WO2015192379A1

WO2015192379A1 - Synthesis method of tale repeated segments for genetic site-specific modification

Info

Publication number: WO2015192379A1
Application number: PCT/CN2014/080423
Authority: WO
Inventors: 魏文胜; 杨君娇; 郭生杰
Original assignee: 北京大学
Priority date: 2014-06-20
Filing date: 2014-06-20
Publication date: 2015-12-23

Abstract

The present invention provides a high-efficiency synthesis method of TALE repeated segments for genetic site-specific modification, which provides 512 TALE quadruplicate unit templates and related PCR primers and can be used in high-throughput production. In the present invention, a TALE coding sequence is synthesized by using 512 template plasmids comprising four TALE repeated units and using two technical means: 1. expanding a tetramer template by using a set of fixed PCR primers comprising uracil deoxyribonucleotide, manufacturing adhesive tail ends at two ends of DNA segments by using a uracil excision reagent, and connecting multiple DNA segments comprising four or less TALE repeated units to form a TALE protein coding sequence; and 2. expanding the tetramer template by using a set of fixed PCR primers comprising BsmBI enzyme cutting sites, and combining multiple segments into a TALE coding sequence by means of a cycle of BsmBI enzyme cutting and connection. After the TALE coding sequences fully connected to multiple carriers are introduced into cells, applications of knockout, knockin, expression and regulation and fluorescent making and the like of target genes are completed by specifically binding to loci of the target genes.

Description

Method for synthesizing TALE repeats for genetic site-directed modification

The present invention relates to biological genetic engineering techniques, and in particular to the application of fixed-point modification to genes (especially eukaryotic genes)

The method of synthesizing TALE repeats. Background technique

TALEs ( Transcription activator like effectors) is a third type of secreted protein produced by Xanthomonas to activate host gene expression or promote self-community in nature (Boch and Bonas, 2010; Bogdanove et Al., 2010; Scholze and Boch, 2011). It has been reported that the amino acid sequence of the TALEs protein nucleic acid binding domain has a relatively constant relationship with the nucleic acid sequence of its target site. The TALEs protein contains a highly conserved tandem repeat sequence consisting of 33-35 amino acids. The 12- and 13-position amino acids are responsible for recognizing and binding a specific DNA base (such as NI recognition A, HD recognition C, NG recognition Τ, NN recognition G and A, etc.). Through this relationship, TALEs can specifically bind to target DNA (Boch et al., 2009; Moscou and Bogdanove, 2009). TALEs successfully solved the problem that zinc finger proteins could not recognize any target gene sequence, and the recognition sequence was often affected by upstream and downstream sequences, and it is one of the most effective methods to bring effector proteins to specific nucleic acid sequences ( Bogdanove and Voytas, 2011). ). Based on this feature of TALE, a variety of applications have been developed for site-directed modification, regulation or expression of eukaryotic gene expression, including TALE-nuclease chimeras (TALENs) technology (for gene knockout) ( Miller et al., 2011), TALE-mediated transcriptional activation of specific genes (Miller et al., 2011) or inhibition (Cong et al., 2012; Garg et al., 2012; Mahfouz et al., 2012), TALE is fused to a fluorescent protein to indicate the position of the target DNA, etc. (Miyanari, Y. et al., 2013).

Since any custom TALE typically contains more than ten highly repeating fragments (34 amino acid residues per fragment), the synthesis of its expression vector is difficult. In previous studies, a number of research institutions have used this amino acid to correspond to nucleic acid sequences, modularly assembling TALEs, and specifically binding to the nucleic acid sequence of interest (Brigs et al., 2012; Cermak et al., 2011; Garg Et al., 2012; Huang et al., 2011; Li et al., 2012; Li et al., 2011; Morbitzer et al., 2011; Reyon et al., 2012; Sanjana et al., 2012; Weber et Al., 2011; Zhang et al., 2011; Schmid-Burgk et al., 2013), but there are still various problems such as low efficiency, long cycle time, cumbersome operation, various types of precursor materials or high cost.

Specifically, in 2011, Tomas Cermak published an article in Nucleic Acids Research to construct sticky ends by different vectors by means of subcloning, and to select subcloned vectors according to the different positions of different repeating units of TALE. Enzymatic digestion produces a uniquely viscous end at a unique position, so that different repeat units can be joined in a certain order. Due to the limitation of connection efficiency and vector construction, only repeat units of positions 1-10 can be designed, so the synthesis of TALE can only be performed in two steps. In addition, the preparation of this method is very complicated and requires at least five days (Cermak et al., 2011).

Based on the previous method, the Rene Geibler team established a synthetic method called "Golden TALE Technology", which reduced the number of vectors using subclones to produce cohesive ends at specific positions to six, and optimized the cloning vectors between different groups. To achieve a more efficient and accurate method without prolonging the time (Geissler et al., 2011).

Professor Zhang Bo of Peking University published a method called "unit synthesis", which uses the site characteristics of two nucleases of Spel and Nhel to design a two-two synthesis unit. This method is highly accurate, but time consuming. Longer (Huang et al., 2011).

The Bing Yang team proposed a synthesis method called "modular assembly", which uses dense Degeneracy of the code The BsmBI digestion method allows eight different sticky ends to be obtained for each repeating unit, so the TALE synthesis is based on eight groups of repeating units that differ from each other in position, which improves efficiency to some extent. (Li et al., 2011). All of the above methods have their own advantages and disadvantages, but at the same time, one problem is that it is difficult to achieve mass production of TALE.

In April 2012, Nature-Biotech published the latest research from researchers at the Massachusetts General Hospital. Joung and colleagues developed a fast called FLASH (fast ligation based automatable solid-phase high-throughput). By connecting an automated solid-phase high-throughput system, by assembling a gene fragment encoding TALEN on a magnetic bead and maintaining an immobilized connection by means of an external magnet, the time required is greatly shortened, which facilitates the automation of the synthesis. This method has the disadvantages of very high initial workload and cumbersome pre-processing (Reyon et al., 2012).

In 2013, a connection-independent TALE cloning method developed by Schmid-Burgk and colleagues was published in Nature-Biotechnology, which uses longer sticky ends and can be used without connection. The fragments are integrated and more than 600 TALEN genes can be synthesized in one day, provided that 3072 precursors containing five repeat units are synthesized (Schmid-Burgk et al., 2013).

In 2013, a ULti MATE synthesis method published in our laboratory used uracil-containing PCR primers and uracil excision reagents to generate longer sticky ends on DNA fragments and 64 precursors containing three repeat units. The construction of the TALE coding sequence can be completed in a few hours (Yang, J., et al. 2013). The method is fast, simple, and has a high correct rate. However, since the template and PCR primers required for each TALE sequence synthesis are different, the workload is relatively large when performing high-throughput synthesis. Summary of the invention

The object of the present invention is to provide a method for synthesizing a TALE repeat of a gene (especially a eukaryotic gene), and to provide 512 TALE four repeat unit templates based on the Chinese patent (ZL201210380206.2). And related PCR primers for high throughput production.

The 512 TALE four-repeat unit template of the present invention is a uracil-specific excision reagent (USER) manufactured by uracil-specific excision reagent (USER) using a uracil deoxyribonucleotide excision reagent (USER) to make the sticky ends of the DNA fragments, and is used for PCR. The amplified DNA template and primer design were used to synthesize 512 template plasmids containing four TALE repeat units based on 16 monomers containing the TALE repeat.

The present invention utilizes 512 template plasmids containing four TALE repeat units to synthesize TALE coding sequences using two technical routes: 1. Amplification of tetrameric templates using a set of immobilized PCR primers containing uracil deoxyribonucleotides Using a uracil excision reagent to make a cohesive end of the DNA fragment, and ligating multiple DNA fragments containing four or fewer TALE repeat units into a TALE protein coding sequence; 2. using a fixed set of BsmBI-containing cleavage sites The PCR primers amplify the tetrameric template, and the multiple fragments are combined into a TALE coding sequence by a B smBI digestion-ligation cycle. After the complete TALE coding sequence of multiple vectors is introduced into the cell, the target gene locus can be specifically combined to complete target gene knockout, knock-in, expression regulation, fluorescent labeling and the like.

In the present invention, the term "TALE repeat" means that the amino acid sequence of each TALE repeat sequence is the same except for the region of variable di-nucleotides (RVDs).

The term "TALE repeat": A DNA fragment used to encode a TALE repeat. The term "monomer", a DNA fragment encoding a single TALE repeat unit. The present invention utilizes the characteristics of codon degeneracy to design four DNA monomer templates, which are named W, X, Y and Z, respectively. Outside the RVDs coding region, these four sequences differ greatly, but the amino acid sequences they encode are identical.

The term "linking monomer", a monomer for synthesizing a TALE repeat sequence, which is designed to amplify the above four DNA monomer templates by using 16 pairs of primers designed to obtain a uracil deoxyribonucleotide or A nucleotide sequence containing a BsmBI recognition site.

The term "quadruplex", the above four linking monomers are sequentially joined to form a quadruplet, which can be used as a PCR template.

The present invention pre-assembles 512 quadruplexes based on 16 monomers used to synthesize TALE repeats. The monomer and the quadruplet encode a TALE repeat sequence containing RVDs, and after PCR by the uracil-containing primer, the uracil deoxyribonucleotides are present at both ends; after cleavage by uracil cleavage reagent, adjacent two The body/quadruplex has mutually matching cohesive ends and one-to-one correspondence. Using another set of technical routes, the monomer and the quadruplex are subjected to primers containing the BsmBI recognition site without uracil deoxyribonucleotides, and the two segments have a BsmBI cleavage site; after BsmBI digestion, the phase The adjacent two monomers/quadruplex have mutually matching sticky ends and one-to-one correspondence.

The monomer of the present invention is the same as the Chinese patent ZL201210380206.2. Except for the intermediate DNA base recognition region, the amino acid sequence of each TALE fragment is the same, so the DNA sequence encoding TALE can be serially and sequentially synthesized. The present invention utilizes the characteristics of codon degeneracy to design four DNA sequences, which are named W, X, Y and Z, respectively. Outside the RVDs coding region, these four sequences differ greatly, but the amino acid sequences they encode are identical. The specific sequences of the W, X, Y and Z types are shown in Table 1 of the Chinese patent ZL201210380206.2. The four repeating units in the quadruplet are WXYZ or XYZW, each with 256 quadruplets, including all possible four RVD combinations.

The plasmid vector shown in Fig. 2 conforming to Chinese Patent ZL201210380206.2 can be applied to the method of the present invention.

In addition to the primers of the uracil deoxyribonucleotides (hereinafter referred to as dUTP or U for short) described in Chinese Patent No. ZL201210380206.2 (see the Chinese patent ZL201210380206.2 SEQ ID N0.17-48 for the sequence), Provided 17 primers containing a BsmBI restriction endonuclease recognition site, using these primers to PCR-amplify the TALE repeat sequence, and then digesting with BsmBI to generate complementary sticky ends between the fragments, and each pair of complementary sticky ends There are at least 2 base differences between them. Different fragments, fragments and vectors can be joined together via these sticky ends.

The nucleotide sequence of the primer containing the BsmBI restriction endonuclease recognition site is shown in Table 1.

Table 1 Primer table containing BsmBI recognition sites

篛篛篛篛瞧瞧篛篛篛瞧瞧篛篛篛瞧瞧篛篛篛瞧瞧篛篛篛篛瞧篛篛篛篛瞧篛篛篛瞧瞧篛篛篛瞧篛篛篛篛瞧篛篛篛篛篛篛篛篛篛篛篛篛篛瞧篛篛篛

F-W5 TATACGTCTCAGAACCTGACACCAGAGCAAGTAGTGGCTATTG

F-Wz-GG TCTCGTCTCTCTOACACCAGAGCAAGTAGTGG

F-Xz-GG GTCCGTCTCATOGGCTCACTCCGGAACA

F-Xw-GG ATACGTCTCACAAGCACACGGTCTCACTCCGGAACAGGTGGT

F-Ww-GG GTCCGTCTCCAGAGCAAGTAGTGGCTAT

F-Wy-GG GTCCGTCTCCCCACGGACTGACACCAGAGCAAGTAGT

F-Xy-GG GTGCGTCTCCCACGGACTCACTCCGGAACAGGTGG

R-Zw-GG TATCGTCTCArCAGCCCATGAGCCTGACACAGTACT

R-Zx-GG CCGCGTCTCGCCCATGAGCCTGACACAG

R-Wx-GG AGACGTCTCGCTTOGCAGAGCACCGGAA R-Ww-GG TATCGTCTCACTCTGGTGTCAGACCGTGTGCTTGGCAGAGCA

R-Yw-GG TATCGTCTCCGTOGGCTTGGCACAAAACGGGCAGC

R-Yx-GG GGGCGTCTCCCGTOGGCTTGGCACAAAACGGGCAGCAACCG

R-W3 TATACGTCTCATOCTCTCCAGCGCTTGTTTGCCACC

R-X3 TATACGTCTCATOCrCTCAAGGGCTTGCTTGCCGC

R-Y3 TATACGTCTCATOCTTTCCAAAGCCTGTTTTCCGCC

R-Z3 TATACGTCTCATOCrTTCCAGTGCCTGCTTACCTCC

Note:

1. The underlined sequence is the BsmBI recognition site, and the italicized bold sequence is the sticky end of the BsmBI cut.

2. F-W5, R-W3, R-X3, R-Y3, and R-Z3 are used to link TALE repeats and vectors, and other primers in the table are used to connect the individual TALE repeats. The invention is based on the Chinese patent ZL201210380206.2, using TALE repeat monomer as a template, using uracil-containing primers for PCR, USER enzyme cleavage, T4 DNA ligase ligation, pre-assembled 512 tetramer templates . Among them, there are 256 tetramers of WXYZ structure and XYZW structure, covering TALE repeat sequences for all four-base DNA fragments (see Table 2 and Table 3). Table 2 Tetramer of WXYZ structure

Note:

1. A, T, C, and G indicate the DNA bases bound by each TALE monomer in the tetramer, as shown in Table 3.

All tetramers in the table are WXYZ structures, that is, the first monomer is W structure, the second is X structure, and the like. Table 3 Tetramer of XYZW structure

Note: All tetramers in the table are XYZW structures, that is, the first monomer is the X structure, the second is the Y structure, and the rest is analogous. After constructing 512 tetramer templates using uracil-specific cleavage reagents, two different techniques can be used to construct complete TALE repeats: (1) using uracil deoxyribonucleotides Primer PCR amplification of the tetrameric template, and continued construction of sticky ends between different tetramers using uracil deoxyribonucleotide-specific cleavage, constructing complete repeats by BsmBI digestion-ligation cycle; (2) The tetramer template was PCR-amplified using BsmBI-recognizing site primers, the cohesive ends were digested by BsmBI digestion, and the complete repeats were constructed by BsmBI digestion-ligation cycle. Since there are 512 tetramer templates, the primers used in the construction of the TALE sequence with the same number of repeating units are fixed, and therefore are very suitable for large-scale, high-throughput TALE construction. At the same time, the time, cost and sequencing mutation rate of the TALE sequence of the present invention are also lower than the previous Chinese patent ZL201210380206.2.

Using the first technical route to construct a TALE sequence specifically includes the following steps (see Figure 3):

1) Sequence determination and template and primer selection: According to the number of TALE repeat units constructed, refer to Table 4 to determine the template structure and the required primers, and then determine the specific template to be used according to Table 2 and Table 3.

Table 4 Selecting Templates and Primers Based on the Number of TALE Repeat Units (Technical Route 1)

1 ^st PCR 2 ^nd PCR 3 ^rd PCR 4 ^th PCR 5 ^th PCR 6 ^th PCR

^St PCR 2 ^nd PCR 3 ^rd PCR 4 ^th PCR 5 ^th PCR 6 ^th PCR

Note: The primer pair shown by the shade is used to amplify the most downstream TALE repeat, in which the BsmBI cleavage site carried by the R primer matches the sticky end to the vector, and the repeat length may be 1/2/3/4 Repeat the unit, and the remaining primer pairs are amplified into fragments containing four repeating units.

2) PCR amplification reaction: The reaction can only be carried out using PfuTurbo Cx (Agilent) or Taq polymerase, 30 cycles (95 ° C, 30 s denaturation; 60 ° C, 30 s annealing; 72 ° C, 30 s extension).

PCR amplification:

Tetramer template (5 ng/l) 3μ1

Upstream primer ( 1 mM ) 3μ1

Downstream primer ( 1 mM ) 3μ1

PfuTurbo Cx ( 2.5U/1 ) 0.15μ1

10 PfuTurbo Cx Buffer 1.5μ1

dNTP (2.5 mM each) 1.2μ1

Dd3⁄40 to ΙΟμΙ

3) USER treatment and ligation reaction: Mix the PCR product and directly perform USERTM enzyme treatment (37 ° C, 15 minutes).

4) Purification of the ligation product, followed by BsmBI digestion-ligation cycle with an expression vector containing ccdB. Repeat six times in a loop

(37°C, 5 min; 16°C, 5 min; 6 cycles) Transformation of E. coli competent cells, identification of recombinants by colony PCR, plasmid digestion, etc., and sequencing of the recombinant TALE protein Plasmid construction.

Since the tetramer template is constructed based on a plasmid carrying an ampicillin resistance gene, if the ccdB-containing vector is used with a resistance gene other than ampicillin, the fourth step of the ligation product can be purified by ordinary PCR products. If the vector also carries ampicillin resistance, the ligation product in the fourth step is subjected to agarose gel electrophoresis and recovered.

By transfecting a cell line with a recombinant plasmid constructed against a specific gene, knockdown, knock-in or overexpression of the target gene, and inhibition of expression can be accomplished. The use of the second technical route to construct the TALE sequence specifically includes the following steps (see Figure 4):

1) Sequence determination and template and primer selection: According to the number of TALE repeat units constructed, refer to Table 5 to determine the template structure and the required primers, and then determine the specific template to be used according to Table 2 and Table 3. Table 5 Selecting Templates and Primers Based on the Number of TALE Repeat Units (Technical Route 2)

1 ^st PCR 2 ^nd PCR 3 ^rd PCR 4 ^th PCR 5 ^th PCR 6 ^th PCR

2) PCR amplification reaction: Commonly used high-fidelity PCR enzymes can be used in the PCR amplification reaction of the second route. Take TaqHiFi enzyme (Transgen) as an example, the reaction is 30 cycles (95 C, 30 s denaturation; 60 C, 30 s annealing; 72 ° C, 30 s extension).

PCR amplification:

Tetramer template (5ng/l) 3μ1

Upstream primer ( 1 mM) 3μ1

Downstream primer ( 1 mM) 3μ1

TaqHiFi ( lOU/1 ) 0.15μ1

10 TaqHiFi Buffer 1.5μ1

dNTP (2.5 mM each) 1.2μ1

Dd3⁄40 to ΙΟμΙ 3) The PCR product was mixed, directly purified, and subjected to a BsmBI digestion-ligation cycle with an expression vector containing ccdB, and the cycle was repeated 20 times (37 ° C, 5 min; 16 ° C, 5 min; 20 cycles). E. coli competent cells were transformed, and the correct recombinants were identified by colony PCR, plasmid digestion and sequencing.

If the ccdB-containing vector is used with a resistance gene other than ampicillin, the ligation product of the third step only needs to be purified by ordinary PCR products; if the vector is only resistant to ampicillin, the ligation product in the third step is subjected to agar. Glycogel electrophoresis and recovery. In summary, the general steps of the second technical route are similar to the first one, except that (1) the primers used in the PCR are the same as the first route except for the primers of the ligation vector, and the other primers are all containing the BsmBI site. GG version (see Table 1); (2) PCR enzyme has no special requirements, common high-fidelity enzymes can be; (3) no need to use USERTM enzyme treatment, PCR reaction directly after purification of mixed PCR products. The beneficial effects of the invention:

(1) The present invention retains the advantages of the TALE repeating unit having a long adhesive end, high connection accuracy, easy expansion, simple steps, high efficiency and rapidity in the Chinese patent ZL201210380206.2.

(2) Since the present invention constructs 512 tetramer templates in advance, the TALE sequence is mainly connected by a fragment containing four repeating units, requiring fewer fragments and a lower error rate.

(3) Since the number of fragments at the time of ligation is small, the structure of the desired template and the PCR primers required for each fragment can be immobilized, and only 12 primers containing uracil deoxyribonucleotides or BsmBI cleavage sites can be satisfied. All the inter-fragment linkage requirements, the primers were further optimized compared to the Chinese patent ZL201210380206.2, and the specificity of the PCR and the difference between the sticky ends were better ensured.

(4) When the TALE sequence is constructed using the second technical route, the common PCR enzyme can be used, and the construction cost is greatly reduced.

(5) Only one PCR product purification is required for the entire construction process, and all PCR products used to construct the same TALE sequence can be mixed into one tube for purification. The operation is very simple and time-saving, and the selective target can be completed within a few hours. The TALE construction process from sequence to transformed competent cells, which actually requires less time to operate.

(6) In actual operation, colony PCR verification showed that the TALE clones obtained by the present invention were almost all correct, and the sequencing verification error rate was also extremely low.

(8) In the present invention, each PCR template structure and primer are fixed, and it is not necessary to separately design a template and a primer pair for each TALE, and is more suitable for high-throughput, automated operation than the Chinese patent ZL201210380206.2. DRAWINGS

Figure 1 is a diagram of the pIRES2-EGFP-TALEN vector;

Figure 2 is a diagram of the pGL3 - TALE- Venus carrier;

3 is a flow chart of constructing a TALE sequence by using the first technical route of the present invention;

4 is a flow chart of constructing a TALE sequence by using the second technical route of the present invention;

5 is a PCR result of a TALEN fragment according to Embodiment 1 of the present invention;

Figure 6 shows the results of treatment with diphtheria toxin by wild type and HBEGF knockout cells. detailed description

The following examples are intended to illustrate the invention but are not intended to limit the scope of the invention. Modifications or substitutions of the methods, steps or conditions of the invention are intended to be within the scope of the invention.

Unless otherwise indicated, the technical means used in the examples are conventional means well known to those skilled in the art. Example 1 Using TALENs to achieve knockout of HBEGF gene in human cells

1. Select the TALENs sequence to be synthesized for a specific gene.

The human HBEGF gene, also known as DTR3⁄4, is a receptor for diphtheria toxin in host cells. After the gene is knocked out, the host cell should be completely resistant to diphtheria toxin.

The exon sequence information of the human HBEGF gene was searched in the NCBI (http://www.ncbi.nlm.nih.gov/gene/) database, and the TALENs used were designed for the sequence. This region is located at positions 81-126 of the second exon of the HBEGF gene. The sequence is as follows:

CCCACTGTATCCACGgaccagctgctaccccTAGGAGGCGGCCGGG

The uppercase letters are TALENs combined with the lowercase letters and the lowercase letters are Spacer. The required synthesis TALE is CCCACTGTATCCACG, CCCGGCCGCCTCCTA. The Spacer region contains a PvuII restriction site (underlined).

2. Synthesize TALENs using the technical route.

The TALE repeat region to be synthesized can be split into four four-unit segments: CCCA CTGT ATCC ACG; CCCG GCCG CCTC CTA.

The sequence structure and primers of these fragments were found in Table 4, and specific templates were selected in Tables 2 and 3. The selection results of the left and right TALEN (TALEN-L, TALEN-R) are shown in Table 6 and Table 7, respectively.

Table 6 TALEN-L template, primer selection table

The above eight fragments were PCR amplified using Taq HiFi DNA Polymerase (Transgen). Take 1 PCR product into the loading buffer and perform agarose gel electrophoresis to verify that the product is the correct size DNA fragment. The result is shown in Figure 5. The leftmost track is

The DNA marker, followed by the left to right, is the four fragments of TALEN-L and TALEN-R. Two different TALEN fragments were separately mixed, treated with USER enzyme, and the PCR product was purified using a PCR product purification kit (Transgen).

The ligation product and the pIRES2-EGFP-TALEN vector (see Fig. 1) were treated with BsmBI endonuclease and T4 ligase, and then transformed into E. coli competent DH50 PCR to identify the recombinant, and the plasmid was extracted and verified by sequencing.

3. Transfect the cells and detect the knockdown efficiency of HBEGF gene.

This experiment used HeLa cells cultured in DMEM (Invitrogen) medium. Transfect 0.9 upstream TALEN, 0.9 downstream TALEN, and 0.2 eGFP plasmid to 1 使用 using the AAD-1001S Nucleofector II ( Lonza ) electrocycler

10 ⁶ HeLa cells. After the completion of the transfection, the cells were cultured at 37 ° C for 24 hours (C 0 ₂ 5% ), and then transferred to 30 ° C for further 72 hours. Subsequently, the cells were cultured in a medium containing 2 μ _§ /ιη1 puromycin for 48 hours at 37 ° C, and the cells not transfected into the plasmid were killed, and the next detection was carried out.

The genomic DNA of the HeLa cells obtained in the previous step was extracted, and primers were designed for genomic PCR amplification. TALEN binding region:

Upstream primer: GTGGCCGCCGCTTCGAAAGTGAC;

Downstream primer: GTCCAAGGATGGGGGGCCTCCA; annealing temperature 65 °C, product length 503 bp, and only contains a PvuII restriction site in Spacer, and digested to produce two fragments of 104 bp and 399 bp. After purification of the product (full-scale gold PCR product purification kit), PvuII (TAKARA) was used for digestion, and agarose gel electrophoresis determined that the probability of fragment deletion in the designed Spacer region was more than 50%.

HeLa cells were cultured using a medium containing 50 ng/ml of diphtheria toxin (this concentration was 5 times the lethal concentration of diphtheria toxin in HeLa cells), and the resistant phenotype was observed. The results are shown in Fig. 6. A is the result of toxin treatment of wild-type HeLa cells, and all the cells are dead. B is the result of treatment of HeLa cells transfected with HBEGF TALEN, and there are many healthy cells. Cells successfully knocked out for HBEGF.

The results showed that the TALENs expression vector for the diphtheria toxin receptor gene synthesized by the ULtiMATE technology pathway can achieve efficient HBEGF gene knockout, and the knockout results were confirmed in the functional assay. Example 2 Construction of a TALE-Vemis fluorescent protein for labeling human cell telomere repeat regions

1. A highly repetitive sequence in human telomeres was found: TTAGGGTTAGGG...TTAGGG, TALE- Venus fusion fluorescent protein with target site TAGGGTTAGGGTTAGG was prepared to indicate telomere structure.

2. Synthesize the TALE sequence using Technical Route 2. The TALE sequence to be synthesized contains 16 repeating units and can be separated into four tetramers of TAGG GTTA GGGT TAGG. According to Table 5, the structure of the four tetramers and the desired primers were found, and the primers with the GG type in Table 1 were used, and the specific templates were determined according to Table 2 and Table 3. The results are shown in Table 8. Table 8 TALE- Venus template, primer selection table

The PCR amplification was carried out by TaqHiFi, and the PCR products were mixed and subjected to agarose electrophoresis, and the 400 bp band obtained by PCR was removed and purified. The purified fragment and the pGL3-TALE-Venus vector were co-transformed into a BsmBI digestion-ligation cycle, transformed into Trans-1-T1 E. coli competent (Transgen), coated with an ampicillin plate, and cultured overnight at 37 °C.

The colonies were correctly cloned by PCR and sequencing, and the plasmid was extracted and transfected into 293T cells. The yellow fluorescence of the telomere was observed. Although the present invention has been described in detail with reference to the preferred embodiments of the present invention, it will be apparent to those skilled in the art. Therefore, such modifications or improvements made without departing from the spirit of the invention are intended to be within the scope of the invention.

references

[1] Boch, J., and Bonas, U. (2010). Xanthomonas AvrBs3 family-type III effectors: discovery and function. Annu Rev Phytopathol 48, 419-436.

[2] Boch, J., Scholze, H., Schornack, S., Landgraf, A., Hahn, S., Kay, S., Lahaye, T., Nickstadt, A., and Bonas, U. (2009) Breaking the code of DNA binding specificity of TAL-type III effectors.

Science 326, 1509-1512.

[3] Bogdanove, A. J., Schornack, S., and Lahaye, T. (2010). TAL effectors: finding plant genes for disease and defense. Current opinion in plant biology 13, 394-401.

[4] Bogdanove, AJ., and Voytas, D.F. (2011). TAL effectors: customizable proteins for DNA targeting. Science 333, 1843-1846.

[5] Briggs, AW, Rios, X., Chari, R., Yang, L., Zhang, F., Mali, P., and Church, GM (2012). Iterative capped assembly: rapid and acknowledge synthesis of repeat -module DNA such as TAL effectors from individual monomers. Nucleic acids research.

[6] Cermak, T., Doyle, EL, Christian, M., Wang, L., Zhang, Y., Schmidt, C, Bailer, JA, Somia, NV, Bogdanove, AJ., and Voytas, DF (2011) Efficient design and assembly of custom TALEN and other TAL effector-based constructs for DNA targeting. Nucleic acids research 39, e82.

[7] Cong, L., Zhou, R., Kuo, YC, Cunniff, M., and Zhang, F. (2012). Comprehensive interrogation of natural TALE DNA-binding modules and transcriptional repressor domains. Nat Commun 3, 968 .

[8] Garg, A., Lohmueller, J. J., Silver, P. A., and Armel, T.Z. (2012). Engineering synthetic TAL effectors with orthogonal target sites. Nucleic acids research.

Geissler, R., Scholze, H., Hahn, S., Streubel, J" Bonas, U., Behrens, S.E., and Boch, J. (2011).

Transcriptional activators of human genes with programmable DNA-specificity. PLoS One 6, el9509. [9] Huang, P., Xiao, A., Zhou, M., Zhu, Z., Lin, S., and Zhang, B. (201 1). Heritable gene targeting in zebrafish using customized TALENs. Nature biotechnology 29 , 699-700.

[10] Li, L., Piatek, MJ., Atef, A., Piatek, A., Wibowo, A" Fang, X, Sabir, S., Zhu, J.K" and

Mahfouz, M.M. (2012). Rapid and highly efficient construction of TALE-based transcriptional regulators and nucleases for genome modification. Plant molecular biology.

[1 1] Li, T., Huang, S., Zhao, X, Wright, DA, Carpenter, S., Spalding, MH" Weeks, D P., and Yang, B. (201 1). Modularly TAL effector nucleases for targeted gene knockout and gene replacement in eukaryotes. Nucleic acids research 39, 6315-6325.

[12] Mahfouz, MM, Li, L., Piatek, M., Fang, X., Mansour, H., Bangamsamy, DK, and Zhu, JK (2012). Targeted transcriptional repression using a chimeric TALE-SRDX repressor protein Plant molecular biology 78, 31 1-321.

[13] Miller, JC, Tan, S., Qiao, G., Barlow, KA, Wang, I, Xia, DF, Meng, X, Paschon, DE, Leung, E., Hinkley, S J., et al (201 1). A TALE nuclease architecture for efficient genome editing. Nature biotechnology 29, 143-148.

[14] Morbitzer, R., Elsaesser, J., Hausner, J., and Lahaye, T. (201 1). Assembly of custom TALE-type DNA binding domains by modular cloning. Nucleic acids research 39, 5790-5799.

[15] Moscou, MJ., and Bogdanove, A.J. (2009). A simple cipher governs DNA recognition by TAL effectors. Science 326, 1501.

[16] Reyon, D., Tsai, S.Q., Khayter, C., Foden, J.A., Sander, D., and Joung, J.K. (2012). FLASH assembly of TALENs for high-throughput genome editing. Nature biotechnology.

[17] Sanjana, N.E., Cong, L., Zhou, Y., Cunniff, M.M., Feng, G., and Zhang, F. (2012). A

Transcription activator-like effector toolbox for genome engineering. Nature protocols 7, 171-192.

[18] Scholze, H., and Boch, J. (201 1). TAL effectors are remote controls for gene activation. Curr Opin Microbiol 14, 47-53.

[19] Weber, E., Gruetzner, R., Werner, S., Engler, C., and Marillonnet, S. (201 1). Assembly of designer TAL effectors by Golden Gate cloning. PLoS One 6, el9722.

[20] Zhang, F., Cong, L., Lodato, S., Kosuri, S., Church, GM, and Arlotta, P. (201 1). Efficient construction of sequence-specific TAL effectors for modulating mammalian transcription. Nature biotechnology 29, 149-153.

[21] Schmid-Burgk, JL, T. Schmidt, et al. (2013). "A ligation-independent cloning technique for high-throughput assembly of transcription activator-like effector genes." Nat Biotechnol 31(1): 76- 81. [22] Yang, J., P. Yuan, et al. (2013). "ULtiMATE system for rapid assembly of customized TAL effectors." PLoS One 8(9): e75649. Industrial applicability

The method for synthesizing a TALE repeat sequence for gene (especially eukaryotic gene) site-directed modification disclosed in the present invention uses a uracil deoxyribonucleotide excision method to produce a sticky end of a DNA fragment at both ends of a DNA fragment by using a uracil excision reagent. Based on the DNA template amplified by P CR and the design of the primers, 512 template plasmids containing four TALE repeat units were synthesized on the basis of 16 monomers containing TALE repeats, which can be used for high-throughput production.

Sequence table

<110> Peking University

<120> New and efficient synthesis method for TALE repeats for gene-fixed modification

<130> KHP143111750

<160> 24

<170> Patentln version 3. 5

<210> 1

<211> 43

<212> DNA

<213> Artificial sequence

<400> 1

Tatacgtctc agaacctgac accagagcaa gtagtggcta ttg 43

<210> 2

<211> 32

<212> DNA

<213> Artificial sequence

<400> 2

Tctcgtctct ctgacaccag agcaagtagt gg 32

<210> 3

<211> 28

<212> DNA

<213> Artificial sequence

<400> 3

Gtccgtctca tgggctcact ccggaaca 28

<210> 4

<211> 42

<212> DNA

<213> Artificial sequence

<400> 4

Atacgtctca caagcacacg gtctcactcc ggaacaggtg gt 42

<210> 5

<211> 28

<212> DNA

<213> Artificial sequence

<400> 5

Gtccgtctcc agagcaagta gtggctat 28

<210> 6

<211> 37

<212> DNA

<213> Artificial sequence

<400> 6

Gtccgtctcc ccacggactg acaccagagc aagtagt 37

<210> 7

<211> 35

<212> DNA

<213> Artificial sequence <400> 7

Gtgcgtctcc cacggactca ctccggaaca ggtgg 35

<210> 8

<211> 36

<212> DNA

<213> Artificial sequence

<400> 8

Tatcgtctca tcagcccatg agcctgacac agtact 36

<210> 9

<211> 28

<212> DNA

<213> Artificial sequence

<400> 9

Ccgcgtctcg cccatgagcc tgacacag 28

<210> 10

<211> 28

<212> DNA

<213> Artificial sequence

<400> 10

Agacgtctcg cttggcagag caccggaa 28

<210> 11

<211> 42

<212> DNA

<213> Artificial sequence

<400> 11

Tatcgtctca ctctggtgtc agaccgtgtg cttggcagag ca 42

<210> 12

<211> 35

<212> DNA

<213> Artificial sequence

<400> 12

Tatcgtctcc gtgggcttgg cacaaaacgg gcagc 35

<210> 13

<211> 41

<212> DNA

<213> Artificial sequence

<400> 13

Gggcgtctcc cgtgggcttg gcacaaaacg ggcagcaacc g 41

<210> 14

<211> 36

<212> DNA

<213> Artificial sequence

<400> 14

Tatacgtctc atgctctcca gcgcttgttt gccacc 36

<210> 15

<211> 35

<212> DNA ₁₅ <213> Artificial sequence

<400> 15

Tatacgtctc atgctctcaa gggcttgctt gccgc

<210> 16

<211> 36

<212> DNA

<213> Artificial sequence

<400> 16

Tatacgtctc atgctttcca aagcctgttt tccgcc

<210> 17

<211> 36

<212> DNA

<213> Artificial sequence

<400> 17

Tatacgtctc atgctttcca gtgcctgctt acctcc

<210> 18

<211> 46

<212> DNA

<213> Artificial sequence

<400> 18

Cccactgtat ccacggacca gctgctaccc ctaggaggcg gccggg

<210> 19

<211> 15

<212> DNA

<213> Artificial sequence

<400> 19

Cccactgtat ccacg

<210> 20

<211> 15

<212> DNA

<213> Artificial sequence

<400> 20

Cccggccgcc tccta

<210> 21

<211> 23

<212> DNA

<213> Artificial sequence

<400> 21

Gtggccgccg cttcgaaagt gac

<210> 22

<211> 22

<212> DNA

<213> Artificial sequence

<400> 22

Gtccaaggat ggggggcctc ca

<210> 23 16 OC

Claims

Claim

A method for synthesizing a TALE repeat for genetic site modification, characterized in that:

1) Pre-assembled 512 tetramer templates, as shown in Table 2 and Table 3;

2) selecting a template according to the TALE monomer, and selecting a PCR amplification primer;

3) PCR amplification;

4) Process the PCR product and connect to obtain a TALE repeat.

2. The method of synthesizing according to claim 1, wherein the PCR amplification is to PCR-amplify a tetramer template using a uracil-deoxyribonucleotide-containing primer, and continue to use uracil deoxyribonucleotides. Specific cleavage reagents construct sticky ends between different tetramers, and complete repeats are constructed by BsmBI digestion-ligation cycle.

3. The method according to claim 1, wherein the PCR amplification is a PCR amplification of a tetramer template using a BsmBI-containing recognition site primer, and the sticky end is constructed by BsmBI digestion, and cleaved by BsmBI- The join loop constructs a complete repeat sequence.

4. The method of synthesizing according to claim 2, wherein the step 2) comprises:

According to the number of TALE repeating units constructed as needed, refer to Table 4 to determine the template structure and the required primers, and then determine the specific template to be used according to Table 2 and Table 3.

5. The method of synthesizing according to claim 3, wherein the step 2) comprises:

According to the number of TALE repeating units constructed as needed, refer to Table 5 to determine the template structure and the required primers, and then determine the specific template to be used according to Table 2 and Table 3.

The BsmBI-containing recognition site primer according to claim 3, wherein the sequence of the primer is as shown in SEQ ID NOS: 1-17.

7. The use of the primer of claim 6 in gene knockout, knock-in, expression regulation, fluorescent labeling.