 내에 태아 유래 유전자가 존재하는 샘플을 대상으로 디지털 PCR을 수행하여 태아의 유전자 정보를 분석함으로써 태아의 유전 질병 중 유전자의 수에 대한 이상에 따라 발생하는 유전 질병을 조기에 진단하는데 이용할 수 있다.In addition, the present invention obtains the basic result of the genetic information of the fetus from the fetal-derived gene present in a small amount in the pregnant woman's blood or plasma, and performs digital PCR on a sample in which the fetal-derived gene is present in the pregnant woman's blood or plasma. By analyzing the genetic information of the fetus can be used for early diagnosis of genetic diseases caused by abnormalities in the number of genes among the genetic diseases of the fetus.
추가로, 본 발명은 임부의 혈액 내지 혈장으로부터 태아의 유전자의 수에 대한 이상에 관한 유전자 분석을 수행하는데 있어서, 디지털 PCR을 수행시 다량으로 존재하는 모체 유래 유전자의 배경 신호에 의해 임부의 혈액 내지 혈장 내에 소량으로 존재하는 태아 유래 표적 유전자와 관련한 유전자의 수에 대한 이상이 검출되지 않거나 불명확한 신호로서 검출되는 문제점을 해결할 수 있다. 즉, 본 발명은 임부의 혈액으로부터 얻은 시료에 미량으로 존재하는 태아 유래 유전자를 이용하되 태아의 특정 표적 유전자에 대한 유전자형 분석 과정이 간편하면서도 아주 낮은 농도에서도 신뢰도가 높게 검사를 진행할 수 있는 장점이 있다. In addition, the present invention is to perform a genetic analysis of the abnormality of the number of genes of the fetus from the blood of the pregnant woman from the plasma, the blood from the pregnant woman by the background signal of the mother-derived gene present in a large amount when performing the digital PCR It is possible to solve the problem that abnormalities in the number of genes related to fetal origin target genes present in small amounts in plasma are not detected or are detected as an unclear signal. That is, the present invention uses fetal-derived genes present in trace amounts in the sample obtained from the blood of the pregnant woman, but the genotyping process for specific target genes of the fetus is easy, but the test can be performed with high reliability even at very low concentrations. .
따라서, 본 발명은 태아 유래 세포 유리 유전자를 이용한 유전자형 분석 기술과 디지털 PCR 기술의 접목을 어렵게 하는 장벽을 해소할 수 있고, 아울러 태아 유래 유전자로부터 유래한 신호만의 분리의 어려운 문제와 모체 유래 유전자 배경 신호에 의한 문제를 해결하면서도 디지털 PCR 기술에서 요구되는 프아송 분포를 만족시켜 정량 결과를 신뢰할 수 있는 기술을 제공할 수 있다.Accordingly, the present invention can solve the barriers that make it difficult to integrate genotyping techniques and digital PCR techniques using fetal-derived cell-free genes, and it is also difficult to separate only signals derived from fetal-derived genes and the mother-derived gene background. It is possible to provide a technology that can reliably quantify the results by satisfying the Poisson distribution required in the digital PCR technology while solving the signal problem.
도 1은 APP 유전자에 대한 리얼타임 PCR 정량 결과를 각 샘플 별로 정리하고, 그 결과를 짧은 앰플리콘(길이 67bp)에 대한 결과와 긴 앰플리콘(길이 180bp)에 대한 결과로 나누어 도시한 그래프이다.FIG. 1 is a graph showing the results of real-time PCR quantification for APP genes for each sample, and dividing the results into results for short amplicons (length 67bp) and for long amplicons (length 180bp).
도 2는 TaqMan® 카피수 어세이(Copy Number Assays)의 결과를 분석 소프트웨어인 CopyCaller® 소프트웨어를 사용하여 분석한 결과를 도시한 그래프이다.FIG. 2 is a graph showing the results of TaqMan ® Copy Number Assays analysis using CopyCaller ® software, an analysis software.
도 3은 태아 유래 유전자에 대한 유전자 분석을 수행하기 위해 선정된 21번 염색체 상의 표적 유전자와 콘트롤 유전자의 위치를 개략적으로 도시한 그림이다.Figure 3 is a schematic diagram showing the location of the target gene and the control gene on chromosome 21 selected to perform genetic analysis on the gene derived from the fetus.
도 4는 태아 유래 유전자에 대한 유전자 분석을 수행하기 위해 선정된 13번 염색체 상의 표적 유전자와 18번 염색체 상의 표적 유전자의 위치를 개략적으로 도시한 그림이다.4 is a diagram schematically showing the positions of the target gene on chromosome 13 and the target gene on chromosome 18 selected for performing genetic analysis on fetal-derived genes.
도 5는 실시예 3-1에서 설계된 각 프라이머 쌍을 이용하여 대응하는 표적 유전자 및 콘트롤 유전자에 대해 PCR 증폭산물을 수행한 후 전기영동을 한 결과를 나타내는 사진이다.5 is a photograph showing the results of electrophoresis after performing PCR amplification products on the corresponding target gene and control gene using each primer pair designed in Example 3-1.
도 6 내지 도 24는 실시예 3-1에서 설계된 각 프라이머 쌍 및 검출 프로브를 이용하여 대응하는 표적 유전자 및 콘트롤 유전자에 대해 리얼 타임 PCR을 수행한 결과 그래프이다.6 to 24 show graphs of real-time PCR of corresponding target genes and control genes using each primer pair and detection probe designed in Example 3-1.
도 25는 실시예 4-1에서 수행되는 디지털 PCR 레이아웃이다.25 is a digital PCR layout performed in Example 4-1.
도 26은 실시예 4-1에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타낸 도면이다.FIG. 26 is a diagram showing a result of performing digital PCR in Example 4-1 by a digital PCR heat map. FIG.
도 27은 도 26의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 각 표적 유전자의 카피수 및 각 콘트롤 유전자의 카피수를 정량적으로 도시한 그래프이다. FIG. 27 is a graph quantitatively illustrating the number of copies of each target gene and the number of copies of each control gene by analyzing fluorescence values measured in each well of FIG. 26.
도 28은 실시예 4-2에서 수행되는 디지털 PCR 레이아웃이다.28 is a digital PCR layout performed in Example 4-2.
도 29는 실시예 4-2에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타낸 도면이다.29 is a diagram showing the results of performing digital PCR in Example 4-2 with a digital PCR heat map.
도 30은 도 29의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 각 표적 유전자의 카피수 및 각 콘트롤 유전자의 카피수를 정량적으로 도시한 그래프이다.FIG. 30 is a graph quantitatively illustrating the copy number of each target gene and the copy number of each control gene by analyzing the fluorescence values measured in each well of FIG. 29.
도 31은 실시예 4-3에서 수행되는 디지털 PCR 레이아웃이다.31 is a digital PCR layout performed in Example 4-3.
도 32는 실시예 4-3에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타낸 도면이다.32 is a diagram showing the results of performing digital PCR in Example 4-3 with a digital PCR heat map.
도 33은 도 32의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 각 표적 유전자의 카피수 및 각 콘트롤 유전자의 카피수를 정량적으로 도시한 그래프이다. FIG. 33 is a graph quantitatively illustrating the number of copies of each target gene and the number of copies of each control gene by analyzing the fluorescence values measured in each well of FIG. 32.
도 34는 실시예 4-4에서 수행되는 디지털 PCR 레이아웃이다.34 is a digital PCR layout performed in Examples 4-4.
도 35는 실시예 4-4에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타낸 도면이다.35 is a diagram showing a result of performing digital PCR in Example 4-4 with a digital PCR heat map.
도 36은 도 35의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 각 표적 유전자의 카피수 및 각 콘트롤 유전자의 카피수를 정량적으로 도시한 그래프이다.FIG. 36 is a graph quantitatively illustrating the number of copies of each target gene and the number of copies of each control gene by analyzing fluorescence values measured in each well of FIG. 35.
이하, 본 발명의 실시예에 기초하여 보다 상세하게 기술한다. 본 발명의 하기 실시예는 본 발명을 구체화하기 위한 것일 뿐 본 발명의 권리범위를 제한하거나 한정하는 것이 아님은 물론이다. 본 발명의 상세한 설명 및 실시예로부터 본 발명이 속하는 기술분야의 전문가가 용이하게 유추할 수 있는 것은 본 발명의 권리범위에 속하는 것으로 해석된다. 본 발명에 인용된 참고문헌은 본 발명에 참고로서 통합된다. Hereinafter, it demonstrates in detail based on the Example of this invention. The following examples of the present invention are not intended to limit or limit the scope of the present invention only to embody the present invention. From the detailed description and examples of the present invention, those skilled in the art to which the present invention pertains can easily be interpreted as belonging to the scope of the present invention. References cited in the present invention are incorporated herein by reference.
실시예Example
실시예 1: 임부의 혈액 샘플 내의 특정 유전자에 대한 모체 유래 유전자 양과 태아 유래 유전자 양의 비율 측정Example 1 Determination of the Ratio of Maternal Derived Gene and Fetal Derived Gene Amount to a Specific Gene in Pregnant Blood Samples
실시예 1-1: 프라이머 및 프로브의 설계Example 1-1 Design of Primers and Probes
임부의 혈액 내지 혈장 내의 태아 유래 DNA는 모체 유래 DNA 보다 크기가 작은 것이 알려져 있다. 따라서, 특정 유전자와 관련하여 크기가 작은 태아 유래 DNA와 이 보다 크기가 큰 모체 유래 DNA를 리얼타임 PCR로 증폭하면 특정 유전자와 관련하여 임부의 혈액 내지 혈장 내에 존재하는 태아 유래 DNA와 모체 유래 DNA를 정량할 수 있고, 이로부터 이들의 유전자 양의 비율을 구할 수 있다. It is known that fetal derived DNA in maternal blood or plasma is smaller than maternally derived DNA. Therefore, real-time PCR amplification of small fetal-derived DNA and larger maternal-derived DNA with respect to a specific gene results in fetal-derived DNA and maternal-derived DNA present in maternal blood or plasma with respect to a specific gene. The amount of these genes can be determined from this.
따라서, 본 실시예에서는 임부의 혈액 내지 혈장 샘플 내의 태아 유래 DNA와 모체 유래 DNA에 공통적으로 존재하는 특정 유전자로서 APP(Amyloid Precursor protein) 유전자 (GenBank accession No. NM_000484), β-액틴 유전자 및 SRY 유전자를 선정하였고, 상기 특정 유전자와 관련한 태아 유래 DNA와 모체 유래 DNA를 증폭할 수 있는 프라이머 쌍과, 증폭반응 결과물을 확인할 수 있는 형광표지가 된 프로브를 설계하였다(하기 표 1 참조). 이들 프라이머 및 프로브는 (주)바이오니아(대한민국 대전광역시 소재)에 의뢰하여 합성하였다.Therefore, in this embodiment, the specific genes commonly present in fetal-derived DNA and maternal-derived DNA in maternal blood or plasma samples are APP (Amyloid Precursor protein) gene (GenBank accession No. NM_000484), β-actin gene, and SRY gene. And a pair of primers capable of amplifying the fetal-derived DNA and maternal-derived DNA related to the specific gene, and a fluorescently labeled probe capable of confirming the result of the amplification reaction were designed (see Table 1 below). These primers and probes were synthesized by BIO Corporation (Daejeon Metropolitan City, Korea).
표 1 특정 유전자에 대한 리얼타임 PCR 증폭용 프라이머 쌍 및 프로브
앰플리콘 길이 형광 프로브 정방향 프라이머 역방향 프라이머 표적유전자
(5'-FAM, 3'-TAMRA) (5'→3') (5'→3')
67 bp ACCCCAGAGGAGCGCCACCTG(서열번호 1) TCAGGTTGACGCCGCTGT(서열번호 2) TTCGTAGCCGTTCTGCTGC (서열번호 3) APP
180 bp TCTATAAATGGACACCGATGGGTAGT (서열번호 4)
83 bp CCCACTTCTCTCTAAGGAGAATGGCCC (서열번호 5) TACAGGAAGTCCCTTGCCAT(서열번호 6) CCTGTGTGGACTTGGGAGAG(서열번호 7) β-액틴
170 bp CACGAAGGCTCATCATTCAA(서열번호 8)
67 bp TTCCGCTGCCCTGAGGCACT(서열번호 9) AGAGCTACGAGCTGCCTGAC(서열번호 10) CCATCTCTTGCTCGAAGTCC(서열번호 11)
169 bp GGCAGGACTTAGCTTCCACA(서열번호 12)
79 bp CGCCTTCCGACGAGGTCGAT(서열번호 13) TACAGGCCATGCACAGAGAG(서열번호 14) CAATTCTTCGGCAGCATCTT(서열번호 15) SRY
185 bp GGTAAGTGGCCTAGCTGGTG(서열번호 16)
90 bp TCTTGCGCCTCTGATCGCGA(서열번호 17) AACGCATTCATCGTGTGGT(서열번호 18) CAGCTGCTTGCTGATCTCTG(서열번호 19)
189 bp TTCCGACGAGGTCGATACTT(서열번호 20)
Table 1 Primer Pairs and Probes for Real-Time PCR Amplification for Specific Genes
Amplicon length Fluorescent probes Forward primer Reverse primer Target gene
(5'-FAM, 3'-TAMRA) (5 '→ 3') (5 '→ 3')
67 bp ACCCCAGAGGAGCGCCACCTG (SEQ ID NO: 1) TCAGGTTGACGCCGCTGT (SEQ ID NO: 2) TTCGTAGCCGTTCTGCTGC (SEQ ID NO: 3) APP
180 bp TCTATAAATGGACACCGATGGGTAGT (SEQ ID NO: 4)
83 bp CCCACTTCTCTCTAAGGAGAATGGCCC (SEQ ID NO: 5) TACAGGAAGTCCCTTGCCAT (SEQ ID NO: 6) CCTGTGTGGACTTGGGAGAG (SEQ ID NO: 7) β-actin
170 bp CACGAAGGCTCATCATTCAA (SEQ ID NO: 8)
67 bp TTCCGCTGCCCTGAGGCACT (SEQ ID NO: 9) AGAGCTACGAGCTGCCTGAC (SEQ ID NO: 10) CCATCTCTTGCTCGAAGTCC (SEQ ID NO: 11)
169 bp GGCAGGACTTAGCTTCCACA (SEQ ID NO: 12)
79 bp CGCCTTCCGACGAGGTCGAT (SEQ ID NO: 13) TACAGGCCATGCACAGAGAG (SEQ ID NO: 14) CAATTCTTCGGCAGCATCTT (SEQ ID NO: 15) SRY
185 bp GGTAAGTGGCCTAGCTGGTG (SEQ ID NO: 16)
90 bp TCTTGCGCCTCTGATCGCGA (SEQ ID NO: 17) AACGCATTCATCGTGTGGT (SEQ ID NO: 18) CAGCTGCTTGCTGATCTCTG (SEQ ID NO: 19)
189 bp TTCCGACGAGGTCGATACTT (SEQ ID NO: 20)
참고로, 상기 표 1에서는 리얼타임 PCR을 이용한 태아 유래 DNA와 모체 유래 DNA의 정량 비교를 통한 이들 유전자 양의 비율을 평가하기 위하여, 태아 유래 DNA의 크기가 모체 유래 DNA의 크기 보다 작은 점을 고려하여 프라이머 쌍을 설계하였다. 특히, 상기 표 1에 도시된 바와 같이, 모체 유래 유전자 양과 태아 유래 유전자 양을 정확히 평가하고 정량 평가시 분석 조건을 통일시키기 위하여, 태아 유래 DNA 및 모체 유래 DNA로부터의 짧은 앰플리콘과 모체 유래 DNA로부터의 긴 앰플리콘의 세트에 대한 검출 프로브와 정방향 프라이머는 공통으로 하고 역방향 프라이머만 다르도록 설계하였다. 그리고, 각 검출 프로브는 리얼 타임 PCR 증폭 반응결과물을 확인하고 이를 정량적으로 분석하기 위해 형광물질 및 소광물질로 이중 표지된다. 본 실시예에서는 각 검출 프로브의 5'말단에 형광물질인 FAM으로 표지하였고, 3'말단에는 소광물질인 TAMRA를 표지하였다.For reference, in Table 1, in order to evaluate the ratio of the amount of these genes by quantitative comparison of fetal-derived DNA and maternal-derived DNA using real-time PCR, considering that the size of the fetal-derived DNA is smaller than the size of the maternal-derived DNA Primer pairs were designed. In particular, as shown in Table 1 above, in order to accurately assess the amount of maternal and fetal-derived genes and to unify the analysis conditions in the quantitative evaluation, from short amplicons and maternal-derived DNAs from fetal and maternal-derived DNAs, The detection probes and the forward primers for the set of long amplicons were designed to be common and only the reverse primers were different. Each detection probe is double-labeled with fluorescent and quencher to identify and quantitatively analyze real-time PCR amplification reaction products. In this embodiment, the 5 'end of each detection probe was labeled with a fluorescent substance FAM, and the 3' end was labeled with a quencher TAMRA.
상기 표 1에 도시된 바와 같이 APP 표적 유전자의 경우, 서열번호 2 및 3의 프라이머 쌍으로부터는 태아 유래 DNA 및 모체 유래 DNA로부터의 짧은 앰플리콘(길이 67bp)이 수득되고, 서열번호 2 및 4의 프라이머 쌍으로부터는 모체 유래 DNA로부터의 긴 앰플리콘(길이 180bp)이 수득된다. As shown in Table 1, in the case of the APP target gene, short amplicons (length 67bp) from fetal-derived DNA and maternal-derived DNA were obtained from the primer pairs of SEQ ID NOs: 2 and 3, and From the primer pairs, long amplicons (180 bp in length) from maternally derived DNA are obtained.
β-액틴 유전자의 경우, 서열번호 6 및 7의 프라이머 쌍으로부터는 태아 유래 DNA 및 모체 유래 DNA로부터의 짧은 앰플리콘(길이 83bp)이 수득되고, 서열번호 6 및 8의 프라이머 쌍으로부터는 모체 유래 DNA로부터의 긴 앰플리콘(길이 170bp)이 수득된다. 또한, 서열번호 10 및 11의 프라이머 쌍으로부터는 태아 유래 DNA 및 모체 유래 DNA로부터의 짧은 앰플리콘(길이 67bp)이 수득되고, 서열번호 10 및 12의 프라이머 쌍으로부터는 모체 유래 DNA로부터의 긴 앰플리콘(길이 169bp)이 수득된다.In the case of the β-actin gene, short amplicons (83 bp in length) from fetal-derived DNA and maternal-derived DNA are obtained from the primer pairs of SEQ ID NOs: 6 and 7, and maternal-derived DNA from the primer pairs of SEQ ID NOs: 6 and 8 Long amplicons (170 bp in length) are obtained. In addition, short amplicons (length 67bp) from fetal-derived DNA and maternal-derived DNA were obtained from the primer pairs of SEQ ID NOs: 10 and 11, and long amplicons from the mother-derived DNA from the primer pairs of SEQ ID NOs: 10 and 12. (Length 169 bp) is obtained.
SRY 유전자의 경우, 서열번호 14 및 15의 프라이머 쌍으로부터는 태아 유래 DNA 및 모체 유래 DNA로부터의 짧은 앰플리콘(길이 79bp)이 수득되고, 서열번호 14 및 16의 프라이머 쌍으로부터는 모체 유래 DNA로부터의 긴 앰플리콘(길이 185bp)이 수득된다. 또한, 서열번호 18 및 19의 프라이머 쌍으로부터는 태아 유래 DNA 및 모체 유래 DNA로부터의 짧은 앰플리콘(길이 90bp)이 수득되고, 서열번호 18 및 20의 프라이머 쌍으로부터는 모체 유래 DNA로부터의 긴 앰플리콘(길이 189bp)이 수득된다.For the SRY gene, short amplicons (79 bp in length) from fetal-derived DNA and maternally-derived DNA are obtained from the primer pairs of SEQ ID NOs: 14 and 15, and from parental DNA from the primer pairs of SEQ ID NOs: 14 and 16. A long amplicon (length 185 bp) is obtained. In addition, short amplicons (length 90bp) from fetal-derived DNA and maternal-derived DNA are obtained from the primer pairs of SEQ ID NOs: 18 and 19, and long amplicons from the mother-derived DNA from the primer pairs of SEQ ID NOs: 18 and 20. (Length 189 bp) is obtained.
실시예 1-2: 임부 혈액 샘플을 이용한 리얼타임 PCR의 수행Example 1-2 Performing Real-Time PCR with Pregnant Blood Samples
국내 종합 병원 산부인과로부터 블라인드 테스트 용으로 임부의 혈액 내지 혈장, 또는 임부의 혈액으로부터 추출된 게놈 DNA(gDNA)를 제공받았다. 각 샘플 별로 하기 표 4와 같은 임의의 샘플 번호를 부여하고, 이후 각 샘플에 대응하는 추출 gDNA 샘플에 대해서도 동일한 샘플 번호를 사용한다. 임부의 혈액 샘플로부터는 혈장을 분리하여 사용하였다. 혈장 샘플(사용량: 1 ml)에 대해서는 독일 퀴아젠사 (QIAGEN)의 QIAamp Circulating Nucleic Acid Kit (Qiagen Cat #55114)를 사용하여 gDNA를 추출하였다. gDNA 추출 과정은 QIAamp Circulating Nucleic Acid Kit 제조사의 매뉴얼에 따라 수행하였다. 이를 구체적으로 설명하면 다음과 같다.Gynecological DNA (gDNA) extracted from maternal blood or plasma, or maternal blood, was provided for blind testing by a gynecological department in Korea. Each sample is given an arbitrary sample number as shown in Table 4 below, and then the same sample number is also used for the extracted gDNA sample corresponding to each sample. Plasma was isolated from the maternal blood sample. For plasma samples (dose: 1 ml), gDNA was extracted using QIAamp Circulating Nucleic Acid Kit (Qiagen Cat # 55114) from QIAGEN, Germany. gDNA extraction was performed according to the QIAamp Circulating Nucleic Acid Kit manufacturer's manual. This will be described in detail as follows.
우선, 임부 혈장 샘플 내에 존재하는 단백질 성분을 제거하여 시료의 순도를 높이기 위하여, 50 ml 원심분리 뷰트에 100 μL의 프로테이나아제 K(proteinase K)를 첨가하였다. 그리고, 프로테이나아제 K가 첨가된 50 ml 원심분리 튜브에, 임부의 혈장 1 ml를 첨가하고 1.0 μg 캐리어 RNA(carrier RNA)가 포함된 ACL 버퍼를 첨가한 후, 볼텍싱(vortexing)을 실시하여 혈장 샘플과 ACL 버퍼를 혼합하였다. 혼합된 혈장 샘플과 ACL 버퍼와의 혼합액을 60℃에서 30분 동안 반응시킨 후, 3.6 ml의 ACB 버퍼(lysate buffer)를 상기 원심분리 튜브에 첨가하고 볼텍싱(vortexing)을 실시하여 ACB 버퍼 혼합물을 수득하고 나서 얼음에 5분간 반응시켰다.First, 100 μL of proteinase K was added to a 50 ml centrifuge butt to remove protein components present in the pregnant plasma sample to increase the purity of the sample. In a 50 ml centrifuge tube to which proteinase K was added, 1 ml of maternal plasma was added and an ACL buffer containing 1.0 μg carrier RNA was added, followed by vortexing. The plasma sample was mixed with the ACL buffer. After reacting the mixed plasma sample with the ACL buffer for 30 minutes at 60 ° C., 3.6 ml of ACB lysate buffer was added to the centrifuge tube and vortexed to prepare the ACB buffer mixture. After obtaining, the resultant was reacted with ice for 5 minutes.
QIAamp Circulating Nucleic Acid Kit의 컬럼 상에 존재하는 멤브레인의 흡착성을 좋게 함으로써 추출되는 gDNA의 수율을 높이기 위하여 진공 펌프 시스템(vacuum pump system)을 사용하였다. 진공 펌프 시스템을 이용하여 QIAamp 미니 컬럼(QIAamp Mini column)과 20 ml 튜브 익스텐더(tube extender)를 장착하여 ACB 버퍼 혼합물을 QIAamp 미니 컬럼에 흘려보낼 수 있도록 하였다. 진공 펌프 시스템을 작동시키고 ACB 버퍼 혼합물을 흘려보낸 후, 진공 펌프 시스템의 수치가 0이 되도록 조정하고 튜브 익스텐더를 제거하였다. 이러한 과정을 통하여 QIAamp 미니 컬럼의 멤브레인에 최대한 많은 양의 반응 물질이 결합되도록 한다. A vacuum pump system was used to increase the yield of gDNA extracted by improving the adsorption of the membrane on the column of QIAamp Circulating Nucleic Acid Kit. Using a vacuum pump system, a QIAamp Mini column and a 20 ml tube extender were mounted to allow the ACB buffer mixture to flow into the QIAamp mini column. After operating the vacuum pump system and flushing the ACB buffer mixture, the vacuum pump system was adjusted to zero and the tube extender was removed. This process ensures that the maximum amount of reactant is bound to the membrane of the QIAamp mini column.
그리고 나서, QIAamp 미니 컬럼에 결합된 반응 물질을 첫번째로 세척할 완충 용액인 ACW1 버퍼 600 μL를 진공 펌프 시스템을 작동시켜 QIAamp 미니 컬럼으로 흘려보낸 후, 진공 펌프 시스템의 수치가 0이 되도록 조정하고 튜브 익스텐더를 제거하였다. 이러한 과정을 통하여 QIAamp 미니 컬럼 멤브레인에 결합하고 있는 DNA를 세척하게 된다. 또한, 순도 높은 DNA를 수득하기 위하여 2차의 세척 작업이 수행된다. 두번째 세척 용액인 ACW2 버퍼 750 μL를 진공 펌프 시스템을 작동시켜 QIAamp 미니 컬럼으로 흘려보낸 후, 진공 펌프 시스템의 수치가 0이 되도록 조정하고 튜브 익스텐더를 제거하였다. 이러한 과정을 통하여 QIAamp 미니 컬럼 멤브레인에 결합하고 있는 DNA를 추가로 세척하게 되고, 순도 높은 DNA를 수득할 수 있다.Then, 600 μL of ACW1 buffer, the first buffer solution to wash the reactants bound to the QIAamp mini column, was run by the vacuum pump system and flowed into the QIAamp mini column, then the vacuum pump system was adjusted to zero and the tube The extender was removed. This process washes the DNA binding to the QIAamp mini column membrane. In addition, a second wash operation is performed to obtain high purity DNA. A second wash solution, 750 μL of ACW2 buffer, was run on a vacuum pump system and flowed into the QIAamp mini column, then the vacuum pump system was adjusted to zero and the tube extender was removed. Through this process, the DNA binding to the QIAamp mini column membrane can be further washed, and high purity DNA can be obtained.
마지막 세척 용액인 에탄올 (96% 내지 100%) 750 μL를 진공 펌프 시스템을 작동시켜 QIAamp 미니 컬럼으로 흘려보낸 후, 진공 펌프 시스템의 수치가 0이 되도록 조정하고 튜브 익스텐더를 제거하였다. 그리고, 에탄올 성분을 최대한 말려 제거함으로써 추출된 DNA의 순도를 높인 후, QIAamp 미니 컬럼의 뚜껑을 닫고 20,000g 및 14,000 rpm 조건으로 3분 동안 원심분리를 하였다. QIAamp 미니 컬럼의 뚜껑을 열고 56℃에서 10분간 말려주었다. 그리고 나서, QIAamp 미니 컬럼에 대해 AVE 버퍼 20 μL를 첨가하고 상온에서 3분 동안 반응시킨 후, QIAamp 미니 컬럼의 뚜껑을 닫고 20,000g 및 14,000 rpm 조건으로 1분 동안 원심분리를 하였다. 이로써, 블라인드 테스트 용으로 제공받은 임부의 혈액 내지 혈장 샘플에 각각 대응하는 gDNA 샘플을 최종적으로 수득하였다.750 μL of the final wash solution, ethanol (96% to 100%) was run on a QIAamp mini column by running the vacuum pump system, then the vacuum pump system was adjusted to zero and the tube extender was removed. Then, the purity of the extracted DNA was increased by drying the ethanol component as much as possible, and the lid of the QIAamp mini column was closed and centrifuged for 3 minutes at 20,000 g and 14,000 rpm. The lid of the QIAamp mini column was opened and dried at 56 ° C. for 10 minutes. Then, 20 μL of the AVE buffer was added to the QIAamp mini column and reacted at room temperature for 3 minutes, and the lid of the QIAamp mini column was closed and centrifuged for 1 minute at 20,000 g and 14,000 rpm. This finally yielded gDNA samples corresponding to maternal blood to plasma samples provided for blind testing, respectively.
블라인드 테스트용으로 제공받은 gDNA 샘플 또는 위와 같은 과정을 통해 혈액 내지 혈장 샘플로부터 분리된 gDNA 샘플의 정량을 위해 리얼 타임 PCR을 수행하였다. 본 실시예에서 리얼 타임 PCR은 7900HT Fast Real Time PCR System (Life Technologies, 미국)을 이용하여 수행하였다. 상기 표 1에 도시된 각각의 앰플리콘 수득 및 검출을 위한 각 프라이머 쌍 및 검출 프로브와, 전술한 바와 같이 준비된 DNA 주형과, 리얼타임 PCR 마스터 믹스(real-time PCR master mixture) 등의 리얼 타임 PCR 조성을 아래의 표 2와 같이 한 후, 아래의 표 3의 리얼 타임 PCR 증폭 조건 하에서 리얼 타임 PCR을 수행하였다. 한편, PCR 증폭 조성 중 PCR 증폭용 마스터 믹스는 예를 들어, PCR 버퍼, dNTP, DNA 폴리머라아제 등으로 이루어진 것으로서, 본 실시예에서는 리얼타임 PCR 마스터 믹스로 TaqMan® Universal Master Mix Ⅱ, no UNG (Life Technologies, Cat. 4440040)를 사용하였다.Real-time PCR was performed for quantification of gDNA samples provided for blind testing or gDNA samples isolated from blood or plasma samples through the above procedure. In this example, real time PCR was performed using a 7900HT Fast Real Time PCR System (Life Technologies, USA). Real-time PCR such as each primer pair and detection probe for obtaining and detecting each amplicon shown in Table 1, a DNA template prepared as described above, and a real-time PCR master mixture After the composition as shown in Table 2 below, real-time PCR was performed under the real-time PCR amplification conditions of Table 3 below. Meanwhile, the PCR amplification master mix in the PCR amplification composition includes, for example, a PCR buffer, dNTP, DNA polymerase, and the like. In this embodiment, a real-time PCR master mix is used as TaqMan ® Universal Master Mix II, no UNG ( Life Technologies, Cat. 4440040).
표 2 리얼타임 PCR 증폭 조성
No. PCR 증폭 조성 부피 (㎕)
1 DNA 주형을 갖는 샘플 1
2 프라이머(5 pM) 정방향 프라이머 0.5
역방향 프라이머 0.5
3 검출 프로브 1
4 증류수 7
5 TaqMan® Universal Master Mix II, no UNG 10
합계 20
TABLE 2 Real-Time PCR Amplification Composition
No. PCR amplification composition Volume (μl)
One Sample with DNA Template One
2 Primer (5 pM) Forward primer 0.5
Reverse primer 0.5
3 Detection probe One
4 Distilled water 7
5 TaqMan ® Universal Master Mix II, no UNG 10
Sum 20
표 3 리얼타임 PCR 증폭 조건
No. 단계 온도 시간 사이클
1 사전변성 95℃ 10분
2 변성 95℃ 15초 50 사이클
3 어닐링 60℃ 60초
4 연장 72℃ 60초
TABLE 3 Real-Time PCR Amplification Conditions
No. step Temperature time cycle
One Predegeneration 95 ℃ 10 minutes
2 denaturalization 95 ℃ 15 seconds 50 cycles
3 Annealing 60 ℃ 60 sec
4 extension 72 ℃ 60 sec
본 실시예에서는 블라인드 테스트용으로 준비된 각 DNA 주형에 대해 상기 표 2의 리얼타임 PCR 증폭 조성 하에서, 상기 표 3의 리얼 타임 PCR 조건으로 리얼타임 PCR을 반복하였다. 리얼타임 PCR 증폭반응이 한번씩 반복될 때마다 FAM 파장에서 형광값을 측정하였으며, 반응 사이클에 대한 형광세기는 SDS 소프트웨어(SDS software)를 이용하여 분석하였다. 이중 APP 유전자에 대한 리얼타임 PCR 정량 결과를 각 샘플 별로 정리하고, 그 결과를 짧은 앰플리콘(길이 67bp)에 대한 결과와 긴 앰플리콘(길이 180bp)에 대한 결과로 나누어 도 1에 도시하였다. R2값이 0.99이상이면 신뢰도가 높은 결과 값을 의미하므로, 도 1의 표준 곡선은 안정성이 높고 도출된 정량 결과는 신뢰도가 높은 것임을 알 수 있다.In this example, real-time PCR was repeated under the real-time PCR amplification composition of Table 2 for each DNA template prepared for the blind test under the real-time PCR amplification composition of Table 2. Whenever real-time PCR amplification was repeated once, the fluorescence value was measured at the FAM wavelength, and the fluorescence intensity of the reaction cycle was analyzed using SDS software. The real-time PCR quantitative results of the APP gene are summarized for each sample, and the results are shown in FIG. 1 by dividing the results for the short amplicon (length 67bp) and the long amplicon (length 180bp). If the R2 value is 0.99 or more, it means that the result is high reliability. Therefore, it can be seen that the standard curve of FIG. 1 is high in stability and the quantitative result is high in reliability.
이와 같이 각 샘플 별로 얻어진 짧은 앰플리콘(예를 들어, 길이 67bp)에 대한 리얼 타임 PCR의 정량 결과와, 긴 앰플리콘(예를 들어, 길이 180bp)에 대한 리얼 타임 PCR의 정량 결과를 다음의 수학식 1에 대입하여 비율을 구한다.Thus, the quantitative result of real-time PCR for the short amplicon (for example, length 67bp) obtained for each sample and the quantitative result of real-time PCR for the long amplicon (for example length 180bp) Substitute in Equation 1 to find the ratio.
수학식 1 Equation 1
비율 = 짧은 앰플리콘(길이 67bp) 양/긴 앰플리콘(길이 180bp) 양Ratio = amount of short amplicons (length 67 bp) / amount of long amplicons (length 180 bp)
그리고 나서, 상기 수학식 1에서 얻어진 비율값을 다음의 수학식 2에 대입하면 각 샘플 별로 임부 혈액 내지는 혈장 내에 존재하는 태아 유래 유전자의 함유량을 구할 수 있다. Then, by substituting the ratio value obtained in Equation 1 into Equation 2 below, the content of the fetus-derived gene present in pregnant blood or plasma can be obtained for each sample.
수학식 2 Equation 2
태아 유래 유전자 함유량(%) = (수학식 1에서 얻어진 비율값 -1.1188)/0.065Fetal-derived gene content (%) = (ratio obtained from Equation 1 -1.1188) /0.065
예를 들어, 임부의 혈액 내지 혈장 내 세포 유리 태아 유래 유전자 세트에 포함되는 것으로 판단되는 APP 유전자에 대한 67 bp 앰플리콘의 양과, 67 bp 앰플리콘에 대해 비교 대상이 되는 180 bp 앰플리콘의 양의 비교를 통해 세포 유리 태아 유래 유전자의 비율을 결정할 수 있고, 수학식 2를 이용하여 임부 혈액 내지 혈장 내에 존재하는 태아 유래 유전자의 함유량을 유추할 수 있다. For example, the amount of 67 bp amplicon for the APP gene that is determined to be included in the maternal blood to plasma free fetal-derived gene set, and the amount of the 180 bp amplicon to be compared for the 67 bp amplicon. By comparison, the ratio of the cell free fetus-derived gene may be determined, and Equation 2 may be used to infer the content of the fetal-derived gene present in pregnant blood or plasma.
하기 표 4에는 짧은 앰플리콘(길이 67bp)에 대한 리얼 타임 PCR의 정량 결과, 긴 앰플리콘(길이 180bp)에 대한 리얼 타임 PCR의 정량 결과, 이들의 비율 그리고 임부 혈액 내지 혈장 내에 존재하는 태아 유래 유전자의 함유량을 계산한 결과를 각 샘플 별로 정리하여 도시하고 있다. Table 4 shows the results of quantification of real-time PCR for short amplicons (length 67bp), quantification of real-time PCR for long amplicons (length 180bp), their ratios, and fetal-derived genes present in pregnant blood or plasma. The result of calculating the content of is summarized and shown for each sample.
표 4
샘플번호 67 bp 양 180 bp 양 비율 태아 DNA % 샘플No. 67 bp 양 180 bp 양 비율 태아 DNA %
24 19.08056 9.790299 1.948925 12.77115 38 17.02248 16.8546 1.00996 0
36 26.99327 12.52466 2.15521 15.94477 39 14.4778 12.4566 1.16226 0.66861
3 11.12497 9.32045 1.193608 1.150892 40 12.23988 10.11207 1.210423 1.409581
4 8.520723 7.1852 1.185871 1.031862 41 9.523374 10.97833 0.86747 0
5 14.76195 11.57453 1.275382 2.408954 46 7.422427 7.21746 1.028399 0
6 12.48913 11.34698 1.100657 0 47 10.41614 8.4564 1.231746 1.737632
34 18.78969 16.4453 1.142557 0.365492 48 9.18421 11.6727 0.786811 0
12 16.21022 11.456 1.414998 4.556892 50 4.708003 3.641657 1.292819 2.677215
14 15.87964 8.4676 1.875341 11.63909 F1 5823.917 5057.577 1.151523 0.503433
19 15.88142 11.4556 1.386345 4.116077 F22 6962.107 4632.537 1.502871 5.90879
22 19.49134 16.80018 1.160186 0.636708 G1 45837.89 39213.56 1.16893 0.771224
33 46.00689 41.4642 1.109557 0
Table 4
Sample number 67 bp amount 180 bp volume ratio Fetal DNA% Sample No. 67 bp amount 180 bp volume ratio Fetal DNA%
24 19.08056 9.790299 1.948925 12.77115 38 17.02248 16.8546 1.00996 0
36 26.99327 12.52466 2.15521 15.94477 39 14.4778 12.4566 1.16226 0.66861
3 11.12497 9.32045 1.193608 1.150892 40 12.23988 10.11207 1.210423 1.409581
4 8.520723 7.1852 1.185871 1.031862 41 9.523374 10.97833 0.86747 0
5 14.76195 11.57453 1.275382 2.408954 46 7.422427 7.21746 1.028399 0
6 12.48913 11.34698 1.100657 0 47 10.41614 8.4564 1.231746 1.737632
34 18.78969 16.4453 1.142557 0.365492 48 9.18421 11.6727 0.786811 0
12 16.21022 11.456 1.414998 4.556892 50 4.708003 3.641657 1.292819 2.677215
14 15.87964 8.4676 1.875341 11.63909 F1 5823.917 5057.577 1.151523 0.503433
19 15.88142 11.4556 1.386345 4.116077 F22 6962.107 4632.537 1.502871 5.90879
22 19.49134 16.80018 1.160186 0.636708 G1 45837.89 39213.56 1.16893 0.771224
33 46.00689 41.4642 1.109557 0
상기 표 4에 도시된 바와 같이, 계산한 결과 태아 유래 유전자가 일정량 함유되는 것으로 산출된 블라인드 테스트용 샘플(예를 들어, F1 샘플, F22 샘플, G1 샘플)은 태아 유래 유전자가 존재하는 것이므로 추후 태아 유전자 수 이상과 관련한 디지털 PCR 분석에 사용될 수 있다.As shown in Table 4, the blind test sample (for example, F1 sample, F22 sample, G1 sample), which is calculated to contain a predetermined amount of the gene derived from the fetus, is a fetus-derived gene. It can be used for digital PCR analysis involving gene number abnormalities.
실시예 2: 카피수 어세이(Copy Number Assays) 및 카피수 변이(CNV) 테스트의 수행Example 2: Performing Copy Number Assays and Copy Number Variance (CNV) Tests
실시예 1에서의 리얼 타임 PCR 정량 결과로부터 계산된 태아 유래 DNA의 함유량이 신뢰할 수 있는 것인지 재차 확인하기 위해 카피수 어세이 및 카피수 변이 테스트를 수행할 수 있다. 당업계에서 공지된 TaqMan® 카피수 어세이(Copy Number Assays) 및 카피수 변이 테스트는 다음과 같이 수행된다.Copy number assays and copy number variation tests can be performed to confirm again that the content of fetal derived DNA calculated from the real-time PCR quantitative results in Example 1 is reliable. TaqMan ® Copy Number Assays and copy number variation tests known in the art are performed as follows.
(1) DNA 추출(1) DNA extraction
TaqMan® 카피수 어세이(Copy Number Assays)를 위한 주형으로는 게놈 DNA (gDNA)를 사용한다.Genomic DNA (gDNA) is used as a template for TaqMan ® Copy Number Assays.
(2) DNA 양 확인(2) Confirmation of DNA amount
정량 PCR을 이용하여 게놈 DNA 또는 플라스미드 DNA 주형의 표준 곡선(Standard Curves)을 만들어 이용한다. UV 흡광도(A260/A280)를 이용하여 DNA 양을 측정하는데, 인간의 gDNA의 경우 A260/A280의 흡광도 비율이 1.7 이상이면 사용이 가능하다.Quantitative PCR is used to create and use standard curves of genomic DNA or plasmid DNA templates. The amount of DNA is measured using UV absorbance (A260 / A280), and in the case of human gDNA, the absorbance ratio of A260 / A280 is 1.7 or more.
(3) DNA 희석과 플레이트 준비(3) DNA Dilution and Plate Preparation
플레이트의 각 웰에 동일한 양의 gDNA가 첨가될 수 있도록 DNA를 희석한다.Dilute DNA so that equal amounts of gDNA can be added to each well of the plate.
(4) 샘플 종류 및 수(4) sample type and number
타겟이 되는 주형의 카피수를 알 수 없는 gDNA 샘플과, 주형이 없는 콘트롤샘플로서 배경 형광값을 나타내고 실험의 오염여부를 확인하는데 사용되는 콘트롤 샘플(No Template Controls)(NTC)과, 타겟이 되는 주형의 카피수를 아는 캘리브레이터 샘플(Calibrator sample)을 사용한다.GDNA sample with unknown copy number of target template, control template without template (No Template Controls) (NTC) used to indicate background fluorescence and contamination of experiments, Use a Calibrator sample that knows the copy number of the template.
(5) 액상의 gDNA를 위한 반응 준비(5) Preparation of reaction for liquid gDNA
반응량과 실험 개수에 근거하여 어세이 대상이 되는 gDNA 양을 결정한다. 반응 용액을 옮길 때 소모되는 양까지 고려하여 전체적인 양을 결정한다(하기 표 5 참조).The amount of gDNA to be assayed is determined based on the reaction amount and the number of experiments. The total amount is determined by considering the amount consumed when transferring the reaction solution (see Table 5 below).
표 5
최종 반응 용액 부피 웰 당 요구되는 gDNA 양 5 ng/μL (5×) gDNA 원액의 웰 당 첨가 부피
384-웰 플레이트 10 μL 10 ng 2 μL
96-웰 플레이트 20 μL 20 ng 4 μL
Table 5
Final reaction solution volume The amount of gDNA required per well Addition volume per well of 5 ng / μL (5 ×) gDNA stock
384-well plate 10 μL 10 ng 2 μL
96-well plate 20 μL 20 ng 4 μL
TaqMan® 카피수 어세이(Copy Number Assays) 시약과 TaqMan® 카피수 참조 어세이(Copy Number Reference Assays) 시약을 섞어준다. 가볍게 흔들어 섞어 주고 원심분리를 실시하여 반응용액들을 모아 준다. TaqMan® 제노타입핑 마스터 믹스(Genotyping Master Mix)를 섞어주어 반응 용액 혼합물을 완성한다(하기 표 6 참조). TaqMan ® assay copy number (Copy Number Assays) and mix the reagents and TaqMan ® reference copy number assays (Copy Number Reference Assays) reagent. Shake lightly and centrifuge to collect the reaction solutions. Mix the TaqMan ® Genotyping Master Mix to complete the reaction solution mixture (see Table 6 below).
표 6
반응 용액 혼합물 웰 당 부피 (μL)
384-웰 플레이트 96-웰 플레이트
2×TaqMan® 제노타입핑 마스터 믹스 5.0 10.0
TaqMan® 카피수 어세이 시약 (20×) 0.5 1.0
TaqMan® 카피수 참조 어세이 시약 (20×) 0.5 1.0
뉴클레아제 없는 물 2.0 4.0
전체 부피 8.0 16.0
Table 6
Reaction solution mixture Volume per well (μL)
384-well plate 96-well plate
2 × TaqMan ® Geno type ping master mix 5.0 10.0
TaqMan ® Copy Number Assay Reagent (20 ×) 0.5 1.0
TaqMan ® Copy Number Reference Assay Reagent (20 ×) 0.5 1.0
Water without nuclease 2.0 4.0
Total volume 8.0 16.0
마이크로 원심분리 튜브에 반응 용액을 넣고 전체 반응 용액 혼합물이 잘 섞이도록 한 후, 이를 준비된 반응 웰 플레이트에 분주한다.The reaction solution is placed in a microcentrifuge tube to allow the entire reaction solution mixture to mix well and then dispensed into the prepared reaction well plates.
희석한 gDNA 샘플을 준비하고, 희석된 gDNA를 반응 혼합물이 분주된 웰 플레이트에 첨가한다. 다른 방법으로서 gDNA를 먼저 분주하고 반응 혼합물을 첨가할 수도 있다. gDNA와 반응 혼합물을 잘 섞어 주고, 반응 웰 플레이트를 실링하여 원심분리를 수행한다.Diluted gDNA samples are prepared and the diluted gDNA is added to the well plates dispensed with the reaction mixture. Alternatively, gDNA may be first dispensed and the reaction mixture may be added. The gDNA and the reaction mixture are mixed well and the reaction well plate is sealed to perform centrifugation.
상기 표 5에 도시된 바와 같이 384-웰 플레이트의 경우에는 웰 당 gDNA (5 ng/μL) 2 μL를 첨가하고, 96-well 웰 플레이트의 경우에는 웰 당 gDNA (5 ng/μL) 4 μL를 첨가하여 하기 표 7과 같은 조건 하에서 TaqMan® 제조사의 매뉴얼에 따라 반응을 수행하고 결과를 분석한다.As shown in Table 5 above, add 2 μL of gDNA (5 ng / μL) per well for 384-well plates and 4 μL of gDNA (5 ng / μL) per well for 96-well well plates. Add and perform the reaction according to the TaqMan ® manufacturer's manual under the conditions shown in Table 7 below and analyze the results.
표 7
단계 온도 시간
유지(Hold) 95℃ 10분
사이클(40 사이클) 95℃ 15초
60℃ 60초
TABLE 7
step Temperature time
Hold 95 ℃ 10 minutes
Cycles (40 cycles) 95 ℃ 15 seconds
60 ℃ 60 sec
(6) 카피수 변이(Copy Number Variation)(CNV) 테스트(6) Copy Number Variation (CNV) Test
전술한 바와 같은 순서에 따라 수행된 TaqMan® 카피수 어세이(Copy Number Assays)의 결과를 분석 소프트웨어, 예를 들어 CopyCaller® 소프트웨어를 사용하여 분석하였다(도 2). 그 분석 결과, 모든 샘플과 주형이 없는 콘트롤(NTC)에 대한 카피수 결과값이 도출되었고, 여성인 임부가 Y염색체 유전자를 가질 수 없는 점을 고려할 때, 도 2에 도시된 바와 같이 테스트한 샘플(표 4에 표시된 샘플) 중에서 Y 염색체 유전자에 대한 결과값이 검출된 샘플 내에는 태아 유래 DNA가 있는 것으로 결정할 수 있다. The results of TaqMan ® Copy Number Assays performed in the order described above were analyzed using analytical software, such as CopyCaller ® software (FIG. 2). The analysis resulted in copy number results for all samples and templateless controls (NTCs), and the sample tested as shown in Figure 2, given that pregnant women could not have the Y chromosome gene. It can be determined that fetal-derived DNA is present in the sample in which the result value for the Y chromosome gene in the sample shown in Table 4 is detected.
실시예 3: 디지털 PCR을 이용한 태아 유래 유전자 분석 준비Example 3: Prenatal Derivation of Gene Analysis Using Digital PCR
실시예 3-1: 표적 유전자의 선정과 프라이머 쌍 및 프로브의 설계 제작Example 3-1: Selection of target gene and design construction of primer pair and probe
우선, 태아 유래 유전자에 대한 유전자 분석, 예를 들어 3염색체성(trisomy)과 같은 유전자 수 이상 여부 분석을 수행하기 위하여 다음과 같은 21번 염색체 상의 유전자 서열을 표적 유전자 서열로 하고(도 3 참조), 이를 토대로 프라이머 쌍과 프로브를 설계하였다. First, in order to perform genetic analysis on fetal-derived genes, for example, abnormality in the number of genes such as trisomy, the following gene sequence on chromosome 21 is used as a target gene sequence (see FIG. 3). Based on this, primer pairs and probes were designed.
(1) 표적 유전자 서열(21번 염색체): NCBI의 GenBank Accession No. NC_018932.2 (서열번호 21)(1) Target gene sequence (chromosome 21): GenBank Accession No. of NCBI NC_018932.2 (SEQ ID NO: 21)
상기 서열번호 21의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 21 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 21-01_73 F: 5'-ATGCTGTTCATGGAGGATGCT-3' (서열번호 22)Forward primer 21-01_73 F: 5'-ATGCTGTTCATGGAGGATGCT-3 '(SEQ ID NO: 22)
역방향 프라이머 21-01_73 R: 5'-TCTATCTCCCACTCTCTCCAACTAATC-3' (서열번호 23)Reverse primer 21-01_73 R: 5'-TCTATCTCCCACTCTCTCCAACTAATC-3 '(SEQ ID NO: 23)
검출 프로브 21-01_73 P: 5'-AGGAAGATGAGAGAAAATTAGTA-3' (서열번호 24)Detection probe 21-01_73 P: 5'-AGGAAGATGAGAGAAAATTAGTA-3 '(SEQ ID NO: 24)
(2) 표적 유전자 서열(21번 염색체): NCBI의 GenBank Accession No. NC_000021.9 (서열번호 25)(2) target gene sequence (chromosome 21): GenBank Accession No. of NCBI NC_000021.9 (SEQ ID NO: 25)
상기 서열번호 25의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 25 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 21-03_73 F: 5'-GCACTGGGAATTTATTAGCACAAA-3' (서열번호 26)Forward primer 21-03_73 F: 5'-GCACTGGGAATTTATTAGCACAAA-3 '(SEQ ID NO: 26)
역방향 프라이머 21-03_73 R: 5'-GCTAAGATATGGTAGAGTCCCTTCTGA-3' (서열번호 27)Reverse primer 21-03_73 R: 5'-GCTAAGATATGGTAGAGTCCCTTCTGA-3 '(SEQ ID NO: 27)
검출 프로브 21-03_73 P: 5'-TCATTCTTTGCAACTCAAA-3' (서열번호 28)Detection probe 21-03_73 P: 5'-TCATTCTTTGCAACTCAAA-3 '(SEQ ID NO: 28)
(3) 표적 유전자 서열(21번 염색체): NCBI의 GenBank Accession No. NC_018932.2 (서열번호 29)(3) target gene sequence (chromosome 21): GenBank Accession No. of NCBI NC_018932.2 (SEQ ID NO: 29)
상기 서열번호 29의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 29 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 21-05_58 F: 5'-TGATGGGCTTGCGCTTATC-3' (서열번호 30)Forward primer 21-05_58 F: 5'-TGATGGGCTTGCGCTTATC-3 '(SEQ ID NO: 30)
역방향 프라이머 21-05_58 R: 5'-TGGGCTCCACAAGAAATCAGA-3' (서열번호 31)Reverse primer 21-05_58 R: 5'-TGGGCTCCACAAGAAATCAGA-3 '(SEQ ID NO: 31)
검출 프로브 21-05_58 P: 5'-TTGTCCCTTCTCCC-3' (서열번호 32)Detection probe 21-05_58 P: 5'-TTGTCCCTTCTCCC-3 '(SEQ ID NO: 32)
다음으로, 태아 유래 유전자에 대한 유전자 분석을 수행하기 위해, 전술한 바와 같은 표적 유전자의 증폭량에 대한 정상화값 산출을 위한 기준이 되는 콘트롤 유전자의 서열을 다음과 같은 1번 염색체 및 2번 염색체 상의 유전자 서열로 하였다(도 3 참조).Next, in order to perform genetic analysis on the fetal-derived gene, the sequence of the control gene, which is a reference for calculating the normalization value of the amplification amount of the target gene, as described above, the gene on the chromosomes 1 and 2 as follows It was set as the sequence (refer FIG. 3).
(4) 콘트롤 유전자 서열(2번 염색체): NCBI의 GenBank Accession No. NC_018913.2 (서열번호 33)(4) Control gene sequence (chromosome 2): GenBank Accession No. of NCBI NC_018913.2 (SEQ ID NO: 33)
상기 서열번호 33의 콘트롤 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 VIC으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the control gene of SEQ ID NO: 33 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with VIC and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 02-03_68 F: 5'-GAGGGACTCTGCCATTACTTAGCT-3' (서열번호 34)Forward primer 02-03_68 F: 5'-GAGGGACTCTGCCATTACTTAGCT-3 '(SEQ ID NO: 34)
역방향 프라이머 02-03_68 R: 5'-CAAGCCCATTCACGTTTGG-3' (서열번호 35)Reverse primer 02-03_68 R: 5'-CAAGCCCATTCACGTTTGG-3 '(SEQ ID NO: 35)
검출 프로브 02-03_68 P: 5'-AGCACAGAGGAGTGCC-3' (서열번호 36)Detection probe 02-03_68 P: 5'-AGCACAGAGGAGTGCC-3 '(SEQ ID NO: 36)
(5) 콘트롤 유전자 서열(1번 염색체): NCBI의 GenBank Accession No. NC_018912.2 (서열번호 37)(5) Control gene sequence (chromosome 1): GenBank Accession No. of NCBI NC_018912.2 (SEQ ID NO: 37)
상기 서열번호 37의 콘트롤 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 VIC으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the control gene of SEQ ID NO: 37 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with VIC and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 01-05_56 F: 5'-CATGGGCCCCACATGGT-3' (서열번호 38)Forward primer 01-05_56 F: 5'-CATGGGCCCCACATGGT-3 '(SEQ ID NO: 38)
역방향 프라이머 01-05_56 R: 5'-GCCAGTGTGCCTGAAGCATA-3' (서열번호 39)Reverse primer 01-05_56 R: 5'-GCCAGTGTGCCTGAAGCATA-3 '(SEQ ID NO: 39)
검출 프로브 01-05_56 P: 5'-CTAGTTTCCCCGGCTCA-3' (서열번호 40)Detection probe 01-05_56 P: 5'-CTAGTTTCCCCGGCTCA-3 '(SEQ ID NO: 40)
한편, 본 실시예에서 예시한 콘트롤 유전자, 표적 유전자 및 염색체는 예시로서 이해되어야 하며, 디지털 PCR을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 본 발명의 방법은 다양한 개체 또는 시료와, 다양한 표적 유전자 및 염색체에 대한 유전자형 분석 내지는 유전자 수 이상 분석에 적용가능한 기반기술로서 이해되어야 할 것이다. On the other hand, the control gene, target gene and chromosome exemplified in the present embodiment should be understood as an example, and the method of the present invention for analyzing fetal genetic information from pregnant women's blood or plasma using digital PCR may be performed with various individuals or samples. In addition, it should be understood as a technology applicable to genotyping or gene count analysis for various target genes and chromosomes.
전술한 바와 같은 표적 유전자 및 콘트롤 유전자를 각각 증폭하기 위한 프라이머 쌍과, 이로부터 증폭된 증폭 산물을 검출하기 위한 프로브는 (주)바이오니아(대한민국 대전광역시 소재)에 의뢰하여 합성하였다. A pair of primers for amplifying the target gene and the control gene as described above, and a probe for detecting the amplified product amplified therefrom were synthesized by Bion Corporation (Daejeon Metropolitan City, Korea).
실시예 3-2: 태아 유래 유전자 분석을 위한 프라이머 및 프로브 성능 평가Example 3-2: Evaluation of Primer and Probe Performance for Fetal Origin Gene Analysis
우선, 실시예 3-1에서 설계된 각 프라이머 쌍을 이용하여 대응하는 표적 유전자 및 콘트롤 유전자가 정상적으로 증폭되었는지 여부를 확인하기 위해, PCR 조성을 아래의 표 8과 같이 한 후, 아래의 표 9의 PCR 증폭 조건 하에서 PCR 증폭을 수행하였다. 한편, PCR 증폭 조성 중 PCR 증폭용 마스터 믹스는 예를 들어, PCR 버퍼, dNTP, DNA 폴리머라아제 등으로 이루어진 것으로서, 본 실시예에서는 PCR 마스터 믹스로 TaqMan® Universal Master Mix Ⅱ, no UNG (Life Technologies, Cat. 4440040)를 사용하였다.First, in order to confirm whether the corresponding target gene and the control gene were normally amplified using each primer pair designed in Example 3-1, PCR composition was prepared as shown in Table 8 below, and then PCR amplification of Table 9 below. PCR amplification was performed under conditions. On the other hand, PCR amplification master mix for PCR amplification of the composition, for example, PCR buffer, dNTP, DNA polymerase been made by Ajay et al., In this embodiment, TaqMan ® Universal Master Mix Ⅱ, no UNG (Life Technologies to the PCR master mix , Cat. 4440040).
표 8 PCR 증폭 조성
No. PCR 증폭 조성 부피 (㎕)
1 DNA 주형이 있는 샘플 또는 주형이 없는 대조군(NTC) 1
2 프라이머 (5 pM) 정방향 프라이머 0.5
역방향 프라이머 0.5
3 증류수 8
4 TaqMan® Universal Master Mix II, no UNG 10
합계 20
Table 8 PCR amplification composition
No. PCR amplification composition Volume (μl)
One Sample with DNA template or control without template (NTC) One
2 Primer (5 pM) Forward primer 0.5
Reverse primer 0.5
3 Distilled water 8
4 TaqMan ® Universal Master Mix II, no UNG 10
Sum 20
표 9 PCR 증폭 조건
No. 단계 온도 시간 사이클
1 사전 변성 95℃ 10분
2 변성 95℃ 30초 40 사이클
3 어닐링 60℃ 60초
Table 9 PCR amplification conditions
No. step Temperature time cycle
One Pre-degeneration 95 ℃ 10 minutes
2 denaturalization 95 ℃ 30 seconds 40 cycles
3 Annealing 60 ℃ 60 sec
상기와 같은 조성과 조건 하에서 증폭된 PCR 증폭산물에 대해 전기영동을 수행하여 밴드를 확인한 결과, 각 프라이머 쌍에 대응하는 표적 유전자 및 콘트롤 유전자가 정상적으로 증폭되었음을 확인할 수 있었다(도 5 참조).As a result of confirming the band by performing electrophoresis on the PCR amplified product amplified under the composition and condition as described above, it was confirmed that the target gene and the control gene corresponding to each primer pair were normally amplified (see FIG. 5).
다음으로, 실시예 3-1에서 설계한 각각의 프라이머 쌍과 프로브를 이용하여 해당 표적 유전자 및 콘트롤 유전자에 대한 리얼 타임 PCR을 수행하였다. 본 실시예에서 리얼 타임 PCR은 7900HT Fast Real Time PCR System (Life Technologies, 미국)을 이용하여 수행하였으며, 실시예 1-2에서 준비된 샘플(태아 유래 유전자가 일정량 함유된 것으로 확인된 F1 샘플, F22 샘플, G1 샘플)의 DNA 주형과, 리얼타임 PCR 마스터 믹스(real-time PCR master mixture) 등의 리얼 타임 PCR 조성을 아래의 표 10과 같이 한 후, 아래의 표 11의 리얼 타임 PCR 증폭 조건 하에서 리얼 타임 PCR을 수행하였다. Next, real time PCR was performed on the target genes and the control genes using the respective primer pairs and probes designed in Example 3-1. In this example, real-time PCR was performed using a 7900HT Fast Real Time PCR System (Life Technologies, USA), and the samples prepared in Examples 1-2 (F1 sample, F22 sample confirmed to contain a certain amount of the gene derived from fetus) Real-time PCR composition of DNA template, G1 sample) and real-time PCR master mixture as shown in Table 10 below, and then real-time under the real-time PCR amplification conditions of Table 11 below. PCR was performed.
표 10 리얼타임 PCR 증폭 조성
No. PCR 증폭 조성 부피 (㎕)
1 DNA 주형이 있는 샘플 또는 주형이 없는 대조군(NTC) 1
2 프라이머 (5 pM) 정방향 프라이머 0.5
역방향 프라이머 0.5
3 검출 프로브 1
4 TaqMan® Universal Master Mix II, no UNG 5
5 증류수 2
합계 10
Table 10 Real-Time PCR Amplification Composition
No. PCR amplification composition Volume (μl)
One Sample with DNA template or control without template (NTC) One
2 Primer (5 pM) Forward primer 0.5
Reverse primer 0.5
3 Detection probe One
4 TaqMan ® Universal Master Mix II, no UNG 5
5 Distilled water 2
Sum 10
표 11 리얼타임 PCR 증폭 조건
No. 단계 온도 시간 사이클
1 활성화(Activation) 50℃ 2분
2 유지(Hold) 95℃ 10분
3 변성 95℃ 15초 40 사이클
4 어닐링 60℃ 60초
Table 11 Real-Time PCR Amplification Conditions
No. step Temperature time cycle
One Activation 50 ℃ 2 minutes
2 Hold 95 ℃ 10 minutes
3 denaturalization 95 ℃ 15 seconds 40 cycles
4 Annealing 60 ℃ 60 sec
위와 같은 리얼 타임 PCR 조성 및 조건 하에서 리얼 타임 PCR을 수행한 결과 그래프가 도 6 내지 도 24에 도시되어 있다. F1 샘플, F22 샘플 및 G1 샘플의 경우에는 표적 유전자 및 콘트롤 유전자에 대해 정상적으로 리얼 타임 PCR 증폭이 이루어지는 것을 나타내는 증폭 곡선이 확인되었고(도 6 내지 도 19), 주형이 없는 콘트롤(NTC)의 경우에는 유의미한 증폭 곡선이 관찰되지 않았다(도 20 내지 도 24). 따라서, 실시예 3-1에서 설계한 프라이머 쌍과 프로브는 샘플 내에 포함된 해당 표적 유전자 및 콘트롤 유전자의 특이적 증폭 및 검출에 적합한 것임을 확인할 수 있었다.6 to 24 show graphs of real-time PCR under real-time PCR compositions and conditions as described above. Normally real time for target genes and control genes for F1 sample, F22 sample, and G1 sample An amplification curve indicating PCR amplification was confirmed (FIGS. 6-19), and no significant amplification curve was observed for the control without template (NTC) (FIGS. 20-24). Therefore, it was confirmed that the primer pair and the probe designed in Example 3-1 are suitable for specific amplification and detection of the target gene and the control gene included in the sample.
실시예 4: 디지털 PCR을 이용한 태아 유래 유전자 이상의 분석Example 4 Analysis of Fetal Derivative Gene Abnormalities Using Digital PCR
실시예 4-1: 태아 유래 유전자가 포함된 것으로 확인된 샘플에 대한 디지털 PCR 수행Example 4-1: Digital PCR of Samples Found to Contain a Fetal-Derived Gene
실시예 1-2에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 F1 샘플, F22 샘플, G1 샘플, G2 샘플(G1 샘플에 대해 DNA 추출을 한번 더 한 샘플) 및 주형이 없는 콘트롤(NTC) 각각을 도 25의 디지털 PCR 레이아웃에 따라 OpenArray® 웰 플레이트(Life Technologies, 미국)의 할당된 어레이 상의 각 웰에 분배하였고, 각 샘플 별 어레이 상의 각 웰에 실시예 3-1에서 설계한 각각의 프라이머 쌍과 이에 대응하는 프로브(총 5세트)를 분주하였다(도 25 참조). 이때 각 웰 당 디지털 PCR 조성은 아래의 표 12와 같이 하였고, 디지털 PCR을 위한 샘플의 적정 농도(sweet spot)를 모르기 때문에 20 ng/ul의 각 샘플을 20배 희석한 것을 사용하였다. F1 sample, F22 sample, G1 sample, G2 sample (a sample of DNA extraction for G1 sample) and template-free control in which gDNA samples prepared in Example 1-2 were found to contain a certain amount of fetal-derived genes (NTC) each was dispensed to each well on an assigned array of OpenArray ® well plates (Life Technologies, USA) according to the digital PCR layout of FIG. 25 and designed in Example 3-1 to each well on an array per each sample. Each primer pair and corresponding probes (5 sets in total) were dispensed (see FIG. 25). At this time, the digital PCR composition for each well was performed as shown in Table 12 below, and since 20 ng / ul of each sample was diluted 20 times because the proper concentration of the sample for digital PCR was not known.
그리고, AccuFill기기 및 QuantStudio 12K Flex 기기(Life Technologies, 미국)를 이용하여 디지털 PCR 증폭을 수행하였는데, 아래의 표 13의 디지털 PCR 증폭 조건 하에서 위 기기 제조사 매뉴얼에 따라 디지털 PCR 증폭을 수행하였다. 한편, 디지털 PCR 증폭 조성 중 디지털 PCR 증폭용 마스터 믹스는 예를 들어, PCR 버퍼, dNTP, DNA 폴리머라아제 등으로 이루어진 것으로서, 본 실시예에서는 디지털 PCR 마스터 믹스로 TaqMan® Universal Master Mix Ⅱ, no UNG (Life Technologies, Cat. 4440040)를 사용하였다.Then, digital PCR amplification was performed using AccuFill device and QuantStudio 12K Flex device (Life Technologies, USA), and digital PCR amplification was performed according to the device manufacturer's manual under the digital PCR amplification conditions shown in Table 13 below. On the other hand, digital PCR amplified digital PCR amplification master mix for one composition are, for example, PCR buffer, dNTP, as a DNA polymerase consisting of a kinase, such as, in the present embodiment, a digital PCR master mix TaqMan ® Universal Master Mix Ⅱ, no UNG (Life Technologies, Cat. 4440040) was used.
표 12 디지털 PCR 증폭 조성
No. PCR 증폭 조성 부피 (㎕)
1 DNA 주형을 갖는 샘플 또는 NTC 1
2 프라이머 (5 pM) 정방향 프라이머 0.5
역방향 프라이머 0.5
3 검출 프로브 (5 pM) 1
4 TaqMan® Universal Master Mix II, no UNG 3
Table 12 Digital PCR Amplification Composition
No. PCR amplification composition Volume (μl)
One Sample or NTC with DNA template One
2 Primer (5 pM) Forward primer 0.5
Reverse primer 0.5
3 Detection probe (5 pM) One
4 TaqMan ® Universal Master Mix II, no UNG 3
표 13 디지털 PCR 증폭 조건
No. 단계 온도 시간 사이클
1 유지(Hold) 95℃ 20초
2 변성 95℃ 1초 40 사이클
3 어닐링 60℃ 20초
Table 13 Digital PCR Amplification Conditions
No. step Temperature time cycle
One Hold 95 ℃ 20 seconds
2 denaturalization 95 ℃ 1 sec 40 cycles
3 Annealing 60 ℃ 20 seconds
도 26에서는 본 실시예에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타내었다. 도 26에 도시된 바와 같이, 도 25의 디지털 PCR 레이아웃 상의 각 샘플 별로 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자) 또는 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)에 대해 증폭이 일어난 웰에서 형광신호가 발생하였고 증폭이 일어나지 않은 웰에서는 형광신호가 검출되지 않았다. In Figure 26, the results of the digital PCR in the present embodiment is shown as a digital PCR heat map. As shown in FIG. 26, the target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) or the control gene (SEQ ID NO: 33 or SEQ ID NO: 37) for each sample on the digital PCR layout of FIG. Fluorescence signals were generated in the wells in which the amplification was performed and no fluorescent signals were detected in the wells in which the amplification did not occur.
도 27에서는 QuantStudio 12K Flex 기기에 제공된 QuantStudio 12K Flex 소프트웨어 및 DigitalSuite 소프트웨어의 실행에 의해 상기 디지털 PCR 레이아웃의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 실시예 3-1의 각 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 카피수 및 각 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 카피수를 정량하여 도시하였다. 이러한 카피수 분석 결과, 웰 당 콘트롤 유전자의 카피수 또는 표적 유전자의 카피수가 과도하게 많아 프아송 분포를 만족시키지 않는 것으로 확인되었다. 따라서, 추가적인 샘플의 희석과 적정 농도의 결정이 필요한 것으로 분석되었다.FIG. 27 shows the fluorescence values measured in each well of the digital PCR layout by execution of QuantStudio 12K Flex software and DigitalSuite software provided in the QuantStudio 12K Flex device, and for each sample, each target gene (SEQ ID NO: The copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown. As a result of the copy number analysis, it was confirmed that the copy number of the control gene or the target gene per well was excessive, so that it did not satisfy the Poisson distribution. Therefore, it was analyzed that additional sample dilution and determination of the appropriate concentration were necessary.
실시예 4-2: 희석된 F1 샘플 및 F22 샘플에 대한 디지털 PCR 수행Example 4-2: Digital PCR of Diluted F1 Sample and F22 Sample
실시예 1-2에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 F1 샘플 및 F22 샘플 각각을 도 28의 디지털 PCR 레이아웃에 따라 OpenArray® 웰 플레이트(Life Technologies, 미국)의 할당된 어레이 상의 각 웰에 분배하였고, 각 샘플 별 어레이 상의 각 웰에 실시예 3-1에서 설계한 각각의 프라이머 쌍과 이에 대응하는 프로브(총 5세트)를 분주하였다(도 28 참조). An assigned array of OpenArray ® well plates (Life Technologies, USA) according to the digital PCR layout of FIG. 28, each of the F1 and F22 samples identified as containing a certain amount of fetal derived genes among the gDNA samples prepared in Examples 1-2. Each well on the phase was dispensed and each well on the array for each sample was dispensed with each primer pair and the corresponding probes (5 sets in total) designed in Example 3-1 (see FIG. 28).
각 웰 당 디지털 PCR 조성은 아래의 표 14와 같이 하였고, 디지털 PCR을 위한 샘플의 적정 농도(sweet spot) 선정을 위하여 20 ng/ul의 각 샘플을 100배 희석한 것을 사용하였다. 한편, 디지털 PCR 기기 및 PCR 조건은 실시예 4-1과 동일하게 하였다.Digital PCR composition for each well was as shown in Table 14 below, and used to dilute each sample of 20 ng / ul 100 times in order to select the sweet spot of the sample for digital PCR. In addition, the digital PCR instrument and PCR conditions were the same as Example 4-1.
표 14 디지털 PCR 증폭 조성
No. PCR 증폭 조성 부피 (㎕)
1 DNA 주형을 갖는 샘플 1
2 프라이머 (20 pM) 정방향 프라이머 0.25
역방향 프라이머 0.25
3 검출 프로브 (5 pM) 1
4 TaqMan® Universal Master Mix II, no UNG 2.5
Table 14 Digital PCR Amplification Composition
No. PCR amplification composition Volume (μl)
One Sample with DNA Template One
2 Primer (20 pM) Forward primer 0.25
Reverse primer 0.25
3 Detection probe (5 pM) One
4 TaqMan ® Universal Master Mix II, no UNG 2.5
도 29에서는 본 실시예에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타내었다. 도 29에 도시된 바와 같이, 도 28의 디지털 PCR 레이아웃 상의 각 샘플 별로 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자) 또는 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)에 대해 증폭이 일어난 웰에서 형광신호가 발생하였고 증폭이 일어나지 않은 웰에서는 형광신호가 검출되지 않았다. In FIG. 29, the results of the digital PCR in the present embodiment are shown as a digital PCR heat map. As shown in FIG. 29, the target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) or the control gene (SEQ ID NO: 33 or SEQ ID NO: 37) for each sample on the digital PCR layout of FIG. Fluorescence signals were generated in the wells in which the amplification was performed and no fluorescent signals were detected in the wells in which the amplification did not occur.
도 30에서는 QuantStudio 12K Flex 기기에 제공된 QuantStudio 12K Flex 소프트웨어 및 DigitalSuite 소프트웨어의 실행에 의해 상기 디지털 PCR 레이아웃의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 실시예 3-1의 각 표적 유전자 (서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 카피수 및 각 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 카피수를 정량하여 도시하였다. 이러한 카피수 분석 결과, 실시예 4-1의 경우 보다는 안정적인 결과값이 산출되었으나, 태아 유래 표적 유전자의 유전자 수 이상을 확인하기에는 여전히 웰 당 콘트롤 유전자의 카피수가 과도하게 많아 프아송 분포를 만족시키지 않는 것으로 확인되었다. 따라서, 추가적인 샘플의 희석과 적정 농도의 결정이 필요한 것으로 분석되었다. Figure 30 shows the fluorescence values measured in each well of the digital PCR layout by the execution of QuantStudio 12K Flex software and DigitalSuite software provided in the QuantStudio 12K Flex instrument to analyze each target gene of Example 3-1 for each sample (SEQ ID NO: The copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown. As a result of the copy number analysis, a more stable result was obtained than in the case of Example 4-1. However, in order to confirm more than the number of genes of the target gene derived from the fetus, the number of control genes per well is still too high to satisfy the Poisson distribution. It was confirmed. Therefore, it was analyzed that additional sample dilution and determination of the appropriate concentration were necessary.
실시예 4-3: 희석된 G1 샘플 및 남성 콘트롤(male control) 샘플에 대한 디지털 PCR 수행Example 4-3: Digital PCR of Diluted G1 Samples and Male Control Samples
실시예 1-2에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 G1 샘플과, 국내 종합병원에서 제공받은 유전적으로 이상이 없는 정상 남성의 게놈 DNA 샘플(male control sample) 각각을 도 31의 디지털 PCR 레이아웃에 따라 OpenArray® 웰 플레이트(Life Technologies, 미국)의 할당된 어레이 상의 각 웰에 분배하였고, 각 샘플 별 어레이 상의 각 웰에 실시예 3-1에서 설계한 각각의 프라이머 쌍과 이에 대응하는 프로브(총 5세트)를 분주하였다(도 31 참조). Among the gDNA samples prepared in Example 1-2, a G1 sample confirmed to contain a certain amount of a fetal-derived gene and a normal male genomic DNA sample (male control sample) of a normal male without genetic abnormalities provided in a domestic general hospital are shown. Each primer pair designed in Example 3-1 and associated with each well on an assigned array of OpenArray ® well plates (Life Technologies, USA) according to 31 digital PCR layouts Corresponding probes (5 sets in total) were dispensed (see FIG. 31).
각 웰 당 디지털 PCR 조성은 아래의 표 15와 같이 하였고, 디지털 PCR을 위한 샘플의 적정 농도(sweet spot) 선정을 위하여 20 ng/ul의 각 샘플을 100배 희석한 것을 사용하였다. 한편, 디지털 PCR 기기 및 PCR 조건은 실시예 4-1과 동일하게 하였다.The digital PCR composition for each well was as shown in Table 15 below, and used to dilute each sample of 20 ng / ul 100 times in order to select a sweet spot of the sample for digital PCR. In addition, the digital PCR instrument and PCR conditions were the same as Example 4-1.
표 15 디지털 PCR 증폭 조성
No. PCR 증폭 조성 부피 (㎕)
1 DNA 주형을 갖는 샘플 1
2 프라이머(20 pM) 정방향 프라이머 0.25
역방향 프라이머 0.25
3 검출 프로브 (5 pM) 1
4 TaqMan® Universal Master Mix II, no UNG 2.5
Table 15 Digital PCR Amplification Composition
No. PCR amplification composition Volume (μl)
One Sample with DNA Template One
2 Primer (20 pM) Forward primer 0.25
Reverse primer 0.25
3 Detection probe (5 pM) One
4 TaqMan ® Universal Master Mix II, no UNG 2.5
도 32에서는 본 실시예에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타내었다. 도 32에 도시된 바와 같이, 도 31의 디지털 PCR 레이아웃 상의 각 샘플 별로 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자) 또는 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)에 대해 증폭이 일어난 웰에서 형광신호가 발생하였고 증폭이 일어나지 않은 웰에서는 형광신호가 검출되지 않았다. In FIG. 32, the results of the digital PCR in the present embodiment are shown as a digital PCR heat map. As shown in FIG. 32, the target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) or the control gene (SEQ ID NO: 33 or SEQ ID NO: 37) for each sample on the digital PCR layout of FIG. Fluorescence signals were generated in the wells in which the amplification was performed and no fluorescent signals were detected in the wells in which the amplification did not occur.
도 33에서는 QuantStudio 12K Flex 기기에 제공된 QuantStudio 12K Flex 소프트웨어 및 DigitalSuite 소프트웨어의 실행에 의해 상기 디지털 PCR 레이아웃의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 실시예 3-1의 각 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 카피수 및 각 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 카피수를 정량하여 도시하였다. 이러한 카피수 분석 결과, 실시예 4-1의 경우 보다는 안정적인 결과값이 산출되었으나, 정상 남성 유전자에 대한 태아 유래 표적 유전자의 유전자 수 이상을 확인하기에는 여전히 웰 당 콘트롤 유전자의 카피수가 과도하게 많아 프아송 분포를 만족시키지 않는 것으로 확인되었다. 따라서, 추가적인 샘플의 희석과 적정 농도의 결정이 필요한 것으로 분석되었다.FIG. 33 shows the fluorescence values measured in each well of the digital PCR layout by execution of QuantStudio 12K Flex software and DigitalSuite software provided in a QuantStudio 12K Flex device. The copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown. As a result of the copy number analysis, a more stable result was obtained than in the case of Example 4-1. However, in order to confirm abnormality in the number of genes of the fetal-derived target gene for the normal male gene, the copy number of the control gene per well is still too high. It was confirmed that the distribution was not satisfied. Therefore, it was analyzed that additional sample dilution and determination of the appropriate concentration were necessary.
실시예 4-4: 추가적으로 희석된 G1 샘플 및 남성 콘트롤(male control) 샘플에 대한 디지털 PCR 수행Example 4-4: Digital PCR on Additional Diluted G1 Samples and Male Control Samples
실시예 1-2에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 G1 샘플과, 국내 종합병원에서 제공받은 유전적으로 이상이 없는 정상 남성의 게놈 DNA 샘플(male control sample) 각각을 도 34의 디지털 PCR 레이아웃에 따라 OpenArray® 웰 플레이트(Life Technologies, 미국)의 할당된 어레이 상의 각 웰에 분배하였고, 각 샘플 별 어레이 상의 각 웰에 실시예 3-1에서 설계한 각각의 프라이머 쌍과 이에 대응하는 프로브(총 5세트)를 분주하였다(도 34 참조). Among the gDNA samples prepared in Example 1-2, a G1 sample confirmed to contain a certain amount of a fetal-derived gene and a normal male genomic DNA sample (male control sample) of a normal male without genetic abnormalities provided in a domestic general hospital are shown. Each well pair was dispensed to each well on an assigned array of OpenArray ® well plates (Life Technologies, USA) according to 34 digital PCR layouts, and each primer pair designed in Example 3-1 to each well on an array per sample The corresponding probes (5 sets in total) were dispensed (see FIG. 34).
각 웰 당 디지털 PCR 조성은 아래의 표 16과 같이 하였고, 디지털 PCR을 위한 샘플의 적정 농도(sweet spot) 선정을 위하여 20 ng/ul의 각 샘플을 1000배 희석한 것을 사용하였다. 한편, 디지털 PCR 기기 및 PCR 조건은 실시예 4-1과 동일하게 하였다.The digital PCR composition for each well was as shown in Table 16 below, and used to dilute 1000 fold of each sample at 20 ng / ul to select a sweet spot of the sample for digital PCR. In addition, the digital PCR instrument and PCR conditions were the same as Example 4-1.
표 16 디지털 PCR 증폭 조성
No. PCR 증폭 조성 부피 (㎕)
1 DNA 주형을 갖는 샘플 1
2 프라이머 (20 pM) 정방향 프라이머 0.25
역방향 프라이머 0.25
3 검출 프로브 (5 pM) 1
4 TaqMan® Universal Master Mix II, no UNG 2.5
Table 16 Digital PCR Amplification Composition
No. PCR amplification composition Volume (μl)
One Sample with DNA Template One
2 Primer (20 pM) Forward primer 0.25
Reverse primer 0.25
3 Detection probe (5 pM) One
4 TaqMan ® Universal Master Mix II, no UNG 2.5
도 35에서는 본 실시예에서 디지털 PCR을 수행한 결과를 디지털 PCR 히트 맵으로 나타내었다. 도 35에 도시된 바와 같이, 도 34의 디지털 PCR 레이아웃 상의 각 샘플 별로 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자) 또는 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)에 대해 증폭이 일어난 웰에서 형광신호가 발생하였고 증폭이 일어나지 않은 웰에서는 형광신호가 검출되지 않았다. In FIG. 35, the results of the digital PCR in the present embodiment are shown as a digital PCR heat map. As shown in FIG. 35, the target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) or the control gene (SEQ ID NO: 33 or SEQ ID NO: 37) for each sample on the digital PCR layout of FIG. Fluorescence signals were generated in the wells in which the amplification was performed and no fluorescent signals were detected in the wells in which the amplification did not occur.
도 36에서는 QuantStudio 12K Flex 기기에 제공된 QuantStudio 12K Flex 소프트웨어 및 DigitalSuite 소프트웨어의 실행에 의해 상기 디지털 PCR 레이아웃의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 실시예 3-1의 각 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 카피수 및 각 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 카피수를 정량하여 도시하였다. FIG. 36 shows the fluorescence values measured in each well of the digital PCR layout by execution of QuantStudio 12K Flex software and DigitalSuite software provided in the QuantStudio 12K Flex device. The copy number of 21, SEQ ID NO: 25 or SEQ ID NO: 29) and the copy number of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37) are quantitatively shown.
이러한 카피수 분석 결과, 전체적으로 안정적인 결과값이 산출되었고, 서열번호 33의 콘트롤 유전자의 카피수 및 서열번호 37의 콘트롤 유전자의 카피수가 대략 통계학적으로 1개에 근접하는 것으로 확인되었다. 즉, 본 실시예에서는 각 샘플의 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)가 웰 당 통계학적으로 대략 1개 정도 배분된 것으로 불 수 있고, 이에 따라 프아송 분포를 만족시킨다. 따라서, 각각의 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 디지털 PCR 증폭산물을 정량하고, 정량화된 값 각각을 각각의 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 디지털 PCR 정량값에 대해 정상화한 값을 산출하면, 정상 남성 유전자에 대한 태아 유래 표적 유전자의 유전자 수 이상을 확인할 수 있다. 그 결과가 하기 표 17에 도시되어 있다. As a result of this copy number analysis, a stable result was obtained as a whole, and it was confirmed that the number of copies of the control gene of SEQ ID NO: 33 and the number of copies of the control gene of SEQ ID NO: 37 were approximately statistically close to one. That is, in the present embodiment, it can be said that about one control gene (gene of SEQ ID NO: 33 or SEQ ID NO: 37) of each sample is distributed about one statistically per well, thereby satisfying the Poisson distribution. Thus, the digital PCR amplification products of each target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) are quantified, and each of the quantified values is assigned to the respective control gene (SEQ ID NO: 33 or SEQ ID NO: 37). By calculating the normalized value for the digital PCR quantitative value of, it is possible to confirm more than the number of genes of the target gene derived from the fetus for the normal male gene. The results are shown in Table 17 below.
표 17
서열번호 37의 콘트롤 유전자(1번 염색체)에 대한 정상화 값 샘플번호 서열번호 33의 콘트롤 유전자(2번 염색체)에 대한 정상화 값
1.65264 2.516783987 G1 2.112308677 1.387042
1.117781206 0.938141276
1.323355 1.110677064
1.03092 0.901134 MC 1.15633 1.181313
0.844723 1.21053
1.346902 1.17708
Table 17
Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2)
1.65264 2.516783987 G1 2.112308677 1.387042
1.117781206 0.938141276
1.323355 1.110677064
1.03092 0.901134 MC 1.15633 1.181313
0.844723 1.21053
1.346902 1.17708
상기 표 17에 도시된 바와 같이, 정상 남성 샘플(MC)의 경우에는 서열번호 37의 콘트롤 유전자(1번 염색체 상의 유전자) 및 서열번호 33의 콘트롤 유전자(2번 염색체 상의 유전자)에 대한 정상화 값이 1에 근접하여 표적 유전자(21번 염색체 상의 유전자)의 유전자 수의 변이가 없는 것을 확인할 수 있다. As shown in Table 17, in the normal male sample (MC), normalization values for the control gene of SEQ ID NO: 37 (gene on chromosome 1) and the control gene of SEQ ID NO: 33 (gene on chromosome 2) It can be confirmed that there is no variation in the number of genes of the target gene (gene on chromosome 21) close to 1.
그러나, G1 샘플의 경우에는 서열번호 37의 콘트롤 유전자(1번 염색체 상의 유전자) 및 서열번호 33의 콘트롤 유전자(2번 염색체 상의 유전자)에 대한 정상화 값이 각각 1.65264 및 1.387042로서 산출되어 표적 유전자(21번 염색체 상의 유전자)의 유전자 수 변이가 있는 것이 확인된다. 이는 태아에 있어 유전자 수 이상이 없는 것으로 알려진 1번 염색체의 유전자 수와 2번 염색체의 유전자 수에 대해 21번 염색체 유전자 수가 대략 1.5배 내외 정도 많은 것을 의미한다. 따라서, 이로부터 21번 염색체 유전자의 수적 이상, 즉 21번 염색체가 3배체(정상은 2배체)인 3염색체성(trisomy)을 태아가 갖는 것으로 추정할 수 있고, G1 샘플을 제공한 임부의 태아의 다운증후군 발생 위험도는 높다고 예진할 수 있다.However, in the case of the G1 sample, normalization values for the control gene of SEQ ID NO: 37 (gene on chromosome 1) and the control gene of SEQ ID NO: 33 (gene on chromosome 2) were calculated as 1.65264 and 1.387042, respectively. Gene variation of the gene on the chromosome is confirmed. This means that the number of chromosome 21 genes is about 1.5 times larger than the number of genes of chromosome 1 and the number of chromosome 2 genes known to have no genes in the fetus. Therefore, it can be estimated from this that the fetus has a number of abnormalities of chromosome 21, ie, trisomy, in which chromosome 21 is a triplex (normally diploid), and the fetus of a pregnant woman who provided a G1 sample. The risk of Down syndrome can be expected to be high.
이와 같이, 본 발명의 방법은 태아 유래 유전자로부터 유래한 신호만의 분리의 어려운 문제와 임부의 유전자 배경 신호에 의한 문제를 해결하면서도 디지털 PCR 기술에서 요구되는 프아송 분포를 만족시켜 정량 결과를 신뢰할 수 있고, 태아 유래 세포 유리 유전자를 이용한 유전자형 분석 기술로의 디지털 PCR 기술의 접목을 어렵게 하는 종래의 문제점을 해결할 수 있다. As described above, the method of the present invention solves the problem of separation of only signals derived from fetal-derived genes and problems caused by the genetic background signal of pregnant women, while satisfying the Poisson distribution required by digital PCR technology, thereby reliably quantifying the results. It is possible to solve the conventional problem of making it difficult to integrate digital PCR technology into genotyping technology using fetal-derived cell free genes.
실시예 5: 디지털 PCR을 이용한 21번 염색체, 18번 염색체 및 13번 염색체의 3염색체성(trisomy) 분석 준비Example 5: Trisomy Analysis Preparation of Chromosome 21, 18 and 13 by Digital PCR
실시예 5-1: 임부 혈장 샘플로부터 검사 대상 시료 준비 및 리얼타임 PCR의 수행Example 5-1 Preparation of Test Samples from Pregnant Plasma Samples and Real-Time PCR
국내 종합 병원 산부인과들로부터 블라인드 테스트 용으로 임부의 혈장을 제공받았다. 각 샘플 별로 MO, M6, M7, M9, S8, S8_1, S2, S4, S5, S6과 같은 임의의 샘플 번호를 부여하고, 이후 각 샘플에 대응하는 추출 gDNA 샘플에 대해서도 동일한 샘플 번호를 사용한다. 독일 퀴아젠사 (QIAGEN)의 QIAamp Circulating Nucleic Acid Kit (Qiagen Cat #55114)를 사용하여, 태아 유래 유전자의 3염색체성(trisomy) 분석 대상이 되는 혈장 샘플(사용량: 1 ml)로부터 gDNA 샘플을 추출하였다. gDNA 추출 과정은 실시예 1-2에서 기술된 방식에 따라 수행하였다.Pregnant women's plasma was provided for blind testing by gynecologists in Korea. Each sample is given an arbitrary sample number such as MO, M6, M7, M9, S8, S8_1, S2, S4, S5, S6, and then the same sample number is also used for the extracted gDNA sample corresponding to each sample. Using a QIAamp Circulating Nucleic Acid Kit (Qiagen Cat # 55114) from QIAGEN, Germany, gDNA samples are extracted from plasma samples (dose: 1 ml) subjected to trisomy analysis of fetal-derived genes. It was. The gDNA extraction procedure was performed according to the manner described in Examples 1-2.
그리고, 각 혈장 샘플로부터 추출된 gDNA에 대해 실시예 1-2에서 수행된 방법과 동일한 방법으로 태아 유래 유전자 함유량을 분석하였다. 즉, 표 1의 프라이머 쌍과 형광 표지된 프로브를 이용하여 APP(Amyloid Precursor protein) 유전자 (GenBank accession No. NM_000484), β-액틴 유전자 및 SRY 유전자에 대한 리얼타임 PCR을 실시예 1-2와 동일한 방식과 조건으로 수행하였고, 리얼타임 PCR 정량 결과로부터 태아 유래 유전자 함유량을 산출하였다. 태아 유래 유전자 함유량 산출은 실시예 1-2과 동일한 방식으로 이루어졌다. And, the gDNA extracted from each plasma sample was analyzed for fetal derived gene content in the same manner as in Example 1-2. That is, real-time PCR of the Amyloid Precursor protein (APP) gene (GenBank accession No. NM_000484), the β-actin gene, and the SRY gene using the primer pairs and the fluorescently labeled probes of Table 1 was performed in the same manner as in Example 1-2. Method and conditions were performed, and fetal-derived gene content was calculated from real-time PCR quantitative results. Fetal-derived gene content was calculated in the same manner as in Example 1-2.
하기 표 18에는 짧은 앰플리콘(길이 67bp)에 대한 리얼 타임 PCR의 정량 결과, 긴 앰플리콘(길이 180bp)에 대한 리얼 타임 PCR의 정량 결과, 이들의 비율 그리고 임부의 혈장 내에 존재하는 태아 유래 유전자의 함유량을 계산한 결과를 각 샘플 별로 정리하여 도시하고 있다. Table 18 below shows the results of quantification of real time PCR for short amplicons (length 67 bp), quantification of real time PCR for long amplicons (length 180 bp), their ratios and The results of calculating the content are shown in a summary for each sample.
표 18
샘플 번호 67 bp 양 180 bp 양 비율 태아 DNA %
M0 33.58 21.43 1.57 6.90
M6 31.20 20.89 1.49 5.77
M7 32.70 26.48 1.23 1.78
M9 32.63 21.86 1.49 5.77
S8 12.35 8.26 1.50 5.79
S8_1 1.45 0.97 1.50 5.79
S2 6.94 4.59 1.51 6.03
S4 4.87 2.85 1.71 9.06
S5 28.66 17.92 1.60 7.30
S6 12.57 7.08 1.78 10.11
Table 18
Sample number 67 bp amount 180 bp volume ratio Fetal DNA%
M0 33.58 21.43 1.57 6.90
M6 31.20 20.89 1.49 5.77
M7 32.70 26.48 1.23 1.78
M9 32.63 21.86 1.49 5.77
S8 12.35 8.26 1.50 5.79
S8_1 1.45 0.97 1.50 5.79
S2 6.94 4.59 1.51 6.03
S4 4.87 2.85 1.71 9.06
S5 28.66 17.92 1.60 7.30
S6 12.57 7.08 1.78 10.11
상기 표 18에 도시된 바와 같이, 계산한 결과 태아 유래 유전자가 일정량 함유되는 것으로 산출된 블라인드 테스트용 샘플(예를 들어, MO 샘플, M6 샘플, M9 샘플, S8 샘플, S8_1 샘플, S2 샘플, S4 샘플, S5 샘플, S6 샘플)은 태아 유래 유전자가 충분히 존재하는 것이므로 추후 태아 유전자 수 이상, 즉 3염색체성(trisomy)과 관련한 디지털 PCR 분석에 사용하였다.As shown in Table 18, the blind test sample (for example, MO sample, M6 sample, M9 sample, S8 sample, S8_1 sample, S2 sample, S4, calculated as a result of calculating a certain amount of fetal-derived genes) Samples, S5 samples, and S6 samples) are sufficient for the presence of fetal genes, so they were later used for digital PCR analysis involving more than the number of fetal genes, ie trisomy.
실시예 5-2: 13번 염색체의 유전자 수 이상 분석을 위한 표적 유전자의 선정과 프라이머 쌍 및 프로브의 설계 제작Example 5-2 Selection of Target Gene and Analysis of Primer Pair and Probe for Gene Number Abnormal Analysis of Chromosome 13
태아 유래 유전자에 대한 유전자 분석, 예를 들어 3염색체성(trisomy)과 같은 유전자 수 이상 여부 분석을 수행하기 위하여, 실시예 3-1에서 설명된 21번 염색체 외에 추가로 13번 염색체 상의 유전자 서열을 표적 유전자 서열로 하고(도 4 참조), 이를 토대로 프라이머 쌍과 프로브를 설계하였다. 13번 염색체 상의 표적 유전자 서열, 이를 증폭하기 위한 프라이머 쌍 및 검출 프로브는 다음과 같다.In order to perform genetic analysis on fetal-derived genes, e.g., abnormal number of genes such as trisomy, gene sequences on chromosome 13 in addition to chromosome 21 described in Example 3-1 were added. The target gene sequence was used (see FIG. 4), and primer pairs and probes were designed based on this. The target gene sequence on chromosome 13, primer pairs and amplification probes for amplifying it are as follows.
(1) 표적 유전자 서열(13번 염색체): NCBI의 GenBank Accession No. NC_018924.2 (서열번호 41)(1) Target gene sequence (chromosome 13): GenBank Accession No. of NCBI NC_018924.2 (SEQ ID NO: 41)
상기 서열번호 41의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 41 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 13_1_2_62F: 5'-CAAAGGCAACGCGTCTTTC-3' (서열번호 42)Forward primer 13_1_2_62F: 5'-CAAAGGCAACGCGTCTTTC-3 '(SEQ ID NO: 42)
역방향 프라이머 13_1_2_62R: 5'-GGCAGAGTGGATGTTTTTGCA-3' (서열번호 43)Reverse primer 13_1_2_62R: 5'-GGCAGAGTGGATGTTTTTGCA-3 '(SEQ ID NO: 43)
검출 프로브 13_1_2_62P: 5'-AGCCAGGCAGTCTGTA-3' (서열번호 44)Detection probe 13_1_2_62P: 5'-AGCCAGGCAGTCTGTA-3 '(SEQ ID NO: 44)
(2) 표적 유전자 서열(13번 염색체): NCBI의 GenBank Accession No. NC_018924.2 (서열번호 45)(2) Target gene sequence (chromosome 13): GenBank Accession No. of NCBI NC_018924.2 (SEQ ID NO 45)
상기 서열번호 45의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 45 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 13_2_1_69F: 5'-TTCTACCAGAAAGGAATGAAGAACAG-3' (서열번호 46)Forward primer 13_2_1_69F: 5'-TTCTACCAGAAAGGAATGAAGAACAG-3 '(SEQ ID NO: 46)
역방향 프라이머 13_2_1_69R: 5'-CCATTTGATATTTGTCTGCATTGTG-3' (서열번호 47)Reverse primer 13_2_1_69R: 5'-CCATTTGATATTTGTCTGCATTGTG-3 '(SEQ ID NO: 47)
검출 프로브 13_2_1_69P: 5'-ACCTTCAGGAATTGAG-3' (서열번호 48)Detection probe 13_2_1_69P: 5'-ACCTTCAGGAATTGAG-3 '(SEQ ID NO: 48)
(3) 표적 유전자 서열(13번 염색체): NCBI의 GenBank Accession No. NC_018924.2 (서열번호 49)(3) target gene sequence (chromosome 13): GenBank Accession No. of NCBI NC_018924.2 (SEQ ID NO: 49)
상기 서열번호 49의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 49 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 13_3_1_62F: 5'-TGTCCTGCTCGCGAGTGA-3' (서열번호 50)Forward primer 13_3_1_62F: 5'-TGTCCTGCTCGCGAGTGA-3 '(SEQ ID NO: 50)
역방향 프라이머 13_3_1_62R: 5'-TCGTCTAGCTCCTTCAGGATCTCT-3' (서열번호 51)Reverse primer 13_3_1_62R: 5'-TCGTCTAGCTCCTTCAGGATCTCT-3 '(SEQ ID NO: 51)
검출 프로브 13_3_1_62P: 5'-CTGTCCTTCTTGCCCC-3' (서열번호 52)Detection probe 13_3_1_62P: 5'-CTGTCCTTCTTGCCCC-3 '(SEQ ID NO: 52)
(4) 표적 유전자 서열(13번 염색체): NCBI의 GenBank Accession No. NC_018924.2 (서열번호 53)(4) target gene sequence (chromosome 13): GenBank Accession No. of NCBI NC_018924.2 (SEQ ID NO: 53)
상기 서열번호 53의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 53 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 13_4_2_69F: 5'-GCAGAAAATGAATGATAGCATGGA-3' (서열번호 54)Forward primer 13_4_2_69F: 5'-GCAGAAAATGAATGATAGCATGGA-3 '(SEQ ID NO: 54)
역방향 프라이머 13_4_2_69R: 5'-CCACCAAGGTCCTGAGATCCT-3' (서열번호 55)Reverse primer 13_4_2_69R: 5'-CCACCAAGGTCCTGAGATCCT-3 '(SEQ ID NO: 55)
검출 프로브 13_4_2_69P: 5'-ACCTCAAACAAGGAAGAG-3' (서열번호 56)Detection probe 13_4_2_69P: 5'-ACCTCAAACAAGGAAGAG-3 '(SEQ ID NO: 56)
한편, 본 실시예에서 예시한 13번 염색체 및 이와 관련된 표적 유전자들은 3염색체성(trisomy)과 같은 유전자 수 이상 여부 분석 대상이 되는 염색체 및 관련 표적 유전자들의 예시로서 이해되어야 하며, 디지털 PCR을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 본 발명의 방법은 다양한 개체 또는 시료와, 다양한 표적 유전자 및 염색체에 대한 유전자형 분석 내지는 유전자 수 이상 분석에 적용가능한 기반기술로서 이해되어야 할 것이다. Meanwhile, chromosome 13 and related target genes exemplified in the present embodiment should be understood as examples of chromosomes and related target genes to be analyzed for abnormality in the number of genes such as trisomy, using digital PCR. The method of the present invention for analyzing fetal genetic information from the blood or plasma of a pregnant woman should be understood as a foundation technology applicable to genotyping or gene count analysis for various individuals or samples, and various target genes and chromosomes.
전술한 바와 같은 표적 유전자들을 각각 증폭하기 위한 프라이머 쌍과, 이로부터 증폭된 증폭 산물을 검출하기 위한 프로브는 (주)바이오니아(대한민국 대전광역시 소재)에 의뢰하여 합성하였다.A primer pair for amplifying the target genes as described above, and a probe for detecting the amplified product amplified therefrom were synthesized by BIO Co., Ltd., Daejeon, Korea.
실시예 5-3: 18번 염색체의 유전자 수 이상 분석을 위한 표적 유전자의 선정과 프라이머 쌍 및 프로브의 설계 제작Example 5-3 Selection of Target Gene for Analysis of Gene Number Abnormality of Chromosome 18 and Design of Primer Pair and Probe
태아 유래 유전자에 대한 유전자 분석, 예를 들어 3염색체성(trisomy)과 같은 유전자 수 이상 여부 분석을 수행하기 위하여, 실시예 3-1에서 설명된 21번 염색체 외에 추가로 18번 염색체 상의 유전자 서열을 표적 유전자 서열로 하고(도 4 참조), 이를 토대로 프라이머 쌍과 프로브를 설계하였다. 18번 염색체 상의 표적 유전자 서열, 이를 증폭하기 위한 프라이머 쌍 및 검출 프로브는 다음과 같다.In order to perform genetic analysis on fetal-derived genes, e.g., abnormal number of genes such as trisomy, gene sequences on chromosome 18 in addition to chromosome 21 described in Example 3-1 were added. The target gene sequence was used (see FIG. 4), and primer pairs and probes were designed based on this. The target gene sequence on chromosome 18, a primer pair for amplifying it, and a detection probe are as follows.
(1) 표적 유전자 서열(18번 염색체): NCBI의 GenBank Accession No. NC_018929.2 (서열번호 57)(1) Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO 57)
상기 서열번호 57의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 57 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 18_1_2_57F: 5'-CTGCTGGGCCCCCTTT-3' (서열번호 58)Forward primer 18_1_2_57F: 5'-CTGCTGGGCCCCCTTT-3 '(SEQ ID NO: 58)
역방향 프라이머 18_1_2_57R: 5'-GGGTTACTTGGGCAGAATGTCA-3' (서열번호 59)Reverse primer 18_1_2_57R: 5'-GGGTTACTTGGGCAGAATGTCA-3 '(SEQ ID NO: 59)
검출 프로브 18_1_2_57P: 5'-TGCTTCATGTCCTCTTG-3' (서열번호 60)Detection probe 18_1_2_57P: 5'-TGCTTCATGTCCTCTTG-3 '(SEQ ID NO: 60)
(2) 표적 유전자 서열(18번 염색체): NCBI의 GenBank Accession No. NC_018929.2 (서열번호 61)(2) Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO: 61)
상기 서열번호 61의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 61 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 18_2_2_58F: 5'-GCCCCGTTCACGTCAGTTT-3' (서열번호 62)Forward primer 18_2_2_58F: 5'-GCCCCGTTCACGTCAGTTT-3 '(SEQ ID NO: 62)
역방향 프라이머 18_2_2_58R: 5'-TGGTACTGGCTTCGCTTTCTC-3' (서열번호 63)Reverse primer 18_2_2_58R: 5'-TGGTACTGGCTTCGCTTTCTC-3 '(SEQ ID NO: 63)
검출 프로브 18_2_2_58P: 5'-ACGTCTGCAACGGG-3' (서열번호 64)Detection probe 18_2_2_58P: 5'-ACGTCTGCAACGGG-3 '(SEQ ID NO: 64)
(3) 표적 유전자 서열(18번 염색체): NCBI의 GenBank Accession No. NC_018929.2 (서열번호 65)(3) Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO: 65)
상기 서열번호 65의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 65 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 18_3_2_62F: 5'-AGCTGGAAGTCGAGTGTGCTACT-3' (서열번호 66)Forward primer 18_3_2_62F: 5'-AGCTGGAAGTCGAGTGTGCTACT-3 '(SEQ ID NO: 66)
역방향 프라이머 18_3_2_62R: 5'-CTGCCGGAAGTTCAGTTTGTC-3' (서열번호 67)Reverse primer 18_3_2_62R: 5'-CTGCCGGAAGTTCAGTTTGTC-3 '(SEQ ID NO: 67)
검출 프로브 18_3_2_62P: 5'-AACTCAGGAGATTTGG-3' (서열번호 68)Detection probe 18_3_2_62P: 5'-AACTCAGGAGATTTGG-3 '(SEQ ID NO: 68)
(4) 표적 유전자 서열(18번 염색체): NCBI의 GenBank Accession No. NC_018929.2 (서열번호 69)(4) Target gene sequence (chromosome 18): GenBank Accession No. of NCBI NC_018929.2 (SEQ ID NO: 69)
상기 서열번호 69의 표적 유전자를 증폭하기 위한 프라이머 쌍과 증폭 산물의 신호를 검출하기 위한 프로브는 다음과 같다. 검출 프로브의 5'말단은 FAM으로 표지하였고 3'말단은 TAMRA로 표지하였다. 그러나, 본 발명은 이에 제한되는 것이 아니고 당업계에 알려진 다양한 형광물질 및 소광물질이 각각 5'말단 및 3'말단에 표지될 수 있음은 물론이다.A primer pair for amplifying the target gene of SEQ ID NO: 69 and a probe for detecting a signal of an amplification product are as follows. The 5 'end of the detection probe was labeled with FAM and the 3' end was labeled with TAMRA. However, the present invention is not limited thereto, and various fluorescent materials and quenchers known in the art may be labeled at the 5 'end and the 3' end, respectively.
정방향 프라이머 18_5_1_67F: 5'-CAGGTCGTACAATTATGGCAAAAT-3' (서열번호 70)Forward primer 18_5_1_67F: 5'-CAGGTCGTACAATTATGGCAAAAT-3 '(SEQ ID NO: 70)
역방향 프라이머 18_5_1_67R: 5'-AGGTCTGGGTTCTCGCTGAA-3' (서열번호 71)Reverse primer 18_5_1_67R: 5'-AGGTCTGGGTTCTCGCTGAA-3 '(SEQ ID NO: 71)
검출 프로브 18_5_1_67P: 5'-TGGCCTTATTTTGTTTTTAG-3' (서열번호 72)Detection probe 18_5_1_67P: 5'-TGGCCTTATTTTGTTTTTAG-3 '(SEQ ID NO: 72)
한편, 본 실시예에서 예시한 18번 염색체 및 이와 관련된 표적 유전자들은 3염색체성(trisomy)과 같은 유전자 수 이상 여부 분석 대상이 되는 염색체 및 관련 표적 유전자들의 예시로서 이해되어야 하며, 디지털 PCR을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 본 발명의 방법은 다양한 개체 또는 시료와, 다양한 표적 유전자 및 염색체에 대한 유전자형 분석 내지는 유전자 수 이상 분석에 적용가능한 기반기술로서 이해되어야 할 것이다. On the other hand, chromosome 18 and the related target genes exemplified in the present embodiment should be understood as an example of chromosomes and related target genes to be analyzed for abnormality in the number of genes such as trisomy, and using digital PCR The method of the present invention for analyzing fetal genetic information from the blood or plasma of a pregnant woman should be understood as a foundation technology applicable to genotyping or gene count analysis for various individuals or samples, and various target genes and chromosomes.
전술한 바와 같은 표적 유전자들을 각각 증폭하기 위한 프라이머 쌍과, 이로부터 증폭된 증폭 산물을 검출하기 위한 프로브는 (주)바이오니아(대한민국 대전광역시 소재)에 의뢰하여 합성하였다. A primer pair for amplifying the target genes as described above, and a probe for detecting the amplified product amplified therefrom were synthesized by BIO Co., Ltd., Daejeon, Korea.
실시예 6: 21번 염색체, 18번 염색체 및 13번 염색체의 3염색체성(trisomy) 분석을 위한 디지털 PCR 수행Example 6: Digital PCR for Trisomy Analysis of Chromosome 21, 18 and 13
실시예 6-1: 21번 염색체의 3염색체성(trisomy) 분석을 위한 디지털 PCR 수행Example 6-1: Digital PCR for Trisomy Analysis of Chromosome 21
실시예 5-1에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 M0 샘플, M6 샘플 및 M9 샘플과, 국내 종합병원에서 제공받은 유전적으로 이상이 없는 정상 남성의 게놈 DNA 샘플(male control sample)에 대해 실시예 4에 기술된 방법과 동일한 방법으로 디지털 PCR을 수행하였다. 웰 플레이트의 각 어레이 별 샘플 분배 방식, 디지털 PCR 증폭 조건, 디지털 PCR 증폭 장비, 그리고 각 웰 당 분주되는 프라이머 쌍과 이에 대응하는 검출 프로브 (21번 염색체 상의 3개의 표적 유전자, 2번 염색체 상의 1개의 콘트롤 유전자 및 1번 염색체 상의 1개의 콘트롤 유전자 각각에 대한 증폭용 프라이머 쌍 및 이에 대응하는 검출 프로브: 총 5세트)는 실시예 4와 동일하게 하였고, 디지털 PCR 증폭 조성은 아래의 표 19와 같이 하였다.Of the gDNA samples prepared in Example 5-1, M0, M6, and M9 samples identified as containing a certain amount of fetal-derived genes, and genomic DNA samples of normal males with no genetic abnormalities provided by a domestic general hospital (male Digital PCR was performed for the control sample in the same manner as described in Example 4. Sample distribution for each array of well plates, digital PCR amplification conditions, digital PCR amplification equipment, and primer pairs dispensed per well and corresponding detection probes (three target genes on chromosome 21, one on chromosome 2) Amplification primer pairs for each of the control gene and one control gene on chromosome 1 and corresponding detection probes (5 sets in total) were the same as in Example 4, and the digital PCR amplification composition was shown in Table 19 below. .
표 19 디지털 PCR 증폭 조성
PCR 증폭 조성 부피(㎕/웰)(384웰 기준)
DNA 주형을 갖는 샘플 1
프라이머(20 pM) 정방향 프라이머 0.25
역방향 프라이머 0.25
검출 프로브 (2.5 pM) 1
TaqMan®Digital PCR Master Mix 2.5
합계 5
Table 19 Digital PCR Amplification Composition
PCR amplification composition Volume (μl / well) (based on 384 wells)
Sample with DNA Template One
Primer (20 pM) Forward primer 0.25
Reverse primer 0.25
Detection probe (2.5 pM) One
TaqMan ® Digital PCR Master Mix 2.5
Sum 5
실시예 4에서 기술된 바와 같은 소트트웨어들을 실행하였고, 실시예 4와 동일한 방식으로 디지털 PCR 레이아웃의 각 웰에서 측정된 형광값을 분석하여 각 샘플 별로 21번 염색체의 각 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 카피수 및 각 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 카피수를 정량하였다. 즉, 검사 대상이 되는 각 샘플 별로, 각각의 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 디지털 PCR 증폭산물을 정량하였고, 정량화된 값 각각을 각각의 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 디지털 PCR 정량값에 대해 정상화한 값을 산출하였다. 이로부터 정상 남성 유전자에 대한 태아 유래 표적 유전자의 유전자 수 이상, 즉 21번 염색체의 3염색체성 여부를 확인하였다(표 20 참조). The software as described in Example 4 was run, and the fluorescence values measured in each well of the digital PCR layout were analyzed in the same manner as in Example 4, and each target gene (SEQ ID NO: 21, sequence number 21) for each sample was analyzed. The copy number of the gene of SEQ ID NO: 25 or SEQ ID NO: 29 and the copy number of each control gene (gene of SEQ ID NO: 33 or SEQ ID NO: 37) were quantified. That is, for each sample to be tested, the digital PCR amplification product of each target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) was quantified, and each of the quantified values was calculated for each control gene (SEQ ID NO: Normalized values were calculated for the digital PCR quantitative value of 33 or the gene of SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, the trisomy of chromosome 21 was confirmed (see Table 20).
표 20
서열번호 37의 콘트롤 유전자(1번 염색체)에 대한 정상화 값 샘플번호 서열번호 33의 콘트롤 유전자(2번 염색체)에 대한 정상화 값
1.360 1.117677348 M0 0.736625849 1.206
1.086434891 1.516032336
1.874456107 1.364799482
2.996 2.922318152 M6 2.003473315 2.111
3.323963935 2.278825941
2.742352911 2.050155311
1.632 1.440920821 M9 0.896090445 1.015
1.85241346 1.151989294
1.603982108 0.997501391
Table 20
Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2)
1.360 1.117677348 M0 0.736625849 1.206
1.086434891 1.516032336
1.874456107 1.364799482
2.996 2.922318152 M6 2.003473315 2.111
3.323963935 2.278825941
2.742352911 2.050155311
1.632 1.440920821 M9 0.896090445 1.015
1.85241346 1.151989294
1.603982108 0.997501391
상기 결과를 분석하면, 정상 남성 샘플(Human Male Control)의 경우에는 콘트롤 유전자 (1번 염색체 상의 유전자, 2번 염색체 상의 유전자)에 대한 정상화 값이 1에 근접하여 표적 유전자(21번 염색체 상의 유전자)의 유전자 수의 변이가 없는 것을 확인할 수 있었다. M6 샘플의 경우에는 서열번호 37의 콘트롤 유전자(1번 염색체 상의 유전자) 및 서열번호 33의 콘트롤 유전자(2번 염색체 상의 유전자)에 대한 정상화 값이 각각 2.996 및 2.111로서 산출되어 표적 유전자(21번 염색체 상의 유전자)의 유전자 수 변이가 있는 것이 확인되었다. 이는 태아에 있어 유전자 수 이상이 없는 것으로 알려진 1번 염색체의 유전자 수와 2번 염색체의 유전자 수에 대해 21번 염색체 유전자 수가 대략 1.5배 이상 많은 것을 의미하고, 이로부터 염색체 수 이상이 존재한다는 것을 알 수 있다. 따라서, 21번 염색체가 3배체 (정상은 2배체)인 3염색체성(trisomy)을 태아가 갖는 것으로 추정할 수 있고, M6 샘플을 제공한 임부의 태아의 다운증후군 발생 위험도는 높다고 예진할 수 있다. Analyzing the results, the normal male sample (Human Male Control), the normalization value for the control gene (gene on chromosome 1, gene on chromosome 2) closer to 1 target gene (gene on chromosome 21) It was confirmed that there is no variation in the number of genes. For the M6 sample, the normalization values for the control gene of SEQ ID NO: 37 (gene on chromosome 1) and the control gene of SEQ ID NO: 33 (gene on chromosome 2) were calculated as 2.996 and 2.111, respectively, resulting in the target gene (chromosome 21). Gene mutations in the gene). This means that the number of chromosome 21 genes is about 1.5 times more than the number of genes of chromosome 1 and the number of chromosome 2 which are known to have no genes in the fetus. Can be. Thus, it can be assumed that the fetus has a trisomy in which the chromosome 21 is a triploid (normally a diploid), and the risk of developing Down syndrome in a fetus of a pregnant woman who provided an M6 sample is high. .
또한, M0 샘플 및 M9 샘플의 경우에는 유전자 수 이상이 없는 것으로 알려진 1번 염색체의 유전자 수와 2번 염색체의 유전자 수에 대해 21번 염색체 유전자 수가 1.5배 미만이라고 유추할 수 있다. M0 샘플 및 M9 샘플에 대해 21번 염색체 기준으로 분석을 하면 태아의 21번 염색체가 정상인 2배체인 것을 추정할 수 있다. 따라서, M0 샘플 및 M9 샘플을 제공한 임부의 태아의 다운증후군 발생 위험도는 낮다고 예진할 수 있다.In addition, in the case of the M0 sample and the M9 sample, it can be inferred that the number of chromosome 21 is less than 1.5 times the number of genes of chromosome 1 and the number of genes of chromosome 2, which are known to have no gene number or more. Analysis of the M0 sample and the M9 sample on the basis of chromosome 21 can estimate that the chromosome 21 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing Down syndrome in the fetus of pregnant women who provided the M0 sample and the M9 sample was low.
한편, 상기 샘플들에 대한 디지털 PCR 정량 결과 및 그 해석은 각 샘플의 제공자 측으로부터 확인한 21번 염색체 이상 여부와 관련한 임상 결과와 일치하였다.On the other hand, digital PCR quantitative results and interpretations of the samples were consistent with the clinical results related to the presence or absence of chromosome 21 confirmed from the provider side of each sample.
실시예 6-2: 13번 염색체의 3염색체성(trisomy) 분석을 위한 디지털 PCR 수행Example 6-2: Digital PCR for Trisomy Analysis of Chromosome 13
실시예 5-1에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 M6 샘플 및 M9 샘플과, 국내 종합병원에서 제공받은 유전적으로 이상이 없는 정상 남성의 게놈 DNA 샘플(male control sample)에 대해 실시예 6-1에 기술된 방법과 동일한 방법으로 디지털 PCR을 수행하였다. 웰 플레이트의 각 어레이 별 샘플 분배 방식, 디지털 PCR 증폭 조성, 디지털 PCR 증폭 조건 및 디지털 PCR 증폭 장비는 실시예 6-1과 동일하게 하였다. 각 웰 당 분주되는 프라이머 쌍과 이에 대응하는 검출 프로브로는 13번 염색체 상의 4개의 표적 유전자, 2번 염색체 상의 1개의 콘트롤 유전자 및 1번 염색체 상의 1개의 콘트롤 유전자 각각에 대한 증폭용 프라이머 쌍 및 이에 대응하는 검출 프로브(총 6세트)를 사용하였다. M6 and M9 samples confirmed to contain a predetermined amount of fetal genes among the gDNA samples prepared in Example 5-1, and a normal male genomic DNA sample (male control sample) provided by a domestic general hospital Digital PCR was performed by the same method as described in Example 6-1. The sample distribution method, digital PCR amplification composition, digital PCR amplification conditions, and digital PCR amplification equipment for each array of well plates were the same as in Example 6-1. Primer pairs dispensed per well and the corresponding detection probes include primer pairs for amplification for each of four target genes on chromosome 13, one control gene on chromosome 2 and one control gene on chromosome 1, and Corresponding detection probes (6 sets in total) were used.
또한, 실시예 6-1과 동일한 방식으로 검사 대상이 되는 각 샘플 별로, 각각의 표적 유전자(서열번호 41, 서열번호 45, 서열번호 49 또는 서열번호 53의 유전자)의 디지털 PCR 증폭산물을 정량하였고, 정량화된 값 각각을 각각의 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 디지털 PCR 정량값에 대해 정상화한 값을 산출하였다. 이로부터 정상 남성 유전자에 대한 태아 유래 표적 유전자의 유전자 수 이상, 즉 13번 염색체의 3염색체성 여부를 확인하였다(표 21 참조).In addition, the digital PCR amplification product of each target gene (SEQ ID NO: 41, SEQ ID NO: 45, SEQ ID NO: 49 or SEQ ID NO: 53) was quantified for each sample to be tested in the same manner as in Example 6-1. , And each of the quantified values was normalized to the digital PCR quantitative value of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, whether the chromosome 13 was trisomy was confirmed (see Table 21).
표 21
서열번호 37의 콘트롤 유전자(1번 염색체)에 대한 정상화 값 샘플번호 서열번호 33의 콘트롤 유전자(2번 염색체)에 대한 정상화 값
1.3894 1.8988 M6 1.9130 1.4016
1.0001 1.0095
1.2542 1.2660
1.4046 1.4178
0.9782 3.6907 M9 3.7847 1.0033
0.0604 0.0621
0.0891 0.0916
0.0728 0.0748
Table 21
Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2)
1.3894 1.8988 M6 1.9130 1.4016
1.0001 1.0095
1.2542 1.2660
1.4046 1.4178
0.9782 3.6907 M9 3.7847 1.0033
0.0604 0.0621
0.0891 0.0916
0.0728 0.0748
상기 결과를 분석하면, M6 샘플 및 M9 샘플의 경우에는 유전자 수 이상이 없는 것으로 알려진 1번 염색체의 유전자 수와 2번 염색체의 유전자 수에 대해 13번 염색체 유전자 수가 1.5배 미만이라고 유추할 수 있다. M6 샘플 및 M9 샘플에 대해 13번 염색체 기준으로 분석을 하면 태아의 13번 염색체가 정상인 2배체인 것을 추정할 수 있다. 따라서, M6 샘플 및 M9 샘플을 제공한 임부의 태아의 13번 삼염색체증 발생 위험도는 낮다고 예진할 수 있다.Analyzing the results, it can be inferred that the number of chromosome 13 is less than 1.5 times the number of genes of chromosome 1 and the number of genes of chromosome 2, which are known to have no genes or more in M6 and M9 samples. Analysis of the M6 sample and the M9 sample on the basis of chromosome 13 indicates that the chromosome 13 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing trisomy 13 of the fetus of the pregnant women who provided the M6 sample and the M9 sample was low.
한편, 상기 샘플들에 대한 디지털 PCR 정량 결과 및 그 해석은 각 샘플의 제공자 측으로부터 확인한 13번 염색체 이상 여부와 관련한 임상 결과와 일치하였다.On the other hand, the digital PCR quantitative results and interpretations of the samples were consistent with the clinical results related to chromosome abnormality 13 confirmed from the provider side of each sample.
실시예 6-3: 18번 염색체의 3염색체성(trisomy) 분석을 위한 디지털 PCR 수행Example 6-3 Digital PCR for Trisomy Analysis of Chromosome 18
실시예 5-1에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 M0, M6 샘플 및 M9 샘플과, 국내 종합병원에서 제공받은 유전적으로 이상이 없는 정상 남성의 게놈 DNA 샘플(male control sample)에 대해 실시예 6-1에 기술된 방법과 동일한 방법으로 디지털 PCR을 수행하였다. 웰 플레이트의 각 어레이 당 샘플 분배 방식, 디지털 PCR 증폭 조성, 디지털 PCR 증폭 조건 및 디지털 PCR 증폭 장비는 실시예 6-1과 동일하게 하였다. 각 웰 당 분주되는 프라이머 쌍과 이에 대응하는 검출 프로브로는 18번 염색체 상의 4개의 표적 유전자, 2번 염색체 상의 1개의 콘트롤 유전자 및 1번 염색체 상의 1개의 콘트롤 유전자 각각에 대한 증폭용 프라이머 쌍 및 이에 대응하는 검출 프로브(총 6세트)를 사용하였다.Among the gDNA samples prepared in Example 5-1, M0, M6 and M9 samples, which were identified as containing a certain amount of fetal-derived genes, and genomic DNA samples of normal males with no genetic abnormalities provided by a Korean general hospital (male control) digital PCR was performed by the same method as described in Example 6-1. The sample distribution method, digital PCR amplification composition, digital PCR amplification conditions, and digital PCR amplification equipment for each array of well plates were the same as in Example 6-1. Primer pairs dispensed per well and corresponding detection probes include a pair of primers for amplification for each of four target genes on chromosome 18, one control gene on chromosome 2 and one control gene on chromosome 1, and Corresponding detection probes (6 sets in total) were used.
또한, 실시예 6-1과 동일한 방식으로 검사 대상이 되는 각 샘플 별로, 각각의 표적 유전자(서열번호 57, 서열번호 61, 서열번호 65 또는 서열번호 69의 유전자)의 디지털 PCR 증폭산물을 정량하였고, 정량화된 값 각각을 각각의 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 디지털 PCR 정량값에 대해 정상화한 값을 산출하였다. 이로부터 정상 남성 유전자에 대한 태아 유래 표적 유전자의 유전자 수 이상, 즉 18번 염색체의 3염색체성 여부를 확인하였다(표 22 참조).In addition, the digital PCR amplification product of each target gene (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69) was quantified for each sample to be tested in the same manner as in Example 6-1. , And each of the quantified values was normalized to the digital PCR quantitative value of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, the trisomy of chromosome 18, was confirmed (see Table 22).
표 22
서열번호 37의 콘트롤 유전자(1번 염색체)에 대한 정상화 값 샘플번호 서열번호 33의 콘트롤 유전자(2번 염색체)에 대한 정상화 값
1.2205 1.5103 M0 1.4506 1.1380
1.2971 1.2459
1.0208 0.9805
1.0539 0.8752
1.1626 1.2608 M6 0.8312 0.7285
0.9659 0.6367
0.7232 0.4768
1.7006 0.9693
0.5499 0.5114 M9 1.0204 1.0563
0.6370 1.2710
0.4447 0.8874
0.6066 1.0465
Table 22
Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1) Sample number Normalization value for the control gene of SEQ ID NO: 33 (chromosome 2)
1.2205 1.5103 M0 1.4506 1.1380
1.2971 1.2459
1.0208 0.9805
1.0539 0.8752
1.1626 1.2608 M6 0.8312 0.7285
0.9659 0.6367
0.7232 0.4768
1.7006 0.9693
0.5499 0.5114 M9 1.0204 1.0563
0.6370 1.2710
0.4447 0.8874
0.6066 1.0465
상기 결과를 분석하면, M0 샘플, M6 샘플 및 M9 샘플의 경우에는 유전자 수 이상이 없는 것으로 알려진 1번 염색체의 유전자 수와 2번 염색체의 유전자 수에 대해 13번 염색체 유전자 수가 1.5배 미만이라고 유추할 수 있다. M0 샘플, M6 샘플 및 M9 샘플에 대해 13번 염색체 기준으로 분석을 하면 태아의 13번 염색체가 정상인 2배체인 것을 추정할 수 있다. 따라서, M0 샘플, M6 샘플 및 M9 샘플을 제공한 임부의 태아의 18번 삼염색체증 발생 위험도는 낮다고 예진할 수 있다.Analyzing the results, it can be inferred that the number of chromosome 13 is less than 1.5 times the number of genes of chromosome 1 and the number of chromosome 2 that are known to have no genes in the M0, M6 and M9 samples. Can be. Analysis of the M0 sample, the M6 sample, and the M9 sample on the basis of chromosome 13 indicates that the chromosome 13 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing trisomy 18 in the fetus of pregnant women who provided the M0 sample, the M6 sample and the M9 sample is low.
한편, 상기 샘플들에 대한 디지털 PCR 정량 결과 및 그 해석은 각 샘플의 제공자 측으로부터 확인한 18번 염색체 이상 여부와 관련한 임상 결과와 일치하였다.On the other hand, the digital PCR quantitative results and interpretations of the samples were consistent with the clinical results related to chromosomal aberration 18 confirmed from the provider side of each sample.
실시예 7: 표적 유전자 검출 프로브들의 교차 반응 여부 확인Example 7: Confirmation of Cross Reaction of Target Gene Detection Probes
본 실시예에서는 검사 대상이 되는 어느 한 샘플이 갖는 어느 하나의 삼염색체증을 검출하기 위한 프로브들이 다른 검사 대상 샘플이 갖는 다른 삼염색체증에 대해 위양성의 신호를 나타내는지 여부를 확인하였다. In this example, it was confirmed whether the probes for detecting any one trisomy in one sample to be tested showed a false positive signal for the other trisomy in another sample.
예를 들어, 21번 삼염색체증을 갖는 어느 한 샘플 내의 21번 염색체의 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 증폭산물에 특이적으로 결합하여 3염색체성을 검출하는데 사용되는 검출 프로브(서열번호 24, 서열번호 28 또는 서열번호 32의 프로브)는 18번 삼염색체증을 갖는 다른 한 샘플 내의 18번 염색체의 표적 유전자(서열번호 57, 서열번호 61, 서열번호 65 또는 서열번호 69의 유전자)의 증폭산물에 대한 반응성이 존재하지 않아야만 정확한 삼염색체증 예진이 가능하다. 반대로, 18번 삼염색체증을 갖는 어느 한 샘플 내의 18번 염색체의 표적 유전자(서열번호 57, 서열번호 61, 서열번호 65 또는 서열번호 69의 유전자)의 증폭산물에 특이적으로 결합하여 3염색체성을 검출하는데 사용되는 검출 프로브(서열번호 60, 서열번호 64, 서열번호 68 또는 서열번호 72의 프로브)는 21번 삼염색체증을 갖는 다른 한 샘플 내의 21번 염색체의 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 증폭산물에 대한 반응성이 존재하지 않아야만 정확한 삼염색체증 예진이 가능하다. For example, trisomy is detected by specifically binding to an amplification product of a target gene of chromosome 21 (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) in a sample having trisomy 21. The detection probe (SEQ ID NO: 24, SEQ ID NO: 28, or SEQ ID NO: 32) used for the detection of the target gene of chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65) in another sample with trisomy 18 Or the presence of no reactivity to the amplification product of the gene of SEQ ID NO: 69 is possible to accurately predict trisomy. Conversely, trisomy by binding specifically to the amplification product of the target gene (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69) of chromosome 18 in any sample with trisomy 18 The detection probe (SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68 or SEQ ID NO: 72 probe) used to detect the target gene of chromosome 21 (SEQ ID NO: 21, SEQ ID NO: 21, SEQ ID NO: 21) in another sample with trisomy 21 Accurate trisomy prophylaxis is only possible if there is no reactivity to the amplification products of genes of SEQ ID NO: 25 or SEQ ID NO: 29.
이러한 검출 프로브들의 교차 반응 여부를 확인하기 위해, 실시예 5-1에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 샘플로서, 21번 삼염색체증(trisomy)을 갖는 S8 샘플과 18번 삼염색체증을 갖는 S8_1 샘플과, 국내 종합병원에서 제공받은 유전적으로 이상이 없는 정상 남성의 게놈 DNA 샘플(male control sample)에 대해 실시예 6-1에 기술된 방법과 동일한 방법으로 디지털 PCR을 수행하였다. 단, 본 실시예에서는 디지털 PCR 장비에서 웰 플레이트 2개를 동시에 사용하여 실험을 수행하였다. 즉, 각 어레이 별로 샘플들이 분배된 제1 웰 플레이트에 대해서는 21번 염색체 상의 3개의 표적 유전자, 2번 염색체 상의 1개의 콘트롤 유전자 및 1번 염색체 상의 1개의 콘트롤 유전자 각각에 대한 증폭용 프라이머 쌍 및 이에 대응하는 검출 프로브(총 5세트)를 분주하여 반응시켰고, 제2 웰 플레이트에 대해서는 18번 염색체 상의 4개의 표적 유전자, 2번 염색체 상의 1개의 콘트롤 유전자 및 1번 염색체 상의 1개의 콘트롤 유전자 각각에 대한 증폭용 프라이머 쌍 및 이에 대응하는 검출 프로브(총 6세트)를 분주하여 반응시켰다. 그리고 나서, 실시예 6-1과 동일한 방식으로 제1 웰 플레이트에 분배된 각 샘플 별로 21번 염색체 상의 3개의 표적 유전자의 디지털 PCR 증폭산물을 정량하였고, 제2 웰 플레이트에 분배된 각 샘플 별로 18번 염색체 상의 4개의 표적 유전자의 디지털 PCR 증폭산물을 정량하였다. 각각의 표적 유전자 정량값을 각각의 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 디지털 PCR 정량값에 대해 정상화한 값을 산출하였다(표 23 참조). In order to confirm the cross-reaction of the detection probes, a sample containing a certain amount of a fetal gene derived from the gDNA samples prepared in Example 5-1 was identified, including an S8 sample having trisomy 21 and 18 Digital PCR was performed in the same manner as described in Example 6-1 on the S8_1 sample having the triple trisomy and the normal male genome DNA sample of the normal male, which was provided by a Korean general hospital. Was performed. However, in this example, the experiment was performed using two well plates at the same time in a digital PCR equipment. That is, for the first well plate in which samples are distributed for each array, primer pairs for amplification for each of three target genes on chromosome 21, one control gene on chromosome 2, and one control gene on chromosome 1, and Corresponding detection probes (total 5 sets) were aliquoted and reacted, and for the second well plate, four target genes on chromosome 18, one control gene on chromosome 2 and one control gene on chromosome 1, respectively Amplification primer pairs and corresponding detection probes (6 sets in total) were aliquoted and reacted. Then, in the same manner as in Example 6-1, the digital PCR amplification products of three target genes on chromosome 21 were quantified for each sample distributed in the first well plate, and 18 for each sample distributed in the second well plate. Digital PCR amplification products of four target genes on chromosome were quantified. Each target gene quantitative value was normalized to the digital PCR quantitative value of each control gene (gene of SEQ ID NO: 33 or SEQ ID NO: 37) (see Table 23).
표 23
샘플번호 검출 프로브 서열번호 33의 콘트롤 유전자 (2번 염색체)에 대한 정상화 값 서열번호 37의 콘트롤 유전자 (1번 염색체)에 대한 정상화 값
S8(21번 삼염색체성) 21-01_73 P(서열번호 24) 1.9705 2.1385 3.1077 3.3728
21-03_73 P(서열번호 28) 2.2469 3.5437
21-05_58 P(서열번호 32) 2.1982 3.4669
18_1_2_57P(서열번호 60) 1.0238 0.9401 1.6147 1.4827
18_2_2_58P(서열번호 64) 1.0148 1.6005
18_3_2_62P(서열번호 68) 1.0423 1.6439
18_5_1_67P(서열번호 72) 0.6795 1.0716
S8_1(18번 삼염색체성) 21-01_73 P(서열번호 24) 1.2800 1.2902 1.1388 1.1479
21-03_73 P(서열번호 28) 1.3055 1.1616
21-05_58 P(서열번호 32) 1.2850 1.1434
18_1_2_57P(서열번호 60) 4.0088 3.0080 3.5668 2.6764
18_2_2_58P(서열번호 64) 3.7724 3.3565
18_3_2_62P(서열번호 68) 2.1104 1.8777
18_5_1_67P(서열번호 72) 2.1406 1.9046
Table 23
Sample number Detection probe Normalized value for the control gene of SEQ ID NO: 33 (chromosome 2) Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1)
S8 (trisomy 21) 21-01_73 P (SEQ ID NO: 24) 1.9705 2.1385 3.1077 3.3728
21-03_73 P (SEQ ID NO: 28) 2.2469 3.5437
21-05_58 P (SEQ ID NO: 32) 2.1982 3.4669
18_1_2_57P (SEQ ID NO: 60) 1.0238 0.9401 1.6147 1.4827
18_2_2_58P (SEQ ID NO: 64) 1.0148 1.6005
18_3_2_62P (SEQ ID NO: 68) 1.0423 1.6439
18_5_1_67P (SEQ ID NO: 72) 0.6795 1.0716
S8_1 (trisomy 18) 21-01_73 P (SEQ ID NO: 24) 1.2800 1.2902 1.1388 1.1479
21-03_73 P (SEQ ID NO: 28) 1.3055 1.1616
21-05_58 P (SEQ ID NO: 32) 1.2850 1.1434
18_1_2_57P (SEQ ID NO: 60) 4.0088 3.0080 3.5668 2.6764
18_2_2_58P (SEQ ID NO: 64) 3.7724 3.3565
18_3_2_62P (SEQ ID NO: 68) 2.1104 1.8777
18_5_1_67P (SEQ ID NO: 72) 2.1406 1.9046
S8 시료의 경우에는 21번 염색체의 표적 유전자들(서열번호 21, 서열번호 25 및 서열번호 29의 유전자)의 증폭산물을 검출하는 프로브들(서열번호 24, 서열번호 28 및 서열번호 32의 프로브)을 사용하여 수행된 디지털 PCR의 정량값을 서열번호 33의 콘트롤 유전자(2번 염색체 상의 유전자) 및 서열번호 37의 콘트롤 유전자(1번 염색체 상의 유전자)에 대해 정상화한 값이 각각 2.1385 및 3.3728로서 산출되어 표적 유전자(21번 염색체 상의 유전자)의 유전자 수 변이가 있는 것이 확인되었다. 반면에, 18번 염색체의 표적 유전자들(서열번호 57, 서열번호 61, 서열번호 65 또는 서열번호 69의 유전자)의 증폭산물을 검출하는 프로브들(서열번호 60, 서열번호 64, 서열번호 68 또는 서열번호 72의 프로브)을 사용하여 수행된 디지털 PCR의 정량값을 서열번호 33의 콘트롤 유전자(2번 염색체 상의 유전자) 및 서열번호 37의 콘트롤 유전자(1번 염색체 상의 유전자)에 대해 정상화한 값은 각각 0.9401 및 1.4827로서 산출되어 표적 유전자(18번 염색체 상의 유전자)의 유전자 수 변이가 없는 것이 확인되었다. 따라서, S8 샘플의 경우, 21번 염색체는 3염색체성의 다운증후군 발생 위험도가 높다고 예진할 수 있고, 18번 염색체는 정상으로 판단할 수 있어, S8 샘플의 제공자 측으로부터 확인한 21번 염색체 및 18번 염색 염색체 이상 여부에 대한 임상 결과와 일치하였다. For S8 samples, probes for detecting amplification products of target genes of chromosome 21 (genes of SEQ ID NO: 21, SEQ ID NO: 25 and SEQ ID NO: 29) (probes of SEQ ID NO: 24, SEQ ID NO: 28 and SEQ ID NO: 32) The normalized values of the digital PCR performed using the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1) are calculated as 2.1385 and 3.3728, respectively. It was confirmed that there was a variation in the number of genes of the target gene (gene on chromosome 21). On the other hand, probes (SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68 or 6) that detect amplification products of target genes of the chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69) The quantitative value of the digital PCR performed using the probe of SEQ ID NO: 72 was normalized to the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1). Calculated as 0.9401 and 1.4827, respectively, it was confirmed that there was no gene number variation of the target gene (gene on chromosome 18) . Therefore, in case of S8 sample, chromosome 21 can be predicted to have high risk of trisomy down syndrome, and chromosome 18 can be judged to be normal, so that chromosome 21 and 18 confirmed from the provider of S8 sample It was consistent with clinical results on chromosomal abnormalities.
또한, S8_1 시료의 경우에는 18번 염색체의 표적 유전자들(서열번호 57, 서열번호 61, 서열번호 65 또는 서열번호 69의 유전자)의 증폭산물을 검출하는 프로브들(서열번호 60, 서열번호 64, 서열번호 68 또는 서열번호 72의 프로브)을 사용하여 수행된 디지털 PCR의 정량값을 서열번호 33의 콘트롤 유전자(2번 염색체 상의 유전자) 및 서열번호 37의 콘트롤 유전자(1번 염색체 상의 유전자)에 대해 정상화한 값은 각각 3.0080 및 2.6764로서 산출되어 표적 유전자(18번 염색체 상의 유전자)의 유전자 수 변이가 있는 것이 확인되었다. 반면에, 21번 염색체의 표적 유전자들(서열번호 21, 서열번호 25 및 서열번호 29의 유전자)의 증폭산물을 검출하는 프로브들(서열번호 24, 서열번호 28 및 서열번호 32의 프로브)을 사용하여 수행된 디지털 PCR의 정량값을 서열번호 33의 콘트롤 유전자(2번 염색체 상의 유전자) 및 서열번호 37의 콘트롤 유전자(1번 염색체 상의 유전자)에 대해 정상화한 값은 1.2902 및 1.1479로서 산출되어 표적 유전자(21번 염색체 상의 유전자)의 유전자 수 변이가 없는 것이 확인되었다. 따라서, S8_1 샘플의 경우, 18번 염색체에 대해서는 삼염색체증의 발생 위험도가 높다고 예진할 수 있고, 21번 염색체는 정상으로 판단할 수 있어, S8_1 샘플의 제공자 측으로부터 확인한 21번 염색체 및 18번 염색 염색체 이상 여부에 대한 임상 결과와 일치하였다. In addition, in the case of the S8_1 sample, probes for detecting amplification products of target genes of the chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69) (SEQ ID NO: 60, SEQ ID NO: 64, Quantitative values of digital PCR performed using SEQ ID NO: 68 or probe of SEQ ID NO: 72 for the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1) Normalized values were calculated as 3.0080 and 2.6764, respectively, confirming that there were gene number variations of the target gene (gene on chromosome 18). On the other hand, using probes (probe of SEQ ID NO: 24, SEQ ID NO: 28 and SEQ ID NO: 32) to detect amplification products of target genes of the chromosome 21 (genes of SEQ ID NO: 21, SEQ ID NO: 25 and SEQ ID NO: 29) The normalized values of the quantitative value of the digital PCR performed on the control gene of SEQ ID NO: 33 (gene on chromosome 2) and the control gene of SEQ ID NO: 37 (gene on chromosome 1) were calculated as 1.2902 and 1.1479, resulting in the target gene. It was confirmed that there is no gene number variation of (gene on chromosome 21) . Therefore, in the case of the S8_1 sample, the chromosome 18 can be predicted to have a high risk of trisomy, and the chromosome 21 can be judged normal, so that the chromosome 21 and the 18 staining confirmed from the provider of the S8_1 sample It was consistent with clinical results on chromosomal abnormalities.
즉, 전술한 바와 같은 교차 반응 결과, 21번 염색체의 3염색체성 판별을 위한 표적 유전자의 증폭산물에 특이적으로 결합하는 검출 프로브(서열번호 24, 서열번호 28 또는 서열번호 32의 프로브)는 3염색체성을 갖는 18번 염색체의 표적 유전자(서열번호 57, 서열번호 61, 서열번호 65 또는 서열번호 69의 유전자)의 증폭산물에 대한 반응성이 존재하지 않아 위양성의 신호를 나타내지 않는 것이 확인되었다. 또한, 18번 염색체의 3염색체성 판별을 위한 표적 유전자의 증폭산물에 특이적으로 결합하는 검출 프로브(서열번호 60, 서열번호 64, 서열번호 68 또는 서열번호 72의 프로브)는 3염색체성을 갖는 21번 염색체의 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 증폭산물에 대한 반응성이 존재하지 않아 위양성의 신호를 나타내지 않는 것이 확인되었다. That is, as a result of the cross-reaction as described above, the detection probe (SEQ ID NO: 24, SEQ ID NO: 28 or SEQ ID NO: 32 probe) that specifically binds to the amplification product of the target gene for trichromosome determination of chromosome 21 is 3 It was confirmed that there was no reactivity with the amplification product of the target gene of the chromosome 18 chromosome 18 (SEQ ID NO: 57, SEQ ID NO: 61, SEQ ID NO: 65 or SEQ ID NO: 69), so that it did not show a false positive signal. In addition, a detection probe (SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 68 or SEQ ID NO: 72) that specifically binds to an amplification product of a target gene for trisomy determination of chromosome 18 has a trisomy It was confirmed that there was no reactivity with the amplification product of the target gene of the chromosome 21 (the gene of SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29), and it did not show a signal of false positive.
실시예 8: 복수의 표적 유전자들에 대해 특이적인 검출 프로브들의 혼합물을 사용한 디지털 PCR 정량Example 8: Digital PCR Quantitation Using a Mixture of Detection Probes Specific for Multiple Target Genes
실시예 8-1: 각각의 검출 프로브를 각각의 웰에 분주한 후 디지털 PCR 정량Example 8-1: Digital PCR Quantitation After Dispensing Each Detection Probe into Each Well
우선, 실시예 5-1에서 준비된 gDNA 샘플들 중 태아 유래 유전자가 일정량 함유된 것으로 확인된 S2 샘플, S4 샘플, S5 샘플 및 S6 샘플과, 국내 종합병원에서 제공받은 유전적으로 이상이 없는 정상 남성의 게놈 DNA 샘플(male control sample)에 대해 실시예 6-1에 기술된 방법과 동일한 방법으로 디지털 PCR을 수행하였다. 웰 플레이트의 각 어레이 별 샘플 분배 방식, 디지털 PCR 증폭 조성, 디지털 PCR 증폭 조건 및 디지털 PCR 증폭 장비는 실시예 6-1과 동일하게 하였다. 각 웰 당 분주되는 프라이머 쌍과 이에 대응하는 검출 프로브로는 21번 염색체 상의 3개의 표적 유전자, 2번 염색체 상의 1개의 콘트롤 유전자 및 1번 염색체 상의 1개의 콘트롤 유전자 각각에 대한 증폭용 프라이머 쌍 및 이에 대응하는 검출 프로브(총 5세트)를 사용하였다. First, S2 sample, S4 sample, S5 sample, and S6 sample, which were found to contain a certain amount of fetal genes among gDNA samples prepared in Example 5-1, and normal males without genetic abnormalities provided by a Korean general hospital Digital PCR was performed on the genomic DNA sample (male control sample) in the same manner as described in Example 6-1. The sample distribution method, digital PCR amplification composition, digital PCR amplification conditions, and digital PCR amplification equipment for each array of well plates were the same as in Example 6-1. Primer pairs dispensed per well and corresponding detection probes include primer pairs for amplification for each of three target genes on chromosome 21, one control gene on chromosome 2 and one control gene on chromosome 1, and Corresponding detection probes (5 sets in total) were used.
또한, 실시예 6-1과 동일한 방식으로 검사 대상이 되는 각 샘플 별로, 각각의 표적 유전자(서열번호 21, 서열번호 25 또는 서열번호 29의 유전자)의 디지털 PCR 증폭산물을 정량하였고, 정량화된 값 각각을 각각의 콘트롤 유전자(서열번호 33 또는 서열번호 37의 유전자)의 디지털 PCR 정량값에 대해 정상화한 값을 산출하였다. 이로부터 정상 남성 유전자에 대한 태아 유래 표적 유전자의 유전자 수 이상, 즉 21번 염색체의 3염색체성 여부를 확인하였다(표 24 참조).In addition, the digital PCR amplification product of each target gene (SEQ ID NO: 21, SEQ ID NO: 25 or SEQ ID NO: 29) was quantified for each sample to be tested in the same manner as in Example 6-1. Each was normalized to the digital PCR quantitative value of each control gene (SEQ ID NO: 33 or SEQ ID NO: 37). From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, the trisomy of chromosome 21 was confirmed (see Table 24).
표 24
서열번호 33의 콘트롤 유전자 (2번 염색체)에 대한 정상화 값 샘플번호 서열번호 37의 콘트롤 유전자(1번 염색체)에 대한 정상화 값
1.0041 1.2681 S2 0.2643 0.2093
0.8585 0.1790
0.8858 0.1846
1.9532 1.9106 S4 1.5300 1.5499
1.9760 1.5878
1.0138 1.5319
1.9989 2.1530 S5 3.0000 1.8551
1.9806 2.7599
1.8631 2.5961
1.2236 1.5102 S6 0.6461 0.5235
1.1608 0.4966
1.0000 0.4278
Table 24
Normalized value for the control gene of SEQ ID NO: 33 (chromosome 2) Sample number Normalized value for the control gene of SEQ ID NO: 37 (chromosome 1)
1.0041 1.2681 S2 0.2643 0.2093
0.8585 0.1790
0.8858 0.1846
1.9532 1.9106 S4 1.5300 1.5499
1.9760 1.5878
1.0138 1.5319
1.9989 2.1530 S5 3.0000 1.8551
1.9806 2.7599
1.8631 2.5961
1.2236 1.5102 S6 0.6461 0.5235
1.1608 0.4966
1.0000 0.4278
S4 샘플의 경우에는 서열번호 33의 콘트롤 유전자 (2번 염색체) 및 서열번호 37의 콘트롤 유전자 (1번 염색체)에 대한 정상화 값이 각각 1.9532 및 1.5499로서 산출되었고, S5 샘플의 경우에는 1.9989 및 1.8551로서 산출되어 이들 샘플에서는 유전자 수 변이가 있는 것이 확인되었다. 이는 태아에 있어 유전자 수 이상이 없는 것으로 알려진 1번 염색체의 유전자 수와 2번 염색체의 유전자 수에 대해 21번 염색체 유전자 수가 대략 1.5배 이상 많은 것을 의미하고, 이로부터 염색체 수 이상이 존재한다는 것을 알 수 있다. 따라서, 21번 염색체가 3배체(정상은 2배체)인 3염색체성(trisomy)을 태아가 갖는 것으로 추정할 수 있고, S4 샘플 및 S5 샘플을 제공한 임부의 태아의 다운증후군 발생 위험도는 높다고 예진할 수 있다. Normalized values for the control gene of SEQ ID NO: 33 (chromosome 2) and the control gene of SEQ ID NO: 37 (chromosome 1) for S4 samples were calculated as 1.9532 and 1.5499, respectively, and 1.9989 and 1.8551 for S5 samples. It was calculated and confirmed that there were gene number variations in these samples . This means that the number of chromosome 21 genes is about 1.5 times more than the number of genes of chromosome 1 and the number of chromosome 2 which are known to have no genes in the fetus. Can be. Therefore, it can be assumed that the fetus has a trisomy in which the chromosome 21 is a triploid (normally a diploid), and there is a high risk of developing Down syndrome in a pregnant woman who provided S4 and S5 samples. can do.
반면에, S2 샘플 및 S6 샘플은 정상화 값이 1.5미만인 것이 확인되어 유전자 수 이상이 없는 것으로 알려진 1번 염색체의 유전자 수와 2번 염색체의 유전자 수에 대해 21번 염색체 유전자 수가 1.5배 미만이라고 유추할 수 있다. S2 샘플 및 S6 샘플에 대해 21번 염색체 기준으로 분석을 하면 태아의 21번 염색체가 정상인 2배체인 것을 추정할 수 있다. 따라서, S2 샘플 및 S6 샘플을 제공한 임부의 태아의 다운증후군 발생 위험도는 낮다고 예진할 수 있다.On the other hand, the S2 sample and the S6 sample were found to have a normalization value of less than 1.5, inferring that the number of chromosome 21 is less than 1.5 times the number of genes of chromosome 1 and the number of chromosome 2 that are known to have no genes. Can be. Analysis of the S2 sample and the S6 sample on the basis of chromosome 21 may indicate that chromosome 21 of the fetus is a normal diploid. Therefore, it can be predicted that the risk of developing Down syndrome in the fetus of pregnant women who provided S2 and S6 samples is low.
실시예 8-2: 프로브 혼합물을 사용한 디지털 PCR 정량Example 8-2 Digital PCR Quantitation Using Probe Mixtures
한편, 각각의 검출 프로브를 각각의 웰에 분주하면, 검출 프로브의 수가 많아지는 만큼 웰 플레이트에서 검출 프로브가 사용하는 웰의 숫자가 증가한다. 따라서, 하나의 웰 플레이트에 사용할 수 있는 샘플의 수가 제한된다. 또한, 웰 플레이트 레이아웃 설계시 많은 검출 프로브를 고려해야 하므로 레이아웃 설계가 불편하고, 검출 프로브의 분주 과정도 복잡하게 되는 문제가 있다. 따라서, 특정 염색체의 3염색체성 판별을 위한 표적 유전자들에 특이적인 프라이머 쌍과 검출 프로브들을 혼합하여 하나의 웰에 분주하면 위와 같은 문제점과 불편함을 해소할 수 있다. 또한, 콘트롤 유전자들에 대해 특이적인 프라이머 쌍과 검출 프로브들을 혼합하여 하나의 웰에 분주하면 웰 플레이트에 분배되는 샘플의 양을 더욱 늘일 수 있고 레이아웃 설계 및 프로브 분주 과정의 불편함을 더욱 개선할 수 있다. On the other hand, when each detection probe is dispensed into each well, the number of wells used by the detection probe in the well plate increases as the number of detection probes increases. Thus, the number of samples that can be used in one well plate is limited. In addition, since a large number of detection probes must be taken into consideration when designing a well plate layout, layout design is inconvenient, and a dispensing process of the detection probes is complicated. Therefore, by mixing primer pairs and detection probes specific to target genes for trisomy identification of a specific chromosome and dispensing them into one well, the above problems and inconveniences can be solved. In addition, mixing primer pairs and detection probes specific for the control genes and dispensing them into one well can further increase the amount of sample dispensed into the well plate and further improve the inconvenience of layout design and probe dispensing. have.
본 실시예는 이러한 검출 프로브의 혼합물을 사용한 경우의 디지털 PCR 정량 결과가 실시예 8-1의 디지털 PCR 정량 결과와 부합되는지 여부를 확인하기 위해 수행되었다. 이를 위해 실시예 8-1에 기술된 방법과 동일한 방법으로 디지털 PCR을 수행하되, 21번 염색체의 표적 유전자에 특이적인 프라이머 쌍과 검출 프로브의 조성과, 콘트롤 유전자에 특이적인 프라이머 쌍과 검출 프로브의 조성을 다음의 (1) 내지 (4)와 같이 변경하고 각 혼합물을 각 웰에 분주한 후 디지털 PCR을 수행하였다:This example was performed to confirm whether the digital PCR quantification results in the case of using a mixture of such detection probes are consistent with the digital PCR quantification results of Example 8-1. To this end, digital PCR is performed in the same manner as described in Example 8-1, except that the primer pair specific to the target gene of chromosome 21 and the composition of the detection probe, the primer pair specific to the control gene and the detection probe The composition was changed as follows (1) to (4) and each mixture was dispensed into each well, followed by digital PCR:
(1) 21번 염색체의 표적 유전자에 특이적인 검출 프로브 혼합물 (5 pM): 검출 프로브 21-01_73 P (서열번호 24) 0.2 μL, 검출 프로브 21-03_73 P (서열번호 28) 0.4 μL, 및 검출 프로브 21-05_58 P (서열번호 32) 0.4 μL를 혼합한 1.0μL 사용;(1) Detection probe mixture specific for target gene of chromosome 21 (5 pM): 0.2 μL detection probe 21-01_73 P (SEQ ID NO: 24), 0.4 μL detection probe 21-03_73 P (SEQ ID NO: 28), and detection Use 1.0 μL mixed with 0.4 μL probe 21-05_58 P (SEQ ID NO: 32);
(2) 21번 염색체의 표적 유전자에 특이적인 증폭 프라이머 쌍 혼합물 (20 pM): 프라이머 쌍 21-01_73 (서열번호 22 및 서열번호 23) 0.1 μL, 프라이머 쌍 21-03_73 (서열번호 26 및 서열번호 27) 0.2 μL, 및 프라이머 쌍 21-05_58 (서열번호 30 및 서열번호 31) 0.2 μL를 혼합한 0.5 μL 사용;(2) Amplification primer pair mixture specific for target gene of chromosome 21 (20 pM): 0.1 μL of primer pair 21-01_73 (SEQ ID NO: 22 and SEQ ID NO: 23), primer pair 21-03_73 (SEQ ID NO: 26 and SEQ ID NO: 27) use 0.5 μL mixed with 0.2 μL and 0.2 μL of primer pair 21-05_58 (SEQ ID NO: 30 and SEQ ID NO: 31);
(3) 2번 염색체 및 1번 염색체의 콘트롤 유전자들에 특이적인 검출 프로브 혼합물 (5 pM): 검출 프로브 02-03_68 P (서열번호 36) 0.5 μL, 및 검출 프로브 01-05_56 P (서열번호 40) 0.5 μL를 혼합한 1.0 μL 사용;(3) Detection probe mixture specific for control genes of chromosome 2 and chromosome 1 (5 pM): 0.5 μL of detection probe 02-03_68 P (SEQ ID NO: 36), and detection probe 01-05_56 P (SEQ ID NO: 40) ) 1.0 μL mixed with 0.5 μL;
(4) 2번 염색체 및 1번 염색체의 콘트롤 유전자들에 특이적인 증폭 프라이머 쌍 혼합물 (20 pM): 프라이머 쌍 02-03_68 (서열번호 34 및 서열번호 35) 0.25 μL, 및 프라이머 쌍 01-05_56 (서열번호 38 및 서열번호 39) 0.25 μL를 혼합한 0.5 μL 사용.(4) Amplification primer pair mixture (20 pM) specific for control genes of chromosome 2 and chromosome 1 (20 pM): 0.25 μL of primer pair 02-03_68 (SEQ ID NO: 34 and SEQ ID NO: 35), and primer pair 01-05_56 ( SEQ ID NO: 38 and SEQ ID NO: 39) 0.5 μL mixed with 0.25 μL.
또한, 실시예 6-1에 기재된 방법에 따라, 검사 대상이 되는 각 샘플 별로 21번 염색체 상의 전체 표적 유전자들의 디지털 PCR 증폭산물을 정량하였고, 정량화된 값을 전체 콘트롤 유전자들의 디지털 PCR 정량값에 대해 정상화한 값을 산출하였다. 이로부터 정상 남성 유전자에 대한 태아 유래 표적 유전자의 유전자 수 이상, 즉 21번 염색체의 3염색체성 여부를 확인하였다(표 25 참조).In addition, according to the method described in Example 6-1, digital PCR amplification products of all target genes on chromosome 21 were quantified for each sample to be tested, and the quantified values were compared to digital PCR quantification values of all control genes. Normalized values were calculated. From this, more than the number of genes of the fetal-derived target gene with respect to the normal male gene, ie, the trisomy of chromosome 21 was confirmed (see Table 25).
표 25
샘플 번호 전체 콘트롤 유전자들에 대해 정상화한 값
S2 1.4740
S4 1.9219
S5 2.0183
S6 1.3859
MC 1.0468
Table 25
Sample number Normalized values for all control genes
S2 1.4740
S4 1.9219
S5 2.0183
S6 1.3859
MC 1.0468
상기 결과를 분석하면, 정상 남성 샘플(Human Male Control)의 경우에는 전체 콘트롤 유전자에 대한 정상화 값이 1에 근접하여 표적 유전자(21번 염색체 상의 유전자)의 유전자 수의 변이가 없는 것을 확인할 수 있었다. S4 샘플 및 S5 샘플의 경우에는 전체 콘트롤 유전자에 대한 정상화 값이 각각 1.9219 및 2.0183로서 산출되어 이들 샘플에서는 유전자 수 변이가 있는 것이 확인되었다. 반면에, S2 샘플 및 S6 샘플은 정상화 값이 1.5미만인 것이 확인되었다. 따라서, 본 실시예의 디지털 PCR 정량 결과는 실시예 8-1의 디지털 PCR 정량 결과와 부합되는 것으로 확인되었다. 이러한 관점에서 프라이머 쌍 혼합물 및 이에 대응하는 검출 프로브 혼합물을 사용한 디지털 PCR 정량 방법은 유의적인 결과를 나타내며, 태아 유래 유전자의 염색체 수 이상과 관련한 질환 진단에 유용하게 사용될 수 있음을 알 수 있다. Analysis of the results, in the case of the normal male sample (Human Male Control) it was confirmed that there is no variation in the number of genes of the target gene (gene on chromosome 21) when the normalization value for the entire control gene is close to 1. For S4 and S5 samples, normalization values for the entire control gene were calculated as 1.9219 and 2.0183, respectively, confirming that there were gene number variations in these samples . On the other hand, the S2 and S6 samples were found to have a normalization value of less than 1.5. Therefore, it was confirmed that the digital PCR quantitative result of this example is consistent with the digital PCR quantitative result of Example 8-1. In this respect, the digital PCR quantification method using the primer pair mixture and the corresponding detection probe mixture shows a significant result, and it can be seen that it can be usefully used for diagnosing diseases related to abnormal chromosome numbers of fetal-derived genes.
이상 본 발명을 상기 실시예를 들어 설명하였으나, 본 발명은 이에 제한되는 것이 아니다. 당업자라면 본 발명의 취지 및 범위를 벗어나지 않고 수정, 변경을 할 수 있으며 이러한 수정과 변경 또한 본 발명에 속하는 것임을 알 수 있을 것이다.Although the present invention has been described with reference to the above embodiments, the present invention is not limited thereto. Those skilled in the art can make modifications and changes without departing from the spirit and scope of the present invention, and it will be appreciated that such modifications and changes also belong to the present invention.

Claims (40)

  1. (a) 임부의 혈액 또는 혈장 시료 내에 태아 유래 유전자가 존재하는지 여부를 분석하는 단계와,(a) analyzing whether a fetal-derived gene is present in the maternal blood or plasma sample,
    (b) 상기 (a) 단계의 분석에 의해 태아 유래 유전자가 존재하는 것으로 검출된 시료를 웰 플레이트의 각 웰에 분배하여 디지털 PCR을 수행하되, 모체 유래 유전자 세트와 태아 유래 유전자 세트에 공통적으로 존재하는, 유전자 수 이상과 관련이 없는 콘트롤 유전자와, 유전자 수 이상과 관련된 표적 유전자에 대해 디지털 PCR을 수행하는 단계와,(b) Digital PCR is performed by distributing a sample detected as having fetal-derived genes by the analysis of step (a) to each well of the well plate, and is commonly present in the maternal and fetal-derived gene sets. Performing a digital PCR on a control gene not related to the abnormal number of genes and a target gene related to the abnormal number of genes,
    (c) 상기 (b) 단계에서 수득된 콘트롤 유전자의 디지털 PCR 증폭산물을 정량한 후, 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개에 근접하는지 여부를 분석하는 단계와,(c) quantifying the digital PCR amplification products of the control gene obtained in step (b), and analyzing whether the number of control gene copies per well is statistically close to one;
    (d) 상기 (c) 단계의 분석 결과, 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개를 초과하는 것으로 결정되면, 상기 시료를 추가로 희석하여 상기 (b) 단계 및 (c) 단계를 반복하는 단계와,(d) If the analysis of step (c) determines that the number of control gene copies per well is statistically greater than one, the sample is further diluted to perform steps (b) and (c). Repeating steps,
    (e) 상기 (c) 단계의 분석 결과, 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개에 근접하는 것으로 결정되면, 상기 표적 유전자의 디지털 PCR 증폭산물을 정량하고, 상기 콘트롤 유전자의 디지털 PCR 정량값에 대한 상기 표적 유전자의 디지털 PCR 정량값의 비율을 산출하는 단계와,(e) If the analysis result of step (c) determines that the number of control gene copies per well is statistically close to one, the digital PCR amplification product of the target gene is quantified, and the digital PCR of the control gene is performed. Calculating a ratio of the digital PCR quantitative value of the target gene to the quantitative value;
    (f) 상기 (e) 단계에서 산출된 비율이 1.5 이상이면 태아 유래 표적 유전자에서 유전자 수 이상이 있는 것으로 결정하는 단계를 포함하는, 디지털 PCR을 이용하여 임부의 혈액 또는 혈장으로부터 태아의 유전자 정보를 분석하는 방법.(f) determining that there is more than the number of genes in the target gene derived from the fetus if the ratio calculated in step (e) is 1.5 or more. How to Analyze.
  2. 제1항에 있어서, The method of claim 1,
    상기 (e) 단계에서는 웰 당 카피수가 1개인 경우 뿐만아니라 웰 당 카피수가 1.01 내지 1.59의 범주 내에 들어 가는 경우 하나의 웰 당 콘트롤 유전자 카피수가 통계학적으로 1개에 근접하는 것으로 결정하는 것을 특징으로 하는 방법.In the step (e), if the number of copies per well as well as the number of copies per well falls within the range of 1.01 to 1.59, it is determined that the control gene copy number per well is statistically close to one How to.
  3. 제1항 또는 제2항에 있어서,The method according to claim 1 or 2,
    상기 (e) 단계에서 상기 콘트롤 유전자의 디지털 PCR 정량값은 웰 당 콘트롤 유전자의 평균 카피수이고, 상기 표적 유전자의 디지털 PCR 정량값은 웰 당 표적 유전자의 평균 카피수인 것을 특징으로 하는 방법.In step (e), the digital PCR quantitative value of the control gene is the average copy number of the control gene per well, and the digital PCR quantitative value of the target gene is characterized in that the average copy number of the target gene per well.
  4. 제1항 또는 제2항에 있어서,The method according to claim 1 or 2,
    상기 (d) 단계에서 상기 시료의 희석은 1000배 부터 5000배까지 단계적으로 수행하는 것을 특징으로 하는 방법.Dilution of the sample in the step (d) is characterized in that it is carried out step by step from 1000 times to 5000 times.
  5. 제1항 또는 제2항에 있어서,The method according to claim 1 or 2,
    상기 콘트롤 유전자는 2번 염색체 상의 유전자인 서열번호 33의 염기서열을 갖는 콘트롤 유전자와, 1번 염색체 상의 유전자인 서열번호 37의 염기서열을 갖는 콘트롤 유전자로 구성된 군으로부터 선택된 적어도 하나인 것을 특징으로 하는 방법.The control gene is at least one selected from the group consisting of a control gene having a nucleotide sequence of SEQ ID NO: 33, which is a gene on chromosome 2, and a control gene having a nucleotide sequence of SEQ ID NO: 37, which is a gene on chromosome 1; Way.
  6. 제5항에 있어서,The method of claim 5,
    상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 34 및 35의 프라이머 쌍이 사용되고, 상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a control gene having a nucleotide sequence of SEQ ID NO: 33, primer pairs of SEQ ID NOs: 34 and 35 are used, and as a probe for detecting a control gene amplification product having a nucleotide sequence of SEQ ID NO: 33, SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 36 and an oligonucleotide complementary to such oligonucleotide is used.
  7. 제5항에 있어서,The method of claim 5,
    상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 38 및 39의 프라이머 쌍이 사용되고, 상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a control gene having a nucleotide sequence of SEQ ID NO: 37, primer pairs of SEQ ID NOs: 38 and 39 are used, and as a probe for detecting a control gene amplification product having a nucleotide sequence of SEQ ID NO: 37, SEQ ID NO: At least one probe selected from the group consisting of 40 oligonucleotides and oligonucleotides complementary to such oligonucleotides is used.
  8. 제5항에 있어서,The method of claim 5,
    서열번호 34 및 35의 프라이머 쌍과 서열번호 38 및 39의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자 및 상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 33의 염기서열을 갖는 콘트롤 유전자 증폭 산물 및 상기 서열번호 37의 염기서열을 갖는 콘트롤 유전자 증폭 산물을 동일한 웰에서 함께 검출하는 것을 특징으로 하는 방법.Using a mixture of primer pairs of SEQ ID NOs: 34 and 35 and primer pairs of SEQ ID NOs: 38 and 39, a control gene having the nucleotide sequence of SEQ ID NO: 33 and a control gene having the nucleotide sequence of SEQ ID NO: 37 in the same well At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 36 and an oligonucleotide complementary to such oligonucleotide, and an oligonucleotide of SEQ ID NO: 40 and an oligonucleotide complementary to such oligonucleotide Using a mixture of at least one probe selected, the control gene amplification product having the nucleotide sequence of SEQ ID NO: 33 and the control gene amplification product having the nucleotide sequence of SEQ ID NO: 37 are detected together in the same well Way.
  9. 제1항 또는 제2항에 있어서,The method according to claim 1 or 2,
    상기 표적 유전자는 21번 염색체 상의 표적 유전자, 13번 염색체 상의 표적 유전자 및 18번 염색체 상의 표적 유전자로 구성된 군으로부터 선택된 적어도 하나인 것을 특징으로 하는 방법.The target gene is at least one selected from the group consisting of a target gene on chromosome 21, a target gene on chromosome 13 and a target gene on chromosome 18.
  10. 제9항에 있어서,The method of claim 9,
    상기 21번 염색체 상의 표적 유전자, 상기 13번 염색체 상의 표적 유전자 및 상기 18번 염색체 상의 표적 유전자로 구성된 군으로부터 선택된 적어도 2종의 표적 유전자에 대한 디지털 PCR을 동시에 수행하는 것을 특징으로 하는 방법.And simultaneously performing digital PCR on at least two target genes selected from the group consisting of a target gene on chromosome 21, a target gene on chromosome 13 and a target gene on chromosome 18.
  11. 제9항에 있어서,The method of claim 9,
    상기 21번 염색체 상의 표적 유전자는 서열번호 21의 염기서열을 갖는 표적 유전자, 서열번호 25의 염기서열을 갖는 표적 유전자 및 서열번호 29의 염기서열을 갖는 표적 유전자로 구성된 군으로부터 선택된 적어도 하나인 것을 특징으로 하는 방법.The target gene on the chromosome 21 is at least one selected from the group consisting of a target gene having a nucleotide sequence of SEQ ID NO: 21, a target gene having a nucleotide sequence of SEQ ID NO: 25, and a target gene having a nucleotide sequence of SEQ ID NO: 29 How to.
  12. 제11항에 있어서,The method of claim 11,
    상기 서열번호 21의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 22 및 23의 프라이머 쌍이 사용되고, 상기 서열번호 21의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 21, primer pairs of SEQ ID NOs: 22 and 23 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 21, SEQ ID NO: At least one probe selected from the group consisting of 24 oligonucleotides and oligonucleotides complementary to such oligonucleotides is used.
  13. 제11항에 있어서,The method of claim 11,
    상기 서열번호 25의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 26 및 27의 프라이머 쌍이 사용되고, 상기 서열번호 25의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 25, primer pairs of SEQ ID NOs: 26 and 27 are used, and as a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 25, SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 28 and an oligonucleotide complementary to such oligonucleotide is used.
  14. 제11항에 있어서,The method of claim 11,
    상기 서열번호 29의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 30 및 31의 프라이머 쌍이 사용되고, 상기 서열번호 29의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 29, primer pairs of SEQ ID NOs: 30 and 31 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 29, SEQ ID NO: At least one probe selected from the group consisting of 32 oligonucleotides and oligonucleotides complementary to such oligonucleotides is used.
  15. 제11항에 있어서,The method of claim 11,
    서열번호 22 및 23의 프라이머 쌍, 서열번호 26 및 27의 프라이머 쌍, 및 서열번호 30 및 31의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 21의 염기서열을 갖는 표적 유전자, 상기 서열번호 25의 염기서열을 갖는 표적 유전자, 및 상기 서열번호 29의 염기서열을 갖는 표적 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 21의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 25의 염기서열을 갖는 표적 유전자 증폭 산물, 및 상기 서열번호 29의 염기서열을 갖는 표적 유전자 증폭산물을 동일한 웰에서 함께 검출하는 것을 특징으로 하는 방법.A target gene having the nucleotide sequence of SEQ ID NO: 21, using a mixture of primer pairs of SEQ ID NOs: 22 and 23, primer pairs of SEQ ID NOs: 26 and 27, and primer pairs of SEQ ID NOs: 30 and 31, of SEQ ID NO: 25 At least one selected from the group consisting of a target gene having a nucleotide sequence and a target gene having the nucleotide sequence of SEQ ID NO: 29 together in the same well, and an oligonucleotide of SEQ ID NO: 24 and an oligonucleotide complementary to such oligonucleotide At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 and an oligonucleotide complementary to such oligonucleotide, and an oligonucleotide of SEQ ID NO: 32 and an oligonucleotide complementary to such oligonucleotide Write down Using a mixture of one probe, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 21, a target gene amplification product having the nucleotide sequence of SEQ ID NO: 25, and a target gene amplification having the nucleotide sequence of SEQ ID NO: 29 The products are detected together in the same well.
  16. 제9항에 있어서,The method of claim 9,
    상기 18번 염색체 상의 표적 유전자는 서열번호 57의 염기서열을 갖는 표적 유전자, 서열번호 61의 염기서열을 갖는 표적 유전자, 서열번호 65의 염기서열을 갖는 표적 유전자 및 서열번호 69의 염기서열을 갖는 표적 유전자로 구성된 군으로부터 선택된 적어도 하나인 것을 특징으로 하는 방법.The target gene on the chromosome 18 is a target gene having a nucleotide sequence of SEQ ID NO: 57, a target gene having a nucleotide sequence of SEQ ID NO: 61, a target gene having a nucleotide sequence of SEQ ID NO: 65, and a target having a nucleotide sequence of SEQ ID NO: 69 At least one selected from the group consisting of genes.
  17. 제16항에 있어서,The method of claim 16,
    상기 서열번호 57의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 58 및 59의 프라이머 쌍이 사용되고, 상기 서열번호 57의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 57, primer pairs of SEQ ID NOs: 58 and 59 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 57, SEQ ID NO: At least one probe selected from the group consisting of 60 oligonucleotides and oligonucleotides complementary to such oligonucleotides is used.
  18. 제16항에 있어서,The method of claim 16,
    상기 서열번호 61의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 62 및 63의 프라이머 쌍이 사용되고, 상기 서열번호 61의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 61, primer pairs of SEQ ID NOs: 62 and 63 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 61, SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 64 and an oligonucleotide complementary to such oligonucleotide is used.
  19. 제16항에 있어서,The method of claim 16,
    상기 서열번호 65의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 66 및 67의 프라이머 쌍이 사용되고, 상기 서열번호 65의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 65, primer pairs of SEQ ID NOs: 66 and 67 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 65, SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 68 and an oligonucleotide complementary to such oligonucleotide is used.
  20. 제16항에 있어서,The method of claim 16,
    상기 서열번호 69의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 70 및 71의 프라이머 쌍이 사용되고, 상기 서열번호 69의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 69, primer pairs of SEQ ID NOs: 70 and 71 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 69, SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 72 and an oligonucleotide complementary to such oligonucleotide is used.
  21. 제16항에 있어서,The method of claim 16,
    서열번호 58 및 59의 프라이머 쌍, 서열번호 62 및 63의 프라이머 쌍, 서열번호 66 및 67의 프라이머 쌍, 및 서열번호 70 및 71의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 57의 염기서열을 갖는 표적 유전자, 상기 서열번호 61의 염기서열을 갖는 표적 유전자, 상기 서열번호 65의 염기서열을 갖는 표적 유전자, 및 상기 서열번호 69의 염기서열을 갖는 표적 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 57의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 61의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 65의 염기서열을 갖는 표적 유전자 증폭 산물, 및 상기 서열번호 69의 염기서열을 갖는 표적 유전자 증폭산물을 동일한 웰에서 함께 검출하는 것을 특징으로 하는 방법.Using a mixture of primer pairs of SEQ ID NOs: 58 and 59, primer pairs of SEQ ID NOs: 62 and 63, primer pairs of SEQ ID NOs: 66 and 67, and primer pairs of SEQ ID NOs: 70 and 71, the nucleotide sequence of SEQ ID NO: 57 was determined. A target gene having the nucleotide sequence of SEQ ID NO: 61, a target gene having the nucleotide sequence of SEQ ID NO: 65, and a target gene having the nucleotide sequence of SEQ ID NO: 69 are amplified together in the same well, and SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 60 and an oligonucleotide complementary to such oligonucleotide, an oligonucleotide of SEQ ID NO: 64 and at least one probe selected from the group consisting of an oligonucleotide complementary to such oligonucleotide, Oligonucleotides of SEQ ID NO: 68 and such oligonucleotides Using at least one probe selected from the group consisting of oligonucleotides complementary to the peptide, and a mixture of an oligonucleotide of SEQ ID NO: 72 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides, The target gene amplification product having the nucleotide sequence of SEQ ID NO: 57, the target gene amplification product having the nucleotide sequence of SEQ ID NO: 61, the target gene amplification product having the nucleotide sequence of SEQ ID NO: 65, and the nucleotide sequence of SEQ ID NO: 69 A method for detecting target gene amplification products having the same well together.
  22. 제9항에 있어서,The method of claim 9,
    상기 13번 염색체 상의 표적 유전자는 서열번호 41의 염기서열을 갖는 표적 유전자, 서열번호 45의 염기서열을 갖는 표적 유전자, 서열번호 49의 염기서열을 갖는 표적 유전자 및 서열번호 53의 염기서열을 갖는 표적 유전자로 구성된 군으로부터 선택된 적어도 하나인 것을 특징으로 하는 방법.The target gene on the chromosome 13 is a target gene having a nucleotide sequence of SEQ ID NO: 41, a target gene having a nucleotide sequence of SEQ ID NO: 45, a target gene having a nucleotide sequence of SEQ ID NO: 49, and a target having a nucleotide sequence of SEQ ID NO: 53 At least one selected from the group consisting of genes.
  23. 제22항에 있어서,The method of claim 22,
    상기 서열번호 41의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 42 및 43의 프라이머 쌍이 사용되고, 상기 서열번호 41의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 41, a primer pair of SEQ ID NOs: 42 and 43 is used, and a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 41 is SEQ ID NO: At least one probe selected from the group consisting of oligonucleotides of 44 and oligonucleotides complementary to such oligonucleotides is used.
  24. 제22항에 있어서,The method of claim 22,
    상기 서열번호 45의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 46 및 47의 프라이머 쌍이 사용되고, 상기 서열번호 45의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 45, primer pairs of SEQ ID NOs: 46 and 47 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 45, SEQ ID NO: At least one probe selected from the group consisting of 48 oligonucleotides and oligonucleotides complementary to such oligonucleotides is used.
  25. 제22항에 있어서,The method of claim 22,
    상기 서열번호 49의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 50 및 51의 프라이머 쌍이 사용되고, 상기 서열번호 49의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having the nucleotide sequence of SEQ ID NO: 49, primer pairs of SEQ ID NO: 50 and 51 are used, and a probe for detecting a target gene amplification product having the nucleotide sequence of SEQ ID NO: 49 is SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 52 and an oligonucleotide complementary to such oligonucleotide.
  26. 제22항에 있어서,The method of claim 22,
    상기 서열번호 53의 염기서열을 갖는 표적 유전자를 증폭하기 위한 프라이머 쌍으로서는 서열번호 54 및 55의 프라이머 쌍이 사용되고, 상기 서열번호 53의 염기서열을 갖는 표적 유전자 증폭 산물을 검출하기 위한 프로브로는 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브가 사용되는 것을 특징으로 하는 방법.As a primer pair for amplifying a target gene having a nucleotide sequence of SEQ ID NO: 53, primer pairs of SEQ ID NOs: 54 and 55 are used, and as a probe for detecting a target gene amplification product having a nucleotide sequence of SEQ ID NO: 53, SEQ ID NO: At least one probe selected from the group consisting of an oligonucleotide of 56 and an oligonucleotide complementary to such oligonucleotide is used.
  27. 제22항에 있어서,The method of claim 22,
    서열번호 42 및 43의 프라이머 쌍, 서열번호 46 및 47의 프라이머 쌍, 서열번호 50 및 51의 프라이머 쌍, 및 서열번호 54 및 55의 프라이머 쌍의 혼합물을 사용하여, 상기 서열번호 41의 염기서열을 갖는 표적 유전자, 상기 서열번호 45의 염기서열을 갖는 표적 유전자, 상기 서열번호 49의 염기서열을 갖는 표적 유전자, 및 상기 서열번호 53의 염기서열을 갖는 표적 유전자를 동일한 웰에서 함께 증폭하고, 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브, 및 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브의 혼합물을 사용하여, 상기 서열번호 41의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 45의 염기서열을 갖는 표적 유전자 증폭 산물, 상기 서열번호 49의 염기서열을 갖는 표적 유전자 증폭 산물, 및 상기 서열번호 53의 염기서열을 갖는 표적 유전자 증폭산물을 동일한 웰에서 함께 검출하는 것을 특징으로 하는 방법.Using the mixture of primer pairs of SEQ ID NOs: 42 and 43, primer pairs of SEQ ID NOs: 46 and 47, primer pairs of SEQ ID NOs: 50 and 51, and primer pairs of SEQ ID NOs: 54 and 55, A target gene having the nucleotide sequence of SEQ ID NO: 45, a target gene having the nucleotide sequence of SEQ ID NO: 49, and a target gene having the nucleotide sequence of SEQ ID NO: 53 are amplified together in the same well, At least one probe selected from the group consisting of an oligonucleotide of 44 and an oligonucleotide complementary to such oligonucleotide, an oligonucleotide of SEQ ID NO: 48 and at least one probe selected from the group consisting of an oligonucleotide complementary to such oligonucleotide, Oligonucleotides of SEQ ID NO: 52 and such oligonucleotides Using at least one probe selected from the group consisting of oligonucleotides complementary to the peptide, and a mixture of an oligonucleotide of SEQ ID NO: 56 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides, The target gene amplification product having the nucleotide sequence of SEQ ID NO: 41, the target gene amplification product having the nucleotide sequence of SEQ ID NO: 45, the target gene amplification product having the nucleotide sequence of SEQ ID NO: 49, and the nucleotide sequence of SEQ ID NO: 53 A method for detecting target gene amplification products having the same well together.
  28. 유전자 시료 내에 존재하는 유전자 수 이상과 관련된 표적 유전자의 증폭 후 얻어진 정량값으로부터 정상화값을 산출하기 위한 기준 정량값을 얻기 위해 사용되는 콘트롤 유전자 조성물로서,A control gene composition used to obtain a reference quantitative value for calculating a normalized value from a quantitative value obtained after amplification of a target gene associated with an abnormal number of genes present in a genetic sample.
    1번 염색체 상의 서열번호 37의 유전자 및 2번 염색체 상의 서열번호 33의 유전자로 구성된 군으로부터 선택된 적어도 하나의 유전자를 포함하는 콘트롤 유전자 조성물.A control gene composition comprising at least one gene selected from the group consisting of a gene of SEQ ID NO: 37 on chromosome 1 and a gene of SEQ ID NO: 33 on chromosome 2.
  29. 제28항에 기재된 콘트롤 유전자의 증폭 산물을 검출하고 정량하는데 사용되는 콘트롤 유전자용 프로브 조성물로서,A probe composition for a control gene used for detecting and quantifying an amplification product of the control gene according to claim 28,
    서열번호 33의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 서열번호 37의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함하는 콘트롤 유전자용 프로브 조성물.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 36 specific to a control gene having a nucleotide sequence of SEQ ID NO: 33 and an oligonucleotide complementary to such oligonucleotide, and a control gene having a nucleotide sequence of SEQ ID NO: 37 A probe composition for a control gene comprising at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 40 specific for and an oligonucleotide complementary to such oligonucleotide.
  30. 유전자 시료를 증폭하고, 증폭산물을 검출 및 정량하는데 사용되는 웰 플레이트로서,A well plate used for amplifying a genetic sample and detecting and quantifying amplification products,
    서열번호 33의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 36의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 서열번호 37의 염기서열을 갖는 콘트롤 유전자에 특이적인 서열번호 40의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 포함하는 웰 플레이트.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 36 specific to a control gene having a nucleotide sequence of SEQ ID NO: 33 and an oligonucleotide complementary to such oligonucleotide, and a control gene having a nucleotide sequence of SEQ ID NO: 37 A well plate comprising a well dispensed with at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 40 specific for and an oligonucleotide complementary to such oligonucleotide.
  31. 제30항에 있어서,The method of claim 30,
    2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주되는 것을 특징으로 하는 웰 플레이트.A well plate, characterized in that two or more probes are individually dispensed into each well or mixed together to dispense into one well.
  32. 제30항에 있어서,The method of claim 30,
    21번 염색체 상의 서열번호 21의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 25의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 29의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 더 포함하는 웰 플레이트.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 24 specific to a target gene having the nucleotide sequence of SEQ ID NO: 21 on chromosome 21 and an oligonucleotide complementary to such oligonucleotide, and SEQ ID NO: 21 on chromosome At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 specific to a target gene having a nucleotide sequence of 25 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 29 on chromosome 21 The wells to which at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 32 specific to the target gene and at least one probe selected from the group consisting of oligonucleotides complementary to the oligonucleotide are further added. Well plates that also.
  33. 제32항에 있어서,33. The method of claim 32,
    2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주되는 것을 특징으로 하는 웰 플레이트.A well plate, characterized in that two or more probes are individually dispensed into each well or mixed together to dispense into one well.
  34. 제30항에 있어서,The method of claim 30,
    18번 염색체 상의 서열번호 57의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 61의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 65의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 69의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 더 포함하는 웰 플레이트.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 60 specific to a target gene having the nucleotide sequence of SEQ ID NO: 57 on chromosome 18, and an oligonucleotide complementary to such oligonucleotide, and SEQ ID NO: 18 on chromosome At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 64 specific to a target gene having a base sequence of 61 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 65 on a chromosome 18 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 68 specific to the target gene and an oligonucleotide complementary to such oligonucleotide, and specific to a target gene having the nucleotide sequence of SEQ ID NO: 69 on chromosome 18 The well plate further comprises a well dispensed with at least one probe selected from the group consisting of oligonucleotide of SEQ ID NO: 72 and at least one probe selected from the group consisting of oligonucleotides complementary to such oligonucleotides.
  35. 제34항에 있어서,The method of claim 34, wherein
    2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주되는 것을 특징으로 하는 웰 플레이트.A well plate, characterized in that two or more probes are individually dispensed into each well or mixed together to dispense into one well.
  36. 제30항에 있어서,The method of claim 30,
    13번 염색체 상의 서열번호 41의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 45의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 49의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 53의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브가 분주된 웰을 더 포함하는 웰 플레이트.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 44 specific for a target gene having the nucleotide sequence of SEQ ID NO: 41 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide, and SEQ ID NO: 13 on chromosome At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 48 specific to a target gene having a nucleotide sequence of 45 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 49 on chromosome 13 Specific for a target gene having at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 52 specific to the target gene and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 53 on chromosome 13; A well plate further comprising a well dispensed with at least one probe selected from the group consisting of oligonucleotides of SEQ ID NO: 56 and oligonucleotides complementary to such oligonucleotides.
  37. 제36항에 있어서,The method of claim 36,
    2종 이상의 프로브가 각 웰에 개별적으로 분주되거나 함께 혼합되어 하나의 웰에 분주되는 것을 특징으로 하는 웰 플레이트.A well plate, characterized in that two or more probes are individually dispensed into each well or mixed together to dispense into one well.
  38. 유전자 시료 내에 존재하는 유전자 수 이상과 관련된 표적 유전자 증폭 산물을 검출하고 정량하는데 사용되는 표적 유전자용 프로브 조성물로서,A probe composition for a target gene used to detect and quantify a target gene amplification product associated with an abnormal number of genes present in a genetic sample,
    21번 염색체 상의 서열번호 21의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 24의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 25의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 28의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 21번 염색체 상의 서열번호 29의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 32의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함하는 표적 유전자용 프로브 조성물.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 24 specific to a target gene having the nucleotide sequence of SEQ ID NO: 21 on chromosome 21 and an oligonucleotide complementary to such oligonucleotide, and SEQ ID NO: 21 on chromosome At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 28 specific to a target gene having a nucleotide sequence of 25 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 29 on chromosome 21 A target gene comprising at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 32 specific to a target gene and an oligonucleotide complementary to such oligonucleotide Electronic probe composition.
  39. 유전자 시료 내에 존재하는 유전자 수 이상과 관련된 표적 유전자 증폭 산물을 검출하고 정량하는데 사용되는 표적 유전자용 프로브 조성물로서,A probe composition for a target gene used to detect and quantify a target gene amplification product associated with an abnormal number of genes present in a genetic sample,
    18번 염색체 상의 서열번호 57의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 60의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 61의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 64의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 65의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 68의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 18번 염색체 상의 서열번호 69의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 72의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함하는 표적 유전자용 프로브 조성물.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 60 specific to a target gene having the nucleotide sequence of SEQ ID NO: 57 on chromosome 18, and an oligonucleotide complementary to such oligonucleotide, and SEQ ID NO: 18 on chromosome At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 64 specific to a target gene having a base sequence of 61 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 65 on a chromosome 18 At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 68 specific to the target gene and an oligonucleotide complementary to such oligonucleotide, and specific to a target gene having the nucleotide sequence of SEQ ID NO: 69 on chromosome 18 Probe composition for a target gene comprising at least one probe selected from the group consisting of oligonucleotide of SEQ ID NO: 72 and oligonucleotide complementary to such oligonucleotide.
  40. 유전자 시료 내에 존재하는 유전자 수 이상과 관련된 표적 유전자 증폭 산물을 검출하고 정량하는데 사용되는 표적 유전자용 프로브 조성물로서,A probe composition for a target gene used to detect and quantify a target gene amplification product associated with an abnormal number of genes present in a genetic sample,
    13번 염색체 상의 서열번호 41의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 44의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 45의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 48의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 49의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 52의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브와, 13번 염색체 상의 서열번호 53의 염기서열을 갖는 표적 유전자에 특이적인 서열번호 56의 올리고뉴클레오티드와 이러한 올리고뉴클레오티드에 상보적인 올리고뉴클레오티드로 이루어진 군에서 선택되는 적어도 하나의 프로브로 구성된 군으로부터 선택된 적어도 하나의 프로브를 포함하는 표적 유전자용 프로브 조성물.At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 44 specific for a target gene having the nucleotide sequence of SEQ ID NO: 41 on chromosome 13, and an oligonucleotide complementary to such oligonucleotide, and SEQ ID NO: 13 on chromosome At least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 48 specific to a target gene having a nucleotide sequence of 45 and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 49 on chromosome 13 Specific for a target gene having at least one probe selected from the group consisting of an oligonucleotide of SEQ ID NO: 52 specific to the target gene and an oligonucleotide complementary to such oligonucleotide, and a nucleotide sequence of SEQ ID NO: 53 on chromosome 13; Probe composition for a target gene comprising at least one probe selected from the group consisting of oligonucleotide of SEQ ID NO: 56 and oligonucleotide complementary to such oligonucleotide.
PCT/KR2015/002438 2014-07-01 2015-03-13 Method for analyzing fetus gene information from blood or blood plasma of pregnant woman by using digital pcr WO2016003047A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0081763 2014-07-01
KR20140081763 2014-07-01

Publications (1)

Publication Number Publication Date
WO2016003047A1 true WO2016003047A1 (en) 2016-01-07

Family

ID=55019547

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/002438 WO2016003047A1 (en) 2014-07-01 2015-03-13 Method for analyzing fetus gene information from blood or blood plasma of pregnant woman by using digital pcr

Country Status (2)

Country Link
KR (1) KR20160003547A (en)
WO (1) WO2016003047A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021209573A1 (en) * 2020-04-15 2021-10-21 Stilla Technologies Method for detecting genetic events

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100063050A (en) * 2007-08-03 2010-06-10 더 차이니즈 유니버시티 오브 홍콩 Analysis of nucleic acids of varying lengths by digital pcr
KR20100075826A (en) * 2007-07-23 2010-07-05 더 차이니즈 유니버시티 오브 홍콩 Determining a nucleic acid sequence imbalance

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101387582B1 (en) 2011-11-11 2014-04-23 주식회사 엑세스바이오코리아 Method for detecting cell free fetal nucleic acid in plasma of pregnant woman

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20100075826A (en) * 2007-07-23 2010-07-05 더 차이니즈 유니버시티 오브 홍콩 Determining a nucleic acid sequence imbalance
KR20100063050A (en) * 2007-08-03 2010-06-10 더 차이니즈 유니버시티 오브 홍콩 Analysis of nucleic acids of varying lengths by digital pcr

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BEJERANO, G. ET AL.: "Ultraconserved elements in the human genome", SCIENCE, vol. 304, no. 5675, 2004, pages 1321 - 1325, XP002601779, ISSN: 0036-8075 *
FAN, HC. ET AL.: "Microfluidic digital PCR enables rapid prenatal diagnosis of fetal aneuploidy", AMERICAN JOURNAL OF OBSTETRICS & GYNECOLOGY, vol. 200, no. 5, May 2009 (2009-05-01), pages 543e1 - 543e7, XP026056021, ISSN: 0002-9378 *
LO, YM. ET AL.: "Digital PCR for the molecular detection of fetal chromosomal aneuploidy.", PROC NATL ACAD SCI USA., vol. 104, no. 32, 7 August 2007 (2007-08-07), pages 13116 - 13121, XP055237304 *
REDON, R. ET AL.: "Global variation in copy number in the human genome", NATURE, vol. 444, no. 7118, 2006, pages 444 - 544, XP008120970, ISSN: 0028-0836 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2021209573A1 (en) * 2020-04-15 2021-10-21 Stilla Technologies Method for detecting genetic events

Also Published As

Publication number Publication date
KR20160003547A (en) 2016-01-11

Similar Documents

Publication Publication Date Title
WO2011055916A2 (en) Method for detecting the methylation of colon-cancer-specific methylation marker genes for colon cancer diagnosis
WO2015023146A1 (en) Method for detecting precancerous lesions
WO2012070861A2 (en) Stomach cancer-specific methylation biomarker for stomach cancer diagnosis
WO2014073785A1 (en) Method for detecting gastric polyp and gastric cancer using marker gene of gastric polyp and gastric cancer-specific methylation
WO2017188669A2 (en) Method for detecting target nucleic acid sequence using cleaved complementary tag fragment and composition thereof
EP2912176A1 (en) Method for the detection of multiple target nucleic acids using clamping probes and detection probes
WO2012081928A2 (en) Method for detecting methylation of the bowel-cancer-specific methylation marker gpm6a gene in order to diagnose bowel cancer
WO2018139826A1 (en) Age predicting method using dna methylation
WO2012048607A1 (en) Method for detecting pca3 and psa genes, and diagnostic kit thereof
WO2022075788A1 (en) Composition for diagnosing colorectal cancer, rectal cancer or colorectal adenoma by using cpg methylation change of linc01798 gene, and use thereof
WO2021230663A1 (en) Method for predicting prognosis of patients having early breast cancer
WO2021182881A1 (en) Multiple biomarkers for breast cancer diagnosis and use thereof
WO2016003047A1 (en) Method for analyzing fetus gene information from blood or blood plasma of pregnant woman by using digital pcr
WO2011139032A2 (en) Primer composition for amplifying a gene region having diverse variations in a target gene
WO2015167087A1 (en) Method for predicting risk of ankylosing spondylitis using dna copy number variants
WO2013105801A1 (en) Probe for typing chronic myelogenous leukemia fusion genotype, primer and method for using same
WO2023027418A1 (en) Composition for detecting oral disease-causing bacteria, or use thereof
WO2012050353A2 (en) Method whereby the base sequence of a target polynucleotide is non-specifically extended
WO2019168261A1 (en) Method for analyzing qualitative or quantitative mutant genotype and real-time pcr kit for performing same method
WO2015105336A1 (en) Method for testing mutant gene through real-time polymerase chain reaction using dna polymerase with inhibited activity of 5'-flap endonuclease
WO2021034034A1 (en) Method for detecting chromosomal abnormality by using information about distance between nucleic acid fragments
WO2022216125A1 (en) Composition for diagnosing nonalcoholic fatty liver disease using dna methylation marker detection, and application thereof
WO2020122679A1 (en) Method for detecting a target analyte in a sample using an s-shaped function for a slope data set
WO2021172653A1 (en) Single nucleic acid for real-time detection of genetic variation of single target gene, and detection method using same
WO2014175604A2 (en) Composition for diagnosing avellino corneal dystrophy and method for diagnosing avellino corneal dystrophy

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15814332

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15814332

Country of ref document: EP

Kind code of ref document: A1