WO2015194832A1 - Immunostimulating composition containing recombinant giardia lamblia binding immunoglobulin protein - Google Patents

Immunostimulating composition containing recombinant giardia lamblia binding immunoglobulin protein Download PDF

Info

Publication number
WO2015194832A1
WO2015194832A1 PCT/KR2015/006091 KR2015006091W WO2015194832A1 WO 2015194832 A1 WO2015194832 A1 WO 2015194832A1 KR 2015006091 W KR2015006091 W KR 2015006091W WO 2015194832 A1 WO2015194832 A1 WO 2015194832A1
Authority
WO
WIPO (PCT)
Prior art keywords
recombinant
glbip
protein
dendritic cells
cells
Prior art date
Application number
PCT/KR2015/006091
Other languages
French (fr)
Korean (ko)
Inventor
박순정
이혜연
김주리
Original Assignee
연세대학교 산학협력단
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 연세대학교 산학협력단 filed Critical 연세대학교 산학협력단
Publication of WO2015194832A1 publication Critical patent/WO2015194832A1/en

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/395—Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Immunostimulating composition comprising recombinant Ramblel flagella binding immunoglobulin protein
  • the present invention relates to an immunoadjuvant composition
  • an immunoadjuvant composition comprising a recombinant Ramble flagellar binding immunoglobulin protein.
  • the Ramble flagella (Giardia Iambi i a) is a protozoan parasite that causes intestinal malabsorption and diarrhea in mammals, including humans. Giardiasis has a variety of clinical manifestations, from asymptomatic to severe diarrhea. Although the Rambler's trophic type does not penetrate tissue, the mucosal surface of the intestinal epidermal cells can be stimulated by antigen expression in the Rambler's flagellum. The mechanism needs to be elucidated to understand the regulation of the immune response during infection. Variant flagellar clones variant surface proteins from GS / M-83-H7 and G1VSP are considered to be antigens that induce a primary immune response in mice as well as in humans infected with the lamba flagella.
  • G1VSP is responsible for the mutation of the Rambler flagella antigen because GIVSP continuously changes in vivo and thereby causes the Rambler flagella to evade the host immune response. It has also been reported that ⁇ -l giardin is an immunodominant protein with plasma membrane-binding ability and glycosaminoglycan ⁇ binding ability (Weiland M, Palm J, Griffiths WJ, McCaffery JM & Svard SG, Int J Parasitol 2003; 33: 13411351).
  • IL-6 Interleukin-6
  • the present inventors have found that the recombinant recombinant Glamb1 ia binding immunoglobulin protein (rGlBiP) has been shown to enhance immune activation through immune responses such as cytokine production of mouse dendritic cells and maturation of dendritic cells.
  • the present invention has been completed by clarifying that the immunopromoting effect can be obtained by greatly improving.
  • Another object of the present invention is to provide a method for enhancing immune response.
  • Another object of the present invention is to provide a method for maturing dendritic cells. Another object of the present invention is to provide a method for screening epitopes having immunogenicity.
  • Another object of the present invention is to provide a method for screening antibodies against protein antigens.
  • the present invention provides a pharmaceutical composition
  • a pharmaceutical composition comprising: ( a ) a pharmaceutically effective amount of a Gibardi a 1 amb 1 ia binding immunoglobul in protein or a fragment thereof; And (b) provides a pharmaceutical composition for immunostimulation comprising a pharmaceutically acceptable carrier.
  • the present invention provides a method for enhancing an immune response comprising administering the pharmaceutical composition to a subject in need thereof.
  • the present invention provides a method for maturing dendritic cells comprising administering the pharmaceutical composition to a subject in need thereof.
  • immune boost refers to inducing an initial immune response or increasing the existing immune response to the antigen to a measurable extent.
  • rGlBiP binding immunoglobulin protein
  • the recombinant Ramble flagella immunoglobulin protein encodes an N-terminal region (12-427 amino acids of SEQ ID NO: 1 to 427) that encodes a DNA sequence of 1281 bp and a DNA sequence of 753 bp
  • a protein SEQ ID NO: 1 comprising the C-terminal site (amino acids 428 to 677 of SEQ ID NO: 1), commonly used in the same terms as recombinant GlBi P or rGlBiP.
  • fragment of recombinant ramble flagella binding immunoglobulin protein refers to a protein fragment comprising some amino acid sequence of said recombinant ramble flagella binding immunoglobulin protein.
  • the fragment of the recombinant Lambblem binding immunoglobulin protein means a protein comprising an N-terminus or a C-terminus.
  • the fragment of the lambda flagellar immunoglobulin protein comprises the C-terminus of the recombinant lamba flagella binding immunoglobulin protein, that is, amino acids 428 to 677 of SEQ ID NO: 1.
  • composition of the present invention may include other drugs or other immune adjuvant to provide additional immune stimulating effects.
  • Additional adjuvant agents include, for example, lipopullysaccharide (LPS), Freund's complete adjuvant, fats and oils, aluminum salts, Krestin, Lentinan and AHCCC Active Hexose Correlated Compound. However, it is not limited to this.
  • composition for immunostimulation of the present invention can be applied to a variety of diseases, for example, (i) cancer (eg, stomach cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, large intestine) Cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, parathyroid cancer and ureter cancer); (ii) viruses (eg adenoviruses, herpesviruses (eg HSV-I, HSV- II, CMV or VZV), poxviruses (eg smallpox, vaccinia or molluscum contagiosum) Orthomyxoviruses (eg rhinoviruses or enteroviruses), orthomyxoviruses (eg influenza viruses), paramyxoviruses (eg 5-parainfluenza viruses) Yumps mumps virus ( ⁇ mps virus), respiratory
  • Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in the preparation, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, calcium phosphate, alginate, Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil Including, but not limited to.
  • the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like.
  • a lubricant e.g., a talc, a glycerol, a glycerol, a glycerol, a glycerol, a g., g., g., g., g., g., g., sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, sorbitol, a glycerol, a glycerol, a glycerol, a glycerol, a glycerol, a glycerol, a glycerol, a g
  • the pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, and the like. have.
  • Suitable dosages of the pharmaceutical compositions of the present invention will vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to response of the patient. It may be prescribed.
  • the oral dosage of the pharmaceutical composition of the present invention is preferably 0.001-100 mg / kg (body weight) per day.
  • compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporating into a multi-dose container.
  • the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer.
  • the invention provides a method for screening epitopes having immunogenicity comprising the following steps:
  • epitope refers to the site of an antigen that interacts with an antibody. More specifically, epitope refers to a protein determinant capable of specifically binding to immunoglobulin (i ⁇ unoglobulin) or T-cell receptor.
  • the epitopes of the present invention include any molecule or substance that can increase immunoreaction.
  • epitopes of the present invention include, but are not limited to, peptides, nucleic acids encoding these peptides, and glycoproteins.
  • Methods of immunization with the Ramibella Iambi i binding immunoglobulin protein or fragments thereof and proteins as epitope candidates include various immunoadministration methods known in the art, preferably parenteral administration. In the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, or transdermal administration.
  • the subject is a non-human animal.
  • mammals other than humans include various animals commonly used in the art, and are preferably mammals, and most preferably mice, rabbits or rats.
  • Immune response measurement in can be made through, for example, a method of measuring the titer of anti-peptide antibodies (total IgG, IgGl and IgG2a) by taking serum from a subject animal to which the selected liposome-captured peptide was administered.
  • the method for measuring the titer of the antibody is performed by ELISA (Enzyme 1 inked immunosorbent assay), Lateral flow test (MIACMagnet ic immunoassay) and immunoprecipitation (I ⁇ unoprecipi tat ion). More preferably, ELISA assays can be used, wherein a specific peptide sequence is used for the anti-peptide antibody. When increasing the titer, the particular peptide is considered an epitope or peptide vaccine.
  • the invention provides a method for screening antibodies against protein antigens comprising the following steps:
  • step (d) contacting the resultant of step (c) with the protein antigen; (e) analyzing the binding of the protein antigen to the antibody of interest.
  • the subject is an animal except a human, and a description thereof is as described above.
  • Protein antigens or candidate antibodies of the invention can be labeled with a detectable label.
  • the detectable label may be a chemical label (eg biotin), an enzyme label (eg horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase ⁇ -galactosidase and ⁇ -glucosidase Radiolabels (eg, C 14 ,.
  • fluorescent labels eg, coumarin, fluorescein, FITC (f luoresein Isothi ocyanate), rhodamine 6G, rhodamine B, TAMRA ( 6-carboxy-tetramethyl-rhodamine), Cy-3, Cy-5 Texas Red, Alexa Fluor, DAP I (4, 6-di am idi ⁇ -2-pheny 1 i ndo 1 e), HEX, TET, Dabsyl and FAM), luminescent labels, chemi luminescent labels, fluorescence resonance energy transfer (FRET) labels or metal labels (eg, gold and silver).
  • fluorescent labels eg, coumarin, fluorescein, FITC (f luoresein Isothi ocyanate), rhodamine 6G, rhodamine B, TAMRA ( 6-carboxy-tetramethyl-rhodamine), Cy-3, Cy-5 Texas Red, Alexa Fluor, DAP I (4,
  • the binding between the protein antigen and the antibody may cause a signal from the label to be detected. Can be detected and analyzed.
  • alkaline phosphatase bromochloroindolylphosphate (BCIP), nitro blue tetrazolium (NBT), naphtho-AS-B1-phosphate (naphtho® AS-Bl-phosphate) and ECF ( Signals are detected using a chromogenic reaction substrate such as enhanced chemi fluorescence.
  • chloronaph When hose radish peroxidase is used as a label, chloronaph is used, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorupin benzyl ether, luminol , Amflex Red Reagent (10-acetyl-3,7-dihydroxyphenoxazine, Pierce), HYR (p-pheny 1 ened i am i ne-HC 1 and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di [3-ethylbenzthiazol ine sulfonate]), 0PD (ophenyl ened i amine) and nap are detected using a substrate such as / pyronine.
  • Amflex Red Reagent 10-acetyl-3,7-dihydroxyphenoxazine, Pierce
  • binding of the antibody of interest to the protein antigen may be analyzed without labeling the interactants.
  • a microphysiometer can be used to analyze whether the antibody of interest binds to a protein antigen.
  • Microphysiometers are analytical tools that can measure the acidifying rate of cells using the light-addressable potent iometric sensor (LAPS). The change in acidification rate can be used as an indicator for binding between the candidate antibody and the protein antigen.
  • LAPS light-addressable potent iometric sensor
  • BIA bimolecular interaction assay
  • the present invention provides a pharmaceutical composition for immunostimulation comprising a ramble flagellar binding immunoglobulin protein or fragment thereof.
  • the recombinant ramble flagella binding immunoglobulin protein of the present invention may suppress immune response such as cytokine production of dendritic cells and maturation of dendritic cells. Since it greatly improves immune activation, not only can be usefully used as an agent for enhancing the immune, but also as an adjuvant of the vaccine.
  • FIG. 1 is a diagram showing the formation of the Rambler flagella recombinant BiP and anti-GlBi p antibody.
  • La shows that recombinant GlBi P was expressed in Escherichia coli using a histidine tag, purified using Talon affinity chromatography and then subjected to 12% SDS-PAGE stained with Coomass ie: (1) SDS-PAGE gel stained with Coomass ie, (2) Western blot using anti-histidine antibody (1: 5000 dilution), (3) Western blot using anti-lambella flagellum (1: 1000 dilution).
  • Lb purified recombinant GlBiP was used as an antigen to prepare polyclonal antibodies using intraperitoneal injection of non-pathogenic rats, and after 3 injections every 2 weeks, serum was obtained from immunized 3 ⁇ 4 and obtained. The titer of the antibody was examined. Western blot of Rambler flagella extract with anti-GlBi P (l; 2000 dilution) was performed.
  • SM represents protein size markers and immunoreactive recombinant GlBiP and native GlBiP are indicated by arrows and arrowheads, respectively.
  • FIG. 2 shows that recombinant GlBi P triggers costimulatory expression and MHCI I molecule expression.
  • 3A-3D show cytokine production by recombinant GlBiP stimulated mouse dendritic cells.
  • the experimental results are expressed as the mean standard deviation of three representative experiments.
  • Figure 4 shows cytokine production by mouse dendritic cells stimulated with Ramblerella extract. The experimental results are expressed as the mean standard deviation of three representative experiments.
  • FIG. 5 shows that recombinant GlBi induces cytokine production in myeloid cell-derived dendritic cells.
  • immature myeloid cell-derived dendritic cells were pre-cultured for 1 hour using anti-TLR4 antibody or anti-TLR2 antibody.
  • Relative homologous IgG was used as a control.
  • the cells were then co-cultured for 16 hours using recombinant GlBiP, and the culture supernatants were analyzed for TNF- ⁇ .
  • 5B shows that HEK293 cells transfected with pFLAG-TU using recombinant GlBiP for an additional 20 hours. Stimulated and then dissolved to measure luciferase activity.
  • FIG. 5C shows that myeloid cells derived from wild type, allogeneic TLR4 knockout and homologous TLR2 0 mice and dendritic cells derived from TLR2 knockout myeloid cells derived dendritic cells were treated with recombinant GlBiP. Cell culture supernatants were obtained to analyze the production of cytokines (IL-12, TNF-Q and IL-6). As a positive control, myeloid cell derived dendritic cells were cultured in LPS. The experimental results are expressed as the mean ⁇ standard deviation of three representative experiments.
  • FIG. 6 shows that cytokine production induced by recombinant GlBiP is MyD88-dependent.
  • 6A shows that myeloid cell-derived dendritic cells derived from the femur and tibia of wild-type BALB / c mice and the homologous MyD88 knockout mice were differentiated into dendritic cells. Immature dendritic cells were stimulated with the following stimulation at concentrations indicated for rGlBiP at 0.1-10 mg / mL for 16 hours and at 0.5 mg / mL for LPS.
  • FIG. 6B shows co-immunoprecipitation of MyD88 using anti-TLR4 antibody in THP-1 cells stimulated by recombinant GlBiP.
  • Lysates of THP-1 cells were incubated with recombinant GlBiP for 2 hours, reacted with anti-TLR4 or anti-MyD88 antibodies and then precipitated with Protein G Sepharose beads (i ⁇ unoprecipi tat ion : IP). Proteins in immunoprecipitates were analyzed by Western blot (WB) using anti-MyD88 or anti-TLR4.
  • Figure 7 is a diagram showing the role of cytokine production induced by recombinant GlBiP in dendritic cells.
  • the inhibitor of FIG. 7A is an ERK1-specific inhibitor (PD98059) and the inhibitor of FIG. 7B is a p38-specific inhibitor (SB202190).
  • FIG. 8 is a diagram showing the weighted binding activation of NF- ⁇ ⁇ and AP-1 in recombinant GlBiP stimulated with recombinant GlBiP. Nucleation was made from immature dendritic cells. Three microorganisms in the nuclear extract were used for binding assays with biotin-11UTP-labeled NF- ⁇ ⁇ -oligonucleotides (FIG. 8A) or AP-1 oligonucleotides (FIG. 8B). To measure the specificity of binding relative amounts of unlabeled oligonucleotides To the coupling reaction. Cells were also treated with LPS, a positive control.
  • 9 shows the mapping of functional domains for dendritic cell activation in GlBiP.
  • 9A shows a schematic of three recombinant GlBiP proteins (full length recombinant GlBiP, truncated recombinant GlBiP-N and truncated recombinant GlBiP-C), respectively.
  • 9B is a diagram showing Western blot analysis (1: 1,000 dilution) of the recombinant GlBiP protein using an anti-Ramble flagella antibody.
  • 9C is a diagram showing cytokine production by mouse dendritic cells stimulated using recombinant GlBiP protein. The experimental results are expressed as the mean standard deviation of three representative experiments.
  • FIG. 10 shows cytokine production by T cells through dendritic cell activation induced by recombinant GlBiP.
  • FIG. 12 shows the identification of antigenic molecules reacted with anti-Ramble flagella antibodies.
  • Figure 12a is a diagram showing the Western blot of the Rambler flagella extract using an anti-Ramble flagellar antibody. Western blot of the Ramblellella extract using anti-Ramblellella antibody showed two major immunoreactive bands at 74 kDa and 30 kDa and minor bends at 63 kDa and 25 kDa.
  • Figure 12b is a diagram showing the fraction of the Ramblellellar protein using a Viva-spin column. The Viva-spin column is an ultrafiltration device that separates proteins according to molecular weight.
  • FIG. 12C shows the fraction of the Ramble flagella protein using DEAE Sepharose cation exchange chromatography (1,000 kDa-100 kDa). Proteins eluted with 0.1 M NaCl-0.5 M NaCl were reacted with anti-Ramble flagella antibodies or full-serum sera. Asterisks indicate the fractions selected for the next round of chromatography.
  • 12D shows the Ramble flagella layer using gel filtration chromatography. Figure shows the fraction of protein (eluted with 0.2 M NaCl).
  • Proteins eluted with 0.1 M NaCl-0.5 M NaCl were reacted with anti-Ramble flagella antibodies or full-serum serumol.
  • An immunoreactive protein band (arrow head) of 74 kDa was analyzed by MALDI-T0F.
  • FIG. 13 shows the effect of polymyxin B on cytokine production on cytokine production in recombinant myeloid cell-derived dendritic cells stimulated with recombinant GlBiP.
  • Nutrients derived from the wild type GS (ATCC50581, American Type Culture Collection, Mannassas, VA) strains were cultured in TYI-S-33 medium for 72 hours (2% casein digest, 1% yeast extract, 13 glucose, 0.2% NaCl, 0.2% L-cysteine, 0.02% ascorbic acid, K2HP04, 0.06% H2P04, 10% calf serum, and 0.05 mg / mL bovine bile, pH 7.1).
  • the Ramblel flagella GS nutrient was subjected to a suspension in lysis buffer (PBS: 137 mM NaCl, 1.7 mM KCl, 10 mM Na 2 HP0 4 and 2 mM 3 ⁇ 4P0 4 , pH 7.3), and sonication. Dissolved. Protein extracts were prepared by centrifugation at 800 g for 5 minutes. l (ig extracts were mixed using 0.1 ml of complete Freund adjuvant (Sigma, St. Louis, M0) and injected intraperitoneally into pathogenic mice (BALB / c mice, 6 week old females) At 2 and 4 weeks after primary immunization Two additional vaccinations were performed using the same amount of protein combined with incomplete Freund's agent.
  • Proteins that passed through a Viva spin membrane with a cutoff value of 1,000-100 kDa were bound using a DEAE Sepharose fast flow rate (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) followed by an exchange column (volume 15x1 cm). Subsequent fractionation by cation exchange chromatography equilibrated with buffer (20 mM Tris-HCl, pH8.5). The protein bound to the column was eluted with increasing the concentration of NaCl from 0.1M to 0.5M. Each fraction was analyzed by Western blot using the anti-Ramble flagella antibodies described above.
  • Protein concentration of each fraction was measured by Bradford assay (Biorad, Hercules, CA). Fractions obtained from each purification step were separated by SDSPAGE and transferred to a polyvinylidene fluoride (PVDF) membrane (Mi 11 ipore, Billerica, Mass.). Membranes were incubated with a polyclonal mouse anti-lambler filamentous antibody in blocking solution (1: 1,000 dilution, PBS with 5% skim milk, and 0.05% Tween 20), and alkaline phosphatase (alkaline phosphatase) AP) -binding rat anti-mouse IgG (Sigma) (1: 1000 dilution) was treated. Immune reaction protein Nitro-blue tetrazolium (NBT) / 5-bromo-4-chloro-3- Visualization was performed using an indolyl phosphate (BCIP) system (Promega, Madison, Wis.).
  • PVDF polyvinylidene fluoride
  • the 74 kDa immunoreactive protein was excised from the eluted gel filtration chromatography fraction and subjected to in-gel digestion (Sigma) using trypsin. Digested products were analyzed by MALDI-TOF MS, as well as by quadrupole TOFCquadrupole TOF, Q-TOP). Ion spectral products were collected in information-dependent acquisition (IDA) mode and analyzed using Agilent 6530 Accurate-Mass Q-TOP MS. Dual mass spectrometry spectra were submitted to the Mascot Inhouse Database Research Engine (GiardiaDB) of the present invention for a Q-T0P Liquid Chromatography-Dual Mass Spectrometer (LC-MS / MS) data set. The molecular weight error ranges of the mass spectra of 100 ppm and 0.2 Da were used for precursor ions and chip ions, respectively. Mascot ion scores greater than 37 were used as criteria for protein identification.
  • A2,034-bp DNA fragment containing bip0RFGL50581_3283 was constructed using two primers, namely primer rBiP_F (5'-CCGGAATTCGATGACGTCTAGTCGCGTTAA-3 ': underlined side indicates EcoRI position) and primer rBiP_R (5'-CCGCICGAGGAGCTCATCTTTCTCT : The underlined base was heavy using Xhol position) and then cloned into pET21b (+) expression vector (Novagen, Darmstadt, Germany).
  • the DNA fragment containing bip 0RF was digested into two parts.
  • the 5'-site (1,280 bp) of bip was transformed into the primers, namely recombinant BiP-F (5'-CCGGAATTCGGGTGCGAAGGATCATGATGT-3 ': underlined base indicates site) and recombinant BiP-NR (5'-CCGCTCGAGGCTAAGGATGGAGGCCTGCA-3' : The underlined base represents the Xhol site) and amplified from genomic DNA of the Ramble flagella layer.
  • the 3 'region of the bip (754 bp) was heavy using another set of primers, ie rBiP-CF (5'-CCGGAATTCGGGTGCGAAGGATCATGATGT-3': EcoRI site) and recombinant ⁇ 11 ⁇ .
  • the obtained bip DNA fragment was cloned into pET21b (Novagen) to generate overexpressing plasmids for the cleaved recombinant GlBiP polypeptide, ie pETBiP-N and pETBiP-C.
  • the recombinant GlBiP was overexpressed in E.coUl BL2UDE3 by adding 1 mM of IPTG (isopropyl thio- ⁇ -D-galactoside) and purified by Talon affinity chromatography according to the manual (Clonetech, Mountain View, CA). .
  • Dendritic cells were preincubated for 1 hour at room temperature at 1 g / niL PmB prior to reaction with 500 ng / mL LPS or 100 ng / mL recombinant GlBiP. After 16 hours, TNF- ⁇ , IL-12 and IL-6 levels in the supernatants of myeloid cell-derived dendritic cells were measured using an ELISA kit.
  • Recombinant GlBiP purified as an antibody for producing polyclonal antibodies via intraperitoneal injection into pathogen-free rats was used (CrjBgi: CD [SD] IGS, 6-weeks-old, females). After three injections at two week intervals, serum was obtained from immunized rats and the titer of the antibodies obtained was tested. One hundred nanograms of recombinant GlBiP were isolated by 12% SDS-PAGE and nitrocells were transferred to the rose membrane. Membranes can be anti-Ramble flagella antibody (1: 1,000 dilution) or anti-GlBiP antibody (1: 2,000 dilution) followed by AP-bound Cultured with rat anti-mouse IgG. Immunostimulatory proteins were detected as described above.
  • BALB / c mice were obtained from OrientBio (Seoul, Korea) and TLR2 knockout (K0) (TLR2 /), TLR4 K0 TLR4 /) and myeloid differentiation factor 88 (MyD88) knockout (MyD88 /) mice were obtained from Dr. Akira ( Obtained from BALB / c mice provided by S. Akira (Department of Host Defense, Research Institute for Microbial Diseases, Osaka University. 'Japan). The animals were humanely cared for according to the research institution's guidelines and the Korean statutory requirements.
  • Myeloid cell derived dendritic cells were prepared from the femur and tibia of BALB / c mice and subjected to suspension in erythrocyte elution buffer (150 mM NH4C1, 10 mM KHC03, and 1 mM EDTA, pH 7.4). After centrifugation, cells were differentiated into myeloid cell-derived dendritic cells (BMDC) supplemented with 100 U / mL of penicillin / streptomycin (GIBC0, Karsruhe, Germany), and 10% FBS, 50 ⁇ of mercaptoethanol.
  • BMDC myeloid cell-derived dendritic cells
  • GM-CSF JW CreaGene, Seongnam, Korea
  • Immature myeloid cell-derived dendritic cells were treated with recombinant GlBiP (0.1 to 5 ⁇ g / mL) or Ramble flagella extract (50 yg / mL) for 16 hours. Cells were then harvested, washed with PBS and measured the percentage percentage of dead (stained) cells using the live / dead fixable dead cell stain kit (Invitrogen, Carlsbad, Calif.) Ice in order Staining for 20 minutes in the stomach.
  • GlBiP 0.1 to 5 ⁇ g / mL
  • Ramble flagella extract 50 yg / mL
  • Immature mouse dendritic cells were dispensed in 48 well culture plates and incubated for 16 hours using Rambler flagella extract (50yg / mL), recombinant GlBiP (0.1-10 yg / mL) or LPS (0.5 yg / mL). Supernatants were analyzed according to the manual (BD Biosciences, Franklin Lakes' NJ) by sandwich ELISA to detect TNF- ⁇ , IL-12, IL-6 and IL-4.
  • Rat myeloid cell-derived dendritic cells were treated with 5 yg / mL mouse TLR4 monoclonal antibody (BioLegend, San Diego, CA), mouse TLR2 monoclonal antibody (BioLegend) or homologous control IgG antibody (BioLegend) treated with recombinant GlBiP.
  • mice TLR4 monoclonal antibody BioLegend, San Diego, CA
  • mouse TLR2 monoclonal antibody BioLegend
  • homologous control IgG antibody BioLegend
  • HEK293 cells were polarized to 1 ⁇ 10 5 cells on 12 well culture plates. Dispensed cells were transient with 0.5 ug of NF-KB luciferase plasmid [pGUL8p-luc +] (27), 5 ng of pCHllO (Promega) and O.lug of pFLAG-TLR2 (28) or pFLAG-TLR4 (28). By transfection with Lipofectamine 2000 (Invitrogen). As a control, pFLAG-CMVl (Invitrogen) was substituted for pFLAG-TLR2 or pFLAG-TLR4. Transfection.
  • Human embryonic kidney cells HEK 293 (CRL-1573; American Type Culture Collection), 4.5 g / L glucose, 10% heat inactivated fetal bovine serum (FBS), 100 U / mL penicillin, 100 ug / Cultured in DMEM supplemented with mL streptomycin and 10 ug / mL blasticidine (blasticidin S, InvivoGen, San Diego, Calif.).
  • THP-1 cells incubated with recombinant GlBiP were lysed in lysis buffer (10 mM TrisHCl, ⁇ 7.4, 5 mM EDTA, 130 mM NaCl, 1% Triton X— 100, 1% 4-amidino-phenyl-methylsul fonyl fluoride, and 1% incubated with anti-TLR4 monoantibody Absor anti-MyD88 monoclonal antibody (Cell Signaling, Beverly, MA) overnight at 4 ° C and then with protein G agarose beads. Precipitate at 4 ° C. for 4 hours. The precipitated protein was then analyzed by Western blot using anti-TLR4 or anti-MyD88 antibody (Cell Signaling). 16. Inhibition of MAPK Pathway in Dendritic Cells Treated with Recombinant GlBiP
  • Mouse myeloid cell-derived dendritic cells dispensed into 24-well culture plates were stimulated with recombinant GlBiP at various times (3-60 minutes) and then processed for nuclear extracts.
  • cells were lysed on ice for 100 minutes in 100 lysate sol [10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, and 1 mM dithiothreitol (DTT)] and 12.5 of 10% Nonidet P-40 Added to cells. After 8 min centrifugation at 20,000 g at 4 ° C, the nuclear pellets were resuspended in 25 ice cold nucleus extract buffers and kept on ice for 15 minutes with intermittent stirring.
  • 100 lysate sol 10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, and 1 mM dithiothreitol (DTT)
  • Binding assays were performed in nuclear extract binding buffer (100 mMTris, 500 mMKCl and 10 mM DTT, pH 7.5) using a Biotin® labeled probe (100 mM Tris, 500 mM KCl and 10 mM DTT, pH 7.5).
  • the sequence of the sense strand oligonucleotide is as follows: NF- ⁇ ⁇ 5′-AGTTGAGGGGACTTTCCCAGGC-3 ′ (Pr omega) and AP-1, 5′-CGCTTGATGAGTCAGCCGGAA-3 ′ (Pr omega).
  • Protein-DNA complexes were electrophoresed on 4 ° C., 6% polyacrylamide gels in 0.5 ⁇ Tr is / Boric acid / EDTA (TBE) buffer and transferred to nylon membranes.
  • UV-crosslinked membranes were treated using a Straptoavidin-Western pepper Peroxidase bond (Pierce) and then X-rays were detected using a Light-Shift Chemi luminescent EMSA Kit (Pierce) to detect DNA bands. Exposed to ray film.
  • nuclear extracts were prepared from myeloid cell-derived dendritic cells stimulated with 0.5 / ml LPS for various times and used as positive controls during binding assays.
  • Na ⁇ ve T-cells were prepared from BALB / c mouse spleens. Splenocytes were lysed in erythrocyte supernatant. CD4 + T Cells in AutoMACSCmagnet I c-act ivated Cell Sorting Separator CD4 (L3T4) It was isolated using MicroBeads (Miltenyi Biotec, Auburn, CA). Dendritic cells treated with 1 yg / mL of recombinant GlBiP were co-cultured at 1:10 dendritic cell: T cell ratio using CD4 + T cells for 24 hours.
  • the Ramblel flagella (strain GS ATCC50581) was used and cultured for infection as described above.
  • BALB / c mice were infected by gavage at 5 ⁇ 10 5 G in the Ramble flagella nutrient of phosphate-buffered saline (PBS).
  • PBS phosphate-buffered saline
  • serum was obtained from infected mice and lysates of Ramblerella or recombinant GlBiP protein were used for Western blot analysis.
  • experimental results are expressed as the mean standard deviation of three representative experiments. Experimental data were analyzed by pairwise comparison using Student's t-test (SYSTAT program, SIGMAPL0T version 9; Systat Software Inc., Chicago, IL, USA). If the P-value was less than 05, the deviation was considered significantly. Experimental data with P values less than 0.01 are represented by two asterisks and experimental data with P-values between 0.01 and 0.05 are represented by one asterisk.
  • the multiclonal antibody (anti-lambella flagella antibody) was prepared using the Ramblellella worm extract as an antigen. Immunoblotting of the prepared antibody and Rambler's flagellar extract showed two major immune response bands of 74 and 30 kDa, Two secondary immunoreactive proteins of 62 and 25 kDa were shown, respectively (FIG. 12A). Lamella flagella extracts were then fractionated using three procedures, and we identified that 74 kDa protein exhibited strong immunity of the anti-lambella flagellum layer.
  • the protein eluted with 0.2 M NaCl was layered on a gel filtration column equilibrated with 20 mM Tr i s-HCl, pH 8. 5 and then eluted with 0.2 M NaCl to elute protein (fractions). Nos. # 22 to # 30) demonstrated the immunoreaction against the Rambler's flagella antibody (FIG. 12D).
  • GlBiP is a 74 kDa protein that has reacted with an anti-Ramble flagella antibody
  • Bip from the Ramble flagella is recombined in E. coli (£. ⁇ ? //) It was expressed as a protein and the BiP of the obtained Rambler flagella was purified. Purified recombinant GlBiP was found that the anti-Ramble flagella, which we used to identify the anti-Ramble flagella, through fractionation experiments, reacted with the anti-Ramble flagella antibody (FIG. La).
  • the purified recombinant GlBiP was then used as an antibody for preparing specific polyclonal antibodies in rats, and the specificity of the anti-GlBiP antibody obtained was analyzed by Western blot analysis of the Ramblerella influencer extract. That is, innate BiP of the Rambler flagellum was clearly detected as an immunoreactive band of 74 kDa (FIG. Lb). 3. Induction of Dendritic Cell Maturation and Pre-inflammatory Cytokine Secretion by Recombinant GlBiP
  • Dendritic cells are specialized antigen-presenting cells (APCs) that migrate to local lymph nodes that recognize pathogens and eventually activate appropriate T cells.
  • APCs antigen-presenting cells
  • BMDC mouse bone marrow-derived dendritic cells
  • PmB an allele against LPS. Cells were incubated for 24 hours in the presence of 0.1 ⁇ g / mL recombinant GlBiP (FIG. 13).
  • TNF- ⁇ in dendritic cells with defects of recombinant rGlBiP was not affected by ⁇ treatment, whereas the production of TNF-CL was dramatically affected by PmB in dendritic cells treated with LPS. Therefore, dendritic cells were pretreated with PmB at 1 ⁇ g / mL in dendritic cells treated with LPS to inhibit the immunological activity of LPS in subsequent experiments.
  • FIG. 2 Myeloid cell derived dendritic cells were incubated for 24 hours in the presence of various recombinant GlBiPs ranging from 0.1 to 5 pg / mL and then analyzed for expression of the surface markers.
  • the percentage proportion of cells expressing surface marker MHCII did not increase rapidly (51% to 68%) as small amounts (0.1 ⁇ g / mL) and large amounts (5 ⁇ g / mL) of recombinant GlBiP.
  • myeloid cell-derived dendritic cells were treated with 0.1 ii g / mL recombinant GlBiP in the following experiment.
  • the percentage proportion of cells showing expression of MHC class II increased from 28% to 65% in reactions treated with recombinant GlBiP.
  • cells expressing cost inml atory molecules, namely CD86 and CD80 also increased by 21% to 59% and 25% to 613 ⁇ 4>, respectively.
  • Dendritic cells derived from mouse myeloid cells were stimulated using various concentrations of recombinant GlBiP (0.1-10 ⁇ g / mL) and then analyzed for IL-12, TNF- ⁇ , IL-6 and IL-4 secretion. (FIG. 3). Recombinant GlBiP secreted higher levels of TNF- ⁇ , IL-12 and IL-6 than control cells.
  • dendritic cells defective in recombinant GlBiP secreted very large amounts of IL-12 (70, 900 pg / mL) in a dose dependent manner.
  • Significant amounts of TNF-a and IL-6 were also secreted by dendritic cells treated with GlBiP (70, 900 pg / mL).
  • Significant amounts of TNF-ci and IL-6 were also secreted by dendritic cells treated with recombinant GlBiP (1, 098 and 2, 322 pg / mL), respectively.
  • levels of TNF-a and IL-6 were reduced at high concentrations of recombinant GlBiP.
  • the inventors have studied how the BiP protein in the Rambler flagella and how the recognition causes dendritic cell activation and cytokine production.
  • TLRs Tol-like receptors
  • Myeloid cell derived dendritic cells were treated with antibodies specific for TLR2 or TLR4 prior to stimulation with recombinant GlBiP.
  • IgG isotype control IgG instead of TLR antibody and then stimulated using recombinant GlBiP in the same manner.
  • the recombinant GlBiP damaged dendritic cells were analyzed for production of TNF- ⁇ .
  • cells pretreated with TLR4 antibody showed a significant decrease in TNF-ci production as compared to protein cells treated with isotype IgG (482 g / mL).
  • TLR4 In mouse dendritic cells, to study the function of TLR4 in recombinant GlBiP-induced cytokine production, we also reconstituted an in vitro system using HEK 293 cells, in which TLR2 Or TLR 4 was expressed with a common adapter protein, MyD88 (Medzhi tov R, Preston-Hurlburt P, Kopp E, et al, Mol Cel l 1998; 2: 253-258.). As a control, another set of HEK 293 cells was transfected with a blank for p ' FLAG- TLR2 or pFLAG-TLR4, pFLAG-CMVl.
  • the system includes a luciferase reporter for normalized NF- ⁇ ⁇ using transfection efficiency.
  • the ability of recombinant Ramble flagella to induce cytokine production was monitored by measuring the luciferase activity of HEK 293 cells expressing TLR4, HEK 293 cells expressing TLR2, and control HEK 293 cells (FIG. 5B).
  • HEK 293 carrying pFLAG-CMV was 57 or 26, respectively, indicating relatively reduced luciferase activity.
  • TLR4 in cytokine production induced by recombinant GlBiP by dendritic cells using the TLR4 knockout mouse model (FIG. 5C).
  • Myeloid cell-derived dendritic cells in TLR4-/-mice showed a sharp decrease (12 pg / mL) in IL-12 secretion induced by recombinant GlBi P, whereas myeloid cell-derived dendritic cells in TLR2-/-mice were recombinant.
  • recombinant GlBiP-treated induced IL-6 production by dendritic cells was obtained in wild type and TLR2-/-mice (6, 792 and 7, 139 pg / mL, respectively).
  • TLR4-/-mouse-derived cells are part of the IL-6 segment induced by recombinant Gl BiP. Reductions were expressed as 4, 082 pg / mL, while testing of wild-type myeloid cell-derived dendritic cells with LPS and TNF- ⁇ resulted in decreased production of TNF-ci (5,300 and 90 pg / mL, respectively). .
  • MyD88 is an adapter that mediates the signaling between surface TLRs and intracellular signaling components (Suzuki N, Suzuki S & Yeh WC, Trends Iunol 2002; 23: 503-506). However, some TLR ligands activate intracellular signaling components such as TRIF without the involvement of MyD88. We investigated whether MyD88 was associated with cytokines induced by recombinant GlBiP BiP (FIG. 6A).
  • Myeloid cell-derived dendritic cells prepared from MyD88 were previously reported when tested using LPS (Takeuchi 0, Takeda K, Hoshino, et al, Int Iun unol 2000; 12: 113117), IL-12, It failed to produce TNF- ⁇ or IL-6.
  • MyD88 suggests that it is an essential signaling component involved in TLR4 / BiP interactions.
  • the interaction between MyD88 and TLR4 was monitored by measuring the physical binding of TLR4 and MyD88 in dendritic cells treated with recombinant GlBiP (FIG. 6B).
  • Lysates derived from dendritic cells treated with recombinant GlBiP were subjected to immunoprecipitation using anti-TLR4 or anti-MyD88 antibodies.
  • Western blot analysis of the precipitated lysates showed that 2-3 times more MyD88 co-precipitated with anti-TLR4 antibodies obtained from recombinant GlBiP-treated cells as compared to untreated cells.
  • Anti-MyD88 antibody sedimented twice as much as recombinant GlBiP stimulated cells than untreated cells. The results demonstrate that binding between TLR4 or MyD88 was increased in dendritic cells exposed to recombinant GlBiP. 7. Role of MAPK in Cytokine Production Induced by Recombinant GlBiP Derived from Dendritic Cells
  • MAP is a well characterized signaling kinase that triggers cellular reaction to pathogenic microorganisms.
  • MAPK subfamily in eukaryotic cells: ERKl / 2, p38 and JNK.
  • the kinase is activated independently or simultaneously in response to various extracellular stimuli such as physical stress, inflammatory cytokines, growth hormones and bacterial components.
  • the present inventors investigated the role of MAPK in cytokine production induced by the Ramble bilayer BiP in mouse dendritic cells.
  • Exposure of recombinant GlBiP resulted in phosphorylation of ERK1 / 2 with maximal activation 10 minutes after stimulation. Phosphorylation of ERK1 / 2 also occurred when maximal activation in dendritic cells treated with LPS was observed 8 minutes after stimulation.
  • Pretreatment of dendritic cells with SB202190, an inhibitor of p38 MAPK resulted in reduced production of IL-12 and TNF-Q up to 12% and 32%, respectively, of levels measured in untreated cells in response to recombinant GlBiP ( 7b).
  • Exposure of mouse dendritic cells to recombinant GlBiP resulted in p38 phosphorylation with maximal activation between 8 and 10 minutes of stimulation. LPS treatment of mouse dendritic cells also induced phosphorylation of p38 MAPK.
  • GlBiP comprises two putative domains, namely an actin binding domain (N-terminal site) and a thermolayer protein (C-terminal site), respectively.
  • an actin binding domain N-terminal site
  • a thermolayer protein C-terminal site
  • two truncated recombinant GlBiP proteins a recombinant GlBiP-N domain and a recombinant GlBiP-C domain were expressed in E. coli (FIG. 9A).
  • the recombinant GlBiP protein was incubated with the anti-Ramble flagella antibody used for the identification of recombinant GlBiP, rGlBiP-N domain and rGlBiP-C domain were expressed in E.
  • FIG. 9A When the recombinant Gi P protein was incubated with anti-lambler flagella antibody (FIGS. 12 and 1), full-length rGlBiP and rGlBiP-colonies showed immunoreactive proteins while they were not present in Western blot analysis using pre-immune serum. (FIG. 9B).
  • Another truncated recombinant GlBiP, recombinant GlBiP-N domain did not react with the full-range serum or anti-lambler flagell antibody.
  • the cleaved recombinant GlBiP protein was used to stimulate dendritic cells derived from mouse myeloid cells (FIG. 9C).
  • Combination GlBiP with Hsp70 domain was efficient at inducing TNF- ⁇ and IL-12 from stimulated dendritic cells.
  • recombinant GlBiP with an actin binding domain did not stimulate cytokine production from mouse myeloid cell-derived dendritic cells.
  • CD4 + T cells obtained from mouse splenocytes were co-cultured with mouse dendritic cells treated with recombinant GlBiP or recombinant GlBiP-C domains, they were IL-2 (174 pg / mL or 2, respectively). , 364 pg / mL) (A in FIG. 10).
  • CD4 + T cells co-cultured with mouse dendritic cells treated with the recombinant GlBiP-N domain did not release IL-2 (2 pg / mL).
  • IL-2 is a dendritic cell to which recombinant GlBiP has been delivered.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Veterinary Medicine (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Public Health (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Mycology (AREA)
  • Microbiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The present invention relates to an immunostimulating composition containing a recombinant Giardia lamblia binding immunoglobulin protein. The recombinant Giardia lamblia binding immunoglobulin protein of the present invention greatly improves immune activation through an immune reaction such as the cytokine production of dendritic cells and the maturation of dendritic cells, and thus can be useful as an immunostimulating preparation.

Description

【명세서】  【Specification】
【발명의 명칭】  [Name of invention]
재조합 람블편모층 결합 면역글로블린 단백질을 포함하는 면역증강 조성물  Immunostimulating composition comprising recombinant Ramblel flagella binding immunoglobulin protein
【기술분야】  Technical Field
본 발명은 재조합 람블편모충 결합 면역글로블린 단백질을 포함하는 면역증강조성물에 관한 것이다.  The present invention relates to an immunoadjuvant composition comprising a recombinant Ramble flagellar binding immunoglobulin protein.
【배경기술】  Background Art
람블편모층 (Giardia Iambi i a)은 인간을 포함하는 포유동물에서 장내 흡수불량 및 설사를 야기하는 원생동물 기생충이다. 람블편모층증 (Giardiasis)은 무증상부터 심각한 설사까지 다양한 임상적 발현 방식을 갖는다. 람블편모충 영양형은 조직으로 침투하지 못한다 하더라도, 장내 표피세포의 점막 표면은 람블편모층의 항원 발현에 의해 자극 받을 수 있다ᅳ 따라서， 숙주 면역체계에 의해 인지된 람불편모충의 항원은 람블편모층의 감염 동안 면역 반응의 조절을 이해하기 위해 그 메커니즘이 해명될 필요가 있다. 람불편모층 클론 GS/M-83-H7 및 G1VSP 유래의 변이체 표면 단백질은 람블편모층에 감염된 인간뿐만 아니라 마우스에서 1차 면역반응을 유도하는 항원으로 고려된다. G1VSP는 GIVSP가 in vivo에서 연속적으로 변화하고, 그렇게함으로써 람블편모층이 숙주 면역 반응을 회피하게 만들기 때문에 람블편모층 항원의 변이에 원인이 된다. 또한， α-l 지아르딘 (giardin)은 원형질막 -결합 능력 및 글라이코사미노글라이칸ᅳ결합 능력을 갖는 면역우성 단백질이라는 것이 보고되었다 (Weiland M, Palm J, Griffiths WJ, McCaffery JM & Svard SG, Int JParasitol 2003 ;33: 13411351).  The Ramble flagella (Giardia Iambi i a) is a protozoan parasite that causes intestinal malabsorption and diarrhea in mammals, including humans. Giardiasis has a variety of clinical manifestations, from asymptomatic to severe diarrhea. Although the Rambler's trophic type does not penetrate tissue, the mucosal surface of the intestinal epidermal cells can be stimulated by antigen expression in the Rambler's flagellum. The mechanism needs to be elucidated to understand the regulation of the immune response during infection. Variant flagellar clones variant surface proteins from GS / M-83-H7 and G1VSP are considered to be antigens that induce a primary immune response in mice as well as in humans infected with the lamba flagella. G1VSP is responsible for the mutation of the Rambler flagella antigen because GIVSP continuously changes in vivo and thereby causes the Rambler flagella to evade the host immune response. It has also been reported that α-l giardin is an immunodominant protein with plasma membrane-binding ability and glycosaminoglycan ᅳ binding ability (Weiland M, Palm J, Griffiths WJ, McCaffery JM & Svard SG, Int J Parasitol 2003; 33: 13411351).
람블편모층의 감염은 대개 자기 제한적이고， 이것은 효과적인 숙주 방어의 존재를 나타낸다. 인터루킨 -6(이하 IL-6라 함)는 람블편모충에 감염된 마우스에서 향상된 수준으로 발견되었다 (Zhou P, Li E, Zhu N, et al . Infect I隱 im 2003； 71： 1566-1568). 람블편모층 감염의 조절은 야생형 마우스 보다 IL— 6가 결핍된 마우스에서 더 느렸고 (Bienz M, Dai WJ, Welle M, Gottstein B & Muller N, Infect Immun 2003； 71： 15691573), 야생형 마우스에서 비만세포 (mast cell)는 중요한 역할을 하였다 (Li E, Zhou P, Petr in Z & Singer SM, Infect I誦 un 2004； 72： 6642-6649) . 또한 람블편모충의 방출에 노출된 상피세포가 람블편모층 케모카인 (C-C 모티프) 리간드 20을 방출한다는 것이 보고되었다 (Roxstrom-Lindqui st K , Palm D , Reiner D, Ringqvi st E & Svard SG, Trends Paras i tol 2006； 22： 26-31) . 넉아웃 (knock out ) 마우스를 이용하여 in vivo 감염과 함께 마우스에서 람블편모층 감염에 대한 마이크로어레이 분석은 iN0S( induci bl e ni tr i c oxide synthase) 및 기질금속단백질 분해효소 7(matr ix metal loprotease , 顧 P7)이 람블편모층 감염의 조절에 있어서 중요한 역할을 한다는 것을 입증하였다 (Tako EA , Hassimi MF, Li E & Singer SM, mBio 2013； 6： e00660-13) . 본 명세서 전체에 걸쳐 다수의 논문 및 특허문헌이 참조되고 그 인용이 표시되어 있다. 인용된 논문 및 특허문헌의 개시 내용은 그 전체로서 본 명세서에 참조로 삽입되어 본 발명이 속하는 기술 분야의 수준 및 본 발명의 내용이 보다 명확하게 설명된다. Infection of the Rambler's flagellum is usually self-limiting, indicating the presence of effective host defense. Interleukin-6 (hereinafter referred to as IL-6) was found to be at an improved level in mice infected with Ramblerella (Zhou P, Li E, Zhu N, et al. Infect I 隱 im 2003; 71: 1566-1568). Regulation of Ramble flagella infection was slower in mice deficient in IL-6 than wild type mice (Bienz M, Dai WJ, Welle M, Gottstein B & Muller N, Infect Immun 2003; 71: 15691573), and obesity in wild type mice Cells played an important role (Li E, Zhou P, Petr in Z & Singer SM, Infect I'un 2004; 72: 6642-6649). It has also been reported that epithelial cells exposed to the release of the Ramblerella worm release Ramblellellar chemokine (CC motif) ligand 20 (Roxstrom-Lindqui st K, Palm D, Reiner D, Ringqvi st E & Svard SG, Trends Paras i tol 2006; 22: 26-31). Microarray analysis of Ramble flagella infection in mice with in vivo infection using knockout mice was performed using induci bl nitr oxy oxide synthase (iN0S) and matr ix metal loprotease. , 顧 P7) has been shown to play an important role in the regulation of Ramblerella infection (Tako EA, Hassimi MF, Li E & Singer SM, mBio 2013; 6: e00660-13). Throughout this specification, many papers and patent documents are referenced and their citations are indicated. The disclosures of cited papers and patent documents are incorporated herein by reference in their entirety, and the level of the technical field to which the present invention belongs and the contents of the present invention are more clearly explained.
【발명의 상세한설명】  Detailed Description of the Invention
【기술적 과제 1  Technical problem 1
본 발명자들은 동정된 재조합 람블편모층 결합 면역글로불린 단백질 (recombinant G . 1 amb 1 i a binding immunoglobul in protein , rGlBiP)이 마우스 수지상 세포의 사이토카인 생산과 수지상 세포의 성숙과 같은 면역반응을 통해 면역 활성화를 크게 향상시킴으로써 면역증진 효과를 나타낼 수 있음을 규명함으로써， 본 발명을 완성하게 되었다.  The present inventors have found that the recombinant recombinant Glamb1 ia binding immunoglobulin protein (rGlBiP) has been shown to enhance immune activation through immune responses such as cytokine production of mouse dendritic cells and maturation of dendritic cells. The present invention has been completed by clarifying that the immunopromoting effect can be obtained by greatly improving.
따라서， 본 발명의 목적은 면역증진용 약제학적 조성물을 제공하는데 있다.  Accordingly, it is an object of the present invention to provide a pharmaceutical composition for immunostimulation.
본 발명의 다른 목적은 상기 면역중진용 약제학적 조성물의 제조를 위한 람블편모층 결합 면역글로블린 단백질 또는 그의 단편의 용도를 제공하는 데 있다.  It is another object of the present invention to provide a use of a lambda flagella binding immunoglobulin protein or fragment thereof for the preparation of the pharmaceutical composition for immunostimulation.
본 발명의 또 다른 목적은 면역반웅을 증진시키는 방법을 제공하는 데 있다.  Another object of the present invention is to provide a method for enhancing immune response.
본 발명의 또 다른 목적은 수지상 세포를 성숙화하는 방법을 제공하는 데 있다. 본 발명의 또 다론 목적은 면역원성을 가지는 에피토프의 스크리닝 방법을 제공하는데 있다. Another object of the present invention is to provide a method for maturing dendritic cells. Another object of the present invention is to provide a method for screening epitopes having immunogenicity.
본 발명의 또 다른 목적은 단백질 항원에 대한 항체의 스크리닝 방법을 제공하는데 있다. 본 발명의 다른 목적 및 이점은 하기의 발명의 상세한 설명, 청구범위 및 도면에 의해 보다 명확하게 된다.  Another object of the present invention is to provide a method for screening antibodies against protein antigens. Other objects and advantages of the present invention will become apparent from the following detailed description, claims and drawings.
【기술적 해결방법】  Technical Solution
본 발명의 일 양태에 따르면, 본 발명은 (a) 람블편모층 결합 면역글로불린 단백질 (Gi ardi a 1 amb 1 i a binding immunoglobul in protein) 또는 그의 단편의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 면역증진용 약제학적 조성물을 제공한다. According to an aspect of the present invention, the present invention provides a pharmaceutical composition comprising: ( a ) a pharmaceutically effective amount of a Gibardi a 1 amb 1 ia binding immunoglobul in protein or a fragment thereof; And (b) provides a pharmaceutical composition for immunostimulation comprising a pharmaceutically acceptable carrier.
본 발명의 다른 일 양태에 따르면, 본 발명은 상기 약제학적 조성물을 이를 필요로 하는 개체에게 투여하는 단계를 포함하는 면역반응을 증진시키는 방법을 제공한다.  According to another aspect of the present invention, the present invention provides a method for enhancing an immune response comprising administering the pharmaceutical composition to a subject in need thereof.
본 발명의 또 다른 일 양태에 따르면， 본 발명은 상기 약제학적 조성물을 이를 필요로 하는 개체에게 투여하는 단계를 포함하는 수지상 세포를 성숙화하는 방법을 제공한다.  According to another aspect of the present invention, the present invention provides a method for maturing dendritic cells comprising administering the pharmaceutical composition to a subject in need thereof.
본 명세서에서 용어 "면역증진" 은 초기 면역 반웅을 유도하거나 항원에 대한 기존의 면역 반응을 측정 가능할 정도로 증가시키는 것을 말한다.  As used herein, the term "immune boost" refers to inducing an initial immune response or increasing the existing immune response to the antigen to a measurable extent.
본 명세서에서 용어 "재조합 람블편모층 결합 면역글로블린 단백질 (recombinant G . 1 amb 1 i a binding immunoglobul in protein , rGlBiP) " 은 람블편모층의 결합 면역글로블린 단밸질 (BiP) 상동체 (GL50581_3283) (sequence coverage, 36%： MASCOT score , 1227)를 의미한다. 하나의 특정예에서， 상기 재조합 람블편모층 결합 면역글로블린 단백질은 1281 bp의 DNA 염기서열을 암호화하는 N-말단 부위 (서열목록 제 1서열의 1 내지 427번째 아미노산)와 753bp의 DNA 염기서열을 암호화하는 C-말단 부위 (서열목록 제 1서열의 428 내지 677번째 아미노산)를 포함하는 단백질 (서열목록 제 1서열)을 의미하며， 재조합 GlBi P 또는 rGlBiP와 동일한 용어로 흔용하여 사용한다. 본 명세서에서 용어 "재조합 람블편모층 결합 면역글로블린 단백질의 단편" 은 상기 재조합 람블편모층 결합 면역글로블린 단백질의 일부 아미노산 서열을 포함하는 단백질 단편을 의미한다 . 하나의 특정예에서， 상기 재조합 람블편모충 결합 면역글로블린 단백질의 단편은 N-말단 또는 C-말단을 포함하는 단백질을 의미한다 . As used herein, the term "recombinant G. 1 amb 1 ia binding immunoglobul in protein (rGlBiP)" refers to the binding immunoglobulin protein (BiP) homolog (GL50581_3283) (sequence coverage, 36%: MASCOT score, 1227). In one specific example, the recombinant Ramble flagella immunoglobulin protein encodes an N-terminal region (12-427 amino acids of SEQ ID NO: 1 to 427) that encodes a DNA sequence of 1281 bp and a DNA sequence of 753 bp Refers to a protein (SEQ ID NO: 1) comprising the C-terminal site (amino acids 428 to 677 of SEQ ID NO: 1), commonly used in the same terms as recombinant GlBi P or rGlBiP. As used herein, the term "fragment of recombinant ramble flagella binding immunoglobulin protein" refers to a protein fragment comprising some amino acid sequence of said recombinant ramble flagella binding immunoglobulin protein. In one specific example, the fragment of the recombinant Lambblem binding immunoglobulin protein means a protein comprising an N-terminus or a C-terminus.
본 발명의 일구현예에 따르면， 상기 람블편모충 결합 면역글로블린 단백질의 단편은 재조합 람블편모층 결합 면역글로블린 단백질의 C-말단, 즉 서열목톡 제 1서열의 428 내지 677번째 아미노산올 포함한다.  According to one embodiment of the present invention, the fragment of the lambda flagellar immunoglobulin protein comprises the C-terminus of the recombinant lamba flagella binding immunoglobulin protein, that is, amino acids 428 to 677 of SEQ ID NO: 1.
본 발명의 조성물에는 기타 약물 또는 다른 면역 보조제가 포함되어 추가적인 면역 자극 효과를 제공할 수 있다. 추가되는 면역 보조제는 예를 들어 리포풀리사카라이드 (LPS), 프레운트 완전 보조제 (Freund's complete adjuvant), 유지 , 알루미늄염， 크레스틴 (Krestin) , 렌티난 (Lentinan) 및 AHCCCActive Hexose Correlated Compound)를 포함하나， 이에 제한되는 것은 아니다ᅳ  The composition of the present invention may include other drugs or other immune adjuvant to provide additional immune stimulating effects. Additional adjuvant agents include, for example, lipopullysaccharide (LPS), Freund's complete adjuvant, fats and oils, aluminum salts, Krestin, Lentinan and AHCCC Active Hexose Correlated Compound. However, it is not limited to this.
본 발명의 면역증강용 조성물은 다양한 질환에 적용될 수 있으며, 예를 들어， (i) 암 (예컨대, 위암， 폐암， 유방암， 난소암， 간암， 기관지암, 비인두암， 후두암， 췌장암， 방광암， 대장암， 결장암, 자궁경부암， 뇌암, 전립선암， 골암， 피부암， 갑상선암， 부갑상선암 및 요관암); (ii) 바이러스 (예컨대 아데노바이러스, 허르페스바이러스 (예를 들어 HSV-I, HSV- II, CMV 또는 VZV), 폭스바이러스 (예를 들어 천연두 (variola), 백시니아 또는 물사마귀바이러스 (molluscum contagiosum)와 같은 진성두창바이러스 (orthopoxvirus), 피코르나바이러스 (예를 들어 리노바이러스 또는 엔테로바이러스))， 오르토믹소바이러스 (예를 들어 인플루엔자바이러스)， 파라믹소바이러스 (예를 들어 5- 파라인플루엔자바이러스， 유핸성 이하선염 바이러스 (腿 mps virus), 흥역 바이러스 및 호흡기합포체 바이러스), 코로나 바이러스 (예를 들어 SARS), 파포바바이러스 (예를 들어 성기사마귀， 보통사마귀 또는 족저 사마귀를 유발하는 파필로마 바이러스)， 헤파드나바이러스 (예를 들어 B형간염 바이러스)， 플라비바이러스 (예를 들어 C형간염 바이러스 또는 뎅기열바이러스 (Dengue virus)) 또는 레트로바이러스 (예를 들어 HIV와 같은 렌티바이러스))에 의한 감염성 질환; ( ) 박테리아 (예컨대 에스케리치아， 엔테로박터， 살모넬라， 스타필로코커스， 쉬겔라， 리스테리아， 에어로박터, 헬리코박터, 클레브시엘라， 프로테우스， 수도모나스, 나이세리아， 클로스트리듐， 바실러스， 코리네박테리움, 마이코박테리움， 캠필로박터，비브리오， 세라티아， 프로비덴시아， 크로모박테리움， 브루셀라， 예르시니아, 해모필러스 또는 보르데텔라 속)에 의한 감염성 질환; ( iv ) 그 밖의 다른 감염성 질병 (예를 들어 클라미디아와 칸디다증， 국균증， 히스토마플라스마증 및 크립토콕쿠스 뇌막염을 포함하는 진균성 질병 및 말라리아， 뉴머시스터스성 폐렴, 리슈마니아증, 립토스포리디움증， 톡소포자층증 및 트리파소노마 감염올 포함하는 기생층성 질환) ; ( V ) 아토피성 피부염 또는 습진, 호산구증가증， 천식， 알레르기， 알레르기비염 및 오멘 증후군과 같은 Th2-매개된 아토피질환; ( vi ) 알로페시아 그레아타 (alopeci a greata) , 강직성 척추염, 항인지질 증후군, 자가면역 아디슨 질환, 부신의 자가면역 질환, 자가면역 용혈성 빈혈， 자가면역 간염， 자가면역 난소염 및 고환염， 자가면역 혈소판감소증, 베체트병， 수포성 유천포창， 심근병증, 복강 스프루우-피부염 ( cel i ac sprue-dermat i t i s) , 만성 피로 면역이상 증후군, 만성염증성 탈수초 다발성 신경병증， Churg- Strauss 증후군， 반흔성유천포창, CREST 증후군, 한넁 응집소 질환， 크론씨병， 원판성 낭창， 복태성복합한냉글로블린혈증, 섬유근통 -섬유근염， 사구체신염， 그레이브스 질환, 귈레인 바레 증후군， 하시모토 갑상선염， 특발성 폐섬유화증, 특발성 혈소판 감소성 자반중, IgA 신경염， 연소자성 관절염， 편평태선 , 홍반성 루푸스， 메니에르병 , 흔합성 연결 조직 질환, 다발성 경화증, 타입 I 또는 면역 -매개 당뇨병， 중중근무력증， 심상성 천포창， 악성 빈혈， 결정성 다발동맥염， 다발연골염, 자가면역성 다선 증후군 류마티스 다발성근통， 다발성 근염과 피부근염， 일차성 무감마글로불린혈증, 일차성 담중성 간경변， 건선， 건선성 관절염, 레이노 현상， 라이터 중후군, 류마티스 관절염, 사르코이드증， 공피증， 강직인간 증후군， 전신성 홍반성 루푸스， 흥반성 루푸스， 다가야스 동맥염， 일시적 동맥염， 거대세포 동맥염， 궤양성 대장염， 포도막염， 백반증 및 베게너 육아종증과 같은 자가면역질환; (vii) 천식, 엔세필리티스 (enceph i l i t i s ) , 염증성 장염， 만성 폐쇄성 폐질환, 알러지, 폐혈병성 쇼크중， 폐섬유증， 미분화 척추관절중, 미분화 관절병증， 관절염, 염증성 골용해, 및 만성 바이러스 또는 박테리아 감염에 의한 만성 염증을 포함하는 염증성 질환; 및 (Vii ) 켈로이드 및 다른 형태의 흉터생성 억계 (예를 돌어 만성상처 등의 치유촉진)와 같은 상처 치유와 관련된 질병의 예방 또는 치료에 이용된다. 본 발명의 일구현예에 따르면, 본 발명의 약제학적 조성물은 수지상 세포를 성숙시킨다 . The composition for immunostimulation of the present invention can be applied to a variety of diseases, for example, (i) cancer (eg, stomach cancer, lung cancer, breast cancer, ovarian cancer, liver cancer, bronchial cancer, nasopharyngeal cancer, laryngeal cancer, pancreatic cancer, bladder cancer, large intestine) Cancer, colon cancer, cervical cancer, brain cancer, prostate cancer, bone cancer, skin cancer, thyroid cancer, parathyroid cancer and ureter cancer); (ii) viruses (eg adenoviruses, herpesviruses (eg HSV-I, HSV- II, CMV or VZV), poxviruses (eg smallpox, vaccinia or molluscum contagiosum) Orthomyxoviruses (eg rhinoviruses or enteroviruses), orthomyxoviruses (eg influenza viruses), paramyxoviruses (eg 5-parainfluenza viruses) Yumps mumps virus (腿 mps virus), respiratory virus and respiratory vesicle virus), corona virus (eg SARS), papovavirus (eg papilloma virus that causes genital warts, common warts or plantar warts) , Hepadnavirus (eg hepatitis B virus), flavivirus (eg hepatitis C virus or dengue virus Infectious disease caused by switch (Dengue virus)) or a retrovirus (e.g., lentivirus such as HIV)); () Bacteria (eg Escherichia, Enterobacter, Salmonella, Staphylococcus, Shigella, Listeria, Aerobacter, Helicobacter, Klebsiella, Proteus, Monastery, Neisseria, Clostridium, Bacillus, Corynebacterium, Mycobacterium, Campylobacter, Infectious diseases caused by Vibrio, Serratia, Providencia, Chromobacterium, Brucella, Yersinia, Haemophilus or Bordetella); (iv) other infectious diseases (e.g., fungal diseases including chlamydia and candidiasis, fungal infections, histoplasmosis and cryptococcus meningitis and malaria, pneumoniae pneumonia, rishmaniasis, liptosporidium) Parasitic diseases, including toxoplasmosis, toxoplasma stratosis and tripasonoma infection; (V) Th2-mediated atopic diseases such as atopic dermatitis or eczema, eosinophilia, asthma, allergies, allergic rhinitis and Omen syndrome; (vi) alopeci a greata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison disease, adrenal autoimmune disease, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune ovarian infection and testicles, autoimmune platelets Decrease, Behcet's disease, bullous swelling, cardiomyopathy, cel i ac sprue-dermat itis, chronic fatigue immunodeficiency syndrome, chronic inflammatory demyelinating polyneuropathy, Churg- Strauss syndrome, scar stool , CREST syndrome, cold coagulopathy, Crohn's disease, discus lupus, congenital complex cold globulinemia, fibromyalgia-fibromyalitis, glomerulonephritis, Graves' disease, Hulamoto's syndrome, Hashimoto's thyroiditis, idiopathic pulmonary fibrosis, idiopathic thrombocytopenic purpura IgA neuritis, juvenile arthritis, lichen planus, lupus erythematosus, Meniere's disease, mixed connective tissue , Multiple sclerosis, type I or immune-mediated diabetes mellitus, myasthenia gravis, vulgaris ulcer, pernicious anemia, crystalline polyarteritis, polychondritis, autoimmune polyline syndrome rheumatoid polymyalgia, multiple myositis and dermatitis, primary ammonia globulinemia , Primary biliary cirrhosis, psoriasis, psoriatic arthritis, Raynaud's phenomenon, lighter prognosis, rheumatoid arthritis, sarcoidosis, scleroderma, ankylosing human syndrome, systemic lupus erythematosus, hepatic lupus, dagayasu arteritis, transient arteritis, giant Autoimmune diseases such as cell arteritis, ulcerative colitis, uveitis, vitiligo and Wegener's granulomatosis; (vii) Asthma, enceph ilitis, inflammatory enteritis, chronic obstructive pulmonary disease, allergies, pulmonary pulmonary shock, pulmonary fibrosis, undifferentiated vertebral joints, undifferentiated arthrosis, arthritis, inflammatory osteolysis, and chronic Inflammatory diseases including chronic inflammation caused by viral or bacterial infections; And (Vii) for the prevention or treatment of diseases associated with wound healing, such as keloids and other forms of scarring inhibition (eg, promoting accelerated healing of chronic wounds, etc.). According to one embodiment of the invention, the pharmaceutical composition of the invention matures dendritic cells.
본 발명의 약제학적 조성물에 포함되는 약제학적으로 허용되는 담체는 제제시에 통상적으로 이용되는 것으로서， 락토스, 덱스트로스， 수크로스， 솔비를， 만니를， 전분， 아카시아 고무， 인산 칼슘， 알기네이트 , 젤라틴， 규산 칼슘， 미세결정성 샐를로스， 폴리비닐피를리돈, 셀를로스, 물, 시럽， 메틸 셀를로스, 메틸히드록시벤조에이트, 프로필히드록시벤조에이트, 활석， 스테아르산 마그네슘 및 미네랄 오일 등을 포함하나， 이에 한정되는 것은 아니다. 본 발명의 약제학적 조성물은 상기 성분들 이외에 윤활제， 습윤제ᅳ 감미제 향미제， 유화제, 현탁제 , 보존제 등을 추가로 포함할 수 있다. 적합한 약제학적으로 허용되는 담체 및 제제는 Remington 's Pharmaceutical Sciences ( 19th ed . , 1995)에 상세히 기재되어 있다.  Pharmaceutically acceptable carriers included in the pharmaceutical composition of the present invention are those commonly used in the preparation, lactose, dextrose, sucrose, sorbbi, manny, starch, acacia rubber, calcium phosphate, alginate, Gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyridone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate and mineral oil Including, but not limited to. In addition to the above components, the pharmaceutical composition of the present invention may further include a lubricant, a wetting agent, a sweetener, a flavoring agent, an emulsifier, a suspending agent, a preservative, and the like. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).
본 발명의 약제학적 조성물은 경구 또는 비경구로 투여할 수 있고， 바람직하게는 비경구 투여이고， 비경구 투여인 경우에는 정맥내 주입， 피하 주입， 근육 주입, 복강 주입， 경피 투여 등으로 투여할 수 있다.  The pharmaceutical composition of the present invention can be administered orally or parenterally, preferably parenterally, and in the case of parenteral administration, can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, transdermal administration, and the like. have.
본 발명의 약제학적 조성물의 적합한 투여량은 제제화 방법, 투여 방식, 환자의 연령, 체중， 성， 병적 상태， 음식, 투여 시간, 투여 경로, 배설 속도 및 .반응 감응성과 같은 요인들에 의해 다양하게 처방될 수 있다. 한편， 본 발명의 약제학적 조성물의 경구 투여량은 바람직하게는 1일 당 0.001-100 mg/kg (체중)이다.  Suitable dosages of the pharmaceutical compositions of the present invention will vary depending on factors such as the formulation method, mode of administration, age, weight, sex, morbidity, food, time of administration, route of administration, rate of excretion and response to response of the patient. It may be prescribed. On the other hand, the oral dosage of the pharmaceutical composition of the present invention is preferably 0.001-100 mg / kg (body weight) per day.
본 발명의 약제학적 조성물은 당해 발명이 속하는 기술분야에서 통상의 지식을 가진 자가 용이하게 실시할 수 있는 방법에 따라， 약제학적으로 허용되는 담체 및 /또는 부형제를 이용하여 제제화함으로써 단위 용량 형태로 제조되거나 또는 다용량 용기내에 내입시켜 제조될 수 있다. 이때 제형은 오일 또는 수성 매질중의 용액， 현탁액 또는 유화액 형태이거나 엑스제, 분말제, 과립제, 정제 또는 캅셀제 형태일 수도 있으며, 분산제 또는 안정화제를 추가적으로 포함할 수 있다. 본 발명의 또 다른 양태에 따르면, 본 발명은 다음의 단계를 포함하는 면역원성을 가지는 에피토프의 스크리닝 방법을 제공한다 : The pharmaceutical compositions of the present invention may be prepared in unit dose form by formulating with a pharmaceutically acceptable carrier and / or excipient according to methods which can be easily carried out by those skilled in the art. Or may be prepared by incorporating into a multi-dose container. In this case, the formulation may be in the form of a solution, suspension or emulsion in an oil or an aqueous medium, or may be in the form of extracts, powders, granules, tablets or capsules, and may further include a dispersant or stabilizer. According to another aspect of the invention, the invention provides a method for screening epitopes having immunogenicity comprising the following steps:
(a) (i) 람블편모층 결합 면역글로불린 단백질 (Giardia Iambi i a binding immunoglobulin protein) 또는 그의 단편과 ( i i ) 에피토프 후보물질로서의 펩타이드를 이용하여 개체를 면역화시키는 단계; 및  (a) immunizing an individual using (i) a Giardia Iambi i a binding immunoglobulin protein or fragment thereof and (i i) a peptide as an epitope candidate; And
(b) 상기 면역화된 개체에서의 면역반응을 측정하는 단계.  (b) measuring an immune response in said immunized subject.
본 명세서에서 용어 "에피토프 (epitope)"는 항체와 상호작용하는 항원의 부위를 의미한다. 보다 자세하게는, 에피토프는 면역글로블린 (i誦 unoglobulin) 또는 T-세포 수용체에 특이적으로 결합할 수 있는 단백질 결정부위 (determinant)를 의미한다. 또한, 본 발명의 에피토프는 면역반웅올 증가시킬 수 있는 어떠한 분자 또는 물질을 포함한다. 예를 들어， 본 발명의 에피토프는 펩타이드, 이들 펩타이드를 인코딩하는 핵산 및 당단백질을 포함하지만, 이에 한정되는 것은 아니다. 람블편모층 결합 면역글로블린 단백질 (Giardia Iambi i a binding immunoglobulin protein) 또는 그의 단편과 에피토프 후보물질로서의 단백질에 의해 면역화시키는 방법은 당업계에 알려진 다양한 면역 투여방법을 포함하며， 바람직하게는 비경구 투여이다. 비경구 투여인 경우에는 정맥내 주입， 피하주입， 근육 주입， 복강 주입, 경피 투여 등으로 투여할수 있다.  As used herein, the term "epitope" refers to the site of an antigen that interacts with an antibody. More specifically, epitope refers to a protein determinant capable of specifically binding to immunoglobulin (i 誦 unoglobulin) or T-cell receptor. In addition, the epitopes of the present invention include any molecule or substance that can increase immunoreaction. For example, epitopes of the present invention include, but are not limited to, peptides, nucleic acids encoding these peptides, and glycoproteins. Methods of immunization with the Ramibella Iambi i binding immunoglobulin protein or fragments thereof and proteins as epitope candidates include various immunoadministration methods known in the art, preferably parenteral administration. In the case of parenteral administration, it can be administered by intravenous injection, subcutaneous injection, intramuscular injection, intraperitoneal injection, or transdermal administration.
본 발명의 일구현예에 따르면， 상기 개체는 인간을 제외한 동물 (non- human animal)이다. 본 발명에서 이용되는 "인간을 제외한 동물' '은 당업계에서 일반적으로 이용되는 다양한 동물들을 포함하며, 바람직하게는 포유동물이고, 가장 바람직하게는 마우스， 토끼 또는 래트이다. 본 발명에서 면역화된 동물에서의 면역반응 측정은 예를 들어， 상기 선별된 리포좀-포집된 펩타이드를 투여한 대상 동물로부터 혈청을 채취하여 항- 펩타이드 항체 (총 IgG, IgGl 및 IgG2a)의 역가를 측정하는 방법을 통해 이루어질 수 있다. 바람직하게는, 항체의 역가를 측정하는 방법은 EL ISA (Enzyme一 1 inked immunosorbent assay) , 즉면이동분석법 (Lateral flow test) , MIACMagnet ic immunoassay) 및 면역침강법 ( I瞧 unoprecipi tat ion)을 포함하지만, 이에 한정되는 것은 아니다. 보다 바람직하게는, ELISA 분석법이 이용될 수 있다. 특정 펩타이드 서열이 항-펩타이드 항체의 역가를 증가시키는 경우， 상기 특정 펩타이드는 에피토프 또는 펩타이드 백신으로 간주된다. 본 발명의 또 다른 양태에 따르면， 본 발명은 다음의 단계를 포함하는 단백질 항원에 대한 항체의 스크리닝 방법을 제공한다: According to one embodiment of the invention, the subject is a non-human animal. As used herein, "animals other than humans" include various animals commonly used in the art, and are preferably mammals, and most preferably mice, rabbits or rats. Immune response measurement in can be made through, for example, a method of measuring the titer of anti-peptide antibodies (total IgG, IgGl and IgG2a) by taking serum from a subject animal to which the selected liposome-captured peptide was administered. Preferably, the method for measuring the titer of the antibody is performed by ELISA (Enzyme 1 inked immunosorbent assay), Lateral flow test (MIACMagnet ic immunoassay) and immunoprecipitation (I 瞧 unoprecipi tat ion). More preferably, ELISA assays can be used, wherein a specific peptide sequence is used for the anti-peptide antibody. When increasing the titer, the particular peptide is considered an epitope or peptide vaccine. According to another aspect of the invention, the invention provides a method for screening antibodies against protein antigens comprising the following steps:
(a) ( i ) 람블편모층 결합 면역글로블린 단백질 (Gi ardia I ambi i a binding immunoglobul in protein) 또는 그의 단편과 ( i i ) 에피토프 후보물질로서의 펩타이드를 이용하여 개체를 면역화시키는 단계;  (a) immunizing an individual using (i) a Gi ardia I ambi i binding immunoglobul in protein or a fragment thereof and (i i) a peptide as an epitope candidate;
(b) 상기 면역화된 개체에서의 면역반웅을 측정하여 면역원성을 나타내는 펩타이드 에피토프를 선별하는 단계;  (b) selecting a peptide epitope exhibiting immunogenicity by measuring immune response in said immunized individual;
(c) 상기 선별된 펩타이드 에피토프와 분석 대상의 항체를 접촉시키는 단계 ;  (c) contacting the selected peptide epitope with the antibody of interest;
(d) 상기 단계 (c)의 결과물과 상기 단백질 항원을 접촉시키는 단계; ( e) 상기 단백질 항원과 상기 분석 대상의 항체의 결합을 분석하는 단계.  (d) contacting the resultant of step (c) with the protein antigen; (e) analyzing the binding of the protein antigen to the antibody of interest.
본 발명의 일구현예에 따르면， 상기 개체는 인간을 제외한 동물이며， 이에 대한 설명은 상술한 바와 같다.  According to one embodiment of the present invention, the subject is an animal except a human, and a description thereof is as described above.
본 발명의 단백질 항원 또는 후보 항체는 검출가능한 표지 (detectable label )로 표지화될 수 있다. 예를 들어， 상기 검출가능한 표지는 화학적 표지 (예컨대， 바이오틴) , 효소 표지 (예컨대， 호스래디쉬 퍼옥시다제 , 알칼린 포스파타제 , 퍼옥시다제， 루시퍼라제 β -갈락토시다제 및 β -글루코시다제)， 방사능 표지 (예컨대, C14 , . 1125 Ρ32 및 S35) , 형광 표지 (예컨대， 쿠마린 , 플루오레세인， FITC( f luoresein Isothi ocyanate) , 로다민 6G, 로다민 B, TAMRA(6-carboxy-tetramethyl-rhodamine) , Cy-3 , Cy- 5 Texas Red, Alexa Fluor , DAP I ( 4 , 6-d i am i d i ηο-2-pheny 1 i ndo 1 e ) , HEX, TET, Dabsyl 및 FAM)， 발광 표지， 화학발광 (chemi luminescent ) 표지， FRET( f luorescence resonance energy transfer ) 표지 또는 금속 표지 (예컨대 , 금 및 은)이다. Protein antigens or candidate antibodies of the invention can be labeled with a detectable label. For example, the detectable label may be a chemical label (eg biotin), an enzyme label (eg horseradish peroxidase, alkaline phosphatase, peroxidase, luciferase β-galactosidase and β-glucosidase Radiolabels (eg, C 14 ,. 1 125 Ρ 32 and S 35 ), fluorescent labels (eg, coumarin, fluorescein, FITC (f luoresein Isothi ocyanate), rhodamine 6G, rhodamine B, TAMRA ( 6-carboxy-tetramethyl-rhodamine), Cy-3, Cy-5 Texas Red, Alexa Fluor, DAP I (4, 6-di am idi ηο-2-pheny 1 i ndo 1 e), HEX, TET, Dabsyl and FAM), luminescent labels, chemi luminescent labels, fluorescence resonance energy transfer (FRET) labels or metal labels (eg, gold and silver).
검출 가능하도록 표지화된 단백질 항원 또는 후보 항체를 이용하는 경우， 단백질 항원과 항체 사이의 결합은 표지로부터 나오는 시그널을 검출하여 분석할 수 있다. 예를 들어， 표지로서 알칼린 포스파타아제가 이용되는 경우에는, BCIP(bromochloroindolylphosphate), 니트로 블루 테트라졸리움 (NBT), 나프틀 -AS-B1-포스페이트 (naphtho卜 AS-Bl-phosphate) 및 ECF(enhanced chemi fluorescence)와 같은 발색반웅 기질을 이용하여 시그널을 검출한다. 표지로서 호스 래디쉬 퍼옥시다아제가 이용되는 경우에는 클로로나프를， 아미노에틸카바졸， 디아미노벤지딘， D-루시페린， 루시게닌 (비스 -N-메틸아크리디늄 니트레이트), 레소루핀 벤질 에테르, 루미놀, 암플렉스레드 시약 (10-아세틸 -3，7-디하이드록시페녹사진， Pierce), HYR ( p-pheny 1 ened i am i ne-HC 1 and pyrocatechol ) , TMB(tetramethylbenzidine), ABTS(2,2'-Azine-di [3-ethylbenzthiazol ine sulfonate]), 0PD( ophenyl ened i amine) 및 나프를 /파이로닌와 같은 기질을 이용하여 시그널을 검출한다. 택일적으로， 분석대상 항체의 단백질 항원과의 결합 여부는 상호작용물 (interactants)의 레이블링 없이 분석할 수도 있다. 예를 들어， 마이크로피지오미터 (microphysiometer)를 이용하여 분석대상의 항체가 단백질 항원에 결합하는 지 여부를 분석할 수 있다. 마이크로피지오미터는 LAPS( light-addressable potent iometr ic sensor)를 이용하여 세포가 그의 환경을 산성화하는 속도 (acidifying rate)를 측정할 수 있는 분석 도구이다. 산성화 속도의 변화는， 후보 항체와 단백질 항원 사이의 결합에 대한 지시자 (indicator)로 이용될 수 있다. When using protein antigens or candidate antibodies labeled as detectable, the binding between the protein antigen and the antibody may cause a signal from the label to be detected. Can be detected and analyzed. For example, when alkaline phosphatase is used as the label, bromochloroindolylphosphate (BCIP), nitro blue tetrazolium (NBT), naphtho-AS-B1-phosphate (naphtho® AS-Bl-phosphate) and ECF ( Signals are detected using a chromogenic reaction substrate such as enhanced chemi fluorescence. When hose radish peroxidase is used as a label, chloronaph is used, aminoethylcarbazole, diaminobenzidine, D-luciferin, lucigenin (bis-N-methylacridinium nitrate), resorupin benzyl ether, luminol , Amflex Red Reagent (10-acetyl-3,7-dihydroxyphenoxazine, Pierce), HYR (p-pheny 1 ened i am i ne-HC 1 and pyrocatechol), TMB (tetramethylbenzidine), ABTS (2, 2'-Azine-di [3-ethylbenzthiazol ine sulfonate]), 0PD (ophenyl ened i amine) and nap are detected using a substrate such as / pyronine. Alternatively, binding of the antibody of interest to the protein antigen may be analyzed without labeling the interactants. For example, a microphysiometer can be used to analyze whether the antibody of interest binds to a protein antigen. Microphysiometers are analytical tools that can measure the acidifying rate of cells using the light-addressable potent iometric sensor (LAPS). The change in acidification rate can be used as an indicator for binding between the candidate antibody and the protein antigen.
단백질 항원에 대한 후보 항체의 결합 능력은 실 -시간 (rea卜 time) 이분자 상호작용 분석 (BIA)를 이용하여 분석할 수 있다. BIA는 상호작용물 (interactants; 예컨대， BIAcore™)의 레이블링 없이 실-시간으로 특이적 상호작용을 분석하는 기술이다. 표면 플라즈몬 공명 (SPR)에서의 변화는 분자들 사이의 실 -시간 반응에 대한 지시자 (indicator)로 이용될 수 있다.  The binding ability of candidate antibodies to protein antigens can be analyzed using a real-time bimolecular interaction assay (BIA). BIA is a technique for analyzing specific interactions in real-time without labeling of interactants (eg, BIAcore ™). Changes in surface plasmon resonance (SPR) can be used as indicators for real-time responses between molecules.
【유리한 효과】  Advantageous Effects
본 발명의 특징 및 이점을 요약하면 다음과 같다:  The features and advantages of the present invention are summarized as follows:
(a) 본 발명은 람블편모층 결합 면역글로블린 단백질 또는 그의 단편을 포함하는 면역증진용 약제학적 조성물을 제공한다.  (a) The present invention provides a pharmaceutical composition for immunostimulation comprising a ramble flagellar binding immunoglobulin protein or fragment thereof.
(b) 본 발명의 재조합 람블편모층 결합 면역글로블린 단백질은 수지상 세포의 사이토카인 생산 및 수지상 세포의 성숙과 같은 면역반웅을 통해 면역 활성화를 크게 향상시키므로， 면역증진용 제제로서 유용하게 이용될 수 있을뿐만 아니라, 백신의 어쥬번트로서도 이용될 수 있다. (b) The recombinant ramble flagella binding immunoglobulin protein of the present invention may suppress immune response such as cytokine production of dendritic cells and maturation of dendritic cells. Since it greatly improves immune activation, not only can be usefully used as an agent for enhancing the immune, but also as an adjuvant of the vaccine.
【도면의 간단한 설명】  [Brief Description of Drawings]
도 1은 람블편모층 재조합 BiP 및 항 -GlBi p 항체의 형성을 나타낸 도이다. 도 la는 재조합 GlBi P는 히스티딘 태그을 이용하여 대장균에서 발현되었고， 탈론 (Talon) 친화성 크로마토그래피를 이용하여 정제되었고 이후 Coomass i e로 염색된 12% SDS-PAGE를 수행한 것을 나타내었다: ( 1) Coomass i e로 염색된 SDS-PAGE 젤, (2) 항-히스티딘 항체를 이용한 웨스턴 블롯 ( 1 : 5000 희석)， (3) 항-람블편모층을 이용한 웨스턴 블롯 ( 1 : 1000 희석) . 도 lb에서는 정제된 재조합 GlBiP는 병원성이 없는 랫트 복강 내 주사를 이용하여 다중클로날 항체를 제조하기 위해 항원으로서 사용되었고, 2주에 3번 주사 후， 혈청을 면역화된 ¾트로부터 수득하고， 수득된 항체의 역가를 검사하였다. 항 -GlBi P( l ; 2000 회석)을 이용한 람블편모층 추출물의 웨스턴 블롯을 수행하였다. SM은 단백질 사이즈 마커를 나타내고， 면역반응성 재조합 GlBiP 및 천연의 GlBiP는 화살표 및 화살표머리 (arrowhead)로 각각 나타내었다.  1 is a diagram showing the formation of the Rambler flagella recombinant BiP and anti-GlBi p antibody. La shows that recombinant GlBi P was expressed in Escherichia coli using a histidine tag, purified using Talon affinity chromatography and then subjected to 12% SDS-PAGE stained with Coomass ie: (1) SDS-PAGE gel stained with Coomass ie, (2) Western blot using anti-histidine antibody (1: 5000 dilution), (3) Western blot using anti-lambella flagellum (1: 1000 dilution). In FIG. Lb, purified recombinant GlBiP was used as an antigen to prepare polyclonal antibodies using intraperitoneal injection of non-pathogenic rats, and after 3 injections every 2 weeks, serum was obtained from immunized ¾ and obtained. The titer of the antibody was examined. Western blot of Rambler flagella extract with anti-GlBi P (l; 2000 dilution) was performed. SM represents protein size markers and immunoreactive recombinant GlBiP and native GlBiP are indicated by arrows and arrowheads, respectively.
도 2는 재조합 GlBi P가 공동자극의 발현 및 MHCI I 분자의 발현을 촉발시킨다는 것을 나타내는 도이다.  FIG. 2 shows that recombinant GlBi P triggers costimulatory expression and MHCI I molecule expression.
도 3a-3d는 재조합 GlBiP 자극 마우스 수지상 세포에 의한 사이토카인 생산을 나타낸 도이다. 실험결과를 대표적인 3번의 실험의 평균士표준편차로 표현하였다.  3A-3D show cytokine production by recombinant GlBiP stimulated mouse dendritic cells. The experimental results are expressed as the mean standard deviation of three representative experiments.
도 4는 람블편모층 추출물로 자극받은 마우스 수지상 세포에 의한 사이토카인 생산을 나타낸다. 실험결과를 대표적인 3번의 실험의 평균士표준편차로 표현하였다.  Figure 4 shows cytokine production by mouse dendritic cells stimulated with Ramblerella extract. The experimental results are expressed as the mean standard deviation of three representative experiments.
도 5는 재조합 GlBi가 골수세포 유래 수지상 세포에서 사이토카인 생산을 유도한다는 것을 나타낸 도이다. 도 5a에서는 미성숙한 골수세포 유래 수지상 세포를 항 -TLR4 항체 또는 항 -TLR2 항체을 이용하여 1시간 동안 전-배양하였다. 상대적인 동종 IgG가 대조군으로 사용되었다. 상기 세포를 이후 재조합 GlBiP을 이용하여 16시간 동안 공배양하고, 배양 상등액을 TNF- α를 위해 분석하였다. 도 5b는 pFLAG-TU 를 이용하여 형질감염된 HEK293 세포가 추가적인 20시간 동안 재조합 GlBiP를 이용하여 자극 받았았고， 이후 루시퍼레이즈활성을 측정하기 위하여 용해되었다. 대조군으로, 폴라스미드 pFLAG-C V 또는 pFLAG-TLR2가 형질감염 실험에서 포함되었다. 도 5c는 야생형， 동질유전자 TLR4 넉아웃 및 동질유전자 TLR2 0 마우스 유래의 골수세포 유래 수지상 세포 및 TLR2 넉아웃 골수세포 유래 수지상 세포 유래의 골수세포 유래 수지상 세포를 분리시켰고, 이후 재조합 GlBiP로 처리하였다. 세포 배양 상등액을 사이토카인 ( IL-12 , TNF- Q 및 IL-6)의 생산을 분석하기 위하여 수득하였다. 양성 대조군으로, 골수세포 유래 수지상 세포를 LPS로 배양하였다. 실험결과를 대표적인 3번의 실험의 평균土표준편차로 표현하였다. 5 shows that recombinant GlBi induces cytokine production in myeloid cell-derived dendritic cells. In FIG. 5A immature myeloid cell-derived dendritic cells were pre-cultured for 1 hour using anti-TLR4 antibody or anti-TLR2 antibody. Relative homologous IgG was used as a control. The cells were then co-cultured for 16 hours using recombinant GlBiP, and the culture supernatants were analyzed for TNF-α. 5B shows that HEK293 cells transfected with pFLAG-TU using recombinant GlBiP for an additional 20 hours. Stimulated and then dissolved to measure luciferase activity. As a control, Polismid pFLAG-C V or pFLAG-TLR2 were included in the transfection experiments. FIG. 5C shows that myeloid cells derived from wild type, allogeneic TLR4 knockout and homologous TLR2 0 mice and dendritic cells derived from TLR2 knockout myeloid cells derived dendritic cells were treated with recombinant GlBiP. Cell culture supernatants were obtained to analyze the production of cytokines (IL-12, TNF-Q and IL-6). As a positive control, myeloid cell derived dendritic cells were cultured in LPS. The experimental results are expressed as the mean 土 standard deviation of three representative experiments.
도 6은 재조합 GlBiP에 의해 유도된 사이토카인 생산이 MyD88- 의존적이라는 것을 나타내는 도이다. 도 6a는 야생형 BALB/c 마우스 및 동질유전자 MyD88 넉아웃 마우스의 대퇴골 및 정강뼈 유래의 골수세포 유래 수지상 세포는 수지상 세포로 분화되었다. 미성숙한 수지상 세포는 16시간 동안 0. 1-10 mg/mL에서 rGlBiP에 대해 지시된 농도에서 및 LPS에 대해 0.5 mg/mL에서 다음 자극을 이용하여 자극받았다. 도 6b는 재조합 GlBiP에 의해 자극받은 THP-1 세포에서 항 -TLR4 항체를 이용한 MyD88의 공동- 면역침강법을 나타낸 도이다. THP-1 세포의 용해물을 2시간 동안 재조합 GlBiP를 이용하여 배양하였고 항 -TLR4 또는 항 -MyD88 항체와 반응시켰고 이후 단백질 G 세파로오스 (Protein G Sepharose) 비드로 침강시켰다 ( i画 unoprecipi tat ion : IP) . 면역침전물에서 단백질을 항 -MyD88 또는 항 -TLR4를 이용하여 웨스턴블롯 (WB)에 의해 분석하였다.  FIG. 6 shows that cytokine production induced by recombinant GlBiP is MyD88-dependent. 6A shows that myeloid cell-derived dendritic cells derived from the femur and tibia of wild-type BALB / c mice and the homologous MyD88 knockout mice were differentiated into dendritic cells. Immature dendritic cells were stimulated with the following stimulation at concentrations indicated for rGlBiP at 0.1-10 mg / mL for 16 hours and at 0.5 mg / mL for LPS. FIG. 6B shows co-immunoprecipitation of MyD88 using anti-TLR4 antibody in THP-1 cells stimulated by recombinant GlBiP. Lysates of THP-1 cells were incubated with recombinant GlBiP for 2 hours, reacted with anti-TLR4 or anti-MyD88 antibodies and then precipitated with Protein G Sepharose beads (i 画 unoprecipi tat ion : IP). Proteins in immunoprecipitates were analyzed by Western blot (WB) using anti-MyD88 or anti-TLR4.
도 7은 수지상 세포에서 재조합 GlBiP에 의해 유도된 사이토카인 생산의 역할을 나타낸 도이다. 도 7a의 억제자는 ERK1-특이적 억제자 (PD98059)이고, 도 7b의 억제자는 p38-특이적인 억제자 (SB202190)이다.  Figure 7 is a diagram showing the role of cytokine production induced by recombinant GlBiP in dendritic cells. The inhibitor of FIG. 7A is an ERK1-specific inhibitor (PD98059) and the inhibitor of FIG. 7B is a p38-specific inhibitor (SB202190).
도 8은 재조합 GlBiP로 자극된 재조합 GlBiP에서 NF- κ Β 및 AP-1의 중가된 결합 활성화를 나타낸 도이다. 핵추출을 미성숙한 수지상 세포로부터 제조하였다. 핵 추출물 중 3개의 미생물은 바이오틴 -11UTP- 표지된 NF- κ Β 을리고뉴클레오타이드 (도 8a) 또는 AP-1 올리고뉴클레오타이드 (도 8b)를 이용한 결합 어세이를 위해 이용되었다. 상대적인 양의 비표지된 올리고뉴클레오타이드를 결합의 특이성을 측정하기 위해서 결합 반응에 첨가하였다. 세포를 또한 양성 대조군인 LPS를 이용하여 처리하였다. 8 is a diagram showing the weighted binding activation of NF-κ Β and AP-1 in recombinant GlBiP stimulated with recombinant GlBiP. Nucleation was made from immature dendritic cells. Three microorganisms in the nuclear extract were used for binding assays with biotin-11UTP-labeled NF-κβ β-oligonucleotides (FIG. 8A) or AP-1 oligonucleotides (FIG. 8B). To measure the specificity of binding relative amounts of unlabeled oligonucleotides To the coupling reaction. Cells were also treated with LPS, a positive control.
도 9는 GlBiP에서 수지상 세포 활성화를 위한 기능적 도메인의 맵핑 (mapping)을 나타낸다. 도 9a는 3개의 재조합 GlBiP 단백질의 계략도 (전장 재조합 GlBiP, 절단된 재조합 GlBiP-N 및 절단된 재조합 GlBiP-C)를 각각 나타낸다. 도 9b는 항 -람블편모층 항체를 이용한 상기 재조합 GlBiP 단백질의 웨스턴 블롯 분석 (1:1,000 dilution)을 나타낸 도이다. 도 9c는 재조합 GlBiP 단백질을 이용하여 자극 받은 마우스 수지상 세포에 의한 사이토카인 생산을 나타낸 도이다. 실험결과를 대표적인 3번의 실험의 평균士표준편차로 표현하였다.  9 shows the mapping of functional domains for dendritic cell activation in GlBiP. 9A shows a schematic of three recombinant GlBiP proteins (full length recombinant GlBiP, truncated recombinant GlBiP-N and truncated recombinant GlBiP-C), respectively. 9B is a diagram showing Western blot analysis (1: 1,000 dilution) of the recombinant GlBiP protein using an anti-Ramble flagella antibody. 9C is a diagram showing cytokine production by mouse dendritic cells stimulated using recombinant GlBiP protein. The experimental results are expressed as the mean standard deviation of three representative experiments.
도 10은 재조합 GlBiP에 의해 유도된 수지상 세포 활성화를 통한 T 세포에 의한사이토카인 생산을 나타낸 도이다.  10 shows cytokine production by T cells through dendritic cell activation induced by recombinant GlBiP.
도 11은 람블편모층으로 감염된 마우스 유래의 혈청을 이용한 람블편모충 추출물 및 재조합 GlBiP (전장 재조합 GlBiP = N, 재조합 GlBiP- N = C, 재조합 GlBiP-C = C, 각각 1 mg) 단백질의 웨스턴 블롯 분석을 나타낸 도이다 (E, 10 mg).  FIG. 11 shows Western blot analysis of Ramblellella larvae extract and recombinant GlBiP (full length recombinant GlBiP = N, recombinant GlBiP-N = C, recombinant GlBiP-C = C, 1 mg each) protein using serum from mice infected with the Rambler layer Is (E, 10 mg).
도 12는 항 -람블편모충 항체로 반응시킨 항원성 분자의 동정을 나타낸 도이다. 도 12a는 항 -람블편모층 항체를 이용한 람블편모층 추출물의 웨스턴 블롯을 나타낸 도이다. 항 -람블편모충 항체를 이용한 람블편모충 추출물의 웨스턴 블롯은 74 kDa 및 30 kDa에서 2 개의 주요한 면역반응성 밴드 및 63 kDa 및 25 kDa에서 부수적인 벤드를 보여주었다. 도 12b는 비바 -스핀 (Viva-spin) 컬럼을 이용한 람블편모충 단백질의 분획을 나타낸 도이다. 상기 비바 -스핀 컬럼은 분자량에 따라 단백질을 분리하는 초미세여과 (ultrafiltration) 장치이다. 웨스턴 블롯 분석은 항 -람블편모층 또는 전면역 혈청을 이용한 상기 분획된 단백질을 이용하여 형성되었다. 별표는 다음 라운드의 크로마토그래피를 위해 선택된 분획물을 나타낸다. 도 12c는 DEAE 세파로오스 양이온 교환 크로마토그래피를 이용한 람블편모층 단백질의 분획을 나타낸다 (1,000 kDa-100 kDa). 0.1 M NaCl-0.5 M NaCl로 용출된 단백질은 항 -람블편모층 항체 또는 전면역 혈청과 반웅하엿다. 별표는 다음 라운드의 크로마토그래피를 위해 선택된 분획물을 나타낸다. 도 12d는 젤 여과 크로마토그래피를 이용하여 람블편모층 단백질의 분획물 (0.2 M NaCl로 용출됨)을 나타낸 도이다. 0.1 M NaCl - 0.5 M NaCl로 용출된 단백질을 항 -람블편모층 항체 또는 전면역 혈청올 이용하여 반응시켰다. 74 kDa의 면역반응성 단백질 밴드 (화살표 머리)를 MALDI-T0F에 의해 분석하였다. Fig. 12 shows the identification of antigenic molecules reacted with anti-Ramble flagella antibodies. Figure 12a is a diagram showing the Western blot of the Rambler flagella extract using an anti-Ramble flagellar antibody. Western blot of the Ramblellella extract using anti-Ramblellella antibody showed two major immunoreactive bands at 74 kDa and 30 kDa and minor bends at 63 kDa and 25 kDa. Figure 12b is a diagram showing the fraction of the Ramblellellar protein using a Viva-spin column. The Viva-spin column is an ultrafiltration device that separates proteins according to molecular weight. Western blot analysis was formed using the fractionated protein using an anti-Ramble flagella or whole region serum. Asterisks indicate the fractions selected for the next round of chromatography. FIG. 12C shows the fraction of the Ramble flagella protein using DEAE Sepharose cation exchange chromatography (1,000 kDa-100 kDa). Proteins eluted with 0.1 M NaCl-0.5 M NaCl were reacted with anti-Ramble flagella antibodies or full-serum sera. Asterisks indicate the fractions selected for the next round of chromatography. 12D shows the Ramble flagella layer using gel filtration chromatography. Figure shows the fraction of protein (eluted with 0.2 M NaCl). Proteins eluted with 0.1 M NaCl-0.5 M NaCl were reacted with anti-Ramble flagella antibodies or full-serum serumol. An immunoreactive protein band (arrow head) of 74 kDa was analyzed by MALDI-T0F.
도 13은 재조합 GlBiP로 자극된 마우스 골수세포 유래 수지상 세포에서 사이토카인 생산에 대한 사이토카인 생산에 대한 폴리믹신 (polymyxin) B의 효과를 나타낸다.  FIG. 13 shows the effect of polymyxin B on cytokine production on cytokine production in recombinant myeloid cell-derived dendritic cells stimulated with recombinant GlBiP.
【발명을실시를 위한 형태】  [Form for carrying out invention]
이하, 실시예를 통하여 본 발명을 더욱 상세히 설명하고자 한다. 이들 실시예는 오로지 본 발명을 보다 구체적으로 설명하기 위한 것으로서， 본 발명의 요지에 따라 본 발명의 범위가 이들 실시예에 의해 제한되지 않는다는 것은 당업계에서 통상의 지식을 가진 자에 있어서 자명할 것이다. 실시예  Hereinafter, the present invention will be described in more detail with reference to Examples. These examples are only for illustrating the present invention in more detail, and it will be apparent to those skilled in the art that the scope of the present invention is not limited by these examples according to the gist of the present invention. . Example
실험재료 및 실험 방법  Experimental Materials and Methods
1. 람블편모층 영향형 ( . /aw /a trophozoite)의 배양  1. Incubation of Rambler's Inflammatory Layer (./aw/a trophozoite)
람블편모충 GS 유래의 영양형 (ATCC50581, American Type Culture Collection, Mannassas, VA) 균주 유래의 영양체를 TYI-S-33 배지에서 72시간 동안 배양하였다 (2% casein digest, 1% yeast extract, 13 glucose, 0.2% NaCl, 0.2% L-cysteine, 0.02% ascorbic acid, K2HP04 , 0.06% H2P04, 10% calf serum, and 0.05 mg/mL bovine bile, pH 7.1).  Nutrients derived from the wild type GS (ATCC50581, American Type Culture Collection, Mannassas, VA) strains were cultured in TYI-S-33 medium for 72 hours (2% casein digest, 1% yeast extract, 13 glucose, 0.2% NaCl, 0.2% L-cysteine, 0.02% ascorbic acid, K2HP04, 0.06% H2P04, 10% calf serum, and 0.05 mg / mL bovine bile, pH 7.1).
2. 항 -람블편모층 영양체 추출물의 제조 및 항 -람블편모층 항체의 형성 2. Preparation of anti-Ramble flagella nutrient extract and formation of anti-Ramble flagella antibody
람블편모층 GS 영양체를 용해 버퍼 (PBS: 137 mMNaCl , 1.7 mM KCl, 10 mM Na2HP04 및 2 mM ¾P04, pH 7.3)에서 리서스펜션 (resusupension)을 수행하였고, 음파처리 (sonication)로 용해하였다. 단백질 추출물을 800g 에서 5 분 동안 원심분리를 하여 제조하였다. l( ig 의 추출물을 0.1 ml 의 완전한 프로인트 보조제 (Freund adjuvant)를 이용하여 흔합하였고 (Sigma, St. Louis, M0), 복강내로 무병원체성 마우스 내로 주입하였다 (BALB/c 마우스， 6 주령 암컷). 1 차 면역 후 2 주 및 4 주에서 두 개의 추가적인 예방 주사를 불완전한 프로인트 보≤제와 흔합된 동일한 양의 단백질을 이용하여 수행하였다. 3 차 면역한지 1 주 후， 혈청을 면역화된 마우스로부터 수득하였고 웨스턴 블롯 분석을 이용하였다. 3. 크로마토그래피를 이용한 람블편모층항원 단백질의 분획 차등적 컷오프값 (1,000 kDa초과， 1,000 - 100 kDa, 100 - 10 kDa 및 10 kDa 미만)을 갖는 람블편모충 영양체로부터 제조된 단백질 추출물을 4 개의 비바 스핀 (Viva— spin, Sartor ius-StedimBiotech, Goet t i ngen , Germany)을 이용하여 분획하였다. The Ramblel flagella GS nutrient was subjected to a suspension in lysis buffer (PBS: 137 mM NaCl, 1.7 mM KCl, 10 mM Na 2 HP0 4 and 2 mM ¾P0 4 , pH 7.3), and sonication. Dissolved. Protein extracts were prepared by centrifugation at 800 g for 5 minutes. l (ig extracts were mixed using 0.1 ml of complete Freund adjuvant (Sigma, St. Louis, M0) and injected intraperitoneally into pathogenic mice (BALB / c mice, 6 week old females) At 2 and 4 weeks after primary immunization Two additional vaccinations were performed using the same amount of protein combined with incomplete Freund's agent. One week after the third immunization, serum was obtained from the immunized mice and Western blot analysis was used. 3. Four protein extracts prepared from the Ramblerella nutrients with fractional differential cutoff values (more than 1,000 kDa, less than 1,000-100 kDa, 100-10 kDa, and 10 kDa) of the Chlamella flagellar antigen proteins by chromatography. Fractionation was performed using Viva spin (Viva—spin, Sartor ius-Stedim Biotech, Goet Tigen, Germany).
1,000-100 kDa 의 컷오프값을 갖는 비바 스핀 멤브레인 (membrane)을 통과했던 단백질을 DEAE 세파로오스 빠른 유속 (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) 이은 교환 칼럼 (volume 15x1 cm)을 이용하여 결합 버퍼 (20mM Tris-HCl, pH8.5)로 평형을 맞춘 양이온 교환 크로마토그래피에 의해 연속적으로 분획화하였다. 컬럼에 결합한 단백질을 0.1M 에서 0.5 M 까지 NaCl 의 농도를 중가시키면서 용출하였다. 각각의 분획물을 상술한 항 -람블편모충 항체를 이용한 웨스턴 블롯에 의해 분석하였다.  Proteins that passed through a Viva spin membrane with a cutoff value of 1,000-100 kDa were bound using a DEAE Sepharose fast flow rate (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) followed by an exchange column (volume 15x1 cm). Subsequent fractionation by cation exchange chromatography equilibrated with buffer (20 mM Tris-HCl, pH8.5). The protein bound to the column was eluted with increasing the concentration of NaCl from 0.1M to 0.5M. Each fraction was analyzed by Western blot using the anti-Ramble flagella antibodies described above.
각각의 분획물을 항-람블편모충을 이용한 웨스턴 블롯에 의해 분석하였다. 0.2M NaCl 을 이용하여 용출된 단백질 분획물을 20m MTris-HCl, pH 8.5 을 이용하여 평형을 맞춘 40 ml Sephacryl S-200 고해상도 컬럼 (GE Healthcare Bio-Sciences AB) (volume 50 x 1 cm)에 적용하였다.  Each fraction was analyzed by Western blot using anti-Ramble flagella. Protein fractions eluted with 0.2 M NaCl were applied to a 40 ml Sephacryl S-200 high resolution column (GE Healthcare Bio-Sciences AB) (volume 50 x 1 cm) equilibrated with 20 m MTris-HCl, pH 8.5. .
각각의 분획물의 단백질 농도를 브래드포드 어세이에 의해 측정하였다 (Biorad, Hercules, CA). 각각의 정제단계로부터 수득된 분획물을 SDSPAGE 에 의해 분리하였고 폴리비닐리덴 풀로라이드 (polyvinylidene fluoride, PVDF) 멤브레인 (Mi 11 ipore, Billerica, MA)에 옮겼다. 멤브레인을 블로킹 (blocking) 용액 (1:1,000 dilution, PBS with 5% skim milk, and 0.05% Tween 20)에서 폴리클로날 마우스 항 -람블편모충 항체를 이용하여 배양하였고, 알칼라인 포스파테이즈 (alkaline phosphatase, AP)-결합 랫트 항—마우스 IgG(Sigma) (1:1000 회석)를 처리하였다. 면역반웅성 단백질을 나이트로- 블루 테트라졸리움 (nitro-blue tetrazolium, NBT)/5-브로모 -4-클로로 -3- 인돌일포스페이트 (BCIP) 시스템 (Promega, Madison, WI)을 이용하여 가시화하였다. Protein concentration of each fraction was measured by Bradford assay (Biorad, Hercules, CA). Fractions obtained from each purification step were separated by SDSPAGE and transferred to a polyvinylidene fluoride (PVDF) membrane (Mi 11 ipore, Billerica, Mass.). Membranes were incubated with a polyclonal mouse anti-lambler filamentous antibody in blocking solution (1: 1,000 dilution, PBS with 5% skim milk, and 0.05% Tween 20), and alkaline phosphatase (alkaline phosphatase) AP) -binding rat anti-mouse IgG (Sigma) (1: 1000 dilution) was treated. Immune reaction protein Nitro-blue tetrazolium (NBT) / 5-bromo-4-chloro-3- Visualization was performed using an indolyl phosphate (BCIP) system (Promega, Madison, Wis.).
4. 람블편모층의 면역반웅성 단백질의 MALDI-T0F분석 4. MALDI-T0F Analysis of Immune Response Proteins in the Rambler's flagella
용출된 젤 여과 크로마토그래피 분획물에서 74 kDa 의 면역반웅성 단백질을 절개하고 트립신을 이용하여 젤 내에서 분해 (in-gel digestion) 처리하였다 (Sigma). 소화된 생성물을 MALDI-TOF MS 뿐만 아니라, 4 중극 TOFCquadrupole TOF, Q-TOP)에 의해 분석하였다. 이온 스펙트럼 생성물을 정보-의존적 인식 (information-dependent acquisition, IDA) 모드에서 수집하였고， Agilent 6530 Accurate-Mass Q-TOP MS을 이용하여 분석하였다. Q-T0P 액체 크로마토그래피 -이중 질량분석기 (LC-MS/MS) 데이터 세트를 위해 이중 질량분석 스펙트럼을 본 발명의 마스코트 인하우스 데이터베이스 연구 엔진 (GiardiaDB)에 제출하였다. 100 ppm 및 0.2 Da 의 질량스펙트럼의 분자량 오차범위는 각각 전구체 이온 및 토막 이온을 위해 이용되었다. 37 초과의 마스코트 이온 스코어를 단백질 동정을 위한 기준으로 이용하였다.  The 74 kDa immunoreactive protein was excised from the eluted gel filtration chromatography fraction and subjected to in-gel digestion (Sigma) using trypsin. Digested products were analyzed by MALDI-TOF MS, as well as by quadrupole TOFCquadrupole TOF, Q-TOP). Ion spectral products were collected in information-dependent acquisition (IDA) mode and analyzed using Agilent 6530 Accurate-Mass Q-TOP MS. Dual mass spectrometry spectra were submitted to the Mascot Inhouse Database Research Engine (GiardiaDB) of the present invention for a Q-T0P Liquid Chromatography-Dual Mass Spectrometer (LC-MS / MS) data set. The molecular weight error ranges of the mass spectra of 100 ppm and 0.2 Da were used for precursor ions and chip ions, respectively. Mascot ion scores greater than 37 were used as criteria for protein identification.
5. 재조합 GlBiP단백질의 형성 5. Formation of Recombinant GlBiP Protein
bip0RFGL50581_3283 를 포함하는 A2,034-bp 의 DNA 단편을 2 개의 프라이머, 즉， 프라이머 rBiP_F(5' -CCGGAATTCGATGACGTCTAGTCGCGTTAA-3 ' ： 밑줄친 옆기는 EcoRI 위치를 나타냄) 및 프라이머 rBiP_R(5' - CCGCICGAGGAGCTCATCTTTCTCTGCAT-3 ' ： 밑줄친 염기는 Xhol위치를 나타냄)을 이용하여 중폭하였고， 이후 pET21b (+) 발현 백터 (Novagen, Darmstadt, Germany) 내로 클로닝을 하였다.  A2,034-bp DNA fragment containing bip0RFGL50581_3283 was constructed using two primers, namely primer rBiP_F (5'-CCGGAATTCGATGACGTCTAGTCGCGTTAA-3 ': underlined side indicates EcoRI position) and primer rBiP_R (5'-CCGCICGAGGAGCTCATCTTTCTCT : The underlined base was heavy using Xhol position) and then cloned into pET21b (+) expression vector (Novagen, Darmstadt, Germany).
또한, bip 0RF 를 포함하는 DNA 단편을 2 부분으로 분해하였다. bip 의 5' -부위 (1,280 bp)를 상기 프라이머， 즉, 재조합 BiP-F(5' - CCGGAATTCGGGTGCGAAGGATCATGATGT-3 ' ： 밑줄친 염기는 부위를 나타냄) 및 재조합 BiP-NR (5' -CCGCTCGAGGCTAAGGATGGAGGCCTGCA-3 ' ： 밑줄친 염기는 Xhol 부위를 나타냄)를 이용한 PCR 에 의해 람블편모층의 게놈 DNA 로부터 증폭하였다. bip 의 3' 지역 (754 bp)을 또 다른 세트의 프라이머， 즉, rBiP-CF (5' -CCGGAATTCGGGTGCGAAGGATCATGATGT-3 ' ： EcoRI 부위를 나타냄) 및 재조합 ^11^을 이용하여 중폭하였다. 수득한 bip DNA 단편을 절단된 재조합 GlBiP 폴리펩타이드를 위한 과발현 플라스미드, 즉, pETBiP-N 및 pETBiP-C 를 생성하기 위하여 pET21b(Novagen) 내로 클로닝을 하였다. 상기 재조합 GlBiP 를 1 mM 의 IPTG(isopropyl thio-β -D-galactoside)를 첨가함으로써 E.coUl BL2UDE3)에서 과발현하였고， 매뉴얼에 따라 Talon 친화성 크로마토그래피에 의해 정제하였다 (Clonetech, Mountain View, CA) . In addition, the DNA fragment containing bip 0RF was digested into two parts. The 5'-site (1,280 bp) of bip was transformed into the primers, namely recombinant BiP-F (5'-CCGGAATTCGGGTGCGAAGGATCATGATGT-3 ': underlined base indicates site) and recombinant BiP-NR (5'-CCGCTCGAGGCTAAGGATGGAGGCCTGCA-3' : The underlined base represents the Xhol site) and amplified from genomic DNA of the Ramble flagella layer. The 3 'region of the bip (754 bp) was heavy using another set of primers, ie rBiP-CF (5'-CCGGAATTCGGGTGCGAAGGATCATGATGT-3': EcoRI site) and recombinant ^ 11 ^. The obtained bip DNA fragment was cloned into pET21b (Novagen) to generate overexpressing plasmids for the cleaved recombinant GlBiP polypeptide, ie pETBiP-N and pETBiP-C. The recombinant GlBiP was overexpressed in E.coUl BL2UDE3 by adding 1 mM of IPTG (isopropyl thio-β-D-galactoside) and purified by Talon affinity chromatography according to the manual (Clonetech, Mountain View, CA). .
6. 재조합 GlBiP 활성을 측정하기 이전의 폴리믹신 (polymyxin) B 를 이용한 엔도톡신의 제거 6. Removal of Endotoxin with polymyxin B prior to measuring recombinant GlBiP activity
재조합 GlBiP 에 의해 유도된 수지상 세포의 성숙은 제조된 단백질에서 오염을 일트키는 엔도톡신에 기인하는 것이 아니라는 것을 확인하기 위하여 폴리믹신 B(Sigma)(PmB)로 수지상 세포의 전처리를 수행하였다. 수지상 세포를 500 ng/mL LPS 또는 100 ng/mL 재조합 GlBiP 를 이용한 반응 전에 1 g/niL PmB 로 상온에서 1 시간 동안 전배양하였다. 16 시간 후， 골수세포 유래 수지상 세포의 상등액에서 TNF-α , IL-12 및 IL-6 수준을 ELISA 키트를 이용하여 측정하였다. 이후 실험에서 , 재조합 GlBiP의 박테리아 LPS 오염을 배제하기 위해 세포를 F½B(1 ug/mL)를 이용하여 1 시간 동안 전배양하였다. 또한， Limulus ½ebocyte Lysate LPS Detection Kit(Lonza, Basel, Swi tzer land)에 의해 측정하였을 때， LPS 오염이 1.5 EU/mL(l EU = 100 pg) 미만이었다는 것을 확인하기 위하여 재조합 GlBiP 단백질을 정제하였다. LPS 로 오염된 단백질 샘플을 Detoxi-GelTM 엔도톡신 제거 젤 (Pierce, Rockford, IL)을 이용하여 추가로 정제하였다.  Pretreatment of dendritic cells with polymyxin B (Sigma) (PmB) was performed to confirm that maturation of dendritic cells induced by recombinant GlBiP was not due to endotoxins causing contamination in the protein produced. Dendritic cells were preincubated for 1 hour at room temperature at 1 g / niL PmB prior to reaction with 500 ng / mL LPS or 100 ng / mL recombinant GlBiP. After 16 hours, TNF-α, IL-12 and IL-6 levels in the supernatants of myeloid cell-derived dendritic cells were measured using an ELISA kit. In subsequent experiments, cells were preincubated for 1 hour with F½B (1 ug / mL) to rule out bacterial LPS contamination of recombinant GlBiP. In addition, the recombinant GlBiP protein was purified to confirm that LPS contamination was less than 1.5 EU / mL (l EU = 100 pg) as measured by Limulus ½ebocyte Lysate LPS Detection Kit (Lonza, Basel, Swi tzer land). Protein samples contaminated with LPS were further purified using Detoxi-GelTM endotoxin removal gel (Pierce, Rockford, IL).
7. 폴리클로날항 -GlBiP의 제조 7. Preparation of Polyclonal Anti-GlBiP
무병원균 랫트 내로 복강내 주사를 통해 폴리클로날 항체를 생산하기 위한 항체로 정제된 재조합 GlBiP 를 이용하였다 (CrjBgi : CD[S.D.]IGS, 6- weeks-old, females). 2 주 간격으로 3 번의 주사 후, 혈청을 면역화된 ¾트로부터 수득하였고 수득된 항체의 티터 (titer)를 시험하였다. 백 나노그램의 재조합 GlBiP 를 12% SDS-PAGE 에 의해 분리하였고 나이트로셀를로오스 멤브레인에 옮겼다. 멤브레인을 항 -람블편모층 항체 (1:1,000 희석) 또는 항 -GlBiP 항체 (1:2,000 회석)， 이어서 AP-결합된 랫트 항-마우스 IgG 를 이용하여 배양하였다. 면역반웅성 단백질을 상술한 바와 같이 검출하였다. Recombinant GlBiP purified as an antibody for producing polyclonal antibodies via intraperitoneal injection into pathogen-free rats was used (CrjBgi: CD [SD] IGS, 6-weeks-old, females). After three injections at two week intervals, serum was obtained from immunized rats and the titer of the antibodies obtained was tested. One hundred nanograms of recombinant GlBiP were isolated by 12% SDS-PAGE and nitrocells were transferred to the rose membrane. Membranes can be anti-Ramble flagella antibody (1: 1,000 dilution) or anti-GlBiP antibody (1: 2,000 dilution) followed by AP-bound Cultured with rat anti-mouse IgG. Immunostimulatory proteins were detected as described above.
8. 실험용마우스 8. Experimental Mouse
BALB/c 마우스를 OrientBio(Seoul, Korea) 및 TLR2 넉아웃 (K0)(TLR2/), TLR4 K0 TLR4/)로부터 수득하였고， 골수성 분화 인자 88(MyD88) 넉아웃 (MyD88/) 마우스를 아키라 박사 (S. Akira)에 의해 제공된 BALB/c 마우스로부터 수득하였다 (Department of Host Defense, Research Institute for Microbial Diseases, Osaka University.' Japan) . 동물들은 연구기관의 지침 및 한국의 법정준비소요액에 따라 인도적인 보살핌을 받았다.  BALB / c mice were obtained from OrientBio (Seoul, Korea) and TLR2 knockout (K0) (TLR2 /), TLR4 K0 TLR4 /) and myeloid differentiation factor 88 (MyD88) knockout (MyD88 /) mice were obtained from Dr. Akira ( Obtained from BALB / c mice provided by S. Akira (Department of Host Defense, Research Institute for Microbial Diseases, Osaka University. 'Japan). The animals were humanely cared for according to the research institution's guidelines and the Korean statutory requirements.
9. 수지상 세포의 분리 및 배양 9. Isolation and Culture of Dendritic Cells
골수세포 유래 수지상 세포를 BALB/c 마우스의 대퇴골 및 경골로부터 제조하였고 적혈구 용출 버퍼에서 리서스펜션을 수행하였다 (150 mM NH4C1 , 10 mM KHC03, and 1 mM EDTA, pH 7.4). 원심분리 후， 세포를 100 U/mL 의 페니실린 /스트렙토마이신 (GIBC0, Karsruhe, Germany)으로 보층된 골수세포 유래 수지상 세포 (BMDC) 내로 분화시켰고 , 10% FBS, 50 μΜ 의 메르캅토에탄올 (mercaptoethanol), 0.1 mM의 비필수 아미노산 (Sigma), 1 mM HEPES 버퍼 및 20 ng/mL 의 과립대식세포집락자극인자 (granulocyte- macrophages colony-stimulating factor (GM-CSF: JW CreaGene , Seongnam , Korea))를 2 일 마다 RPMI1640 배지에서 보층하였고 37° C, 5% C02 존재 하에서 배양하였다. 6 또는 7 일간의 배양일 동안， 미성숙한 골수세포 유래 수지상 세포를 추가실험을 위해 수득하였다. Myeloid cell derived dendritic cells were prepared from the femur and tibia of BALB / c mice and subjected to suspension in erythrocyte elution buffer (150 mM NH4C1, 10 mM KHC03, and 1 mM EDTA, pH 7.4). After centrifugation, cells were differentiated into myeloid cell-derived dendritic cells (BMDC) supplemented with 100 U / mL of penicillin / streptomycin (GIBC0, Karsruhe, Germany), and 10% FBS, 50 μΜ of mercaptoethanol. , 0.1 mM non-essential amino acid (Sigma), 1 mM HEPES buffer and 20 ng / mL granulocyte- macrophages colony-stimulating factor (GM-CSF: JW CreaGene, Seongnam, Korea) Every day was supplemented in RPMI1640 medium and incubated in the presence of 37 ° C., 5% CO 2 . During 6 or 7 days of culture, immature myeloid cell-derived dendritic cells were obtained for further experiments.
10. 세포 표면 표현형의 유세포 분석 (Flow cytometric analysis) 미성숙한 골수세포 유래 수지상 세포를 16 시간 동안 재조합 GlBiP(0.1 to 5 μ g/mL) 또는 람블편모층 추출물 (50 yg/mL)로 처리하였다. 이후, 세포를 수득하였고， PBS 로 세척하고 라이브 /데드 고정가능 사멸세포 염색 키트 live/dead f ixable dead cell stain kit (Invitrogen, Carlsbad, CA)를 이용하여 죽은 (염색된) 세포의 퍼센트 비율을 측정하기 위해서 얼음 위에서 20 분 동안 염색하였다. 이후， 세포를 PBS 로 세 번 세척하고 페리디닌 클로로필 (PerCP)-Cy 5.5-결합 항-마우스 I-A/I-E(MHC class II) 알로피코시아닌 (allophycocyanin, APC)-결합 항 -CD80 및 피코에리트린 (phycoerythrin, PE)-결합 항 -CD86 및 APC-eFk r780-결합 항- CDllc를 이용하여 얼음 상에서 20분 동안 염색하였다. 세포를 PBS로 세 번 세척하고 500 yL 의 FACS(f luorescence-activated cell sorter)에서 리서스펜션을 수행하였다 (PBS, 1% BSA, and 0.1% sodium azide). 형광을 유세포 분석기로 측정하고, 실험데이터를 FlowJo 데이터 분석 소프트웨어를 이용하여 분석하였다. 10. Flow cytometric analysis of cell surface phenotypes Immature myeloid cell-derived dendritic cells were treated with recombinant GlBiP (0.1 to 5 μg / mL) or Ramble flagella extract (50 yg / mL) for 16 hours. Cells were then harvested, washed with PBS and measured the percentage percentage of dead (stained) cells using the live / dead fixable dead cell stain kit (Invitrogen, Carlsbad, Calif.) Ice in order Staining for 20 minutes in the stomach. Cells were then washed three times with PBS and peridinine chlorophyll (PerCP) -Cy 5.5-binding anti-mouse IA / IE (MHC class II) allophycocyanin (allophycocyanin (APC) -binding anti-CD80 and phycoerythrin (phycoerythrin, PE) -binding anti-CD86 and APC-eFk r780-binding anti-CDllc were stained for 20 minutes on ice. Cells were washed three times with PBS and subjected to suspension in 500 yL of FACS (Fluorescence-activated cell sorter) (PBS, 1% BSA, and 0.1% sodium azide). Fluorescence was measured with a flow cytometer and experimental data were analyzed using FlowJo data analysis software.
11. 사이토카인 농도의 측정 11. Measurement of cytokine concentration
미성숙한 마우스 수지상 세포를 48 웰 배양 플레이트에서 분주하고 람블편모층 추출물 (50yg/mL), 재조합 GlBiP (0.1-10 yg/mL) 또는 LPS(0.5 yg/mL)를 이용하여 16시간 동안 배양하였다. 상등액을 TNF- α , IL-12, IL- 6 및 IL-4를 검출하기 위해 샌드위치 ELISA에 의해 매뉴얼 (BD Biosciences, Franklin Lakes' NJ)에 따라 분석하였다.  Immature mouse dendritic cells were dispensed in 48 well culture plates and incubated for 16 hours using Rambler flagella extract (50yg / mL), recombinant GlBiP (0.1-10 yg / mL) or LPS (0.5 yg / mL). Supernatants were analyzed according to the manual (BD Biosciences, Franklin Lakes' NJ) by sandwich ELISA to detect TNF-α, IL-12, IL-6 and IL-4.
12. 항체 블로킹 실험 12. Antibody Blocking Experiment
쥐의 골수세포 유래 수지상 세포를 재조합 GlBiP 로 처리된 5 yg/mL 의 마우스 TLR4 단일클론 항체 (BioLegend, San Diego, CA), 마우스 TLR2 단일클론 항체 (BioLegend) 또는 동종 대조군 IgG 항체 (BioLegend)를 이용하여 RPMI 1640 무혈청 배지에서 1 시간 동안 전배양하였다. 자극을 이용하여 16시간 후， 상등액을 ELISA을 위해 수득하였다. 13. NF-κΒ리포터 어세이  Rat myeloid cell-derived dendritic cells were treated with 5 yg / mL mouse TLR4 monoclonal antibody (BioLegend, San Diego, CA), mouse TLR2 monoclonal antibody (BioLegend) or homologous control IgG antibody (BioLegend) treated with recombinant GlBiP. Was precultured in RPMI 1640 serum free medium for 1 hour. After 16 hours using stimulation, supernatants were obtained for ELISA. 13. NF-κΒ Reporter Assay
형질감염 하루 전에， HEK293 세포를 12 웰 배양 플레이트 상에서 1 x 105 세포로 폴레이팅을 수행하였다. 분주된 세포를 0.5ug 의 NF- KB 루시퍼레이즈 플라스미드 [pGUL8p-luc+](27), 5ng 의 pCHllO(Promega) 및 O.lug 의 pFLAG-TLR2(28) 또는 pFLAG-TLR4(28)를 이용하여 일시적으로 Lipofectamine 2000 (Invitrogen)에 의해 형질감염시켰다. 대조군으로， pFLAG-CMVl(Invitrogen)을 pFLAG-TLR2 또는 pFLAG-TLR4 대신에 형질감염시켰다. 형질감염한지 24 시간 후， 세포를 PBS 없이 재조합 GlBiP(lyg/mL) 또는 LPS (0.5pg/mL)를 이용하여 6 시간 동안 자극시켰다. 루시퍼레이즈 활성을 Dual-Lucif erase Reporter Assay System(Promega)를 이용하여 매뉴얼에 따라 측정하였다. One day before transfection, HEK293 cells were polarized to 1 × 10 5 cells on 12 well culture plates. Dispensed cells were transient with 0.5 ug of NF-KB luciferase plasmid [pGUL8p-luc +] (27), 5 ng of pCHllO (Promega) and O.lug of pFLAG-TLR2 (28) or pFLAG-TLR4 (28). By transfection with Lipofectamine 2000 (Invitrogen). As a control, pFLAG-CMVl (Invitrogen) was substituted for pFLAG-TLR2 or pFLAG-TLR4. Transfection. 24 hours after transfection, cells were stimulated for 6 hours using recombinant GlBiP (lyg / mL) or LPS (0.5pg / mL) without PBS. Luciferase activity was measured according to the manual using the Dual-Lucif erase Reporter Assay System (Promega).
14. 세포주의 배양 14. Culture of Cell Lines
인간 배아 신장 세포， HEK 293 (CRL- 1573； American Type Culture Collection)를 4.5 g/L 포도당, 10% 열로 불활성화된 소태아 혈청 (fetal bovine serum, FBS), 100 U/mL 페니실린， 100 ug/mL 스트렙토마이신 및 10 ug/mL 블라스티시딘 (blasticidin S, InvivoGen, San Diego, CA)로 보충된 DMEM 에서 배양하였다. 인간 단핵세포주， THP-KTIB-202; American Type Culture Collection)를 37°C， 5% CO2건조 대기， RPMI-1640(Sigma) 조건에서 배양하였다. 15. 공동면역침강법 (Coimmunoprecipitation) Human embryonic kidney cells, HEK 293 (CRL-1573; American Type Culture Collection), 4.5 g / L glucose, 10% heat inactivated fetal bovine serum (FBS), 100 U / mL penicillin, 100 ug / Cultured in DMEM supplemented with mL streptomycin and 10 ug / mL blasticidine (blasticidin S, InvivoGen, San Diego, Calif.). Human mononuclear cell line, THP-KTIB-202; American Type Culture Collection) was incubated at 37 ° C, 5% CO 2 dry atmosphere, RPMI-1640 (Sigma) conditions. 15. Coimmunoprecipitation
재조합 GlBiP 로 배양된 THP-1 세포를 용해 완충액 (10 mM TrisHCl , ρΗ 7.4, 5 mM EDTA, 130 mM NaCl, 1% Triton X— 100， 1% 4-amidino-phenyl- methylsul fonyl fluoride, and 1% protease inhibitor)에서 파괴하고, 4°C에서 하룻밤 동안 항 -TLR4 단일항체 Absor 항 -MyD88 단일클로날 항체 (Cell Signaling, Beverly, MA)를 이용하여 배양하고， 이후 단백질 G 아가로오스 비드를 이용하여 4° C 에서 4 시간 동안 침전시켰다. 침전된 단백질을 이후 항 -TLR4 또는 항 -MyD88 항체를 이용하여 웨스턴 블롯에 의해 분석하였다 (Cell Signaling). 16. 재조합 GlBiP로 처리된 수지상 세포에서 MAPK경로의 억제THP-1 cells incubated with recombinant GlBiP were lysed in lysis buffer (10 mM TrisHCl, ρΗ 7.4, 5 mM EDTA, 130 mM NaCl, 1% Triton X— 100, 1% 4-amidino-phenyl-methylsul fonyl fluoride, and 1% incubated with anti-TLR4 monoantibody Absor anti-MyD88 monoclonal antibody (Cell Signaling, Beverly, MA) overnight at 4 ° C and then with protein G agarose beads. Precipitate at 4 ° C. for 4 hours. The precipitated protein was then analyzed by Western blot using anti-TLR4 or anti-MyD88 antibody (Cell Signaling). 16. Inhibition of MAPK Pathway in Dendritic Cells Treated with Recombinant GlBiP
MAP 의 관련성을 연구하기 위해서, 미성숙한 수지상 세포를 무혈청 RPMI 1640 배지에서 억제자를 이용하여 16 시간 동안 전처리하였다. 약제학적 성분을 Calbiochem( Darmstadt, Germany)으로부터 구입하였다. 모든 억제자들을 DMS0 에서 용해시켰다. 억제자들을 다음 농도에서 이용하였다: 0.1-1 의 SB 202190(선택적 p38 억제자) 또는 PD98059(선택적 ERK1/2 억제자) 및 0.2-2 JNK 억제자 11(선택적 JNK 억제자). 억제자를 이용한 모든 실험에서， 시험된 농도는 배양 부피의 1%를 초과하지 않았고 수지상 세포의 생존능력에 영향을 주지 않았다. To study the relevance of MAP, immature dendritic cells were pretreated for 16 hours with inhibitor in serum-free RPMI 1640 medium. Pharmaceutical ingredients were purchased from Calbiochem (Darmstadt, Germany). All inhibitors were dissolved in DMS0. Inhibitors were used at the following concentrations: SB 202190 (selective p38 inhibitor) or PD98059 (selective ERK1 / 2 inhibitor) and 0.2-2 JNK inhibitor 11 (selective JNK inhibitor) of 0.1-1. Suppressor In all experiments used, the tested concentration did not exceed 1% of the culture volume and did not affect the viability of dendritic cells.
17. 핵 추출물의 제조 및 젤 이동성 분석 (elect rophoretic mobility gel shift assay, EMSA) 17. Preparation and Nuclear Extraction (elect rophoretic mobility gel shift assay, EMSA)
24 웰 배양 플레이트로 분주된 마우스 골수세포 유래 수지상 세포를 다양한 시간 (3-60 분)으로 재조합 GlBiP 를 이용하여 자극하고, 이후 핵 추출물을 위해 처리하였다. 요약해서 , 세포를 100 용해 완층액 [10 mM HEPES, 10 mMKCl , 0.1 mM EDTA, 0.1 mM EGTA, and 1 mM dithiothreitol (DTT)]에서 15 분 동안 얼음 상에서 용해하고 12.5 의 10% Nonidet P-40 을 세포에 첨가하였다. 4°C, 20,000g 에서 8 분 동안 원심분리 후， 핵 펠렛을 25 의 얼음처럼 찬 핵 추출물 버퍼에서 리서스펜션하고 간헐적인 교반으로 15 분 동안 얼음에서 유지하였다. 이후 샘플을 4°C 얼음에서 5 분 동안 원심분리하고, 결합 어세이까지 상등액을 -70° C 에 저장하였다. 바이오틴ᅳ 표지된 프로브 (100 mM Tris, 500 mM KCl 및 10 mM DTT, pH 7.5)를 이용하여 결합 어세이를 핵 추출물 결합 버퍼 (100 mMTris, 500 mMKCl 및 10 mM DTT, pH 7.5)에서 수행하였다. 센스 가닥 올리고뉴클레이타이드의 서열은 다음과 같다: NF-κΒᅳ 5' -AGTTGAGGGGACTTTCCCAGGC-3 ' (Pr omega) 및 AP-1, 5' - CGCTTGATGAGTCAGCCGGAA-3 ' (Pr omega) . 단백질 -DNA 복합체를 0.5xTr is/Boric acid/EDTA (TBE) 버퍼에서 4° C, 6% 폴리아크릴아마이드 젤에서 전기영동하고， 나일론 멤브레인에 옮겼다. UV-가교결합된 멤브레인을 스트랩토아비딘-서양고추넁이 퍼옥시데이즈 결합 (Pierce)를 이용하여 처리하고， 이후 DNA 밴드를 검출하기 위하여 Light-Shift Chemi luminescent EMSA 키트 (Pierce)를 이용하여 X_레이 필름에 노출시켰다. 또한， 핵 추출물을 다양한 시간 동안 0.5 /ml LPS 로 자극된 골수세포 유래 수지상 세포로부터 제조하고, 결합 어세이 동안 양성 대조군으로 이용하였다. Mouse myeloid cell-derived dendritic cells dispensed into 24-well culture plates were stimulated with recombinant GlBiP at various times (3-60 minutes) and then processed for nuclear extracts. In summary, cells were lysed on ice for 100 minutes in 100 lysate sol [10 mM HEPES, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, and 1 mM dithiothreitol (DTT)] and 12.5 of 10% Nonidet P-40 Added to cells. After 8 min centrifugation at 20,000 g at 4 ° C, the nuclear pellets were resuspended in 25 ice cold nucleus extract buffers and kept on ice for 15 minutes with intermittent stirring. Samples were then centrifuged for 5 minutes on 4 ° C ice and the supernatant was stored at -70 ° C until binding assay. Binding assays were performed in nuclear extract binding buffer (100 mMTris, 500 mMKCl and 10 mM DTT, pH 7.5) using a Biotin® labeled probe (100 mM Tris, 500 mM KCl and 10 mM DTT, pH 7.5). The sequence of the sense strand oligonucleotide is as follows: NF-κΒ ᅳ 5′-AGTTGAGGGGACTTTCCCAGGC-3 ′ (Pr omega) and AP-1, 5′-CGCTTGATGAGTCAGCCGGAA-3 ′ (Pr omega). Protein-DNA complexes were electrophoresed on 4 ° C., 6% polyacrylamide gels in 0.5 × Tr is / Boric acid / EDTA (TBE) buffer and transferred to nylon membranes. UV-crosslinked membranes were treated using a Straptoavidin-Western pepper Peroxidase bond (Pierce) and then X-rays were detected using a Light-Shift Chemi luminescent EMSA Kit (Pierce) to detect DNA bands. Exposed to ray film. In addition, nuclear extracts were prepared from myeloid cell-derived dendritic cells stimulated with 0.5 / ml LPS for various times and used as positive controls during binding assays.
18. 혼합된 림프구 반웅 18. Mixed Lymphocyte Reaction
미접촉 (naive) T-세포를 BALB/c 마우스 비장으로부터 제조하였다. 비장세포를 적혈구 완층액에서 용해하였다. CD4+ T 세포를 autoMACSCmagnet i c-act ivated cell sorting) 분리기에서 CD4(L3T4) MicroBeads(Miltenyi Biotec, Auburn , CA)를 이용하여 분리하였다. 1 yg/mL 의 재조합 GlBiP 로 처리된 수지상 세포를 24 시간 동안 CD4+ T 세포를 이용하여 1:10 의 수지상 세포: T 세포 비율에서 공동 배양하였다. 공동 배양 중 3 일째에, 상등액을 IL-2 생산을 위하여 ELISA 에 의하여 수집하고 분석하였다 (Centrell DA & Smith KA, Science 1984； 224： 1312- 1316). 또한， 상등액을 Thl 분극 (polarization)를 검사하기 위하여 IFN- γ로 분석하였다 (Bradley LM, Dal ton DK SCroft M, J I睡 unol 1996； 157： 1350-1358) . . 19. 마우스 감염 어세이 Naïve T-cells were prepared from BALB / c mouse spleens. Splenocytes were lysed in erythrocyte supernatant. CD4 + T Cells in AutoMACSCmagnet I c-act ivated Cell Sorting Separator CD4 (L3T4) It was isolated using MicroBeads (Miltenyi Biotec, Auburn, CA). Dendritic cells treated with 1 yg / mL of recombinant GlBiP were co-cultured at 1:10 dendritic cell: T cell ratio using CD4 + T cells for 24 hours. On day 3 of co-culture, supernatants were collected and analyzed by ELISA for IL-2 production (Centrell DA & Smith KA, Science 1984; 224: 1312-1316). In addition, the supernatant was analyzed by IFN-γ to examine Thl polarization (Bradley LM, Dal ton DK SCroft M, J i unol 1996; 157: 1350-1358). . 19. Mouse Infection Assays
람블편모층 (균주 GS ATCC50581)를 상술한 바와 같이 감염을 위하여 이용하고 배양하였다. BALB/c 마우스를 PBS(phosphate-buffered saline)의 람블편모층 영양체에서 5 X 105G로 위관영양법에 의해 감염시켰다. 2주 및 4 주 간격으로, 혈청을 감염된 마우스로부터 수득하고 람블편모충 또는 재조합 GlBiP 단백질의 용해물을 웨스턴 블롯 분석을 위해 이용하였다.  The Ramblel flagella (strain GS ATCC50581) was used and cultured for infection as described above. BALB / c mice were infected by gavage at 5 × 10 5 G in the Ramble flagella nutrient of phosphate-buffered saline (PBS). At two and four week intervals, serum was obtained from infected mice and lysates of Ramblerella or recombinant GlBiP protein were used for Western blot analysis.
20. 통계분석 20. Statistical Analysis
실험결과를 대표적인 3 번의 실험의 평균士표준편차로 표현하였다. 실험데이터를 Student' s t-test(SYSTAT program, SIGMAPL0T version 9； Systat Software Inc. , Chicago, IL, USA)를 이용하여 쌍으로 비교에 의하여 분석하였다. P-값이 으 05 미만이면， 편차를 유의하게 고려하였다. 0.01 미만의 P 값을 갖는 실험데이터는 2 개의 별표로 나타내고 0.01 및 0.05 사이의 P-값을 갖는 실험데이터를 하나의 별표로 나타내었다ᅳ [실험 결과]  The experimental results are expressed as the mean standard deviation of three representative experiments. Experimental data were analyzed by pairwise comparison using Student's t-test (SYSTAT program, SIGMAPL0T version 9; Systat Software Inc., Chicago, IL, USA). If the P-value was less than 05, the deviation was considered significantly. Experimental data with P values less than 0.01 are represented by two asterisks and experimental data with P-values between 0.01 and 0.05 are represented by one asterisk.
1. 람블편모층의 항원 단백질로서 결합 면역글로블린 단백질 (binding immunoglobul in protein, BiP)의 동정  1. Identification of binding immunoglobulin protein (BiP) as an antigenic protein in the Rambler flagella
본 발명자들은 람블편모층의 항원 분자를 동정하기 위해 일련의 실험을 수행하였다. 람블편모충 추출물을 항원으로서 이용하여 다중클로날 항체 (항 -람블편모층 항체 )를 제조하였다. 제조된 항체와 람블편모층 추출물의 면역블로팅은 74 및 30 kDa의 두 개의 주요한 면역반웅성 밴드와 , 62 및 25 kDa 의 두 개의 부수적인 면역 반웅성 단백질을 각각 보여주었다 (도 12a) . 이후, 람블편모충 추출물을 3 가지의 절차를 이용하여 분획하고， 본 발명자들은 74 kDa 의 단백질이 항-람블편모층의 강한 면역을 나타낸다는 것을 동정하였다. 1000 kDa 초과 및 1000-100 kDa 의 컷오프 (cut-of f )값을 갖는 세포막을 이용하여 비바 스핀 (Viva spi n) 원심분리를 통해 수득된 웨스턴 블롯 (Western blot )의 분석은 74 kDa 의 면역반응성 단백질이라는 것을 밝혀내었다 (도 12b) . We performed a series of experiments to identify antigenic molecules in the Rambler flagella. The multiclonal antibody (anti-lambella flagella antibody) was prepared using the Ramblellella worm extract as an antigen. Immunoblotting of the prepared antibody and Rambler's flagellar extract showed two major immune response bands of 74 and 30 kDa, Two secondary immunoreactive proteins of 62 and 25 kDa were shown, respectively (FIG. 12A). Lamella flagella extracts were then fractionated using three procedures, and we identified that 74 kDa protein exhibited strong immunity of the anti-lambella flagellum layer. Analysis of Western blots obtained by Viva spi centrifugation using cell membranes with cut-of f values greater than 1000 kDa and 1000-100 kDa yielded an immunoreactivity of 74 kDa. It was found to be a protein (FIG. 12B).
대조적으로， 상기 면역반응성 밴드는 면역반응전 혈청 분획물의 웨스턴 블롯 분석에서 존재하지 않았다. 100-10 kDa 의 컷오프값을 갖는 세포막을 이용하여 비바 스핀 원심분리를 통해서 수득된 분획물은 15 kDa의 면역반응성 단백질의 면역 반응성 밴드를 나타냈다 . 74 kDa 를 포함하는 상기 두 벤드 중에서 본 발명자들은 이후의 분획과정을 위해 1 , 000-100 kDa 의 컷오프값을 갖는 세포막을 통해서 비바 스핀 원심분리로부터 수득된 분획물을 선별하였다. 상기 분획물의 DEAE 세파로오스 ( sepharose) 양이온 교환 크로마토그래피는 74 kDa 의 면역반웅성 단백질을 포함하는 두 가지 분획물을 야기하였고， 상기 단백질들을 0.2 또는 0.3 M NaCl 를 이용하여 용출하였다 (도 12c) . 0.2 M NaCl 에 의해 용출된 단밸질은 20 mM Tr i s-HCl , pH 8. 5 을 이용하여 평형을 이룬 젤 여과 컬럼 상에 층진되었고 이후 0.2 M NaCl 을 이용하여 용출되었을 때， 용출된 단백질 (분획물 번호 #22 내지 #30)은 람블편모층 항체에 대한 면역반웅을 입증하였다 (도 12d) .  In contrast, the immunoreactive bands were not present in Western blot analysis of serum fractions prior to immune response. Fractions obtained through Viva spin centrifugation using a cell membrane with a cutoff value of 100-10 kDa exhibited an immunoreactive band of an immunoreactive protein of 15 kDa. Of the two bends containing 74 kDa, the inventors selected fractions obtained from Viva spin centrifugation through cell membranes with cutoff values of 1,000-100 kDa for subsequent fractionation. DEAE sepharose cation exchange chromatography of the fractions resulted in two fractions containing 74 kDa of immunoreactive protein, and the proteins were eluted with 0.2 or 0.3 M NaCl (FIG. 12C). The protein eluted with 0.2 M NaCl was layered on a gel filtration column equilibrated with 20 mM Tr i s-HCl, pH 8. 5 and then eluted with 0.2 M NaCl to elute protein (fractions). Nos. # 22 to # 30) demonstrated the immunoreaction against the Rambler's flagella antibody (FIG. 12D).
74 kDa 의 단백질 밴드를 잘라내어， LC-MS/MS 로 분석하였다. 단백질의 LC-MS/MS 분석을 이용한 데이터베이스 분석은 상기 단백질이 람블편모층의 결합 면역글로블린 단밸질 (Bi P) 상동체 (GL50581_3283) ( sequence coverage , 36%： MASCOT score , 1227)였다는 것을 나타내었다. 따라서, 본 발명자들은 Bip 가 이후 실험에서 람블편모충에서 검출한 74 kDa 의 면역반웅성 단백질에 해당하는 지를 조사하였다.  A 74 kDa protein band was cut out and analyzed by LC-MS / MS. Database analysis using LC-MS / MS analysis of the protein indicated that the protein was a binding immunoglobulin protein (Bi P) homologue (GL50581_3283) (sequence coverage, 36%: MASCOT score, 1227) in the Ramblel flagella. Therefore, we investigated whether Bip corresponds to a 74 kDa immunoreactive protein detected in Ramblerella in later experiments.
2. 람블편모충의 74 kDa인 면역성 단백질로서 GlBiP의 확인 2. Identification of GlBiP as an Immunogenic Protein of 74 kDa of Ramblerella
GlBiP 가 항—람블편모층 항체와 반응한 74 kDa 의 단백질인지를 결정하기 위하여, 람블편모층의 Bip 를 대장균 (£. α?//)에서 재조합 단백질로서 발현시켰고， 수득된 람블편모층의 BiP 를 정제하였다. 정제된 재조합 GlBiP 를 본 발명자들이 항-람블편모충은 분획 실험을 통해서 동정하기 위해 사용했던 항-람블편모충이 항 -람블편모층 항체와 반응한다는 사실이 발견되었다 (도 la). 이후 상기 정제된 재조합 GlBiP 를 래트에서 특이적인 다중클로날 항체를 제조하기 위한 항체로서 사용하고， 수득된 항- GlBiP 항체의 특이성을 람블편모층 영향형 추출물의 웨스턴 블롯 분석에 의해 분석하였다. 즉， 람블편모층의 타고난 BiP 가 명백히 74 kDa 의 면역반응성 밴드로 검출되었다 (도 lb). 3. 재조합 GlBiP 에 의한 수지상 세포 성숙 및 염증전 사이토카인 분비의 유도 To determine if GlBiP is a 74 kDa protein that has reacted with an anti-Ramble flagella antibody, Bip from the Ramble flagella is recombined in E. coli (£. Α? //) It was expressed as a protein and the BiP of the obtained Rambler flagella was purified. Purified recombinant GlBiP was found that the anti-Ramble flagella, which we used to identify the anti-Ramble flagella, through fractionation experiments, reacted with the anti-Ramble flagella antibody (FIG. La). The purified recombinant GlBiP was then used as an antibody for preparing specific polyclonal antibodies in rats, and the specificity of the anti-GlBiP antibody obtained was analyzed by Western blot analysis of the Ramblerella influencer extract. That is, innate BiP of the Rambler flagellum was clearly detected as an immunoreactive band of 74 kDa (FIG. Lb). 3. Induction of Dendritic Cell Maturation and Pre-inflammatory Cytokine Secretion by Recombinant GlBiP
수지상 세포는 병원균을 인지하고 결과적으로 적절한 T 세포를 활성화시키는 국소 림프절로 이동하는 전문적인 항원제공 세포 (antigen- presenting cells, APC)이다. 본 발명자들은 GlBiP 가 수지상 세포의 성숙을 유도할 수 있는지를 검사하였다. GlBiP의 면역촉진성 활성을 측정하기 위한 어세이를 수행하기 전에， 본 발명자들은 LPS 에 대해 대립하는 화합물인 PmB 를 이용하여 마우스 골수유래 수지상 세포 (bone marrow-derived dendritic cell, BMDC)를 전처리하였고, 0.1 μ g/mL 재조합 GlBiP 의 존재하에서 24 시간 동안 세포를 배양하였다 (도 13). 재조합 rGlBiP 의 결함을 갖는 수지상 세포에서 TNF-α의 수준은 ΡηιΒ 치료에 의한 영향을 받지 않은 반면， TNF- CL의 생산은 LPS 로 처리된 수지상 세포에서 PmB 에 의해 급격하게 영향을 받았다. 따라서， 수지상 세포는 이후 실험에서 LPS 의 면역학적 활성을 억제하기 위하여 LPS 로 처리된 수지상 세포에서 1 μ g/mL에서 PmB로 전처리되었다 ,  Dendritic cells are specialized antigen-presenting cells (APCs) that migrate to local lymph nodes that recognize pathogens and eventually activate appropriate T cells. We examined whether GlBiP can induce maturation of dendritic cells. Prior to performing the assay for measuring the immunopromoting activity of GlBiP, we pretreated mouse bone marrow-derived dendritic cells (BMDC) using PmB, an allele against LPS. Cells were incubated for 24 hours in the presence of 0.1 μg / mL recombinant GlBiP (FIG. 13). The level of TNF-α in dendritic cells with defects of recombinant rGlBiP was not affected by ΡηιΒ treatment, whereas the production of TNF-CL was dramatically affected by PmB in dendritic cells treated with LPS. Therefore, dendritic cells were pretreated with PmB at 1 μg / mL in dendritic cells treated with LPS to inhibit the immunological activity of LPS in subsequent experiments.
이후 실험에서, 본 발명자들은 수지상 세포 활성에 대한 3 개의 마커， 즉 CD80, CD86 및 MHC 클래스 II 의 발현을 조사하였다 (도 2). 골수세포 유래 수지상 세포를 0.1 내지 5 pg/mL 범위의 다양한 재조합 GlBiP 의 존재하에서 24 시간 동안 배양하고， 이후 상기 표면 마커의 발현에 대해 분석하였다. 표면 마커 MHCII 를 발현하는 세포의 퍼센트 비율은 소량 (0.1 μ g/mL) 및 다량 (5 μ g/mL)의 재조합 GlBiP 로서 급격하게 증가하지 않았다 (51% 내지 68%). 따라서， 골수세포 유래 수지상 세포를 하기 실험에서 0. 1 ii g/mL 의 재조합 GlBiP 를 이용하여 처리하였다. MHC 클래스 I I 의 발현을 보여주는 세포의 퍼센트 비율은 재조합 GlBiP 로 처리한 반웅에서 28% 내지 65%까지 증가하였다. 재조합 GlBiP 을 이용한 자극에서， 공동자극 (cost inml atory) 분자, 즉 CD86 및 CD80 를 발현하는 세포는 또한 각각 21% 내지 59% 및 25% 내지 61¾>로 증가하였다. 수지상 세포 활성화에 대한 양성 조절로서, LPS(0.5 y g/mL)가 골수세포 유래 수지상 세포를 자극시키기 위해 이용되었고, 골수세포 유래 수지상 세포에서 MHC 클래스 1 1 (53%)와 두 개의 공동자극 마커， CD86(59« 및 CD80 (49«를 향상시킨다는 것을 발견하였다. 상기 결과는 람블편모층 BiP 가 LPS 만큼 효율적으로 수지상 세포의 활성화를 유도하였음을 보여준다. In subsequent experiments, we examined the expression of three markers for dendritic cell activity, namely CD80, CD86 and MHC class II (FIG. 2). Myeloid cell derived dendritic cells were incubated for 24 hours in the presence of various recombinant GlBiPs ranging from 0.1 to 5 pg / mL and then analyzed for expression of the surface markers. The percentage proportion of cells expressing surface marker MHCII did not increase rapidly (51% to 68%) as small amounts (0.1 μg / mL) and large amounts (5 μg / mL) of recombinant GlBiP. Therefore, myeloid cell-derived dendritic cells were treated with 0.1 ii g / mL recombinant GlBiP in the following experiment. The percentage proportion of cells showing expression of MHC class II increased from 28% to 65% in reactions treated with recombinant GlBiP. In stimulation with recombinant GlBiP, cells expressing cost inml atory molecules, namely CD86 and CD80, also increased by 21% to 59% and 25% to 61¾>, respectively. As a positive control for dendritic cell activation, LPS (0.5 yg / mL) was used to stimulate myeloid cell-derived dendritic cells, MHC class 1 1 (53%) and two co-stimulatory markers in myeloid cell-derived dendritic cells, It was found that CD86 (59 «and CD80 (49«) was improved. The results show that the Ramblel flagella BiP induced activation of dendritic cells as efficiently as LPS.
활성화된 수지상 세포는 사이토카인을 분비하고, 상기 사이토카인은 면역반응에서 중요한 역할을 한다 (Moser M & Murphy KM, Nat I國 unol 2000； 1 : 199-205) . 마우스 골수세포 유래 수지상 세포는 다양한 농도의 재조합 GlBiP 을 이용하여 자극받았고 (0. 1-10 μ g/mL) , 이후 IL— 12， TNF- α , IL-6 및 IL-4 분비에 대해 분석되었다 (도 3) . 재조합 GlBiP 는 대조군 세포 보다 높은 수준의 TNF- α , IL-12 및 IL-6 를 분비하였다. 특히， 재조합 GlBiP 에 결함이 있는 수지상 세포는 용량 의존적 방법으로 매우 다량의 IL- 12(70 , 900 pg/mL)를 분비하였다. 상당한 양의 TNF- a 및 IL-6 가 또한 GlBiP 가 처리된 수지상 세포에 의해 분비되었다 (70 , 900 pg/mL) . 상당한 양의 TNF- ci 및 IL-6 가 또한 재조합 GlBiP 이 처리된 수지상 세포에 의해 각각 분비되었다 ( 1， 098 및 2， 322 pg/mL) . 그러나, TNF- a 및 IL-6의 수준은 고농도의 재조합 GlBiP에서 감소하였다. 1 1-4(79 pg/mL)는 재조합 GlBiP가 처리된 수지상 세포에서 거의 검출되지 않았다. 예상대로, 유의한 양의 IL- 12， TNF- a , 및 IL-6 가 LPS 가 처리된 수지상 세포에 의해 분비되었다. 람블편모층에 대한 반응에서 생산된 사이토카인 프로과일은 람블편모층에 의해 유도된 수지상 세포 활성화가 Th-1 유형 면역 반웅을 유도한다는 가능성을 향상시켰다. 4. 람블편모충 추출물에 의한 마우스 골수유래 수지상 세포 (bone marrow-derived dendri t ic eel Is , BDDC)의 성숙 본 발명자들은 람블편모층 추출물이 골수세포 유래 수지상 세포의 성숙을 유도할 수 있다는 것을 조사하였다 (도 4) . 마우스 골수세포 유래 수지상 세포를 50 u g/mL 에서 람블편모충와 경쟁시켰을 때， MHC I I 표면 마커 발현하는 세포의 퍼센트 비율은 40% 내지 58%까지 증가하였다. 람블편모충 추출물을 이용한 자극의 경우， 공동자극성 분자， 즉 CD86 및 CD80 를 발현하는 세포는 각각 40% 내지 92% 및 70% 내지 92%까지 증가하였다. 또한， 람블편모층 추출물로 자극 받은 세포는 람블편모충이 수지상 세포 활성화를 유도한다는 것을 나타내는, 유의한 수준의 TNF- Q ( 129 pg/mL) 및 IL-12 (7 , 980 pg/mL)를 분비하였다 (도 4) . Activated dendritic cells secrete cytokines, which play an important role in the immune response (Moser M & Murphy KM, Nat Iun unol 2000; 1: 199-205). Dendritic cells derived from mouse myeloid cells were stimulated using various concentrations of recombinant GlBiP (0.1-10 μg / mL) and then analyzed for IL-12, TNF-α, IL-6 and IL-4 secretion. (FIG. 3). Recombinant GlBiP secreted higher levels of TNF-α, IL-12 and IL-6 than control cells. In particular, dendritic cells defective in recombinant GlBiP secreted very large amounts of IL-12 (70, 900 pg / mL) in a dose dependent manner. Significant amounts of TNF-a and IL-6 were also secreted by dendritic cells treated with GlBiP (70, 900 pg / mL). Significant amounts of TNF-ci and IL-6 were also secreted by dendritic cells treated with recombinant GlBiP (1, 098 and 2, 322 pg / mL), respectively. However, levels of TNF-a and IL-6 were reduced at high concentrations of recombinant GlBiP. 1 1-4 (79 pg / mL) was hardly detected in dendritic cells treated with recombinant GlBiP. As expected, significant amounts of IL-12, TNF-a, and IL-6 were secreted by dendritic cells treated with LPS. Cytokine profruit produced in response to the Rambler layer enhanced the likelihood that dendritic cell activation induced by the Rambler layer induces Th-1 type immune response. 4. Maturation of Mouse Bone Marrow-derived Dendritic Isol Is (BDDC) by Ramblel Beetle Extract The inventors investigated that the extract of Ramble flagella can induce maturation of myeloid cell-derived dendritic cells (FIG. 4). When mouse myeloid cell-derived dendritic cells competed with Ramblerella at 50 ug / mL, the percentage of cells expressing MHC II surface markers increased from 40% to 58%. In the case of stimulation with the Ramblerella extract, the cells expressing the co-stimulatory molecules, namely CD86 and CD80, increased by 40% to 92% and 70% to 92%, respectively. In addition, cells stimulated with the Ramblerella extract secrete significant levels of TNF-Q (129 pg / mL) and IL-12 (7,980 pg / mL), indicating that the Ramblel worms induce dendritic cell activation. (FIG. 4).
5. 수지상 세포에 의해 GlBiP-유도된 사이토카인 생산에서 TLR4 의 역할 5. Role of TLR4 in GlBiP-Induced Cytokine Production by Dendritic Cells
본 발명자들은 람블편모층의 BiP 단백질이 인지하는 방법 및 상기 인지방법이 수지상 세포의 활성화 및 사이토카인 생산을 야기하는 방법를 연구하였다. 특히， 본 발명자들은 수지상 세포에 의해 재조합 GlBiP 로 유도된 사이토카인 생산에서 두 가지 Tol l 유사 수용기 (Tol l -l ike receptors , TLR)의 역할을 조사하였다 (도 5a) . 골수세포 유래 수지상 세포는 재조합 GlBiP 를 이용한 자극 전에 TLR2 또는 TLR4 에 특이적인 항체로 처리되었다. 대조군으로서， 골수세포 유래 수지상 세포의 또 다른 세트는 TLR 항체 대신에 아이소타입 ( isotype) 대조군 IgG 로 처리되었고， 이후 동일한 방법으로 재조합 GlBiP 를 이용하여 자극 받았다. 상기 재조합 GlBiP 가 손상된 수지상 세포는 TNF- α의 생산을 위해 분석되었다. TLR2 항체로 처리된 수지상 세포에서, 재조합 GlBiP 로 활성화된 수지상 세포는 아이소타입 IgG(2, 554 pg/mL; p= 0.852 , Student t-test )을 이용하여 전처리된 활성화된 수지상 세포와 유사한 수준의 TNF- a를 분비하였다. 대조적으로， TLR4 항체로 전처리된 세포는 아이소타입 IgG 로 처리된 단백백혈구와 비교해서 TNF- ci 생산에서 유의한 감소를 나타내었다 (482 g/mL) .  The inventors have studied how the BiP protein in the Rambler flagella and how the recognition causes dendritic cell activation and cytokine production. In particular, we investigated the role of two Tol-like receptors (TLRs) in the production of recombinant GlBiP-induced cytokine by dendritic cells (FIG. 5A). Myeloid cell derived dendritic cells were treated with antibodies specific for TLR2 or TLR4 prior to stimulation with recombinant GlBiP. As a control, another set of myeloid cell-derived dendritic cells was treated with isotype control IgG instead of TLR antibody and then stimulated using recombinant GlBiP in the same manner. The recombinant GlBiP damaged dendritic cells were analyzed for production of TNF-α. In dendritic cells treated with TLR2 antibody, dendritic cells activated with recombinant GlBiP were at levels similar to activated dendritic cells pretreated using isotype IgG (2, 554 pg / mL; p = 0.852, Student t-test). TNF-a was secreted. In contrast, cells pretreated with TLR4 antibody showed a significant decrease in TNF-ci production as compared to protein cells treated with isotype IgG (482 g / mL).
마우스 수지상 세포에서, 재조합 GlBiP 로 유도된 사이토카인 생산에서 TLR4 의 기능을 연구하기 위하여， 본 발명자들은 또한 HEK 293 세포를 이용한 in vitro시스템를 재구성하였고, 상기 시스템에서 TLR2 또는 TLR 4 가 공통된 어댑터 단백질 (adaptor protein) , 즉 MyD88 과 함께 발현되었다 (Medzhi tov R , Preston-Hur lbur t P , Kopp E , et al , Mol Cel l 1998； 2： 253-258. ) . 대조군으로서， HEK 293 세포의 또 다른 세트는 p'FLAG- TLR2 또는 pFLAG-TLR4 를 위한 공백터, pFLAG-CMVl 을 이용하여 형질감염되었다. 리포터 유전자를 이용한 사이토카인 생산을 모니터하기 위하여， 상기 시스템은 형질 감염 효율을 이용하여 노말화된 NF- κ Β에 대한 루시퍼레이즈 리포터를 포함한다. 사이토카인 생산을 유도하기 위한 재조합 람블편모충의 능력은 TLR4 를ᅳ발현하는 HEK 293 세포, TLR2을 발현하는 HEK 293 세포, 및 대조군 HEK 293 세포의 루시퍼레이즈 활성을 측정함으로써 모니터링 되었다 (도 5b) . LPS 또는 재조합 GlBiP 을 이용한 배양의 경우， pFLAG-CMV를 운반하는 HEK 293는 각각 57또는 26으로， 상대적으로 감소된 루시퍼레이즈 활성을 나타내었다. TLR2 를 발현하는 HEK293 세포는 재조합 GlBiP 가 아니라， 오직 LPS 와 반웅하여 루시퍼레이즈 활성에서 적절한 증가를 보여주었다 (루시퍼레이즈 활성에 상대적으로 80 내지 196) ) . 대조적으로， 재조합 GlBiP 또는 LPS 로 자극되는 경우ᅳ TLR4 를 발현하는 HEK 293 세포는 루시퍼레이즈 활성에서 유의한 증가를 보여주었다 (루시퍼레이즈 활성에 상대적으로 각각 771 및 636) . In mouse dendritic cells, to study the function of TLR4 in recombinant GlBiP-induced cytokine production, we also reconstituted an in vitro system using HEK 293 cells, in which TLR2 Or TLR 4 was expressed with a common adapter protein, MyD88 (Medzhi tov R, Preston-Hurlburt P, Kopp E, et al, Mol Cel l 1998; 2: 253-258.). As a control, another set of HEK 293 cells was transfected with a blank for p ' FLAG- TLR2 or pFLAG-TLR4, pFLAG-CMVl. In order to monitor cytokine production using the reporter gene, the system includes a luciferase reporter for normalized NF-κ Β using transfection efficiency. The ability of recombinant Ramble flagella to induce cytokine production was monitored by measuring the luciferase activity of HEK 293 cells expressing TLR4, HEK 293 cells expressing TLR2, and control HEK 293 cells (FIG. 5B). For culture with LPS or recombinant GlBiP, HEK 293 carrying pFLAG-CMV was 57 or 26, respectively, indicating relatively reduced luciferase activity. HEK293 cells expressing TLR2, but not recombinant GlBiP, only showed a moderate increase in luciferase activity in response to LPS (80-196 relative to luciferase activity). In contrast, HEK 293 cells expressing TLR4 when stimulated with recombinant GlBiP or LPS showed a significant increase in luciferase activity (771 and 636 relative to luciferase activity, respectively).
다음 세트의 실험에서, 본 발명자들은 TLR4 넉아웃 마우스 모델을 이용한 수지상 세포에 의하여 재조합 GlBiP 에 의해 유도된 사이토카인 생산에서 TLR4 의 역할을 확인하였다 (도 5c) . TLR4-/- 마우스의 골수세포 유래 수지상 세포는 재조합 GlBi P 에 의해 유도된 IL-12 분비에서 급격한 감소 ( 12 pg/mL)를 나타낸 반면에， TLR2-/- 마우스의 골수세포 유래 수지상 세포는 재조합 GlBiP 에 대한 반웅에서 야생형 골수세포 유래 수지상 세포 (24 , 350 pg/mL)에 대한 IL-12 와 유사한 수준 (23 , 671 pg/mL)을 분비하였다. 재조합 GlBiP 를 이용한 골수세포 유래 수지상 세포의 자극의 경우， 야생형 세포 및 TLR2 결핍 마우스 유래의 세포는 향상된 TNF- a 생산을 입증한 (각각 719 및 682 pg/mL) 반면에， TLR-4 결핍 세포는 TNF- α를 생산하지 못하였다 (6 pg/mL) . 동일한 방법으로， 수지상 세포에 의한 재조합 GlBiP-처리 유도된 IL-6 생산은 야생형 및 TLR2-/- 마우스에서 수득되었다 (각각 6 , 792 및 7 , 139 pg/mL) . 대조적으로， TLR4-/- 마우스 유래의 세포는 예상대로 재조합 Gl BiP 에 의해 유도된 IL-6 분부의 일부 감소를 4 , 082 pg/mL 로서 나타낸 반면에 , LPS 및 TNF- α를 이용한 야생형 골수세포 유래 수지상 세포의 시험은 TNF- ci의 감소된 생산을 야기하였다 (각각 5，300 및 90 pg/mL) . TLR4-/- 마우스 유래의 골수세포 유래 수지상 세포는 LPS 에 대한 반응에서 IL-6 를 분비할 능력을 상실하였다 (87 pg/mL) . 상기 데이터는 명확히 TLR4 가 람블편모층 Bip 에 대한 반응을 위해 요구된다는 것을 나타낸다. In the next set of experiments, we identified the role of TLR4 in cytokine production induced by recombinant GlBiP by dendritic cells using the TLR4 knockout mouse model (FIG. 5C). Myeloid cell-derived dendritic cells in TLR4-/-mice showed a sharp decrease (12 pg / mL) in IL-12 secretion induced by recombinant GlBi P, whereas myeloid cell-derived dendritic cells in TLR2-/-mice were recombinant. Reactions to GlBiP secreted similar levels of IL-12 (23, 671 pg / mL) to wild-type myeloid cell-derived dendritic cells (24, 350 pg / mL). For stimulation of myeloid cell-derived dendritic cells with recombinant GlBiP, cells from wild-type cells and TLR2 deficient mice demonstrated improved TNF-a production (719 and 682 pg / mL, respectively), whereas TLR-4 deficient cells Could not produce TNF-α (6 pg / mL). In the same way, recombinant GlBiP-treated induced IL-6 production by dendritic cells was obtained in wild type and TLR2-/-mice (6, 792 and 7, 139 pg / mL, respectively). In contrast, TLR4-/-mouse-derived cells, as expected, are part of the IL-6 segment induced by recombinant Gl BiP. Reductions were expressed as 4, 082 pg / mL, while testing of wild-type myeloid cell-derived dendritic cells with LPS and TNF-α resulted in decreased production of TNF-ci (5,300 and 90 pg / mL, respectively). . Myeloid cell-derived dendritic cells derived from TLR4-/-mice lost the ability to secrete IL-6 in response to LPS (87 pg / mL). The data clearly indicate that TLR4 is required for the response to the Ramble flagella Bip.
6. 수지상 세포 유래의 재조합 GlBiP 에 의해 유도된 사이토카인 생산에서 MyD88의 역할 6. Role of MyD88 in Cytokine Production Induced by Recombinant GlBiP Derived from Dendritic Cells
MyD88 은 표면 TLR 과 세포내 신호전달 구성성분 사이의 신호전달을 매개하는 일종의 어댑터 (adaptor )이다 (Suzuki N , Suzuki S & Yeh WC , Trends I隱 unol 2002； 23： 503-506) . 그러나, 일부 TLR 리간드는 세포내 신호전달 구성요소， 예컨대 TRIF 를 MyD88 의 관여 없이 활성화시킨다. 본 발명자들은 MyD88 가 재조합 GlBiP BiP 에 의해 유도된 사이토카인과 관련이 있는 지를 MyD88 을 이용하여 조사하였다 (도 6a) . MyD88 로부터 제조된 골수세포 유래 수지상 세포는 LPS 를 이용하여 시험하였을 때， 종래 보고된 바외 같이 (Takeuchi 0, Takeda K, Hoshino , et al , Int I画 unol 2000 ; 12 : 113117) , IL-12 , TNF- α 또는 IL-6 를 생산하지 못하였다. 재조합 GlBiP 로 처리되었을 경우, MyD88 은 TLR4/BiP 상호작용과 관련된 본질적인 신호전달 구성요소라는 것을 시사한다. 또한, MyD88 및 TLR4 간의 상호작용은 재조합 GlBiP 로 처리된 수지상 세포에서 TLR4 와 MyD88 의 물리적 결합을 측정함으로씨 모니터링 되었다 (도 6b) . 재조합 GlBiP 를 이용하여 처리된 수지상 세포 유래의 용해물을 항 -TLR4 또는 항 -MyD88 항체를 이용한 면역침강법을 수행하였다. 침강된 용해물의 웨스턴 블롯 분석은 비처리된 세포와 비교하여 2 내지 3 배 더 많은 MyD88 가 재조합 GlBiP-처리된 세포로부터 수득한 항 -TLR4 항체와 공동 -침강된다는 것을 나타내었다. 항- MyD88 항체는 비처리된 세포 보다 재조합 GlBiP 로 자극 받은 세포의 두배만큼 침강되었다. 상기 결과는 TLR4 또는 MyD88 간의 결합이 재조합 GlBiP에 노출된 수지상 세포에서 증가되었다는 것을 입증하는 것이다. 7. 수지상 세포 유래의 재조합 GlBiP 에 의해 유도된 사이토카인 생산에서 MAPK의 역할 MyD88 is an adapter that mediates the signaling between surface TLRs and intracellular signaling components (Suzuki N, Suzuki S & Yeh WC, Trends Iunol 2002; 23: 503-506). However, some TLR ligands activate intracellular signaling components such as TRIF without the involvement of MyD88. We investigated whether MyD88 was associated with cytokines induced by recombinant GlBiP BiP (FIG. 6A). Myeloid cell-derived dendritic cells prepared from MyD88 were previously reported when tested using LPS (Takeuchi 0, Takeda K, Hoshino, et al, Int Iun unol 2000; 12: 113117), IL-12, It failed to produce TNF-α or IL-6. When treated with recombinant GlBiP, MyD88 suggests that it is an essential signaling component involved in TLR4 / BiP interactions. In addition, the interaction between MyD88 and TLR4 was monitored by measuring the physical binding of TLR4 and MyD88 in dendritic cells treated with recombinant GlBiP (FIG. 6B). Lysates derived from dendritic cells treated with recombinant GlBiP were subjected to immunoprecipitation using anti-TLR4 or anti-MyD88 antibodies. Western blot analysis of the precipitated lysates showed that 2-3 times more MyD88 co-precipitated with anti-TLR4 antibodies obtained from recombinant GlBiP-treated cells as compared to untreated cells. Anti-MyD88 antibody sedimented twice as much as recombinant GlBiP stimulated cells than untreated cells. The results demonstrate that binding between TLR4 or MyD88 was increased in dendritic cells exposed to recombinant GlBiP. 7. Role of MAPK in Cytokine Production Induced by Recombinant GlBiP Derived from Dendritic Cells
MAP 는 병원성 미생물에 대한 세포 반웅을 촉발하는 특성규명이 잘된 신호전달 카이네이즈이다. 진핵세포에서 3 개의 잘 알려진 MAPK 서브 패밀리， 즉 ERKl/2, p38 및 JNK 이다. 상기 카이네이즈는 다양한 세포외적 자극， 예컨대 물리적 스트레스, 염증성 사이토카인， 성장 호르몬 및 박테리아 성분들에 대한 반응에서 독립적으로 또는 동시에 활성화된다. 본 발명자들은 마우스 수지상 세포에서 람블편모층 BiP 에 의해 유도된 사이토카인 생산에서 MAPK의 역할을 조사하였다. PD98059에 의한 ERK1/2의 불활성화 (ERK1/2 의 선택적 억제자)는 마우스 수지상 세포에서 재조합 GlBiP 와 반응하여 IL-12 및 TNF-α의 생산을 비처리된 세포에서 각각 14% 및 36%의 수준까지 감소시켰다 (도 7a). 이후 본 발명자는 재조합 GlBiP 처리에 대한 반웅에서 ERKl/2 MAPK의 활성화 상태를 조사하였다.  MAP is a well characterized signaling kinase that triggers cellular reaction to pathogenic microorganisms. There are three well known MAPK subfamily in eukaryotic cells: ERKl / 2, p38 and JNK. The kinase is activated independently or simultaneously in response to various extracellular stimuli such as physical stress, inflammatory cytokines, growth hormones and bacterial components. The present inventors investigated the role of MAPK in cytokine production induced by the Ramble bilayer BiP in mouse dendritic cells. Inactivation of ERK1 / 2 by PD98059 (selective inhibitor of ERK1 / 2) reacted with recombinant GlBiP in mouse dendritic cells to produce IL-12 and TNF-α in 14% and 36%, respectively, in untreated cells. Reduced to level (FIG. 7A). The inventors then investigated the activation status of ERKl / 2 MAPK in reaction to recombinant GlBiP treatment.
재조합 GlBiP의 노출은 자극 10분 후 최대 활성화를 갖는 ERK1/2의 인산화를 야기하였다. ERK1/2 의 인산화는 또한 LPS 로 처리된 수지상 세포에서 최대 활성화가 자극 8 분 후에 관찬되었을 때 발생하였다. p38 MAPK 의 억제자인 SB202190 을 이용한 수지상 세포의 전처리는 재조합 GlBiP 에 대한 반웅에서 비처리된 세포에서 측정된 수준의 12% and 32%까지 각각 IL-12 및 TNF- Q의 생산의 감소를 야기하였다 (도 7b). 재조합 GlBiP 에 대한 마우스 수지상 세포의 노출은 자극의 8 분 및 10 분 사이의 최대활성화를 갖는 p38 인산화를 야기하였다ᅳ 마우스 수지상 세포의 LPS 처리는 또한 p38 MAPK의 인산화를 유도하였다.  Exposure of recombinant GlBiP resulted in phosphorylation of ERK1 / 2 with maximal activation 10 minutes after stimulation. Phosphorylation of ERK1 / 2 also occurred when maximal activation in dendritic cells treated with LPS was observed 8 minutes after stimulation. Pretreatment of dendritic cells with SB202190, an inhibitor of p38 MAPK, resulted in reduced production of IL-12 and TNF-Q up to 12% and 32%, respectively, of levels measured in untreated cells in response to recombinant GlBiP ( 7b). Exposure of mouse dendritic cells to recombinant GlBiP resulted in p38 phosphorylation with maximal activation between 8 and 10 minutes of stimulation. LPS treatment of mouse dendritic cells also induced phosphorylation of p38 MAPK.
p38 및 ERKl/2 MAPK 와 대조적으로， JNK 의 분명한 활성화는 재조합 GlBiP 를 이용한 마우스 수지상 세포의 배양의 경우 검출되지 않았다. JNK 억제자 및 JNK 억제자 II 를 이용한 마우스 수지상 세포의 전처리는 재조합 GlBiP 와 반웅하여 IL-12 and TNF-α에서 약간의 감소, 즉 24-28%의 감소를 야기하였다. 상기 결과는 MAPK 가 수지상 세포 성숙에서 어떤 역할을 한다는 것을 나타내었다. 3 개의 MAPK 중에서， p38 및 ERKl/2 MAPK 는 재조합 GlBiP에 의해 유도된 면역 반응에 대한 JNK 보다 더 많이 기여하였다. 8. GlBiP 에 의해 활성화된 수지상 세포에서 NF-κΒ 및 AP-1 의 증가된 결합활성 In contrast to p38 and ERKl / 2 MAPK, no clear activation of JNK was detected in the culture of mouse dendritic cells using recombinant GlBiP. Pretreatment of mouse dendritic cells with JNK inhibitor and JNK inhibitor II resulted in a slight decrease, ie 24-28% reduction in IL-12 and TNF-α in response to recombinant GlBiP. The results indicated that MAPK plays a role in dendritic cell maturation. Of the three MAPKs, p38 and ERKl / 2 MAPK contributed more than JNK to the immune response induced by recombinant GlBiP. 8. Increased Binding Activity of NF-κΒ and AP-1 in GlBiP-activated Dendritic Cells
본 발명자들은 두 개의 전사인자， AP-1 및 NF-κΒ 가 람블편모층 BiP 자극에 대해 유사한 결합 부위에 결합하는 지를 EMAS 를 이용하여 조사하였다. 핵 추출물을 재조합 GlBiP 로 처리된 마우스 골수세포 유래 수지상 세포로부터 제조하였고， 이후 NF-κΒ 결합 부위를 포함하는 올리고뉴클레오타이드와 함께 배양하였다 (도 8a). 이것은 표지된 DNA 단편이 더 느리게 이동하게 만들지만, 이 효과는 초과한 비표지된 NF- KB 결합 부위를 결합 반응에 첨가하였을 때 사라졌다. NF- KB 결합 활성은 예상대로 LPS 로 자극된 수지상 세포의 핵 추출물에서 관찰되었다. 재조합 GlBiP 로 자극 받은 골수세포 유래 수지상 세포의 핵 추출물은， 또한 AP-1 결합 부위를 포함하는 표지된 올리고뉴클레오타이드와 함게 배양되었다 (도 8b). 마찬가지로， 상기 핵 추출물은 느리게 움직이는 AP-1 DNA 단편을 생산하였고， 이 상호작용은 특이적인 상호작용을 나타내는 AP-1 결할 부위의 첨가에 의해 방해받았다. LPS 로 처리된 수지상 세포로부터 제조된 핵 추출물은 또한 증가된 AP-1 결합 활성을 나타내었다.  We investigated whether two transcription factors, AP-1 and NF-κΒ, bind to similar binding sites for Ramble flagella BiP stimulation using EMAS. Nuclear extracts were prepared from dendritic cells derived from mouse myeloid cells treated with recombinant GlBiP and then incubated with oligonucleotides containing the NF-κΒ binding site (FIG. 8A). This caused the labeled DNA fragments to move more slowly, but this effect disappeared when excess unlabeled NF-KB binding sites were added to the binding reaction. NF-KB binding activity was observed in nuclear extracts of dendritic cells stimulated with LPS as expected. Nuclear extracts of myeloid cell-derived dendritic cells stimulated with recombinant GlBiP were also incubated with labeled oligonucleotides comprising the AP-1 binding site (FIG. 8B). Similarly, the nuclear extract produced slow moving AP-1 DNA fragments, which interactions were hindered by the addition of AP-1 defect sites indicating specific interactions. Nuclear extracts prepared from dendritic cells treated with LPS also showed increased AP-1 binding activity.
9. GlBiP의 Hsp70도메인에 의한수지상 세포 활성화의 유도 9. Induction of Dendritic Cell Activation by Hsp70 Domain of GlBiP
GlBiP 은 2 개의 추정상의 도메인， 즉， 액틴 결합 도메인 (N 말단 부위) 및 열층격 단백질 (C 말단 부위)을 각각 포함한다. 전장 재조합 GlBiP 뿐만 아니라， 두 개의 절단된 재조합 GlBiP 단백질， 재조합 GlBiP-N 도메인 및 재조합 GlBiP-C 도메인이 대장균에서 발현되었다 (도 9a). 상기 재조합 GlBiP 단백질을 재조합 GlBiP 의 동정을 위해 이용된 항—람블편모층 항체로 배양하였을 때, rGlBiP-N 도메인 및 rGlBiP-C 도메인이 대장균에서 발현되었다 (도 9a). 상기 재조합 Gi P 단백질을 항 -람블편모충 항체를 이용하여 배양하였을 때 (도 12 및 1)， 전장 rGlBiP 및 rGlBiP-콜로니는 면역반응성 단백질을 나타낸 반면에 그것들은 면역전 혈청을 이용한 웨스턴 블롯 분석에서 존재하지 않았다 (도 9b). 또 다른 절단된 재조합 GlBiP, 재조합 GlBiP-N 도메인은 전면역 혈청 또는 항 -람블편모층 항체와 반응하지 않았다. 상기 절단된 재조합 GlBiP 단백질은 마우스 골수세포 유래 수지상 세포를 자극하기 위하여 이용되었다 (도 9c) . Hsp70 도메인을 갖는 조합 GlBiP 는 자극 받은 수지상 세포로부터 TNF- α 및 IL-12 를 유도하는데 효율적이었다. 반면에， 액틴 결합 도메인을 갖는 재조합 GlBiP 는 마우스 골수세포 유래 수지상 세포로부터 사이토카인 생산을 자극하지 않았다. GlBiP comprises two putative domains, namely an actin binding domain (N-terminal site) and a thermolayer protein (C-terminal site), respectively. In addition to full length recombinant GlBiP, two truncated recombinant GlBiP proteins, a recombinant GlBiP-N domain and a recombinant GlBiP-C domain were expressed in E. coli (FIG. 9A). When the recombinant GlBiP protein was incubated with the anti-Ramble flagella antibody used for the identification of recombinant GlBiP, rGlBiP-N domain and rGlBiP-C domain were expressed in E. coli (FIG. 9A). When the recombinant Gi P protein was incubated with anti-lambler flagella antibody (FIGS. 12 and 1), full-length rGlBiP and rGlBiP-colonies showed immunoreactive proteins while they were not present in Western blot analysis using pre-immune serum. (FIG. 9B). Another truncated recombinant GlBiP, recombinant GlBiP-N domain did not react with the full-range serum or anti-lambler flagell antibody. The cleaved recombinant GlBiP protein was used to stimulate dendritic cells derived from mouse myeloid cells (FIG. 9C). Combination GlBiP with Hsp70 domain was efficient at inducing TNF-α and IL-12 from stimulated dendritic cells. In contrast, recombinant GlBiP with an actin binding domain did not stimulate cytokine production from mouse myeloid cell-derived dendritic cells.
10. 재조합 GlBiP 단백질에 의한 수지상 세포 활성화를 통하여 T 세포에 의한사이토카인 생산의 유도 10. Induction of cytokine production by T cells through dendritic cell activation by recombinant GlBiP protein
마우스 지라세포 (spl enocyte)로부터 수득된 CD4+ T 세포가 재조합 GlBiP 또는 재조합 GlBiP-C 도메인을 이용하여 처리된 마우스 수지상 세포를 이용하여 공동 배양되었을 때, 이들은 IL-2(각각 174 pg/mL or 2 , 364 pg/mL)을 분비하였다 (도 10 의 A) . 반면에， 재조합 GlBiP-N 도메인으로 처리된 마우스 수지상 세포와 공배양된 CD4+ T 세포는 IL-2 를 방출하지 않았다 (2 pg/mL) . IL-2 는 재조합 GlBiP 가 손송된 수지상 세포는. IL-2 를 생산하지 않았기 때문에 CD4+ T 세포로부터 수득되었지만, 마우스 수지상 세포로부터 수득되지 않았다. 또한， 오직 전장 재조합 GlBiP 또는 재조합 GlBiP-C 도메인과 함께 배양된 T—세포로부터 수득된 배양액은 상당한 양의 IFN- Y 분비를 입증하였다 (2 , 921 pg/mLor 52 , 469 pg/mL) (도 10 의 B) . 동일한 방법으로， 대부분의 는 재조합 GlBiP 로 자극된 수지상 세포만이 T 세포 없이 낮은 수준의 IFN- Y를 생산하였기 때문에 , T 세포로부터 나온다 (68 pg/mL) . 상기 결과는 GlBiP 가 DC 활성화를 통해서 T 세포에 의한 사이토카인 생산을 유도할 수 있고 C-말단의 Hsp70 도메인은 이 과정에서 중요하다는 것을 나타낸다. 11. 마우스의 람블편모충 감염에 의한 GlBiP 의 Hsp70 도메인에 대한 항체 형성의 촉진  When CD4 + T cells obtained from mouse splenocytes were co-cultured with mouse dendritic cells treated with recombinant GlBiP or recombinant GlBiP-C domains, they were IL-2 (174 pg / mL or 2, respectively). , 364 pg / mL) (A in FIG. 10). In contrast, CD4 + T cells co-cultured with mouse dendritic cells treated with the recombinant GlBiP-N domain did not release IL-2 (2 pg / mL). IL-2 is a dendritic cell to which recombinant GlBiP has been delivered. It was obtained from CD4 + T cells because it did not produce IL-2, but not from mouse dendritic cells. In addition, cultures obtained from T-cells cultured with only full-length recombinant GlBiP or recombinant GlBiP-C domains demonstrated significant amounts of IFN-Y secretion (2, 921 pg / mLor 52, 469 pg / mL) (FIG. 10 b). In the same way, most are derived from T cells, since only dendritic cells stimulated with recombinant GlBiP produced low levels of IFN-Y without T cells (68 pg / mL). The results indicate that GlBiP can induce cytokine production by T cells through DC activation and that the C-terminal Hsp70 domain is important in this process. 11. Promoting antibody formation against Hsp70 domain of GlBiP by infection with Ramblerella infestation of mice
람블편모층 영양형의 마우스내로의 구강 감염 후， 이들의 혈청을 람블편모층 추출물 또는 재조합 GlBiP 단백질을 이용하여 웨스턴 블록에 의해 분석하였다 (도 11 ) . 4개의 면역반응성 단백질이 항 -람블편모층 항체를 이용한 웨스턴 블롯에서 분자량 74， 58 , 55 및 30 kDa 에서 관찰되었다 (도 12a) . 74 kDa 의 면역반웅성 단백질은 GlBiP 로 추정되었다. 상기 혈청을 3 개의 재조합 GlBiP 와 반응시켰다. 전면역 혈청을 이용한 웨스턴 블롯에서 명백한 면역반웅성 단백질이 전혀 존재하지 않는 반면에， 감염된 마우스로부터 수득된 혈청을 이용한 반웅은 Hsp70 도메인을 수반하는 절단된 재조합 GlBiP-C 도메인뿐만 아니라， 전장 재조합 GlBiP 단백질에 대한 면역반응성을 입증하였다. 대조적으로, 재조합 GlBiP-N 도메인은 상기 혈청에 대한 어떠한 면역반응성을 나타내지 않았다. 이상으로 본 발명의 특정한 부분을 상세히 기술하였는바, 당업계의 통상의 지식을 가진 자에게 있어서 이러한 구체적인 기술은 단지 바람직한 구현 예일 뿐이며, 이에 본 발명의 범위가 제한되는 것이 아닌 점은 명백하다. 따라서 본 발명의 실질적인 범위는 첨부된 청구항과 그의 등가물에 의하여 정의된다고 할 것이다. After oral infection into Rambler's trophoblastic mice, their serum was analyzed by Western block using Rambler's flagella extract or recombinant GlBiP protein (FIG. 11). Four immunoreactive proteins were observed at molecular weights 74, 58, 55 and 30 kDa in Western blot using anti-Ramble flagella antibodies (FIG. 12A). The 74 kDa immunoreactive protein was estimated to be GlBiP. The serum Reaction with three recombinant GlBiP. While there was no apparent immunoreactive protein in the western blot using the full range serum, the reaction with serum obtained from infected mice was not only the truncated recombinant GlBiP-C domain carrying the Hsp70 domain, but also the full length recombinant GlBiP protein. Immune responsiveness to was demonstrated. In contrast, the recombinant GlBiP-N domain did not show any immunoreactivity to the serum. Having described the specific part of the present invention in detail, it is apparent to those skilled in the art that the specific technology is merely a preferred embodiment, and the scope of the present invention is not limited thereto. Therefore, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

Claims

【청구의 범위】 [Range of request]
【청구항 11  [Claim 11
(a) 람블편모층 결합 면역글로블린 단백질 (Giardia lamblia binding immunoglobulin protein) 또는 그의 단편의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 면역증진용 약제학적 조성물.  (a) a pharmaceutically effective amount of a Giardia lamblia binding immunoglobulin protein or fragment thereof; And (b) a pharmaceutically acceptable carrier.
【청구항 2】 [Claim 2]
제 1 항에 있어서， 상기 람블편모층 결합 면역글로블린 단백질의 단편은 서열목록 제 1 서열의 428 내지 677 번째 아미노산을 포함하는 것을 특징으로 하는 조성물.  The composition of claim 1, wherein the fragment of the Ramble flagella binding immunoglobulin protein comprises amino acids 428-677 of SEQ ID NO: 1.
【청구항 3】 [Claim 3]
다음의 단계를 포함하는 면역원성을 가지는 에피토프의 스크리닝 방법:  Screening methods for epitopes with immunogenicity comprising the following steps:
(a) (i) 람블편모층 결합 면역글로블린 단백질 (Giardia lamblia binding immunoglobulin protein) 또는 그의 단편과 (i i ) 에피토프 후보물질로서의 펩타이드를 이용하여 개체를 면역화시키는 단계; 및  (a) immunizing an individual using (i) a Giardia lamblia binding immunoglobulin protein or fragment thereof and (i i) a peptide as an epitope candidate; And
(b) 상기 면역화된 개체에서의 면역반웅을 측정하는 단계.  (b) measuring the immune response in said immunized subject.
【청구항 4】 [Claim 4]
다음의 단계를 포함하는 단백질 항원에 대한 항체의 스크리닝 방법: (a) (i) 람블편모충 결합 면역글로블린 단백질 (Giardia lamblia binding immunoglobulin protein) 또는 그의 단편과 ( i i ) 에피토프 후보물질로서의 펩타이드를 이용하여 개체를 면역화시키는 단계;  A method for screening antibodies against protein antigens comprising the following steps: (a) an individual using (i) a Giardia lamblia binding immunoglobulin protein or fragment thereof and (ii) a peptide as an epitope candidate Immunizing;
(b) 상기 면역화된 개체에서의 면역반웅을 측정하여 면역원성을 나타내는 펩타이드 에피토프를 선별하는 단계;  (b) selecting a peptide epitope exhibiting immunogenicity by measuring immune response in said immunized individual;
(c) 상기 선별된 펩타이드 에피토프와 분석 대상의 항체를 접촉시키는 단계;  (c) contacting the selected peptide epitope with an antibody of interest;
(d) 상기 단계 (c)의 결과물과 상기 단백질 항원을 접촉시키는 단계 ; 및 (e) 상기 단백질 항원과 상기 분석 대상의 항체의 결합을 분석하는 단계. (d) contacting the resultant of step (c) with the protein antigen; And (e) analyzing the binding of the protein antigen to the antibody of interest.
【청구항 5] [Claim 5]
제 3 항 또는 제 4 항에 있어서， 상기 람블편모층 결합 면역글로블린 단백질의 단편은 서열목록 제 1 서열의 428 내지 677 번째 아미노산을 포함하는 것을 특징으로 하는 방법 .  The method of claim 3 or 4, wherein the fragment of the Ramble flagella binding immunoglobulin protein comprises amino acids 428-677 of SEQ ID NO: 1.
【청구항 6】 [Claim 6]
(a) 람불편모충 결합 면역글로블린 단백질 (Giardia lamblia binding immunoglobulin protein) 또는 그의 단편의 약제학적 유효량; 및 (b) 약제학적으로 허용되는 담체를 포함하는 면역증진용 약제학적 조성물을 이를 필요로하는 개체에게 투여하는 단계를 포함하는 면역반웅을 증진시키는 방법 .  (a) a pharmaceutically effective amount of a Giardia lamblia binding immunoglobulin protein or fragment thereof; And (b) administering an immunopromoting pharmaceutical composition comprising a pharmaceutically acceptable carrier to the subject in need thereof.
PCT/KR2015/006091 2014-06-16 2015-06-16 Immunostimulating composition containing recombinant giardia lamblia binding immunoglobulin protein WO2015194832A1 (en)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
KR10-2014-0072731 2014-06-16
KR1020140072731A KR101631312B1 (en) 2014-06-16 2014-06-16 Immunostimulatory Compositions Comprising Recombinant Giardia lamblia binding immunoglobulin protein

Publications (1)

Publication Number Publication Date
WO2015194832A1 true WO2015194832A1 (en) 2015-12-23

Family

ID=54935759

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/KR2015/006091 WO2015194832A1 (en) 2014-06-16 2015-06-16 Immunostimulating composition containing recombinant giardia lamblia binding immunoglobulin protein

Country Status (2)

Country Link
KR (1) KR101631312B1 (en)
WO (1) WO2015194832A1 (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR20050007375A (en) * 2002-05-02 2005-01-17 유니버시티 오브 코네티컷 헬스 센터 Use of heat shock proteins to enhance efficacy of antibody therapeutics
JP3856345B2 (en) * 1992-12-04 2006-12-13 ユニバーシテイ・テクノロジーズ・インターナシヨナル・インコーポレーテツド Intestinal protozoan vaccines
WO2012122618A1 (en) * 2011-03-17 2012-09-20 Nowill Alexandre Eduardo Immunogenic composition for immune system modulation and use thereof, method for treating and preventing diseases, method for inducing cell regeneration and method for restoring immune response

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP3856345B2 (en) * 1992-12-04 2006-12-13 ユニバーシテイ・テクノロジーズ・インターナシヨナル・インコーポレーテツド Intestinal protozoan vaccines
KR20050007375A (en) * 2002-05-02 2005-01-17 유니버시티 오브 코네티컷 헬스 센터 Use of heat shock proteins to enhance efficacy of antibody therapeutics
WO2012122618A1 (en) * 2011-03-17 2012-09-20 Nowill Alexandre Eduardo Immunogenic composition for immune system modulation and use thereof, method for treating and preventing diseases, method for inducing cell regeneration and method for restoring immune response

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
DATABASE GenBank [O] 13 July 2009 (2009-07-13), FRANZEN, O, XP055245887, retrieved from ncbi Database accession no. EES99538.1 *
GUPTA, R. S. ET AL.: "Cloning of Giardia lamblia heat shock protein HSP70 homologs: Implications regarding origin of eukaryotic cells and of endoplasmic reticulum", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 91, April 1994 (1994-04-01), pages 2895 - 2899, XP055245886 *
LEE, H. -Y. ET AL.: "Giardia lamblia binding immunoglobulin protein triggers maturation of dendritic cells via activation of TLR4-MyD88-p38 and ERK1/2 MAPKs", PARASITE IMMUNOLOGY, vol. 36, no. 12, December 2014 (2014-12-01), pages 627 - 646, XP055245351, ISSN: 0141-9838, [retrieved on 20141127] *
LEE, HYE YEON: "Thesis of Yonsei University(doctorate", CHARACTERIZATION OF SIGNALING PATHWAYS FOR IMMUNE RESPONSE OF HOST CELL INDUCED BY GIARDIA LAMBIIA, 9 May 2014 (2014-05-09) *

Also Published As

Publication number Publication date
KR20150144381A (en) 2015-12-28
KR101631312B1 (en) 2016-06-20

Similar Documents

Publication Publication Date Title
EP1560847A2 (en) Acetylated hmgb1 protein
US20100015169A1 (en) Tumor Antigens
Lee et al. Giardia lamblia binding immunoglobulin protein triggers maturation of dendritic cells via activation of TLR 4‐MyD88‐p38 and ERK 1/2 MAPK s
Kim et al. Mycobacterium tuberculosis Rv3628 drives Th1-type T cell immunity via TLR2-mediated activation of dendritic cells and displays vaccine potential against the hyper-virulent Beijing K strain
Yorozu et al. Propionibacterium acnes catalase induces increased Th1 immune response in sarcoidosis patients
WO2008098749A2 (en) Peptides derived from the major allergen of ragweed (ambrosia artemisiifolia) and uses thereof
TWI425952B (en) Immunogenic protein carrier containing an antigen presenting cell binding domain and a cysteine-rich domain
Teixeira et al. Participation of the serine-rich Entamoeba histolytica protein in amebic phagocytosis of apoptotic host cells
Zhu et al. Detection of serum anti-melanocyte antibodies and identification of related antigens in patients with vitiligo
Li et al. Dendritic cell activation and maturation induced by recombinant calreticulin fragment 39-272
Myneni et al. Identification of a unique TLR2-interacting peptide motif in a microbial leucine-rich repeat protein
WO2011157905A1 (en) Polyclonal antibody binding to acetylated hmgb1
Gesheva et al. Marine gastropod hemocyanins as adjuvants of non-conjugated bacterial and viral proteins
Hoja-Łukowicz et al. The new face of nucleolin in human melanoma
US8563704B2 (en) Peptide aptamer for neutralizing the binding of platelet antigen specific antibodies and diagnostic and therapeutic applications containing the same
Burrows et al. Preferential binding of unusually long peptides to MHC class I and its influence on the selection of target peptides for T cell recognition
Li et al. Characterization of novel Omp31 antigenic epitopes of Brucella melitensis by monoclonal antibodies
WO2015194832A1 (en) Immunostimulating composition containing recombinant giardia lamblia binding immunoglobulin protein
Araújo et al. High diagnostic efficiency of IgM-ELISA with the use of multiple antigen peptides (MAP1) from T. gondii ESA (SAG-1, GRA-1 and GRA-7), in acute toxoplasmosis
Broomfield et al. Characterization of an antibody to the cross-reacting determinant of the glycosyl-phosphatidylinositol anchor of human membrane dipeptidase
US20100080792A1 (en) Method for Identifying a MHC Class II-Dependent Tumor-Associated T Helper Cell Antigen
RU2733886C2 (en) Composition for stimulating dendritic cell maturation, containing hybrid protein rv2299c/esat-6
Mir et al. Cloning, expression and N-terminal formylation of ESAT-6 of Mycobacterium tuberculosis H37Rv
Kurien et al. Induction of anti-Ro60/anti-La by immunization with spectrin and, induction of anti-spectrin by immunization with Ro60 and 4-hydroxy-2-nonenal-modified Ro60 immunization
US20180282379A1 (en) Glycosylated yghj polypeptides from enterotoxigenic escherichia coli (etec)

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15810220

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15810220

Country of ref document: EP

Kind code of ref document: A1