WO2015198054A1 - Novel treatment for endometriosis - Google Patents

Novel treatment for endometriosis Download PDF

Info

Publication number
WO2015198054A1
WO2015198054A1 PCT/GB2015/051853 GB2015051853W WO2015198054A1 WO 2015198054 A1 WO2015198054 A1 WO 2015198054A1 GB 2015051853 W GB2015051853 W GB 2015051853W WO 2015198054 A1 WO2015198054 A1 WO 2015198054A1
Authority
WO
WIPO (PCT)
Prior art keywords
scn11a
scn1
expression level
antagonist
endometriosis
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/GB2015/051853
Other languages
French (fr)
Inventor
Michael Joseph FINNEN
Erin GREAVES
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Edinburgh
Original Assignee
University of Edinburgh
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Edinburgh filed Critical University of Edinburgh
Publication of WO2015198054A1 publication Critical patent/WO2015198054A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/185Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19Carboxylic acids, e.g. valproic acid
    • A61K31/20Carboxylic acids, e.g. valproic acid having a carboxyl group bound to a chain of seven or more carbon atoms, e.g. stearic, palmitic, arachidic acids
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/045Hydroxy compounds, e.g. alcohols; Salts thereof, e.g. alcoholates
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00Drugs for genital or sexual disorders; Contraceptives

Definitions

  • the present invention relates to a novel therapy for the treatment of endometriosis comprising the combination of a SCN11A antagonist and a SCN11A expression level modifier.
  • the invention provides the combination of omega-3 fatty acid and menthol for the treatment of endometriosis.
  • Endometriosis is a painful and distressing chronic inflammatory and proliferative disease affecting up to 1 in 10 women of childbearing age, in which cells which in normal development would line the uterus, the endometrial cells, and thereby naturally detach and leave the body as part of the menstrual cycle, in fact grow outside the lining of the uterus womb. Whilst this abnormal growth of endometrial tissue is common on the ovaries and fallopian tubes, it can occur on other organs in the pelvic and bladder regions. During the menstrual cycle, such abnormal endometrial tissue outside of the uterus has no natural way to exit the body and the sufferer will commonly experience pain.
  • SCN1 1A also known as Nav1.9 is a voltage-gated sodium ion channel protein which in humans is encoded by the SCN1 1A gene. Mutations in the SCN11A gene have been associated with loss of pain perception in man (Nature Genetics 45 1319 2013). We have now found that that SCN11A has a prominent role in endometriosis, and in particular we have found that SCN11A is overexpressed in the peritoneum of women with endometriosis compared to women that have pain but no endometriosis. We have also demonstrated that omega-3 fatty acids down regulate gene expression of SCN11A in rat dorsal root ganglia neurons.
  • a novel therapy for the treatment of endometriosis comprising the combination of a SCN1 1A antagonist and a SCN1 1A expression level modifier.
  • a novel therapy for the treatment of endometriosis comprising the combination of omega-3 fatty acid and menthol.
  • a novel therapy for the treatment of endometriosis comprising one or more agents which inhibit the expression levels and/or activity of SCN1 1A.
  • the present invention provides a novel therapy for the treatment of dysmenorrhea comprising one or more agents which inhibit the expression levels and/or activity of SCN1 1A, and in particular the combination of a SCN 1 1A antagonist and a SCN1 1A expression level modifier.
  • compositions of the above- noted therapies and their medical utility particularly for the treatment of pain associated with endometriosis.
  • SCN1 1A is also known as NaN, SNS-2, NAV1.9, and SCN 12A.
  • SCN1 1A encodes Nav1.9, a voltage-gated sodium channel alpha subunit, type XI.
  • Nav1.9 shares 50% identity with most of the other Nav isoforms, but does not, based on phylogeny, belong to a new Na channel subfamily.
  • Nav1.9 is best known for its high expression levels in peripheral sensory neurons and is thought to carry the NaN current, a persistent and tetrodrotoxin (TTX)- resistant voltage-gated Na current, and as indicated herein the involvement of Nav 1.9 in pain has been proposed.
  • TTX tetrodrotoxin
  • a SCN11A antagonist as defined herein means an agent capable of nullifying, or otherwise reducing the impact of SCN11A and examples of SCN11A antagonists suitable for use herein are independently selected from: menthol; mibefradil; inorganic l(Ca) blockers; and mixtures or combinations thereof.
  • the present invention provides a novel therapy for the treatment of endometriosis comprising the combination of menthol and a SCN11A expression level modifier.
  • SCN1 1A expression level modifiers can also be called SCN1 1A down- regulating agents.
  • Suitable SCN1 1A expression level modifying agents for use herein are omega-3 fatty acids.
  • an SCN1 1A expression level modulator can be potentiated (increased) by co-administration with the SCN1 1A antagonist menthol.
  • the present invention provides a novel therapy for the treatment of endometriosis-associated pain comprising the combination of menthol and omega-3 fatty acid.
  • Omega-3 fatty acids are also known as ⁇ -3 fatty acids or n-3 fatty acids, and the term refers to a group of three fats: ALA from plant oils; and EPA and DHA which are commonly found in marine oils.
  • Alpha (a) linolenic acid (ALA), cis, cis, cis -9, 12, 15-octadecatrienoic acid, is also known as (9Z, 12Z, 15Z)-9,12,15-Octadecatrienoic acid, Industrene 120 and, in the nomenclature of fatty acids, 18:3 (n-3).
  • ALA is abundant in nature, with plant oils, specifically seed oils, and most notably chia (chia sage), perilla (shiso), flaxseed (linseed oil), rapeseed (canola) and soybeans being the richest sources, and kiwifruit (Chinese gooseberry), lingonberry (cowberry), camelina (camelina), puslane (portulaca), sea buckthorn (seaberry)and hemp (cannabis) less so, with alternative sources being the thylakoid membranes in the leaves of pea leaves (pisum sativum).
  • Synthetic ALA is commercially available.
  • Eicosapentaenoic acid (5Z,8Z, 11Z, 14Z, 17Z)-5,8, 11 , 14,17-icosapentaenoic acid, is also known as timnodonic acid, and 20:5(n-3).
  • EPA Eicosapentaenoic acid
  • timnodonic acid 20:5(n-3).
  • common sources of EPA in dietary terms are oily fish or fish oils such as cod liver, herring, mackerel, salmon, menhaden, and sardine as well as some edible seaweeds.
  • EPA itself is produced from algae, and is available commercially via microalgae production.
  • Docosahexaenoic acid (DHA), cis, cis, cis-, cis— docosa-4,7,10, 13, 16, 19-hexa-enoic acid or (4Z,7Z, 10Z, 13Z, 16Z, 19Z)-docosa-4,7, 10, 13, 16, 19-hexaenoic acid, is also known as Doconexent, cervonic acid and 22:6(n-3).
  • the richest natural sources of DHA are cold- water oceanic fish oils. DHA can be commercially produced from Crypthecodinium cohnii and Schizochytrium microalgae.
  • Suitable omega-3 fatty acids for use herein are independently selected from: ALA; EPA; DHA; and mixtures and combinations thereof.
  • Preferred herein are omega-3 fatty acids derivable from fish oils, and in particular EPA, DHA and mixtures thereof.
  • the present invention provides a novel therapy for the treatment of endometriosis comprising the combination of a SCN1 1A antagonist and one or more fish oils. More particularly the present invention provides a novel therapy for the treatment of endometriosis comprising the combination of menthol and one or more omega-3 fatty acids derivable from fish oils, and in particular EPA, DHA and mixtures thereof.
  • Exemplary omega-3 fatty acids for use herein include: commercially available purified EPA and/or commercially available DHA such as are available from Swanson Health Products, Fargo, ND, USA; commercially available EPA and/or commercially available DHA such as Max Epa, Omega-3, Salmon Oil, or Superepa; commercially available mixtures of EPA and DHA such as are available from Omacor for example Omacor fish oils having EPA (465mg) and DHA (375mg).
  • the relative ratios of SCN1 1A antagonist : SCN 11A expression level modifier suitable for use in the combinations according to the invention are between about: 10 : 1 to about 1 : 10; 5 : 1 to about 1 : 5; and about 2 : 1 to about 1 : 2, wherein the relative ratios are based on the total weight percent (wt. %) of antagonist(s) : modifier(s).
  • the relative amounts of EPA and DHA are between about 0.1 % to about 99.9%.
  • the SCN11A expression modifier (100%) includes from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA, wherein the relative percentages are based on weight percent (wt. %) of each material, and wherein the additive percent levels of EPA and DHA present equate to 100%.
  • the relative amount of each is 100%.
  • the present invention provides a novel therapy for the treatment of endometriosis- associated pain comprising the combination of menthol and one or more omega-3 fatty acids derivable from fish oils wherein the ratios of menthol : omega-3 fatty acids are between about: 10 : 1 to about 1 : 10 and wherein the omega-3 fatty acids consists essentially of from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA.
  • the present invention provides a novel therapy for the treatment of endometriosis- associated pain comprising the combination of menthol and one or more omega-3 fatty acids derivable from fish oils wherein the ratios of menthol : omega-3 fatty acids are between about: 10 : 1 to about 1 : 10 and wherein the omega-3 fatty acids consists essentially of EPA or DHA.
  • the present invention provides a novel therapy for the treatment of dysmenorrhea comprising one or more agents which inhibit the expression levels and/or activity of SCN 1 1A, and in particular the combination of a SCN 1 1A antagonist and a SCN1 1A expression level modifier.
  • Suitable SCN11A expression level modifying agents for such use are omega-3 fatty acids, as defined hereinbefore, and in particular EPA and/or DHA as defined and in the relative levels as defined hereinbefore.
  • Suitable SCN1 1A antagonists for such use are as defined hereinbefore is in particular menthol.
  • Menthol may be utilised either alone or within a preparation containing peppermint oil.
  • Peppermint oil contains between 30% to 55% menthol, a commercially available source of menthol in a peppermint oil based preparation is Colpermin® available from McNeil Healthcare.
  • dysmenorrhea is related to pain in women of childbearing age.
  • Primary dysmenorrhea is often referred to as period pain, and is generally associated with painful periods, and is most often experienced by younger women from their teenage years until the end of their 20s.
  • Pain during the menstrual cycle can be caused by problems in the womb or pelvis, such as for example endometriosis.
  • the present invention additionally provides a novel therapy for the treatment of pain associated with secondary dysmenorrhea comprising one or more agents which inhibit the expression levels and/or activity of SCN11 A, and in particular the combination of a SCN1 1 A antagonist and a SCN1 1A expression level modifier.
  • the invention provides formulations for use in the novel therapy according to the present invention, in any of the forms detailed herein, and particularly at least one SCN11A antagonist and at least one SCN11A expression level modifier formulated for pharmaceutical and/or nutraceutical use and optionally further comprising a pharmaceutically and/or nutraceutical acceptable diluent, excipient and/or carrier.
  • the invention therefore additionally includes pharmaceutical formulations which may include, in addition to the therapeutic compositions as defined hereinbefore, which include at least one SCN11A antagonist and at least one SCN1 1A expression level modifier, a pharmaceutically or nutraceutically acceptable diluent, excipient and/or carrier.
  • Such formulations may be used in the methods of the disclosure.
  • pharmaceutical or nutraceutically formulations may include a buffer, stabiliser and/or other material well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the at least one SCN1 1A antagonist and at least one SCN1 1A expression level modifier.
  • the precise nature of the carrier or other material will depend on the route of administration, which may be any suitable route.
  • the oral route is preferred.
  • Alternative routes which may be used are independently selected from: local (topical administration); parenteral administration and particularly by infusion or injection (with or without a needle); subcutaneous injection; intravenous injection; infusion.
  • Other routes of administration which may be used include administration by inhalation or intranasal administration.
  • the formulations of the invention may be administered rectally or vaginally, for example, in the form of a suppository, pessary, or enema.
  • Cocoa butter is a traditional suppository base, but various alternatives may be used as appropriate.
  • the formulations may be to be immediate and/or modified release.
  • Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release.
  • a preferred formulation herein is an oral modified release formulation.
  • the invention provides a pharmaceutical formulation for oral delivery comprising one or more SCN11A antagonist, one or more SCN11 A expression level modifier and a pharmaceutically acceptable diluent, excipient and/or carrier wherein said formulation is formulated for modified release.
  • the invention provides for co-administration via oral delivery of a pharmaceutical formulation formulated for immediate or modified release comprising one or more SCN11A antagonist, and a pharmaceutical formulation formulated for modified release comprising one or more SCN11A expression level modifier wherein each formulation independently additionally includes a pharmaceutically acceptable diluent, excipient and/or carrier.
  • Amounts effective for therapeutic use which may be a prophylactic use, will depend upon the severity of the disease and the general state of the patient's health.
  • Therapeutically effective amounts of at least one SCN11A antagonist and at least one SCN11A expression level modifier are those which provide either subjective relief of a symptom(s) or an objectively identifiable improvement as noted by the clinician or other qualified observer.
  • Single or multiple administrations of the pharmaceutical or nutraceutical formulations of the invention may be are administered depending on the dosage and frequency as required and tolerated by the patient.
  • the formulation should provide a sufficient quantity of at least one SCN11A antagonist and at least one SCN1 1A expression level modifier as disclosed herein to effectively treat the patient, bearing in mind though that it may not be possible to achieve effective treatment in every instance.
  • the dosage can be administered once but may be applied periodically until either a therapeutic result is achieved or until side effects warrant discontinuation of treatment.
  • the dose may be sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the patient.
  • Suitable daily dose ranges for the at least one SCN1 1A antagonist are: from about 15mg to about 200mg per day; from about 20mg to about 150mg per day; from about 30mg to about 100mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day.
  • menthol is provided at: from about 15mg to about 200mg per day; from about 20mg to about 150mg per day; from about 30mg to about 100mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day.
  • Suitable daily dose ranges for the at least one SCN1 1A expression level modifier are: from about 1.5mg to about 2000mg per day; from about 2mg to about 1500mg per day; from about 3mg to about 1000mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day.
  • EPA and/or DHA is provided at: from about 1.5mg to about 2000mg per day; from about 2mg to about 1500mg per day; from about 3mg to about 1000mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day.
  • any specific dosage of a pharmaceutical formulation comprising at least one SCN11A expression level modifier, for example a fish oil, such as EPA and/or DHA, and at least one SCN1 1A antagonist, for example menthol, as defined hereinbefore may be provided in a single dosage form, such as a single tablet, or in a multiple dosage format, such as two or more tablets in accordance with the needs of the particular patient.
  • at least one SCN 11A antagonist and the at least one SCN 1 1A antagonist are coadministered as separate pharmaceutical formulations as detailed hereinbefore then each may be independently provided in a single dosage form, such as a single tablet, or in a multiple dosage format, such as two or more tablets in accordance with the needs of the particular patient.
  • novel and inventive treatment in accordance with the present invention may also be provided in combination with one or more of any of the pre-existing medicaments which are known to have potential for the amelioration of the symptoms of endometriosis, such as for example currently prescribed medicaments for pain relief and/or hormonal treatment.
  • Such prescribed medicaments for pain relief include for example: non-steroidal anti- inflammatory drugs (NSAIDS) such as Ibuprofen, Voltarol and Ponstan (mefanemic acid); paracetamol; pain modifiers including tricyclic anti-depressants such as Amitriptyline; glucocorticoids, opioids, anticonvulsants, antidepressants, Na + or Ca 2+ channel blockers, inhibitors of TRPV1 channel function.
  • NSAIDS non-steroidal anti- inflammatory drugs
  • Ibuprofen Voltarol and Ponstan (mefanemic acid)
  • paracetamol pain modifiers including tricyclic anti-depressants such as Amitriptyline
  • glucocorticoids opioids, anticonvulsants, antidepressants, Na + or Ca 2+ channel blockers, inhibitors of TRPV1 channel function.
  • Such prescribed hormonal based medicaments include for example: the combined oral contraceptive pill ("the Pill”); Mirena Coil; progestogen-containing drugs such as for example Medroxyprogesterone (Provera), Norethisterone (Primolut), Dydrogesterone (Duphaston)and Depo-Provera; GnRH analogues such as for example Leuprorelin (Prostap), Goserelin (Zoladex), Nafarelin (Synarel), Buserelin (Suprecur) and Triptorelin (Decapeptyl); synthetic androgens (testosterone) such as for example Danazol and Gestrinone (Dimetriose).
  • progestogen-containing drugs such as for example Medroxyprogesterone (Provera), Norethisterone (Primolut), Dydrogesterone (Duphaston)and Depo-Provera
  • GnRH analogues such as for example Leupro
  • An approach including both current medicaments for relief of symptoms in conjunction with a pharmaceutical or nutraceutical formulation including least one SCN1 1a antagonist and at least one SCN11A expression level modifier in accordance with the present invention may be particularly suited to subjects who are experiencing chronic pain from a pre-existing diagnosis of endometriosis and whom are already receiving medication for symptom management.
  • two or more pharmaceutical compositions may conveniently be combined in the form of a kit suitable for coadministration of such compositions.
  • the kit of the invention comprises two or more separate pharmaceutical or nutraceutical compositions, at least one of which contains a pharmaceutical or nutraceutical composition of at least one SCN11A antagonist and at least one SCN11A expression level modifier in accordance with the invention, and means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet.
  • a kit is the familiar blister pack used for the packaging of tablets, capsules and the like.
  • the kit of the invention is particularly suitable for administering different dosage forms, for example, oral and parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another.
  • the kit typically comprises directions for administration and may be provided with a so-called memory aid.
  • references herein to "treatment” include references to curative, palliative and prophylactic treatment.
  • mice (day 1) were primed with subcutaneous (sc) injections of 100ng (E2, days 7-9), treated with progesterone (P4; Sigma) delivered via a SILASTIC implant (DOW CORNING, USA) from days 13-19 and injected with 5 ng E2 in sesame oil on days 13, 14 and 15.
  • sc subcutaneous
  • P4 progesterone
  • Tissue from one decidualized donor horn was used to inoculate each recipient mouse (approx. 40 mg tissue/ 0.2 ml PBS per mouse).
  • three weeks following i.p. injection recipient mice were culled, photographs taken with lesions carefully dissected from surrounding tissue and either fixed in 4% normal buffered formaldehyde for histological analysis or placed in RNA Save (GENEFLOW, UK) for RNA extraction.
  • Omacor® are FDA approved and widely used by women, and can therefore be easily transferred to a clinical trial. Pain associated behavior was recorded on consecutive days for 1 week during hours of darkness for periods of ten minutes with mice in observation boxes. The pain score was based on numerical assessment of periods spent licking the abdomen and over-grooming.
  • Omacor® are FDA approved and widely used by women, and can therefore be easily transferred to a clinical trial. Pain associated behavior was recorded on consecutive days for
  • DRG Dorsal root ganglia
  • Papain commercially available from Worthington, Lakewood, NJ, USA
  • L-Cysteine commercially available from Sigma, Dorset, UK
  • DNasel also available from Sigma, UK
  • MEM minimal essential medium
  • the dissociated DRGs were plated in 200 ⁇ drops (with approximately 100,000 soma per well) using a pipette, onto Poly-D-Lysine at levels of from 5 to 10 ⁇ g/ ml (obtained from Sigma, UK);) and Matrigel (obtained from BD Biosciences, Oxford, UK) at a ratio of 1 :40 diluted in sterile water) coated coverslips in M1 media (high glucose Dulbecco's Modified Eagle Medium (DMEM;, obtained from Gibco), supplemented with a solution of 0.01 % Penicillin-Streptomycin (Pen/Strep), 10% fetal calf serum (FCS) and 0.1 ⁇ g/ml nerve growth factor (NGF obtained from Serotec, Oxford, UK) and maintained at 37°C in an atmosphere containing 7.5 % C0 2 .
  • M1 media high glucose Dulbecco's Modified Eagle Medium (DMEM;, obtained from Gibco)
  • DMEM high glucose D
  • the wells were then carefully flooded with 2ml M1 , using a pipette supplemented with the anti-mitotic FdU (10 ⁇ , obtained from Sigma, UK) and the media was changed every 2 days until contaminating astrocytes were eliminated ( ⁇ 6 days; confirmed by microscopic visualisation).
  • the medium was changed from a supplemented M1 medium, to a phenol red free medium supplemented with 10% fatty acid free bovine serum albumin (BSA).
  • BSA bovine serum albumin
  • the dissociated DRGs were then treated with either: vehicle control; a balanced PUFA formulation; a formulation of high Omega-3; or high Omega-6 PUFA.
  • vehicle control a balanced PUFA formulation
  • high Omega-3 a formulation of high Omega-3
  • high Omega-6 PUFA a formulation of high Omega-6 PUFA.
  • Table 1 The relative compositions of these are illustrated in Table 1. The treatments were performed in triplicate, and three separate experiments performed. After an incubation of 24h the DRGs were then harvested for RNA extraction.
  • Figure 1 shows two charts A and B, wherein chart A indicates the expression levels of SCN1 1A in the peritoneal tissue of different groups of women where the vertical axis is the level of SCN11A expressed as relative quantification (RQ) compared to a control sample, and the horizontal axis indicates the test groups, and chart B indicates the expression levels of SCN11A in dorsal root ganglia where the vertical axis is the level of SCN11A expressed and the horizontal axis indicates the test groups.
  • Statistical analysis was performed using a one way analysis of variance (ANOVA) followed by a Newman Keuls post-comparison test. **: p ⁇ 0.01.
  • Figure 2 shows various aspects of a murine model of endometriosis.
  • A is a schematic of experimentally induced endometriosis in a mouse model.
  • B is an illustration of an H & E stain of a typical lesion recovered from the peritoneum of experimental mice.
  • C is an illustration of dual immunofluorescence for the endothelial cell marker CD31 and the pan neuronal marker PGP9.5 indicating high levels of vascularisation in lesions and readily detectable small diameter nerve fibres. In the subsection indicated by the dotted line which has been expanded the arrows are pointing to the neuronal marker PGP9.5. In this expended subsection an area of immunofluorescence for the endothelial cell marker CD31 is clearly indicated around the third arrow.
  • E is an illustration of the results of the QPCR analysis of EP2.
  • F is an illustration of the results of the QPCR analysis of COX1.
  • RQ Relative quantification. *** p ⁇ 0.001.
  • Omacor® highly purified omega-3 acid ethyl esters
  • EXAMPLE 1 Expression of SCN 11A in peritoneal tissue of different groups of women
  • the level of SCN1 1A expression in each group was determined using the method described hereinbefore.
  • the relative levels of SCN1 1A expression from each group can be compared because the peritoneal tissue or lesion from each patient is biopsied from the same area (pouch of Douglas) which is prone to endometriosis development. All samples were run on the same plate and compared to the same calibrator and endogenous house-keeping gene. The results of this experiment, and as illustrated in Chart A in Figure 1 , show that women with endometriosis-associated pain have unique SCN11A mRNA levels.
  • Chart A illustrates the relative levels of SC1 1 A expressed in the peritoneal tissue of four groups of women: Control; Pain; Endometriosis; Lesions and demonstrates that an increased level of SCN11A expression only applies to the peritoneal tissue of women with endometriosis.
  • RQ Relative quantification (p ⁇ 0.01).
  • EXAMPLE 2 Effect of Omega-3 on SCN11A mRNA levels in an animal model To determine the effect of omega-3 on SCN1 1A mRNA levels we carried out experiments to assess the impact of balanced, high omega-3, and high omega-6 levels on levels of SCN11A expressed in rat DRG neurons.
  • Chart B in Figure 1 shows a reduction in expression levels of SCN1 1A mRNA by omega-3 in the rat spinal cord model.
  • Chart D of Figure 2 shows that mice with induced endometriosis have increased level of pain-associated behaviours.
  • EXAMPLE 4 Modification of Pain Behavior in Mice with Experimentally-induced Endometriosis
  • Mice were experimentally induced with endometriosis in accordance with the method detailed hereinbefore.
  • To determine the impact of EPA on the pain-associated behaviours of mice with experimentally induced endometriosis versus control mice we carried out the following experiment.
  • Chart A of Figure 3 shows that mice with induced endometriosis have reduced pain behaviours when treated with EPA.
  • a novel therapy for the treatment of endometriosis comprising the combination of SCN11 A antagonist and a SCN1 1A expression level modifier, and in particular wherein the SCN1 1 A antagonist is menthol and the SCN11 A expression level modifier is one or more fish oils, especially EPA.
  • FIG 2 Charts E, F and G illustrate the unique EP2, COX-1 and COX-2 levels found in endometriosis lesions in the endometriosis mouse model;
  • Figure 2 Charts G and D illustrate that mice with experimentally-induced endometriosis have increased pain-associated behaviours; and
  • Figure 3 Chart A mice with induced endometriosis have reduced pain behaviour when treated with EPA whilst in Figure 3, Chart B mice with experimentally induced endometriosis which are treated with EPA have reduced levels of serum PGE2 (EP2) levels.
  • EP2 serum PGE2
  • a novel therapy for the treatment of for the alleviation/mitigation of pain associated with dysmenorrhea, particularly secondary dysmenorrhea comprising the combination of SCN11A antagonist and a SCN11A expression level modifier, and in particular wherein the SCN11A antagonist is menthol and the SCN11A expression level modifier is one or more fish oils, an omega-3 fatty acid, or EPA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Chemical & Material Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Medicinal Chemistry (AREA)
  • Epidemiology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Reproductive Health (AREA)
  • Endocrinology (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

Described herein are new treatments for the pain associated with endometriosis. More particularly, there is provided a novel combination of at least one SCN11Aantagonistand at least one SCN11Aexpression level modifier for use in the treatment of endometriosis.

Description

NOVEL TREATMENT FOR ENDOMETRIOSIS
FIELD OF THE INVENTION
The present invention relates to a novel therapy for the treatment of endometriosis comprising the combination of a SCN11A antagonist and a SCN11A expression level modifier. In particular the invention provides the combination of omega-3 fatty acid and menthol for the treatment of endometriosis.
BACKGROUND OF THE INVENTION
Endometriosis is a painful and distressing chronic inflammatory and proliferative disease affecting up to 1 in 10 women of childbearing age, in which cells which in normal development would line the uterus, the endometrial cells, and thereby naturally detach and leave the body as part of the menstrual cycle, in fact grow outside the lining of the uterus womb. Whilst this abnormal growth of endometrial tissue is common on the ovaries and fallopian tubes, it can occur on other organs in the pelvic and bladder regions. During the menstrual cycle, such abnormal endometrial tissue outside of the uterus has no natural way to exit the body and the sufferer will commonly experience pain. However, the long term damage to the ovaries and fallopian tubes, as well as fertility issues associated with endometriosis and the fact that there is no cure, mean that a diagnosis of endometriosis can be very distressing, especially for women wishing to have children.
As there is no treatment or cure for endometriosis per se, presently symptoms associated with endometriosis are managed by a variety of different approaches. Pain relief is the most common treatment, and is routinely treated using over the counter analgesics / pain relieving medicaments. Alternatively, reduction of oestrogen levels, via hormone treatment is used to provide symptomatic relief. However this is not usually a long-term approach. Particularly where potential fertility is an issue, varying degrees of invasive treatments to remove areas of endometriosis can be employed via endometrial ablation, laparoscopy, laparotomy or in extreme cases hysterectomy. Although the nature of this condition is such that it can return even post-surgery.
Thus there is a high unmet medical need for effective therapies which can deliver improvements in either the management of the symptoms associated with endometriosis, and/or the underlying chronic condition itself.
The search for a potential therapy for the treatment of endometriosis has been long-hindered by the lack of clarity in relation to the aetiology of the disease. We have now found that
l SCN1 1A has a potentially prominent role in the search for an effective treatment for the pain associated with endometriosis.
SCN1 1A, also known as Nav1.9 is a voltage-gated sodium ion channel protein which in humans is encoded by the SCN1 1A gene. Mutations in the SCN11A gene have been associated with loss of pain perception in man (Nature Genetics 45 1319 2013). We have now found that that SCN11A has a prominent role in endometriosis, and in particular we have found that SCN11A is overexpressed in the peritoneum of women with endometriosis compared to women that have pain but no endometriosis. We have also demonstrated that omega-3 fatty acids down regulate gene expression of SCN11A in rat dorsal root ganglia neurons.
In brief we have found that there is an increased expression of SCN11A in peritoneal tissue of women with endometriosis and without wishing to be bound to any particular theory we believe that a combination therapy based on a SCN1 1A expression level modifier and a SCN1 1A antagonist would provide a potentially highly effective treatment for endometriosis- associated pain.
Although various ion channels have been reported as being associated with pain, and in particular it has been proposed by Martinez and Melgar, European Journal of Pain 12 (2008) 934-944, that there may be a link between voltage-gated sodium ion channels, such as SCN1 1A (Nav 1.9 protein) and pain, prior to the present invention there had been no suggestion of the implication of SCN 11 A in the treatment of endometriosis.
Although the analgesic properties of menthol are well established, having been used for the delivery of pain relief since Greek times, and it has more recently been proposed that at least some of these analgesic properties may be mediated by voltage-gated sodium channels, Gaudioso et al., Pain, 153 (2012) 4730484, prior to the present invention there has been no suggestion that menthol may be of particular utility in the potential treatment of endometriosis.
The potential impact of omega-3 fatty acids on endometriosis has been reported, Netsu et al., Fertility and Sterility, Vol 90, Suppl 2, October 2008. However, prior to the present invention there has been no suggestion that these effects are mediated by SCN11A or the potential impact of fatty acids on the pain associated with endometriosis.
SUMMARY OF THE INVENTION According therefore to an aspect of the present invention there is provided a novel therapy for the treatment of endometriosis comprising the combination of a SCN1 1A antagonist and a SCN1 1A expression level modifier.
According to an aspect of the present invention there is provided a novel therapy for the treatment of endometriosis comprising the combination of omega-3 fatty acid and menthol.
According to a yet further aspect of the present invention there is provided a novel therapy for the treatment of endometriosis comprising one or more agents which inhibit the expression levels and/or activity of SCN1 1A.
According to a still further aspect, the present invention provides a novel therapy for the treatment of dysmenorrhea comprising one or more agents which inhibit the expression levels and/or activity of SCN1 1A, and in particular the combination of a SCN 1 1A antagonist and a SCN1 1A expression level modifier.
According to further aspects there are provided pharmaceutical compositions of the above- noted therapies and their medical utility, particularly for the treatment of pain associated with endometriosis.
DETAILED DESCRIPTION
The gene SCN1 1A is also known as NaN, SNS-2, NAV1.9, and SCN 12A. SCN1 1A encodes Nav1.9, a voltage-gated sodium channel alpha subunit, type XI. Nav1.9 shares 50% identity with most of the other Nav isoforms, but does not, based on phylogeny, belong to a new Na channel subfamily. Nav1.9 is best known for its high expression levels in peripheral sensory neurons and is thought to carry the NaN current, a persistent and tetrodrotoxin (TTX)- resistant voltage-gated Na current, and as indicated herein the involvement of Nav 1.9 in pain has been proposed. A SCN11A antagonist as defined herein means an agent capable of nullifying, or otherwise reducing the impact of SCN11A and examples of SCN11A antagonists suitable for use herein are independently selected from: menthol; mibefradil; inorganic l(Ca) blockers; and mixtures or combinations thereof.
As proposed herein and as discussed in relation to the results detailed hereinafter, there are advantages for the combination of at least ne SCN11A expression level modulator and at least one SCN1 1A antagonist. The analgesic effect of an SCN1 1A expression level modulator can be augmented by co-administration with the SCN11A antagonist menthol.
Accordingly the present invention provides a novel therapy for the treatment of endometriosis comprising the combination of menthol and a SCN11A expression level modifier.
SCN1 1A expression level modifiers, or modulators, can also be called SCN1 1A down- regulating agents. Suitable SCN1 1A expression level modifying agents for use herein are omega-3 fatty acids.
The analgesic effect of an omega-3 fatty acid, an SCN1 1A expression level modulator can be potentiated (increased) by co-administration with the SCN1 1A antagonist menthol.
Accordingly the present invention provides a novel therapy for the treatment of endometriosis-associated pain comprising the combination of menthol and omega-3 fatty acid.
Omega-3 fatty acids are also known as ω-3 fatty acids or n-3 fatty acids, and the term refers to a group of three fats: ALA from plant oils; and EPA and DHA which are commonly found in marine oils.
Alpha (a) linolenic acid (ALA), cis, cis, cis -9, 12, 15-octadecatrienoic acid, is also known as (9Z, 12Z, 15Z)-9,12,15-Octadecatrienoic acid, Industrene 120 and, in the nomenclature of fatty acids, 18:3 (n-3). In common with many essential fatty acids, ALA is abundant in nature, with plant oils, specifically seed oils, and most notably chia (chia sage), perilla (shiso), flaxseed (linseed oil), rapeseed (canola) and soybeans being the richest sources, and kiwifruit (Chinese gooseberry), lingonberry (cowberry), camelina (camelina), puslane (portulaca), sea buckthorn (seaberry)and hemp (cannabis) less so, with alternative sources being the thylakoid membranes in the leaves of pea leaves (pisum sativum). Synthetic ALA is commercially available.
Eicosapentaenoic acid (EPA), (5Z,8Z, 11Z, 14Z, 17Z)-5,8, 11 , 14,17-icosapentaenoic acid, is also known as timnodonic acid, and 20:5(n-3). Whilst common sources of EPA in dietary terms are oily fish or fish oils such as cod liver, herring, mackerel, salmon, menhaden, and sardine as well as some edible seaweeds. EPA itself is produced from algae, and is available commercially via microalgae production.
Docosahexaenoic acid (DHA), cis, cis, cis-, cis— docosa-4,7,10, 13, 16, 19-hexa-enoic acid or (4Z,7Z, 10Z, 13Z, 16Z, 19Z)-docosa-4,7, 10, 13, 16, 19-hexaenoic acid, is also known as Doconexent, cervonic acid and 22:6(n-3). The richest natural sources of DHA are cold- water oceanic fish oils. DHA can be commercially produced from Crypthecodinium cohnii and Schizochytrium microalgae.
Suitable omega-3 fatty acids for use herein are independently selected from: ALA; EPA; DHA; and mixtures and combinations thereof. Preferred herein are omega-3 fatty acids derivable from fish oils, and in particular EPA, DHA and mixtures thereof.
Accordingly the present invention provides a novel therapy for the treatment of endometriosis comprising the combination of a SCN1 1A antagonist and one or more fish oils. More particularly the present invention provides a novel therapy for the treatment of endometriosis comprising the combination of menthol and one or more omega-3 fatty acids derivable from fish oils, and in particular EPA, DHA and mixtures thereof.
Exemplary omega-3 fatty acids for use herein include: commercially available purified EPA and/or commercially available DHA such as are available from Swanson Health Products, Fargo, ND, USA; commercially available EPA and/or commercially available DHA such as Max Epa, Omega-3, Salmon Oil, or Superepa; commercially available mixtures of EPA and DHA such as are available from Omacor for example Omacor fish oils having EPA (465mg) and DHA (375mg).
The relative ratios of SCN1 1A antagonist : SCN 11A expression level modifier suitable for use in the combinations according to the invention are between about: 10 : 1 to about 1 : 10; 5 : 1 to about 1 : 5; and about 2 : 1 to about 1 : 2, wherein the relative ratios are based on the total weight percent (wt. %) of antagonist(s) : modifier(s).
Within the SCN11A expression level modifier ratio, where a mixture of omega-3 fatty acids are present the relative amounts of EPA and DHA are between about 0.1 % to about 99.9%. In other words the SCN11A expression modifier (100%) includes from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA, wherein the relative percentages are based on weight percent (wt. %) of each material, and wherein the additive percent levels of EPA and DHA present equate to 100%. For the avoidance of doubt, where only EPA or DHA are present then the relative amount of each is 100%.
Thus the present invention provides a novel therapy for the treatment of endometriosis- associated pain comprising the combination of menthol and one or more omega-3 fatty acids derivable from fish oils wherein the ratios of menthol : omega-3 fatty acids are between about: 10 : 1 to about 1 : 10 and wherein the omega-3 fatty acids consists essentially of from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA. Thus the present invention provides a novel therapy for the treatment of endometriosis- associated pain comprising the combination of menthol and one or more omega-3 fatty acids derivable from fish oils wherein the ratios of menthol : omega-3 fatty acids are between about: 10 : 1 to about 1 : 10 and wherein the omega-3 fatty acids consists essentially of EPA or DHA.
According to a still further aspect, the present invention provides a novel therapy for the treatment of dysmenorrhea comprising one or more agents which inhibit the expression levels and/or activity of SCN 1 1A, and in particular the combination of a SCN 1 1A antagonist and a SCN1 1A expression level modifier. Suitable SCN11A expression level modifying agents for such use are omega-3 fatty acids, as defined hereinbefore, and in particular EPA and/or DHA as defined and in the relative levels as defined hereinbefore.
Suitable SCN1 1A antagonists for such use are as defined hereinbefore is in particular menthol. Menthol may be utilised either alone or within a preparation containing peppermint oil. Peppermint oil contains between 30% to 55% menthol, a commercially available source of menthol in a peppermint oil based preparation is Colpermin® available from McNeil Healthcare.
In general terms dysmenorrhea is related to pain in women of childbearing age. Primary dysmenorrhea is often referred to as period pain, and is generally associated with painful periods, and is most often experienced by younger women from their teenage years until the end of their 20s.
Secondary dysmenorrhea is often referred to as period pain due to an underlying cause. Pain during the menstrual cycle can be caused by problems in the womb or pelvis, such as for example endometriosis.
The present invention additionally provides a novel therapy for the treatment of pain associated with secondary dysmenorrhea comprising one or more agents which inhibit the expression levels and/or activity of SCN11 A, and in particular the combination of a SCN1 1 A antagonist and a SCN1 1A expression level modifier.
FORMULATIONS AND THERAPEUTIC METHODS The invention provides formulations for use in the novel therapy according to the present invention, in any of the forms detailed herein, and particularly at least one SCN11A antagonist and at least one SCN11A expression level modifier formulated for pharmaceutical and/or nutraceutical use and optionally further comprising a pharmaceutically and/or nutraceutical acceptable diluent, excipient and/or carrier.
The invention therefore additionally includes pharmaceutical formulations which may include, in addition to the therapeutic compositions as defined hereinbefore, which include at least one SCN11A antagonist and at least one SCN1 1A expression level modifier, a pharmaceutically or nutraceutically acceptable diluent, excipient and/or carrier. Such formulations may be used in the methods of the disclosure. Additionally or alternatively, pharmaceutical or nutraceutically formulations may include a buffer, stabiliser and/or other material well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the at least one SCN1 1A antagonist and at least one SCN1 1A expression level modifier. The precise nature of the carrier or other material will depend on the route of administration, which may be any suitable route.
For the provision of relief from pain associated with Endometriosis, the oral route is preferred.
Alternative routes which may be used are independently selected from: local (topical administration); parenteral administration and particularly by infusion or injection (with or without a needle); subcutaneous injection; intravenous injection; infusion. Other routes of administration which may be used include administration by inhalation or intranasal administration.
The formulations of the invention may be administered rectally or vaginally, for example, in the form of a suppository, pessary, or enema. Cocoa butter is a traditional suppository base, but various alternatives may be used as appropriate.
The formulations may be to be immediate and/or modified release. Modified release formulations include delayed-, sustained-, pulsed-, controlled-, targeted and programmed release. A preferred formulation herein is an oral modified release formulation.
According to a further aspect the invention provides a pharmaceutical formulation for oral delivery comprising one or more SCN11A antagonist, one or more SCN11 A expression level modifier and a pharmaceutically acceptable diluent, excipient and/or carrier wherein said formulation is formulated for modified release. According to a further aspect the invention provides for co-administration via oral delivery of a pharmaceutical formulation formulated for immediate or modified release comprising one or more SCN11A antagonist, and a pharmaceutical formulation formulated for modified release comprising one or more SCN11A expression level modifier wherein each formulation independently additionally includes a pharmaceutically acceptable diluent, excipient and/or carrier.
DOSAGE
Amounts effective for therapeutic use, which may be a prophylactic use, will depend upon the severity of the disease and the general state of the patient's health. Therapeutically effective amounts of at least one SCN11A antagonist and at least one SCN11A expression level modifier are those which provide either subjective relief of a symptom(s) or an objectively identifiable improvement as noted by the clinician or other qualified observer.
Single or multiple administrations of the pharmaceutical or nutraceutical formulations of the invention may be are administered depending on the dosage and frequency as required and tolerated by the patient. In any event, the formulation should provide a sufficient quantity of at least one SCN11A antagonist and at least one SCN1 1A expression level modifier as disclosed herein to effectively treat the patient, bearing in mind though that it may not be possible to achieve effective treatment in every instance. The dosage can be administered once but may be applied periodically until either a therapeutic result is achieved or until side effects warrant discontinuation of treatment. The dose may be sufficient to treat or ameliorate symptoms or signs of disease without producing unacceptable toxicity to the patient.
Suitable daily dose ranges for the at least one SCN1 1A antagonist are: from about 15mg to about 200mg per day; from about 20mg to about 150mg per day; from about 30mg to about 100mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day.
According to a further aspect menthol is provided at: from about 15mg to about 200mg per day; from about 20mg to about 150mg per day; from about 30mg to about 100mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day.
Suitable daily dose ranges for the at least one SCN1 1A expression level modifier are: from about 1.5mg to about 2000mg per day; from about 2mg to about 1500mg per day; from about 3mg to about 1000mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day. According to a further aspect EPA and/or DHA is provided at: from about 1.5mg to about 2000mg per day; from about 2mg to about 1500mg per day; from about 3mg to about 1000mg per day; wherein said doses may be provided as a single daily dose, or dosed periodically during the day. For the avoidance of doubt any specific dosage of a pharmaceutical formulation comprising at least one SCN11A expression level modifier, for example a fish oil, such as EPA and/or DHA, and at least one SCN1 1A antagonist, for example menthol, as defined hereinbefore may be provided in a single dosage form, such as a single tablet, or in a multiple dosage format, such as two or more tablets in accordance with the needs of the particular patient. Where the at least one SCN 11A antagonist and the at least one SCN 1 1A antagonist are coadministered as separate pharmaceutical formulations as detailed hereinbefore then each may be independently provided in a single dosage form, such as a single tablet, or in a multiple dosage format, such as two or more tablets in accordance with the needs of the particular patient. The novel and inventive treatment in accordance with the present invention may also be provided in combination with one or more of any of the pre-existing medicaments which are known to have potential for the amelioration of the symptoms of endometriosis, such as for example currently prescribed medicaments for pain relief and/or hormonal treatment.
Such prescribed medicaments for pain relief include for example: non-steroidal anti- inflammatory drugs (NSAIDS) such as Ibuprofen, Voltarol and Ponstan (mefanemic acid); paracetamol; pain modifiers including tricyclic anti-depressants such as Amitriptyline; glucocorticoids, opioids, anticonvulsants, antidepressants, Na+ or Ca2+ channel blockers, inhibitors of TRPV1 channel function.
Such prescribed hormonal based medicaments include for example: the combined oral contraceptive pill ("the Pill"); Mirena Coil; progestogen-containing drugs such as for example Medroxyprogesterone (Provera), Norethisterone (Primolut), Dydrogesterone (Duphaston)and Depo-Provera; GnRH analogues such as for example Leuprorelin (Prostap), Goserelin (Zoladex), Nafarelin (Synarel), Buserelin (Suprecur) and Triptorelin (Decapeptyl); synthetic androgens (testosterone) such as for example Danazol and Gestrinone (Dimetriose). An approach including both current medicaments for relief of symptoms in conjunction with a pharmaceutical or nutraceutical formulation including least one SCN1 1a antagonist and at least one SCN11A expression level modifier in accordance with the present invention may be particularly suited to subjects who are experiencing chronic pain from a pre-existing diagnosis of endometriosis and whom are already receiving medication for symptom management.
KIT-OF-PARTS
Inasmuch as it may desirable to administer a combination of different active compounds, for example, for the purpose of treating a particular disease or condition, it is within the scope of the present invention that two or more pharmaceutical compositions, at least one of which contains a combination in accordance with the invention, may conveniently be combined in the form of a kit suitable for coadministration of such compositions.
Thus the kit of the invention comprises two or more separate pharmaceutical or nutraceutical compositions, at least one of which contains a pharmaceutical or nutraceutical composition of at least one SCN11A antagonist and at least one SCN11A expression level modifier in accordance with the invention, and means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet. An example of such a kit is the familiar blister pack used for the packaging of tablets, capsules and the like.
The kit of the invention is particularly suitable for administering different dosage forms, for example, oral and parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another. To assist compliance, the kit typically comprises directions for administration and may be provided with a so-called memory aid.
For the avoidance of doubt, references herein to "treatment" include references to curative, palliative and prophylactic treatment.
EXPERIMENTAL METHODS Human tissues Peritoneal endometriotic lesion biopsies, taken from the Pouch of Douglas (EL; n=21) and peritoneal biopsies from an adjacent site (EP; n=12) were obtained from women who were undergoing laparoscopic surgery for the treatment of endometriosis associated pain.
Peritoneal biopsies (PP; n=1 1) were collected from women undergoing explorative laparoscopic surgery for pelvic pain but with confirmed absence of endometriosis. Peritoneal biopsies were also collected from women with no pain or endometriosis who were undergoing surgical sterilisation via laparoscopy (Control; n=4).
The women were aged 18-45 years. The biopsy samples were taken during different stages of the menstrual cycle from women who had not been taking exogenous hormones at least 3 months prior to surgery. Ethical approval for this study was obtained from the Lothian Research Ethics Committee (LREC 1 1/AL/0376). All samples were collected after informed consent was obtained. Biopsies were collected into RNAIater, which is commercially available from Applied Biosystems, Warrington, UK, for qRT-PCR.
Mouse model of endometriosis
The methodology for the mouse model of endometriosis utilised herein is in accordance with that detailed in Greaves et. al., The American Journal of Pathology, Vol. 1894, No. 7, July 2014, pp1931-1939, the disclosures of which are incorporated herein by reference. In brief, menstruation was induced in adult donor mice (~8 weeks of age) using a protocol developed by the applicant (Figure 1A upper timeline). In brief, ovariectomized mice (day 1) were primed with subcutaneous (sc) injections of 100ng
Figure imgf000012_0001
(E2, days 7-9), treated with progesterone (P4; Sigma) delivered via a SILASTIC implant (DOW CORNING, USA) from days 13-19 and injected with 5 ng E2 in sesame oil on days 13, 14 and 15. Decidualization was induced within one uterine horn using 20μΙ oil (day 15) and endometrial tissue in the process of being shed from the decidualized horn recovered from mice culled on day 19, 4h after P4 withdrawal (removal of pellet) by opening the horn longitudinally in a Petri dish and scraping the tissue away from the myometrial layer using a scalpel (Figure 1 , B and C). The tissue mass was suspended in 0.2 ml PBS and passed through a 19g needle before being injected intra-peritoneally (i.p.) into anesthetized recipient mice (~8 weeks of age) which had been previously ovariectomized and implanted with an E2 (Sigma) SILASTIC implant (Figure 1A lower timeline). Tissue from one decidualized donor horn was used to inoculate each recipient mouse (approx. 40 mg tissue/ 0.2 ml PBS per mouse). Three weeks following i.p. injection recipient mice were culled, photographs taken with lesions carefully dissected from surrounding tissue and either fixed in 4% normal buffered formaldehyde for histological analysis or placed in RNA Save (GENEFLOW, UK) for RNA extraction.
A pilot experiment was conducted using two groups of mice (n=4 each group) with experimentally induced endometriosis; following lesion establishment for 2 weeks mice received 5% dietary intake of EPA which was extracted from Omacor® fish oil capsules or control sesame oil. Omacor® are FDA approved and widely used by women, and can therefore be easily transferred to a clinical trial. Pain associated behavior was recorded on consecutive days for 1 week during hours of darkness for periods of ten minutes with mice in observation boxes. The pain score was based on numerical assessment of periods spent licking the abdomen and over-grooming. Cell culture and PUFA treatment
Dorsal root ganglia (DRG) were dissected from the spinal cords of E15.5 Sprague-Dawley rat embryos. The DRGs were dissociated using a solution of: 30 μg/ml of Papain (commercially available from Worthington, Lakewood, NJ, USA); 0.24 mg/ml of L-Cysteine (commercially available from Sigma, Dorset, UK; and 40 μg/ml of DNasel (also available from Sigma, UK) in minimal essential medium (MEM) (commercially available from Sigma, UK).
The dissociated DRGs were plated in 200 μΙ drops (with approximately 100,000 soma per well) using a pipette, onto Poly-D-Lysine at levels of from 5 to 10 μg/ ml (obtained from Sigma, UK);) and Matrigel (obtained from BD Biosciences, Oxford, UK) at a ratio of 1 :40 diluted in sterile water) coated coverslips in M1 media (high glucose Dulbecco's Modified Eagle Medium (DMEM;, obtained from Gibco), supplemented with a solution of 0.01 % Penicillin-Streptomycin (Pen/Strep), 10% fetal calf serum (FCS) and 0.1 μg/ml nerve growth factor (NGF obtained from Serotec, Oxford, UK) and maintained at 37°C in an atmosphere containing 7.5 % C02.
After 24h hours the wells were then carefully flooded with 2ml M1 , using a pipette supplemented with the anti-mitotic FdU (10 μΜ, obtained from Sigma, UK) and the media was changed every 2 days until contaminating astrocytes were eliminated (≤ 6 days; confirmed by microscopic visualisation). At least 24 hours prior to running experiments the medium was changed from a supplemented M1 medium, to a phenol red free medium supplemented with 10% fatty acid free bovine serum albumin (BSA).
The dissociated DRGs were then treated with either: vehicle control; a balanced PUFA formulation; a formulation of high Omega-3; or high Omega-6 PUFA. The relative compositions of these are illustrated in Table 1. The treatments were performed in triplicate, and three separate experiments performed. After an incubation of 24h the DRGs were then harvested for RNA extraction.
Table 1 Mg
Mg/250mi Control Balanced High Graega3 High Omega6
Palmitic acid (mg) 0 5.2 5.2 5.2
Oleic {mg} 0 5.1 5.1 5.1
Linoleic {mg} 0 2 2 2
Alpha Linoleic '.{mg} 0 Q.1 0.1 0.1
Arachidonic (mg) 0 0.6 Q 1.2
Eicosapentanoic (mg) 0 0.6 1.2 0
Ethanol final volume (μ!) 1 2 1 1
RNA extraction and cDNA synthesis
Total RNA was extracted from mouse and human tissues by homogenisation in TRI Reagent, which is a monophasic solution of phenol and guanidinium isothiocyanate (a single-step RNA isolation reagent available from Sigma-Aldrich), followed by chloroform phase separation. The top phase (lysate) was then processed using standard methodology by use of an RNAeasy Kit (available from QIAGEN, Crawley, UK). Total RNA from cells was extracted using Buffer RLT (a lysis buffer) and an RNAeasy Kit (both available from QIAGEN). Complementary DNA was synthesized using SuperScript®VILO™ enzyme and reaction mix (both available from Invitrogen, Paisley, UK).
Quantitative real time PCR Real-time PCR reactions were performed using the Roche Universal ProbeLibrary (available from Roche Applied Science, West Sussex, UK) and Express qPCR Supermix (from Invitrogen, Paisley) on a 7900 Fast Real-Time PCR with 18S as the endogenous control. Primer sequences: Human SCN1 1A; (F) acctgagcctgaacaacagg, (R) tttgaactctctggctcgtg, Rat SCNUA; (F) cagaggacgatgcctctaaaa.m (R) ttctgggacagtcgtttggt. Statistics Statistical analysis was carried out using a D'Agostino & Pearson omnibus normality test followed by a one way analysis of variance with a Newman Keuls post-hoc test. * p<0.05, ** p<0.01 , *** p<0.001 , using GraphPad Prism 5 software.
The invention will now be described, by way of illustration only, with reference to the following examples and figures accompanying the specification.
Brief Description of the Figures
Figure 1 : shows two charts A and B, wherein chart A indicates the expression levels of SCN1 1A in the peritoneal tissue of different groups of women where the vertical axis is the level of SCN11A expressed as relative quantification (RQ) compared to a control sample, and the horizontal axis indicates the test groups, and chart B indicates the expression levels of SCN11A in dorsal root ganglia where the vertical axis is the level of SCN11A expressed and the horizontal axis indicates the test groups. Statistical analysis was performed using a one way analysis of variance (ANOVA) followed by a Newman Keuls post-comparison test. **: p<0.01.
Figure 2: shows various aspects of a murine model of endometriosis. A is a schematic of experimentally induced endometriosis in a mouse model. B is an illustration of an H & E stain of a typical lesion recovered from the peritoneum of experimental mice. C is an illustration of dual immunofluorescence for the endothelial cell marker CD31 and the pan neuronal marker PGP9.5 indicating high levels of vascularisation in lesions and readily detectable small diameter nerve fibres. In the subsection indicated by the dotted line which has been expanded the arrows are pointing to the neuronal marker PGP9.5. In this expended subsection an area of immunofluorescence for the endothelial cell marker CD31 is clearly indicated around the third arrow. D indicates the increased levels of pain associated behaviour (p<0.001) exhibited by mice with experimentally induced endometriosis (n=6), compared to mice without any manipulation (control; n=3) and mice which have been ovariectomised followed by E2 supplementation (OVX+E2; n=3). Pain scores are based on a numerical assessment of periods spent licking the abdomen and excessive grooming during a ten minute window in observation boxes during hours of darkness. E is an illustration of the results of the QPCR analysis of EP2. F is an illustration of the results of the QPCR analysis of COX1. G is an illustration of the results of the QPCR analysis of COX2 in the uterus (NU; n=6) and peritoneum (NP; n=9) from cycling mice and the peritoneum (EP; n=6) and lesions (EL; n=8) from mice with endometriosis. RQ: Relative quantification. *** p<0.001. Figure 3: shows two charts A and B, wherein chart A indicates the pain associated behavior in control endometriosis mice compared to endometriosis mice which have been supplemented with Omacor® (highly purified omega-3 acid ethyl esters), and chart B indicates the serum PGE2 levels in control endometriosis mice compared to endometriosis mice which have been supplemented with Omacor. N=4 for each group.
EXPERIMENTAL RESULTS
EXAMPLE 1 : Expression of SCN 11A in peritoneal tissue of different groups of women
To determine whether there was a difference in the level of SCN1 1A expressed in the peritoneal tissue or lesions of women with endometriosis, versus the peritoneum of healthy women without pain or endometriosis (control), or women with chronic pelvic pain but no demonstrable underlying pathology we tested 4 different groups of women. The composition of these groups was:
Control: Peritoneum from women with no pain and no endometriosis undergoing a surgical sterilisation via laparoscopy (n=4). Pain: Peritoneum from women with pain and no demonstrable underlying pathology undergoing an exploratory laparoscopy (n=1 1).
Endometriosis: Peritoneum from women with pain and proven endometriosis (n=12).
Lesions: Peritoneal endometriotic lesions from women with endometriosis (n=21).
The level of SCN1 1A expression in each group was determined using the method described hereinbefore.
The relative levels of SCN1 1A expression from each group can be compared because the peritoneal tissue or lesion from each patient is biopsied from the same area (pouch of Douglas) which is prone to endometriosis development. All samples were run on the same plate and compared to the same calibrator and endogenous house-keeping gene. The results of this experiment, and as illustrated in Chart A in Figure 1 , show that women with endometriosis-associated pain have unique SCN11A mRNA levels.
Figure 1 , Chart A illustrates the relative levels of SC1 1 A expressed in the peritoneal tissue of four groups of women: Control; Pain; Endometriosis; Lesions and demonstrates that an increased level of SCN11A expression only applies to the peritoneal tissue of women with endometriosis. In particular, Chart A of Figure 1 provides a representation of the results of our QPCR analysis of SCN1 1A in the peritoneum from women with no pain and no endometriosis (control; n=4), women with pain but no endometriosis (pain; n=11) and from the peritoneum (endometriosis; n=12) and lesions (lesions; n=21) from women with endometriosis. RQ: Relative quantification (p <0.01).
EXAMPLE 2: Effect of Omega-3 on SCN11A mRNA levels in an animal model To determine the effect of omega-3 on SCN1 1A mRNA levels we carried out experiments to assess the impact of balanced, high omega-3, and high omega-6 levels on levels of SCN11A expressed in rat DRG neurons.
The results of this experiment, and as illustrated in Chart B in Figure 1 , shows a reduction in expression levels of SCN1 1A mRNA by omega-3 in the rat spinal cord model. In particular Chart B of Figure 1 provides a representation of the results of our QPCR analysis SCN11A in rat DRGs treated with different formulations of PUFAs (n=4/group). p<0.05.
EXAMPLE 3: Pain Behavior in Mice with Experimentally-induced Endometriosis To determine the baseline behaviour of mice with experimentally induced endometriosis versus control mice we carried out the following experiment. Mice (n=12) were divided into 3 groups; group 1 (control, n=3) received no procedures, group 2 (OVX+E2, n =3) were ovariectomised and supplemented with a subcutaneous slow release E2 (estradiol) pellet. Group 3 (endometriosis, n=6), were ovariectomised and induced with endometriosis in accordance with the method detailed hereinbefore. After a 21 day period allowed for endometriosis lesion development all mice were observed on consecutive days during hours of darkness for a ten minute period in observation boxes. Pain scores were based on numerical assessment of periods spent licking the abdomen and over-grooming.
The results of this experiment, and as illustrated in Figure 2. In particular Chart D of Figure 2 shows that mice with induced endometriosis have increased level of pain-associated behaviours.
EXAMPLE 4: Modification of Pain Behavior in Mice with Experimentally-induced Endometriosis Mice were experimentally induced with endometriosis in accordance with the method detailed hereinbefore. To determine the impact of EPA on the pain-associated behaviours of mice with experimentally induced endometriosis versus control mice we carried out the following experiment. Mice (n=8) with experimentally induced endometriosis were divided into two groups (n=4 each group); Group 1 (Control) sesame oil as oral gavage; and Group 2 (Omacor) received 5% dietary intake of EPA which was extracted from Omacor® fish oil capsules. Pain-associated behaviour was recorded as detailed hereinbefore.
The results of this experiment are illustrated in Figure 3.
In particular, Chart A of Figure 3 shows that mice with induced endometriosis have reduced pain behaviours when treated with EPA.
On the basis of the demonstrated results provided herein on animal models, and in particular the observed effects that mice with experimentally-induced endometriosis, as illustrated in Figure 3, Chart A, are associated with a knock-down of SCN11A, it is plausible to propose the use of EPA/omega-3 for the alleviation/mitigation of endometrial pain in women with endometriosis.
Further experiments have been carried out using the methodology as detailed hereinbefore for Example 4 and using a 1 % dose of the SCN1 1A antagonist menthol, applied topically. These preliminary experiments have indicated that dosing with menthol has an additive effect (reduction of pain behaviours in mice with induced endometriosis).
Thus according to a further aspect there is provided a novel therapy for the treatment of endometriosis comprising the combination of SCN11 A antagonist and a SCN1 1A expression level modifier, and in particular wherein the SCN1 1 A antagonist is menthol and the SCN11 A expression level modifier is one or more fish oils, especially EPA.
In addition to the results discussed which support the use in endometriosis and particularly the use for the treatment of pain associated with endometriosis, the data presented herein provides support for the proposition of the use of EPA/omega-3 for the alleviation/mitigation of pain associated with dysmenorrhea, particularly secondary dysmenorrhea.
In particular, the following experimental results support this proposition:
Figure 2, Charts E, F and G illustrate the unique EP2, COX-1 and COX-2 levels found in endometriosis lesions in the endometriosis mouse model; Figure 2, Charts G and D illustrate that mice with experimentally-induced endometriosis have increased pain-associated behaviours; and Figure 3, Chart A mice with induced endometriosis have reduced pain behaviour when treated with EPA whilst in Figure 3, Chart B mice with experimentally induced endometriosis which are treated with EPA have reduced levels of serum PGE2 (EP2) levels.
Thus according to a further aspect there is provided a novel therapy for the treatment of for the alleviation/mitigation of pain associated with dysmenorrhea, particularly secondary dysmenorrhea comprising the combination of SCN11A antagonist and a SCN11A expression level modifier, and in particular wherein the SCN11A antagonist is menthol and the SCN11A expression level modifier is one or more fish oils, an omega-3 fatty acid, or EPA. Sequence Listing
SEQ ID NO 1. Human SCN1 1A (F) acctgagcctgaacaacagg; SEQ ID NO 2. Human SCN1 1A (R) tttgaactctctggctcgtg; SEQ ID NO 3. Rat SCN 11A; (F) cagaggacgatgcctctaaaa; SEQ ID NO 4. Rat SCN11A; (R) ttctgggacagtcgtttggt.

Claims

1. A combination of at least one SCN11A antagonist and at least one SCN11A expression level modifier for use as a medicament.
2. A combination of at least one SCN11A antagonist and at least one SCN11A expression level modifier for use in the treatment of endometriosis.
3. A combination according to any of the preceding claims for use in the treatment of pain associated with endometriosis.
4. A combination according to any of the preceding claims wherein the at least one SCN1 1A antagonist is menthol.
5. A combination according to any of the preceding claims wherein the at least one SCN1 1A expression level modifier is an omega-3 fatty acid.
6. A combination according to any of the preceding claims wherein the at least one SCN1 1A expression level modifier is independently selected from: a source of EPA; a source of DHA; and/or mixtures thereof.
7. A combination according to any of the preceding claims wherein the at least one SCN1 1A antagonist is menthol and wherein the at least one SCN1 1A expression level modifier one or more fish oils.
8. A combination according to any of the preceding claims wherein the at least one SCN1 1A antagonist is menthol and wherein the at least one SCN1 1A expression level modifier is EPA and/or DHA from microalgae.
9. A combination according to any of the preceding claims wherein the SCN11A expression modifier includes from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA.
10. A combination according to any of the preceding claims wherein the ratios of SCN1 1A antagonist : SCN11A expression level modifier(s) are between about: 10 : 1 to about 1 : 10 and wherein the SCN1 1a expression level modifier is a mixture of omega-3 fatty acids consisting essentially of from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA, and wherein the SCN11A antagonist is menthol.
1 1. A combination according to any of the preceding claims wherein the ratios of SCN1 1A antagonist : SCN11A expression level modifier(s) are between about: 10 : 1 to about 1 : 10 and wherein the SCN11 a expression level modifier is EPA or DHA.
12. A pharmaceutical formulation comprising one or more SCN11A antagonist, one or more SCN11A expression level modifier and a pharmaceutically acceptable diluent, excipient and/or carrier.
13. A pharmaceutical formulation according to Claim 1 1 formulated for oral delivery.
14. A nutraceutical formulation comprising one or more SCN11A antagonist, one or more SCN1 1A expression level modifier and a nutraceutically acceptable diluent, excipient and/or carrier.
15. A nutraceutical formulation according to Claim 13 formulated for oral delivery.
16. A combination of at least one SCN1 1a antagonist and at least one SCN11 a expression level modifier for use in the treatment of dysmenorrhea or secondary dysmenorrhea.
17. A combination according to Claim 15 wherein the at least one SCN11A antagonist is menthol.
18. A combination according to Claim 15 or 16 wherein the at least one SCN11A expression level modifier is an omega-3 fatty acid.
19. A combination according to any of claims 15 to 17 wherein the at least one SCN1 1A expression level modifier is independently selected from: a source of EPA; a source of DHA; and/or mixtures thereof.
20. A combination according to any of claims 15 to 18 wherein the at least one SCN11A antagonist is menthol and wherein the at least one SCN1 1A expression level modifier is one or more fish oils.
21. A combination according to any of claims 15 to 19 wherein the at least one SCN11A antagonist is menthol and wherein the at least one SCN1 1A expression level modifier is EPA and/or DHA from microalgae.
22. A combination according to any of claims 15 to 20 wherein the SCN11A expression modifier includes from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA.
23. A combination according to any of claims 15 to 21 wherein the ratios of SCN11A antagonist : SCN1 1A expression level modifier(s) are between about: 10 : 1 to about 1 : 10 and wherein the SCN11 a expression level modifier is a mixture of omega-3 fatty acids consisting essentially of from 0.1 % to 99.9% EPA and from about 99.9% to about 0.1 % of DHA, and wherein the SCN11A antagonist is menthol.
24. Use of one or more agents which inhibit the expression levels and/or activity of SCN11 A for the treatment of pain associated with endometriosis.
PCT/GB2015/051853 2014-06-27 2015-06-25 Novel treatment for endometriosis Ceased WO2015198054A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
GB1411468.0 2014-06-27
GBGB1411468.0A GB201411468D0 (en) 2014-06-27 2014-06-27 Novel treatment for endometriosis

Publications (1)

Publication Number Publication Date
WO2015198054A1 true WO2015198054A1 (en) 2015-12-30

Family

ID=51410239

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2015/051853 Ceased WO2015198054A1 (en) 2014-06-27 2015-06-25 Novel treatment for endometriosis

Country Status (2)

Country Link
GB (1) GB201411468D0 (en)
WO (1) WO2015198054A1 (en)

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10538764B2 (en) 2014-06-16 2020-01-21 University Of Southampton Reducing intron retention
US10683503B2 (en) 2017-08-25 2020-06-16 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US10696969B2 (en) 2014-10-03 2020-06-30 Cold Spring Harbor Laboratory Targeted augmentation of nuclear gene output
US10941405B2 (en) 2015-10-09 2021-03-09 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
US11083745B2 (en) 2015-12-14 2021-08-10 Cold Spring Harbor Laboratory Antisense oligomers for treatment of autosomal dominant mental retardation-5 and Dravet Syndrome
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
US11814622B2 (en) 2020-05-11 2023-11-14 Stoke Therapeutics, Inc. OPA1 antisense oligomers for treatment of conditions and diseases
US12060558B2 (en) 2018-05-04 2024-08-13 Stoke Therapeutics, Inc. Methods and compositions for treatment of cholesteryl ester storage disease
US12577561B2 (en) 2019-02-27 2026-03-17 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993009773A1 (en) * 1991-11-18 1993-05-27 Taiyo Gyogyo Kabusiki Kaisha Preventive or curative for dysmenorrhea and food having function of preventing dysmenorrhea
JP2007161591A (en) * 2005-12-09 2007-06-28 Naris Cosmetics Co Ltd Melanogenesis-inhibiting skin care preparation
WO2009095437A1 (en) * 2008-01-30 2009-08-06 Pharmanutra S.R.L. Use of eicosapentaenoic acid and/or docosahexahenoic acid in women with endometriosis

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1993009773A1 (en) * 1991-11-18 1993-05-27 Taiyo Gyogyo Kabusiki Kaisha Preventive or curative for dysmenorrhea and food having function of preventing dysmenorrhea
JP2007161591A (en) * 2005-12-09 2007-06-28 Naris Cosmetics Co Ltd Melanogenesis-inhibiting skin care preparation
WO2009095437A1 (en) * 2008-01-30 2009-08-06 Pharmanutra S.R.L. Use of eicosapentaenoic acid and/or docosahexahenoic acid in women with endometriosis

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
CHRISTELLE GAUDIOSO ET AL: "Menthol pain relief through cumulative inactivation of voltage-gated sodium channels", PAIN, ELSEVIER SCIENCE PUBLISHERS, AMSTERDAM, NL, vol. 153, no. 2, 14 November 2011 (2011-11-14), pages 473 - 484, XP028445462, ISSN: 0304-3959, [retrieved on 20111118], DOI: 10.1016/J.PAIN.2011.11.014 *
GAUDIOSO ET AL., PAIN, vol. 153, 2012, pages 4730484
GREAVES, THE AMERICAN JOURNAL OF PATHOLOGY, vol. 1894, no. 7, July 2014 (2014-07-01), pages 1931 - 1939
HAREL ET AL: "Supplementation with omega-3 polyunsaturated fatty acids in the management of dysmenorrhea in adolescents", AMERICAN JOURNAL OF OBSTETRICS & GYNECOLOGY, MOSBY, ST LOUIS, MO, US, vol. 174, no. 4, 1 April 1996 (1996-04-01), pages 1335 - 1338, XP005691219, ISSN: 0002-9378, DOI: 10.1016/S0002-9378(96)70681-6 *
MARTINEZ; MELGAR, EUROPEAN JOURNAL OF PAIN, vol. 12, 2008, pages 934 - 944
NAHID RAHBAR ET AL: "Effect of omega-3 fatty acids on intensity of primary dysmenorrhea", INTERNATIONAL JOURNAL OF GYNECOLOGY AND OBSTETRICS, NEW YORK, NY, US, vol. 117, no. 1, 22 December 2011 (2011-12-22), pages 45 - 47, XP028467327, ISSN: 0020-7292, [retrieved on 20120103], DOI: 10.1016/J.IJGO.2011.11.019 *
NATURE GENETICS, vol. 45, 2013, pages 1319
NETSU ET AL., FERTILITY AND STERILITY, vol. 90, no. 2, October 2008 (2008-10-01)
NETSU S ET AL: "Oral eicosapentaenoic acid supplementation as possible therapy for endometriosis", FERTILITY AND STERILITY, ELSEVIER SCIENCE INC, NEW YORK, NY, USA, vol. 90, no. 4, 1 October 2008 (2008-10-01), pages 1496 - 1502, XP025479669, ISSN: 0015-0282, [retrieved on 20071203], DOI: 10.1016/J.FERTNSTERT.2007.08.014 *
PARVANEH MIRABI ET AL: "Effect of medicinal herbs on primary dysmenorrhoea- a systematic review", IRANIAN JOURNAL OF PHARMACEUTICAL RESEARCH, vol. 13, no. 3, 1 January 2014 (2014-01-01), IR, pages 757 - 767, XP055216120, ISSN: 1735-0328 *

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US11891605B2 (en) 2014-06-16 2024-02-06 University Of Southampton Reducing intron retention
US10538764B2 (en) 2014-06-16 2020-01-21 University Of Southampton Reducing intron retention
US10696969B2 (en) 2014-10-03 2020-06-30 Cold Spring Harbor Laboratory Targeted augmentation of nuclear gene output
US11702660B2 (en) 2015-10-09 2023-07-18 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
US10941405B2 (en) 2015-10-09 2021-03-09 University Of Southampton Modulation of gene expression and screening for deregulated protein expression
US11083745B2 (en) 2015-12-14 2021-08-10 Cold Spring Harbor Laboratory Antisense oligomers for treatment of autosomal dominant mental retardation-5 and Dravet Syndrome
US11096956B2 (en) 2015-12-14 2021-08-24 Stoke Therapeutics, Inc. Antisense oligomers and uses thereof
US10913947B2 (en) 2017-08-25 2021-02-09 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US11873490B2 (en) 2017-08-25 2024-01-16 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US10683503B2 (en) 2017-08-25 2020-06-16 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US12060558B2 (en) 2018-05-04 2024-08-13 Stoke Therapeutics, Inc. Methods and compositions for treatment of cholesteryl ester storage disease
US12577561B2 (en) 2019-02-27 2026-03-17 Stoke Therapeutics, Inc. Antisense oligomers for treatment of conditions and diseases
US11814622B2 (en) 2020-05-11 2023-11-14 Stoke Therapeutics, Inc. OPA1 antisense oligomers for treatment of conditions and diseases
US12338437B2 (en) 2020-05-11 2025-06-24 Stoke Therapeutics, Inc. OPA1 antisense oligomers for treatment of conditions and diseases

Also Published As

Publication number Publication date
GB201411468D0 (en) 2014-08-13

Similar Documents

Publication Publication Date Title
WO2015198054A1 (en) Novel treatment for endometriosis
Lima et al. Effects of 1 or 2 treatments with prostaglandin F2α on subclinical endometritis and fertility in lactating dairy cows inseminated by timed artificial insemination
US20120115782A1 (en) Compositions and methods for treating or inhibiting liver injury
Vahdat et al. Evening primrose oil effect on the ease of cervical ripening and dilatation before operative hysteroscopy
AU2018251616A1 (en) Methods for the treatment of inflammation and inflammatory conditions
DK2276461T3 (en) PHARMACEUTICAL FORMULATION CONTAINING PALMITOYLETHANOLAMIDE AND STEAROYLETHANOLAMIDE
EP2211852A2 (en) Compositions and methods for reducing hepatotoxicity associated with drug administration
Wu et al. The protective effect of sophocarpine in osteoarthritis: an in vitro and in vivo study
WO2023174450A2 (en) Silicone material, silicone tube, implant, pharmaceutical composition, and test method for amount of drug released
RU2455992C1 (en) Preparation for treatment and prevention of postpartum endometritis in cows
Yang et al. Interceed combined with bone marrow mesenchymal stem cells improves endometrial receptivity of intrauterine adhesion
TWI544921B (en) Use of osthole for manufacturing composition for treating focal segmental glomerulosclerosis
CN102014922A (en) Use of maslinic acid for the treatment of disorders and symptoms thereof by inhibiting COX-2
CN110862963B (en) Application of decidua NK cells and cell subsets thereof in preparation of medicines for treating infertility-related diseases
CN1108795C (en) Treatment of uterine contractility disorders with nitric oxide synthase substrates and/or donors, or nitric oxide inhibitors
CN108653319A (en) Application of the ozone carburetion in gynaecological inflammation disease
RU2464979C1 (en) Medicine for treatment and prevention of postnatal endometritis and syndrome of metritis-mastitis-agalactia in sows
CA3199000A1 (en) Composition containing 1,8-cineole for therapeutic use
CN105228631A (en) Comprise the topical formulations of hyaluronic acid, verbascoside and phosphoglycerol inositol
Zhang et al. EP2/4 receptors promote the synthesis of PGE2 increasing tissue damage in bovine endometrial explants induced by Escherichia coli
BRPI0608599A2 (en) Modified release pharmaceutical compositions
Sunita et al. Histone deacetylase: A potential therapeutic target for ovarian dysfunction
WO2018231829A1 (en) Compositions and methods for treating itch, skin inflammation, and pruritus
RU2428173C1 (en) Pharmaceutical composition for treating diseases of lower part of genitourinary system
CN116847833A (en) Compositions for the effective control of fibroblast-like synoviocyte-mediated rheumatoid arthritis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15738965

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15738965

Country of ref document: EP

Kind code of ref document: A1