WO2015195684A2 - Small molecule anti-scarring agents - Google Patents

Small molecule anti-scarring agents Download PDF

Info

Publication number
WO2015195684A2
WO2015195684A2 PCT/US2015/036059 US2015036059W WO2015195684A2 WO 2015195684 A2 WO2015195684 A2 WO 2015195684A2 US 2015036059 W US2015036059 W US 2015036059W WO 2015195684 A2 WO2015195684 A2 WO 2015195684A2
Authority
WO
WIPO (PCT)
Prior art keywords
fibrosis
inhibitors
group
agents
tgfp
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2015/036059
Other languages
French (fr)
Other versions
WO2015195684A3 (en
Inventor
Richard P. Phipps
Collynn WOELLER
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Rochester
Original Assignee
University of Rochester
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Rochester filed Critical University of Rochester
Priority to CA2952069A priority Critical patent/CA2952069C/en
Priority to US15/319,254 priority patent/US10548911B2/en
Publication of WO2015195684A2 publication Critical patent/WO2015195684A2/en
Publication of WO2015195684A3 publication Critical patent/WO2015195684A3/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/70Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7042Compounds having saccharide radicals and heterocyclic rings
    • A61K31/7048Compounds having saccharide radicals and heterocyclic rings having oxygen as a ring hetero atom, e.g. leucoglucosan, hesperidin, erythromycin, nystatin, digitoxin or digoxin
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/095Sulfur, selenium, or tellurium compounds, e.g. thiols
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/13Amines
    • A61K31/155Amidines (), e.g. guanidine (H2N—C(=NH)—NH2), isourea (N=C(OH)—NH2), isothiourea (—N=C(SH)—NH2)
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/166Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the carbon of a carboxamide group directly attached to the aromatic ring, e.g. procainamide, procarbazine, metoclopramide, labetalol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/16Amides, e.g. hydroxamic acids
    • A61K31/165Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide
    • A61K31/167Amides, e.g. hydroxamic acids having aromatic rings, e.g. colchicine, atenolol, progabide having the nitrogen of a carboxamide group directly attached to the aromatic ring, e.g. lidocaine, paracetamol
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/34Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide
    • A61K31/341Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having five-membered rings with one oxygen as the only ring hetero atom, e.g. isosorbide not condensed with another ring, e.g. ranitidine, furosemide, bufetolol, muscarine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/335Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/35Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom
    • A61K31/351Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin having six-membered rings with one oxygen as the only ring hetero atom not condensed with another ring
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/38Heterocyclic compounds having sulfur as a ring hetero atom
    • A61K31/381Heterocyclic compounds having sulfur as a ring hetero atom having five-membered rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/4151,2-Diazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/41641,3-Diazoles
    • A61K31/41841,3-Diazoles condensed with carbocyclic rings, e.g. benzimidazoles
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4409Non condensed pyridines; Hydrogenated derivatives thereof only substituted in position 4, e.g. isoniazid, iproniazid
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4412Non condensed pyridines; Hydrogenated derivatives thereof having oxo groups directly attached to the heterocyclic ring
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/44Non condensed pyridines; Hydrogenated derivatives thereof
    • A61K31/4427Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems
    • A61K31/4439Non condensed pyridines; Hydrogenated derivatives thereof containing further heterocyclic ring systems containing a five-membered ring with nitrogen as a ring hetero atom, e.g. omeprazole
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/473Quinolines; Isoquinolines ortho- or peri-condensed with carbocyclic ring systems, e.g. acridines, phenanthridines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/435Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with one nitrogen as the only ring hetero atom
    • A61K31/47Quinolines; Isoquinolines
    • A61K31/4738Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems
    • A61K31/4745Quinolines; Isoquinolines ortho- or peri-condensed with heterocyclic ring systems condensed with ring systems having nitrogen as a ring hetero atom, e.g. phenantrolines
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/495Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with two or more nitrogen atoms as the only ring heteroatoms, e.g. piperazine or tetrazines
    • A61K31/505Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim
    • A61K31/519Pyrimidines; Hydrogenated pyrimidines, e.g. trimethoprim ortho- or peri-condensed with heterocyclic rings
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/535Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one oxygen as the ring hetero atoms, e.g. 1,2-oxazines
    • A61K31/53751,4-Oxazines, e.g. morpholine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/54Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame
    • A61K31/549Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having six-membered rings with at least one nitrogen and one sulfur as the ring hetero atoms, e.g. sulthiame having two or more nitrogen atoms in the same ring, e.g. hydrochlorothiazide
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/33Heterocyclic compounds
    • A61K31/395Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/55Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole
    • A61K31/551Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having seven-membered rings, e.g. azelastine, pentylenetetrazole having two nitrogen atoms, e.g. dilazep
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00Medicinal preparations containing organic active ingredients
    • A61K31/63Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
    • A61K31/635Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide having a heterocyclic ring, e.g. sulfadiazine
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A61K45/06Mixtures of active ingredients without chemical characterisation, e.g. antiphlogistics and cardiaca

Definitions

  • This application is directed to the identification of compounds and pharmaceutical compositions, and methods of using the same for the treatment or prevention of fibrosis and fibrotic-related disorders in an individual.
  • hypertrophic scarring usually results from physical injury, such as laceration or surgery or from burns either thermally, chemically or radiation induced (Niessen et al., "On the nature of hypertrophic scars and keloids: a review," Plast. Reconstr. Surg. 104: 1435-1458 (1999)).
  • an unfortunate consequence of severe heat-induced burns is the development of debilitating hypertrophic scars (Gauglitz et al., "Hypertrophic scarring and keloids: pathomechanisms and current and emerging treatment strategies," Mol. Med.17: 113-125 (2011)).
  • Chronic inflammation and autoimmune disease can also lead to aberrant tissue reorganization and scarring (Lehmann et al., "Immune mechanisms in thyroid eye disease," Thyroid : official journal of the American Thyroid
  • Thyroid eye disease is an example of an autoimmune disease in which immune cells target the muscle and connective tissue in the ocular orbit leading to orbital tissue remodeling and excessive scarring (Bru R.S., “Graves' ophthalmopathy,” N. Engl. J. Med. 362:726-738 (2010); Kuriyan et al, “The eye and thyroid disease,” Curr. Opin.
  • myofibroblast (Hinz et al., "The myofibroblast: one function, multiple origins," Am. J. Pathol. 170: 1807-1816 (2007)).
  • Myofibroblasts are derived from tissue resident fibroblasts, epithelial- mesenchymal transitions, circulating fibrocytes, mesenchymal stem cells or other progenitor cells (Desmouliere et al, "Tissue repair, contraction, and the myofibroblast,” Wound Repair Regen. 13:7-12 (2005)).
  • Myofibroblasts highly express alpha- smooth muscle actin (aSMA), an important protein required for wound contraction, and these cells produce large amounts of extracellular matrix (ECM) material including collagen, fibronectin and glycosaminoglycans (Hinz et al., "Recent developments in myofibroblast biology: paradigms for connective tissue remodeling," Am. J. Pathol. 180: 1340-1355 (2012); Smith et al, "Fibroblasts as sentinel cells. Synthesis of chemokines and regulation of inflammation,” Am. J. Pathol. 151 :317-322 (1997)). The contraction of myofibroblasts and their excessive production of ECM material such as collagen result in rigid tissue formation and increases in tissue size.
  • ASMA alpha- smooth muscle actin
  • ECM extracellular matrix
  • myofibroblasts In addition to their contractile phenotype, myofibroblasts also secrete a variety of cytokines including IL-6, MCP-1 and TGFP that recruit immune cells and lead to further myofibroblast formation (Micallef et al., "The myofibroblast, multiple origins for major roles in normal and pathological tissue repair,” Fibrogenesis & Tissue Repair 5:S5 (2012)).
  • cytokines including IL-6, MCP-1 and TGFP that recruit immune cells and lead to further myofibroblast formation
  • a first aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof.
  • This method includes administering to the patient an amount of a polyether antibiotic that is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
  • a second aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof.
  • This method includes administering to the patient an amount of one or more of amsacrine, alexidine, bithionate, or a combination thereof, wherein the amount is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
  • a third aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof.
  • This method includes administering to the patient an amount of one or more compounds according to formula (I) as disclosed herein, formula (II) as disclosed herein, formula (III) as disclosed herein, formula (IV) as disclosed herein, formula (V) as disclosed herein, formula (VI) as disclosed herein, formula (VII) as disclosed herein, formula (VIII) as disclosed herein, formula (IX) as disclosed herein, formula (X) as disclosed herein, formula (XI) as disclosed herein, formula (XIII) as disclosed herein, formula (XIV) as disclosed herein, formula (XV) as disclosed herein, formula (XVI) as disclosed herein, formula (XVII) as disclosed herein, formula (XVIII) as disclosed herein, formula (XIX) as disclosed herein, formula (XX) as disclosed herein, formula (XXI) as disclosed herein, formula (XXI) as disclosed herein,
  • a fourth aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof.
  • This method includes administering to the patient an amount of one or more agents selected from the group of 10-hydroxycamptothecin, omeprazole, esomeprazole, flutamide, 4,5-dichloro-2-methyl-N-(4-pyridinylmethyl)benzenesulfonamide, N-(2- methoxyphenyl)-3-phenyl-2-propynamide, 3-amino-4-chloro-N,N-diethylbenzamide, 4-ethoxy- 2,3-dimethyl-N-(4-pyridinylmethyl)benzenesulfonamide, ⁇ 5-[(4-chlorophenyl)thio]-2- furyl ⁇ methanol, N-(l -phenyl ethyl) [IJbenzofuro [3, 2-d]pyrimidin-4-amine hydrochloride, 3-[3-(2- chloride
  • a fifth aspect of the disclosure relates to a pharmaceutical or veterinary composition that includes a carrier, an effective amount of a polyether antibiotic and an effective amount of a compound according to formula (I) as disclosed herein, formula (II) as disclosed herein, formula (III) as disclosed herein, formula (IV) as disclosed herein, formula (V) as disclosed herein, formula (VI) as disclosed herein, formula (VII) as disclosed herein, formula (VIII) as disclosed herein, formula (IX) as disclosed herein, formula (X) as disclosed herein, formula (XI) as disclosed herein, formula (XII) as disclosed herein, formula (XIII) as disclosed herein, formula (XIV) as disclosed herein, formula (XV) as disclosed herein, formula (XVI) as disclosed herein, formula (XVII) as disclosed herein, formula (XVIII) as disclosed herein, formula (XIX) as disclosed herein, formula (XXI) as disclosed herein, formula (XXI) as disclosed herein, formula (X
  • a sixth aspect of the disclosure relates to a recombinant cell line.
  • This recombinant cell line includes a recombinant gene that expresses a detectable expression product in a dose-dependent response to TGFP concentration.
  • the HEK293-Thyl SBE-Luc cell line described in the Examples represents a non-limiting example thereof.
  • a seventh aspect of the disclosure relates to a method of identifying a compound that inhibits TGFP -mediated cellular activity.
  • the method includes growing a recombinant cell line according to the fifth aspect of the disclosure in the presence of TGF and a compound of interest, and measuring the amount of the detectable expression product and comparing the measured amount to a control lacking the compound of interest and/or a control lacking TGFP, wherein a significant difference in the measured amount of the detectable expression product, relative to the control, indicates that the compound of interest inhibits TGFP-mediated cellular activity.
  • Figures 1 A-D show that small molecule screen identified salinomycin as a potential anti-scarring compound.
  • Figure 1 A is a diagram of Smad-dependent reporter construct. Four tandem Smad binding elements (SBE) were inserted upstream of the minimal Thymidine Kinase (TK) promoter. Downstream of the promoter is a destabilized version of the firefly luciferase gene (luc2P) present in the pLuc2P-Hygro plasmid which also harbors the hygromycin resistance gene.
  • SBE Smad binding elements
  • TK Thymidine Kinase
  • luc2P firefly luciferase gene
  • FIG. 1A illustrates the structure of salinomycin (SNC), which is one of several members of the 2300 compound Spectrum collection that blocked TGFP-induced luciferase activity when screened with the HEK293FT-luc reporter line of Fig. 1A.
  • SNC salinomycin
  • the polyether ionophore salinomycin was further tested in a dual luciferase screen including a constitutive renilla luciferase to normalize the SBE-luciferase activity, which demonstrated that it was a potent inhibitor of TGFp.
  • Figure ID shows that salinomycin exhibited a dose dependent decrease in TGFP-induced SBE-luciferase activity. 1 uM salinomycin reduced SBE-luciferase activity to below baseline levels while 100 nM salinomycin reduced SBE-luciferase activity more than 3 -fold. Experiments were repeated three times in triplicate and similar results were observed in all tests. * p ⁇ 0.05.
  • Figures 2A-C show that salinomycin inhibits TGFP-induced expression of myofibroblast markers in human fibroblasts.
  • Figure 2A shows that human fibroblasts were treated with varying doses of salinomycin and treated with TGFP (1 ng/ml) for 72 hours. The cells were then lysed and analyzed by Western blot for the myofibroblast markers alpha-smooth muscle actin (aSMA) and calponin. ⁇ -tubulin was used as a loading control.
  • Figure 2B shows densitometry analysis of blots in panel A, where a dose-dependent decrease in myofibroblast markers aSMA and calponin was observed.
  • FIG. 2C shows the results of a slot blot analysis for collagen I using culture supernatants from cells treated as in panel Fig. 2A. Salinomycin similarly reduced collagen I levels in a dose-dependent manner.
  • Figures 3A-C show that the three polyether ionophores salinomycin, narasin and monensin inhibit myofibroblast formation, but not the structurally unrelated ionophore clioquionol.
  • Figure 3A shows molecular structures of narasin, monensin and clioquionol.
  • Figure 3B shows Western blot results using cell lysates from human fibroblasts treated with vehicle (DMSO), TGFP or TGFP plus 250 nM of the indicated compounds for 72 hours, followed by analysis of the myofibroblast markers aSMA and calponin.
  • Figure 3C shows densitometry analysis of Western blots shown in Fig. 3B.
  • Salinomycin, narasin and monensin all inhibited expression of aSMA and calponin whereas clioquinol did not.
  • FIGS 4A-B show that salinomycin does not affect viability or basal
  • FIG. 4A shows the results of a cell viability assay using human fibroblasts treated with vehicle (DMSO), 50, 100 or 250 nM salinomycin, TGFp, TGFP plus 250 nM salinomycin or puromycin (5 ug/ml) for 72 hours in the presence of alamar blue, a redox sensitive fluorescent dye. After 72 hours, fluorescence was measured to check cellular viability. Puromycin, which served as a positive control resulted in a total loss of cell viability, whereas salinomycin did not significantly affect cell viability at doses tested, either in the presence or absence of TGFp.
  • vehicle DMSO
  • Figure 4B shows the results of a TGFP-induced proliferation assay using human fibroblasts treated with vehicle (DMSO), 250 nM salinomycin, 250 nM narasin, TGFP alone or TGFP plus salinomycin or narasin (250 nM) for 24 hours before addition of bromodeoxyuridine (BrdU).
  • BrdU treatment was an additional 24 hours and then cells were fixed and stained for BrdU incorporation, which serves as a measure of cell proliferation.
  • Salinomycin and narasin did not affect basal fibroblast proliferation (first 3 columns), however, salinomycin and narasin significantly blocked TGFP induced proliferation (last 3 columns). Results are from a representative experiment performed in triplicate. * p ⁇ 0.01.
  • FIGS 5A and 5B show that salinomycin inhibits TGFP-induced p38
  • FIG. 5A shows a Western blot of cell lysates obtained from human orbital fibroblasts treated with vehicle, TGFP or TGFP plus 250 nM salinomycin. Cells were harvested at various time points and analyzed for phosphorylated versions of SMAD2/3 and p38. Salinomycin reduced Smad2/3 and p38 phosphorylation at 5 hour and 24 hour TGFP treatments.
  • Figure 5B is a pair of graphs that together show densitometry of Western blots in Fig. 5 A.
  • Salinomycin reduced TGFP induced phospho-Smad2/3 levels by 2-fold at 5 hours and by 5-fold at 24 hours. Likewise, salinomycin reduced phospho-p38 levels by more than 2-fold at 5 hours and by 10-fold at 24 hours. Data are representative of two different experiments performed with human fibroblasts.
  • Figures 6A-C show that expression of constitutively active MKK6 attenuates the inhibitory effect of salinomycin on TGFp.
  • Figure 6A shows that a Smad-luc reporter, constitutive renilla reporter and either a control plasmid or the pcDNA3.1 flag-MK 6 (glu) plasmid were introduced into human orbital fibroblasts by electroporation. After electroporation, cells were treated with vehicle (DMSO), TGFP or TGFP plus 250 nM salinomycin. After 24 hours, cells were lysed and luciferase activity was measured. Smad-luc activity was normalized to renilla activity. Salinomycin blocked TGFP induced Smad-luc activity.
  • FIG. 6B shows Western blot results for human orbital fibroblasts into which a control plasmid or the pcDNA3.1 flag-MK 6 (glu) plasmid was introduced by electroporation. Cells were then treated with vehicle, TGFP or TGFP plus 250 nM salinomycin for 24 hours.
  • Figure 6C shows Western blot results for cells treated as in Fig. 6B, however, cells were cultured for 72 hours to allow sufficient time for myofibroblast differentiation. The experiment was repeated three times in different fibroblast strains, results are from one representative set.
  • Figure 7 is a schematic illustration showing a potential model for salinomycin
  • TGFP TGFP receptor
  • TGFpR TGFP receptor
  • p38 p38MAPK
  • Smad2/3 and p38MAPK Smad2/3 and p38MAPK
  • FIG. 9 is a set of images of capsular fibroblasts explanted from primary tissue samples cultured in vitro. Treatment consisted of 48 hours growth in serum-starved media (0.1% fetal bovine serum), followed by administration of vehicle, 2.5 ng/mL transforming growth factor-beta (TGF- ⁇ ), 250 nM salinomycin (SNC), or TGF- ⁇ plus SNC for 72 hours. At this time point, TGF- ⁇ treated cells show increased density and a more flattened, spiculated morphology suggestive of myofibroblastic differentiation relative to the untreated cells. The concomitant addition of SNC appears to reduce the effect of TGF- ⁇ on the fibroblasts. Original magnification 200X.
  • TGF- ⁇ transforming growth factor-beta
  • SNC salinomycin
  • FIG. 10A-B shows a representative fibroblast strain explanted from primary capsular tissue and treated with 2.5 ng/mL transforming growth factor-beta (TGF- ⁇ ), 250 nM salinomycin (SNC), or TGF- ⁇ plus SNC for 72 hours. After treatment, cells were lysed for protein extraction and analysis via Western blot. Data are presented in graph form (Fig. 10A) and as images of Western blots (Fig. 10B). Though lacking a significant induction following treatment with TGF- ⁇ , Thyl expression was significantly reduced with SNC. Alpha-SMA expression increased nearly 3-fold with TGF- ⁇ , but concomitant SNC treatment decreased expression to below basal levels. All protein expression is relative to ⁇ -tubulin levels.
  • TGF- ⁇ transforming growth factor-beta
  • SNC salinomycin
  • FIGs 11 A-B show, using a lentiviral vector, fibroblasts transduced with either a plasmid to reduce basal expression of Thyl (shThyl) or a control plasmid (GIPZ).
  • Transduced cells were selected using antibiotic resistance (Puromycin at 2ug/mL). Cells were then grown to confluency and harvested for analysis via Western blot. Data are presented in graph form (Fig. 11A) and as images of Western blots (Fig. 1 IB).
  • shThyl cells showed a reduction of approximately 80% in basal Thyl expression. These cells also had reduced expression of both alpha-SMA and extracellular soluble collagen type I.
  • FIG. 12 is a graph showing results from a secondary luciferase screen, which was performed to determine specificity and dose responsiveness of the six best small molecule hits from initial screening of the Spectrum library for TGF inhibition.
  • BZB benzbromarone
  • BTS bithionate sodium
  • PPT piplartine (piperlongumine)
  • ASC amsacrine
  • AXD alexidine
  • SNC salinomycin
  • Figure 13 is a panel of images showing that BTS, PPT, ASC, AXD, and SNC inhibit TGF -dependent myofibroblast (scar cells) formation in primary human fibroblasts. Myofibroblast phenotype was observed in TGF treated cells. All five small molecule hits inhibit myofibroblast phenotype at the lowest effective dose from Fig. 12.
  • Figure 14 shows Western blot results that demonstrate that BTS, PPT, ASC,
  • AXD, and SNC inhibit ⁇ -dependent a-SMA and calponin expression in human fibroblasts.
  • Figure 15 shows relative aSMA expression in human orbital fibroblasts.
  • Human orbital fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM to 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp.
  • HCPT 10-hydroxycamptothecin
  • aSMA serves as a marker for myofibroblast formation while ⁇ -tubulin is a control protein.
  • Salinomycin SNC
  • alexidine AXD
  • Figure 16 shows relative aSMA expression in human lung fibroblasts.
  • Human lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM to 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp.
  • HCPT 10-hydroxycamptothecin
  • aSMA serves as a marker for myofibroblast formation while ⁇ -tubulin is a control protein.
  • Salinomycin SNC
  • alexidine AXD
  • Figure 17 is a panel of images that show the formation of myofibroblasts.
  • Human lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM or 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp.
  • HCPT 10-hydroxycamptothecin
  • FIG. 18 shows relative aSMA expression in mouse lung fibroblasts.
  • Mouse lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM to 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp.
  • HCPT 10-hydroxycamptothecin
  • aSMA serves as a marker for myofibroblast formation while ⁇ -tubulin is a control protein.
  • Salinomycin (SNC) and alexidine (AXD) serve as positive controls for anti-fibrotic activity.
  • HCPT potently blocks myofibroblast formation.
  • Figure 19 is a set of Western blot results and corresponding graphs showing that omeprazole inhibits human orbital fibroblast to myofibroblast differentiation.
  • aSMA serves as a marker for myofibroblast formation while ⁇ -tubulin is a control protein.
  • Figure 20 is a set of Western blot results and corresponding graphs showing that flutamide inhibits human orbital fibroblast to myofibroblast differentiation.
  • aSMA serves as a marker for myofibroblast formation while ⁇ -tubulin is a control protein.
  • Figure 21 is a graph showing normalized luciferase activity (TGF signaling) for TGF signaling.
  • Figure 22 is a panel of cell images showing efficacy of selected Chembridge hits in myofibroblast formation assays using human orbital fibroblasts. These cell images show the powerful effect of these small molecules in preventing TGFP induced myofibroblast formation while not causing cell death.
  • SNC salinomycin control
  • Al 5255687; A2:5130037; A4:9040737; B3:9057423; C2:9018748; C3:9048694; C4:9022265.
  • Figure 23 is a panel of cell images showing efficacy of selected Chembridge hits in myofibroblast formation assays using human lung fibroblasts. These cell images show the powerful effect of these small molecules in preventing TGFP induced myofibroblast formation while not causing cell death.
  • SNC salinomycin control
  • Al 5255687; A2:5130037; A4:9040737; B3:9057423; C2:9018748; C3:9048694; C4:9022265.
  • the present invention relates to a method of treating fibrosis in a patient in need thereof.
  • This method includes administering to the patient an amount of a compound (or active agent) that is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
  • the patient can be any mammal susceptible to fibrosis or exhibiting signs of fibrosis, including without limitation, humans, non-human primates, and various domesticated animals including livestock (dairy cows, steer, pigs, horses, mules, donkeys, llamas, alpaca, sheep, etc.), household animals (dogs, cats, rabbits, ferrets, chinchilla, rodents), and lab animals (typically rodents and rabbits).
  • myofibroblasts are fundamentally involved in scar formation, they represent ideal targets for new therapeutic options to limit or even reverse scarring.
  • Myofibroblast differentiation is driven by the cytokine transforming growth factor-beta (TGFP), which is produced during the natural healing process
  • TGFP cytokine transforming growth factor-beta
  • TGFbeta family members are key mediators in the induction of myofibroblast phenotype of human adipose tissue progenitor cells by macrophages
  • PloS one 7:e31274 (2012) George, “Regulation of myofibroblast differentiation by convergence of the Wnt and TGF-betal/Smad signaling pathways,” J. Mol.Cell. Cardiol. 46:610-611 (2009), each of which is hereby incorporated by reference in its entirety).
  • TGFP is also involved in many other cellular responses including immune suppression, cell migration and extracellular matrix remodeling (Massague, "TGFbeta signalling in context,” Nat. Rev. Mol. Cell Biol. 13:616-630 (2012), which is hereby incorporated by reference in its entirety). While TGFP is normally tightly regulated at multiple levels to limit its powerful effects, TGFP is often highly expressed in conditions such as cancer, chronic inflammation and in fibrosis (Massague, "TGFbeta signalling in context,” Nat. Rev. Mol. Cell Biol. 13:616-630 (2012), which is hereby incorporated by reference in its entirety). While driving myofibroblast formation, TGFP regulates numerous cell signaling pathways. One key pathway activated by TGFP is Smad dependent signaling.
  • Smads are a family of highly conserved transcription factors that regulate expression of many genes that contain Smad- binding element (SBEs) in their promoter and/or regulatory regions (Weiss et al., "The TGFbeta superfamily signaling pathway,” Wiley Interdiscip. Rev. Dev. Biol. 2:47-63 (2013), which is hereby incorporated by reference in its entirety).
  • Smad- binding element SBEs
  • TGFP binding to its cognate receptor on the cell surface triggers phosphorylation of the Smad family members, Smad2 and Smad3. Once phosphorylated, these transcription factors bind their binding partner namely, the coSmad, Smad4.
  • This Smad complex is then shuttled into the nucleus where it activates transcription of myofibroblast genes including aSMA, calponin and collagen (Usuki et al, "Sequential analysis of myofibroblast differentiation and transforming growth factor-betal/Smad pathway activation in murine pulmonary fibrosis," J. Nippon Med. Sch.
  • the expressions "fibrosis”, “fibrosis conditions”, and “fibrotic conditions” are intended to have the same meaning.
  • the fibrotic conditions are those mediated by a fibrotic stimulator.
  • exemplary fibrotic stimulators include, without limitation, TGF- ⁇ , endothelin, lactic acid (via lactate dehydrogenase), IL-1, Thy-1 (CD90), connective tissue growth factor (“CTGF”), as well as combinations thereof.
  • CTGF connective tissue growth factor
  • the fibrotic condition is one that is mediated by TGF- ⁇ .
  • the fibrotic condition is related to an autoimmune condition.
  • the fibrotic condition is subsequent to injury, including radiation, alkali burn, physical burn, surgery, physical trauma, or a combination thereof.
  • the fibrotic condition is not secondary to a microbial infection that is treatable with a polyether antibiotic.
  • a number of fibrotic conditions can be treated in accordance with the present invention, including those involving internal organs such as lung, liver, kidney, heart, pancreas, gastrointestinal organs, and genitourinary organs; vascular tissue; and ocular tissue such as corneal tissue, retinal tissue, and lacrimal gland tissues.
  • Exemplary fibrotic conditions of the lung include, but are not limited to, idiopathic pulmonary fibrosis (IPF); idiopathic pulmonary upper lobe fibrosis (Amitani disease); familial pulmonary fibrosis; pulmonary fibrosis secondary to systemic inflammatory diseases such as, rheumatoid arthritis, scleroderma, lupus, cryptogenic fibrosing alveolitis, chronic obstructive pulmonary disease (COPD) or chronic asthma; cystic fibrosis; non-specific interstitial pneumonia (NSIP); cryptogenic organizing pneumonia (COP);
  • IPF idiopathic pulmonary fibrosis
  • Amitani disease idiopathic pulmonary upper lobe fibrosis
  • familial pulmonary fibrosis pulmonary fibrosis secondary to systemic inflammatory diseases such as, rheumatoid arthritis, scleroderma, lupus, cryptogenic fibrosing alveolitis, chronic obstructive
  • scleroderma/systemic sclerosis bronchiolitis obliterans-organizing pneumonia
  • pulmonary hypertension pulmonary tuberculosis
  • silicosis asbestosis
  • acute lung injury and acute respiratory distress (ARD; including bacterial pneumonia induced, trauma-induced, and viral pneumonia-induced, ventilator-induced, non-pulmonary sepsis induced).
  • ARD acute respiratory distress
  • Exemplary fibrotic conditions of the liver include, but are not limited to, liver cirrhosis due to all etiologies; congenital hepatic fibrosis; obesity; fatty liver; alcohol induced liver fibrosis; non-alcoholic steatohepatitis (NASH); biliary duct injury; primary biliary cirrhosis; infection- or viral-induced liver fibrosis (e.g., chronic hepatitis B and C virus infections); cystic fibrosis; autoimmune hepatitis; necrotizing hepatitis; primary sclerosing cholangitis; hemochromatosis; disorders of the biliary tree; hepatic dysfunction attributable to infections.
  • liver fibrosis include, but are not limited to, liver cirrhosis due to all etiologies; congenital hepatic fibrosis; obesity; fatty liver; alcohol induced liver fibrosis; non-alcoholic steatohepatitis
  • Exemplary fibrotic conditions of the heart and/or pericardium include, but are not limited to, endomyocardial fibrosis; cardiac allograft vasculopathy (CAV); myocardial infarction; atrial fibrosis; congestive heart failure; arterioclerosis; atherosclerosis; vascular stenosis; myocarditis; congestive cardiomyopathy; coronary infarcts; varicose veins; coronary artery stenosis and other post-ischemic conditions; and idiopathic retroperitoneal fibrosis.
  • CAV cardiac allograft vasculopathy
  • Exemplary fibrotic conditions of the kidney include, but are not limited to, glomerulonephritis (including membranoproliferative, diffuse proliferative, rapidly progressive or sclerosing, post-infectious and chronic forms); diabetic
  • glomerulosclerosis focal segmental glomerulosclerosis; IgA nephropathy; diabetic nephropathy;
  • HIV-associated nephropathy nephropathy
  • membrane nephropathy glomerulonephritis secondary to systemic inflammatory diseases such as lupus, scleroderma and diabetes glomerulonephritis
  • idiopathic membranoproliferative glomerular nephritis mesangial proliferative glomerulonephritis;
  • autoimmune nephritis autoimmune nephritis
  • renal tubuloinsterstitial fibrosis renal arteriosclerosis
  • Alport's syndrome nephrotic syndrome
  • nephrotic syndrome chronic renal failure
  • periglomerular fibrosis/atubular glomeruli combined apical emphysema and basal fibrosis syndrome (emphysema/fibrosis syndrome)
  • glomerular hypertension nephrogenic fibrosing dermatopathy
  • polycystic kidney disease Fabry's disease and renal hypertension.
  • Exemplary fibrotic conditions of the pancreas include, but are not limited to, stromal remodeling pancreatitis and stromal fibrosis.
  • Exemplary fibrotic conditions of the gastrointestinal tract include, but are not limited to, Crohn's disease; ulcerative colitis; collagenous colitis; colorectal fibrosis; villous atrophy; crypt hyperplasia; polyp formation; healing gastric ulcer; and microscopic colitis.
  • Exemplary fibrotic conditions of the eye include, but are not limited to, ocular fibrosis, ophthalmic fibrosis, proliferative vitreoretinopathy; vitreoretinopathy of any etiology; fibrosis associated with retinal dysfunction; fibrosis associated with wet or dry macular degeneration; scarring in the cornea and conjunctiva; fibrosis in the corneal endothelium;
  • anterior subcapsular cataract and posterior capsule opacification anterior segment fibrotic diseases of the eye; fibrosis of the corneal stroma (e.g., associated with corneal opacification); fibrosis of the trabecular network (e.g., associated with glaucoma); posterior segment fibrotic diseases of the eye; fibrovascular scarring (e.g., in retinal or choroidal vasculature of the eye); retinal fibrosis; epiretinal fibrosis; retinal gliosis; subretinal fibrosis (e.g., associated with age related macular degeneration); tractional retinal detachment in association with contraction of the tissue in diabetic retinopathy; congenital orbital fibrosis; lacrimal gland fibrosis; corneal subepithelial fibrosis; and Grave's ophthalmopathy.
  • corneal stroma e.g., associated with corneal opacification
  • aforementioned conditions include, but are not limited to, spinal cord injury/fibrosis or central nervous system fibrosis such as fibrosis after a stroke, fibrosis associated with neurodegenerative disorder such as Alzheimer's disease or multiple sclerosis; vascular restenosis; uterine fibrosis; endometriosis; ovarian fibroids; Peyronie's disease; polycystic ovarian syndrome; disease related pulmonary apical fibrosis in ankylosing spondylitis; and fibrosis incident to microbial infections (e.g., bacterial, viral, parasitic, fungal etc.).
  • microbial infections e.g., bacterial, viral, parasitic, fungal etc.
  • treatment of fibrosis or fibrotic conditions is meant to include disruption of the fibrotic processes so as to halt progression of the fibrotic condition, slow progression of the fibrotic condition, or cause regression of the fibrotic condition (i.e., improve the patient's state of health with respect to the degree of fibrosis in the affected tissue or organ).
  • treatment precedes onset of the fibrotic condition i.e., treatment is performed prior to a known or an otherwise expected onset of fibrosis
  • such treatment may include preventing development or onset of the fibrotic condition.
  • Administration of the various active agents can therefore be carried out for a suitable duration to either control or halt progression of the fibrotic condition, or prevent onset thereof.
  • the compound or active agent is a polyether antibiotic.
  • Exemplary polyether antibiotics include, without limitation, those selected from the group consisting of monensin, lasalocid, salinomycin, narasin, maduramycin, semduramycin, laidlomycin, lonomycin, ionomycin, nigericin, grisorixin, dianemycin, lenoremycin, antibiotic X206, alborixin, septamycin, antibiotic A204, Compound 47,224, mutalomycin, isolasalocid A, lysocellin, tetronasin, etheromycin, antibiotic X-14766A, antibiotic A-23187, antibiotic A- 32887, Compound 51,532, and K41.
  • the polyether antibiotic is selected from the group consisting of monensin, lasalocid, salinomycin, narasin, maduramycin, semduramycin, and laidlomycin. Salinomycin and derivatives thereof are described in
  • the compound or active agent has a structure according to formula (I), shown below, which is described in U.S. Patent No. 6,509,360 to Malamas et al, which is hereby incorporated by reference in its entirety:
  • A is O, S, or NH
  • B is— (CH 2 ) m — ,— CH(OH)— , or carbonyl
  • R 1 is hydrogen, nitro, halogen, alkyl of 1-6 carbon atoms, alkoxy of 1-6 carbon atoms, or trifluoromethyl;
  • R is alkyl of 1-18 carbon atoms, aryl of 6-10 carbon atoms, arylalkyl of 7-15 carbon atoms, Het- alkyl wherein the alkyl moiety is 1-6 carbon atoms;
  • R 2a is alkylene of 1-3 carbon atoms
  • G is oxygen, sulfur, or nitrogen
  • R 3 and R 4 are each, independently, hydrogen, halogen, alkyl of 1-3 carbon atoms, aryl of 6-10 carbon atoms or a heterocyclic ring of 5 to 7 ring atom containing 1 to 3 heteroatoms selected from oxygen, nitrogen, sulfur;
  • R 5 is hydrogen, alkyl of 1-6 carbon atoms,— CH(R 7 )R 8 ,— C(CH 2 ) administratC0 2 R 9 ,— C(CH 3 ) 2 C0 2 R 9 ,— CH(R 7 )(CH 2 ) consentC0 2 R 9 , or— CH(R 7 )C 6 H 4 C0 2 R 9 ;
  • R 6 is hydrogen, halogen, alkyl of 1-6 carbon atoms, or— OR 5 ;
  • n l-6;
  • R 7 is hydrogen, alkyl of 1-6 carbon atoms, aryl of 6-10 carbon atoms, or arylalkyl of 7-15 carbon atoms;
  • R 8 is— C0 2 R 10 ,— CONHR 10 , tetrazole, or— P0 3 H 2 ;
  • R 9 and R 10 are each, independently, hydrogen, alkyl of 1-6 carbon atoms, aryl of 6-10 carbon atoms, or arylalkyl of 7-15 carbon atoms;
  • One exemplary compound of formula (I) has the following structure:
  • the compound has a structure according to formula (II), shown below, which is described in U.S. Patent No. 8,318,737 to Foley et al, which is hereby incorporated by reference in its entiret :
  • Ring A is selected from the group consisting of one or more monocyclic aryl, one or more
  • heteroaryl a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur;
  • each R 1 , R2 , and R 3 is independently selected from the group consisting of hydrogen, halogen, deuterium, CF 3 , CN, OR, SR, NRR, NRCOR, NRCONRR, NRC0 2 R, COR, C0 2 R, NOR,
  • N0 2 CONRR, OC(0)NRR, S0 2 R, S0 2 NRR, NRS0 2 R, NRS0 2 NRR, C(0)C(0)R, or
  • each R is independently selected from hydrogen or an optionally substituted C1-C4 aliphatic moiety (i.e. alkyl, alkenyl, or alkynyl), or alternately, two R moieties bound to the same nitrogen atom are optionally taken together with the nitrogen atom to form a 3-7 membered saturated, partially unsaturated, or fully unsaturated ring having 1-2 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur;
  • B is selected from:
  • R4, R5, R6 and R7 are independently selected from hydrogen, a substituted or unsubstituted Ci to Ci 2 alkyl, a substituted or unsubstituted C 2 to C 12 alkenyl or a substituted or unsubstituted C 2 to Ci 2 alkynyl;
  • X is C(O), C(S), or S(0) 2 ;
  • C is a saturated or unsaturated heteroaryl or a saturated or unsaturated CI to C7 heterocyclic containing one or more heteroatoms wherein the heteroatoms are independently selected from N, O or S;
  • the compounds Formula (II) above have a structure wherein ring A is selected from:
  • Y is N, O or S
  • C is selected from:
  • R 10 and R 11 are independently selected from a substituted or unsubstituted Ci to C 12 alkyl, a substituted or unsubstituted Ci to C 12 alkenyl or a substituted or unsubstituted Ci to C 12 alkynyl, an ether, a thioether, aryl,
  • n 1, 2 or 3;
  • Xi is O or S
  • PPT Piperlongumine
  • the compound is a 2,2'-dihydroxy halogenated diphenyl sulfide having the structure of formula (III), shown below, which is described in U.S. Patent No. 2,353,735 to Kunz et al, which is hereby incorporated by reference in its entirety:
  • R is halogen and n is an integer from 1 to 4 inclusive.
  • Exemplary 2,2'-dihydroxy halogenated diphenyl sulfide include
  • the compound has a structure according to formula
  • Z and Z' are each alkylene of from 1 to 3 carbon atoms
  • R is a member of the group consisting of
  • alkyl- Y-alkylene wherein Y is a member of the group consisting of O and S; R' is a member of the group consisting of H and lower-alkyl; and
  • x is an integer from 1 to 2.
  • A has the formula C n H 2n (wherein n is an integer from 2 to 12), is bivalent, and has free valence bonds on different carbon atoms.
  • the bivalent alkylene bridge can be polymethylene, represented by (CH 2 ) n ,— or equivalently by— (CH 2 ) 2 _i 2 — but it also includes branched-chain alkylene bridges.
  • A includes the alpha,omega-divalent unbranched radicals ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, heptamethylene, octamethylene, nonamethylene, decamethylene, undecamethylene, and dodecamethylene, and also includes for example the branched divalent radicals 1,3 -propylene, 1 ,4-pentylene, 1,10-dodecamethylene, 2-methyl-l ,4-butylene, 2-methyl-l,5-pentylene, and the like.
  • A is an oxa- or thia-polymethylene radical containing from 5 to 13 atoms.
  • m and n can be the same or different, and each represents an integer of from 2 to 6.
  • Y represents— O— or— S— . In this sense, therefore, A includes such radicals as
  • A represents bridging groups (d) through (f), each of which contains one or more benzene rings
  • the said benzene rings can be unsubstituted or can be substituted with up to four inert substituents exemplified by, but not limited to, lower-alkyl, halogen (fluorine, chlorine, bromine, or iodine), lower-alkoxy, nitro, and hydroxy.
  • A is a divalent phenylene-bis(lower-alkylene) group.
  • Z and Z' can be the same or different and represent alkylene radicals of from 1 to 3 carbon atoms. Moreover the Z and Z' radicals can be in any of the ortho-, meta-, or para-positions relative to each other. Because of their ready availability, particularly preferred l,4-phenylene-bis(lower-alkylene) groups are 1,2-, 1,3- or 1,4-xylylene and halo- and alkyl-substituted 1,2-, 1,3- and 1,4-xylylene.
  • A includes 2,3,5,6-tetramethyl-l,4-phenylene-bis(methylene), 2,5-dimethyl-l,4- phenylene-bis(methylene), 2-chloro-l ,4-phenylenebis(methylene), 2,3,5,6-tetrachloro-l ,4- phenylenebis(methylene) l,2-phenylenebis(methylene), l,3-phenylenebis(methylene), and 1,4- phenylenebis(methylene), and also 2-methyl-l,4-phenylenebis(ethylene), 1,4- phenylenebis(propylene),
  • R is a member of the group consisting of alkyl of from 6 to 16 carbon atoms and lower-alkyl-Y-lower-alkylene, wherein Y, as above, is— O— or— S— .
  • Y is— O— or— S— .
  • R is a straight- or branched-chain saturated monovalent aliphatic radical.
  • R includes n-hexyl, n-heptyl, n- octyl, n-nonyl, n-decyl, n-undecyl, n-dodecyl, n-tetradecyl, n-hexadecyl, 2-ethyl-l-hexyl, 2- heptyl, 2-octyl, 1,1,3,3-tetramethylbutyl, and the like.
  • R is an oxa- or thia-interrupted alkyl group of from 6 to 16 atoms.
  • Particularly preferred alkyl-Y-alkylene groups are those wherein the alkylene moiety is propylene because of the ease of preparing the requisite alkylmercapto- and alkoxyamine intermediates from acrylonitrile by methods well-known in the art.
  • R is thus exemplified by 3-(ethoxy)propyl, 3- (butoxy)propyl, 3-(pentoxy)propyl, 6-(propyloxy)hexyl, 3-(hexylmercapto)propyl, 3- (butylmercapto)propyl, 5-(pentylmercapto)pentyl, 7-(methoxy)heptyl, 6-(pentoxy)hexyl, 3- (tridecyloxy)propyl, 3-(dodecylmercapto)propyl, and the like.
  • R' is H or lower-alkyl.
  • R is a straight- or branched-chain saturated aliphatic radical which contains from one to six carbon atoms.
  • the group R' thus includes, H, methyl, ethyl, n-propyl, isopropyl, n- butyl, isobutyl, tert-butyl, n-amyl, n-hexyl, and the like.
  • x in general Formula (IV) is 1 or 2.
  • x represents the integer 1
  • the compounds are bridged-bis[guanidines]
  • the compounds are bridged- bis[biguanides].
  • AMSA has the following structure:
  • m-AMSA, amsacrine or (“ASC”) has the following structure
  • m-AMSA derivatives are described in U.S. Patent No. 4,472,582 to Cain et al., which is hereby incorporated by reference in its entirety. 3,5-Disubstituted m-AMSA compounds having the following formula:
  • R 2 and R 3 represent, respectively,— CH 3 and— CONHCH 3 ,— CH 3 and—
  • the compound is a 10-substituted camptothecin derivative having the following the structure according to formula (VI), shown below, which is described in U.S. Patent No. 4,473,692 to Miyasaka et al, which is hereby incorporated by reference in its entirety:
  • R 1 is a hydrogen atom, an alkyl group, a hydroxyl group, an alkoxy group or an acyloxy group
  • R is a hydrogen atom, an alkyl group, an aralkyl group, a hydroxymethyl group, a carboxymethyl group or an acyloxymethyl group
  • R is the grouping— XR (where R is a hydrogen atom, an alkyl group or an acyl group and X is an oxygen atom or a sulfur atom), a nitro group, an amino group, an alkylamino group, an acylamino group or a halogen atom, with
  • R when both of R and R are hydrogen atoms, R should not be a hydroxyl group, methoxy group or acetoxy group.
  • One exemplary compound of formula (VI) is 10-hydroxycamptothecin having the structure shown below:
  • the compound has a structure according to formula (VII), shown below), which is described in U.S. Patent No. 4,255,431 to Junggren et al.., which is hereby incorporated by reference in its entirety:
  • R 1 and R 2 are same or different and are each selected from the group consisting of hydrogen, alkyl, halogen, carbomethoxy, carbethoxy, alkoxy, and alkanoyl
  • R 6 is selected from the group consisting of hydrogen, methyl, and ethyl
  • R 3 , and R 5 are the same or different and are each selected from the group consisting of hydrogen, methyl, methoxy, ethoxy,
  • exemplary compounds according to formula (VII) include omeprazole, which is a racemic mixture having the following structure:
  • the compound is Flutamide (Flutamide)
  • the compound has a structure according to formula (IX), shown below, or a pharmaceutically or veterinarily acceptable salt thereof, which is described in PCT Application Publ. No. WO 2014/099837 to Lahm et al., which is hereby incorporated by reference in its entirety:
  • R is hydrogen, C1-C4 alkyl, C 2 -C6 alkylcarbonyl or C 2 -C 6 alkoxycarbonyl;
  • R are each independently hydrogen, halogen, cyano, hydroxyl, amino, nitro, CHO, SF 5 , OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or S(O) 2 NRi 0 Rn; or Ci-C 6 alkyl,
  • R" and R J are taken together with the carbons to which they are attached to form a 5- to 6- membered carbocyclic or heterocyclic ring optionally substituted with up to 3 substituents independently selected from R 4a on carbon atom ring members and R 4b on nitrogen atom ring members;
  • G is a phenyl ring or an 8- to 10-membered carbocyclic bicyclic ring system, each ring or ring system optionally substituted with up to 5 substituents independently selected from R 5a ; or
  • G is a 5- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R 5a on carbon atom ring members and R 5b on nitrogen atom ring members;
  • X is CR 4c or N
  • Y is CR 4d or N
  • Q 1 is 3- to 7-membered carbocyclic ring or an 8- to 10-membered carbocyclic bicyclic ring
  • each ring or ring system optionally substituted with up to 5 substituents
  • Q 1 is a 5- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R 0a on carbon atom ring members and R 0b on nitrogen atom ring members;
  • J is hydrogen; or phenyl or naphthalenyl each optionally substituted with up to 5 substituents independently selected from R 14a ; or
  • J is a 5- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R 14a on carbon atom ring members and R 14b on nitrogen atom ring members; or
  • J is L-Q 2 ;
  • L is O, S, SO, S0 2 , NR 15 , (CH 2 ) discipline, OCH 2 , or CH 2 0;
  • Q is a 3- to 7-membered carbocyclic ring or an 8- to 10-membered carbocyclic bicyclic ring system, each ring or ring system optionally substituted with up to 5 substituents independently selected from R 16a ; or
  • Q is a 3- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R 16a on carbon atom ring members and R 16b on nitrogen atom ring members;
  • each R 4a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF 5 , OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or S(O) 2 NR 10 R n ; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R u , S(0) p R 12 and S(O) 2 NR 10 R u ; or G;
  • R 4b is cyano, -CHO, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R u , S(0) p R 12 or S(O) 2 NR 10 R u ; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C3-C7 cycloalkyl, C 4 -C 8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 and S(O) 2 NR 10 R n ; or G;
  • R 4c and R 4d are each independently hydrogen, halogen, cyano, hydroxyl, amino, nitro, -CHO, - SF 5 , OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or S(O) 2 NRi 0 Rn; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C3-C7 cycloalkyl, C 4 -Cs cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 and S(O) 2 NR 10 R n ; or
  • each R 5a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF 5 , OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or S(O) 2 NR 10 R n ; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C3-C 7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C 7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R u , S(0) p R 12 and S(O) 2 NR 10 R u ;
  • R 5b is cyano, -CHO, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R u , S(0) p R 12 or
  • each R 6 is independently hydrogen, C 2 -C 6 alkylcarbonyl, C 2 -C 6 alkoxycarbonyl, C 2 -C 6
  • alkylaminocarbonyl C3-C 6 dialkylaminocarbonyl, Ci-C 6 alkylsulfenyl, Ci-C 6 alkylsulfinyl,
  • each R 7a is independently hydrogen, C 2 -C 6 alkylcarbonyl, C 2 -C 6 alkoxycarbonyl, C 2 -C 6
  • Ci-C 6 alkylaminocarbonyl C 3 -C 6 dialkylaminocarbonyl, Ci-C 6 alkylsulfenyl, Ci-C 6 alkylsulfinyl or Ci-C 6 alkylsulfonyl, C 2 -C 6 alkylaminosulfonyl or C 3 -C 6 dialkylaminosulfonyl; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or benzyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, Ci-C 6 alkoxy, Ci-
  • each R 7b is independently hydrogen; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or benzyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, Ci-C 6 alkoxy, Ci-C 6 alkylamino, C 2 -Cs dialkylamino, C 2 -C 6 alkylcarbonyl, C 2 -C 6 alkoxycarbonyl, C 2 -C 6 alkylaminocarbonyl, C 3 -C 6
  • dialkylaminocarbonyl Ci-C 6 alkylsulfenyl, Ci-C 6 alkylsulfinyl, Ci-C 6 alkylsulfonyl, C 2 -C 6 alkylaminosulfonyl and C 3 - C 6 dialkylaminosulfonyl;
  • R , R , R and R are each independently hydrogen; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6
  • alkylsulfenyl C 1 -C 4 alkylsulfinyl, C 1 -C 4 alkylsulfonyl, C 1 -C 4 haloalkylsulfenyl, C 1 -C 4 haloalkylsulfinyl and C 1 -C 4 haloalkylsulfonyl;
  • each R 11 is independently hydrogen; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl or benzyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, C1-C4 alkylsulfenyl, C 1 -C 4 alkylsulfinyl, C 1 -C 4 alkylsulfonyl, C 1 -C 4 haloalkylsulfenyl, C 1 -C 4 haloalkylsulfinyl and C 1 -C 4 haloalkylsulfonyl;
  • each R 13a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF 5 , OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or S(O) 2 NR 10 R n ; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C 3 -C 7 cycloalkyl, C 4 -C 8 cycloalkylalkyl or C 5 -C 7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 and S(O) 2 NR 10 R u ;
  • R 13b is cyano, -CHO, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or
  • each R 14a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF 5 , OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or S(O) 2 NR 10 R n ; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 and S(O) 2 NR 10 R u ;
  • R 14b is cyano, -CHO, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or
  • R 15 is hydrogen, cyano, -CHO, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R u , S(0) p R 12 or S(O) 2 NR 10 R u ; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C3-C7 cycloalkyl, C 4 -C 8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 and S(O) 2 NR 10 R n ;
  • each R 16a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF 5 , OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or S(O) 2 NR 10 R n ; or Ci-C 6 alkyl, C 2 -C 6 alkenyl, C 2 -C 6 alkynyl, C3-C7 cycloalkyl, C 4 -C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 and S(O) 2 NR 10 R u ; or G;
  • R 16b is cyano, -CHO, OR 6 , NR 7a R 7b , C(0)R 8 , C(0)OR 9 , C(O)NR 10 R n , S(0) p R 12 or
  • n 1 or 2;
  • p 0, 1 or 2;
  • Exemplary compounds according to formula (IX) include, without limitation, those selected from the group of: ⁇ infra Table 1, C2), ⁇ infra Table 1, C4), ⁇ infra Table 1, A3), and ⁇ infra Table 1 ,
  • R is hydrogen atom or carboxyl, alkoxycarbonyl, phenyl or substituted phenyl radical, and Q is alkoxycarbonyl, carbamoyl,
  • Q may be a group of the formula
  • Ri represents hydrogen atom, lower alkyl, phenyl, substituted phenyl or aralkyl radical
  • R 2 represents lower alkyl, phenyl, substituted phenyl, naphthyl or aralkyl radical, or it may, together with the Ri, form a cycloalkyl radical
  • R 3 is hydrogen or acyl radical
  • Ri and R 2 are H, alkyl, (substituted) aralkyl, or (substituted) phenyl.
  • These compounds can be easily prepared by reducing the corresponding m-nitrobenzoic acid amide by conventional methods (JP 57021320 to Honda Narimitsu et al., which is hereby incorporated by reference in its entirety). Using the procedures described in JP 57021320 to Hyundai Narimitsu et al, persons of skill in the art will be able to prepare compounds bearing an additional halogen substituent on a phenyl ring (i.e., by using the appropriate starting materials).
  • the compound is a sulfide having the following formula:
  • R is substituted aryl or substituted heteroaryl
  • R is substituted aryl or substituted heteroaryl
  • the compound has a structure according to formula (XIII), shown below, which is described in U.S. Patent No. 6,596,726 to Bridges et al, which is hereby incorporated by reference in its entiret :
  • A, B, D and E can all be carbon, or up to two of them can be nitrogen, whereupon the remaining atoms must be carbon, or any two contiguous positions in A-E can be a single heteroatom, N, O or S, forming a five membered fused ring, in which case one of the two remaining atoms must be carbon, and the other can be either carbon or nitrogen, except that the case where A and B taken together, and D and E taken separately are all three nitrogen atoms;
  • X is O, S, NH or NR 9 , such that R 9 is lower alkyl (1-4 carbon atoms), OH, NH 2 , lower alkoxy (1-4 carbon atoms) or lower monoalkylamino (1-4 carbon atoms);
  • R 1 is H or lower alkyl
  • n 0, 1 or 2;
  • R 1 can be independently H or lower alkyl on either linking carbon atom, and both R and S stereocentres on either linker are included;
  • R is lower alkyl (1-4 carbon atoms), cycloalkyl (3-8 carbon atoms), lower alkoxy (1-4 carbon atoms), cycloalkoxy (3-8 carbon atoms), nitro, halo, lower perfluoroalkyl (1-4 carbon atoms), hydroxy, lower acyloxy (1-4 carbon atoms; -O-C(O)-R), amino, lower mono or dialkylamino (1-4 carbon atoms), lower mono or dicycloalkylamino (3-8 carbon atoms), hydroxymethyl, lower acyl (1-4 carbon atoms;— C(O) R), cyano, lower thioalkyl (1-4 carbon atoms), lower sulfmylalkyl (1-4 carbon atoms), lower sulfonylalkyl (1-4 carbon atoms), thiocycloalkyl (3-8 carbon atoms), sulfmylcyclo alkyl (3-8 carbon atoms), sulfonylcycloalkyl (3
  • m is 0-3, wherein Ar is phenyl, thienyl, furanyl, pyrrolyl, pyridyl, pyrimidyl, imidazoyl, pyrazinyl, oxazolyl, thiazolyl, naphthyl, benzothienyl, benzofuranyl, indolyl, quinolinyl, isoquinolinyl and quinazolinyl;
  • R 3 , R 4 , R 5 and R 6 are independently, not present, H, lower alkyl (1-4 carbon atoms), cycloalkyl (3-8 carbon atoms), lower alkoxy (1-4 carbon atoms), cycloalkoxy (3-8 carbon atoms), hydroxy, lower acyloxy (1-4 carbon atoms), amino, lower mono or dialkylamino (1-4 carbon atoms), lower mono or dicycloalkylamino (3-8 carbon atoms), lower alkyl (1-4 carbon atoms) or cycloalkyl (3-8 carbon atoms), carbonate (-OC(O)OR) where R is alkyl of from 1-4 carbon atoms or cycloalkyl of from 3-8 carbon atoms;
  • R' and R° can be independently as appropriate, lone pairs of electrons, H, or lower alkyl; any lower alkyl group substituent on any of the substituents in R 3— R 8 which contain such a moiety can be optionally substituted with one or more of hydroxy, amino, lower monoalkylamino, lower dialkylamino, N-pyrrolidyl, N-piperidinyl, N-pyridinium, N- morpholino, N-thiomorpholino or N-piperazino groups;
  • R 10 is H or lower alkyl (1-4 carbon atoms), amino or lower mono- or dialkylamino (1-4 carbon atoms);
  • R 1 , R 2 , R 3 or R 4 contain chiral centers, or in the case of R 1 create chiral centers on the linking atoms, then all stereoisomers thereof both separately and as racemic and/or diastereoisomeric mixtures are included;
  • the ring containing A-E is aromatic
  • one of the imidazole nitrogen atoms must have a substituent from the R 3 — R 6 group other than lone pair or hydrogen;
  • Ar cannot be unsubstituted phenyl, unsubstituted or substituted pyridyl or unsubstituted or substituted pyrimidyl.
  • A-E are carbon one of Y and Z cannot be nitrogen, substituted with hydrogen, and the other a bond.
  • the compound or active agent is a cinnamoyl compound having a structure of formula (XIV), shown below, which is described in U.S. Patent Application Publication No. US 2009/0143368 to Shiraki et al., which is hereby incorporated by reference in its entirety:
  • I. a represents a benzene ring or a pyridine ring; in ( ⁇ ⁇ ) 3 ⁇ 4 , ⁇ is a substituent on a carbon atom and represents a group included in the following X 0 group or the Yo group, q represents 0, 1, 2, 3, 4 or 5, and when q is not less than 2, Y a s are the same or different, and when q is not less than 2, adjacent two same or different Y a s may together form a group included in the Zo group to be fused to the a ring; and in (X a ) p , X a is a substituent on a carbon atom and represents a group which does not belong to the following X 0 group, Yo group and Zo group, p represents 0, 1, 2, 3, 4 or 5, and when p is not less than 2, X a s are the same or different and the sum of p and q is not more than 5;
  • the Xo group a M a -group, wherein M a represents a R b — group (wherein R b represents a CI - CIO alkyl group optionally substituted with a halogen atom), a halogen atom, a nitro group, a cyano group, a hydroxyl group, a R c — B a — R ⁇ — group (wherein Rc represents a CI -CIO alkyl group optionally substituted with a halogen atom, B a represents an oxy group, a thio group, a sulfmyl group or a sulfonyl group, and R ⁇ represents a single bond or a CI -CIO alkylene group), an HOR ⁇ — group (wherein R ⁇ is as defined above), a R e — CO— R ⁇ — group (wherein R e represents a hydrogen atom, or a CI -CIO alkyl group optionally substituted
  • M c0 represents a M d o-RJ— group
  • M do represents a 6 to 10-membered aryl group optionally substituted with a M a — group (wherein M a is as defined above), a 5 to 10- membered heteroaryl group optionally substituted with a M a — group (wherein M a is as defined above), a 3 to 10-membered cyclic hydrocarbon or heterocyclic group optionally substituted with a M a - group (wherein M a is as defined above) and optionally containing an unsaturated bond, a (bo)- group represented by
  • eo forms a 5 to 12-membered hydrocarbon ring optionally substituted with a carbonyl group, a thiocarbonyl group, an oxy group, a thio group, a— NRi— group (wherein Ri is as defined above), a sulfmyl group or a sulfonyl group); and ⁇ RJ is the same as or different from Rr f and has the same meaning as R ⁇ has], a M c0 -B a group (wherein M c0 and B a are as defined above), a M c0 -CO— group (wherein M c0 is as defined above), a M co -CO— O— group (wherein M eo is as defined above), a M c oO— CO— group (wherein M c o is as defined above), a M c oR e N— group (wherein M c o and R e are as defined above), a M c0 -
  • the Zo group a 5- to 12-membered hydrocarbon ring or heterocyclic ring which may be
  • a halogen atom substituted with a halogen atom, a CI -CIO alkoxy group, C3-C 10 alkenyloxy group, a C3- C10 alkynyloxy group, a carbonyl group, a thiocarbonyl group, an oxy group, a thio group, a sulfinyl group or a sulfonyl group, and which is aromatic or non-aromatic and monocyclic or fused ring and is fused to the a ring; and
  • Q a represents an optionally substituted hydroxyl group, or an optionally substituted amino group
  • W a represents an oxygen atom or a— NTray— group (wherein ⁇ ⁇ represents a hydrogen atom, or a substituent on the nitrogen atom),
  • ⁇ ⁇ is as defined above, and L y represents a C I -C IO alkyl group;
  • ⁇ ⁇ is as defined above, and K p represents a cyano group or a UOCO— group (wherein
  • U represents a hydrogen atom or a CI -CIO alkyl group
  • W a is as defined above, and K y and Lg form an optionally substituted C3-C 10 alkylene group or an optionally substituted C4-C 10 alkenylene group;
  • ⁇ ⁇ is as defined above, and ⁇ ⁇ represents an optionally substituted hydroxyl group; or a group represented by formula (1-8): wherein U and W a are as defined above.
  • the compound is a 4,5,6,7-tetrahydrobenzo[b]thiophene compounds having the general structure according to formula (XV), shown below, which is described in U.S. Patent Application Publication No. US2004/0171603 to Pato et al, which is hereby incorporated by reference in its entirety:
  • Y represents C or S
  • R 2 represents— COOR 12 ,— CONR 12 R 12* ,— CONR 12 R 14 ; — C ⁇ N,— COCOOR 12 ,
  • R 3 , R 4 , R 5 represent independently of each other— R 11 ,— R 12 ,— R 12* ,—OR 12 ,— SR 12 ,
  • R 6 represents— R 11 ,— R 12 ,— R 12* ,—OR 12 ,— SR 12 ,— N0 2 ,— CO— R 12 ,—NO,— N 3 ,— CN,—OCN,—NCO,—SCN,—NCS,—COOR 12 ,—COCN,— CONR 12 R 12* ,—
  • NR 12 R 12 ',—SOR 2 ,— S0 2 R 12 ,— S0 3 R 12 , and R 6* is hydrogen;
  • R 7 , R 8 , R 9 , R 10 represent independently of each other— R n — R 12 —OR 12 ,— SR 12 ,— N0 2 ,— CO— R 12 ,— COOR 12 ,— OOCR 16 ;
  • R 11 represents— F,— CI,— Br,— I;
  • CH CHC 2 H 5 ,— CH(CH 3 )C 2 H 5 ,— (CH 2 ) n — C ⁇ C— R 5 ,— C 4 H 9 ,— C(CH 3 ) 3 ,— Ph,— CH 2 — R 15 ,— C 2 H 4 OH with n being an integer from 0-2;
  • R 14 represents
  • R represents
  • R lb is R
  • nitrobenzyl particularly p-nitrobenzyl
  • R 21 represents R 15 .
  • An exemplary compound of formula (XV) includes, without limitation, the following structure:
  • the compound or active agent is a pyrazolo-[l,5a]- pyrimidone compound having the structure according to formula (XVI), shown below, which is described in U.S. Patent No. 8,796,285 to Zhang et al, which is hereby incorporated by reference in its entirety:
  • R is alkyl, aryl, substituted aryl, heterocyclic compound, substituted heterocyclic compound or — COOR 5 ;
  • Pvi is hydrogen, halogen, alkyl, alkyl halide, aryl or substituted aryl;
  • R 2 is halogen, alkyl, substituted alkyl, aryl, substituted aryl, heterocyclic compound, substituted heterocyclic compound, or
  • X is O or NH
  • n is a natural number selected from 0 to 6
  • P 3 is hydrogen, halogen, aryl or substituted aryl
  • P 4 is fatty acid or cyclic imine
  • R5 is an alkyl with 1-4 carbon.
  • Exemplary compounds of formula (XVI) include, without limitation, those selected from the group of: ⁇ infra Table 1, A4).
  • the compound or active agent has a structure shown below ⁇ infra Table 1, A5), or a derivative thereof represented by formula (XVII), shown below,
  • R 1 can be H, o-I, m-I, p-I, p-CF3, or p-OMe.
  • the compound is a 1 ,4-substituted benzene compound or a pharmaceutically acceptable salt thereof having the following structure of formula XVIII, shown below, which is described in WO 2005103030 to Jiang et al, which is hereby incorporated by reference in its entirety: (XVIII),
  • X, Z are each independently selected from O, S or NH;
  • Y is selected from CO or S0 2 ;
  • Ri is selected from hydrogen; Ci-C 6 alkyl with a straight-chain or branched, alkenyl or alkynyl group; C3-C7 cycloalkyl, cycloalkenyl or cycloalkynyl; aromatic group Ar; contains 1-3 substituents selected from oxygen, 5-7 membered heteroaryl or substituted heteroatom sulfur or nitrogen heteroaryl, wherein heteroaryl with phenyl or 5-7 membered aromatic heterocyclyl group form a fused ring aromatic group, a substituted heteroaryl group substituents independently selected from the group consisting of one or 2-5: halogen; Ci-C 6 alkyl with straight or branched, alkenyl or alkynyl; cyano; nitro; amino; hydroxy; hydroxy groups; trifluoromethyl; trifluoromethoxy; carboxy; C 1 -C 4 alkoxy; mercapto; C 1 -C 4 acyl; aryl Ar;
  • R 2 is selected from the followin structural groups (II, III, IV or V):
  • n 0, 1, 2 or 3;
  • R3, R4 are each independently selected from hydrogen; Ci-C 6 linear or branched alkyl, alkenyl or alkynyl group; a nitro group; a halogen; cyano; trifluoromethyl; trifluoromethoxy;
  • R 5 , R5 each independently selected from hydrogen; methyl; ethyl; cyclohexyl; aromatic group Ar containing 1 to 3 heteroatoms, 5-7 membered heteroaryl, or a substituted sulfur or nitrogen heteroatoms heteroaryl group, wherein heteroaryl with phenyl or 5-7 membered heterocyclic aromatic group form a fused ring aryl, substituted heteroaryl the substituents are
  • halogen independently selected from the group consisting of one or 2-5: halogen; Ci-C 6 alkyl, alkenyl or alkynyl group linear or branched; cyano; nitro; amino; hydroxy group; trifluoromethyl; trifluoromethoxy; carboxy; C 1 -C 4 alkoxy group; mercapto; aromatic group Ar;
  • the aromatic group Ar denotes phenyl, naphthyl, biphenyl or a substituted phenyl group
  • substituted phenyl wherein the substituents are independently selected from the group 1-4: halo; Ci-C 6 straight-chain or branched-chain alkyl, alkenyl or alkynyl group; cyano; nitro; amino; hydroxy group; trifluoromethyl; trifluoromethoxy; carboxy; C 1 -C 4 alkoxy; mercapto.
  • One exem lary compound of formula (XVIII) has the following structure: ⁇ infra Table 1, B2).
  • the compound has the structure
  • A is a lower alkylene group
  • P i to P 5 each are the same or different from one another; each represent hydrogen atom, a halogen atom, a lower alkyl group, a lower alkoxy group, a carboxylic acid salt group, an acyl group, cyano group, a cycloalkyl group, an aryl group or nitro group; and may form a ring in conjunction of two adjacent groups.
  • N-alkylbenzamido ring members can be introduced instead of the other substituted phenyl rings.
  • the compound has the structure
  • Ri represents an aromatic radical having 1-3 nuclei, including a carbocyclic aryl radical such as phenyl, biphenyl, naphthyl, anthryl, phenanthryl, and the like, and a heterocyclic aryl radical such as furan, thiophene, pyridine, pyridazine, pyrimidine, pyrazine, quinoline, isoquinoline, acridine, phenanthridine, phenazine, phenoxazine, phenthiazine, coumarone, benzothiophene, indole, pyrazole, imidazole, thiazole, oxazole, triazole, carbazole and the like.
  • a carbocyclic aryl radical such as phenyl, biphenyl, naphthyl, anthryl, phenanthryl, and the like
  • a heterocyclic aryl radical such as furan, thiophen
  • aliphatic acid amides of 2- aminobenzirnidazole where Ri is alkyl .
  • Variants of formula XX can be prepared according to Grier where Ri is a substituted phenyl containing, e.g., a halogen substituent.
  • the compound of formula (XX) has the following structure, as described in U.S. Patent No. 7,132,438 to Frenkel et al, which is hereby incorporated by reference in its entirety:
  • R 1 is selected from the group consisting of H, (Ci-Cs) alkyl, hetero(Ci-Cs)alkyl, fluoro(Ci- C 4 )alkyl, cycloalkyl(Ci-C8)alkyl, heterocyclo(Ci-Cs)alkyl, aryl, aryl(Ci-Cs)alkyl, cyclo(C 3 -C8)alkyl-(Ci-Cs)alkyl, cyclo(C 3 -C8)alkylhetero(Ci-C8)alkyl, heterocyclo(Ci- Cs)alkyl, arylhetero(Ci-Cs)alkyl and heteroaryl;
  • R is (Ci-Cs)alkyl, hetero(Ci-Cs)alkyl, perfluoro (Ci-C 4 )alkyl, aryl or heteroaryl;
  • Z 1 and Z 2 are independently H, halogen, CN, C0 2 R, CONR'R", (Ci-C 4 )alkyl, (Ci- C 4 )heteroalkyl, perfluoro(Ci-C 4 )alkyl, aryl, heteroaryl, NR'R" or OR";
  • Z and Z may be combined to form an additional fused 5-, 6-, 7- or 8-membered cycloalkane, heterocycloalkane, aromatic or heteroaromatic ring;
  • R 3 and R 4 are independently selected from the group consisting of H, CN, C0 2 R, CONR'R", (Ci-C 4 )alkyl, (Ci-C 4 )heteroalkyl, aryl, heteroaryl, NR'R" and OR * ;
  • R and R" are independently H, (Ci-C 4 )alkyl, hetero(Ci-C 4 )alkyl, aryl or aryl(Ci-C 4 )alkyl; alternatively, when R' and R" are attached to nitrogen, R' and R" may be combined with the nitrogen atom to form a 5-, 6- or 7-membered ring; and
  • R 3 , R 4 or R may be combined with R to form a 5-, 6-, 7- or 8-membered ring containing from 0 to 3 heteroatoms selected from the group consisting of O, N, Si and S; with the proviso that R 1
  • the compound has the formula
  • Ta le 1 , B5 or a derivative thereof having the structure according to formula (XXI), shown below, which is described in JP Patent Publ. No. H 02145588 to Miura Akaio et al., which is hereby incorporated by reference in its entirety: wherein
  • Pvi represents H or monovalent organic group
  • Y represents— O— ,— S— ,—SO—,— S0 2 — ,— (R 3 )— ;
  • R 2 and R 3 represent H or monovalent organic group.
  • derivatives of compound B5 have the structure of formula (XXII), shown below, which is described in Karthikeyan et al, "Synthesis and antimicrobial studies of novel dichlorophenyl containing aminotriazolothiadiazines," Eur. J. Med. Chem. 43:309-314 (2008 which is hereby incorporated by reference in its entirety
  • R is selected from the group consisting of 4-CH 3 ; 4-Cl; 4-OCH 3 ; 4-OC 2 H 5 ; 4-F, 2,3-Cl 2 ; 2,4-Cl 2 ; 2,6-Cl 2 ; 2,3-(CH 3 ) 2 ; 2,4-(CH 3 ) 2 ; 2,6-(CH 3 ) 2 ; 3-C1-4-F; 2,4,6-(CH 3 ) 3 ; and 2,4,5-Cl 3 ; 2- CF 3 .
  • the compound or active agent has the structure according to formula (XXIII), shown below, which is described in EP 0289879 to Okada et al, which is hereby incorporated by reference in its entirety): (XXIII),
  • R 1 represents hydrogen atom, C 1 -C 4 alkyl group, C 1 -C 4 haloalkyl group, phenyl group or benzyl group;
  • R 2 and R 3 represents— C(0)-R 4 or— C(S)-R 4 ;
  • R 5 , R 6 and R 7 represent respectively hydrogen atom, C 1 -C 4 alkyl group or phenyl group;
  • R and R represent respectively hydrogen atom, halogen atom, Ci-Cs alkyl group, C 3 -C 5 alkenyl group, C 3 -C 5 alkynyl group, C 3 -C 6 cycloalkyl group, C 2 -C 4 alkoxyalkyl group, C 1 -C 4 alkoxy group, C 1 -C 4 haloalkoxy group, nitro group, trifluoromethyl group, phenyl group, benzyl group, phenoxy group, benzyloxy group, amino group, C 1 -C 4 alkylamino group, C 2 -Cs dialkylamino group, cyano group, carboxyl group, C 2 -C 5 alkoxycarbonyl group, C 4 -C7 cycloalkoxycarbonyl group, C 3 -C9 alkoxyalkoxycarbonyl group, C 2 -C 6 alkylaminocarbonyl group, C 3 -C 11 dialkylaminocarbonyl
  • R 1 represents C 1 -C 4 alkyl group, C 1 -C 4 haloalkyl group, phenyl group or benzyl group;
  • R and R represents hydrogen atom, C 1 -C 4 alkyl group, C 1 -C 4 haloalkyl group, C 3 -
  • X represents hydrogen atom, halogen atom, C 1 -C 4 alkyl group, nitro group, cyano group, C 1 -C 5 alkylamino group, C 2 -Cio dialkylamino group and C 2 -C 7 acylamino group.
  • XXIII One exemplary compound of formula (XXIII) has the structure of:
  • the compound or active agent has a structure according to formula (XXIV), shown below, which is described in U.S. Patent No. 8,609,663 to Finberg et al, which is hereby incorporated b reference in its entirety:
  • Ar is C 6 -io aryl or Ci_ heteroaryl, each of which is optionally substituted by 1, 2, 3, or 4 independently selected R l groups;
  • each R 9 is independently selected from halogen, cyano, nitro, carboxy, hydroxyl, Ci_ 6
  • Ci_ 6 alkoxycarbonyl Ci_ 6 alkyl, C 2 -6 alkenyl, C 2 _ 6 alkynyl, Ci_ 6 haloalkyl, Ci_ 6 alkoxy, and Ci_ 6 haloalkoxy;
  • each R l is independently selected from halogen, cyano, nitro, carboxy, hydroxyl, Ci_ 6
  • Ci_ 6 alkoxycarbonyl amino, Ci_ 6 alkylamino, di-Ci_ 6 alkylamino, Ci_ 6
  • Ci_ 6 alkyl C 2 _ 6 alkenyl, C 2 _ 6 alkynyl, Ci_ 6 haloalkyl, Ci_ 6 alkoxy, and Ci_ 6 haloalkoxy;
  • r is an integer selected from 0, 1, 2, 3, 4, 5, and 6.
  • each variable can be a different moiety independently selected from the group defining the variable.
  • the two R groups can represent different moieties independently selected from the group defined for R.
  • an optionally multiple substituent is designated in the form:
  • substituent R can occur p number of times on the ring, and R can be a different moiety at each occurrence. It is understood that each R group may replace both of the (CH 2 )n hydrogen atoms.
  • variable Q be defined to include hydrogens, such as when Q is the to be CH2, NH, etc.
  • any floating substituent such as R in the above example can replace a hydrogen of the Q variable as well as a hydrogen in any other non-variable component of the ring. Unless otherwise indicated, should floating substituent R appear on a fused ring system, the substituent may replace a hydrogen atom at any ring atom in the fused ring system.
  • alkyl means an aliphatic hydrocarbon group which may be straight or branched. When not otherwise restricted, the term refers to an alkyl of 20 or fewer carbons. Lower alkyl refers to alkyl groups having about 1 to about 6 carbon atoms in the chain.
  • Branched means that one or more lower alkyl groups such as methyl, ethyl or propyl are attached to a linear alkyl chain.
  • exemplary alkyl groups include methyl, ethyl, n-propyl, i-propyl, n- butyl, t-butyl, n-pentyl, 3-pentyl, and the like.
  • alkenyl means an aliphatic hydrocarbon group containing a carbon— carbon double bond and which may be straight or branched having about 2 to about 6 carbon atoms in the chain. Particular alkenyl groups have 2 to about 4 carbon atoms in the chain.
  • Branched means that one or more lower alkyl groups such as methyl, ethyl, or propyl are attached to a linear alkenyl chain.
  • exemplary alkenyl groups include ethenyl, propenyl, n- butenyl, and i-butenyl.
  • alkenyl may also refer to a hydrocarbon chain having 2 to 6 carbons containing at least one double bond and at least one triple bond.
  • alkynyl means an aliphatic hydrocarbon group containing a carbon— carbon triple bond and which may be straight or branched having about 2 to about 6 carbon atoms in the chain. Particular alkynyl groups have 2 to about 4 carbon atoms in the chain.
  • Branched means that one or more lower alkyl groups such as methyl, ethyl, or propyl are attached to a linear alkynyl chain.
  • exemplary alkynyl groups include ethynyl, propynyl, n- butynyl, 2-butynyl, 3-methylbutynyl, and n-pentynyl.
  • cycloalkyl means a non-aromatic, saturated or unsaturated, mono- or multi-cyclic ring system of about 3 to about 7 carbon atoms, or of about 5 to about 7 carbon atoms, and which may include at least one double bond.
  • exemplary cycloalkyl groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclophenyl, anti-bicyclopropane, and syn-tricyclopropane.
  • cycloalkylalkyl means a cycloalkyl-alkyl-group in which the cycloalkyl and alkyl are as defined herein.
  • exemplary cycloalkylalkyl groups include cyclopropylmethyl and cyclop entylmethyl.
  • the alkyl radical and the cycloalkyl radical may be optionally substituted as defined herein.
  • heterocyclyl or “heterocycle” refers to a stable 3- to 18- membered ring (radical) which consists of carbon atoms and from one to five heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur.
  • the heterocycle may be a monocyclic, or a polycyclic ring system, which may include fused, bridged, or spiro ring systems; and the nitrogen, carbon, or sulfur atoms in the heterocycle may be optionally oxidized; the nitrogen atom may be optionally quaternized; and the ring may be partially or fully saturated.
  • heterocycles include, without limitation, azepinyl, azocanyl, pyranyl dioxanyl, dithianyl, 1,3-dioxolanyl, tetrahydrofuryl, dihydropyrrolidinyl, decahydroisoquinolyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2- oxopyrrolidinyl, 2-oxoazepinyl, oxazolidinyl, oxiranyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, thiazolidinyl, tetrahydropyranyl, thiamorpholiny
  • the term "monocyclic” used herein indicates a molecular structure having one ring.
  • polycyclic or “multi-cyclic” used herein indicates a molecular structure having two or more rings, including, but not limited to, fused, bridged, or spiro rings.
  • aryl means an aromatic monocyclic or multi-cyclic (polycyclic) ring system of 6 to about 19 carbon atoms, or of 6 to about 10 carbon atoms, and includes arylalkyl groups.
  • the ring system of the aryl group may be optionally substituted.
  • Representative aryl groups include, but are not limited to, groups such as phenyl, naphthyl, azulenyl, phenanthrenyl, anthracenyl, fluorenyl, pyrenyl, triphenylenyl, chrysenyl, and naphthacenyl.
  • heteroaryl means an aromatic monocyclic or multi-cyclic ring system of about 5 to about 19 ring atoms, or about 5 to about 10 ring atoms, in which one or more of the atoms in the ring system is/are element(s) other than carbon, for example, nitrogen, oxygen, or sulfur.
  • element(s) other than carbon for example, nitrogen, oxygen, or sulfur.
  • heteroaryl In the case of multi-cyclic ring system, only one of the rings needs to be aromatic for the ring system to be defined as "heteroaryl”.
  • Particular heteroaryls contain about 5 to 6 ring atoms.
  • aza, oxa, thia, or thio before heteroaryl means that at least a nitrogen, oxygen, or sulfur atom, respectively, is present as a ring atom.
  • a nitrogen, carbon, or sulfur atom in the heteroaryl ring may be optionally oxidized; the nitrogen may optionally be quaternized.
  • heteroaryls include pyridyl, 2-oxo-pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, triazinyl, furanyl, pyrrolyl, thiophenyl, pyrazolyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, indolyl, isoindolyl, benzofuranyl, benzothiophenyl, indolinyl, 2-oxoindolinyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, indazolyl, benzimidazolyl, benzooxazolyl, benzothiazolyl, benzoisoxazolyl, benzoisothiazolyl, benzotriazolyl,
  • arylalkyl and hetero arylalkyl mean an alkyl substituted with one or more aryl or heteroaryl groups, wherein the alkyl, aryl, and heteroaryl groups are as herein described.
  • arylmethyl or heteroarylmethyl group in which a single carbon spacer unit is attached to an aryl or heteroaryl group, where the carbon spacer and the aryl or heteroaryl group can be optionally substituted as described herein.
  • acyl means a moiety of formula R-carbonyl, where R is an alkyl, cycloalkyl, aryl, or heteroaryl as defined above.
  • exemplary acyl groups include formyl, acetyl, propanoyl, benzoyl, and propenoyl.
  • carbonyl means a carbonyl group,— C(O)— .
  • thiocarbonyl means a thiocarbonyl group,— C(S)— .
  • sulfoxide means a sulfoxide group,— S(O)— .
  • sulfone means a sulfone group,— S(0) 2 — .
  • alkoxy means groups of from 1 to 8 carbon atoms of a straight, branched, or cyclic configuration and combinations thereof attached to the parent structure through an oxygen. Examples include methoxy, ethoxy, propoxy, isopropoxy, cyclopropyloxy, cyclohexyloxy, and the like. Lower-alkoxy refers to groups containing one to four carbons. For the purposes of the present patent application, alkoxy also includes methyl enedioxy and ethylenedioxy in which each oxygen atom is bonded to the atom, chain, or ring from which the methylenedioxy or ethylenedioxy group is pendant as to form a ring. Thus, for example,
  • phenyl substituted by alkoxy may be, for example,
  • halogen means fluoro, chloro, bromo, or iodo.
  • phenyl means a phenyl group as shown below
  • benzyl means a benzyl group as shown below
  • naphthyl means a naphthyl group as shown below
  • haloalkyl means both branched and straight-chain alkyl substituted with one or more halogen, wherein the alkyl group is as herein described.
  • alkoxyalkyl means both branched and straight-chain alkyl substituted with one or more alkoxy groups, wherein the alkyl group is as herein described.
  • Up to three H atoms in each residue are replaced with alkyl, halogen, haloalkyl, hydroxy, loweralkoxy, carboxy, carboalkoxy (also referred to as alkoxycarbonyl), carboxamido (also referred to as alkylaminocarbonyl), cyano, carbonyl, nitro, amino, alkylamino, dialkylamino, mercapto, alkylthio, sulfoxide, sulfone, acylamino, amidino, phenyl, benzyl, heteroaryl, phenoxy, benzyloxy, or heteroaryloxy.
  • the terms "compound,” “product compound,” “active agents” and equivalent expressions are meant to embrace the polyether antibiotics disclosed herein, compounds of formulae (I)-(XXIV) as described herein, as well as any other compounds identified herein (e.g., those compounds identified in the Examples or Table 1). Also contemplated are the prodrugs, the pharmaceutically acceptable salts, the oxides, the solvates, e.g. hydrates, and inclusion complexes of that compound, where the context so permits, as well as any stereoisomeric form, or a mixture of any such forms of that compound in any ratio. Inclusion complexes are described in Remington, The Science and Practice of Pharmacy, 19th Ed.
  • a compound as described herein including in the contexts of pharmaceutical compositions, methods of treatment, and compounds per se, is provided as the salt form.
  • reference to intermediates, whether or not they themselves are claimed, is meant to embrace their salts, and solvates, where the context so permits. For the sake of clarity, particular instances when the context so permits are sometimes indicated in the text, but these instances are purely illustrative and it is not intended to exclude other instances when the context so permits.
  • composition means a composition comprising at least one compound disclosed herein, as well as combinations thereof, and at least one component comprising pharmaceutically acceptable carriers, diluents, adjuvants, excipients, or vehicles, such as preserving agents, fillers, disintegrating agents, wetting agents, emulsifying agents, suspending agents, sweetening agents, flavoring agents, perfuming agents, antibacterial agents, antifungal agents, lubricating agents and dispensing agents, depending on the nature of the mode of administration and dosage forms.
  • pharmaceutically acceptable carrier is used to mean any carrier, diluent, adjuvant, excipient, or vehicle, as described herein.
  • suspending agents examples include ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar— agar and tragacanth, or mixtures of these substances.
  • Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monosterate and gelatin.
  • suitable carriers, diluents, solvents, or vehicles include water, ethanol, polyols, suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate.
  • excipients include lactose, milk sugar, sodium citrate, calcium carbonate, and dicalcium phosphate.
  • disintegrating agents include starch, alginic acids, and certain complex silicates.
  • lubricants include magnesium stearate, sodium lauryl sulphate, talc, as well as high molecular weight polyethylene glycols.
  • pharmaceutically acceptable means it is, within the scope of sound medical judgment, suitable for use in contact with the cells of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
  • pharmaceutically acceptable dosage forms means dosage forms of the compounds described herein, and includes, for example, tablets, dragees, powders, elixirs, syrups, liquid preparations, including suspensions, sprays, inhalants tablets, lozenges, emulsions, solutions, granules, capsules, and suppositories, as well as liquid preparations for injections, including liposome preparations.
  • Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., latest edition, which is hereby incorporated by reference in its entirety.
  • pharmaceutically acceptable salt refers to salts prepared from pharmaceutically acceptable non-toxic acids or bases including inorganic acids and bases and organic acids and bases.
  • suitable pharmaceutically acceptable acid addition salts for the compounds described herein include acetic, benzenesulfonic (besylate), benzoic,
  • suitable pharmaceutically acceptable base addition salts for the compounds described herein include metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from lysine, ⁇ , ⁇ '- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine), and procaine.
  • salts include, but are not limited to, amine salts, such as but not limited to N, N'dibenzylethylenediamine, chloroprocaine, choline, ammonia, diethanolamine and other hydroxyalkylamines, ethylenediamine, N- methyl glucamine, procaine, N-benzylphenethylamine, l-para-chlorobenzyl-2-pyrrolidin-l'- ylmethyl- benzimidazole, diethylamine and other alkylamines, piperazine, and tris
  • amine salts such as but not limited to N, N'dibenzylethylenediamine, chloroprocaine, choline, ammonia, diethanolamine and other hydroxyalkylamines, ethylenediamine, N- methyl glucamine, procaine, N-benzylphenethylamine, l-para-chlorobenzyl-2-pyrrolidin-l'- yl
  • alkali metal salts such as but not limited to lithium, potassium, and sodium
  • alkali earth metal salts such as but not limited to barium, calcium, and magnesium
  • transition metal salts such as but not limited to zinc
  • other metal salts such as but not limited to sodium hydrogen phosphate and disodium phosphate
  • salts of mineral acids such as but not limited to hydrochlorides and sulfates
  • salts of organic acids such as but not limited to acetates, lactates, malates, tartrates, citrates, ascorbates, succinates, butyrates, valerates and fumarates.
  • esters include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl and heterocyclyl esters of acidic groups, including, but not limited to, carboxylic acids, phosphoric acids, phosphinic acids, sulfonic acids, sulfinic acids, and boronic acids.
  • Pharmaceutical acceptable solvates and hydrates are complexes of a compound with one or more solvent or water molecules, or 1 to about 100, or 1 to about 10, or one to about 2,3 or 4, solvent or water molecules.
  • solvate refers to a compound described herein in the solid state, wherein molecules of a suitable solvent are incorporated in the crystal lattice.
  • a suitable solvent for therapeutic administration is physiologically tolerable at the dosage administered.
  • Suitable solvents for therapeutic administration are ethanol and water.
  • the solvate When water is the solvent, the solvate is referred to as a hydrate.
  • solvates are formed by dissolving the compound in the appropriate solvent and isolating the solvate by cooling or using an antisolvent.
  • the solvate is typically dried or azeotroped under ambient conditions.
  • terapéuticaally effective amount is meant to describe an amount of compound described herein effective in producing the desired therapeutic effect. Such amounts generally vary according to a number of factors well within the purview of ordinarily skilled artisans given the description provided herein to determine and account for. These include, without limitation: the particular subject, as well as its age, weight, height, general physical condition, and medical history, the particular compound used, as well as the carrier in which it is formulated and the route of administration selected for it; and, the nature and severity of the condition being treated.
  • Compounds described herein may contain one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms.
  • Each chiral center may be defined, in terms of absolute stereochemistry, as (R)- or (S)-. This technology is meant to include all such possible isomers, as well as mixtures thereof, including racemic and optically pure forms.
  • Optically active (R)- and (S)-, (-)- and (+)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques.
  • the compounds described herein contain olefmic double bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.
  • This technology also envisions the "quaternization" of any basic nitrogen- containing groups of the compounds disclosed herein.
  • the basic nitrogen can be quaternized with any agents known to those of ordinary skill in the art including, for example, lower alkyl halides, such as methyl, ethyl, propyl and butyl chloride, bromides and iodides; dialkyl sulfates including dimethyl, diethyl, dibutyl and diamyl sulfates; long chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; and aralkyl halides including benzyl and phenethyl bromides.
  • lower alkyl halides such as methyl, ethyl, propyl and butyl chloride, bromides and iodides
  • dialkyl sulfates including dimethyl, diethyl, dibutyl and dia
  • the active agents can be administered to an individual in the form of a
  • the active agent will be administered to a mammal as a pharmaceutical formulation that includes the active agent and any pharmaceutically acceptable suitable adjuvants, carriers, excipients, and/or stabilizers, and can be in solid or liquid form, such as tablets, capsules, powders, solutions, suspensions, or emulsions.
  • the compositions preferably contain from about 0.01 to about 99 weight percent, more preferably from about 2 to about 60 weight percent, of active agent together with the adjuvants, carriers, and/or excipients.
  • the amount of active agent in such therapeutically useful compositions is such that a suitable dosage unit will be obtained.
  • the dosage of the active agent is preferably administered at a dose of between about 0.01 mg per kg of body weight per day (mg/kg/day) to about 100 mg/kg/day, preferably 0.01 mg per kg of body weight per day (mg/kg/day) to 10 mg/kg/day, and most preferably 0.1 to 5.0 mg/kg/day.
  • Administration can be accomplished either via systemic administration to the subject, administration directly to a fibrotic tissue site, or via targeted administration to affected cells.
  • routes of administration include, without limitation, orally, parenterally, periadventitially, subcutaneously, intravenously, intramuscularly, intraperitoneally, by inhalation, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, intradermally or by application to mucous membranes.
  • Other suitable modes of delivery can also be used, and administration can be repeated periodically as needed.
  • the active agent may be orally administered, for example, with an inert diluent, or with an assimilable edible carrier, or they may be enclosed in hard or soft shell capsules, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet.
  • these active agents may be incorporated with excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, and the like.
  • Such compositions and preparations should contain at least 0.1% of the agent.
  • the percentage of the active agent in these compositions may, of course, be varied and may conveniently be between about 2% to about 60% of the weight of the unit.
  • the amount of the active agent in such therapeutically useful compositions is such that a suitable dosage will be obtained.
  • the tablets, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a binder such as gum
  • disintegrating agent such as corn starch, potato starch, or alginic acid
  • a lubricant such as magnesium stearate
  • a sweetening agent such as sucrose, lactose, or saccharin.
  • a liquid carrier such as a fatty oil.
  • tablets may be coated with shellac, sugar, or both.
  • a syrup may contain, in addition to active ingredient(s), sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring such as cherry or orange flavor.
  • the active agent may also be administered parenterally.
  • Solutions or suspensions of the active agent can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose.
  • Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils.
  • Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil.
  • water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycol or polyethylene glycol are preferred liquid carriers, particularly for injectable solutions. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
  • the pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions.
  • the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi.
  • the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
  • the active agent may also be administered directly to the airways in the form of an aerosol.
  • the compounds of the present invention in solution or suspension may be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
  • suitable propellants for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
  • suitable propellants for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants.
  • the materials of the present invention also may be administered in a non-pressurized form such as in a nebulizer or atomizer.
  • the active agent may be administered to the airways in the form of a lung surfactant formulation.
  • the lung surfactant formulation can include exogenous lung surfactant formulations (e.g., INFASURF® (Forest Laboratories), SURVANTA® (Ross Products), and CUROSURF® (DEY, California, USA) or synthetic lung surfactant formulations (e.g., Exosurf (Glaxo Wellcome Inc.), ALEC, and those described in U.S. Application Publ. Nos. 20100055164 and 20150125515, both to Notter et al., each of which is hereby incorporated by reference in its entirety).
  • These surfactant formulations are typically administered via airway instillation (i.e., after intubation) or intratracheally.
  • ophthalmic solutions, suspensions, ointments or inserts comprising an active agent can be administered.
  • Eye drops can be prepared by dissolving the active ingredient in a sterile aqueous solution such as physiological saline, buffering solution, etc., or by combining powder compositions to be dissolved before use.
  • Other vehicles can be chosen, as is known in the art, including but not limited to: balance salt solution, saline solution, water soluble polyethers such as polyethyene glycol, polyvinyls, such as polyvinyl alcohol and povidone, cellulose derivatives such as methylcellulose and
  • hydroxypropyl methylcellulose petroleum derivatives such as mineral oil and white petrolatum, animal fats such as lanolin, polymers of acrylic acid such as carboxypolymethylene gel, vegetable fats such as peanut oil and polysaccharides such as dextrans, and glycosaminoglycans such as sodium hyaluronate. If desired, additives ordinarily used in the eye drops can be added.
  • Such additives include isotonizing agents (e.g., sodium chloride, etc.), buffer agent (e.g., boric acid, sodium monohydrogen phosphate, sodium dihydrogen phosphate, etc.), preservatives (e.g., benzalkonium chloride, benzethonium chloride, chlorobutanol, etc.), thickeners (e.g., saccharide such as lactose, mannitol, maltose, etc.; e.g., hyaluronic acid or its salt such as sodium
  • hyaluronate potassium hyaluronate, etc.
  • mucopolysaccharide such as chondroitin sulfate, etc.
  • sodium polyacrylate carboxyvinyl polymer, crosslinked polyacrylate, polyvinyl alcohol, polyvinyl pyrrolidone, methyl cellulose, hydroxy propyl methylcellulose, hydroxyethyl cellulose, carboxymethyl cellulose, hydroxy propyl cellulose or other agents known to those skilled in the art).
  • the active agents may also be administered directly to the targeted tissue.
  • the active agents may be administered to a non-targeted area along with one or more agents that facilitate migration of the active agent to (and/or uptake by) a targeted tissue, organ, or cell.
  • the therapeutic agent itself can be modified to facilitate its transport to (and uptake by) the desired tissue, organ, or cell.
  • targeted delivery to the liver can be achieved using cationic solid lipid nanoparticles of Kong et al. ("Cationic solid lipid nanoparticles derived from apolipoprotein-free LDLs for target specific systemic treatment of liver fibrosis," Biomaterials 34(2):542-51 (2012), which is hereby incorporated by reference in its entirety) modified to deliver the active agents.
  • Exemplary delivery devices include, without limitation, nebulizers, atomizers, liposomes, transdermal patches, implants, implantable or injectable protein depot compositions, syringes, and gene therapy.
  • Other delivery systems which are known to those of skill in the art can also be employed to achieve the desired delivery of the therapeutic agent to the desired organ, tissue, or cells in vivo to carry out this aspect of the present invention.
  • the method of treating fibrosis includes administering to the patient an amount of a second agent that is therapeutically effective to treat the fibrosis (i.e., additional anti-fibrotic agents), wherein the second agent is different from the active agent disclosed above.
  • Exemplary second agents include, without limitation, calcium channel blockers, cytotoxic agents, cytokines, chemokines, integrins, growth factors, hormones, lysophosphatidic acid (LP A) receptor 1 antagonists, agents that modulate the TGF- ⁇ pathway, endothelin receptor antagonists, agents that reduce connective tissue growth factor (CTGF) activity, matrix metalloproteinase (MMP) inhibitors, agents that reduce the activity of platelet-derived growth factor (PDGF), agents that interfere with integrin function, agents that interfere with the pro-fibrotic activities of cytokines, agents that reduce oxidative stress, PDE4 inhibitors, PDE5 inhibitors, mTor inhibitors, modifiers of the arachidonic acid pathway, peroxisome proliferator-activated receptor (PPAR)-y agonists, kinase inhibitors, inhibitors of VEGF signaling pathway, matrix metalloproteinases, tissue inhibitors of metalloprotein
  • Exemplary calcium channel blockers include, without limitation, Verapamil.
  • cytotoxic agents include, without limitation, azathioprine,
  • methotrexate and cyclophosphamide. In certain embodiments, these agents can be excluded.
  • cytokines include, without limitation, interleukins such as IL-1, IL-4,
  • interferons such as interferon- ⁇ ; lymphokines; tumor necrosis factor-a; endothelin-1; angiotensin II; leptins; angiogenin(s); monocyte chemoattractant protein type 1 (MCP-1); and macrophage inflammatory protein (MIP-l , MIP-2).
  • chemokines include, without limitation, CCL2, CCL12, CXCL12,
  • Exemplary integrins include, without limitation, ⁇ , ⁇ 2 ⁇ , ⁇ ⁇ ⁇ 6, and ⁇ ⁇ ⁇ 3 .
  • Exemplary growth factors include, without limitation, insulin growth factors
  • IGF-1, IGF-2 keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), fibroblast growth factors (FGF-1, 2 and 4), platelet-derived growth factors (PDGF-AB, PDGF-BB, PDGF- AA), epidermal growth factors (EGFs), transforming growth factors (TGF ⁇ l-3), osteoid- inducing factor (OIF), bone morphogenic proteins (BMPs; BMP1, BMP2, BMP2A, BMP2B, BMP 3, BMP3b, BMP4, BMP5 , BMP6, BMP9 - BMP- 15 , OP- 1 , OP-2, OP-3 , BMP-7, HBGF- 1 , HBGF-2), growth differentiation factors (GDF1-3 and GDF5-12), osteogenic proteins (OP-1, OP-2, OP-3), cartilage-derived morphogenic proteins (CDMP-1, CDMP-2, CDMP-3), colony stimulating factors (CSF-1, G-CSF and GM-
  • Exemplary hormones include, without limitation, progesterone, estrogen, testosterone, growth hormone, thyroid hormone, and parathyroid hormone.
  • Exemplary lysophosphatidic acid ⁇ LP A) receptor 1 antagonists include, without
  • Exemplary agents that modulate TGF- ⁇ pathways include, without limitation, ⁇ ⁇ ⁇ 6 inhibitors; HGF; rBMP7 (bone morphogenic protein 7); decorin; tyrosine kinase inhibitors (Imantinib, Desatinib, Nolitinib); and agents that that reduce TGF- ⁇ activity (e.g., metelimumab (CAT-192), GC-1008 (Genzyme/Medimmune), lerdelimumab (CAT-152), LY-2157299 (Eli Lilly), and ACU-HTR-028 (Opko Health)); antibodies that target one or more TGF- ⁇ isoforms; inhibitors of TGF- ⁇ receptor kinases (e.g., TGFBRl (ALK5) and TGFBR2); modulators of post- receptor signaling pathways; and chemokine receptor signaling.
  • TGFBRl ALK5
  • Exemplary endothelin receptor antagonists include, without limitation, ambrisentan; avosentan; bosentan; clazosentan; darusentan; BQ-153; FR- 139317, L-744453; macitentan; PD-145065; PD-156252; PD163610; PS-433540; S-0139;
  • sitaxentan sodium TBC-3711; and zibotentan.
  • CTGF include, without limitation, FG-3019, FibroGen, other CTGF-neutralizing antibodies.
  • Exemplary matrix metalloproteinase (MMP) inhibitors include, without limitation, MMPI-12, PUP-1 and tigapotide triflutate.
  • PDGF include, without limitation, Imatinib mesylate (Novartis)) and PDGF neutralizing antibodies, antibodies targeting PDGF receptor (PDGFR), inhibitors of PDGFR kinase activity, and post-receptor signaling pathways.
  • PDGFR inhibitors include, but are not limited to, SU9518, CP-673,451 and CP-868596.
  • Exemplary agents that interfere with integrin function include, without limitation,
  • agents that interfere with the pro-fibrotic activities of cytokines include, without limitation, AER-001, AMG-317, APG-201, sIL-4Ra, anrukinzumab, CAT-354, cintredekin besudotox, MK-6105, QAX-576, SB-313, SL- 102, and TNX-650; as well as neutralizing antibodies to either cytokine, antibodies that target IL-4 receptor or IL-13 receptor, the soluble form of IL-4 receptor or derivatives thereof that is reported to bind and neutralize both IL-4 and IL-13, chimeric proteins including all or part of IL- 13 and a toxin particularly pseudomonas endotoxin, signaling though the JAK-STAT kinase pathway.
  • agents that interfere with epithelial mesenchymal transition include, without limitation, inhibitors of mTor (including but not limited to rapamycin, 40-O-(2- hydroxy)-ethyl-rapamycin, 32-deoxorapamycin, 40-[3-hydroxy-2-(hydroxy-methyl)-2- methylpropanoate]-rapamycin, Ridaforolimus (AP-23573 or MK-8669) and Torisel
  • Exemplary agents that reduce oxidative stress include, without limitation, N- acetylcysteine (a cysteine pro-drug), tetrathiomolybdate, and interferon- ⁇ .
  • Exemplary agents that are inhibitors of phosphodiesterase 4 (PDE4) or phosphodiesterase 5 (PDE5) include, without limitation, Roflumilast, mirodenafil, PF-4480682, sildenafil citrate, SLx-2101, tadalafil, udenafil, UK-369003, vardenafil, and zaprinast.
  • Exemplary modifiers of the arachidonic acid pathway include, with limitation, cyclooxygenase (COX) and 5 -lipoxygenase (LO) inhibitors such as Zileuton.
  • COX cyclooxygenase
  • LO 5 -lipoxygenase
  • Exemplary compounds that reduce tissue remodeling during fibrosis include, without limitation, prolyl hydrolase inhibitors such as 1016548, CG-0089, FG-2216, FG-4497, FG-5615, FG-6513, fibrostatin A (Takeda), lufironil, P-1894B, and safironil.
  • prolyl hydrolase inhibitors such as 1016548, CG-0089, FG-2216, FG-4497, FG-5615, FG-6513, fibrostatin A (Takeda), lufironil, P-1894B, and safironil.
  • Exemplary PPAR-gamma agonists include, without limitation, pioglitazone (Takeda), farglitizar (GSK) and rosiglitazone (GSK).
  • Exemplary kinase inhibitors include, without limitation, MEK inhibitors (e.g., MEK inhibitors), e.g., MEK inhibitors, kinase inhibitors, and others.
  • EGFR inhibitors e.g., IressaTM (gefitinib, AstraZeneca), TarcevaTM (erlotinib or OSI-774, OSI Pharmaceuticals Inc.), ErbituxTM (cetuximab, Imclone Pharmaceuticals, Inc.), EMD-7200 (Merck AG), ABX-EGF (Amgen Inc. and Abgenix Inc.), HR3 (Cuban Government), IgA antibodies (University of Er Weg-A),
  • Nuremberg Nuremberg
  • TP-38 IV AX
  • EGFR fusion protein EGF -vaccine
  • anti-EGFR immuno liposomes Hermes Biosciences Inc.
  • antibodies targeting EGF receptor inhibitors of EGF receptor kinase, and modulators of post-receptor signaling pathways
  • ErbB2 receptor inhibitors e.g., CP-724-714, CI-1033 (canertinib), HerceptinTM (trastuzumab)
  • Pan ERBB receptor inhibitors e.g., GW572016, CI-1033, EKB-569, and Omnitarg
  • MP371 SuperGen which is an inhibitor of c-Kit, Ret, PDGFR, and Lck, as well as the non-receptor tyrosine kinase c-src
  • MP470 SuperGen which is an inhibitor of c-Kit, PDGFR, and c-Met, Imatinib
  • GleevecTM which is an inhibitor of c-kit, PDGFR, and ROR, as well as the non-receptor tyrosine kinase bcl/abl, Lapatinib (TykerbTM) which is an epidermal growth factor receptor (EGFR) and ERBB2 (Her2/neu) dual tyrosine kinase inhibitor, inhibitors of PDGFR and VEGFR (e.g., NexavarTM (sorafenib, BAY43-9006), SutentTM (sunitinib, SU11248), and ABT- 869), inhibitors of VEGFR and (e.g., ZactimaTM (vandetanib, ZD-6474), BMS-690514 which is a reversible oral inhibitor of epidermal growth factor receptor (EGFR/HER-1), HER-2 and -4, and vascular endothelial growth factor receptors (VEGFRs)-l to -3, BIBF-11
  • VEGF-R2 inhibitor PTK-787/ZK222584 (Astra-Zeneca), SU5416, SU11248 (Pfizer), ZD6474 ([N-(4-bromo-2-fluorophenyl)-6-methoxy-7-[(l-methylpiperidin-4-yl)methoxy]quinazolin-4- amine]), vandetanib, cediranib, AG-013958, CP-547632, E-7080 (lenvatinib), XL-184, L-21649, ZK-304709, SU6668, sorafenib, sunitinib, pazopanib, vatalanib, AEE-788, AMG-706
  • Suitable matrix degrading enzymes include those described in U.S. Application
  • Exemplary matrix degrading enzymes include, without limitation, pancreatic elastase, elastase-2a, elastase-2b, neutrophil elastase, proteinase-3, endogenous vascular elastase, cathepsin G, mast cell chymase, mast cell tryptase, plasmin, thrombin, granzyme B, cathepsin S, cathepsin K, cathepsin L, cathepsin B, cathespin C, cathepsin H, cathespin F, cathepsin G, cathepsin O, cathepsin R, cathepsin V (cathepsin 12), cathepsin W, calpain 1, calpain 2, legumain, cathepsin Z (cathepsin X),
  • chondroitinase AC hyaluronidase
  • chymopapain chymotrypsin
  • collagenase papain, subtilisin, subtilisin A, heparanase.
  • matrix metalloproteinases such as for example, MMP-1
  • MMP-2 (gelatinase A), MMP-3 (stromelysin-1), MMP-7 (matrilysin; PUMP1), MMP-8 (collagenase-2), MMP-9 (gelatinase B), MMP-10 (stromelysin-2), MMP-11 (stromelysin-3), MMP-12 (metalloelastase), MMP-13 (collagenase-3), MMP-14 (MT1-MMP), MMP-15 (MT2-MMP), MMP-16 (MT3-MMP), MMP-17 (MT4-MMP), MMP-18 (collagenase- 4), MMP-19 (stromelysin-4), MMP-20 (enamelysin), MMP-21 (x-MMP), MMP-23A (MT5- MMP), MMP-23B, MMP-24 (MT5-MMP), MMP-25 (MT6-MMP), MMP-26 (matrilysin-2), MMP-27 (MMP-22; c
  • Exemplary tissue inhibitors of matrix-metalloproteinases include, without limitation, TIMP-1, TIMP-2, TIMP-3, and TIMP-4.
  • Exemplary HGF agonists include, without limitation, Refanalin (Angion
  • Exemplary ACE inhibitors include, without limitation, Alacepril, Benazepril,
  • Captopril Cilazapril, Ceronapril, Delapril, Enalapril, Enalaprilat, Fosinopril, Fosinoprilat, Imidapril, Lisinopril, Moexipril, Perindopril, Perindoprilat, Quinapril, Quinaprilat, Ramipril, saralasin acetate, spirapril, temocapril, trandolapril, fasidotrilat, beclometasone dipropionate, FPL-66564, Idrapril, MDL- 100240, and S-5590.
  • angiotensin receptor antagonists include, without limitation,
  • Exemplary advanced glycation endproducts (AGEs) inhibitors include, without limitation, Pyridoxamine (Biostratum).
  • Examples of AGE receptors (RAGE) inhibitors include, without limitation, TTP-488 (Transtech Pharma) and TTP-4000 (Transtech Pharma).
  • Rho kinase inhibitors include, without limitation, GSK269962,
  • GSK429286 AS 1892802, SB772077B, and SR3677.
  • Exemplary PKC inhibitors include, without limitation, Ruboxistaurin mesilate hydrate (Lilly).
  • ADAM- 10 inhibitors include, without limitation, XL-784 (Exelixis).
  • Exemplary farnesoid X receptor agonists include, without limitation, INT-747
  • Exemplary caspase inhibitors include, without limitation, PF-3491390 (Pfizer, formally IDN-6556), and LB84318 (LG Life Sciences).
  • Exemplary anti-oxidants include, without limitation, Heptax (Hawaii Biotech), N- acetylcysteine (Pierre Fabre), tocopherol, silymarin, and Sho-saiko-To (H-09).
  • Exemplary inhibitors of collagen expression include, without limitation,
  • Exemplary low molecular weight heparin or heparin analogs include, without limitation, Sulodexide (Keryx).
  • Exemplary copper chelators include, without limitation, Trientine (Protemix),
  • Coprexa (Pipex), and tetrathiomolybdate.
  • TNF-a blocking agents include, without limitation, Etanercept
  • HMG-CoA reductase inhibitors include, without limitation, statins such atorvastatin (Lipitor), fluvastatin (Lescol), lovastatin (Mevacor, Altocor), pitavastatin (Livalo), pravastatin (Pravachol), rosuvastatin (Crestor), and simvastatin (Zocor).
  • statins such as atorvastatin (Lipitor), fluvastatin (Lescol), lovastatin (Mevacor, Altocor), pitavastatin (Livalo), pravastatin (Pravachol), rosuvastatin (Crestor), and simvastatin (Zocor).
  • Thy- 1 (CD90) inhibitors include monoclonal antibodies against Thy- 1
  • anti-fibrotic agents include, without limitation, 5-flurouracil (5-FU; a pyrimidine analog), mitomycin C (MMC), colchicine (antibiotic), d-penicillamine, Pediapred oral liquid, Medrol, cyclosporine (an immunosuppressant), mycophenolate mofetil (MMF;
  • Cellcept an immunosuppressant
  • prednisolone bovine collagen type I, ribavirin (a guanosine (ribonucleic) analog), spirichostatin A (a histone deacetylase inhibitor); TGF-2 specific inhibitors (transglutaminase -2), tacrolimus (FK5-6, a calcineurin inhibitor), relaxin, taurine, niacin, treprostinil (a prostacyclin analog), Tiplaxtinin (PAI-039, a plasminogen activator-1 inhibitor); Pentraxin-1 (e.g., serum amyloid P component (SAP), c-reactive protein (CRP), and PTX-3) and Pentraxin-2 (PTX-2 or PRM-151), imidazolium and imidazolinium salts (U.S.
  • additional anti-fibrotic agents are those agents described as being possibly co-administered with the polyether antimicrobial alexidine, as described in U.S. Publ. No. 2009/0054381 to Letts et al, which is hereby incorporated by reference in its entirety; and those agents described as being possibly co -administered with the polyether antimicrobial amsacrine, as described in U.S. Publ. No. 2007/0202051 to Schuschnig, which is hereby incorporated by reference in its entirety.
  • compositions including these agents preferably contain from about 0.01 to about 99 weight percent, more preferably from about 2 to about 60 weight percent, of therapeutic agent together with the adjuvants, carriers, and/or excipients.
  • the amount of active compound in such therapeutically useful compositions is such that a suitable dosage unit will be obtained.
  • the dosage of the one of these additional anti-fibrotic agents is preferably administered at a dose of between about 0.01 mg per kg of body weight per day (mg/kg/day) to about 100 mg/kg/day, preferably 0.01 mg per kg of body weight per day (mg/kg/day) to 10 mg/kg/day, and most preferably 0.1 to 5.0 mg/kg/day.
  • Administration of one or more of the additional anti-fibrotic agents can be carried out orally, parenterally, periadventitially, subcutaneously, intravenously, intramuscularly, intraperitoneally, by inhalation, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, intradermally or by application to mucous membranes. Other suitable modes of delivery can also be used.
  • the additional anti-fibrotic agents can be co -administered with the active agents described above in a single formulation or in separate formulations.
  • a further aspect of the invention relates to a recombinant cell line that includes a recombinant gene that expresses a detectable expression product in a dose-dependent response to TGFP concentration.
  • This recombinant cell line is useful for screening agents that can induce a change in TGFP expression levels.
  • the recombinant cell line can be any human or animal derived cell line that can be maintained in culture.
  • the recombinant gene can be prepared using recombinant techniques that are well known to those of skill in the art.
  • the expression product is luciferase, preferably one that comprises a half-life that is less than 2 hours (see LeClerc, Biotechniques 29(3):590-8 (2000), which is hereby incorporated by reference in its entirety), and the open reading frame is operably coupled to a promoter element that is responsive to TGFp.
  • TK thymidine kinase
  • Response to TGFP can be engineered by introducing into the upstream promoter region one or more binding elements responsive to TGFp (e.g., two TGFp response elements, three TGFp response elements, four TGFp response elements, and so on).
  • An exemplary TK promoter has the nucleotide sequence shown below: CGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGG
  • TGFP response element has the nucleotide sequence shown below:
  • An exemplary luciferase open reading frame has the nucleotide sequence shown below:
  • the recombinant cell line is used in a method of identifying a compound that inhibits TGFP-mediated cellular activity.
  • This method includes growing a recombinant cell line in the presence of TGFP and a compound of interest, and measuring the amount of the detectable expression product and comparing the measured amount to a control lacking the compound of interest and/or a control lacking TGFp, wherein a significant difference in the measured amount of the detectable expression product, relative to the control, indicates that the compound of interest inhibits TGFP-mediated cellular activity.
  • measuring can be carried out using an optical detection system.
  • the step of growing the recombinant cell line in the presence of TGFP and the compound of interest is carried out for a period of time sufficient to allow for an assessment of whether the compound of interest inhibits TGFP-mediated expression of the detectable expression product. In certain embodiments, this growing step is carried out for at least about 12 hours before said measuring, and in certain other embodiments this growing step is carried out for at least about 24 hours before said measuring.
  • HEK293FT cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in DMEM supplemented with 10% fetal calf serum (Hyclone) and antibiotics.
  • DMEM, MEM and hygromycin were purchased from Gibco (Carlsbad, CA).
  • Fibroblast growth medium was purchased from Promocell. Other compounds were obtained as follows: salinomycin (Cayman), narasin, monensin and clioquinol (all three from Sigma).
  • the resultant PCR product was TOPO cloned (Invitrogen) and the correct insert was verified by DNA sequencing.
  • the construct was digested with Sacl-Hindlll and the SBEx4-TK insert was purified and ligated with the pGL4.15 vector (Promega). Clones were verified by restriction digest and then tested for TGFp responsiveness in transient transfections of 293FT cells. Once the pSBEx4-TK-luc construct was demonstrated to be TGFp responsive, the construct was introduced into 293FT cells for stable cell line production. Clones were selected by treatment with 200 ⁇ g/ml hygromycin. 20 clones were selected and screened for TGFP-induced luciferase activity. One clone that was robustly responsive was subsequently used in the small molecule screen.
  • Plasmid DNA Transfection Plasmid DNA was introduced into human fibroblasts by electroporation. Plasmids were electroporated with an Amaxa nucleofector (program U-025) into 1 x 10 6 cells. The pcDNA3-flag MKK6(glu) plasmid was obtained from Addgene (plasmid 13518, from Roger Davis' lab). After transfection cells were cultured for 12-24 hours and culture medium was subsequently changed to treatment conditions.
  • Collagen Production Assay Cell culture supernatant was collected and transferred (5-20 ul) to PVDF membrane using a slot blot device. The membrane was blocked and probed with a goat anti-collagen antibody (1 :5000), washed and incubated with a donkey anti-goat antibody conjugated to HRP. Band intensities were quantified using ImageLab software and values were normalized to vehicle treatments.
  • Alamar Blue Viability Assay 5 x 10 cells were plated per well in a 96-well plate
  • Griener with 200 ul of culture medium. Vehicle (DMSO), salinomycin and/or TGFP (1 ng/ml) were added as indicated and then 20 ul of alamar blue reagent was added to all wells. Cells were incubated for 24 and 48 hours and then fluorescence of the oxidized alamar reagent was measured (ex 470 nM, em 480 nM). Background fluorescence was subtracted from all wells and the fluorescence was normalized to vehicle treated cells. The assay was performed in two different human fibroblast strains and treatments were performed in triplicate.
  • BrdU Incorporation Assay Human fibroblasts were seeded on a 96-well plate at a density of lxl 0 5 cells/well. Cells were treated in triplicate. Cell proliferation was determined using the bromodeoxyuridine (BrdU) assay following manufacturer's instructions. Briefly, cells were treated with a BrdU label at a 1 :2000 dilution for 24h after the initial 72h treatment with TGFP +/- drugs. BrdU incorporation was measured using the BrdU Cell Proliferation Assay kit (Calbiochem, San Diego, CA) at 450-540nm using a Varioskan microplate reader.
  • DAPI a fluorescent counterstain
  • the pSBEx4-TK-luc- Hygro plasmid was then introduced into HEK293FT cells by lipofection. Stable clones were generated and screened for TGFP induced luciferase activity. One clone was selected that consistently gave a 15 to 20-fold induction of luciferase activity when cells were treated with TGFP for 24 hours ( Figure IB).
  • Salinomycin an antibiotic produced from Streptomyces albus is used as coccidiostat agent in animal feed (Knirschova et al., "Multiple regulatory genes in the salinomycin biosynthetic gene cluster of Streptomyces albus CCM 4719," Folia Microbiologica 52:359-365 (2007), which is hereby incorporated by reference in its entirety). Furthermore, salinomycin has recently been shown to have activity against cancer stem cells (Naujokat et al., "Salinomycin as a drug for targeting human cancer stem cells," J. Biomed. Biotechnol.
  • Fibroblasts are sentinel cells that respond to numerous stimuli and serve as key effector cells in many biological processes (Baglole et al., "More than structural cells, fibroblasts create and orchestrate the tumor microenvironment,” Immunol. Invest. 35:297-325 (2006), which is hereby incorporated by reference in its entirety).
  • One key function of fibroblasts is their differentiation into scar-forming myofibroblasts.
  • Thyroid eye disease is a disorder in which myofibroblasts and scar tissue accumulate in the ocular orbit causing pain, proptosis and in severe cases, blindness (Lehmann et al, "Immune mechanisms in thyroid eye disease,” Thyroid : Official Journal of the American Thyroid Association 18:959-965 (2008), which is hereby incorporated by reference in its entirety).
  • Human orbital fibroblasts have been shown to respond dramatically to TGFP by forming myofibroblasts that express aSMA, calponin and produce high levels of collagen (Kuriyan et al., "Orbital fibroblasts from thyroid eye disease patients differ in proliferative and adipogenic responses depending on disease subtype," Invest. Ophthalmol. Vis. Sci.
  • TED fibroblasts were an ideal model to test the ability of salinomycin to block TGFP function. [0229] TED fibroblasts were treated with TGFP (1 ng/ml) in the presence or absence of
  • FIG. 2C Another key role of myofibroblasts in scar formation is the production of collagen. Whether salinomycin could block myofibroblast collagen production was assessed. Cells were treated with TGFP and salinomycin as above and after 72 hours, culture medium was collected and analyzed for collagen levels using a specific collagen I antibody and slot blot analysis. As Figure 2C shows, TGFP induced myofibroblasts produce high levels of collagen. However, salinomycin blocked production of collagen in a dose- dependent manner. Starting at 10 nM salinomycin, collagen production decreases and at 100 nM salinomycin, collagen production is at baseline levels. Finally, at 250 nM salinomycin, collagen production is below baseline levels of untreated fibroblasts ( Figure 2C).
  • Monensin is another polyether ionophore that is used extensively in animal feed to prevent coccidiosis (Mortier et al.,
  • REDOX mitochondrial oxidation-reduction
  • TGFP treatment induces phosphorylation of Smad2 in minutes in human fibroblasts, however, at early time points (30 sec-1 hour), salinomycin treatment did not affect phospho-Smad2 levels.
  • the experiment was repeated, with samples being incubated for extended periods of time including 5, 24, 48 and 72 h hours ( Figure 5 A, top panel).
  • TGFP treatment induced phospho-Smad2 by 200% at 5 hours and then phospho-Smad2 levels decreased at 24 (140%), 48 (40%), and 72 hours (-5% of vehicle levels) (Figure 5B, top panel).
  • Salinomycin treatment resulted in an 80% reduction of phospho-Smad2 levels, compared to TGFP alone at 5 hours.
  • salinomycin was most effective at blocking phospho- Smad2 levels at 24 hours, with approximately an 8-10 fold reduction compared to TGFP treatment alone. This data indicated that salinomycin was not working directly on Smad2, but rather at another signaling step.
  • P38 MAPKs are a class of protein kinases that respond to TGFp, ultraviolet radiation and other stimuli. Phosphorylation and activation of p38 can lead to numerous downstream signaling pathways, including phosphorylation of Smad proteins.
  • TGFP treatment of human fibroblasts was observed to result in a dramatic induction of phospho- p38 at 5 hours (7 fold) and 24 hours (2-3 fold).
  • salinomycin treatment completely blocked phospho-p38 levels at 5 hours TGFP treatment ( Figures 5A and 5B, lower panels).
  • salinomycin treatment inhibited phospho-p38 by 80% at 24 hours TGFP treatment.
  • MKK6 pcDNA3-flag MK 6(glu)
  • MK 6 phosphorylates and thus activates p38 in response to extracellular signals such as TGFP or other environmental stresses.
  • the MK 6(glu) protein which harbors glutamate mutations at amino acid residues serine 207 and threonine 211, is constitutively active and thus
  • MK 3- and MK 6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway," Mol. Cell. Biol. 16: 1247-1255 (1996), which is hereby incorporated by reference in its entirety).
  • MK 6(glu) should overcome the effect of salinomycin.
  • MK 6(glu) was first tested using the SBE4-TK-luc reporter plasmid.
  • the luciferase reporter plasmid was introduced into human fibroblasts along with the MKK6(glu) plasmid or a control plasmid (pcDNA3-GFP). Cells were then treated with vehicle, TGFP or TGFP plus 250 nM salinomycin. After 24 hours, luciferase activity was measured ( Figure 6A). As expected, in human fibroblasts expressing the GFP plasmid, TGFP induced luciferase activity by 2-fold and salinomycin completely blocked TGFP- induced luciferase activity.
  • TGFP-dependent, Smad reporter cell line was screened with a small molecule library consisting of bioactive drugs.
  • the p38 pathway functions in myofibroblast formation in part by providing a feed forward loop to stimulate Smad2/3 phosphorylation and activation (Figure 7) (Yang et al., "TRPV1 potentiates TGFbeta-induction of corneal myofibroblast development through an oxidative stress-mediated p38-SMAD2 signaling loop," PloS one 8:e77300 (2013), which is hereby incorporated by reference in its entirety). This is consistent with the data showing that salinomycin impairs phosphorylation of both p38 and Smad2 at later time points, whereas early time points were not affected (Figure 5).
  • the p38-MAPK pathway has been implicated in fibrosis of the kidney, lung and heart (Fan et al., "Decreased expression of p38 MAPK mediates protective effects of hydrogen sulfide on hepatic fibrosis," Eur. Rev. Med. Pharmacol. Sci. 17:644-652 (2013); Li et al., "Inhibition of p38 mitogen-activated protein kinase and transforming growth factor-b eta 1 /Smad signaling pathways modulates the development of fibrosis in adriamycin-induced nephropathy," Am. J. Pathol.
  • pirfenidone Esbriet (pirfenidone) ((Moran N., "p38 kinase inhibitor approved for idiopathic pulmonary fibrosis,” Nat. Biotechnol. 29:301 (2011), which is hereby incorporated by reference in its entirety), was approved for treatment of idiopathic pulmonary fibrosis in Europe, indicating the efficacy of targeting the pathway in fibrosis. While pirfenidone does slow the disease progression of pulmonary fibrosis, it does not stop it, indicating the need for more efficacious drugs.
  • the activity of p38 is regulated by the upstream kinases, MKK3 and MKK6 ( Figure 7) (Raingeaud et al, "MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway," Mol. Cell. Biol. 16: 1247-1255 (1996); Enslen et al., "Selective activation of p38 mitogen-activated protein (MAP) kinase iso forms by the MAP kinase kinases MKK3 and MKK6," J. Biol. Chem. 273: 1741-1748 (1998), which are hereby incorporated by reference in their entirety).
  • MAP mitogen-activated protein
  • Thyl a glycophosphatadyl inositol membrane anchored glycoprotein
  • Thyl a glycophosphatadyl inositol membrane anchored glycoprotein
  • the expression of Thyl in implant capsule was characterized and tested as a potential pharmacologic target to modulate scar formation in post-irradiated women.
  • capsular fibroblasts were grown in vitro and treated with the pro-fibrotic cytokine transforming growth factor- ⁇ (TGFP) and the polyether ionophore salinomycin, and analyzed for expression of Thyl, aSMA, fibronectin, and collagen by Western blot ( Figure 9 and Figures 10A-B).
  • Thyl expression was depleted using Thyl siRNA (delivered by lentiviral transduction) ( Figures 11 A- B).
  • Western blot analysis showed that explanted fibroblasts treated with TGFP expressed increased aSMA and collagen I, which was nearly completely inhibited by salinomycin treatment ( Figures 10A-B).
  • Thyl siRNA reduced capsular fibroblast/myofibroblast expression of aSMA and collagen I ( Figures 11A-B).
  • irradiated breast capsules express more Thyl than non-irradiated breast capsule, indicating a seminal role for Thyl in capsule scar formation.
  • explant fibroblast cultures treated with TGFP showed increased production of collagen and aSMA, which was reduced by salinomycin treatment.
  • Direct knockdown of Thyl by Thyl siRNA also reduced capsular culture expression of collagen and aSMA.
  • the initial Spectrum Collection screen identified five other compounds, beside salinomycin, that inhibit TGF -induced luciferase in the luciferase screening assay described in the preceding Examples. They are: Benzbromarone ("BZB”), Bithionate sodium (“BTS”), Piplartine (piperlongumine) (“PPT”), Amsacrine (“ASC”), and Alexidine (“AXD”).
  • BZB Benzbromarone
  • BTS Bithionate sodium
  • PPT Piplartine (piperlongumine)
  • ASC Amsacrine
  • Alexidine Alexidine
  • a secondary luciferase screening assay was performed to determine specificity and dose responsiveness of these compounds in comparison to salinomycin ("SNC”).
  • SNC salinomycin
  • the secondary screen utilizes dual luciferase technology that includes the above mentioned SBE-luciferase in addition to a Renilla luciferase that is under control of the constitutive SV40
  • the SBE-luciferase activity can be normalized to the Renilla luciferase activity to control for toxicity and non-specific effects.
  • the secondary screen can thus be used to remove small molecules that display overt toxicity and/or non-specific effects on the primary assay.
  • BTS, PPT, ASC, and AXD all exhibited strong luciferase inhibition at low micromolar levels ( Figure 12).
  • the four compounds that displayed strong luciferase inhibition in the secondary screening assay were assessed for their ability to inhibit TGFP -dependent myofibroblast formation.
  • PPT 5 ⁇
  • ASC 1 ⁇
  • BTS 1 ⁇
  • AXD 1 ⁇
  • the myofibroblast formation assay consists of the following protocol: fibroblasts are treated with the aforementioned small molecules and treated with TGFP (1 ng/ml) for 72 hours.
  • the cells were then either photographed for morphological analysis or collected, lysed and analyzed by Western blot for the myofibroblast markers alpha-smooth muscle actin (aSMA) and calponin.
  • ⁇ -tubulin was used as a loading control.
  • PPT 5 ⁇
  • ASC 1 ⁇
  • BTS calponin
  • AXD 1 ⁇
  • Example 6 Assessing Efficacy of 10-Hydroxycamptothecin (HCPT) to Inhibit TGFp- Induced Myofibroblast Formation
  • HCPT 10-Hydroxycamptothecin
  • Primary human orbital fibroblasts, primary human lung fibroblasts, and primary mouse lung fibroblasts were treated with TGFp and HCPT (50 nM, 500 nM, and 5000 nM) or SNC (500 nM) or AXD (0.5 ⁇ , 5 ⁇ , and 50 ⁇ ) to assess the ability of HCPT to inhibit myofibroblast formation.
  • Salinomycin and alexidine served as positive controls for anti-fibrotic activity.
  • FIG. 17 Cells images related to the formation of myofibroblasts are shown in Figure 17.
  • Human lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 uM or 500 uM) and induced to form scar-forming myofibroblasts by treating with TGFp.
  • Cells images were captured to show formation of myofibroblast in TGFP treated samples but not in samples with HCPT or salinomycin (SNC).
  • SNC salinomycin
  • the Chembridge collection of 20,000 small molecules was screened to identify other small molecules that inhibit TGFP activity and, thus, may be novel anti-scarring compounds
  • the Chembridge screen revealed several potential anti-scarring compounds. 100 top candidates from the initial screen were re-screened. Results from this screen are shown in Figure 21. Numbers indicate the Chembride molecule ID number.
  • the second screen controls for toxicity and non-specific effects by using a constitutive luciferase to normalize results. This assay can be further used in a high throughput fashion to analyze newly derived compounds and monitor structure activity relationships (SAR) to discover new molecules that can serve as the basis for anti-scarring therapeutics.
  • SAR structure activity relationships

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Molecular Biology (AREA)
  • Pain & Pain Management (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

Disclosed are methods of treating fibrosis in a patient in need thereof that includes administering to the patient an amount of an active agent, as identified herein, that is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis. Also disclosed is a recombinant cell line that includes a recombinant gene that expresses a detectable expression product in a dose-dependent response to TGFβ, as well as methods of identifying a compound that inhibits TGFβ,-mediated expression of the detectable expression product.

Description

SMALL MOLECULE ANTI-SCARRING AGENTS
[0001] This application claims the benefit of U.S. Provisional Patent Application Serial
No. 62/012,602, filed June 16, 2014, and U.S. Provisional Patent Application Serial No.
62/114,932, filed February 11, 2015, each of which is hereby incorporated by reference in its entirety.
[0002] This invention was made with government support under grant numbers ES-
023032, EY-023239, and ES-02437 awarded by the National Institutes of Health. The government has certain rights in this invention.
FIELD OF THE DISCLOSURE
[0003] This application is directed to the identification of compounds and pharmaceutical compositions, and methods of using the same for the treatment or prevention of fibrosis and fibrotic-related disorders in an individual.
BACKGROUND OF THE DISCLOSURE
[0004] Formation of excess scar tissue, called fibrosis in organs, affects billions of people world-wide. Fibrosis of the lung, heart, kidney, liver, eye, bone marrow, etc. is responsible for morbidity and mortality. Scarring is a consequence of the normal wound healing response.
However, scar formation can be exuberant leading to hypertrophic scarring and/or fibrosis that can ultimately lead to a loss of tissue function (Friedlander M., "Fibrosis and diseases of the eye," J. Clin. Invest. 117:576-586 (2007); Noble et al, "Pulmonary fibrosis: patterns and perpetrators," J. Clin. Invest. 122:2756-2762 (2012); Bahn R.S., "Graves' ophthalmopathy," N. Engl. J. Med. 362:726-738 (2010); and Hinz B., "Formation and function of the myofibroblast during tissue repair," J. Iinvest. Dermatol. 127:526-537 (2007)). While there is a major knowledge gap as to why scarring sometimes proceeds out of control, hypertrophic scarring usually results from physical injury, such as laceration or surgery or from burns either thermally, chemically or radiation induced (Niessen et al., "On the nature of hypertrophic scars and keloids: a review," Plast. Reconstr. Surg. 104: 1435-1458 (1999)). For example, an unfortunate consequence of severe heat-induced burns is the development of debilitating hypertrophic scars (Gauglitz et al., "Hypertrophic scarring and keloids: pathomechanisms and current and emerging treatment strategies," Mol. Med.17: 113-125 (2011)). Chronic inflammation and autoimmune disease can also lead to aberrant tissue reorganization and scarring (Lehmann et al., "Immune mechanisms in thyroid eye disease," Thyroid : official journal of the American Thyroid
Association 18:959-965 (2008); Phan S.H., "The myofibroblast in pulmonary fibrosis," Chest 122:286S-289S (2002)). Thyroid eye disease (TED) is an example of an autoimmune disease in which immune cells target the muscle and connective tissue in the ocular orbit leading to orbital tissue remodeling and excessive scarring (Bahn R.S., "Graves' ophthalmopathy," N. Engl. J. Med. 362:726-738 (2010); Kuriyan et al, "The eye and thyroid disease," Curr. Opin.
Ophthalmol. 19:499-506 (2008)). While aberrant scarring is observed in numerous pathologies, there are few, if any effective therapies that limit or prevent scarring.
[0005] The key effector cell in scar formation is the contractile and secretory
myofibroblast (Hinz et al., "The myofibroblast: one function, multiple origins," Am. J. Pathol. 170: 1807-1816 (2007)). Myofibroblasts are derived from tissue resident fibroblasts, epithelial- mesenchymal transitions, circulating fibrocytes, mesenchymal stem cells or other progenitor cells (Desmouliere et al, "Tissue repair, contraction, and the myofibroblast," Wound Repair Regen. 13:7-12 (2005)). Myofibroblasts highly express alpha- smooth muscle actin (aSMA), an important protein required for wound contraction, and these cells produce large amounts of extracellular matrix (ECM) material including collagen, fibronectin and glycosaminoglycans (Hinz et al., "Recent developments in myofibroblast biology: paradigms for connective tissue remodeling," Am. J. Pathol. 180: 1340-1355 (2012); Smith et al, "Fibroblasts as sentinel cells. Synthesis of chemokines and regulation of inflammation," Am. J. Pathol. 151 :317-322 (1997)). The contraction of myofibroblasts and their excessive production of ECM material such as collagen result in rigid tissue formation and increases in tissue size. In addition to their contractile phenotype, myofibroblasts also secrete a variety of cytokines including IL-6, MCP-1 and TGFP that recruit immune cells and lead to further myofibroblast formation (Micallef et al., "The myofibroblast, multiple origins for major roles in normal and pathological tissue repair," Fibrogenesis & Tissue Repair 5:S5 (2012)).
[0006] Despite the magnitude of the problem there are no effective anti-scarring approaches of consequence. New directed therapies to prevent scar formation are urgently needed. It would be desirable, therefore, to identify small molecule compounds that possess an ability to disrupt myofibroblast differentiation and thereby modulate scarring or fibrosis.
[0007] The present invention is directed to overcoming these and other deficiencies in the art. SUMMARY OF THE DISCLOSURE
[0008] A first aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof. This method includes administering to the patient an amount of a polyether antibiotic that is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
[0009] A second aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof. This method includes administering to the patient an amount of one or more of amsacrine, alexidine, bithionate, or a combination thereof, wherein the amount is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
[0010] A third aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof. This method includes administering to the patient an amount of one or more compounds according to formula (I) as disclosed herein, formula (II) as disclosed herein, formula (III) as disclosed herein, formula (IV) as disclosed herein, formula (V) as disclosed herein, formula (VI) as disclosed herein, formula (VII) as disclosed herein, formula (VIII) as disclosed herein, formula (IX) as disclosed herein, formula (X) as disclosed herein, formula (XI) as disclosed herein, formula (XII) as disclosed herein, formula (XIII) as disclosed herein, formula (XIV) as disclosed herein, formula (XV) as disclosed herein, formula (XVI) as disclosed herein, formula (XVII) as disclosed herein, formula (XVIII) as disclosed herein, formula (XIX) as disclosed herein, formula (XX) as disclosed herein, formula (XXI) as disclosed herein, formula (XXII) as disclosed herein, formula (XXIII) as disclosed herein, formula (XXIV) as disclosed herein, or a combination thereof, wherein the amount is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
[0011] A fourth aspect of the disclosure relates to a method of treating fibrosis in a patient in need thereof. This method includes administering to the patient an amount of one or more agents selected from the group of 10-hydroxycamptothecin, omeprazole, esomeprazole, flutamide, 4,5-dichloro-2-methyl-N-(4-pyridinylmethyl)benzenesulfonamide, N-(2- methoxyphenyl)-3-phenyl-2-propynamide, 3-amino-4-chloro-N,N-diethylbenzamide, 4-ethoxy- 2,3-dimethyl-N-(4-pyridinylmethyl)benzenesulfonamide, {5-[(4-chlorophenyl)thio]-2- furyl}methanol, N-(l -phenyl ethyl) [IJbenzofuro [3, 2-d]pyrimidin-4-amine hydrochloride, 3-[3-(2- chlorophenyl)acryloyl]-4,6-dimethyl-2(lH)-pyridinone, ethyl 2-amino-7-(hydroxyimino)- 4,5,6,7-tetrahydro-l-benzothiophene-3-carboxylate, 4-fluoro-3-methyl-N-(4- pyridinylmethyl)benzenesulfonamide, 3 -(4-fluorophenyl)-2-methyl-5 -phenylpyrazolo [1,5- a]pyrimidin-7(4H)-one, N-[4-(allyloxy)phenyl]-4-(4-morpholinomethyl)benzamide, 3-fluoro-N- (4-pyridinylmethyl)benzenesulfonamide, N- {4-[(tert- butylamino)sulfonyl]phenyl} isonicotinamide, N-methyl-2-(2-phenoxyethoxy)benzamide, N- 1 H- benzimidazol-2-yl-2-bromobenzamide, 3-benzyl-N-(4-methylphenyl)-7H-[l,2,4]triazolo[3,4- b] [ 1 ,3,4]thiadiazin-6-amine, 5-(4-chlorophenyl)-2-methyl-3-phenylpyrazolo[ 1 ,5-a]pyrimidin- 7(4H)-one, 4-chloro-N-[ 1 -(3,4-dimethylphenyl)ethyl]- 1 -methyl- lH-pyrazole-5-carboxamide, and 3-(2-furyl)-l l-methyl-2,3,4,5-tetrahydro-lH-dibenzo[b,e][l,4]diazepin-l-one, wherein the amount is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
[0012] A fifth aspect of the disclosure relates to a pharmaceutical or veterinary composition that includes a carrier, an effective amount of a polyether antibiotic and an effective amount of a compound according to formula (I) as disclosed herein, formula (II) as disclosed herein, formula (III) as disclosed herein, formula (IV) as disclosed herein, formula (V) as disclosed herein, formula (VI) as disclosed herein, formula (VII) as disclosed herein, formula (VIII) as disclosed herein, formula (IX) as disclosed herein, formula (X) as disclosed herein, formula (XI) as disclosed herein, formula (XII) as disclosed herein, formula (XIII) as disclosed herein, formula (XIV) as disclosed herein, formula (XV) as disclosed herein, formula (XVI) as disclosed herein, formula (XVII) as disclosed herein, formula (XVIII) as disclosed herein, formula (XIX) as disclosed herein, formula (XX) as disclosed herein, formula (XXI) as disclosed herein, formula (XXII) as disclosed herein, formula (XXIII) as disclosed herein, or formula (XXIV) as disclosed herein, which is intended to include one or more of amsacrine, alexidine, bithionate, benzbromarone, piperlongumine, 10-hydroxycamptothecin, omeprazole,
esomeprazole, flutamide, 4,5-dichloro-2-methyl-N-(4-pyridinylmethyl)benzenesulfonamide, N- (2-methoxyphenyl)-3-phenyl-2-propynamide, 3-amino-4-chloro-N,N-diethylbenzamide, 4- ethoxy-2,3-dimethyl-N-(4-pyridinylmethyl)benzenesulfonamide, {5-[(4-chlorophenyl)thio]-2- furyljmethanol, N-(l -phenyl ethyl) [IJbenzofuro [3, 2-d]pyrimidin-4-amine hydrochloride, 3-[3-(2- chlorophenyl)acryloyl]-4,6-dimethyl-2(lH)-pyridinone, ethyl 2-amino-7-(hydroxyimino)- 4,5,6,7-tetrahydro-l-benzothiophene-3-carboxylate, 4-fluoro-3-methyl-N-(4- pyridinylmethyl)benzenesulfonamide, 3 -(4-fluorophenyl)-2-methyl-5 -phenylpyrazolo [1,5- a] pyrimidin-7(4H)-one, N-[4-(allyloxy)phenyl]-4-(4-morpholinomethyl)benzamide, 3-fluoro-N- (4-pyridinylmethyl)benzenesulfonamide, N- {4- [(tert- butylamino)sulfonyl]phenyl} isonicotinamide, N-methyl-2-(2-phenoxyethoxy)benzamide, N- 1 H- benzimidazol-2-yl-2-bromobenzamide, 3-benzyl-N-(4-methylphenyl)-7H-[l,2,4]triazolo[3,4- b] [ 1 ,3,4]thiadiazin-6-amine, 5 -(4-chlorophenyl)-2-methyl-3 -phenylpyrazolo [ 1 ,5-a]pyrimidin- 7(4H)-one, 4-chloro-N-[ 1 -(3,4-dimethylphenyl)ethyl]- 1 -methyl- lH-pyrazole-5-carboxamide, and 3-(2-furyl)-l l-methyl-2,3,4,5-tetrahydro-lH-dibenzo[b,e][l,4]diazepin-l-one. Effective amounts are those which are effective to inhibit myofibroblast formation and thereby treat fibrosis.
[0013] A sixth aspect of the disclosure relates to a recombinant cell line. This recombinant cell line includes a recombinant gene that expresses a detectable expression product in a dose-dependent response to TGFP concentration. The HEK293-Thyl SBE-Luc cell line described in the Examples represents a non-limiting example thereof.
[0014] A seventh aspect of the disclosure relates to a method of identifying a compound that inhibits TGFP -mediated cellular activity. The method includes growing a recombinant cell line according to the fifth aspect of the disclosure in the presence of TGF and a compound of interest, and measuring the amount of the detectable expression product and comparing the measured amount to a control lacking the compound of interest and/or a control lacking TGFP, wherein a significant difference in the measured amount of the detectable expression product, relative to the control, indicates that the compound of interest inhibits TGFP-mediated cellular activity.
[0015] While scarring is a component of wound healing, excessive scar formation is a debilitating condition that results in pain, loss of tissue function and even death. Many tissues including the lung, heart, skin, and eye can develop excessive scar tissue as a result of tissue injury, chronic inflammation or autoimmune disease. Unfortunately, there are few, if any, effective treatments to prevent excess scarring and new treatment strategies are needed. Using HEK293FT cells stably transfected with a TGFP-dependent luciferase reporter, a small molecule screen was performed to identify novel compounds with anti-scarring activity. Several small molecules were identified that could disrupt TGFP-dependent myofibroblast formation, and thereby mitigate excessive scarring and fibrosis. These results reveal that several polyether antibiotics, including salinomycin, are potent inhibitors of TGFP-dependent human
myofibroblast formation. Salinomycin potently inhibited the formation of scar-forming myofibroblasts, and salinomycin (250 nM) blocked TGFP-dependent expression of the cardinal myofibroblast products alpha smooth muscle actin, calponin and collagen in primary human fibroblasts without causing cell death. Expression of constitutively active mitogen activated kinase kinase (MK ) 6, which activates p38 MAPK, attenuates the ability of salinomycin to block myofibroblast formation indicating that salinomycin targets the p38 kinase pathway to disrupt TGFP signaling. These data identify salinomycin and other polyether antibiotics as a novel class of compounds useful as anti-scarring therapeutic agents. [0016] Using this same novel reporter cell line, both the Spectrum library of natural compounds and Chembridge library of 20,000 synthetic molecules (designed by medicinal chemists) were screened, and a significant number of small molecules that inhibit myofibroblast formation in human and mouse fibroblasts were discovered. Importantly, many of the compounds disclosed herein lack overt cytotoxic effects and, consequently, should also be useful candidates for the therapeutic treatment or prevention of fibrosis.
BRIEF DESCRIPTION OF THE DRAWINGS
[0017] Figures 1 A-D show that small molecule screen identified salinomycin as a potential anti-scarring compound. Figure 1 A is a diagram of Smad-dependent reporter construct. Four tandem Smad binding elements (SBE) were inserted upstream of the minimal Thymidine Kinase (TK) promoter. Downstream of the promoter is a destabilized version of the firefly luciferase gene (luc2P) present in the pLuc2P-Hygro plasmid which also harbors the hygromycin resistance gene. The plasmid was introduced into HEK293FT cell line and individual colonies were selected with hygromycin (200 ug/ml) to develop a Smad/TGFP dependent- luciferase reporter cell line. Figure IB is a graph illustrating the response of the reporter cell line to 1 ng/ml treatment of TGFP for 20 hours, which results in an approximately 20-fold increase of luciferase activity. Figure 1C illustrates the structure of salinomycin (SNC), which is one of several members of the 2300 compound Spectrum collection that blocked TGFP-induced luciferase activity when screened with the HEK293FT-luc reporter line of Fig. 1A. The polyether ionophore salinomycin was further tested in a dual luciferase screen including a constitutive renilla luciferase to normalize the SBE-luciferase activity, which demonstrated that it was a potent inhibitor of TGFp. Figure ID shows that salinomycin exhibited a dose dependent decrease in TGFP-induced SBE-luciferase activity. 1 uM salinomycin reduced SBE-luciferase activity to below baseline levels while 100 nM salinomycin reduced SBE-luciferase activity more than 3 -fold. Experiments were repeated three times in triplicate and similar results were observed in all tests. * p < 0.05.
[0018] Figures 2A-C show that salinomycin inhibits TGFP-induced expression of myofibroblast markers in human fibroblasts. Figure 2A shows that human fibroblasts were treated with varying doses of salinomycin and treated with TGFP (1 ng/ml) for 72 hours. The cells were then lysed and analyzed by Western blot for the myofibroblast markers alpha-smooth muscle actin (aSMA) and calponin. β-tubulin was used as a loading control. Figure 2B shows densitometry analysis of blots in panel A, where a dose-dependent decrease in myofibroblast markers aSMA and calponin was observed. Salinomycin treatments of 100 and 200 nM reduced expression of myofibroblast markers to below baseline levels. Figure 2C shows the results of a slot blot analysis for collagen I using culture supernatants from cells treated as in panel Fig. 2A. Salinomycin similarly reduced collagen I levels in a dose-dependent manner.
[0019] Figures 3A-C show that the three polyether ionophores salinomycin, narasin and monensin inhibit myofibroblast formation, but not the structurally unrelated ionophore clioquionol. Figure 3A shows molecular structures of narasin, monensin and clioquionol.
Narasin, a methylated derivative of salinomycin, and monensin are polyether ionophores whereas clioquinol is an unrelated ionophore. Figure 3B shows Western blot results using cell lysates from human fibroblasts treated with vehicle (DMSO), TGFP or TGFP plus 250 nM of the indicated compounds for 72 hours, followed by analysis of the myofibroblast markers aSMA and calponin. Figure 3C shows densitometry analysis of Western blots shown in Fig. 3B.
Salinomycin, narasin and monensin all inhibited expression of aSMA and calponin whereas clioquinol did not.
[0020] Figures 4A-B show that salinomycin does not affect viability or basal
proliferation of human fibroblasts, however, it does block TGFP induced proliferation. Figure 4A shows the results of a cell viability assay using human fibroblasts treated with vehicle (DMSO), 50, 100 or 250 nM salinomycin, TGFp, TGFP plus 250 nM salinomycin or puromycin (5 ug/ml) for 72 hours in the presence of alamar blue, a redox sensitive fluorescent dye. After 72 hours, fluorescence was measured to check cellular viability. Puromycin, which served as a positive control resulted in a total loss of cell viability, whereas salinomycin did not significantly affect cell viability at doses tested, either in the presence or absence of TGFp. Figure 4B shows the results of a TGFP-induced proliferation assay using human fibroblasts treated with vehicle (DMSO), 250 nM salinomycin, 250 nM narasin, TGFP alone or TGFP plus salinomycin or narasin (250 nM) for 24 hours before addition of bromodeoxyuridine (BrdU). BrdU treatment was an additional 24 hours and then cells were fixed and stained for BrdU incorporation, which serves as a measure of cell proliferation. Salinomycin and narasin did not affect basal fibroblast proliferation (first 3 columns), however, salinomycin and narasin significantly blocked TGFP induced proliferation (last 3 columns). Results are from a representative experiment performed in triplicate. * p < 0.01.
[0021] Figures 5A and 5B show that salinomycin inhibits TGFP-induced p38
phosphorylation. Figure 5A shows a Western blot of cell lysates obtained from human orbital fibroblasts treated with vehicle, TGFP or TGFP plus 250 nM salinomycin. Cells were harvested at various time points and analyzed for phosphorylated versions of SMAD2/3 and p38. Salinomycin reduced Smad2/3 and p38 phosphorylation at 5 hour and 24 hour TGFP treatments. Figure 5B is a pair of graphs that together show densitometry of Western blots in Fig. 5 A.
Salinomycin reduced TGFP induced phospho-Smad2/3 levels by 2-fold at 5 hours and by 5-fold at 24 hours. Likewise, salinomycin reduced phospho-p38 levels by more than 2-fold at 5 hours and by 10-fold at 24 hours. Data are representative of two different experiments performed with human fibroblasts.
[0022] Figures 6A-C show that expression of constitutively active MKK6 attenuates the inhibitory effect of salinomycin on TGFp. Figure 6A shows that a Smad-luc reporter, constitutive renilla reporter and either a control plasmid or the pcDNA3.1 flag-MK 6 (glu) plasmid were introduced into human orbital fibroblasts by electroporation. After electroporation, cells were treated with vehicle (DMSO), TGFP or TGFP plus 250 nM salinomycin. After 24 hours, cells were lysed and luciferase activity was measured. Smad-luc activity was normalized to renilla activity. Salinomycin blocked TGFP induced Smad-luc activity. However, the presence of MKK6(glu) attenuated the effect of salinomycin on the Smad reporter. Figure 6B shows Western blot results for human orbital fibroblasts into which a control plasmid or the pcDNA3.1 flag-MK 6 (glu) plasmid was introduced by electroporation. Cells were then treated with vehicle, TGFP or TGFP plus 250 nM salinomycin for 24 hours. Figure 6C shows Western blot results for cells treated as in Fig. 6B, however, cells were cultured for 72 hours to allow sufficient time for myofibroblast differentiation. The experiment was repeated three times in different fibroblast strains, results are from one representative set.
[0023] Figure 7 is a schematic illustration showing a potential model for salinomycin
(and other polyether ionophore) mode of action. Active TGFP, present at high concentrations during wound healing, exuberant scarring or chronic inflammation, binds to the TGFP receptor (TGFpR). Activation of the TGFpR triggers a range of cell signaling events including the phosphorylation and activation of Smad2/3 and p38MAPK (p38). Active p38 leads to a further increase of Smad2/3 activation. These signaling pathways converge to lead to transcription and expression of aSMA, calponin, collagen and other genes involved in myofibroblast formation and scarring. Salinomycin, or other polyether ionophores (PEI) can block the activation and phosphorylation of p38, thereby limiting activation of Smad2/3 and blocking myofibroblast formation.
[0024] Figure 8 is a graph showing Thyl expression in whole tissue specimens obtained from thirteen women during implant revision surgeries. Tissue was classified as either non- irradiated (Capsule, n=9) or irradiated (Capsule IR, n=4). Following tissue homogenization, cells were lysed and mRNA was extracted for qPCR analysis of Thyl levels. Results demonstrate that Thyl expression is significantly greater in irradiated capsular tissue. Colored data points represent matched samples, taken from a single patient having undergone unilateral radiation. * = p < 0.05.
[0025] Figure 9 is a set of images of capsular fibroblasts explanted from primary tissue samples cultured in vitro. Treatment consisted of 48 hours growth in serum-starved media (0.1% fetal bovine serum), followed by administration of vehicle, 2.5 ng/mL transforming growth factor-beta (TGF-β), 250 nM salinomycin (SNC), or TGF-β plus SNC for 72 hours. At this time point, TGF-β treated cells show increased density and a more flattened, spiculated morphology suggestive of myofibroblastic differentiation relative to the untreated cells. The concomitant addition of SNC appears to reduce the effect of TGF-β on the fibroblasts. Original magnification 200X.
[0026] Figures 10A-B shows a representative fibroblast strain explanted from primary capsular tissue and treated with 2.5 ng/mL transforming growth factor-beta (TGF-β), 250 nM salinomycin (SNC), or TGF-β plus SNC for 72 hours. After treatment, cells were lysed for protein extraction and analysis via Western blot. Data are presented in graph form (Fig. 10A) and as images of Western blots (Fig. 10B). Though lacking a significant induction following treatment with TGF-β, Thyl expression was significantly reduced with SNC. Alpha-SMA expression increased nearly 3-fold with TGF-β, but concomitant SNC treatment decreased expression to below basal levels. All protein expression is relative to β-tubulin levels. At time of cell harvest, media supernatant was also taken and equal volumes run on a slot blot to compare presence of extracellular soluble collagen. In like manner, collagen I increased with TGF-β and was reduced with co-administration of SNC. ** = p<0.01; *** = p<0.001; **** = pO.0001.
[0027] Figures 11 A-B show, using a lentiviral vector, fibroblasts transduced with either a plasmid to reduce basal expression of Thyl (shThyl) or a control plasmid (GIPZ). Transduced cells were selected using antibiotic resistance (Puromycin at 2ug/mL). Cells were then grown to confluency and harvested for analysis via Western blot. Data are presented in graph form (Fig. 11A) and as images of Western blots (Fig. 1 IB). shThyl cells showed a reduction of approximately 80% in basal Thyl expression. These cells also had reduced expression of both alpha-SMA and extracellular soluble collagen type I. Interestingly, fibronectin levels, another constituent of scar tissue, appears to inversely correlate with Thyl expression, though these results did not reach significance. All results are relative to β-tubulin and normalized to a positive control. * = p<0.05; **** = p<0.0001. [0028] Figure 12 is a graph showing results from a secondary luciferase screen, which was performed to determine specificity and dose responsiveness of the six best small molecule hits from initial screening of the Spectrum library for TGF inhibition. The compounds are benzbromarone ("BZB"), bithionate sodium ("BTS"), piplartine (piperlongumine) ("PPT"), amsacrine ("ASC"), alexidine ("AXD"), and salinomycin ("SNC"). All but BZB substantially inhibited luciferase expression at one or more of the doses tested.
[0029] Figure 13 is a panel of images showing that BTS, PPT, ASC, AXD, and SNC inhibit TGF -dependent myofibroblast (scar cells) formation in primary human fibroblasts. Myofibroblast phenotype was observed in TGF treated cells. All five small molecule hits inhibit myofibroblast phenotype at the lowest effective dose from Fig. 12.
[0030] Figure 14 shows Western blot results that demonstrate that BTS, PPT, ASC,
AXD, and SNC inhibit β-dependent a-SMA and calponin expression in human fibroblasts. Lanes: 1. vehicle; 2. TGFb; 3. TGFb+PPT (1 uM); 4. TGFb+PPT (5 uM); 5.TGFb+BTS (0.1 uM); 6. TGFb+BTS (1 uM); 7. TGFb+ASC (0.1 uM); 8. TGFb+ASC(l uM); 9. TGFb+ SNC (100 nM); 10. TGFb+ SNC (1 uM); 11. TGFb+ AXD (0.1 uM); and 12. TGFb+ AXD (1 uM).
[0031] Figure 15 shows relative aSMA expression in human orbital fibroblasts. Human orbital fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM to 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp. aSMA serves as a marker for myofibroblast formation while β-tubulin is a control protein.
Salinomycin (SNC) and alexidine (AXD) serve as positive controls for anti-fibrotic activity. HCPT potently blocks myofibroblast formation.
[0032] Figure 16 shows relative aSMA expression in human lung fibroblasts. Human lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM to 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp. aSMA serves as a marker for myofibroblast formation while β-tubulin is a control protein.
Salinomycin (SNC) and alexidine (AXD) serve as positive controls for anti-fibrotic activity. HCPT potently blocks myofibroblast formation.
[0033] Figure 17 is a panel of images that show the formation of myofibroblasts. Human lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM or 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp.
Cells images were captured to show formation of myofibroblast in TGFP treated samples but not in samples treated with HCPT or SNC. HCPT potently blocks myofibroblast formation without being overtly toxic, as cell pictures show viable fibroblasts in HCPT treated cultures. [0034] Figure 18 shows relative aSMA expression in mouse lung fibroblasts. Mouse lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 nM to 500 nM) and induced to form scar-forming myofibroblasts by treating with TGFp. aSMA serves as a marker for myofibroblast formation while β-tubulin is a control protein. Salinomycin (SNC) and alexidine (AXD) serve as positive controls for anti-fibrotic activity. HCPT potently blocks myofibroblast formation.
[0035] Figure 19 is a set of Western blot results and corresponding graphs showing that omeprazole inhibits human orbital fibroblast to myofibroblast differentiation. aSMA serves as a marker for myofibroblast formation while β-tubulin is a control protein.
[0036] Figure 20 is a set of Western blot results and corresponding graphs showing that flutamide inhibits human orbital fibroblast to myofibroblast differentiation. aSMA serves as a marker for myofibroblast formation while β-tubulin is a control protein.
[0037] Figure 21 is a graph showing normalized luciferase activity (TGF signaling) for
19 compounds that were discovered from screening the Chembridge library. Chemical ID Nos. are shown. The structures and names of these compounds are shown in Table I presented in the Examples.
[0038] Figure 22 is a panel of cell images showing efficacy of selected Chembridge hits in myofibroblast formation assays using human orbital fibroblasts. These cell images show the powerful effect of these small molecules in preventing TGFP induced myofibroblast formation while not causing cell death. Key: SNC: salinomycin control; Al : 5255687; A2:5130037; A4:9040737; B3:9057423; C2:9018748; C3:9048694; C4:9022265.
[0039] Figure 23 is a panel of cell images showing efficacy of selected Chembridge hits in myofibroblast formation assays using human lung fibroblasts. These cell images show the powerful effect of these small molecules in preventing TGFP induced myofibroblast formation while not causing cell death. Key: SNC: salinomycin control; Al : 5255687; A2:5130037; A4:9040737; B3:9057423; C2:9018748; C3:9048694; C4:9022265.
DETAILED DESCRIPTION
[0040] The present invention relates to a method of treating fibrosis in a patient in need thereof. This method includes administering to the patient an amount of a compound (or active agent) that is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis. [0041] The patient can be any mammal susceptible to fibrosis or exhibiting signs of fibrosis, including without limitation, humans, non-human primates, and various domesticated animals including livestock (dairy cows, steer, pigs, horses, mules, donkeys, llamas, alpaca, sheep, etc.), household animals (dogs, cats, rabbits, ferrets, chinchilla, rodents), and lab animals (typically rodents and rabbits).
[0042] Because myofibroblasts are fundamentally involved in scar formation, they represent ideal targets for new therapeutic options to limit or even reverse scarring.
[0043] Myofibroblast differentiation is driven by the cytokine transforming growth factor-beta (TGFP), which is produced during the natural healing process (Bourlier et al, "TGFbeta family members are key mediators in the induction of myofibroblast phenotype of human adipose tissue progenitor cells by macrophages," PloS one 7:e31274 (2012); George, "Regulation of myofibroblast differentiation by convergence of the Wnt and TGF-betal/Smad signaling pathways," J. Mol.Cell. Cardiol. 46:610-611 (2009), each of which is hereby incorporated by reference in its entirety). TGFP is also involved in many other cellular responses including immune suppression, cell migration and extracellular matrix remodeling (Massague, "TGFbeta signalling in context," Nat. Rev. Mol. Cell Biol. 13:616-630 (2012), which is hereby incorporated by reference in its entirety). While TGFP is normally tightly regulated at multiple levels to limit its powerful effects, TGFP is often highly expressed in conditions such as cancer, chronic inflammation and in fibrosis (Massague, "TGFbeta signalling in context," Nat. Rev. Mol. Cell Biol. 13:616-630 (2012), which is hereby incorporated by reference in its entirety). While driving myofibroblast formation, TGFP regulates numerous cell signaling pathways. One key pathway activated by TGFP is Smad dependent signaling. Smads are a family of highly conserved transcription factors that regulate expression of many genes that contain Smad- binding element (SBEs) in their promoter and/or regulatory regions (Weiss et al., "The TGFbeta superfamily signaling pathway," Wiley Interdiscip. Rev. Dev. Biol. 2:47-63 (2013), which is hereby incorporated by reference in its entirety). TGFP binding to its cognate receptor on the cell surface triggers phosphorylation of the Smad family members, Smad2 and Smad3. Once phosphorylated, these transcription factors bind their binding partner namely, the coSmad, Smad4. This Smad complex is then shuttled into the nucleus where it activates transcription of myofibroblast genes including aSMA, calponin and collagen (Usuki et al, "Sequential analysis of myofibroblast differentiation and transforming growth factor-betal/Smad pathway activation in murine pulmonary fibrosis," J. Nippon Med. Sch. 79:46-59 (2012); Carthy et al, "Wnt3a induces myofibroblast differentiation by upregulating TGF-beta signaling through SMAD2 in a beta-catenin-dependent manner," PloS one 6:el9809 (2011); and Gu et al., "Effect of TGF- beta/Smad signaling pathway on lung myofibroblast differentiation," Acta Pharmacol. Sin. 28:382-391 (2007), each of which is hereby incorporated by reference in its entirety).
[0044] As used herein, the expressions "fibrosis", "fibrosis conditions", and "fibrotic conditions" are intended to have the same meaning. In certain embodiments, the fibrotic conditions are those mediated by a fibrotic stimulator. Exemplary fibrotic stimulators include, without limitation, TGF-β, endothelin, lactic acid (via lactate dehydrogenase), IL-1, Thy-1 (CD90), connective tissue growth factor ("CTGF"), as well as combinations thereof. In certain embodiments, the fibrotic condition is one that is mediated by TGF-β.
[0045] In certain embodiments, the fibrotic condition is related to an autoimmune condition. In other embodiments, the fibrotic condition is subsequent to injury, including radiation, alkali burn, physical burn, surgery, physical trauma, or a combination thereof. In certain embodiments, the fibrotic condition is not secondary to a microbial infection that is treatable with a polyether antibiotic.
[0046] A number of fibrotic conditions can be treated in accordance with the present invention, including those involving internal organs such as lung, liver, kidney, heart, pancreas, gastrointestinal organs, and genitourinary organs; vascular tissue; and ocular tissue such as corneal tissue, retinal tissue, and lacrimal gland tissues.
[0047] Exemplary fibrotic conditions of the lung (i.e., pulmonary fibrosis) include, but are not limited to, idiopathic pulmonary fibrosis (IPF); idiopathic pulmonary upper lobe fibrosis (Amitani disease); familial pulmonary fibrosis; pulmonary fibrosis secondary to systemic inflammatory diseases such as, rheumatoid arthritis, scleroderma, lupus, cryptogenic fibrosing alveolitis, chronic obstructive pulmonary disease (COPD) or chronic asthma; cystic fibrosis; non-specific interstitial pneumonia (NSIP); cryptogenic organizing pneumonia (COP);
progressive massive fibrosis, a complication of coal worker's pneumoconiosis;
scleroderma/systemic sclerosis; bronchiolitis obliterans-organizing pneumonia; pulmonary hypertension; pulmonary tuberculosis; silicosis; asbestosis; acute lung injury; and acute respiratory distress (ARD; including bacterial pneumonia induced, trauma-induced, and viral pneumonia-induced, ventilator-induced, non-pulmonary sepsis induced).
[0048] Exemplary fibrotic conditions of the liver (i.e., liver fibrosis) include, but are not limited to, liver cirrhosis due to all etiologies; congenital hepatic fibrosis; obesity; fatty liver; alcohol induced liver fibrosis; non-alcoholic steatohepatitis (NASH); biliary duct injury; primary biliary cirrhosis; infection- or viral-induced liver fibrosis (e.g., chronic hepatitis B and C virus infections); cystic fibrosis; autoimmune hepatitis; necrotizing hepatitis; primary sclerosing cholangitis; hemochromatosis; disorders of the biliary tree; hepatic dysfunction attributable to infections.
[0049] Exemplary fibrotic conditions of the heart and/or pericardium (i.e., heart or pericardial fibrosis, or fibrosis of the associate vasculature) include, but are not limited to, endomyocardial fibrosis; cardiac allograft vasculopathy (CAV); myocardial infarction; atrial fibrosis; congestive heart failure; arterioclerosis; atherosclerosis; vascular stenosis; myocarditis; congestive cardiomyopathy; coronary infarcts; varicose veins; coronary artery stenosis and other post-ischemic conditions; and idiopathic retroperitoneal fibrosis.
[0050] Exemplary fibrotic conditions of the kidney (i.e., kidney fibrosis) include, but are not limited to, glomerulonephritis (including membranoproliferative, diffuse proliferative, rapidly progressive or sclerosing, post-infectious and chronic forms); diabetic
glomerulosclerosis; focal segmental glomerulosclerosis; IgA nephropathy; diabetic nephropathy;
HIV-associated nephropathy; membrane nephropathy; glomerulonephritis secondary to systemic inflammatory diseases such as lupus, scleroderma and diabetes glomerulonephritis; idiopathic membranoproliferative glomerular nephritis; mesangial proliferative glomerulonephritis;
crescentic glomerulonephritis; amyloidosis (which affects the kidney among other tissues);
autoimmune nephritis; renal tubuloinsterstitial fibrosis; renal arteriosclerosis; Alport's syndrome; nephrotic syndrome; chronic renal failure; periglomerular fibrosis/atubular glomeruli; combined apical emphysema and basal fibrosis syndrome (emphysema/fibrosis syndrome); glomerular hypertension; nephrogenic fibrosing dermatopathy; polycystic kidney disease; Fabry's disease and renal hypertension.
[0051] Exemplary fibrotic conditions of the pancreas (i.e., pancreatic fibrosis) include, but are not limited to, stromal remodeling pancreatitis and stromal fibrosis.
[0052] Exemplary fibrotic conditions of the gastrointestinal tract (i.e., GI tract fibrosis) include, but are not limited to, Crohn's disease; ulcerative colitis; collagenous colitis; colorectal fibrosis; villous atrophy; crypt hyperplasia; polyp formation; healing gastric ulcer; and microscopic colitis.
[0053] Exemplary fibrotic conditions of the eye include, but are not limited to, ocular fibrosis, ophthalmic fibrosis, proliferative vitreoretinopathy; vitreoretinopathy of any etiology; fibrosis associated with retinal dysfunction; fibrosis associated with wet or dry macular degeneration; scarring in the cornea and conjunctiva; fibrosis in the corneal endothelium;
anterior subcapsular cataract and posterior capsule opacification; anterior segment fibrotic diseases of the eye; fibrosis of the corneal stroma (e.g., associated with corneal opacification); fibrosis of the trabecular network (e.g., associated with glaucoma); posterior segment fibrotic diseases of the eye; fibrovascular scarring (e.g., in retinal or choroidal vasculature of the eye); retinal fibrosis; epiretinal fibrosis; retinal gliosis; subretinal fibrosis (e.g., associated with age related macular degeneration); tractional retinal detachment in association with contraction of the tissue in diabetic retinopathy; congenital orbital fibrosis; lacrimal gland fibrosis; corneal subepithelial fibrosis; and Grave's ophthalmopathy.
[0054] Additional fibrotic disorders or fibrosis resulting from any one of the
aforementioned conditions include, but are not limited to, spinal cord injury/fibrosis or central nervous system fibrosis such as fibrosis after a stroke, fibrosis associated with neurodegenerative disorder such as Alzheimer's disease or multiple sclerosis; vascular restenosis; uterine fibrosis; endometriosis; ovarian fibroids; Peyronie's disease; polycystic ovarian syndrome; disease related pulmonary apical fibrosis in ankylosing spondylitis; and fibrosis incident to microbial infections (e.g., bacterial, viral, parasitic, fungal etc.).
[0055] As used herein, treatment of fibrosis or fibrotic conditions is meant to include disruption of the fibrotic processes so as to halt progression of the fibrotic condition, slow progression of the fibrotic condition, or cause regression of the fibrotic condition (i.e., improve the patient's state of health with respect to the degree of fibrosis in the affected tissue or organ). In certain embodiments, where treatment precedes onset of the fibrotic condition, i.e., treatment is performed prior to a known or an otherwise expected onset of fibrosis, then such treatment may include preventing development or onset of the fibrotic condition. Administration of the various active agents can therefore be carried out for a suitable duration to either control or halt progression of the fibrotic condition, or prevent onset thereof.
[0056] In certain embodiments, the compound or active agent is a polyether antibiotic.
Exemplary polyether antibiotics include, without limitation, those selected from the group consisting of monensin, lasalocid, salinomycin, narasin, maduramycin, semduramycin, laidlomycin, lonomycin, ionomycin, nigericin, grisorixin, dianemycin, lenoremycin, antibiotic X206, alborixin, septamycin, antibiotic A204, Compound 47,224, mutalomycin, isolasalocid A, lysocellin, tetronasin, etheromycin, antibiotic X-14766A, antibiotic A-23187, antibiotic A- 32887, Compound 51,532, and K41. In one particular embodiment, the polyether antibiotic is selected from the group consisting of monensin, lasalocid, salinomycin, narasin, maduramycin, semduramycin, and laidlomycin. Salinomycin and derivatives thereof are described in
Hammann et al., "Anticoccidial Activity of Salinomycin Derivatives," J. of Antibiotics
46(3):523-525 (1993), which is hereby incorporated by reference in its entirety. [0057] In another embodiment the compound or active agent has a structure according to formula (I), shown below, which is described in U.S. Patent No. 6,509,360 to Malamas et al, which is hereby incorporated by reference in its entirety:
Figure imgf000017_0001
wherein:
A is O, S, or NH;
B is— (CH2)m— ,— CH(OH)— , or carbonyl;
R1 is hydrogen, nitro, halogen, alkyl of 1-6 carbon atoms, alkoxy of 1-6 carbon atoms, or trifluoromethyl;
R is alkyl of 1-18 carbon atoms, aryl of 6-10 carbon atoms, arylalkyl of 7-15 carbon atoms, Het- alkyl wherein the alkyl moiety is 1-6 carbon atoms;
Het is
Figure imgf000017_0002
R2a is alkylene of 1-3 carbon atoms;
G is oxygen, sulfur, or nitrogen;
R3 and R4 are each, independently, hydrogen, halogen, alkyl of 1-3 carbon atoms, aryl of 6-10 carbon atoms or a heterocyclic ring of 5 to 7 ring atom containing 1 to 3 heteroatoms selected from oxygen, nitrogen, sulfur;
R5 is hydrogen, alkyl of 1-6 carbon atoms,— CH(R7)R8,— C(CH2)„C02R9,— C(CH3)2C02R9,— CH(R7)(CH2)„C02R9, or— CH(R7)C6H4C02R9;
R6 is hydrogen, halogen, alkyl of 1-6 carbon atoms, or— OR5;
m=l-6;
n=l-6;
R7 is hydrogen, alkyl of 1-6 carbon atoms, aryl of 6-10 carbon atoms, or arylalkyl of 7-15 carbon atoms;
R8 is— C02R10,— CONHR10, tetrazole, or— P03H2;
R9 and R10 are each, independently, hydrogen, alkyl of 1-6 carbon atoms, aryl of 6-10 carbon atoms, or arylalkyl of 7-15 carbon atoms;
or a pharmaceutically acceptable salt thereof. [0058] One exemplary compound of formula (I) has the following structure:
Figure imgf000018_0001
(Benzbromarone ("BZB")).
[0059] In another embodiment the compound has a structure according to formula (II), shown below, which is described in U.S. Patent No. 8,318,737 to Foley et al, which is hereby incorporated by reference in its entiret :
Figure imgf000018_0002
or a pharmaceutically acceptable salt or pharmaceutically acceptable derivative thereof, wherein:
Ring A is selected from the group consisting of one or more monocyclic aryl, one or more
heteroaryl, a 3-7 membered saturated or partially unsaturated carbocyclic ring, an 8-10 membered bicyclic saturated, partially unsaturated or aryl ring, a 5-6 membered monocyclic heteroaryl ring having 1-4 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 4-7 membered saturated or partially unsaturated heterocyclic ring having 1-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur, a 7-10 membered bicyclic saturated or partially unsaturated heterocyclic ring having 1-5 heteroatoms independently selected from nitrogen, oxygen or sulfur, or an 8-10 membered bicyclic heteroaryl ring having 1-5 heteroatoms independently selected from nitrogen, oxygen, or sulfur;
each R 1 , R2 , and R 3 is independently selected from the group consisting of hydrogen, halogen, deuterium, CF3, CN, OR, SR, NRR, NRCOR, NRCONRR, NRC02R, COR, C02R, NOR,
N02, CONRR, OC(0)NRR, S02R, S02NRR, NRS02R, NRS02NRR, C(0)C(0)R, or
C(0)CH2C(0)R, alkyl, aryl, heteroaryl and morpholino, wherein either R 1 and R 2 , or R 2 and R are optionally taken together to form a 4-8 membered saturated, partially unsaturated, or fully unsaturated ring having 0-3 heteroatoms independently selected from nitrogen, oxygen, or sulfur;
each R is independently selected from hydrogen or an optionally substituted C1-C4 aliphatic moiety (i.e. alkyl, alkenyl, or alkynyl), or alternately, two R moieties bound to the same nitrogen atom are optionally taken together with the nitrogen atom to form a 3-7 membered saturated, partially unsaturated, or fully unsaturated ring having 1-2 additional heteroatoms independently selected from nitrogen, oxygen, or sulfur;
B is selected from:
Figure imgf000019_0001
wherein
R4, R5, R6 and R7 are independently selected from hydrogen, a substituted or unsubstituted Ci to Ci2 alkyl, a substituted or unsubstituted C2 to C12 alkenyl or a substituted or unsubstituted C2 to Ci2 alkynyl;
X is C(O), C(S), or S(0)2; and
C is a saturated or unsaturated heteroaryl or a saturated or unsaturated CI to C7 heterocyclic containing one or more heteroatoms wherein the heteroatoms are independently selected from N, O or S;
or C is a fused ring; and
wherein any one or more H is optionally replaced by a deuterium. [0060] In another embodiment, the compounds Formula (II) above have a structure wherein ring A is selected from:
Figure imgf000020_0001
wherein the ring carries R1, R2 and R3 as defined above;
wherein Y is N, O or S; and
C is selected from:
Figure imgf000020_0002
Figure imgf000021_0001
wherein the ring is optionally substituted with one or more R10 and R11, wherein R10 and R11 are independently selected from a substituted or unsubstituted Ci to C12 alkyl, a substituted or unsubstituted Ci to C12 alkenyl or a substituted or unsubstituted Ci to C12 alkynyl, an ether, a thioether, aryl,
n is 1, 2 or 3;
Xi is O or S;
[0061] Exemplary compounds of formula (II) have the structures shown below: -21 -
Figure imgf000022_0001
Figure imgf000023_0001
(Piplartine or piperlongumine, "PPT").
[0062] In another embodiment the compound is a 2,2'-dihydroxy halogenated diphenyl sulfide having the structure of formula (III), shown below, which is described in U.S. Patent No. 2,353,735 to Kunz et al, which is hereby incorporated by reference in its entirety:
Figure imgf000023_0002
wherein R is halogen and n is an integer from 1 to 4 inclusive.
[0063] Exemplary 2,2'-dihydroxy halogenated diphenyl sulfide include
Figure imgf000023_0003
sodium, "BTS").
[0064] Alternatively, 2,2'-dihydroxydiphenyl sulfide having the structure shown below can be used (as described in U.S. Patent No. 2,760,988 to Schetty et al, which is hereby incorporated by reference in its entiret : .
Figure imgf000023_0004
[0065] In yet another embodiment the compound has a structure according to formula
(IV), shown below, which is described in U.S. Patent No. 3,468,898 to Cutler et al, which is hereby incorporated by reference in its entirety:
Figure imgf000023_0005
wherein: the bivalent bridge A is a member of the group consisting of:
(a) alkylene of from 2 to 12 carbon atoms having the valence bonds attached to different carbon atoms,
(b)— (CH2)m— Y— (CH2)n— wherein m and n each represent an integer from 2 to 6 and Y is a member of the group consisting of O and S,
Figure imgf000024_0001
wherein Z and Z' are each alkylene of from 1 to 3 carbon atoms,
(e)
Figure imgf000024_0002
wherein Q is a member of the group consisting of— O S SO— and S02— , and
(f)
Figure imgf000024_0003
R is a member of the group consisting of
(a) alkyl of from 6 to 16 carbon atoms, and
(b) alkyl- Y-alkylene, wherein Y is a member of the group consisting of O and S; R' is a member of the group consisting of H and lower-alkyl; and
x is an integer from 1 to 2.
[0066] In Formula (IV), above, when representing (a), the alkylene bridge of from 2 to
12 carbon atoms, A has the formula CnH2n (wherein n is an integer from 2 to 12), is bivalent, and has free valence bonds on different carbon atoms. The bivalent alkylene bridge can be polymethylene, represented by (CH2)n,— or equivalently by— (CH2)2_i2— but it also includes branched-chain alkylene bridges. Thus in this sense, A includes the alpha,omega-divalent unbranched radicals ethylene, trimethylene, tetramethylene, pentamethylene, hexamethylene, heptamethylene, octamethylene, nonamethylene, decamethylene, undecamethylene, and dodecamethylene, and also includes for example the branched divalent radicals 1,3 -propylene, 1 ,4-pentylene, 1,10-dodecamethylene, 2-methyl-l ,4-butylene, 2-methyl-l,5-pentylene, and the like.
[0067] When representing the bridged grouping
(b) — (CH2)m— Y— (CH2)n
A is an oxa- or thia-polymethylene radical containing from 5 to 13 atoms. The terms m and n can be the same or different, and each represents an integer of from 2 to 6. The term Y represents— O— or— S— . In this sense, therefore, A includes such radicals as
— CH2CH2- -S- -CH2CH2
— CH2CH2— CH2— -s- — CH2— CH2CH2
— CH2CH2CH2CH2— -s- — CH2CH2CH2CH2
— CH2CH2CH2CH2CH2— -s- — CH2CH2CH2CH2CH2
CH2CH2CH2CH2CH2CH2— -s- — CH2CH2CH2CH2CH2CH2
— CH2CH2- 0 -CH2CH2
— CH2CH2CH2— 0 — CH2CH2CH2
— CH2CH2CH2CH2— 0 — CH2CH2CH2CH2
— CH2CH2CH2CH2CH2— 0 — CH2CH2CH2CH2CH2
— CH2— CH2— S— CH2- — CH2— CH2— CH2
— CH2CH2CH2 — 0— CH2CH2
and the like.
[0068] When A represents bridging groups (d) through (f), each of which contains one or more benzene rings, the said benzene rings can be unsubstituted or can be substituted with up to four inert substituents exemplified by, but not limited to, lower-alkyl, halogen (fluorine, chlorine, bromine, or iodine), lower-alkoxy, nitro, and hydroxy.
[0069] When representing the radical
Figure imgf000025_0001
A is a divalent phenylene-bis(lower-alkylene) group. The terms Z and Z' can be the same or different and represent alkylene radicals of from 1 to 3 carbon atoms. Moreover the Z and Z' radicals can be in any of the ortho-, meta-, or para-positions relative to each other. Because of their ready availability, particularly preferred l,4-phenylene-bis(lower-alkylene) groups are 1,2-, 1,3- or 1,4-xylylene and halo- and alkyl-substituted 1,2-, 1,3- and 1,4-xylylene. In this sense, therefore, A includes 2,3,5,6-tetramethyl-l,4-phenylene-bis(methylene), 2,5-dimethyl-l,4- phenylene-bis(methylene), 2-chloro-l ,4-phenylenebis(methylene), 2,3,5,6-tetrachloro-l ,4- phenylenebis(methylene) l,2-phenylenebis(methylene), l,3-phenylenebis(methylene), and 1,4- phenylenebis(methylene), and also 2-methyl-l,4-phenylenebis(ethylene), 1,4- phenylenebis(propylene),
— CH2— ( 1 ,4-phenylene)— CH2CH2
-CH(CH3)— ( 1 ,4-phenylene)— CH(CH3)—
— CH(CH3)— (1,4-phenylene)— CH(CH3)- and the like.
[0070] In the above general Formula (IV), R is a member of the group consisting of alkyl of from 6 to 16 carbon atoms and lower-alkyl-Y-lower-alkylene, wherein Y, as above, is— O— or— S— . When representing an alkyl group of from 6 to 16 carbon atoms, R is a straight- or branched-chain saturated monovalent aliphatic radical. Thus, R includes n-hexyl, n-heptyl, n- octyl, n-nonyl, n-decyl, n-undecyl, n-dodecyl, n-tetradecyl, n-hexadecyl, 2-ethyl-l-hexyl, 2- heptyl, 2-octyl, 1,1,3,3-tetramethylbutyl, and the like.
[0071] When representing an alkyl-Y-alkylene radical, R is an oxa- or thia-interrupted alkyl group of from 6 to 16 atoms. The alkyl and alkylene radicals together contain from 5 to 15 carbon atoms, and Y is— O— or— S— . Particularly preferred alkyl-Y-alkylene groups are those wherein the alkylene moiety is propylene because of the ease of preparing the requisite alkylmercapto- and alkoxyamine intermediates from acrylonitrile by methods well-known in the art. When representing alkyl-Y-alkylene, R is thus exemplified by 3-(ethoxy)propyl, 3- (butoxy)propyl, 3-(pentoxy)propyl, 6-(propyloxy)hexyl, 3-(hexylmercapto)propyl, 3- (butylmercapto)propyl, 5-(pentylmercapto)pentyl, 7-(methoxy)heptyl, 6-(pentoxy)hexyl, 3- (tridecyloxy)propyl, 3-(dodecylmercapto)propyl, and the like.
[0072] In the above general Formula (IV), R' is H or lower-alkyl. When representing lower-alkyl, R is a straight- or branched-chain saturated aliphatic radical which contains from one to six carbon atoms. The group R' thus includes, H, methyl, ethyl, n-propyl, isopropyl, n- butyl, isobutyl, tert-butyl, n-amyl, n-hexyl, and the like.
[0073] The term x in general Formula (IV) is 1 or 2. When x represents the integer 1, the compounds are bridged-bis[guanidines], and when representing 2, the compounds are bridged- bis[biguanides].
[0074] One exemplary compound of formula (IV) has the following structure:
Figure imgf000026_0001
AXD"). [0075] In a further embodiment the compound is AMSA or m-AMSA or a derivative thereof according to the structure of formulae (Va, Vb, or Vc), shown below. AMSA has the following structure:
Figure imgf000027_0001
m-AMSA, amsacrine or ("ASC") has the following structure
Figure imgf000027_0002
m-AMSA derivatives are described in U.S. Patent No. 4,472,582 to Cain et al., which is hereby incorporated by reference in its entirety. 3,5-Disubstituted m-AMSA compounds having the following formula:
Figure imgf000027_0003
wherein R 2 and R 3 represent, respectively,— CH3 and— CONHCH3,— CH3 and—
CONHCH2CONH2,—CI and— CONHCH2CONH2,— CONHCH3 and— CH3; and acid additional salts thereof.
[0076] In yet another embodiment the compound is a 10-substituted camptothecin derivative having the following the structure according to formula (VI), shown below, which is described in U.S. Patent No. 4,473,692 to Miyasaka et al, which is hereby incorporated by reference in its entirety:
Figure imgf000028_0001
wherein R1 is a hydrogen atom, an alkyl group, a hydroxyl group, an alkoxy group or an acyloxy group, R is a hydrogen atom, an alkyl group, an aralkyl group, a hydroxymethyl group, a carboxymethyl group or an acyloxymethyl group, and R is the grouping— XR (where R is a hydrogen atom, an alkyl group or an acyl group and X is an oxygen atom or a sulfur atom), a nitro group, an amino group, an alkylamino group, an acylamino group or a halogen atom, with
1 2 3
the proviso that when both of R and R are hydrogen atoms, R should not be a hydroxyl group, methoxy group or acetoxy group.
[0077] One exemplary compound of formula (VI) is 10-hydroxycamptothecin having the structure shown below:
Figure imgf000028_0002
[0078] In another embodiment the compound has a structure according to formula (VII), shown below), which is described in U.S. Patent No. 4,255,431 to Junggren et al.., which is hereby incorporated by reference in its entirety:
Figure imgf000028_0003
wherein R 1 and R 2 are same or different and are each selected from the group consisting of hydrogen, alkyl, halogen, carbomethoxy, carbethoxy, alkoxy, and alkanoyl, R6 is selected from the group consisting of hydrogen, methyl, and ethyl, and R 3 , and R 5 are the same or different and are each selected from the group consisting of hydrogen, methyl, methoxy, ethoxy,
methoxyethoxy and ethoxyethoxy and R4 is methoxy, ethoxy, methoxyethoxy or ethoxyethoxy whereby R3, R4 and R5 are not all hydrogen, and whereby when two of R3, R4, and R5 are hydrogen, the third of R3, R4 and R5 is not methyl. [0079] Exemplary compounds according to formula (VII) include omeprazole, which is a racemic mixture having the following structure:
Figure imgf000029_0001
and esomeprazole, which is the substantially purified isomer having the following structure
Figure imgf000029_0002
[0080] In another embodiment the compound is Flutamide
Figure imgf000029_0003
(Flutamide)
or a derivative thereof having the structure according to formula (VIII), shown below, which is described in U.S. Patent No. 3,332,768 to Freund et al, which is hereby incorporated by reference in its entirety:
Figure imgf000029_0004
wherein Ri is lower alkyl, R2 is halogen, and R3 and R4 each are hydrogen, halogen, lower alkyl, lower alkoxy, trifluormethyl, or the nitro group.
[0081] In a further embodiment the compound has a structure according to formula (IX), shown below, or a pharmaceutically or veterinarily acceptable salt thereof, which is described in PCT Application Publ. No. WO 2014/099837 to Lahm et al., which is hereby incorporated by reference in its entirety:
Figure imgf000030_0001
wherein
R is hydrogen, C1-C4 alkyl, C2-C6 alkylcarbonyl or C2-C6 alkoxycarbonyl;
and R are each independently hydrogen, halogen, cyano, hydroxyl, amino, nitro, CHO, SF5, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or S(O)2NRi0Rn; or Ci-C6 alkyl,
C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9,
C(O)NR10Ru,S(O)pR12 and S(O)2NR10Rn; or G; or
2 3
R" and RJ are taken together with the carbons to which they are attached to form a 5- to 6- membered carbocyclic or heterocyclic ring optionally substituted with up to 3 substituents independently selected from R4a on carbon atom ring members and R4b on nitrogen atom ring members;
G is a phenyl ring or an 8- to 10-membered carbocyclic bicyclic ring system, each ring or ring system optionally substituted with up to 5 substituents independently selected from R5a; or
G is a 5- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R5a on carbon atom ring members and R5b on nitrogen atom ring members;
X is CR4c or N;
Y is CR4d or N;
Q1 is 3- to 7-membered carbocyclic ring or an 8- to 10-membered carbocyclic bicyclic ring
system, each ring or ring system optionally substituted with up to 5 substituents
independently selected from R 13a; or
Q1 is a 5- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R0a on carbon atom ring members and R0b on nitrogen atom ring members;
J is hydrogen; or phenyl or naphthalenyl each optionally substituted with up to 5 substituents independently selected from R14a; or
J is a 5- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R14a on carbon atom ring members and R14b on nitrogen atom ring members; or
J is L-Q2;
L is O, S, SO, S02, NR15, (CH2)„, OCH2, or CH20;
Q is a 3- to 7-membered carbocyclic ring or an 8- to 10-membered carbocyclic bicyclic ring system, each ring or ring system optionally substituted with up to 5 substituents independently selected from R16a; or
Q is a 3- to 7-membered heterocyclic ring or an 8- to 10-membered heterocyclic bicyclic ring system, each ring or ring system containing ring members selected from carbon atoms and up to 4 heteroatoms independently selected from up to 2 O, up to 2 S and up to 4 N atoms, and optionally substituted with up to 5 substituents independently selected from R16a on carbon atom ring members and R16b on nitrogen atom ring members;
each R4a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF5, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or S(O)2NR10Rn; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Ru, S(0)pR12 and S(O)2NR10Ru; or G;
R4b is cyano, -CHO, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Ru, S(0)pR12 or S(O)2NR10Ru; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Rn; or G;
R4c and R4d are each independently hydrogen, halogen, cyano, hydroxyl, amino, nitro, -CHO, - SF5, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or S(O)2NRi0Rn; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-Cs cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Rn; or G;
each R5a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF5, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or S(O)2NR10Rn; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Ru, S(0)pR12 and S(O)2NR10Ru;
R5b is cyano, -CHO, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Ru, S(0)pR12 or
S(O)2NR10Ru; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NRi0Rn;
each R6 is independently hydrogen, C2-C6 alkylcarbonyl, C2-C6 alkoxycarbonyl, C2-C6
alkylaminocarbonyl, C3-C6 dialkylaminocarbonyl, Ci-C6 alkylsulfenyl, Ci-C6 alkylsulfinyl,
Ci-C6 alkylsulfonyl, C2-C6 alkylaminosulfonyl or C3-C6 dialkylaminosulfonyl; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or benzyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, Ci-C6 alkoxy, Ci- C6 alkylamino, C2-Cs dialkylamino, C2-C6 alkylcarbonyl, C2-C6 alkoxycarbonyl, C2-C6 alkylaminocarbonyl, C3-C6 dialkylaminocarbonyl, Ci-C6 alkylsulfenyl, Ci-C6 alkylsulfinyl,
Ci-C6 alkylsulfonyl, C2-C6 alkylaminosulfonyl and C3-C6 dialkylaminosulfonyl; or C3-C7 cycloalkyl, C4-Cs cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, Ci-C4 alkyl, Ci-C4 haloalkyl, Ci-C4 alkoxy, Ci-C4 alkylsulfenyl, Ci-C4 alkylsulfinyl and Ci-C4 alkylsulfonyl;
each R7a is independently hydrogen, C2-C6 alkylcarbonyl, C2-C6 alkoxycarbonyl, C2-C6
alkylaminocarbonyl, C3-C6 dialkylaminocarbonyl, Ci-C6 alkylsulfenyl, Ci-C6 alkylsulfinyl or Ci-C6 alkylsulfonyl, C2-C6 alkylaminosulfonyl or C3-C6 dialkylaminosulfonyl; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or benzyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, Ci-C6 alkoxy, Ci-
C6 alkylamino, C2-Cs dialkylamino, C2-C6 alkylcarbonyl, C2-C6 alkoxycarbonyl, C2-C6 alkylaminocarbonyl, C3-C6 dialkylaminocarbonyl, Ci-C6 alkylsulfenyl, Ci-C6 alkylsulfinyl, Ci-C6 alkylsulfonyl, C2-C6 alkylaminosulfonyl and C3-C6 dialkylaminosulfonyl; or C3-C7 cycloalkyl, C4-Cs cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 alkylsulfenyl, C1-C4 alkylsulfinyl and C1-C4 alkylsulfonyl;
each R7b is independently hydrogen; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or benzyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, Ci-C6 alkoxy, Ci-C6 alkylamino, C2-Cs dialkylamino, C2-C6 alkylcarbonyl, C2-C6 alkoxycarbonyl, C2-C6 alkylaminocarbonyl, C3-C6
dialkylaminocarbonyl, Ci-C6 alkylsulfenyl, Ci-C6 alkylsulfinyl, Ci-C6 alkylsulfonyl, C2-C6 alkylaminosulfonyl and C3- C6 dialkylaminosulfonyl;
8 9 10 12
R , R , R and R are each independently hydrogen; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6
alkynyl, phenyl, benzyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, C2-C6 alkoxycarbonyl, C2-C6 alkylaminocarbonyl, C2-Cs dialkylaminocarbonyl, C1-C4
alkylsulfenyl, C1-C4 alkylsulfinyl, C1-C4 alkylsulfonyl, C1-C4 haloalkylsulfenyl, C1-C4 haloalkylsulfinyl and C1-C4 haloalkylsulfonyl;
each R11 is independently hydrogen; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl or benzyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, C1-C4 alkyl, C1-C4 haloalkyl, C1-C4 alkoxy, C1-C4 haloalkoxy, C1-C4 alkylsulfenyl, C1-C4 alkylsulfinyl, C1-C4 alkylsulfonyl, C1-C4 haloalkylsulfenyl, C1-C4 haloalkylsulfinyl and C1-C4 haloalkylsulfonyl;
each R13a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF5, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or S(O)2NR10Rn; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Ru;
R13b is cyano, -CHO, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or
S(O)2NR10Ru; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Rn;
each R14a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF5, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or S(O)2NR10Rn; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Ru;
R14b is cyano, -CHO, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or
S(O)2NR10Ru; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Rn;
R15 is hydrogen, cyano, -CHO, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Ru, S(0)pR12 or S(O)2NR10Ru; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Rn;
each R16a is independently halogen, cyano, hydroxyl, amino, nitro, -CHO, -SF5, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or S(O)2NR10Rn; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(O)2NR10Ru; or G;
R16b is cyano, -CHO, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 or
S(O)2NR10Ru; or Ci-C6 alkyl, C2-C6 alkenyl, C2-C6 alkynyl, C3-C7 cycloalkyl, C4-C8 cycloalkylalkyl or C5-C7 cycloalkenyl, each optionally substituted with substituents independently selected from the group consisting of halogen, cyano, nitro, OR6, NR7aR7b, C(0)R8, C(0)OR9, C(O)NR10Rn, S(0)pR12 and S(0)2NRu; or G;
n is 1 or 2; and
p is 0, 1 or 2;
provided that
(a) when J is phenyl and Q1 is phenyl, then each R0a is hydrogen; and
(b) when L is S, SO, S02, NR15, (CH2)n, OCH2, or CH20, then Q2 is other than phenyl.
[0082] Exemplary compounds according to formula (IX) include, without limitation, those selected from the group of:
Figure imgf000035_0001
{infra Table 1, C2), {infra Table 1, C4),
Figure imgf000035_0002
{infra Table 1, A3), and {infra Table 1 ,
In a further embodiment the compound has the structure
Figure imgf000035_0003
able 1, C3)
or a derivative thereof having the formula (X), shown below, which is described in U.S. Patent No. 3,212,900 to Oguchi et al, which is hereby incorporated by reference in its entirety:
Q— C≡C— R (X),
wherein R is hydrogen atom or carboxyl, alkoxycarbonyl, phenyl or substituted phenyl radical, and Q is alkoxycarbonyl, carbamoyl,
phenyl, substituted phenyl or naphthyl radical, or in case R represents hydrogen atom, Q may be a group of the formula
R K ?l R
c—
R2
(in which Ri represents hydrogen atom, lower alkyl, phenyl, substituted phenyl or aralkyl radical; R2 represents lower alkyl, phenyl, substituted phenyl, naphthyl or aralkyl radical, or it may, together with the Ri, form a cycloalkyl radical; and R3 is hydrogen or acyl radical). Using the procedures described in U.S. Patent No. 3,212,900 to Oguchi et al, persons of skill in the art will be able to prepare compounds where the group \= comprises one or more alkyl or alkoxy substituents (i.e., by using the appropriate starting materials). [0084] In another embodiment the compound has the structure
Figure imgf000036_0001
{infra Table 1)
or derivatives thereof having the formula (XI), shown below, which is described in JP 57021320 to Honda Narimitsu et al., which is hereby incorporated by reference in its entirety:
Figure imgf000036_0002
wherein Ri and R2 are H, alkyl, (substituted) aralkyl, or (substituted) phenyl. These compounds can be easily prepared by reducing the corresponding m-nitrobenzoic acid amide by conventional methods (JP 57021320 to Honda Narimitsu et al., which is hereby incorporated by reference in its entirety). Using the procedures described in JP 57021320 to Honda Narimitsu et al, persons of skill in the art will be able to prepare compounds bearing an additional halogen substituent on a phenyl ring (i.e., by using the appropriate starting materials).
[0085] In one embodiment the compound is a sulfide having the following formula:
Figure imgf000036_0003
Alternatively aromatic or heteroaromatic sulfides having the formula R-S-R (XII),
wherein R is substituted aryl or substituted heteroaryl can be prepared as described in GB Patent
No. 1460559 to Voronkov et al., which is hereby incorporated by reference in its entirety.
[0086] In another embodiment the compound has a structure according to formula (XIII), shown below, which is described in U.S. Patent No. 6,596,726 to Bridges et al, which is hereby incorporated by reference in its entiret :
Figure imgf000036_0004
(ΧΠΙ), wherein: 1) Y and Z are both C (carbon), both N or one N and the other C, in which case the ring structure is a linearly fused 6,6 (5 or 6) tricycle, or 2) one of Y and Z is C=C, C=N whereupon the other one of Y or Z is simply a bond between the two aromatic rings, then the ring structure is a nonlinear 6,6 (5 or 6) tricycle, or 3) one of Y and Z is N, O or S, whereupon the other one of Y or Z is simply a bond between the two aromatic rings, then the ring structure is a fused 6,5 (5 or 6) tricycle;
A, B, D and E can all be carbon, or up to two of them can be nitrogen, whereupon the remaining atoms must be carbon, or any two contiguous positions in A-E can be a single heteroatom, N, O or S, forming a five membered fused ring, in which case one of the two remaining atoms must be carbon, and the other can be either carbon or nitrogen, except that the case where A and B taken together, and D and E taken separately are all three nitrogen atoms;
X is O, S, NH or NR9, such that R9 is lower alkyl (1-4 carbon atoms), OH, NH2, lower alkoxy (1-4 carbon atoms) or lower monoalkylamino (1-4 carbon atoms);
R1 is H or lower alkyl;
n is 0, 1 or 2;
if n is 2, R1 can be independently H or lower alkyl on either linking carbon atom, and both R and S stereocentres on either linker are included;
R is lower alkyl (1-4 carbon atoms), cycloalkyl (3-8 carbon atoms), lower alkoxy (1-4 carbon atoms), cycloalkoxy (3-8 carbon atoms), nitro, halo, lower perfluoroalkyl (1-4 carbon atoms), hydroxy, lower acyloxy (1-4 carbon atoms; -O-C(O)-R), amino, lower mono or dialkylamino (1-4 carbon atoms), lower mono or dicycloalkylamino (3-8 carbon atoms), hydroxymethyl, lower acyl (1-4 carbon atoms;— C(O) R), cyano, lower thioalkyl (1-4 carbon atoms), lower sulfmylalkyl (1-4 carbon atoms), lower sulfonylalkyl (1-4 carbon atoms), thiocycloalkyl (3-8 carbon atoms), sulfmylcyclo alkyl (3-8 carbon atoms), sulfonylcycloalkyl (3- 8 carbon atoms), mercapto, lower alkoxycarbonyl (1-4 carbon atoms), cycloalkoxycarbonyl (3-8 carbon atoms), lower alkenyl (2-4 carbon atoms), cycloalkenyl (4-8 carbon atoms), lower alkynyl (2-4 carbon atoms), or two R taken together can form a carbocyclic ring of 5-7 members; and
m is 0-3, wherein Ar is phenyl, thienyl, furanyl, pyrrolyl, pyridyl, pyrimidyl, imidazoyl, pyrazinyl, oxazolyl, thiazolyl, naphthyl, benzothienyl, benzofuranyl, indolyl, quinolinyl, isoquinolinyl and quinazolinyl;
R3, R4, R5 and R6 are independently, not present, H, lower alkyl (1-4 carbon atoms), cycloalkyl (3-8 carbon atoms), lower alkoxy (1-4 carbon atoms), cycloalkoxy (3-8 carbon atoms), hydroxy, lower acyloxy (1-4 carbon atoms), amino, lower mono or dialkylamino (1-4 carbon atoms), lower mono or dicycloalkylamino (3-8 carbon atoms), lower alkyl (1-4 carbon atoms) or cycloalkyl (3-8 carbon atoms), carbonate (-OC(O)OR) where R is alkyl of from 1-4 carbon atoms or cycloalkyl of from 3-8 carbon atoms;
or ureido or thioureido or N or O linked urethane any one of which is optionally substituted by mono or di-lower alkyl (1-4 carbon atoms) or cycloalkyl (3-8 carbon atoms); lower thioalkyl (1-4 carbon atoms), thiocycloalkyl (3-8 carbon atoms), mercapto, lower alkenyl (2-4 carbon atoms), hydrazino, N- and/or N'- mono- or di lower alkylhydrazino (1-4 carbon atoms), lower acylamino (1-4 carbon atoms), hydroxylamino, N- and/or C-mono- or di lower alkylhydroxylamino (1-4 carbon atoms), or taken together can be methylene-, ethylene-or propylenedioxy, or taken together form a fused pyrrolidine, tetrahydrofuranyl, pipenidinyl, piperazinyl, morpholino or thiomorpholino ring;
7 8
R' and R° can be independently as appropriate, lone pairs of electrons, H, or lower alkyl; any lower alkyl group substituent on any of the substituents in R 3— R 8 which contain such a moiety can be optionally substituted with one or more of hydroxy, amino, lower monoalkylamino, lower dialkylamino, N-pyrrolidyl, N-piperidinyl, N-pyridinium, N- morpholino, N-thiomorpholino or N-piperazino groups;
if one or two of A through E are N, then if any of R3— R6 is on a neighboring C atom to one of the N atoms, that substituent cannot be either OH or SH; and
R10 is H or lower alkyl (1-4 carbon atoms), amino or lower mono- or dialkylamino (1-4 carbon atoms);
if any of the substitutents R1, R2, R3 or R4 contain chiral centers, or in the case of R1 create chiral centers on the linking atoms, then all stereoisomers thereof both separately and as racemic and/or diastereoisomeric mixtures are included;
or a pharmaceutical salt or hydrate thereof.
[0087] For the compounds of formula (XIII), the following provisos are provided:
the ring containing A-E is aromatic;
if A and B taken together and E are nitrogen, and if neither Y nor Z is a heteroatom, and if X=NH, and n=l, and R1=H and Ar=Ph, then one of the imidazole nitrogen atoms must have a substituent from the R3— R6 group other than lone pair or hydrogen;
if A-E are carbon, and Y is a bond, and Z is sulfur, and X=NH, and n=0, then Ar cannot be unsubstituted phenyl, unsubstituted or substituted pyridyl or unsubstituted or substituted pyrimidyl.
[0088] For the compounds of formula (XIII), the following additional provisos may apply: if A-E are carbon, Y and Z cannot be both carbon-or one ethylidene and the other a bond, unless at least one of R3— R6 is not hydrogen;
if A-E are carbon one of Y and Z cannot be nitrogen, substituted with hydrogen, and the other a bond.
[0089] An exemplary compound of formula (XIII) has the following structure:
Figure imgf000039_0001
{infra Table 1, C6).
[0090] In yet another embodiment, the compound or active agent is a cinnamoyl compound having a structure of formula (XIV), shown below, which is described in U.S. Patent Application Publication No. US 2009/0143368 to Shiraki et al., which is hereby incorporated by reference in its entirety:
Figure imgf000039_0002
(XIV),
wherein,
I. a represents a benzene ring or a pyridine ring; in (Υα)¾, Υα is a substituent on a carbon atom and represents a group included in the following X0 group or the Yo group, q represents 0, 1, 2, 3, 4 or 5, and when q is not less than 2, Yas are the same or different, and when q is not less than 2, adjacent two same or different Yas may together form a group included in the Zo group to be fused to the a ring; and in (Xa)p, Xa is a substituent on a carbon atom and represents a group which does not belong to the following X0 group, Yo group and Zo group, p represents 0, 1, 2, 3, 4 or 5, and when p is not less than 2, Xas are the same or different and the sum of p and q is not more than 5;
(1) the Xo group: a Ma-group, wherein Ma represents a Rb— group (wherein Rb represents a CI - CIO alkyl group optionally substituted with a halogen atom), a halogen atom, a nitro group, a cyano group, a hydroxyl group, a Rc— Ba— R^— group (wherein Rc represents a CI -CIO alkyl group optionally substituted with a halogen atom, Ba represents an oxy group, a thio group, a sulfmyl group or a sulfonyl group, and R^ represents a single bond or a CI -CIO alkylene group), an HOR^— group (wherein R^ is as defined above), a Re— CO— R^— group (wherein Re represents a hydrogen atom, or a CI -CIO alkyl group optionally substituted with a halogen atom, and R^ is as defined above), a Re— CO— O— R^— group (wherein Re and R^ are as defined above), a ReO— CO— R^— group (wherein Re and R^ are as defined above), an HO— CO— CH=CH— group, a ReRe'N— R^— group (wherein Re and Re' are the same or different, Re is as defined above, Re' has the same meaning as Re has, and Rrf is as defined above), a Re— CO— NRe'— R^— group (wherein Re, Re' and R^ are as defined above), a RbO— CO— N(Re)— R^— group (wherein Rb, Rg and R^ are as defined above), a ReRe'N— CO— R^— group (wherein Re, Re' and R^ are as defined above), a ReRe'N— CO— NRe"— Rrf— group (wherein Re, Re' and Re" are the same or different, Re, and Re' are as defined above, Re" has the same meaning as Re has, and R^ is as defined above), a ReRe'N— C(=NRe")— NRe'"— Regroup (wherein Re, Re', Re" and Re'" are the same or different, Rg, Re', and Re" are as defined above, Re'" has the same meaning as Re has, and R^ is as defined above), a R¾— S02— NRe— R^— group (wherein R¾, Re and R^ are as defined above), a ReRe'N— S02— R^— group (wherein Re, Re" and R^ are as defined above), a C2- C10 alkenyl group or a C2-C10 alkynyl group;
(2) the Yo group: a M¾0-Rd— group, wherein Mbo represents a Mc0- group
[wherein Mc0 represents a Mdo-RJ— group [wherein Mdo represents a 6 to 10-membered aryl group optionally substituted with a Ma— group (wherein Ma is as defined above), a 5 to 10- membered heteroaryl group optionally substituted with a Ma— group (wherein Ma is as defined above), a 3 to 10-membered cyclic hydrocarbon or heterocyclic group optionally substituted with a Ma- group (wherein Ma is as defined above) and optionally containing an unsaturated bond, a (bo)- group represented by
Figure imgf000040_0001
(wherein Go forms an optionally substituted, saturated or unsaturated, nonaromatic 5 to 14- membered hydrocarbon ring or heterocyclic ring), a (c0)- group represented by
Figure imgf000041_0001
(wherein, J0 forms a 5 to 7-membered aromatic ring optionally containing a nitrogen atom), a (do)- group represented by
Figure imgf000041_0002
(do)
[wherein do forms a 5 to 12-membered hydrocarbon ring which is substituted with a carbonyl group or a thiocarbonyl group and further which may be optionally substituted with an oxy group, a thio group, a— NRi— group {wherein Ri represents a hydrogen atom, or a CI -CIO alkyl group, or a C2-C10 alkyl group substituted with a halogen atom or a R2— Bi— group (wherein R2 represents a CI -CIO alkyl group, a C3-C10 alkenyl group or a C3-C10 alkynyl group, and Bi represents an oxy group, a thio group, a sulfmyl group or a sulfonyl group), a
C3-C10 alkenyl group, or a C3-C10 alkynyl group), a sulfmyl group, or a sulfonyl group], or a (e0)- group represented by
Figure imgf000041_0003
(eo)
{wherein eo forms a 5 to 12-membered hydrocarbon ring optionally substituted with a carbonyl group, a thiocarbonyl group, an oxy group, a thio group, a— NRi— group (wherein Ri is as defined above), a sulfmyl group or a sulfonyl group); and ~RJ is the same as or different from Rrf and has the same meaning as R^ has], a Mc0-Ba group (wherein Mc0 and Ba are as defined above), a Mc0-CO— group (wherein Mc0 is as defined above), a Mco-CO— O— group (wherein Meo is as defined above), a McoO— CO— group (wherein Mco is as defined above), a McoReN— group (wherein Mco and Re are as defined above), a Mc0-CO— NRe— group (wherein Mc0 and Re are as defined above), a McoO— CO— NRe group (wherein Mc0 and Re are as defined above), a Mc0ReN— CO— group (wherein Mco and Re are as defined above), a McoReN— CO— NRe'— group (wherein Mco, Re and Re' are as defined above), a McooReN— C(=NRe')— NRe"— group (wherein Mco, Re, Re' and Re" are as defined above), a Mc0-SO2— NRe— group (wherein Mc0 and Re are as defined above) or a Mc0ReN— S02— group (wherein Mc0 and Re are as defined above), and Rrf is as defined above;
(3) the Zo group: a 5- to 12-membered hydrocarbon ring or heterocyclic ring which may be
substituted with a halogen atom, a CI -CIO alkoxy group, C3-C 10 alkenyloxy group, a C3- C10 alkynyloxy group, a carbonyl group, a thiocarbonyl group, an oxy group, a thio group, a sulfinyl group or a sulfonyl group, and which is aromatic or non-aromatic and monocyclic or fused ring and is fused to the a ring; and
II. β represents
a group represented by formula (1-1):
Figure imgf000042_0001
wherein,
(1) Qa represents an optionally substituted hydroxyl group, or an optionally substituted amino group,
(2) Wa represents an oxygen atom or a— NT„— group (wherein Ία represents a hydrogen atom, or a substituent on the nitrogen atom),
(3) a and La form a— Va=Va'Va"'=Va"'— group (wherein Va, Va', Va" and Va"' are the same or different, and represent an optionally substituted methine group or a— N=group, and at least one of Va, Va', Va" and Va"' represents a— N=group);
a group represented by formula (1-2):
Figure imgf000042_0002
(1-2) wherein Ύα is as defined above, and Lp represents a hydroxyl group or a methyl group;
a group represented by formula (1-3):
Figure imgf000043_0001
wherein Ία is as defined above, and Ly represents a C I -C IO alkyl group;
a group represented by formula (1-4):
Figure imgf000043_0002
(1-4)
wherein Ύα is as defined above;
a group represented by formula (1-5):
Figure imgf000043_0003
wherein Ία is as defined above, and Kp represents a cyano group or a UOCO— group (wherein
U represents a hydrogen atom or a CI -CIO alkyl group);
a group represented by formula (1-6):
Figure imgf000043_0004
wherein Wa is as defined above, and Ky and Lg form an optionally substituted C3-C 10 alkylene group or an optionally substituted C4-C 10 alkenylene group;
a group represented by formula (1-7):
Figure imgf000043_0005
wherein Ία is as defined above, and Ο represents an optionally substituted hydroxyl group; or a group represented by formula (1-8):
Figure imgf000043_0006
wherein U and Wa are as defined above.
[0091] An exemplary compound according to formula (XIV) has the following structure:
Figure imgf000044_0001
(infra Table 1, Al).
[0092] In another embodiment the compound is a 4,5,6,7-tetrahydrobenzo[b]thiophene compounds having the general structure according to formula (XV), shown below, which is described in U.S. Patent Application Publication No. US2004/0171603 to Pato et al, which is hereby incorporated by reference in its entirety:
Figure imgf000044_0002
wherein
Y represents C or S;
ft1 represents R2,— NH— CO— R16,— NH2,— N=CH— R15,— N=CH— R16,— NH— CH2
— NH— CH2— R16,— NH— S02— R14,— NH— CO— NH— R14,— NH— CS— NH—
CH(CC13)— NH— CO— R16,— NH— CH(CC13)— NH— CO— R12,— NH— CS— NH-
N=CH— R 12
Figure imgf000044_0003
Figure imgf000044_0004
Figure imgf000045_0001
Figure imgf000045_0002
R2 represents— COOR12,— CONR12R12*,— CONR12R14; — C≡N,— COCOOR12,
— COCH2Cl,— COCONHNH2;
R3, R4, R5 represent independently of each other— R11,— R12,— R12*,—OR12,— SR12,
— N02,— CO— R12,—NO,— N3,— CN,— OCN,— NCO,— SCN,— NCS,—COOR12,—
COCN,— CONR12R12*,— NR12R12',— SOR12,— S02R12,— S03R12,— CH2OR12;
in one case R6 represents— R11,— R12,— R12*,—OR12,— SR12,— N02,— CO— R12,—NO,— N3,— CN,—OCN,—NCO,—SCN,—NCS,—COOR12,—COCN,— CONR12R12*,—
NR12R12',—SOR2,— S02R12,— S03R12, and R6* is hydrogen;
in the other case R6 and R6' together represent a carbonyl oxygen or a oximo residue =N— OH or
=N— 0(0)C— R12;
R7, R8, R9, R10 represent independently of each other— Rn— R12—OR12,— SR12,— N02,— CO— R12,— COOR12,— OOCR16;
R11 represents— F,— CI,— Br,— I; R12, R12* represent independently of each other— H,— CH3,— C(Rn)3,— C2H5,— C3H7,— CH(CH3)2,— CH2— CH=CH2,— CCH3=CH2,— CH=C(CH3)2,— CH=CH— CH3,—
CH=CHC2H5,— CH(CH3)C2H5,— (CH2)n— C≡C— R5 ,— C4H9,— C(CH3)3,— Ph,— CH2— R15,— C2H4OH with n being an integer from 0-2;
R13 represents— CF2CHF2,— C5Hn,— C6Hn,— C6H13,— C7H15,— C8H17,— C9H19,— C10H21, — CiiH23,— Ci2H25 ,— Ci3H27,— CH2SPh,— CH2Rn,— C2H4Rn,— C3H6Rn,— C4HsRn, — C2H4Ph,— CH=CH-COOR12,— CH2COOR12,— C2H4COOR12,— C3H6COOR12,— CH(Ph)— SPh,— C3H5,— CH2CH(Ph)2,— C4H7,— C5H9,— C(CH3)2CH2Rn,—
CH2CH(CH3)2,— CH(Rn)Ph,— CH2CH(CH3)CH2C(CH3)3,— CH(C2H5)— C4H9,—
CH(Rn)2,— CH(Ph)— C2H5,— CH2C(CH3)3,
R14 represents
Figure imgf000046_0001
R represents
Figure imgf000046_0002
12
Rlb is R
Figure imgf000046_0003
Figure imgf000047_0001
-47-
Figure imgf000048_0001
-CH20— R14,— CH=CH— R14,— CH2CH(R14)— CO— R12,— C2H40— R14,— C3H60— R14, — C2H4S— CO— R12,— CH2S— CO— R12;— COOR12,
Figure imgf000049_0001
Figure imgf000049_0002
nitrobenzyl, particularly p-nitrobenzyl;
R17 represents— H,— CO— R12,— CO— R13,— CO— R14,— CO— NH— R12,— CO— NH— R — CO— NH— R14,— S02— R14,— CO— NH— CH2— COO— R12,— CO— CH2— O— R14, - CO— CH=CH— R14,
Figure imgf000049_0003
or R 1 and R 2 together represent a heterocyclic ring system having the following formula
Figure imgf000050_0001
Figure imgf000051_0001
represents R3, R14,— SCH2— R3,— SCH2— CO— R14— SCH2— CO— NH— R14 ,— SCH2 CO— NH— CH2— R12,— NH— CO— CH2— OR14,— CO— NH— N=CHR12(R14),
Figure imgf000051_0002
Rzu represents R , — NH— CO— R ,— N=CH— R13;
R21 represents R15,
Figure imgf000051_0003
[0093] An exemplary compound of formula (XV) includes, without limitation, the following structure:
Figure imgf000052_0001
(infra Table 1, A2).
[0094] In another embodiment the compound or active agent is a pyrazolo-[l,5a]- pyrimidone compound having the structure according to formula (XVI), shown below, which is described in U.S. Patent No. 8,796,285 to Zhang et al, which is hereby incorporated by reference in its entirety:
Figure imgf000052_0002
wherein
R is alkyl, aryl, substituted aryl, heterocyclic compound, substituted heterocyclic compound or — COOR5;
Pvi is hydrogen, halogen, alkyl, alkyl halide, aryl or substituted aryl;
R2 is halogen, alkyl, substituted alkyl, aryl, substituted aryl, heterocyclic compound, substituted heterocyclic compound, or
O
II
CH2X— C (CH2)„— R3 or -CH2R4;
X is O or NH, n is a natural number selected from 0 to 6,
P 3 is hydrogen, halogen, aryl or substituted aryl;
P 4 is fatty acid or cyclic imine; and
R5 is an alkyl with 1-4 carbon.
[0095] Exemplary compounds of formula (XVI) include, without limitation, those selected from the group of:
Figure imgf000053_0001
{infra Table 1, A4).
[0096] In an ther embodiment the compound or active agent has a structure shown below
Figure imgf000053_0002
{infra Table 1, A5), or a derivative thereof represented by formula (XVII), shown below,
Figure imgf000053_0003
wherein R1 can be H, o-I, m-I, p-I, p-CF3, or p-OMe. These structures of formula (XVII) are described by Nagao et al, "Synthesis and Structure-Activity Relationships of Novel, Potent, Orally Active Hypoxia-Inducible Factor-1 Inhibitors," Bioorg. Med. Chem., 22:5513-5529 (2014), which is hereby incorporated by reference in its entirety. Other O-Ci to C6 hydrocarbon substituents, like those of compound A5, can be similarly synthesized in the manner described in Nagao.
[0097] In another embodiment the compound is a 1 ,4-substituted benzene compound or a pharmaceutically acceptable salt thereof having the following structure of formula XVIII, shown below, which is described in WO 2005103030 to Jiang et al, which is hereby incorporated by reference in its entirety:
Figure imgf000053_0004
(XVIII),
wherein X, Z are each independently selected from O, S or NH;
Y is selected from CO or S02;
Ri is selected from hydrogen; Ci-C6 alkyl with a straight-chain or branched, alkenyl or alkynyl group; C3-C7 cycloalkyl, cycloalkenyl or cycloalkynyl; aromatic group Ar; contains 1-3 substituents selected from oxygen, 5-7 membered heteroaryl or substituted heteroatom sulfur or nitrogen heteroaryl, wherein heteroaryl with phenyl or 5-7 membered aromatic heterocyclyl group form a fused ring aromatic group, a substituted heteroaryl group substituents independently selected from the group consisting of one or 2-5: halogen; Ci-C6 alkyl with straight or branched, alkenyl or alkynyl; cyano; nitro; amino; hydroxy; hydroxy groups; trifluoromethyl; trifluoromethoxy; carboxy; C1-C4 alkoxy; mercapto; C1-C4 acyl; aryl Ar;
R2 is selected from the followin structural groups (II, III, IV or V):
Figure imgf000054_0001
I I II I IV V
where, n is 0, 1, 2 or 3;
R3, R4 are each independently selected from hydrogen; Ci-C6 linear or branched alkyl, alkenyl or alkynyl group; a nitro group; a halogen; cyano; trifluoromethyl; trifluoromethoxy;
R5, R5 each independently selected from hydrogen; methyl; ethyl; cyclohexyl; aromatic group Ar containing 1 to 3 heteroatoms, 5-7 membered heteroaryl, or a substituted sulfur or nitrogen heteroatoms heteroaryl group, wherein heteroaryl with phenyl or 5-7 membered heterocyclic aromatic group form a fused ring aryl, substituted heteroaryl the substituents are
independently selected from the group consisting of one or 2-5: halogen; Ci-C6 alkyl, alkenyl or alkynyl group linear or branched; cyano; nitro; amino; hydroxy group; trifluoromethyl; trifluoromethoxy; carboxy; C1-C4 alkoxy group; mercapto; aromatic group Ar;
The aromatic group Ar denotes phenyl, naphthyl, biphenyl or a substituted phenyl group,
substituted phenyl wherein the substituents are independently selected from the group 1-4: halo; Ci-C6 straight-chain or branched-chain alkyl, alkenyl or alkynyl group; cyano; nitro; amino; hydroxy group; trifluoromethyl; trifluoromethoxy; carboxy; C1-C4 alkoxy; mercapto.
[0098] One exem lary compound of formula (XVIII) has the following structure:
Figure imgf000054_0002
{infra Table 1, B2).
[0099] In another embodiment the compound has the structure
CH3
{infra Table 1, B3) or a derivative thereof. For example a compound having the following structure as described by U.S. Patent No. 5,041,604 to Saito et al., which is hereby incorporated by reference in its entirety:
Figure imgf000055_0001
wherein
A is a lower alkylene group, and
P i to P 5 each are the same or different from one another; each represent hydrogen atom, a halogen atom, a lower alkyl group, a lower alkoxy group, a carboxylic acid salt group, an acyl group, cyano group, a cycloalkyl group, an aryl group or nitro group; and may form a ring in conjunction of two adjacent groups. N-alkylbenzamido ring members can be introduced instead of the other substituted phenyl rings.
[0100] In another embodiment the compound has the structure
Figure imgf000055_0002
1, B4) or a derivative thereof having the structure of formula (XX), shown below, which is described in U.S. Patent No. 3,907,700 to Grier, which is hereb incorporated by reference in its entirety:
Figure imgf000055_0003
wherein Ri represents an aromatic radical having 1-3 nuclei, including a carbocyclic aryl radical such as phenyl, biphenyl, naphthyl, anthryl, phenanthryl, and the like, and a heterocyclic aryl radical such as furan, thiophene, pyridine, pyridazine, pyrimidine, pyrazine, quinoline, isoquinoline, acridine, phenanthridine, phenazine, phenoxazine, phenthiazine, coumarone, benzothiophene, indole, pyrazole, imidazole, thiazole, oxazole, triazole, carbazole and the like. Specifically excluded from the invention are aliphatic acid amides of 2- aminobenzirnidazole (where Ri is alkyl ). In addition R, may be attached to the carbonyl through a vinyl group— (CH=CH2); and R2 represents hydrogen, alkanoyl, alkenyl, benzoyl, halobenzoyl, alkoxybenzoyl, alkoxycarbonyl, benzoyl, alkyl, phenyl, or aralkyl.
[0101] Variants of formula XX can be prepared according to Grier where Ri is a substituted phenyl containing, e.g., a halogen substituent.
[0102] In another embodiment the compound of formula (XX) has the following structure, as described in U.S. Patent No. 7,132,438 to Frenkel et al, which is hereby incorporated by reference in its entirety:
Figure imgf000056_0001
wherein
R1 is selected from the group consisting of H, (Ci-Cs) alkyl, hetero(Ci-Cs)alkyl, fluoro(Ci- C4)alkyl, cycloalkyl(Ci-C8)alkyl, heterocyclo(Ci-Cs)alkyl, aryl, aryl(Ci-Cs)alkyl, cyclo(C3-C8)alkyl-(Ci-Cs)alkyl, cyclo(C3-C8)alkylhetero(Ci-C8)alkyl, heterocyclo(Ci- Cs)alkyl, arylhetero(Ci-Cs)alkyl and heteroaryl;
R is (Ci-Cs)alkyl, hetero(Ci-Cs)alkyl, perfluoro (Ci-C4)alkyl, aryl or heteroaryl;
Y is C(0), S(0)m, S(0)2NR* C(0)NR*, CR3R4, C(NR*), C(=CR3R4), CR3(OR) or CR3(NR*R"), wherein the subscript m is an integer from 1 to 2;
Z1 and Z2 are independently H, halogen, CN, C02R, CONR'R", (Ci-C4)alkyl, (Ci- C4)heteroalkyl, perfluoro(Ci-C4)alkyl, aryl, heteroaryl, NR'R" or OR";
1 2
alternatively, Z and Z may be combined to form an additional fused 5-, 6-, 7- or 8-membered cycloalkane, heterocycloalkane, aromatic or heteroaromatic ring;
R3 and R4 are independently selected from the group consisting of H, CN, C02R, CONR'R", (Ci-C4)alkyl, (Ci-C4)heteroalkyl, aryl, heteroaryl, NR'R" and OR*;
R and R" are independently H, (Ci-C4)alkyl, hetero(Ci-C4)alkyl, aryl or aryl(Ci-C4)alkyl; alternatively, when R' and R" are attached to nitrogen, R' and R" may be combined with the nitrogen atom to form a 5-, 6- or 7-membered ring; and
alternatively, when Y is CR3R4, C(NR), C(=CR3R4), CR3(OR) or CR3(NR*R"), R3, R4 or R may be combined with R to form a 5-, 6-, 7- or 8-membered ring containing from 0 to 3 heteroatoms selected from the group consisting of O, N, Si and S; with the proviso that R1
1 2
is not 3-(dialkylamino)propyl when Y is C(O) and Z and Z are combined to form an additional fused benzene ring. [0103] In another embodiment the compound has the formula
Figure imgf000057_0001
Ta le 1 , B5) or a derivative thereof having the structure according to formula (XXI), shown below, which is described in JP Patent Publ. No. H 02145588 to Miura Akaio et al., which is hereby incorporated by reference in its entirety:
Figure imgf000057_0002
wherein
Pvi represents H or monovalent organic group;
Y represents— O— ,— S— ,—SO—,— S02— ,— (R3)— ;
R2 and R3 represent H or monovalent organic group.
Compounds of formula (XXI) can be easily prepared using the method described in by Miura Akaio et al.
[0104] In another embodiment, derivatives of compound B5 have the structure of formula (XXII), shown below, which is described in Karthikeyan et al, "Synthesis and antimicrobial studies of novel dichlorophenyl containing aminotriazolothiadiazines," Eur. J. Med. Chem. 43:309-314 (2008 which is hereby incorporated by reference in its entirety
Figure imgf000057_0003
wherein R is selected from the group consisting of 4-CH3; 4-Cl; 4-OCH3; 4-OC2H5; 4-F, 2,3-Cl2; 2,4-Cl2; 2,6-Cl2; 2,3-(CH3)2; 2,4-(CH3)2; 2,6-(CH3)2; 3-C1-4-F; 2,4,6-(CH3)3; and 2,4,5-Cl3; 2- CF3.
[0105] In another embodiment the compound or active agent has the structure according to formula (XXIII), shown below, which is described in EP 0289879 to Okada et al, which is hereby incorporated by reference in its entirety):
Figure imgf000058_0001
(XXIII),
wherein
R1 represents hydrogen atom, C1-C4 alkyl group, C1-C4 haloalkyl group, phenyl group or benzyl group;
one of R2 and R3 represents— C(0)-R4 or— C(S)-R4;
wherein R4 re resents
Figure imgf000058_0002
wherein R5, R6 and R7 represent respectively hydrogen atom, C1-C4 alkyl group or phenyl group;
8 9
R and R represent respectively hydrogen atom, halogen atom, Ci-Cs alkyl group, C3-C5 alkenyl group, C3-C5 alkynyl group, C3-C6 cycloalkyl group, C2-C4 alkoxyalkyl group, C1-C4 alkoxy group, C1-C4 haloalkoxy group, nitro group, trifluoromethyl group, phenyl group, benzyl group, phenoxy group, benzyloxy group, amino group, C1-C4 alkylamino group, C2-Cs dialkylamino group, cyano group, carboxyl group, C2-C5 alkoxycarbonyl group, C4-C7 cycloalkoxycarbonyl group, C3-C9 alkoxyalkoxycarbonyl group, C2-C6 alkylaminocarbonyl group, C3-C11 dialkylaminocarbonyl group, piperidinocarbonyl group, morpholinocarbonyl group, trimethylsilyl group, C1-C4 alkylthio group, C1-C4 alkylsulfinyl group, or C1-C4 alkylsulfonyl group;
providing that if all of R6, R7, R8 and R9 represent hydrogen atoms, R1 represents C1-C4 alkyl group, C1-C4 haloalkyl group, phenyl group or benzyl group;
2 3
the other of R and R represents hydrogen atom, C1-C4 alkyl group, C1-C4 haloalkyl group, C3-
C6 cycloalkyl group or phenyl group;
X represents hydrogen atom, halogen atom, C1-C4 alkyl group, nitro group, cyano group, C1-C5 alkylamino group, C2-Cio dialkylamino group and C2-C7 acylamino group. [0106] One exemplary compound of formula (XXIII) has the structure of:
Figure imgf000059_0001
(infra Table 1, CI).
[0107] In another embodiment the compound or active agent has a structure according to formula (XXIV), shown below, which is described in U.S. Patent No. 8,609,663 to Finberg et al, which is hereby incorporated b reference in its entirety:
Figure imgf000059_0002
or a pharmaceutically acceptable salt thereof;
wherein:
Ar" is C6-io aryl or Ci_ heteroaryl, each of which is optionally substituted by 1, 2, 3, or 4 independently selected Rl groups;
each R9 is independently selected from halogen, cyano, nitro, carboxy, hydroxyl, Ci_6
alkylcarbonyl, Ci_6 alkoxycarbonyl, Ci_6 alkyl, C2-6 alkenyl, C2_6 alkynyl, Ci_6 haloalkyl, Ci_6 alkoxy, and Ci_6 haloalkoxy;
each Rl is independently selected from halogen, cyano, nitro, carboxy, hydroxyl, Ci_6
alkylcarbonyl, Ci_6 alkoxycarbonyl, amino, Ci_6 alkylamino, di-Ci_6 alkylamino, Ci_6
alkylsulfonyl, Ci_6 alkyl, C2_6 alkenyl, C2_6 alkynyl, Ci_6 haloalkyl, Ci_6 alkoxy, and Ci_6 haloalkoxy; and
r is an integer selected from 0, 1, 2, 3, 4, 5, and 6.
[0108] For compounds in which a variable appears more than once, each variable can be a different moiety independently selected from the group defining the variable. For example, where a structure is described having two R groups that are simultaneously present on the same compound, the two R groups can represent different moieties independently selected from the group defined for R. In another example, when an optionally multiple substituent is designated in the form:
Figure imgf000059_0003
then it is understood that substituent R can occur p number of times on the ring, and R can be a different moiety at each occurrence. It is understood that each R group may replace both of the (CH2)n hydrogen atoms. Further, in the above example, should the variable Q be defined to include hydrogens, such as when Q is the to be CH2, NH, etc., any floating substituent such as R in the above example, can replace a hydrogen of the Q variable as well as a hydrogen in any other non-variable component of the ring. Unless otherwise indicated, should floating substituent R appear on a fused ring system, the substituent may replace a hydrogen atom at any ring atom in the fused ring system.
[0109] One exemplary compound of formula (XXIV) has the following structure:
Figure imgf000060_0001
{infra Table 1).
[0110] As used above, and throughout the description herein, the following terms, unless otherwise indicated, shall be understood to have the following meanings. If not defined otherwise herein, all technical and scientific terms used herein have the same meaning as is commonly understood by one of ordinary skill in the art to which this technology belongs. In the event that there is a plurality of definitions for a term herein, those in this section prevail unless stated otherwise.
[0111] Specific definitions for the substituents mentioned in the compounds formulae (I) to (XXIV) can be the same definitions described in the references cited above for each of formulae (I) to (XXIV). However, commonly understand definitions include those presented below.
[0112] The term "alkyl" means an aliphatic hydrocarbon group which may be straight or branched. When not otherwise restricted, the term refers to an alkyl of 20 or fewer carbons. Lower alkyl refers to alkyl groups having about 1 to about 6 carbon atoms in the chain.
Branched means that one or more lower alkyl groups such as methyl, ethyl or propyl are attached to a linear alkyl chain. Exemplary alkyl groups include methyl, ethyl, n-propyl, i-propyl, n- butyl, t-butyl, n-pentyl, 3-pentyl, and the like.
[0113] The term "alkenyl" means an aliphatic hydrocarbon group containing a carbon— carbon double bond and which may be straight or branched having about 2 to about 6 carbon atoms in the chain. Particular alkenyl groups have 2 to about 4 carbon atoms in the chain.
Branched means that one or more lower alkyl groups such as methyl, ethyl, or propyl are attached to a linear alkenyl chain. Exemplary alkenyl groups include ethenyl, propenyl, n- butenyl, and i-butenyl. The term "alkenyl" may also refer to a hydrocarbon chain having 2 to 6 carbons containing at least one double bond and at least one triple bond. [0114] The term "alkynyl" means an aliphatic hydrocarbon group containing a carbon— carbon triple bond and which may be straight or branched having about 2 to about 6 carbon atoms in the chain. Particular alkynyl groups have 2 to about 4 carbon atoms in the chain.
Branched means that one or more lower alkyl groups such as methyl, ethyl, or propyl are attached to a linear alkynyl chain. Exemplary alkynyl groups include ethynyl, propynyl, n- butynyl, 2-butynyl, 3-methylbutynyl, and n-pentynyl.
[0115] The term "cycloalkyl" means a non-aromatic, saturated or unsaturated, mono- or multi-cyclic ring system of about 3 to about 7 carbon atoms, or of about 5 to about 7 carbon atoms, and which may include at least one double bond. Exemplary cycloalkyl groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclopropenyl, cyclobutenyl, cyclopentenyl, cyclophenyl, anti-bicyclopropane, and syn-tricyclopropane.
[0116] The term "cycloalkylalkyl" means a cycloalkyl-alkyl-group in which the cycloalkyl and alkyl are as defined herein. Exemplary cycloalkylalkyl groups include cyclopropylmethyl and cyclop entylmethyl. The alkyl radical and the cycloalkyl radical may be optionally substituted as defined herein.
[0117] As used herein, "heterocyclyl" or "heterocycle" refers to a stable 3- to 18- membered ring (radical) which consists of carbon atoms and from one to five heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. For purposes of this application, the heterocycle may be a monocyclic, or a polycyclic ring system, which may include fused, bridged, or spiro ring systems; and the nitrogen, carbon, or sulfur atoms in the heterocycle may be optionally oxidized; the nitrogen atom may be optionally quaternized; and the ring may be partially or fully saturated. Examples of such heterocycles include, without limitation, azepinyl, azocanyl, pyranyl dioxanyl, dithianyl, 1,3-dioxolanyl, tetrahydrofuryl, dihydropyrrolidinyl, decahydroisoquinolyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, 2-oxopiperazinyl, 2-oxopiperidinyl, 2- oxopyrrolidinyl, 2-oxoazepinyl, oxazolidinyl, oxiranyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, thiazolidinyl, tetrahydropyranyl, thiamorpholinyl, thiamorpholinyl sulfoxide, and thiamorpholinyl sulfone. Further heterocycles and heteroaryls are described in Katritzky et al, eds., Comprehensive Heterocyclic Chemistry: The Structure, Reactions, Synthesis and Use of Heterocyclic Compounds, Vol. 1-8, Pergamon Press, N.Y. (1984), which is hereby incorporated by reference in its entirety.
[0118] The term "monocyclic" used herein indicates a molecular structure having one ring. [0119] The term "polycyclic" or "multi-cyclic" used herein indicates a molecular structure having two or more rings, including, but not limited to, fused, bridged, or spiro rings.
[0120] The term "aryl" means an aromatic monocyclic or multi-cyclic (polycyclic) ring system of 6 to about 19 carbon atoms, or of 6 to about 10 carbon atoms, and includes arylalkyl groups. The ring system of the aryl group may be optionally substituted. Representative aryl groups include, but are not limited to, groups such as phenyl, naphthyl, azulenyl, phenanthrenyl, anthracenyl, fluorenyl, pyrenyl, triphenylenyl, chrysenyl, and naphthacenyl.
[0121] The term "heteroaryl" means an aromatic monocyclic or multi-cyclic ring system of about 5 to about 19 ring atoms, or about 5 to about 10 ring atoms, in which one or more of the atoms in the ring system is/are element(s) other than carbon, for example, nitrogen, oxygen, or sulfur. In the case of multi-cyclic ring system, only one of the rings needs to be aromatic for the ring system to be defined as "heteroaryl". Particular heteroaryls contain about 5 to 6 ring atoms. The prefix aza, oxa, thia, or thio before heteroaryl means that at least a nitrogen, oxygen, or sulfur atom, respectively, is present as a ring atom. A nitrogen, carbon, or sulfur atom in the heteroaryl ring may be optionally oxidized; the nitrogen may optionally be quaternized.
Representative heteroaryls include pyridyl, 2-oxo-pyridinyl, pyrimidinyl, pyridazinyl, pyrazinyl, triazinyl, furanyl, pyrrolyl, thiophenyl, pyrazolyl, imidazolyl, oxazolyl, isoxazolyl, thiazolyl, isothiazolyl, triazolyl, oxadiazolyl, thiadiazolyl, tetrazolyl, indolyl, isoindolyl, benzofuranyl, benzothiophenyl, indolinyl, 2-oxoindolinyl, dihydrobenzofuranyl, dihydrobenzothiophenyl, indazolyl, benzimidazolyl, benzooxazolyl, benzothiazolyl, benzoisoxazolyl, benzoisothiazolyl, benzotriazolyl, benzo[l,3]dioxolyl, quinolinyl, isoquinolinyl, quinazolinyl, cinnolinyl, pthalazinyl, quinoxalinyl, 2,3-dihydro-benzo[l,4]dioxinyl, benzo[l,2,3]triazinyl,
benzo[l,2,4]triazinyl, 4H-chromenyl, indolizinyl, quinolizinyl, 6aH-thieno[2,3-d]imidazolyl, lH-pyrrolo[2,3-£]pyridinyl, imidazo[ 1 ,2-a]pyridinyl, pyrazolo[ 1 ,5-a]pyridinyl,
[l,2,4]triazolo[4,3-a]pyridinyl, [l,2,4]triazolo[l,5-a]pyridinyl, thieno[2,3-£]furanyl, thieno[2,3- £]pyridinyl, thieno[3,2-£]pyridinyl, furo[2,3-£]pyridinyl, furo[3,2-£]pyridinyl, thieno[3,2- djpyrimidinyl, furo[3,2- ]pyrimidinyl, thieno[2,3-£]pyrazinyl, imidazo[l,2-a]pyrazinyl, 5,6,7,8- tetrahydroimidazo[l,2-a]pyrazinyl, 6,7-dihydro-4H-pyrazolo[5,l-c][l,4]oxazinyl, 2-oxo-2,3- dihydrobenzo[<i]oxazolyl, 3,3-dimethyl-2-oxoindolinyl, 2-oxo-2,3-dihydro-lH-pyrrolo[2,3- £]pyridinyl, benzo[c][l,2,5]oxadiazolyl, benzo[c][l,2,5]thiadiazolyl, 3,4-dihydro-2H- benzo[£][l,4]oxazinyl, 5,6,7,8-tetrahydro-[l,2,4]triazolo[4,3-a]pyrazinyl, [l,2,4]triazolo[4,3- a]pyrazinyl, 3-oxo-[l,2,4]triazolo[4,3-a]pyridin-2(3H)-yl, and the like.
[0122] The terms "arylalkyl" and "hetero arylalkyl" mean an alkyl substituted with one or more aryl or heteroaryl groups, wherein the alkyl, aryl, and heteroaryl groups are as herein described. One particular example is an arylmethyl or heteroarylmethyl group, in which a single carbon spacer unit is attached to an aryl or heteroaryl group, where the carbon spacer and the aryl or heteroaryl group can be optionally substituted as described herein.
[0123] As used herein, the term "acyl" means a moiety of formula R-carbonyl, where R is an alkyl, cycloalkyl, aryl, or heteroaryl as defined above. Exemplary acyl groups include formyl, acetyl, propanoyl, benzoyl, and propenoyl.
[0124] The term "carbonyl" means a carbonyl group,— C(O)— .
[0125] The term "thiocarbonyl" means a thiocarbonyl group,— C(S)— .
[0126] The term "sulfoxide" means a sulfoxide group,— S(O)— .
[0127] The term "sulfone" means a sulfone group,— S(0)2— .
[0128] The term "alkoxy" means groups of from 1 to 8 carbon atoms of a straight, branched, or cyclic configuration and combinations thereof attached to the parent structure through an oxygen. Examples include methoxy, ethoxy, propoxy, isopropoxy, cyclopropyloxy, cyclohexyloxy, and the like. Lower-alkoxy refers to groups containing one to four carbons. For the purposes of the present patent application, alkoxy also includes methyl enedioxy and ethylenedioxy in which each oxygen atom is bonded to the atom, chain, or ring from which the methylenedioxy or ethylenedioxy group is pendant as to form a ring. Thus, for example,
phenyl substituted by alkoxy may be, for example,
Figure imgf000063_0001
[0129] The term "halogen" means fluoro, chloro, bromo, or iodo.
[0130] The term "phenyl" means a phenyl group as shown below
Figure imgf000063_0002
[0131] The term "benzyl" means a benzyl group as shown below
Figure imgf000063_0003
[0132] The term "naphthyl" means a naphthyl group as shown below
Figure imgf000063_0004
[0133] The term "haloalkyl" means both branched and straight-chain alkyl substituted with one or more halogen, wherein the alkyl group is as herein described. [0134] The term "alkoxyalkyl" means both branched and straight-chain alkyl substituted with one or more alkoxy groups, wherein the alkyl group is as herein described.
[0135] The term "optionally substituted" is used to indicate that a group may have a substituent at each substitutable atom of the group (including more than one substituent on a single atom), provided that the designated atom's normal valency is not exceeded and the identity of each substituent is independent of the others. Up to three H atoms in each residue are replaced with alkyl, halogen, haloalkyl, hydroxy, loweralkoxy, carboxy, carboalkoxy (also referred to as alkoxycarbonyl), carboxamido (also referred to as alkylaminocarbonyl), cyano, carbonyl, nitro, amino, alkylamino, dialkylamino, mercapto, alkylthio, sulfoxide, sulfone, acylamino, amidino, phenyl, benzyl, heteroaryl, phenoxy, benzyloxy, or heteroaryloxy.
"Unsubstituted" atoms bear all of the hydrogen atoms dictated by their valency. When a substituent is keto (i.e., =0), then two hydrogens on the atom are replaced. Combinations of substituents and/or variables are permissible only if such combinations result in stable compounds; by "stable compound" or "stable structure" is meant a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
[0136] The terms "compound," "product compound," "active agents" and equivalent expressions are meant to embrace the polyether antibiotics disclosed herein, compounds of formulae (I)-(XXIV) as described herein, as well as any other compounds identified herein (e.g., those compounds identified in the Examples or Table 1). Also contemplated are the prodrugs, the pharmaceutically acceptable salts, the oxides, the solvates, e.g. hydrates, and inclusion complexes of that compound, where the context so permits, as well as any stereoisomeric form, or a mixture of any such forms of that compound in any ratio. Inclusion complexes are described in Remington, The Science and Practice of Pharmacy, 19th Ed. 1 : 176-177 (1995), which is hereby incorporated by reference in its entirety. The most commonly employed inclusion complexes are those with cyclodextrins, and all cyclodextrin complexes, natural and synthetic, are specifically encompassed within the claims. In accordance with some embodiments, a compound as described herein, including in the contexts of pharmaceutical compositions, methods of treatment, and compounds per se, is provided as the salt form. Similarly, reference to intermediates, whether or not they themselves are claimed, is meant to embrace their salts, and solvates, where the context so permits. For the sake of clarity, particular instances when the context so permits are sometimes indicated in the text, but these instances are purely illustrative and it is not intended to exclude other instances when the context so permits. [0137] The term "pharmaceutical composition" means a composition comprising at least one compound disclosed herein, as well as combinations thereof, and at least one component comprising pharmaceutically acceptable carriers, diluents, adjuvants, excipients, or vehicles, such as preserving agents, fillers, disintegrating agents, wetting agents, emulsifying agents, suspending agents, sweetening agents, flavoring agents, perfuming agents, antibacterial agents, antifungal agents, lubricating agents and dispensing agents, depending on the nature of the mode of administration and dosage forms. As used herein, the term "pharmaceutically acceptable carrier" is used to mean any carrier, diluent, adjuvant, excipient, or vehicle, as described herein. Examples of suspending agents include ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar— agar and tragacanth, or mixtures of these substances. Prevention of the action of microorganisms can be ensured by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, sorbic acid, and the like. It may also be desirable to include isotonic agents, for example sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the use of agents delaying absorption, for example, aluminum monosterate and gelatin. Examples of suitable carriers, diluents, solvents, or vehicles include water, ethanol, polyols, suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate. Examples of excipients include lactose, milk sugar, sodium citrate, calcium carbonate, and dicalcium phosphate. Examples of disintegrating agents include starch, alginic acids, and certain complex silicates. Examples of lubricants include magnesium stearate, sodium lauryl sulphate, talc, as well as high molecular weight polyethylene glycols.
[0138] The term "pharmaceutically acceptable" means it is, within the scope of sound medical judgment, suitable for use in contact with the cells of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit/risk ratio.
[0139] The term "pharmaceutically acceptable dosage forms" means dosage forms of the compounds described herein, and includes, for example, tablets, dragees, powders, elixirs, syrups, liquid preparations, including suspensions, sprays, inhalants tablets, lozenges, emulsions, solutions, granules, capsules, and suppositories, as well as liquid preparations for injections, including liposome preparations. Techniques and formulations generally may be found in Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa., latest edition, which is hereby incorporated by reference in its entirety. [0140] The term "pharmaceutically acceptable salt" refers to salts prepared from pharmaceutically acceptable non-toxic acids or bases including inorganic acids and bases and organic acids and bases. Suitable pharmaceutically acceptable acid addition salts for the compounds described herein include acetic, benzenesulfonic (besylate), benzoic,
camphorsulfonic, citric, ethenesulfonic, fumaric, gluconic, glutamic, hydrobromic, hydrochloric, isethionic, lactic, maleic, malic, mandelic, methanesulfonic, mucic, nitric, pamoic, pantothenic, phosphoric, succinic, sulfuric, tartaric acid, p-toluenesulfonic, and the like. When the compounds contain an acidic side chain, suitable pharmaceutically acceptable base addition salts for the compounds described herein include metallic salts made from aluminum, calcium, lithium, magnesium, potassium, sodium and zinc or organic salts made from lysine, Ν,Ν'- dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine), and procaine. Pharmaceutically acceptable salts include, but are not limited to, amine salts, such as but not limited to N, N'dibenzylethylenediamine, chloroprocaine, choline, ammonia, diethanolamine and other hydroxyalkylamines, ethylenediamine, N- methyl glucamine, procaine, N-benzylphenethylamine, l-para-chlorobenzyl-2-pyrrolidin-l'- ylmethyl- benzimidazole, diethylamine and other alkylamines, piperazine, and tris
(hydroxymethyl) aminomethane; alkali metal salts, such as but not limited to lithium, potassium, and sodium; alkali earth metal salts, such as but not limited to barium, calcium, and magnesium; transition metal salts, such as but not limited to zinc; and other metal salts, such as but not limited to sodium hydrogen phosphate and disodium phosphate ; and also including, but not limited to, salts of mineral acids, such as but not limited to hydrochlorides and sulfates ; and salts of organic acids, such as but not limited to acetates, lactates, malates, tartrates, citrates, ascorbates, succinates, butyrates, valerates and fumarates. Pharmaceutically acceptable esters include, but are not limited to, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl and heterocyclyl esters of acidic groups, including, but not limited to, carboxylic acids, phosphoric acids, phosphinic acids, sulfonic acids, sulfinic acids, and boronic acids. Pharmaceutical acceptable enol ethers include, but are not limited to, derivatives of formula C=C (OR) where R is hydrogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, or heterocyclyl.
Pharmaceutically acceptable enol esters include, but are not limited to, derivatives of formula C=C (OC (O) R) where R is hydrogen, alkyl, alkenyl, alkynyl, aryl, heteroaryl, cycloalkyl, or heterocyclyl. Pharmaceutical acceptable solvates and hydrates are complexes of a compound with one or more solvent or water molecules, or 1 to about 100, or 1 to about 10, or one to about 2,3 or 4, solvent or water molecules. [0141] The term "solvate" refers to a compound described herein in the solid state, wherein molecules of a suitable solvent are incorporated in the crystal lattice. A suitable solvent for therapeutic administration is physiologically tolerable at the dosage administered. Examples of suitable solvents for therapeutic administration are ethanol and water. When water is the solvent, the solvate is referred to as a hydrate. In general, solvates are formed by dissolving the compound in the appropriate solvent and isolating the solvate by cooling or using an antisolvent. The solvate is typically dried or azeotroped under ambient conditions.
[0142] The term "therapeutically effective amount" is meant to describe an amount of compound described herein effective in producing the desired therapeutic effect. Such amounts generally vary according to a number of factors well within the purview of ordinarily skilled artisans given the description provided herein to determine and account for. These include, without limitation: the particular subject, as well as its age, weight, height, general physical condition, and medical history, the particular compound used, as well as the carrier in which it is formulated and the route of administration selected for it; and, the nature and severity of the condition being treated.
[0143] Compounds described herein may contain one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms. Each chiral center may be defined, in terms of absolute stereochemistry, as (R)- or (S)-. This technology is meant to include all such possible isomers, as well as mixtures thereof, including racemic and optically pure forms. Optically active (R)- and (S)-, (-)- and (+)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques. When the compounds described herein contain olefmic double bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.
[0144] This technology also envisions the "quaternization" of any basic nitrogen- containing groups of the compounds disclosed herein. The basic nitrogen can be quaternized with any agents known to those of ordinary skill in the art including, for example, lower alkyl halides, such as methyl, ethyl, propyl and butyl chloride, bromides and iodides; dialkyl sulfates including dimethyl, diethyl, dibutyl and diamyl sulfates; long chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; and aralkyl halides including benzyl and phenethyl bromides. Water or oil-soluble or dispersible products may be obtained by such quaternization. [0145] In the characterization of some of the substituents, it is recited that certain substituents may combine to form rings. Unless stated otherwise, it is intended that such rings may exhibit various degrees of unsaturation (from fully saturated to fully unsaturated), may include heteroatoms and may be substituted with lower alkyl or alkoxy.
[0146] The active agents can be administered to an individual in the form of a
pharmaceutically acceptable dosage unit that includes an effective amount of the active agent and a pharmaceutically acceptable carrier. Typically, the active agent will be administered to a mammal as a pharmaceutical formulation that includes the active agent and any pharmaceutically acceptable suitable adjuvants, carriers, excipients, and/or stabilizers, and can be in solid or liquid form, such as tablets, capsules, powders, solutions, suspensions, or emulsions. The compositions preferably contain from about 0.01 to about 99 weight percent, more preferably from about 2 to about 60 weight percent, of active agent together with the adjuvants, carriers, and/or excipients. The amount of active agent in such therapeutically useful compositions is such that a suitable dosage unit will be obtained.
[0147] The dosage of the active agent is preferably administered at a dose of between about 0.01 mg per kg of body weight per day (mg/kg/day) to about 100 mg/kg/day, preferably 0.01 mg per kg of body weight per day (mg/kg/day) to 10 mg/kg/day, and most preferably 0.1 to 5.0 mg/kg/day.
[0148] Administration can be accomplished either via systemic administration to the subject, administration directly to a fibrotic tissue site, or via targeted administration to affected cells. Exemplary routes of administration include, without limitation, orally, parenterally, periadventitially, subcutaneously, intravenously, intramuscularly, intraperitoneally, by inhalation, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, intradermally or by application to mucous membranes. Other suitable modes of delivery can also be used, and administration can be repeated periodically as needed.
[0149] As persons of skill will recognize, optimization of dosage amount and frequency can be carried out to maximize the efficacy of treatment in accordance with the present invention.
[0150] The active agent may be orally administered, for example, with an inert diluent, or with an assimilable edible carrier, or they may be enclosed in hard or soft shell capsules, or they may be compressed into tablets, or they may be incorporated directly with the food of the diet. For oral therapeutic administration, these active agents may be incorporated with excipients and used in the form of tablets, capsules, elixirs, suspensions, syrups, and the like. Such compositions and preparations should contain at least 0.1% of the agent. The percentage of the active agent in these compositions may, of course, be varied and may conveniently be between about 2% to about 60% of the weight of the unit. The amount of the active agent in such therapeutically useful compositions is such that a suitable dosage will be obtained.
[0151] The tablets, capsules, and the like may also contain a binder such as gum tragacanth, acacia, corn starch, or gelatin; excipients such as dicalcium phosphate; a
disintegrating agent such as corn starch, potato starch, or alginic acid; a lubricant such as magnesium stearate; and a sweetening agent such as sucrose, lactose, or saccharin. When the dosage unit form is a capsule, it may contain, in addition to materials of the above type, a liquid carrier, such as a fatty oil.
[0152] Various other materials may be present as coatings or to modify the physical form of the dosage unit. For instance, tablets may be coated with shellac, sugar, or both. A syrup may contain, in addition to active ingredient(s), sucrose as a sweetening agent, methyl and propylparabens as preservatives, a dye, and flavoring such as cherry or orange flavor.
[0153] The active agent may also be administered parenterally. Solutions or suspensions of the active agent can be prepared in water suitably mixed with a surfactant, such as hydroxypropylcellulose. Dispersions can also be prepared in glycerol, liquid polyethylene glycols, and mixtures thereof in oils. Illustrative oils are those of petroleum, animal, vegetable, or synthetic origin, for example, peanut oil, soybean oil, or mineral oil. In general, water, saline, aqueous dextrose and related sugar solutions, and glycols such as propylene glycol or polyethylene glycol, are preferred liquid carriers, particularly for injectable solutions. Under ordinary conditions of storage and use, these preparations contain a preservative to prevent the growth of microorganisms.
[0154] The pharmaceutical forms suitable for injectable use include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. In all cases, the form must be sterile and must be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms, such as bacteria and fungi. The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol, and liquid polyethylene glycol), suitable mixtures thereof, and vegetable oils.
[0155] The active agent may also be administered directly to the airways in the form of an aerosol. For use as aerosols, the compounds of the present invention in solution or suspension may be packaged in a pressurized aerosol container together with suitable propellants, for example, hydrocarbon propellants like propane, butane, or isobutane with conventional adjuvants. The materials of the present invention also may be administered in a non-pressurized form such as in a nebulizer or atomizer.
[0156] As another alternative, the active agent may be administered to the airways in the form of a lung surfactant formulation. The lung surfactant formulation can include exogenous lung surfactant formulations (e.g., INFASURF® (Forest Laboratories), SURVANTA® (Ross Products), and CUROSURF® (DEY, California, USA) or synthetic lung surfactant formulations (e.g., Exosurf (Glaxo Wellcome Inc.), ALEC, and those described in U.S. Application Publ. Nos. 20100055164 and 20150125515, both to Notter et al., each of which is hereby incorporated by reference in its entirety). These surfactant formulations are typically administered via airway instillation (i.e., after intubation) or intratracheally.
[0157] According to a further alternative, ophthalmic solutions, suspensions, ointments or inserts comprising an active agent can be administered. Eye drops can be prepared by dissolving the active ingredient in a sterile aqueous solution such as physiological saline, buffering solution, etc., or by combining powder compositions to be dissolved before use. Other vehicles can be chosen, as is known in the art, including but not limited to: balance salt solution, saline solution, water soluble polyethers such as polyethyene glycol, polyvinyls, such as polyvinyl alcohol and povidone, cellulose derivatives such as methylcellulose and
hydroxypropyl methylcellulose, petroleum derivatives such as mineral oil and white petrolatum, animal fats such as lanolin, polymers of acrylic acid such as carboxypolymethylene gel, vegetable fats such as peanut oil and polysaccharides such as dextrans, and glycosaminoglycans such as sodium hyaluronate. If desired, additives ordinarily used in the eye drops can be added. Such additives include isotonizing agents (e.g., sodium chloride, etc.), buffer agent (e.g., boric acid, sodium monohydrogen phosphate, sodium dihydrogen phosphate, etc.), preservatives (e.g., benzalkonium chloride, benzethonium chloride, chlorobutanol, etc.), thickeners (e.g., saccharide such as lactose, mannitol, maltose, etc.; e.g., hyaluronic acid or its salt such as sodium
hyaluronate, potassium hyaluronate, etc.; e.g., mucopolysaccharide such as chondroitin sulfate, etc.; e.g., sodium polyacrylate, carboxyvinyl polymer, crosslinked polyacrylate, polyvinyl alcohol, polyvinyl pyrrolidone, methyl cellulose, hydroxy propyl methylcellulose, hydroxyethyl cellulose, carboxymethyl cellulose, hydroxy propyl cellulose or other agents known to those skilled in the art).
[0158] The active agents may also be administered directly to the targeted tissue.
Additionally and/or alternatively, the active agents may be administered to a non-targeted area along with one or more agents that facilitate migration of the active agent to (and/or uptake by) a targeted tissue, organ, or cell. As will be apparent to one of ordinary skill in the art, the therapeutic agent itself can be modified to facilitate its transport to (and uptake by) the desired tissue, organ, or cell.
[0159] By way of example, targeted delivery to the liver can be achieved using cationic solid lipid nanoparticles of Kong et al. ("Cationic solid lipid nanoparticles derived from apolipoprotein-free LDLs for target specific systemic treatment of liver fibrosis," Biomaterials 34(2):542-51 (2012), which is hereby incorporated by reference in its entirety) modified to deliver the active agents.
[0160] Exemplary delivery devices include, without limitation, nebulizers, atomizers, liposomes, transdermal patches, implants, implantable or injectable protein depot compositions, syringes, and gene therapy. Other delivery systems which are known to those of skill in the art can also be employed to achieve the desired delivery of the therapeutic agent to the desired organ, tissue, or cells in vivo to carry out this aspect of the present invention.
[0161] In one embodiment, the method of treating fibrosis includes administering to the patient an amount of a second agent that is therapeutically effective to treat the fibrosis (i.e., additional anti-fibrotic agents), wherein the second agent is different from the active agent disclosed above.
[0162] Exemplary second agents (additional anti-fibrotic agents) include, without limitation, calcium channel blockers, cytotoxic agents, cytokines, chemokines, integrins, growth factors, hormones, lysophosphatidic acid (LP A) receptor 1 antagonists, agents that modulate the TGF-β pathway, endothelin receptor antagonists, agents that reduce connective tissue growth factor (CTGF) activity, matrix metalloproteinase (MMP) inhibitors, agents that reduce the activity of platelet-derived growth factor (PDGF), agents that interfere with integrin function, agents that interfere with the pro-fibrotic activities of cytokines, agents that reduce oxidative stress, PDE4 inhibitors, PDE5 inhibitors, mTor inhibitors, modifiers of the arachidonic acid pathway, peroxisome proliferator-activated receptor (PPAR)-y agonists, kinase inhibitors, inhibitors of VEGF signaling pathway, matrix metalloproteinases, tissue inhibitors of metalloproteinases (TIMPs), HGF agonists, angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor antagonists, inhibitors of advanced glycation endproducts (AGEs) or their receptors (RAGEs), Rho kinase inhibitors, PKC inhibitors, ADAM- 10 inhibitor, farnesoid X receptor agonists, caspase inhibitors, anti-oxidants, inhibitors of collagen expression, LMW heparin or heparin analogs, copper chelators, TNF-a blocking agents, agents that inhibit fibronectin deposition and/or enhance fibronectin degradation and turnover (e.g., bacterial adhesin peptides, fibronectin-derived peptides, and antibodies against fibronectin, as described in U.S. Appl. Publ. No. 20130190224 to Sottile et al., which is hereby incorporated by reference in its entirety), HMG-CoA reductase inhibitors, Thy-1 (CD90) inhibitors, and LDH inhibitors of the type described in co-pending U.S. Application Serial No. 14/718,933 filed on May 21, 2015, which is hereby incorporated by reference in its entirety.
[0163] Exemplary calcium channel blockers include, without limitation, Verapamil.
[0164] Exemplary cytotoxic agents include, without limitation, azathioprine,
methotrexate, and cyclophosphamide. In certain embodiments, these agents can be excluded.
[0165] Exemplary cytokines include, without limitation, interleukins such as IL-1, IL-4,
IL-5, IL-6, IL-8, IL-10, IL-12, and IL-13; interferons such as interferon-γ; lymphokines; tumor necrosis factor-a; endothelin-1; angiotensin II; leptins; angiogenin(s); monocyte chemoattractant protein type 1 (MCP-1); and macrophage inflammatory protein (MIP-l , MIP-2).
[0166] Exemplary chemokines include, without limitation, CCL2, CCL12, CXCL12,
CXCR4, CCR3, CCR5, CCR7, and SLC/CCL21.
[0167] Exemplary integrins include, without limitation, αιβι, α2βι, ανβ6, and ανβ3.
[0168] Exemplary growth factors include, without limitation, insulin growth factors
(IGF-1, IGF-2), keratinocyte growth factor (KGF), hepatocyte growth factor (HGF), fibroblast growth factors (FGF-1, 2 and 4), platelet-derived growth factors (PDGF-AB, PDGF-BB, PDGF- AA), epidermal growth factors (EGFs), transforming growth factors (TGF^l-3), osteoid- inducing factor (OIF), bone morphogenic proteins (BMPs; BMP1, BMP2, BMP2A, BMP2B, BMP 3, BMP3b, BMP4, BMP5 , BMP6, BMP9 - BMP- 15 , OP- 1 , OP-2, OP-3 , BMP-7, HBGF- 1 , HBGF-2), growth differentiation factors (GDF1-3 and GDF5-12), osteogenic proteins (OP-1, OP-2, OP-3), cartilage-derived morphogenic proteins (CDMP-1, CDMP-2, CDMP-3), colony stimulating factors (CSF-1, G-CSF and GM-CSF or iso forms thereof), vascular endothelial growth factor (VEGF), connective tissue growth factor (CTGF), and neural epidermal growth factor-like 1 (NELL-1).
[0169] Exemplary hormones include, without limitation, progesterone, estrogen, testosterone, growth hormone, thyroid hormone, and parathyroid hormone.
[0170] Exemplary lysophosphatidic acid {LP A) receptor 1 antagonists include, without
{imitation, AMI 52 (Amira Pharmaceuticals), AM966, and ΚΪ16198.
[0171] Exemplary agents that modulate TGF-β pathways include, without limitation, ανβ6 inhibitors; HGF; rBMP7 (bone morphogenic protein 7); decorin; tyrosine kinase inhibitors (Imantinib, Desatinib, Nolitinib); and agents that that reduce TGF-β activity (e.g., metelimumab (CAT-192), GC-1008 (Genzyme/Medimmune), lerdelimumab (CAT-152), LY-2157299 (Eli Lilly), and ACU-HTR-028 (Opko Health)); antibodies that target one or more TGF-β isoforms; inhibitors of TGF-β receptor kinases (e.g., TGFBRl (ALK5) and TGFBR2); modulators of post- receptor signaling pathways; and chemokine receptor signaling.
[0172] Exemplary endothelin receptor antagonists (including inhibitors that target both endothelin receptor A and B and those that selectively target endothelin receptor A) include, without limitation, ambrisentan; avosentan; bosentan; clazosentan; darusentan; BQ-153; FR- 139317, L-744453; macitentan; PD-145065; PD-156252; PD163610; PS-433540; S-0139;
sitaxentan sodium; TBC-3711; and zibotentan.
[0173] Exemplary agents that reduce the activity of connective tissue growth factor
(CTGF) include, without limitation, FG-3019, FibroGen, other CTGF-neutralizing antibodies.
[0174] Exemplary matrix metalloproteinase (MMP) inhibitors include, without limitation, MMPI-12, PUP-1 and tigapotide triflutate.
[0175] Exemplary agents that reduce the activity of platelet derived growth factor
(PDGF) include, without limitation, Imatinib mesylate (Novartis)) and PDGF neutralizing antibodies, antibodies targeting PDGF receptor (PDGFR), inhibitors of PDGFR kinase activity, and post-receptor signaling pathways. PDGFR inhibitors include, but are not limited to, SU9518, CP-673,451 and CP-868596.
[0176] Exemplary agents that interfere with integrin function include, without limitation,
STX-100, IMGN-388, and integrin targeted antibodies.
[0177] Exemplary agents that interfere with the pro-fibrotic activities of cytokines (such as interleukins, e.g., IL4 and IL-13) include, without limitation, AER-001, AMG-317, APG-201, sIL-4Ra, anrukinzumab, CAT-354, cintredekin besudotox, MK-6105, QAX-576, SB-313, SL- 102, and TNX-650; as well as neutralizing antibodies to either cytokine, antibodies that target IL-4 receptor or IL-13 receptor, the soluble form of IL-4 receptor or derivatives thereof that is reported to bind and neutralize both IL-4 and IL-13, chimeric proteins including all or part of IL- 13 and a toxin particularly pseudomonas endotoxin, signaling though the JAK-STAT kinase pathway.
[0178] Exemplary agents that interfere with epithelial mesenchymal transition include, without limitation, inhibitors of mTor (including but not limited to rapamycin, 40-O-(2- hydroxy)-ethyl-rapamycin, 32-deoxorapamycin, 40-[3-hydroxy-2-(hydroxy-methyl)-2- methylpropanoate]-rapamycin, Ridaforolimus (AP-23573 or MK-8669) and Torisel
(temsirolimus).
[0179] Exemplary agents that reduce oxidative stress include, without limitation, N- acetylcysteine (a cysteine pro-drug), tetrathiomolybdate, and interferon-γ. [0180] Exemplary agents that are inhibitors of phosphodiesterase 4 (PDE4) or phosphodiesterase 5 (PDE5) include, without limitation, Roflumilast, mirodenafil, PF-4480682, sildenafil citrate, SLx-2101, tadalafil, udenafil, UK-369003, vardenafil, and zaprinast.
[0181] Exemplary modifiers of the arachidonic acid pathway include, with limitation, cyclooxygenase (COX) and 5 -lipoxygenase (LO) inhibitors such as Zileuton.
[0182] Exemplary compounds that reduce tissue remodeling during fibrosis include, without limitation, prolyl hydrolase inhibitors such as 1016548, CG-0089, FG-2216, FG-4497, FG-5615, FG-6513, fibrostatin A (Takeda), lufironil, P-1894B, and safironil.
[0183] Exemplary PPAR-gamma agonists include, without limitation, pioglitazone (Takeda), farglitizar (GSK) and rosiglitazone (GSK).
[0184] Exemplary kinase inhibitors include, without limitation, MEK inhibitors (e.g.,
PD325901, ARRY-142886, ARRY-438162 and PD98059); EGFR inhibitors (e.g., Iressa™ (gefitinib, AstraZeneca), Tarceva™ (erlotinib or OSI-774, OSI Pharmaceuticals Inc.), Erbitux™ (cetuximab, Imclone Pharmaceuticals, Inc.), EMD-7200 (Merck AG), ABX-EGF (Amgen Inc. and Abgenix Inc.), HR3 (Cuban Government), IgA antibodies (University of Erlangen-
Nuremberg), TP-38 (IV AX), EGFR fusion protein, EGF -vaccine, anti-EGFR immuno liposomes (Hermes Biosciences Inc.) and combinations thereof, antibodies targeting EGF receptor, inhibitors of EGF receptor kinase, and modulators of post-receptor signaling pathways); ErbB2 receptor inhibitors (e.g., CP-724-714, CI-1033 (canertinib), Herceptin™ (trastuzumab),
Omnitarg™ (2C4, petuzumab), TAK-165, GW-572016 (Ionafarnib), GW-282974, EKB-569, PI- 166, dHER2 (HER2 Vaccine), APC8024 (HER2 Vaccine), anti-HER/2neu bispecific antibody, B7.her2IgG3, AS HER2 trifunctional bispecific antibodies, mAB AR-209 and mAB 2B-1); IGFIR antibodies (e.g., those described in PCT Application Publ. No. WO 2002/053596, which is hereby incorporated by reference in its entirety); AXL inhibitors (e.g., SGI-AXL-277
(SuperGen) as well as inhibitors disclosed in U.S. Pat. Pub. 20050186571, which is hereby incorporated by reference in its entirety); p38 inhibitors (e.g., SB202190, SB203580 and pyridinyl imidazoles); FGFR inhibitors (e.g., PD 17034, PD166866, and SU5402); TIE2 inhibitors (e.g., those described in Kissau, L. et. al, J Med Chem., 46:2917-2931 (2003), which is hereby incorporated by reference in its entirety); the following kinase inhibitors: Pan ERBB receptor inhibitors (e.g., GW572016, CI-1033, EKB-569, and Omnitarg), MP371 (SuperGen) which is an inhibitor of c-Kit, Ret, PDGFR, and Lck, as well as the non-receptor tyrosine kinase c-src, MP470 (SuperGen) which is an inhibitor of c-Kit, PDGFR, and c-Met, Imatinib
(Gleevec™) which is an inhibitor of c-kit, PDGFR, and ROR, as well as the non-receptor tyrosine kinase bcl/abl, Lapatinib (Tykerb™) which is an epidermal growth factor receptor (EGFR) and ERBB2 (Her2/neu) dual tyrosine kinase inhibitor, inhibitors of PDGFR and VEGFR (e.g., Nexavar™ (sorafenib, BAY43-9006), Sutent™ (sunitinib, SU11248), and ABT- 869), inhibitors of VEGFR and (e.g., Zactima™ (vandetanib, ZD-6474), BMS-690514 which is a reversible oral inhibitor of epidermal growth factor receptor (EGFR/HER-1), HER-2 and -4, and vascular endothelial growth factor receptors (VEGFRs)-l to -3, BIBF-1120 which is a receptor kinase inhibitor for VEGF, FGF and PDGF; inhibitors of the VEGF signaling pathway (e.g., PTC-299, INGN-241, oral tetrathiomolybdate, 2-methoxyestradiol, 2-methoxyestradiol nanocrystal dispersion, bevasiranib sodium, PTC-299, Veglin, VEGF neutralizing antibodies, soluble form of VEGFR1 (sFlt) and derivatives thereof which neutralize VEGF, anti-KDR antibodies, VEGFR 1 (Fltl) antibodies (e.g., icrucumab (IMC-18F1)), VEGFR2 (KDR) antibodies (e.g., CDP-791 or IMC-1121B (ramucirumab) and VEGFR3 antibodies (e.g., mF4- 31C1 from Imclone Systems) and CT-322 (Angiocept™; a VEGFR2 inhibitor), VEGF inhibitors (e.g., bevacizumab (Avastin™), pegaptanib, ranibizumab, NEOVASTAT™, AE-941, VEGF Trap, and PI-88), and VEGF receptor antagonists (e.g., JNJ-17029259 (4-[4-(l-Amino-l- methylethyl)phenyl] -2- [4-(2-morpholin-4-yl-ethyl)phenylamino]pyrimidine-5 -carbonitrile (a
VEGF-R2 inhibitor)), PTK-787/ZK222584 (Astra-Zeneca), SU5416, SU11248 (Pfizer), ZD6474 ([N-(4-bromo-2-fluorophenyl)-6-methoxy-7-[(l-methylpiperidin-4-yl)methoxy]quinazolin-4- amine]), vandetanib, cediranib, AG-013958, CP-547632, E-7080 (lenvatinib), XL-184, L-21649, ZK-304709, SU6668, sorafenib, sunitinib, pazopanib, vatalanib, AEE-788, AMG-706
(motesanib), axitinib, BIBF-1120, SU-14813, XL-647, XL-999, ABT-869, BAY-57-9352, BAY- 73-4506 (regorafimb), BMS-582664, CEP-7055, CHIR-265, OSI-930, TKI-258, fenretinide, and squalamine).
[0185] Suitable matrix degrading enzymes include those described in U.S. Application
Publ. Nos. 20100003237 and 20120101325, each of which is hereby incorporated by reference in its entirety. Exemplary matrix degrading enzymes include, without limitation, pancreatic elastase, elastase-2a, elastase-2b, neutrophil elastase, proteinase-3, endogenous vascular elastase, cathepsin G, mast cell chymase, mast cell tryptase, plasmin, thrombin, granzyme B, cathepsin S, cathepsin K, cathepsin L, cathepsin B, cathespin C, cathepsin H, cathespin F, cathepsin G, cathepsin O, cathepsin R, cathepsin V (cathepsin 12), cathepsin W, calpain 1, calpain 2, legumain, cathepsin Z (cathepsin X), cathepsin D, cathepsin E, chondroitinase ABC,
chondroitinase AC, hyaluronidase, chymopapain, chymotrypsin, collagenase, papain, subtilisin, subtilisin A, heparanase. and matrix metalloproteinases, such as for example, MMP-1
(collagenase- 1), MMP-2 (gelatinase A), MMP-3 (stromelysin-1), MMP-7 (matrilysin; PUMP1), MMP-8 (collagenase-2), MMP-9 (gelatinase B), MMP-10 (stromelysin-2), MMP-11 (stromelysin-3), MMP-12 (metalloelastase), MMP-13 (collagenase-3), MMP-14 (MT1-MMP), MMP-15 (MT2-MMP), MMP-16 (MT3-MMP), MMP-17 (MT4-MMP), MMP-18 (collagenase- 4), MMP-19 (stromelysin-4), MMP-20 (enamelysin), MMP-21 (x-MMP), MMP-23A (MT5- MMP), MMP-23B, MMP-24 (MT5-MMP), MMP-25 (MT6-MMP), MMP-26 (matrilysin-2), MMP-27 (MMP-22; c-MMP), MMP-28 (epilysin), ADAMTS-1 , ADAMTS-2, ADAMTS-3, ADAMTS-4 (aggrecanase-1), ADAMTS-5(aggrecanase-2), ADAMTS-14.
[0186] Exemplary tissue inhibitors of matrix-metalloproteinases (TIMPs) include, without limitation, TIMP-1, TIMP-2, TIMP-3, and TIMP-4.
[0187] Exemplary HGF agonists include, without limitation, Refanalin (Angion
Biomedica).
[0188] Exemplary ACE inhibitors include, without limitation, Alacepril, Benazepril,
Captopril, Cilazapril, Ceronapril, Delapril, Enalapril, Enalaprilat, Fosinopril, Fosinoprilat, Imidapril, Lisinopril, Moexipril, Perindopril, Perindoprilat, Quinapril, Quinaprilat, Ramipril, saralasin acetate, spirapril, temocapril, trandolapril, fasidotrilat, beclometasone dipropionate, FPL-66564, Idrapril, MDL- 100240, and S-5590.
[0189] Exemplary angiotensin receptor antagonists include, without limitation,
Candesartan, Irbesartan, Losartan, Valsartan, Telmisartan, and Eprosartan.
[0190] Exemplary advanced glycation endproducts (AGEs) inhibitors include, without limitation, Pyridoxamine (Biostratum). Examples of AGE receptors (RAGE) inhibitors include, without limitation, TTP-488 (Transtech Pharma) and TTP-4000 (Transtech Pharma).
[0191] Exemplary Rho kinase inhibitors include, without limitation, GSK269962,
GSK429286, AS 1892802, SB772077B, and SR3677.
[0192] Exemplary PKC inhibitors include, without limitation, Ruboxistaurin mesilate hydrate (Lilly).
[0193] Exemplary ADAM- 10 inhibitors include, without limitation, XL-784 (Exelixis).
[0194] Exemplary farnesoid X receptor agonists include, without limitation, INT-747
(Intercept Pharmaceuticals).
[0195] Exemplary caspase inhibitors include, without limitation, PF-3491390 (Pfizer, formally IDN-6556), and LB84318 (LG Life Sciences).
[0196] Exemplary anti-oxidants include, without limitation, Heptax (Hawaii Biotech), N- acetylcysteine (Pierre Fabre), tocopherol, silymarin, and Sho-saiko-To (H-09).
[0197] Exemplary inhibitors of collagen expression include, without limitation,
Pirfenidone (InterMune), Halofuginone (Collgard) and F351 (Shanghai Genomics). [0198] Exemplary low molecular weight heparin or heparin analogs include, without limitation, Sulodexide (Keryx).
[0199] Exemplary copper chelators include, without limitation, Trientine (Protemix),
Coprexa (Pipex), and tetrathiomolybdate.
[0200] Exemplary TNF-a blocking agents include, without limitation, Etanercept
(Enbrel™) and pentoxyfylline (Trental™).
[0201] Exemplary HMG-CoA reductase inhibitors include, without limitation, statins such atorvastatin (Lipitor), fluvastatin (Lescol), lovastatin (Mevacor, Altocor), pitavastatin (Livalo), pravastatin (Pravachol), rosuvastatin (Crestor), and simvastatin (Zocor).
[0202] Exemplary Thy- 1 (CD90) inhibitors include monoclonal antibodies against Thy- 1
(e.g., clone 5E10, Gundlach et al, Bioconjug. Chem. 22(8): 1706-14 (2011), which is hereby incorporated by reference in its entirety).
[0203] Other known anti-fibrotic agents include, without limitation, 5-flurouracil (5-FU; a pyrimidine analog), mitomycin C (MMC), colchicine (antibiotic), d-penicillamine, Pediapred oral liquid, Medrol, cyclosporine (an immunosuppressant), mycophenolate mofetil (MMF;
Cellcept; an immunosuppressant); prednisolone; bovine collagen type I, ribavirin (a guanosine (ribonucleic) analog), spirichostatin A (a histone deacetylase inhibitor); TGF-2 specific inhibitors (transglutaminase -2), tacrolimus (FK5-6, a calcineurin inhibitor), relaxin, taurine, niacin, treprostinil (a prostacyclin analog), Tiplaxtinin (PAI-039, a plasminogen activator-1 inhibitor); Pentraxin-1 (e.g., serum amyloid P component (SAP), c-reactive protein (CRP), and PTX-3) and Pentraxin-2 (PTX-2 or PRM-151), imidazolium and imidazolinium salts (U.S. Publication Application No. 20116178040, which is hereby incorporated by reference in its entirety) and IL-17 antagonists (U.S. Publication Application No. 20110091378, which is hereby incorporated by reference in its entirety); relaxin (a hormone; U.S. Publication Application No. 20120101325, which is hereby incorporated by reference in its entirety), ultraviolet A (UVA), and cannabinoids and agents altering the MMP-TIMP balance.
[0204] Explicitly excluded from the scope of additional anti-fibrotic agents are those agents described as being possibly co-administered with the polyether antimicrobial alexidine, as described in U.S. Publ. No. 2009/0054381 to Letts et al, which is hereby incorporated by reference in its entirety; and those agents described as being possibly co -administered with the polyether antimicrobial amsacrine, as described in U.S. Publ. No. 2007/0202051 to Schuschnig, which is hereby incorporated by reference in its entirety.
[0205] These additional anti-fibrotic agents can be administered in any previously known dosage. Compositions including these agents preferably contain from about 0.01 to about 99 weight percent, more preferably from about 2 to about 60 weight percent, of therapeutic agent together with the adjuvants, carriers, and/or excipients. The amount of active compound in such therapeutically useful compositions is such that a suitable dosage unit will be obtained. The dosage of the one of these additional anti-fibrotic agents is preferably administered at a dose of between about 0.01 mg per kg of body weight per day (mg/kg/day) to about 100 mg/kg/day, preferably 0.01 mg per kg of body weight per day (mg/kg/day) to 10 mg/kg/day, and most preferably 0.1 to 5.0 mg/kg/day.
[0206] Administration of one or more of the additional anti-fibrotic agents (or compositions containing the same) can be carried out orally, parenterally, periadventitially, subcutaneously, intravenously, intramuscularly, intraperitoneally, by inhalation, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, intradermally or by application to mucous membranes. Other suitable modes of delivery can also be used.
[0207] The additional anti-fibrotic agents can be co -administered with the active agents described above in a single formulation or in separate formulations.
[0208] A further aspect of the invention relates to a recombinant cell line that includes a recombinant gene that expresses a detectable expression product in a dose-dependent response to TGFP concentration. This recombinant cell line is useful for screening agents that can induce a change in TGFP expression levels. The recombinant cell line can be any human or animal derived cell line that can be maintained in culture.
[0209] The recombinant gene can be prepared using recombinant techniques that are well known to those of skill in the art. In one embodiment, the expression product is luciferase, preferably one that comprises a half-life that is less than 2 hours (see LeClerc, Biotechniques 29(3):590-8 (2000), which is hereby incorporated by reference in its entirety), and the open reading frame is operably coupled to a promoter element that is responsive to TGFp. Although any suitable promoter element can be used, one suitable promoter element is a thymidine kinase (TK) promoter. Response to TGFP can be engineered by introducing into the upstream promoter region one or more binding elements responsive to TGFp (e.g., two TGFp response elements, three TGFp response elements, four TGFp response elements, and so on).
[0210] An exemplary TK promoter has the nucleotide sequence shown below: CGGCCCCGCCCAGCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTCGG
GGCGGCGCGGTCCGAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTCGA ACACCGAGCGACCCTGCAGCGACCCGCTTAACAGCGTCAACAGCGTGCCGCAGA TCTCGAGA
(SEQIDNO: l).
[0211] An exemplary TGFP response element has the nucleotide sequence shown below:
TACTAAGTCTAGACGGCAGTCTAGACGTACTAAGTCTAGACGGCAGTCTAGACG TAGAGCTCGGCCCCGCCCAGCGTCTTGTC
(SEQ ID NO: 2).
[0212] An exemplary luciferase open reading frame has the nucleotide sequence shown below:
ATGGAAGATGCCAAAAACATTAAGAAGGGCCCAGCGCCATTCTACCCACTCGAA GACGGGACCGCCGGCGAGCAGCTGCACAAAGCCATGAAGCGCTACGCCCTGGTG CCCGGCACCATCGCCTTTACCGACGCACATATCGAGGTGGACATTACCTACGCC GAGTACTTCGAGATGAGCGTTCGGCTGGCAGAAGCTATGAAGCGCTATGGGCTG AATACAAACCATCGGATCGTGGTGTGCAGCGAGAATAGCTTGCAGTTCTTCATG CCCGTGTTGGGTGCCCTGTTCATCGGTGTGGCTGTGGCCCCAGCTAACGACATC TACAACGAGCGCGAGCTGCTGAACAGCATGGGCATCAGCCAGCCCACCGTCGTA TTCGTGAGCAAGAAAGGGCTGCAAAAGATCCTCAACGTGCAAAAGAAGCTACCG ATCATACAAAAGATCATCATCATGGATAGCAAGACCGACTACCAGGGCTTCCAA AGCATGTACACCTTCGTGACTTCCCATTTGCCACCCGGCTTCAACGAGTACGAC TTCGTGCCCGAGAGCTTCGACCGGGACAAAACCATCGCCCTGATCATGAACAGT AGTGGCAGTACCGGATTGCCCAAGGGCGTAGCCCTACCGCACCGCACCGCTTGT GTCCGATTCAGTCATGCCCGCGACCCCATCTTCGGCAACCAGATCATCCCCGAC ACCGCTATCCTCAGCGTGGTGCCATTTCACCACGGCTTCGGCATGTTCACCACG CTGGGCTACTTGATCTGCGGCTTTCGGGTCGTGCTCATGTACCGCTTCGAGGAG GAGCTATTCTTGCGCAGCTTGCAAGACTATAAGATTCAATCTGCCCTGCTGGTG CCCACACTATTTAGCTTCTTCGCTAAGAGCACTCTCATCGACAAGTACGACCTA AGCAACTTGCACGAGATCGCCAGCGGCGGGGCGCCGCTCAGCAAGGAGGTAGGT GAGGCCGTGGCCAAACGCTTCCACCTACCAGGCATCCGCCAGGGCTACGGCCTG ACAGAAACAACCAGCGCCATTCTGATCACCCCCGAAGGGGACGACAAGCCTGGC GCAGTAGGCAAGGTGGTGCCCTTCTTCGAGGCTAAGGTGGTGGACTTGGACACC GGTAAGACACTGGGTGTGAACCAGCGCGGCGAGCTGTGCGTCCGTGGCCCCATG ATCATGAGCGGCTACGTTAACAACCCCGAGGCTACAAACGCTCTCATCGACAAG GACGGCTGGCTGCACAGCGGCGACATCGCCTACTGGGACGAGGACGAGCACTTC TTCATCGTGGACCGGCTGAAGAGCCTGATCAAATACAAGGGCTACCAGGTAGCC CCAGCCGAACTGGAGAGCATCCTGCTGCAACACCCCAACATCTTCGACGCCGGG GTCGCCGGCCTGCCCGACGACGATGCCGGCGAGCTGCCCGCCGCAGTCGTCGTG CTGGAACACGGTAAAACCATGACCGAGAAGGAGATCGTGGACTATGTGGCCAGC CAGGTTACAACCGCCAAGAAGCTGCGCGGTGGTGTTGTGTTCGTGGACGAGGTG CCTAAAGGACTGACCGGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATT AAGGCCAAGAAGGGCGGCAAGATCGCCGTGAATTCTCACGGCTTCCCTCCCGAG GTGGAGGAGCAGGCCGCCGGCACCCTGCCCATGAGCTGCGCCCAG
(SEQ ID NO: 3). [0213] In certain embodiments, the recombinant cell line is used in a method of identifying a compound that inhibits TGFP-mediated cellular activity. This method includes growing a recombinant cell line in the presence of TGFP and a compound of interest, and measuring the amount of the detectable expression product and comparing the measured amount to a control lacking the compound of interest and/or a control lacking TGFp, wherein a significant difference in the measured amount of the detectable expression product, relative to the control, indicates that the compound of interest inhibits TGFP-mediated cellular activity.
[0214] When luciferase or another fluorescent protein is used as the detectable expression product, measuring can be carried out using an optical detection system.
[0215] In this embodiment, the step of growing the recombinant cell line in the presence of TGFP and the compound of interest is carried out for a period of time sufficient to allow for an assessment of whether the compound of interest inhibits TGFP-mediated expression of the detectable expression product. In certain embodiments, this growing step is carried out for at least about 12 hours before said measuring, and in certain other embodiments this growing step is carried out for at least about 24 hours before said measuring.
EXAMPLES
[0216] The following examples are provided to illustrate embodiments of the present technology but are by no means intended to limit its scope.
Materials and Methods for Examples
[0217] Cell Culture: Primary human fibroblasts were acquired and cultured as previously described (Lehmann et al., "Novel anti-adipogenic activity produced by human fibroblasts," Am. J. Physiol. Cell Physiol. 229(3):C672-C681 (2010), which is hereby incorporated by reference in its entirety). HEK293FT cells were obtained from the American Type Culture Collection (Rockville, MD) and cultured in DMEM supplemented with 10% fetal calf serum (Hyclone) and antibiotics. DMEM, MEM and hygromycin were purchased from Gibco (Carlsbad, CA).
Fibroblast growth medium was purchased from Promocell. Other compounds were obtained as follows: salinomycin (Cayman), narasin, monensin and clioquinol (all three from Sigma).
Recombinant human TGFP was obtained from R&D systems and was used at final
concentrations of either 1, 5 or 10 ng/ml. [0218] Development of ΤϋΡβ Responsive Cell Line: The minimal thymidine kinase promoter was amplified by PCR with the following forward and reverse primers, of which the forward primer contained four tandem Smad binding elements (SBE):
Fwd (SEQ ID NO: 4, 5'^3'):
AGGTACCTACTAAGTCTAGACGGCAGTCTAGACGTACTAAGTCTAGACGGCAGTCTA GACGTAGAGCTCGGCCCCGCCCAGCGTCTTGTC
Rev (SEQ ID NO: 5, 5'- 3'):
TAAAGCTTCTCGAGATCTGCGGCACGCT
Restriction sites in the primers are underlined. The resultant PCR product was TOPO cloned (Invitrogen) and the correct insert was verified by DNA sequencing. The construct was digested with Sacl-Hindlll and the SBEx4-TK insert was purified and ligated with the pGL4.15 vector (Promega). Clones were verified by restriction digest and then tested for TGFp responsiveness in transient transfections of 293FT cells. Once the pSBEx4-TK-luc construct was demonstrated to be TGFp responsive, the construct was introduced into 293FT cells for stable cell line production. Clones were selected by treatment with 200 μg/ml hygromycin. 20 clones were selected and screened for TGFP-induced luciferase activity. One clone that was robustly responsive was subsequently used in the small molecule screen.
[0219] Plasmid DNA Transfection: Plasmid DNA was introduced into human fibroblasts by electroporation. Plasmids were electroporated with an Amaxa nucleofector (program U-025) into 1 x 106 cells. The pcDNA3-flag MKK6(glu) plasmid was obtained from Addgene (plasmid 13518, from Roger Davis' lab). After transfection cells were cultured for 12-24 hours and culture medium was subsequently changed to treatment conditions.
[0220] Western Blotting: Total protein was isolated from 0.5-2 x 106 cells and lysed in 60 mM Tris, pH 6.8, 2% SDS containing IX protease inhibitor cocktail (Sigma, St. Louis, MO). The lysates were passed through a 26 gauge needle 5-6 times to shear genomic DNA. Protein concentrations were determined using the detergent compatible protein assay (BioRad). Total protein (1-10 ug per lane) was subjected to SDS-PAGE. Protein gels were transferred to PVDF membrane (Millipore) and probed with antibodies as specified. Western blot band intensities were quantified using ImageLab software (BioRad). Protein expression was normalized to β- tubulin levels.
[0221] Collagen Production Assay: Cell culture supernatant was collected and transferred (5-20 ul) to PVDF membrane using a slot blot device. The membrane was blocked and probed with a goat anti-collagen antibody (1 :5000), washed and incubated with a donkey anti-goat antibody conjugated to HRP. Band intensities were quantified using ImageLab software and values were normalized to vehicle treatments.
[0222] Alamar Blue Viability Assay: 5 x 10 cells were plated per well in a 96-well plate
(Griener) with 200 ul of culture medium. Vehicle (DMSO), salinomycin and/or TGFP (1 ng/ml) were added as indicated and then 20 ul of alamar blue reagent was added to all wells. Cells were incubated for 24 and 48 hours and then fluorescence of the oxidized alamar reagent was measured (ex 470 nM, em 480 nM). Background fluorescence was subtracted from all wells and the fluorescence was normalized to vehicle treated cells. The assay was performed in two different human fibroblast strains and treatments were performed in triplicate.
[0223] BrdU Incorporation Assay: Human fibroblasts were seeded on a 96-well plate at a density of lxl 05 cells/well. Cells were treated in triplicate. Cell proliferation was determined using the bromodeoxyuridine (BrdU) assay following manufacturer's instructions. Briefly, cells were treated with a BrdU label at a 1 :2000 dilution for 24h after the initial 72h treatment with TGFP +/- drugs. BrdU incorporation was measured using the BrdU Cell Proliferation Assay kit (Calbiochem, San Diego, CA) at 450-540nm using a Varioskan microplate reader.
[0224] Immunocytochemistry: Human orbital fibroblasts were seeded in a multiwell dish and grown to 85-90% confluence. Cells were then treated with TGFP +/- salinomycin or narasin for 72h. Following treatment cells were fixed with 4% paraformaldehyde. Cells were then permeabilized and non-specific binding sites were blocked using 10% serum in PBS for thirty minutes at room temperature. Cells were incubated overnight at 4° with a monoclonal aSMA antibody which detects aSMA in differentiated fibroblasts. Cells were washed with PBS then incubated at room temperature with a Texas Red-conjugated secondary antibody at a
concentration of 1 :200. DAPI, a fluorescent counterstain, was used to visualize nuclear DNA.
[0225] Statistical Analysis: Student's T test and One-way analysis of variance (ANOVA) were used for statistical analysis and p values of p< 0.05; p<0.01; p<0.001; were considered significant.
Example 1 - Design of TGFp-inducible Luciferase Construct and Use Thereof
[0226] Excessive scarring results from the formation of too many myofibroblasts and the production of too much extracellular matrix material such as collagen. Since TGFP drives the formation of myofibroblasts in part through activating the Smad pathway, a reporter construct was designed to serve as a measure of TGFP-induced Smad activity (Figure 1A). Four tandem Smad binding elements (SBE) were inserted upstream of the minimal thymidine kinase promoter. The SBEx4-TK promoter was inserted into the pGL4.15 vector which contains a destabilized firefly luciferase gene and the hygromycin resistance gene. The pSBEx4-TK-luc- Hygro plasmid was then introduced into HEK293FT cells by lipofection. Stable clones were generated and screened for TGFP induced luciferase activity. One clone was selected that consistently gave a 15 to 20-fold induction of luciferase activity when cells were treated with TGFP for 24 hours (Figure IB).
[0227] To find compounds that inhibit TGFP activity and thus may be novel anti-scarring compounds, the Spectrum collection of 2,300 small molecules was screened with the cell line. One small molecule that was particularly potent at inhibiting luciferase activity was the polyether antibiotic agent, salinomycin (Figure 1C). Further testing of salinomycin showed a dose responsive decrease in TGFP -induced luciferase, where 100 nM salinomycin reduced luciferase activity by approximately 4-fold and 1 uM salinomycin reduced luciferase activity levels to below baseline levels (Figure ID). Salinomycin, an antibiotic produced from Streptomyces albus is used as coccidiostat agent in animal feed (Knirschova et al., "Multiple regulatory genes in the salinomycin biosynthetic gene cluster of Streptomyces albus CCM 4719," Folia Microbiologica 52:359-365 (2007), which is hereby incorporated by reference in its entirety). Furthermore, salinomycin has recently been shown to have activity against cancer stem cells (Naujokat et al., "Salinomycin as a drug for targeting human cancer stem cells," J. Biomed. Biotechnol.
2012:950658 (2012), which is hereby incorporated by reference in its entirety). Thus, further investigation was made to assess the use of salinomycin as an anti-scarring agent.
[0228] Fibroblasts are sentinel cells that respond to numerous stimuli and serve as key effector cells in many biological processes (Baglole et al., "More than structural cells, fibroblasts create and orchestrate the tumor microenvironment," Immunol. Invest. 35:297-325 (2006), which is hereby incorporated by reference in its entirety). One key function of fibroblasts is their differentiation into scar-forming myofibroblasts. Thyroid eye disease is a disorder in which myofibroblasts and scar tissue accumulate in the ocular orbit causing pain, proptosis and in severe cases, blindness (Lehmann et al, "Immune mechanisms in thyroid eye disease," Thyroid : Official Journal of the American Thyroid Association 18:959-965 (2008), which is hereby incorporated by reference in its entirety). Human orbital fibroblasts have been shown to respond dramatically to TGFP by forming myofibroblasts that express aSMA, calponin and produce high levels of collagen (Kuriyan et al., "Orbital fibroblasts from thyroid eye disease patients differ in proliferative and adipogenic responses depending on disease subtype," Invest. Ophthalmol. Vis. Sci. 54:7370-7377 (2013), which is hereby incorporated by reference in its entirety). Thus, TED fibroblasts were an ideal model to test the ability of salinomycin to block TGFP function. [0229] TED fibroblasts were treated with TGFP (1 ng/ml) in the presence or absence of
10-250 nM salinomycin for 72 hours to allow formation of myofibroblasts. After 72 hours, cells were harvested and analyzed by Western blot. As expected, the fibroblasts robustly responded to TGFp, expressing high levels of aSMA and calponin (Figure 2A). Interestingly, salinomycin blocked the expression of aSMA and calponin in a dose dependent manner (Figures 2A and 2B). At 50 nM salinomycin, expression of aSMA was reduced by 4-fold over TGFP treatment alone. Furthermore, at 250 nM salinomycin, aSMA expression was reduced by approximately 16-fold, to levels at or below untreated fibroblasts. Similar results were observed with calponin expression (Figures 2A and 2B). Another key role of myofibroblasts in scar formation is the production of collagen. Whether salinomycin could block myofibroblast collagen production was assessed. Cells were treated with TGFP and salinomycin as above and after 72 hours, culture medium was collected and analyzed for collagen levels using a specific collagen I antibody and slot blot analysis. As Figure 2C shows, TGFP induced myofibroblasts produce high levels of collagen. However, salinomycin blocked production of collagen in a dose- dependent manner. Starting at 10 nM salinomycin, collagen production decreases and at 100 nM salinomycin, collagen production is at baseline levels. Finally, at 250 nM salinomycin, collagen production is below baseline levels of untreated fibroblasts (Figure 2C).
Example 2 - Identification of Other Polyether Antibiotics That Block TGFp- induced
Myofibroblast Formation
[0230] Since salinomycin, a polyether antibiotic agent, could block formation of myofibroblasts, two other polyether antibiotic agents and a non-polyether ionophore, clioquinol, were tested for anti-myofibroblast activities (Figure 3A). Narasin is a methylated derivative of salinomycin and is also a coccidiostat used in animal feed (Mortier et al., "Determination of the ionophoric coccidiostats narasin, monensin, lasalocid and salinomycin in eggs by liquid chromatography/tandem mass spectrometry," Rapid Commun.Mass Spectrom. 19:533-539
(2005), which is hereby incorporated by reference in its entirety). Monensin is another polyether ionophore that is used extensively in animal feed to prevent coccidiosis (Mortier et al.,
"Determination of the ionophoric coccidiostats narasin, monensin, lasalocid and salinomycin in eggs by liquid chromatography/tandem mass spectrometry," Rapid Commun.Mass Spectrom. 19:533-539 (2005), which is hereby incorporated by reference in its entirety). Finally, a fourth compound, clioquinol, was selected for analysis. Clioquinol is an anti-protozoal drug and ionophore, but it is structurally unrelated to salinomycin (Schimmer et al., "A phase I study of the metal ionophore clioquinol in patients with advanced hematologic malignancies," Clin. Lymphoma, Myeloma Leuk.12:330-336 (2012), which is hereby incorporated by reference in its entirety).
[0231] To test these four compounds, human fibroblasts were treated with TGFP in the absence or presence of 250 nM of either salinomycin, narasin, clioquinol or monensin for 72 hours. After treatment, cell lysates were harvested and analyzed for the presence of the myofibroblast markers, aSMA and calponin (Figure 3B). As expected, salinomycin reduced the expression of aSMA and calponin to lower than vehicle levels. Interestingly, both narasin and monensin had similar activities to salinomycin. However, the structurally unrelated compound clioquinol, did not inhibit expression of aSMA or calponin (Figures 3B and 3C). Thus, these data demonstrate that salinomycin and other polyether ionophores may specifically block TGFP induced myofibroblast formation.
[0232] While salinomycin and other polyether ionophores blocked myofibroblast formation, it was next assessed whether these effects were a result of toxicity and/or due to a block of cell proliferation. Though the treatment doses are relatively low (efficacy in 100-250 nM range), a loss of cell viability could still be a possibility. To test this, human fibroblasts were treated with vehicle (DMSO), 50-250 nM salinomycin alone, TGFp or TGFp plus 250 nM salinomycin. As a positive control, fibroblasts were treated with the cytotoxic drug, puromycin. Treated cells were cultured in the presence of alamar blue reagent, which measures
mitochondrial oxidation-reduction (REDOX) potential and serves as a quantitative viability sensor. After 72 hours of culture, alamar blue fluorescence was measured to assay cell viability (Figure 4A). As expected, puromycin treatment resulted in a total loss of cell viability.
However, treatment of salinomycin alone or salinomycin plus TGFP did not result in a loss of viability. These results demonstrate that salinomycin is not affecting human fibroblast viability. It was also tested whether salinomycin affects basal fibroblast proliferation. To address this, cells were treated with vehicle or 250 nm of either salinomycin or narasin for 24 hours in the presence of bromodeoxyuridine (BrdU) to measure cell proliferation (Figure 4A, first three bars). Neither salinomycin nor narasin blocked basal fibroblast proliferation. BrdU was also added to cells treated with TGFP in the presence or absence of 250 nM salinomycin or narasin (Figure 4B, last three bars). As expected, TGFP induced human fibroblast proliferation. Remarkably, both salinomycin and narasin were able to beneficially block TGFP induced proliferation by 4 to 5 fold, without affecting basal proliferation levels. Example 3 - Characterization of Mode of Action for Salinomycin Blockade of TGFp- induced Myofibroblast Formation
[0233] To further characterize the molecular mechanisms whereby salinomycin (and other polyether antibiotics) blocks TGFP induced myofibroblast formation, activation kinetics were analyzed for some of the key mediators of TGFP signaling (Weiss et al., "The TGFbeta superfamily signaling pathway," Wiley Interdiscip. Rev. Dev. Biol. 2:47-63 (2013), which is hereby incorporated by reference in its entirety). Since salinomycin was first identified as a putative anti-scarring molecule by its ability to block TGFP -induced Smad activity, the levels of phospho-Smad2 were analyzed by Western blot in cells treated with TGFP or TGFP plus salinomycin. TGFP treatment induces phosphorylation of Smad2 in minutes in human fibroblasts, however, at early time points (30 sec-1 hour), salinomycin treatment did not affect phospho-Smad2 levels. The experiment was repeated, with samples being incubated for extended periods of time including 5, 24, 48 and 72 h hours (Figure 5 A, top panel). TGFP treatment induced phospho-Smad2 by 200% at 5 hours and then phospho-Smad2 levels decreased at 24 (140%), 48 (40%), and 72 hours (-5% of vehicle levels) (Figure 5B, top panel). Salinomycin treatment resulted in an 80% reduction of phospho-Smad2 levels, compared to TGFP alone at 5 hours. Interestingly, salinomycin was most effective at blocking phospho- Smad2 levels at 24 hours, with approximately an 8-10 fold reduction compared to TGFP treatment alone. This data indicated that salinomycin was not working directly on Smad2, but rather at another signaling step.
[0234] Therefore, activity of another signaling molecule that is involved in myofibroblast formation, namely the mitogen-activated protein kinase (MAPK), p38, was measured to assess its potential role in the observed results. P38 MAPKs are a class of protein kinases that respond to TGFp, ultraviolet radiation and other stimuli. Phosphorylation and activation of p38 can lead to numerous downstream signaling pathways, including phosphorylation of Smad proteins.
TGFP treatment of human fibroblasts was observed to result in a dramatic induction of phospho- p38 at 5 hours (7 fold) and 24 hours (2-3 fold). Remarkably, salinomycin treatment completely blocked phospho-p38 levels at 5 hours TGFP treatment (Figures 5A and 5B, lower panels). Furthermore, salinomycin treatment inhibited phospho-p38 by 80% at 24 hours TGFP treatment. These data support the belief that salinomycin targets (along with other polyether antibiotics) the p38 signaling pathway in response to TGFp.
[0235] To further test if salinomycin targets the p38 pathway to block myofibroblast formation, a plasmid encoding a mutant MKK6 (pcDNA3-flag MK 6(glu)) protein was used. MK 6 phosphorylates and thus activates p38 in response to extracellular signals such as TGFP or other environmental stresses. The MK 6(glu) protein, which harbors glutamate mutations at amino acid residues serine 207 and threonine 211, is constitutively active and thus
phosphorylates p38 irrespective of signal (Raingeaud et al, "MK 3- and MK 6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway," Mol. Cell. Biol. 16: 1247-1255 (1996), which is hereby incorporated by reference in its entirety). Thus, if salinomycin is blocking the p38 signaling pathway, MK 6(glu) should overcome the effect of salinomycin. MK 6(glu) was first tested using the SBE4-TK-luc reporter plasmid. The luciferase reporter plasmid was introduced into human fibroblasts along with the MKK6(glu) plasmid or a control plasmid (pcDNA3-GFP). Cells were then treated with vehicle, TGFP or TGFP plus 250 nM salinomycin. After 24 hours, luciferase activity was measured (Figure 6A). As expected, in human fibroblasts expressing the GFP plasmid, TGFP induced luciferase activity by 2-fold and salinomycin completely blocked TGFP- induced luciferase activity. Interestingly, in cells expressing constitutively active MK 6(glu) plasmid, salinomycin was unable to block TGFP -induced luciferase activity (Figure 6A). MK 6(glu) was further tested to assess whether it could attenuate the ability of salinomycin to inhibit p38 phosphorylation. Control or MKK6(glu) plasmids were introduced into human fibroblasts by electroporation and then cells were treated with TGFP for 24 hours. Following treatment, cells were analyzed for flag-MK 6(glu) expression and phospho-p38 by Western blot (Figure 6B). As expected, salinomycin blocks phosphorylation of p38 at 24 hours. However, MKK6(glu) expression leads to a large induction of phospho-p38, regardless of salinomycin treatment. As a third test, control or MK 6(glu) plasmids were introduced into human fibroblasts by
electroporation. After electroporation, cells were induced to form myofibroblasts by TGFP treatment for 72 hours. Samples were analyzed for expression of flag-MK 6(glu), aSMA , calponin and β-tubulin by Western blot (Figure 6C). As expected TGFP treatment induced expression of aSMA and calponin in control, GFP expressing cells and salinomycin blocked their induction (Figure 6C, left hand panel). Interestingly, expression of MK 6(glu) attenuated the ability of salinomycin to block TGFP induced aSMA and calponin (Figure 6C, right hand panel). Taken together, these data provide strong evidence demonstrating that salinomycin blocks the p38 signaling pathway to prevent TGFP induced Smad2/3-dependent signaling and formation of scar forming myofibroblasts (Figure 7).
Discussion of Examples 1-3
[0236] Exuberant TGFP signaling and excessive development of scar-forming myofibroblasts is at the root of disorders involving excessive scar formation. Unfortunately, therapeutic options to treat excessive scarring are limited and most are not proven to be effective (Klingberg et al., "The myofibroblast matrix: implications for tissue repair and fibrosis," J.
Pathol. 229:298-309 (2013), which is hereby incorporated by reference in its entirety). The results presented in the preceding Examples identify salinomycin and other polyether ionophores as novel small molecules that block myofibroblast formation. Salinomycin potently blocked TGFP induced expression of aSMA, calponin and collagen, all of which are hallmarks of myofibroblasts (Figure 2). The ability of salinomycin to block expression of these myofibroblast markers has not been previously recognized. The knowledge gained from these studies highlights the potential of salinomycin and other polyether ionophores to serve as new anti- scarring drugs.
[0237] Heightened activity of TGFP is observed in cancer, fibrosis and hypertrophic scarring and, thus, the pathway is under intense active research in order to develop new therapies (Akhurst et al, "Targeting the TGFbeta signalling pathway in disease," Nat. Rev. Drug Discov. 11 :790-811 (2012), which is hereby incorporated by reference in its entirety). In the preceding Examples, a TGFP-dependent, Smad reporter cell line was screened with a small molecule library consisting of bioactive drugs. Since Smad transcription factors are directly downstream of the TGFP receptor, it was expected to identify small molecules that could act directly on the TGFP receptor or Smad proteins, such as the small molecule inhibitor of the TGFP receptor, SB- 43152 (Laping et al., "Inhibition of transforming growth factor (TGF)-betal -induced
extracellular matrix with a novel inhibitor of the TGF-beta type I receptor kinase activity: SB- 431542," Mol. Pharmacol. 62:58-64 (2002), which is hereby incorporated by reference in its entirety). These data support that salinomycin indirectly targets the Smad pathway by working through the p38 signaling pathway. The p38 pathway functions in myofibroblast formation in part by providing a feed forward loop to stimulate Smad2/3 phosphorylation and activation (Figure 7) (Yang et al., "TRPV1 potentiates TGFbeta-induction of corneal myofibroblast development through an oxidative stress-mediated p38-SMAD2 signaling loop," PloS one 8:e77300 (2013), which is hereby incorporated by reference in its entirety). This is consistent with the data showing that salinomycin impairs phosphorylation of both p38 and Smad2 at later time points, whereas early time points were not affected (Figure 5). The p38-MAPK pathway has been implicated in fibrosis of the kidney, lung and heart (Fan et al., "Decreased expression of p38 MAPK mediates protective effects of hydrogen sulfide on hepatic fibrosis," Eur. Rev. Med. Pharmacol. Sci. 17:644-652 (2013); Li et al., "Inhibition of p38 mitogen-activated protein kinase and transforming growth factor-b eta 1 /Smad signaling pathways modulates the development of fibrosis in adriamycin-induced nephropathy," Am. J. Pathol. 169: 1527-1540 (2006); Zhang et al, "The role of the Grb2-p38 MAPK signaling pathway in cardiac hypertrophy and fibrosis," J. Clin. Invest. 111 :833-841 (2003); Matsuoka et al, "A p38 MAPK inhibitor, FR-167653, ameliorates murine bleomycin-induced pulmonary fibrosis," Am. J. .Physiol. Lung Cell. Mol. Physiol. 283:L103-112 (2002), which are hereby incorporated by reference in their entirety). Recently, a p38 inhibitor, Esbriet (pirfenidone) ((Moran N., "p38 kinase inhibitor approved for idiopathic pulmonary fibrosis," Nat. Biotechnol. 29:301 (2011), which is hereby incorporated by reference in its entirety), was approved for treatment of idiopathic pulmonary fibrosis in Europe, indicating the efficacy of targeting the pathway in fibrosis. While pirfenidone does slow the disease progression of pulmonary fibrosis, it does not stop it, indicating the need for more efficacious drugs.
[0238] Interestingly, a recent report demonstrated that p38 was activated by salinomycin in human ovarian cancer (Zhang et al., "Antitumor properties of salinomycin on cisplatin- resistant human ovarian cancer cells in vitro and in vivo: involvement of p38 MAPK activation," Oncol. Rep. 29: 1371-1378 (2013), which is hereby incorporated by reference in its entirety). However, the concentration of salinomycin used to treat cancer cells was much higher (2-7 uM) compared to the levels used in the preceding Examples (50-250 nM). Thus, the effects of salinomycin on activity of p38 may vary with cell type and treatment concentration. The activity of p38 is regulated by the upstream kinases, MKK3 and MKK6 (Figure 7) (Raingeaud et al, "MKK3- and MKK6-regulated gene expression is mediated by the p38 mitogen-activated protein kinase signal transduction pathway," Mol. Cell. Biol. 16: 1247-1255 (1996); Enslen et al., "Selective activation of p38 mitogen-activated protein (MAP) kinase iso forms by the MAP kinase kinases MKK3 and MKK6," J. Biol. Chem. 273: 1741-1748 (1998), which are hereby incorporated by reference in their entirety). While these two kinases are very similar in sequence and structure, they can often have differential effects on activation of p38 (Tanaka et al., "Differential involvement of p38 mitogen-activated protein kinase kinases MKK3 and MKK6 in T-cell apoptosis," EMBO Rep. 3:785-791 (2002), which is hereby incorporated by reference in its entirety). These data in human fibroblasts show that expression and activation of a constitutively active MKK6 attenuate the effect of salinomycin on p38 and myofibroblast formation (Figure 6). Further analysis of the role of salinomycin in altering MKK3/6 activity will clarify its mechanism of action.
[0239] Based on the similar results achieved with three structurally related polyether ionophores, it is believed that all three operate via the same mechanism of action. Salinomycin, its derivative narasin, and the related polyether ionophore, monensin all appear to have powerful anti-myofibroblast activity (Figure 3). The ability of all three to possess this ability opens up the possibility that polyether ionophore function is required. Polyether ionophores preferentially bind monovalent cations such as sodium and potassium (Antoszczak et al, "Synthesis, cytotoxicity and antibacterial activity of new esters of polyether antibiotic - salinomycin," Eur. J. Med. Chem. 76:435-444 (2014), which is hereby incorporated by reference in its entirety).
While this may be important in their coccidiostat properties, it is unclear if this is required to block TGFP function. However, since only nanomolar amounts of these ionophores are required, and there are micromolar levels or more of sodium and potassium ions in culture medium, it appears to be an alternative property of this family of molecules that is unrelated to their activity as ionophores. Development of new analogs of salinomycin, or other polyether ionophores, that alter the polyether moieties will help to elucidate the nature of their anti-TGFp properties.
[0240] Recent publications have reported on the exciting possibility that salinomycin is a powerful therapeutic in combating cancer stem cells (Naujokat et al., "Salinomycin as a drug for targeting human cancer stem cells," J. Biomed. Biotechnol. 2012:950658 (2012); Huczynski A., "Salinomycin: a new cancer drug candidate," Chem. Biol. Drug Des. 79:235-238 (2012); Wang Y., "Effects of salinomycin on cancer stem cell in human lung adenocarcinoma A549 cells," Med. Chem. 7: 106-111 (2011); Naujokat et al., "Salinomycin in cancer: A new mission for an old agent," Mol. Med. Rep. 3:555-559 (2010), which are hereby incorporated by reference in their entirety). The concept that salinomycin may target highly proliferative cells as opposed to other, more slowly growing cells is also supported by the data showing salinomycin is not toxic to human fibroblasts at the levels needed to blunt myofibroblast formation. Interestingly, salinomycin does not affect basal proliferation of human fibroblasts, but does prevent TGFP- induced proliferation (Figure 4). In addition to driving myofibroblast formation, another consequence of high TGFP levels in fibrosis and scarring are the unwanted proliferative effects (Akhurst et al, "Targeting the TGFbeta signalling pathway in disease," Nat. Rev. Drug Discov. 11 :790-811 (2012), which is hereby incorporated by reference in its entirety).
Example 4 - Characterization of Thyl Expression in Breast Implant Capsules and Its
Potential as a Pharmacologic Target to Modulate Scar Formation in Post- Irradiated Women
[0241] Capsular contracture is a poorly understood complication of radiation treatment following implant-based breast reconstruction. Thyl (CD90), a glycophosphatadyl inositol membrane anchored glycoprotein, is fundamental to myofibroblast differentiation. Herein, the expression of Thyl in implant capsule was characterized and tested as a potential pharmacologic target to modulate scar formation in post-irradiated women. [0242] Peri-implant tissue samples from irradiated (n=4) and non-irradiated (n=9) breast capsules were analyzed for expression of Thyl mRNA by qRT-PCR (Figure 8). Additionally, capsular fibroblasts were grown in vitro and treated with the pro-fibrotic cytokine transforming growth factor-β (TGFP) and the polyether ionophore salinomycin, and analyzed for expression of Thyl, aSMA, fibronectin, and collagen by Western blot (Figure 9 and Figures 10A-B). To investigate the fundamental role of Thyl in capsular fibroblast/myofibroblast formation, Thyl expression was depleted using Thyl siRNA (delivered by lentiviral transduction) (Figures 11 A- B).
[0243] RT-qPCR analysis revealed that irradiated capsule contained more Thyl mRNA than non-irradiated samples (13.2 vs. 4.0, P=0.02) (Figure 8). Western blot analysis showed that explanted fibroblasts treated with TGFP expressed increased aSMA and collagen I, which was nearly completely inhibited by salinomycin treatment (Figures 10A-B). Salinomycin
dramatically reduced the expression of Thyl in both untreated and TGFP treated cultures. Direct knockdown of Thyl by Thyl siRNA reduced capsular fibroblast/myofibroblast expression of aSMA and collagen I (Figures 11A-B).
[0244] In conclusion, irradiated breast capsules express more Thyl than non-irradiated breast capsule, indicating a seminal role for Thyl in capsule scar formation. Further, explant fibroblast cultures treated with TGFP showed increased production of collagen and aSMA, which was reduced by salinomycin treatment. Direct knockdown of Thyl by Thyl siRNA also reduced capsular culture expression of collagen and aSMA. These studies demonstrate that myofibroblast differentiation is important in capsular contracture and molecular targeting of Thyl by salinomycin or other small molecules, including other polyether ionophores, should reduce capsular contracture following radiation. It is expected that salinomycin and other polyether ionophores will be effective for controlling capsular contracture and inhibiting scar formation in reconstructed breast tissue in post-irradiated women.
Example 5 - Dose Responsiveness of Other Compounds from the Spectrum Collection
[0245] The initial Spectrum Collection screen identified five other compounds, beside salinomycin, that inhibit TGF -induced luciferase in the luciferase screening assay described in the preceding Examples. They are: Benzbromarone ("BZB"), Bithionate sodium ("BTS"), Piplartine (piperlongumine) ("PPT"), Amsacrine ("ASC"), and Alexidine ("AXD"). A secondary luciferase screening assay was performed to determine specificity and dose responsiveness of these compounds in comparison to salinomycin ("SNC"). The secondary screen utilizes dual luciferase technology that includes the above mentioned SBE-luciferase in addition to a Renilla luciferase that is under control of the constitutive SV40 promoter.
Therefore the SBE-luciferase activity can be normalized to the Renilla luciferase activity to control for toxicity and non-specific effects. The secondary screen can thus be used to remove small molecules that display overt toxicity and/or non-specific effects on the primary assay. Of these five compounds tested in the secondary screen, BTS, PPT, ASC, and AXD all exhibited strong luciferase inhibition at low micromolar levels (Figure 12).
[0246] The four compounds that displayed strong luciferase inhibition in the secondary screening assay were assessed for their ability to inhibit TGFP -dependent myofibroblast formation. Using the lowest effective dose from the secondary screening assay, PPT (5 μΜ), ASC (1 μΜ), BTS (1 μΜ), and AXD (1 μΜ) were compared to 0.1 μΜ SNC using primary human fibroblasts (Figure 13). The myofibroblast formation assay consists of the following protocol: fibroblasts are treated with the aforementioned small molecules and treated with TGFP (1 ng/ml) for 72 hours. The cells were then either photographed for morphological analysis or collected, lysed and analyzed by Western blot for the myofibroblast markers alpha-smooth muscle actin (aSMA) and calponin. β-tubulin was used as a loading control. Each of PPT (5 μΜ), ASC (1 μΜ), BTS (1 μΜ), and AXD (1 μΜ) inhibits myofibroblast formation.
[0247] Western blots were also performed using cell lysates from the primary human fibroblasts exposed to TGF to assess TGF -dependent aSMA and calponin expression. PPT was used at 1 and 5 μΜ (lanes 3 and 4), BTS was used at 0.1 and 1 μΜ (lanes 5 and 6), ASC was used at 0.1 and 1 μΜ (lanes 7 and 8), SNC was used at 100 nM and 1 μΜ (lanes 9 and 10), and AXD was used at 0.1 and 1 μΜ (lanes 11 and 12). The results, shown in Figure 14, demonstrate that PPT, BTS, ASC, and AXD inhibited marker expression at their higher doses, whereas SNC was effective even at the lower dose. SNC also inhibits expression of Thy 1 at both doses, demonstrating it works through a unique mechanism. AXD did inhibit Thyl at its high dose.
Example 6 - Assessing Efficacy of 10-Hydroxycamptothecin (HCPT) to Inhibit TGFp- Induced Myofibroblast Formation [0248] Primary human orbital fibroblasts, primary human lung fibroblasts, and primary mouse lung fibroblasts were treated with TGFp and HCPT (50 nM, 500 nM, and 5000 nM) or SNC (500 nM) or AXD (0.5 μΜ, 5 μΜ, and 50 μΜ) to assess the ability of HCPT to inhibit myofibroblast formation. Salinomycin and alexidine served as positive controls for anti-fibrotic activity. Western blots were performed using cell lysates from the fibroblasts exposed to TGFP to assess TGF -dependent aSMA expression. As shown in Figures 15 and 16, HCPT potently blocks myofibroblast formation and exhibits a dose-dependent inhibition of aSMA in both human orbital and lung fibroblasts.
[0249] Cells images related to the formation of myofibroblasts are shown in Figure 17. Human lung fibroblasts were treated with various concentrations of 10-hydroxycamptothecin (HCPT) (50 uM or 500 uM) and induced to form scar-forming myofibroblasts by treating with TGFp. Cells images were captured to show formation of myofibroblast in TGFP treated samples but not in samples with HCPT or salinomycin (SNC). HCPT potently blocks myofibroblast formation with out being overtly toxic as cell pictures show viable fibroblasts in HCPT treated cultures.
[0250] Similar dose-dependent responses were observed in mouse lung fibroblasts, although HCPT was less effective in blocking myofibroblast formation of mouse fibroblasts (compare Figure 18 to Figures 15-16). Example 7 - Assessing Efficacy of Omeprazole and Flutamide to Inhibit TGFp-Induced
Myofibroblast Formation
[0251] Primary human orbital fibroblasts were treated with TGFP and either 6- formylindolo(3,2-b)carbazole ("FICZ", 1 μΜ), Omeprazole ("Ome", 2 μΜ, 10 μΜ, 50 μΜ, 100 μΜ, 250 μΜ, 500 μΜ), or Flutamide ("Flut", 2 μΜ, 10 μΜ, 50 μΜ, 100 μΜ, 250 μΜ, 500 μΜ) to assess their ability to inhibit myofibroblast formation. FICZ was included as a positive control that blocks myofibroblast formation. Western blots were performed using cell lysates from the fibroblasts exposed to TGF to assess TGF -dependent aSMA expression. Densitometry analyses of the Western blots were also performed. The results demonstrate that omeprazole (Figure 19) and flutamide (Figure 20) inhibited TGF -induced myofibroblast differentiation of human orbital fibroblasts in a dose dependent manner. Omeprazole reduced aSMA expression to sub-baseline levels at 100 100 μΜ (Figure 19). No overt toxicity was observed.
Example 8 - Chembridge Collection Screen
[0252] Using the recombinant HEK293-Thyl SBE-Luc cell line described in the preceding Examples, the Chembridge collection of 20,000 small molecules was screened to identify other small molecules that inhibit TGFP activity and, thus, may be novel anti-scarring compounds [0253] The Chembridge screen revealed several potential anti-scarring compounds. 100 top candidates from the initial screen were re-screened. Results from this screen are shown in Figure 21. Numbers indicate the Chembride molecule ID number. The second screen controls for toxicity and non-specific effects by using a constitutive luciferase to normalize results. This assay can be further used in a high throughput fashion to analyze newly derived compounds and monitor structure activity relationships (SAR) to discover new molecules that can serve as the basis for anti-scarring therapeutics.
[0254] The 19 compounds listed in Table 1 are excellent inhibitors of TGFP signaling that do not display overt cytotoxic effects. The two-dimensional structures of the molecules are depicted in the left hand column. Chembridge collection IDs are listed in the second column and the additional columns denote the following (in order): the molecular name, the percent inhibition of the molecule using the screen (100% being a complete inhibition) (% Inhib.), and the internal key (key) for further identification in Figures 22 and 23.
Table 1: Hits found in Chem bridge collection (20,000 compounds) screen
Figure imgf000094_0001
Table 1: Hits found in Chem bridge collection (20,000 compounds) screen
Figure imgf000095_0001
Figure imgf000096_0001
[0255] Selected Chembridge hits were tested in myofibroblast formation assays using human orbital fibroblasts (Figure 22) and human lung fibroblasts (Figure 23). These cell images show the powerful effect of these small molecules in preventing TGFP induced myofibroblast formation while not causing cell death.
[0256] Although preferred embodiments have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the invention and these are therefore considered to be within the scope of the invention as defined in the claims which follow.

Claims

WHAT IS CLAIMED:
1. A method of treating fibrosis in a patient in need thereof comprising: administering to the patient an amount of a polyether antibiotic that is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
2. The method of claim 1, wherein the polyether antibiotic is selected from the group consisting of monensin, lasalocid, salinomycin, narasin, maduramycin, semduramycin, laidlomycin lonomycin, ionomycin, nigericin, grisorixin, dianemycin, lenoremycin, antibiotic X206, alborixin, septamycin, antibiotic A204, Compound 47,224, mutalomycin, isolasalocid A, lysocellin, tetronasin, etheromycin, antibiotic X-14766A, antibiotic A-23187, antibiotic A- 32887, Compound 51,532, and K41.
3. The method of claim 1, wherein the polyether antibiotic is selected from the group consisting of monensin, lasalocid, salinomycin, narasin, maduramycin, semduramycin, and laidlomycin.
4. The method of claim 1, wherein fibrosis is internal organ fibrosis.
5. The method of claim 4, wherein the fibrosis is liver fibrosis, heart fibrosis, pulmonary fibrosis, or kidney fibrosis.
6. The method of claim 1, wherein the fibrosis is scarring of eye tissue.
7. The method of claim 1 , wherein the fibrosis is present in reconstructed breast tissue in a post-irradiated patient.
8. The method of claim 1, wherein said administering is carried out orally, parenterally, periadventitially, subcutaneously, intravenously, intramuscularly, intraperitoneally, by inhalation, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, or by application to mucous membranes.
9. The method of claim 1 further comprising repeating said administering.
10. The method of claim 1, further comprising:
administering to the patient an amount of a second agent that is therapeutically effective to treat the fibrosis, wherein the second agent is different from the polyether antibiotic.
11. The method of claim 10, wherein the second agent is selected from the group consisting of calcium channel blockers, cytotoxic agents, cytokines, chemokines, integrins, growth factors, hormones, lysophosphatidic acid (LP A) receptor 1 antagonists, agents that modulate the TGF-β pathway, endothelin receptor antagonists, agents that reduce connective tissue growth factor (CTGF) activity, matrix metalloproteinase (MMP) inhibitors, agents that reduce the activity of platelet-derived growth factor (PDGF), agents that interfere with integrin function, agents that interfere with the pro-fibrotic activities of cytokines, agents that reduce oxidative stress, PDE4 inhibitors, PDE5 inhibitors, mTor inhibitors, modifiers of the arachidonic acid pathway, peroxisome proliferator-activated receptor (PPAR)-y agonists, kinase inhibitors, inhibitors of VEGF signaling pathway, matrix metalloproteinases, tissue inhibitors of
metalloproteinases (TIMPs), HGF agonists, angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor antagonists, inhibitors of advanced glycation endproducts (AGEs) or their receptors (RAGEs), Rho kinase inhibitors, PKC inhibitors, ADAM- 10 inhibitor, farnesoid X receptor agonists, caspase inhibitors, anti-oxidants, inhibitors of collagen expression, LMW heparin or heparin analogs, copper chelators, TNF-a blocking agents, HMG-CoA reductase inhibitors, and Thy-1 (CD90) inhibitors.
12. A method of treating fibrosis in a patient in need thereof comprising: administering to the patient an amount of amsacrine, alexidine, bithionate, or a combination thereof, wherein the amount is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
The method of claim 12, wherein the fibrosis is not secondary to microbial infection.
14. The method of claim 12, wherein amsacrine is administered alone or in combination with a polyether antibiotic.
15. The method of claim 12, wherein alexidine is administered alone or in combination with a polyether antibiotic.
16. The method of claim 12, wherein bithionate is administered alone or in combination with a polyether antibiotic.
17. The method of claim 12, wherein the fibrosis is internal organ fibrosis.
18. The method of claim 17, wherein the fibrosis is liver fibrosis, heart fibrosis, pulmonary fibrosis, or kidney fibrosis.
19. The method of claim 12, wherein the fibrosis is scarring of eye tissue.
20. The method of claim 12, wherein the fibrosis is present in reconstructed breast tissue in a post-irradiated patient.
21. The method of claim 12, wherein said administering is carried out orally, parenterally, periadventitially, subcutaneously, intravenously, intramuscularly, intraperitoneally, by inhalation, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, or by application to mucous membranes.
22. The method of claim 12 further comprising repeating said administering.
23. The method of claim 12, further comprising:
administering to the patient an amount of a second agent that is therapeutically effective to treat the fibrosis.
24. The method of claim 23, wherein the second agent is selected from the group consisting of calcium channel blockers, cytotoxic agents, cytokines, chemokines, integrins, growth factors, hormones, lysophosphatidic acid (LP A) receptor 1 antagonists, agents that modulate the TGF-β pathway, endothelin receptor antagonists, agents that reduce connective tissue growth factor (CTGF) activity, matrix metalloproteinase (MMP) inhibitors, agents that reduce the activity of platelet-derived growth factor (PDGF), agents that interfere with integrin function, agents that interfere with the pro-fibrotic activities of cytokines, agents that reduce oxidative stress, PDE4 inhibitors, PDE5 inhibitors, mTor inhibitors, modifiers of the arachidonic acid pathway, peroxisome proliferator-activated receptor (PPAR)-y agonists, kinase inhibitors, inhibitors of VEGF signaling pathway, matrix metalloproteinases, tissue inhibitors of metalloproteinases (TIMPs), HGF agonists, angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor antagonists, inhibitors of advanced glycation endproducts (AGEs) or their receptors (RAGEs), Rho kinase inhibitors, PKC inhibitors, ADAM- 10 inhibitor, farnesoid X receptor agonists, caspase inhibitors, anti-oxidants, inhibitors of collagen expression, LMW heparin or heparin analogs, copper chelators, TNF-a blocking agents, HMG-CoA reductase inhibitors, and Thy-1 (CD90) inhibitors.
25. A method of treating fibrosis in a patient in need thereof comprising: administering to the patient an amount of one or more agents selected from the group of 10-hydroxycamptothecin, omeprazole, esomeprazole, flutamide, 4,5-dichloro-2-methyl- N-(4-pyridinylmethyl)benzenesulfonamide, N-(2-methoxyphenyl)-3-phenyl-2-propynamide, 3- amino-4-chloro-N,N-diethylbenzamide, 4-ethoxy-2,3-dimethyl-N-(4- pyridinylmethyl)benzenesulfonamide, {5-[(4-chlorophenyl)thio]-2-furyl}methanol, N-(l - phenylethyl)[l]benzofuro[3,2-d]pyrimidin-4-amine hydrochloride, 3-[3-(2- chlorophenyl)acryloyl]-4,6-dimethyl-2(lH)-pyridinone, ethyl 2-amino-7-(hydroxyimino)- 4,5,6,7-tetrahydro-l-benzothiophene-3-carboxylate, 4-fluoro-3-methyl-N-(4- pyridinylmethyl)benzenesulfonamide, 3 -(4-fluorophenyl)-2-methyl-5 -phenylpyrazolo [1,5- a] pyrimidin-7(4H)-one, N-[4-(allyloxy)phenyl]-4-(4-morpholinomethyl)benzamide, 3-fluoro-N- (4-pyridinylmethyl)benzenesulfonamide, N- {4-[(tert- butylamino)sulfonyl]phenyl} isonicotinamide, N-methyl-2-(2-phenoxyethoxy)benzamide, N- 1 H- benzimidazol-2-yl-2-bromobenzamide, 3-benzyl-N-(4-methylphenyl)-7H-[l,2,4]triazolo[3,4- b] [ 1 ,3,4]thiadiazin-6-amine, 5 -(4-chlorophenyl)-2-methyl-3 -phenylpyrazolo [ 1 ,5-a]pyrimidin- 7(4H)-one, 4-chloro-N-[ 1 -(3,4-dimethylphenyl)ethyl]- 1 -methyl- lH-pyrazole-5-carboxamide, and 3-(2-furyl)-l l-methyl-2,3,4,5-tetrahydro-lH-dibenzo[b,e][l,4]diazepin-l-one,
wherein the amount is therapeutically effective to inhibit myofibroblast formation and thereby treat the fibrosis.
26. The method of claim 25, wherein the fibrosis is not secondary to microbial infection.
27. The method of claim 25, wherein one or more agents is administered alone or in combination with a polyether antibiotic.
28. The method of claim 25, wherein one or more agents is administered alone or in combination with one or more of amsacrine, bithionate, and alexidine.
29. The method of claim 25, wherein the fibrosis is internal organ fibrosis.
30. The method of claim 29, wherein the fibrosis is liver fibrosis, heart fibrosis, pulmonary fibrosis, or kidney fibrosis.
31. The method of claim 25, wherein the fibrosis is scarring of eye tissue.
32. The method of claim 25, wherein the fibrosis is present in reconstructed breast tissue in a post-irradiated patient.
33. The method of claim 25, wherein said administering is carried out orally, parenterally, periadventitially, subcutaneously, intravenously, intramuscularly, intraperitoneally, by inhalation, by intranasal instillation, by implantation, by intracavitary or intravesical instillation, intraocularly, intraarterially, intralesionally, transdermally, or by application to mucous membranes .
34. The method of claim 25 further comprising repeating said administering.
35. The method of claim 25, further comprising:
administering to the patient an amount of a second agent that is therapeutically effective to treat the fibrosis.
36. The method of claim 35, wherein the second agent is selected from the group consisting of calcium channel blockers, cytotoxic agents, cytokines, chemokines, integrins, growth factors, hormones, lysophosphatidic acid (LP A) receptor 1 antagonists, agents that modulate the TGF-β pathway, endothelin receptor antagonists, agents that reduce connective tissue growth factor (CTGF) activity, matrix metalloproteinase (MMP) inhibitors, agents that reduce the activity of platelet-derived growth factor (PDGF), agents that interfere with integrin function, agents that interfere with the pro-fibrotic activities of cytokines, agents that reduce oxidative stress, PDE4 inhibitors, PDE5 inhibitors, mTor inhibitors, modifiers of the arachidonic acid pathway, peroxisome proliferator-activated receptor (PPAR)-y agonists, kinase inhibitors, inhibitors of VEGF signaling pathway, matrix metalloproteinases, tissue inhibitors of metalloproteinases (TIMPs), HGF agonists, angiotensin-converting enzyme (ACE) inhibitors, angiotensin receptor antagonists, inhibitors of advanced glycation endproducts (AGEs) or their receptors (RAGEs), Rho kinase inhibitors, PKC inhibitors, ADAM- 10 inhibitor, farnesoid X receptor agonists, caspase inhibitors, anti-oxidants, inhibitors of collagen expression, LMW heparin or heparin analogs, copper chelators, TNF-a blocking agents, HMG-CoA reductase inhibitors, and Thy-1 (CD90) inhibitors.
37. A recombinant cell line comprising a recombinant gene that expresses a detectable expression product in a dose-dependent response to TGF concentration.
38. The recombinant cell line according to claim 37, wherein the expression product is luciferase.
39. The recombinant cell line according to claim 38, wherein the luciferase comprises a half-life that is less than 2 hours.
40. The recombinant cell line according to claim 38, wherein the recombinant gene comprises a promoter element operably coupled to an open reading frame for the detectable expression product.
41. The recombinant cell line according to claim 40, wherein the promoter element is operably coupled to a binding element responsive to TGFp.
42. The recombinant cell line according to claim 41, wherein a plurality of the binding elements responsive to TGFP are present.
43. The recombinant cell line according to claim 42, wherein four binding elements responsive to TGF are present.
44. The recombinant cell line according to any one of claims 41 to 43, wherein the binding element responsive to TGFp comprises the nucleotide sequence of SEQ ID NO: 2.
45. The recombinant cell line according to claim 40, wherein the promoter element is a thymidine kinase promoter according to SEQ ID NO: 1.
46. The recombinant cell line according to claim 37, wherein the recombinant cell line further comprises a selection gene product.
47. The recombinant cell line according to claim 37, wherein the cell line is a mammalian cell.
48. The recombinant cell line according to claim 37, wherein the cell line is a human cell.
49. A method of identifying a compound that inhibits TGF -mediated cellular activity, the method comprising:
growing a recombinant cell line according any one of claims 37 to 48 in the presence of TGF and a compound of interest, and
measuring the amount of the detectable expression product and comparing the measured amount to a control lacking the compound of interest and/or a control lacking TGF , wherein a significant difference in the measured amount of the detectable expression product, relative to the control, indicates that the compound of interest inhibits TGF -mediated cellular activity.
50. The method of claim 49, wherein the TGF -mediated cellular activity is myofibroblast formation.
51. The method of claim 49, wherein the detectable expression product is luciferase and said measuring is carried out using an optical detection system.
52. The method of claim 49, wherein said growing is carried out for at least about 12 hours before said measuring.
53. The method of claim 49, wherein said growing is carried out for at least about 24 hours before said measuring.
54. The method of claim 1, 12 or 25, wherein the fibrosis is not secondary to microbial infection.
PCT/US2015/036059 2014-06-16 2015-06-16 Small molecule anti-scarring agents Ceased WO2015195684A2 (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CA2952069A CA2952069C (en) 2014-06-16 2015-06-16 Small molecule anti-scarring agents
US15/319,254 US10548911B2 (en) 2014-06-16 2015-06-16 Small molecule anti-scarring agents

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US201462012602P 2014-06-16 2014-06-16
US62/012,602 2014-06-16
US201562114932P 2015-02-11 2015-02-11
US62/114,932 2015-02-11

Publications (2)

Publication Number Publication Date
WO2015195684A2 true WO2015195684A2 (en) 2015-12-23
WO2015195684A3 WO2015195684A3 (en) 2016-02-25

Family

ID=54936231

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2015/036059 Ceased WO2015195684A2 (en) 2014-06-16 2015-06-16 Small molecule anti-scarring agents

Country Status (3)

Country Link
US (1) US10548911B2 (en)
CA (1) CA2952069C (en)
WO (1) WO2015195684A2 (en)

Cited By (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2023540661A (en) * 2020-07-03 2023-09-26 ナンキン イムノファージ バイオテック カンパニー リミテッド Methods and compositions for targeting Tregs using CCR8 inhibitors
WO2024012325A1 (en) * 2022-07-12 2024-01-18 安徽神东生物科技开发有限责任公司 Use of mlph gene in preparation of drug for treating pneumoconiosis
US12274703B2 (en) 2017-12-21 2025-04-15 Gliapharm Sa Compositions and methods of treatment for neurological disorders comprising a dementia
US12310967B2 (en) 2017-12-21 2025-05-27 Gliapharm Sa Compositions and methods of treatment for neurological disorders comprising motor neuron diseases
US12433892B2 (en) 2018-12-22 2025-10-07 Gliapharm Sa Compositions and methods of treatment for neurological disorders comprising depression

Families Citing this family (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP4031669A4 (en) * 2019-09-22 2023-01-04 The National Institute for Biotechnology in the Negev, Ltd. SPECIFIC EXPRESSION OF A TUMOR ENVIRONMENT OF EFFECTIVE GENES
MX2022012726A (en) * 2020-04-13 2022-11-07 Aptabio Therapeutics Inc Pulmonary fibrosis medicine containing pyrazole derivative.
WO2021236718A1 (en) * 2020-05-20 2021-11-25 Fred Hutchinson Cancer Research Center Anti-fibrotic composition and related methods
CN113813283B (en) * 2020-06-19 2023-12-12 中山大学附属第六医院 Application of compounds in promoting skin injury repair
WO2025063816A1 (en) * 2023-09-21 2025-03-27 오토텔릭바이오 주식회사 Composition for treating uterine fibrosis comprising thiazole derivative compound

Family Cites Families (40)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US2353735A (en) 1941-02-21 1944-07-18 Burton T Bush Inc Germicidal soap
US2760988A (en) 1953-05-06 1956-08-28 Geigy Ag J R Bis(2-hydroxy-4, 5-dichlorophenyl) sulfide
US3212900A (en) 1962-05-10 1965-10-19 Konishiroku Photo Ind Photographic compositions
DE1189312B (en) 1963-12-06 1965-03-18 Schering Ag Means with selective herbicidal effect
US3468898A (en) 1966-05-26 1969-09-23 Sterling Drug Inc Bridged bis-biguanides and bis-guanidines
NL6913261A (en) 1968-09-09 1970-03-11
GB1460559A (en) 1975-05-01 1977-01-06 Ir I Orch Khim Sib Otdel Akade Method of preparing aromatic and heterocyclic sulphides and disulphides
SE7804231L (en) 1978-04-14 1979-10-15 Haessle Ab Gastric acid secretion
GB2055094B (en) * 1979-07-11 1984-05-31 Int Minerals & Chem Corp Polyether antibiotic zinc complexes
JPS5651457A (en) 1979-09-14 1981-05-09 Dev Finance Antitumoral compound and its manufacture
JPS5721320A (en) 1980-07-11 1982-02-04 Chugai Pharmaceut Co Ltd Blood sugar level depressing agent
US4473692A (en) 1981-09-04 1984-09-25 Kabushiki Kaisha Yakult Honsha Camptothecin derivatives and process for preparing same
US4366168A (en) 1981-09-21 1982-12-28 Eli Lilly And Company Anticoccidial combinations
US4764534A (en) 1982-05-04 1988-08-16 Eli Lilly And Company Anticoccidial naphthalenamines and combinations thereof
JPH0621083B2 (en) 1986-12-22 1994-03-23 株式会社三光開発科学研究所 Process for producing di (aryloxy) alkane
JPS6425763A (en) 1987-04-24 1989-01-27 Mitsubishi Chem Ind Pyrazoles and insecticide and acaricide containing said pyrazoles as active ingredient
JPH02145588A (en) 1988-11-29 1990-06-05 Konica Corp Production of 1,2,4-triazolo(3,4-b)-1,3,4-thiadiazine based compound substituted by heteroatom at 6-position
MX9200339A (en) 1991-01-28 1992-08-01 Hoechst Ag PREPARED FOR THE CONTROLLED RELEASE OF ACTIVE SUBSTANCES, WHICH ARE APPROPRIATE AS THERAPEUTICS OR TO IMPROVE THE GROWTH AND USE OF FEED IN RUMINANTS
FR2697723B1 (en) 1992-11-06 1995-03-03 Ungda Use of polyether ionophoric antibiotics in industrial extraction or production of sweet products.
IL112248A0 (en) 1994-01-25 1995-03-30 Warner Lambert Co Tricyclic heteroaromatic compounds and pharmaceutical compositions containing them
AUPM430894A0 (en) 1994-03-08 1994-03-31 Eli Lilly And Company A formulation and methods of treatment (1)
US6166069A (en) 1998-05-12 2000-12-26 American Home Products Corporation Phenyl oxo-acetic acids useful in the treatment of insulin resistance and hyperglycemia
AU2001268734A1 (en) 2000-06-28 2002-01-08 Merck & Co., Inc. Use of agents capable of reducing uric acid levels for the treatment of cardiovascular disease
US20040171603A1 (en) 2001-05-18 2004-09-02 Janos Pato Novel therapeutic targets for the treatment of mycobacterial infections and compounds useful therefor
ES2367422T3 (en) 2001-10-09 2011-11-03 Amgen Inc. IMIDAZOL DERIVATIVES AS ANTI-INFLAMMATORY AGENTS.
US9211259B2 (en) 2002-11-29 2015-12-15 Foamix Pharmaceuticals Ltd. Antibiotic kit and composition and uses thereof
US20060040980A1 (en) 2004-08-20 2006-02-23 Lind Stuart E Ionophores as cancer chemotherapeutic agents
WO2006093339A1 (en) 2005-03-02 2006-09-08 Sumitomo Chemical Company, Limited Use of cinnamoyl compound
US20090054381A1 (en) 2005-10-04 2009-02-26 Nitromed, Inc. Methods for treating respiratory disorders
US20070202051A1 (en) 2006-02-10 2007-08-30 Pari Gmbh Aerosols for sinunasal drug delivery
US20100093613A1 (en) 2007-03-09 2010-04-15 Kunkel Eric J Methods for identifying agents and their use for the prevention or stabilization of fibrosis
CN101906105B (en) 2009-06-08 2013-01-16 河北医科大学 Pyrazolo (1,5-a) pyrimidone derivative as well as drug combination thereof and application thereof
US8318737B2 (en) 2009-09-02 2012-11-27 Canthera Therapeutics Inc. Compounds and compositions for treating cancer
WO2011062955A2 (en) 2009-11-18 2011-05-26 University Of Massachusetts Compounds for modulating tlr2
US20130274215A1 (en) * 2010-04-08 2013-10-17 Fate Therapeutics, Inc. Pharmaceutical compositions to treat fibrosis
US8877188B2 (en) 2010-05-04 2014-11-04 The Brigham And Women's Hospital, Inc. Detection and treatment of non-dermal fibrosis
US9333242B2 (en) 2012-01-19 2016-05-10 Hybrid Medical, Llc Topical therapeutic formulations
US20130225595A1 (en) 2012-02-29 2013-08-29 Gilead Sciences, Inc. Method for treating pulmonary arterial hypertension in a patient not having idiopathic pulmonary fibrosis
WO2014066622A2 (en) 2012-10-24 2014-05-01 The Research Foundation For The State University Of New York Use of collagenase to treat glaucoma
WO2014099837A1 (en) 2012-12-18 2014-06-26 E. I. Du Pont De Nemours And Company Sulfonamide anthelmintics

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US12274703B2 (en) 2017-12-21 2025-04-15 Gliapharm Sa Compositions and methods of treatment for neurological disorders comprising a dementia
US12310967B2 (en) 2017-12-21 2025-05-27 Gliapharm Sa Compositions and methods of treatment for neurological disorders comprising motor neuron diseases
US12433892B2 (en) 2018-12-22 2025-10-07 Gliapharm Sa Compositions and methods of treatment for neurological disorders comprising depression
JP2023540661A (en) * 2020-07-03 2023-09-26 ナンキン イムノファージ バイオテック カンパニー リミテッド Methods and compositions for targeting Tregs using CCR8 inhibitors
EP4175949A4 (en) * 2020-07-03 2024-02-28 Nanjing Immunophage Biotech Co., Ltd. Methods and compositions for targeting tregs using ccr8 inhibitors
JP7653166B2 (en) 2020-07-03 2025-03-28 ナンキン イムノファージ バイオテック カンパニー リミテッド Methods and compositions for targeting Tregs using CCR8 inhibitors
US12552753B2 (en) 2020-07-03 2026-02-17 Nanjing Immunophage Biomedical Co., Ltd. Methods and compositions for targeting Tregs using CCR8 inhibitors
WO2024012325A1 (en) * 2022-07-12 2024-01-18 安徽神东生物科技开发有限责任公司 Use of mlph gene in preparation of drug for treating pneumoconiosis

Also Published As

Publication number Publication date
US20170216332A1 (en) 2017-08-03
WO2015195684A3 (en) 2016-02-25
US10548911B2 (en) 2020-02-04
CA2952069A1 (en) 2015-12-23
CA2952069C (en) 2022-06-14

Similar Documents

Publication Publication Date Title
US10548911B2 (en) Small molecule anti-scarring agents
US9750761B2 (en) LDH inhibitors as treatment for fibrosis and fibrotic-related disorders
US20200325130A1 (en) Proteolysis Targeting Chimera Compounds and Methods of Preparing and Using Same
RU2519779C2 (en) Quinazolinone, quinolone and related analogues as sirtuin modulators
EP2609082B1 (en) Imidazo[4,5-c]quinolines as dna-pk inhibitors
CN115443276B (en) Pyridopyrimidone derivatives and their use as aryl hydrocarbon receptor modulators
EP2651403B1 (en) Use of lp-pla2 inhibitors in the treatment and prevention of eye diseases
CN102414180A (en) 8-substituted quinolines and related analogs as sirtuin modulators
WO2012047587A2 (en) Mdm2 inhibitors for treatment of ocular conditions
KR20110036602A (en) Benzimidazole and related analogs as sirtuin modulators
KR20110098789A (en) Isoindolinone and related analogs as sirtuin modulators
KR20110110194A (en) Thiazolopyridine sirtuin modulating compounds
KR20140007865A (en) Novel composition for the treatment of cystic fibrosis
JP2023107784A (en) VAP-1 inhibitors for the treatment of pain
JP2017149745A (en) Blockade of inflammatory proteases by theta defensin
US20200069647A1 (en) RelA Inhibitors for Biofilm Disruption
JP2023518375A (en) Method of treatment
EP2671589A1 (en) Medicinal agent for prevention or treatment of diseases associated with intraocular neovascularization and/or intraocular vascular hyperpermeability
JP2023549762A (en) Methods and compositions for treating fibrotic diseases
KR20200100726A (en) Compounds and compositions for treating fibrosis
WO2023064195A1 (en) Cgrp antagonists for treating trigeminal neuralgia
WO2025087941A1 (en) Parg inhibitors in combination with parp inhibitors and uses thereof
CA2203379C (en) Cgmp-pde inhibitors for the treatment of erectile dysfunction
WO2026000074A1 (en) Use of cd38 inhibitors for reducing th2 inflammation
NZ613118B2 (en) Novel composition for the treatment of cystic fibrosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15810038

Country of ref document: EP

Kind code of ref document: A2

ENP Entry into the national phase

Ref document number: 2952069

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 15319254

Country of ref document: US

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15810038

Country of ref document: EP

Kind code of ref document: A2