WO2015188870A1

WO2015188870A1 - Use of selectable marker gene in sugar beet protoplasts transformation method and system

Info

Publication number: WO2015188870A1
Application number: PCT/EP2014/062291
Authority: WO
Inventors: Guy Weyens; Marc LEFÈBVRE; Shivegowda THAMMANNAGOWDA; Murielle LOMMEL
Original assignee: Sesvanderhave N.V.
Priority date: 2014-06-12
Filing date: 2014-06-12
Publication date: 2015-12-17

Abstract

The present invention is related to a method for the transformation of sugar beet protoplasts comprising the step of: – obtaining protoplasts from stomatal guard cells isolated from a sugar beet plant, - transforming said protoplasts with a nucleic acid construct comprising a nucleotide sequence of interest and a marker sequence, - applying to an in vitro culture of said protoplasts, one or more ALS inhibitors at a concentration that is lethal to the in vitro culture of the protoplasts and - regenerating sugar beet plants from the surviving protoplasts having integrated the nucleic acid construct comprising the sequence of interest and the selectable marker sequence where the selectable marker sequence is the mutated BvALS113 sequence carrying in its sequence a mutation at amino acid 113 position from Alanine to Tyrosine.

Description

USE OF SELECTABLE MARKER GENE IN SUGAR BEET PROTOPLASTS TRANSFORMATION METHOD AND SYSTEM. Field of the invention

[0001] The present invention is in the field of plants biotechnology, more particularly is related to a plant transformation method and means, especially to a method and means for transforming sugar beet protoplasts, cells, tissues (calli) and/or plants by using a new selection marker genetic sequence, preferably the mutated BvALS selectable marker genetic sequence.

[0002] The present invention is also related to a method for regenerating transgenic sugar beet plants from said transformed sugar beet protoplasts, cells or tissues and to transgenic plants and seeds obtained by such method.

Background of the invention

[0003] Sugar beet (Beta vulgaris L.) is an important agricultural crop involved in about 20% of world sugar production. Despite increasing demand for genetically modified sugar beet plants, sugar beet plant is still a difficult plant to transform and a difficult material for plant regeneration. Improvement and innovation are still needed to obtain a reliable and efficient transformation and regeneration process of such plant.

[0004] As a general rule, and more particularly for plants which are difficult to transform, like sugar beet, the availability of appropriate effective means and method for selecting the transformed protoplast, cell or tissue is crucial .

[0005] Furthermore, as the selection marker is generally present in the transformed plant, the use of nucleotide sequences, like genes coding for resistance to an antibiotics are not accepted, because subsequent and often complicated and expensive methods should be used for removing the selection marker out of the transformed plant.

[0006] As sugar beet is an important agricultural crop in temperate and subtropical regions, herbicides are widely used to manage weeds proliferation during their growth. These new developed herbicides include Acetolactate synthase (ALS ) also known as Acetohydroxyacid Synthase (AHAS ) inhibitors . The genes coding for Acetolactate synthase (ALS ) are known from US patent 5 013 659, 5 141 870 and 5 378 824.

[0007] The ability to modify chromosomes through homologous recombination (gene targeting) is needed for a long time in the field of plant genetics, because gene targeting can target specific sequences or nucleotides resulting into modifications of specific plant functions and opening new possibilities for crops improvement, for increased production of new seeds with required carbohydrate profile or with enhanced nutritional qualities, or for increasing resistance to diseases and stress .

[0008] Transcription Activator-Like Effector

Nucleases (TALEN) sequences originating from plant pathogen bacteria of the genus xanthomonas, play important role in diseases or trigger defence, by binding host DNA and activating effector-specific host genes.

[0009] These nucleases sequences and their derived protein allow to efficiently target and/or process double stranded nucleic acid sequences. [0010] Their derived proteins are specific chimeric protein monomers composed of a core scaffold comprising Repeat Variable Dipeptide regions (RVDs) having binding specificity to a target sequence, to which is fused a catalytic domain to its N-terminal portion. This catalytic domain, which can be a monomer of a nuclease, is placed at a position to possibly interact with another catalytic domain fused to another TAL monomer, such that, when both monomers are binding to their respective target DNA sequence, both catalytic domains will form catalytic entity likely to process DNA in the proximity of this target sequence .

[0011] The international patent application

WO2011/072246 describes a method for modifying the genetic material of a cell with the use of this Transcription Activator-Like Effector nuclease (also called DNA enzyme) nucleotide sequence or its derived protein, wherein the TAL Effector Nuclease will bind to and will process the target DNA.

[0012] This method will comprise also the step of providing to the cell, a nucleic acid sequence comprising a sequence homologous to at least a portion of the target DNA sequence, such that homologous recombination could occur between the target sequence portions and its corresponding nucleic acid portions disposed between the sequence of the gene of interest.

[0013] A transformation of a cell could be obtained either by using one or more vectors comprising the sequences encoding the TALEN protein or by introducing directly the corresponding derived protein into the cell through a mechanic injection, through the means of a bacterial secretion system or through electroporation.

[0014] This method has been already used for the transformation of various cells through the use of Transcription Activator-Like proteins, especially type II restriction endonuclease (such as Fokl).

[0015] However, in the field of plants genetics, transformation methods are complicate, not always efficient, and time consuming. This is particularly true for several plant species, such as sugar beet cells and plants which are reluctant to genetic transformation.

[0016] Therefore, it exists a clear need for the improvement of genetic methods dedicated to transformation especially gene targeting of sugar beet plants.

[0017] Therefore, the present invention aims to provide a new method and tools for gene targeting of sugar beet cells and plants which allow its genetic transformation, especially genetic targeting and editing of sugar beet protoplasts.

Aims of the invention

[0018] The present invention aims to provide new method and means for the transformation of sugar beet protoplasts, cells, tissues (calli) and plants that do not present the drawbacks of the state of the art, especially a method and means that are based upon the use of a new selection marker and new means improving the transformation of sugar beet protoplasts and the selection of genetically modified sugar beet protoplasts, cells, tissues and plants comprising and expressing one or more gene of interest.

Summary of the invention

[0019] The present invention is related to a first method and means for a transformation of sugar beet protoplast ( s ) , cell (s) , tissue (s) and plant (s) with the use of BvALS113 mutated genetic sequence as selection marker gene . [0020] Preferably, the present invention is related to a first transformation method of sugar beet protoplasts, cells, tissues and/or plants with a nucleic acid construct (or vector) and to this nucleic acid construct comprising (or consisting of) a nucleotide sequence (preferably a gene) of interest and the selection marker sequence being the mutated BvALS113 sequence carrying in its sequence a mutation at amino acid 113 position from Alanine to Tyrosine .

[0021] Advantageously, the nucleic acid construct according to the invention and used in the first method of the invention is included into a vector that further comprises (adequate) regulatory sequences for expression of the nucleotide sequence of interest in a sugar beet protoplasts, cells, tissues or plants, preferably promoters, transcription termination and/or poly- adenylation signal sequence active in plants, more preferably the (CAMV) 35S promoter sequence and Nos terminator sequence (from Agrobacterium tumefaciens) .

[0022] Preferably, the selection marker sequence according to the invention is the sequence SEQ ID NO: 1 (described in the enclosed figures) comprising a mutation in its (wild-type) ALS sequence at amino acid 113 position (from an L-Alanine (Ala) to an L-tyrosine (Tyr) ) .

[0023] Advantageously, the first method according to the invention comprises the following steps:

- obtaining protoplasts from stomatal guard cells isolated from a sugar beet plant,

- transforming these protoplasts with a nucleic acid construct (or vector) comprising a nucleotide sequence of interest and the selection marker sequence according to the invention,

- applying to an in vitro culture of these protoplasts, one or more ALS inhibitor (s) at a concentration that is lethal to (more than 99.9% of) the in vitro cultured protoplasts and

- regenerating one or more sugar beet plant (s) from the surviving protoplasts of these in vitro cultured protoplasts and wherein the surviving protoplasts being the one having integrated the nucleic acid construct comprising this nucleotide sequence of interest and this selection marker sequence (providing resistance to one or more ALS inhibitor ( s )) .

According to an alternative embodiment, this first method can be combined with the technical features described in the following second method, in particular this transformation method may include the step of transforming the protoplasts obtained from stomatal guard cells of a sugar beet plant with a nucleic acid construct comprising the selectable marker (above described) and the nucleotide sequence of interest, in addition to Transcription Activator-Like Effector Nucleases (TALEN) or one or more vectors comprising sequences encoding these Transcription Activator-Like Effector Nucleases (Talen) targeting and processing a Target DNA sequence of the protoplast through homologous recombination with the nucleic acid construct comprising the nucleotide sequence of interest.

[0024] Preferably, in the first method according to the invention, the ALS inhibitor is applied to more than 20 million of these protoplasts.

[0025] More advantageously, in the first method according to the invention, the ALS inhibitor is applied at a concentration comprised between 5xlO^~9M and lxlO^"8M for foramsulfuron, 5xlO^_11M and 5xlO^"10M for ethoxysulfuron .

[0026] Suitable ALS inhibitors are preferably selected from the group consisting of sulfonylurea herbicides , sulfonylaminocarbonyltriazolinone herbicides , imidazolinone herbicides , triazolopyrimidine herbicides and pyrimidinyl ( thio) benzoate herbicides . More preferably, the method according to the invention comprises the step of applying several ALS inhibitors present in a composition that comprises at least one sulfonylurea herbicide and at least one triazolopyrimidine herbicide .

[0027] The preferred ALS inhibitors are sulfonylurea herbicides selected from the group consisting of foramsulfuron (ALF) , iodosulfuron, amidosulfuron, ethoxysulfuron (ALE) , chloramsulfuron or a mixture thereof.

[0028] Others suitable ALS inhibitors are thiencarbazone-methyl and triazolopyrimidine herbicides .

[0029] The person skilled in the art may also select others adequate herbicides that interact with the above mentioned ALS sequence and wherein the above-mentioned mutation in SEQ ID NO: 1 (amino acid 113 position mutation from a L-Alanine (Ala) to a L-tyrosine (Tyr) may render protoplasts, cells and plant resistant to this ALS inhibitor or mixture of ALS inhibitors.

[0030] In the method (s) according to the invention, the stomatal guard cells protoplasts, have the ability to divide (grow) and to regenerate (via a sugar beet callus) when grown in a suitable culture medium.

[0031] A callus refers to a mass of undifferentiated cells. In the art, a callus can be obtained from explants, such as embryos or parenchyma- derived explants from leaves or a cotyledon.

[0032] In the method (s) according to the invention, a callus is the result of the growth of (well-regenerating) stomatal guard cells protoplasts.

[0033] Advantageously, the calli obtained by these

(well-regenerating) protoplasts have the capacity to develop shoots and to regenerate into a viable sugar beet plant, when grown in a suitable culture media such as polymer-containing medium (such as alginate or agarose containing medium) .

[0034] In the method (s) according to the invention, the ALS inhibitor is (or comprises) foramsulfuron, such as foramsulfuron applied to a one-week old (or to a three- weeks old) in vitro culture of protoplasts (more particularly to the in vitro culture comprising calli regenerated from these cultured protoplasts) on alginate- containing medium.

[0035] Another aspect of the present invention is related to a second transformation method (second method) of sugar beet protoplasts comprising the steps of:

- transforming these protoplasts with a nucleic acid construct comprising a nucleic acid construct with a nucleotide sequence of interest and either a Transcription Activator-Like Effector Nucleases (TALEN) or one or more vectors comprising sequences encoding these Transcription Activator-Like Effector

Nucleases (TALEN) , these Transcription Activator-Like Effector Nucleases (TALEN) targeting and processing a target DNA sequence of the protoplast and replace this target DNA sequence through homologous recombination with the nucleic acid construct comprising the nucleotide sequence of interest,

- possibly applying to an in vitro culture of these protoplasts, a medium that is toxic, preferably lethal to the in vitro culture of the protoplasts, and

- regenerating sugar beet plants from the cell culture, preferably from the surviving protoplasts having integrated the nucleic acid construct comprising the sequence of interest that possibly renders the transformed cell resistant to the toxic, preferably lethal activity of the applied medium.

[0036] Preferably, the both described embodiments of the method of the invention are combined and in the second method according to the invention, the nucleic acid construct further comprises a selectable marker sequence and, as a nucleic sequence of interest, preferably a mutated BvAL13 sequence carrying in its sequence a mutation at amino acid 113 position from alanine to tyrosine. Alternatively, in this second method, the nucleic acid construct may comprises any gene of interest and as the preferred selection marker sequence this mutated BvALS113 sequence carrying in its sequence a mutation at amino acid 113 position from alanine to tyrosine.

[0037] Preferably, in the second method according to the invention, the nucleic acid construct further comprises one or more regulatory sequences for expression of the nucleotide sequence of interest in sugar beet protoplasts, cells, tissues (calli) and/or plants.

[0038] Examples of regulatory sequences for expression of the nucleic sequence of interest into a sugar beet protoplast, cell, tissue and/or plant are promoter transcription termination and/or poly-A signal sequence (s) , more preferably the CAMV35S promoter sequence and the Nos terminator sequence obtained from agrobacterium tumefaciens .

[0039] Preferably, in the second method according to the invention, the applied medium to the in vitro culture of protoplasts comprises one or more ALS inhibitors selected from the group consisting of sulfonylurea herbicides, sulfonylaminocarbonyltrazolinone herbicides, imidazolinone herbicides, triazolopyrimidine herbicides, pyrimidinyl ( thio) benzoate herbicides or a mixture thereof. More preferably, these sulfonylurea herbicides are selected from the group consisting of foramsulfuron, iodosulfuron, amidosulfuron, ethoxysulfuron, chloramsulfuron or a mixture thereof. More preferably, in the method according to the invention the ALS inhibitor (s) is (are) applied at a concentration comprised between (about) 5xlO^~9M and (about) lxlO^_6M for foramsulfuron, and between (about) 5xlO^_11M and (about) 5xlO^_10M for ethoxysulfuron .

[0040] In the method (s) according to the invention, the sequence of interest can encode a peptide or protein conferring (or involved in) a resistance to one or more herbicide ( s ) , resistance to insects, resistance to nematodes, resistance to plant diseases, resistance to viral infections, resistance to stress (such hydric or saline stress), may encode one or more enzymes and/or may encode a peptide or protein having antibacterial or antifungal properties.

[0041] When the nucleic sequence of interest is the

BVALS 113 sequence carrying a sequence mutation at amino acid 113 position from an L-Alanine (Ala) to an L-tyrosine (Tyr) , the preferred and suitable ALS inhibitor (s) is (are) one of the above mentioned herbicides, more preferably foramsulfuron and/or ethoxysulfuron .

[0042] Furthermore, the person skilled in the art may also select other adequate herbicides which interact with the above mentioned ALS sequence and wherein the above mentioned mutation (at amino acid 113 position from L- Alanine (Ala) to L-tyrosine (Tyr) ) may render protoplast cell tissue and plant resistance to this ALS inhibitor or mixture of A1S inhibitors.

[0043] In the method (s) according to the invention, the preferred protoplasts are stomatal guard cell protoplasts which have the ability to divide (grow) and to originate viral sugar beet callus when grown in suitable culture media. A callus refers to a mass of undifferentiated cells which can be obtained from explants, such as embryos or parenchyma-derived explants from leaves or a cotyledon. According to the invention, the callus is preferably the result of the growth of well-regenerating (stomatal) guard cell protoplasts, having the capacity to develop shoots or to regenerate into viable sugar beet plants when grown in appropriate culture media such as polymer-containing medium (such as alginate or agarose containing medium) .

[0044] The present invention is also related to the protoplast ( s ) , cell (s) , tissue (s) (calli) or plant (s) obtained by the transformation method according to the invention, more particularly to a sugar beet plant integrating in its genome the nucleotide sequence of interest.

[0045] The present invention will be described in details in the following examples in reference to the enclosed figures presented as non-limited embodiment of the present invention.

Short description of the drawings

[0046] Fig. 1 represents the pS189 vector according to the invention.

[0047] Fig. 2 represents sequences BvALS gene including used sequence SEQ ID NO:l and Fig. 3 represents survivability of sugar beet protoplasts transformed with the vector of the invention.

[0048] Fig. 4 represents the introduction of ALS113 mutation in sugar beet protoplasts using specific TALEN and donor matrix containing the mutation along with the flanking sequences for recombination according to the invention . [0049] Fig. 5 represents the T7E1 assay for sugar beet BvALS TALEN activity validation according to the invention .

[0050] Fig. 6 represents two plant expression vectors with specific Transcription Activator-Like Effector Nucleases (TALEN) sequence expressed in protoplasts.

[0051] Fig. 7 represents the complete sequence of donor matrix sequences according to the invention. Detailed description of the invention

[0052] Several sugar beet plant genotypes were selected for their capacity of regeneration from stomatal guard cells protoplasts. Protoplasts are selected by their capacity to growth and divide in vitro. A selection is made also upon the capacity of the grown calli to form shoots and the proportion of growing calli to regenerate a plant.

[0053] Preferably, the selected genotype has more than 0.25% of the stomatal guard cells protoplasts that are able to grow in vitro. The person skilled in the art may, for instance, to refer to plants submitted to deposit as NCIMB 42050 or NCIMB 42051 as suitable genotype comprising a high proportion of growing stomatal guard cells protoplasts .

[0054] The used vector according to the invention is described in the enclosed figure 1 and may comprises a nucleic acid construct made of (comprising or consisting of) a nucleotide sequence of interest and the selection marker sequence of the invention both under the control of the constitutive (CAMV) 35S promoter and Nos terminator sequences.

[0055] In this nucleic acid construct according to the invention, the sugar beet ALS nucleotide sequence containing the nucleotides TAT at position 337 instead of GCA changing the corresponding amino-acid at position 113 from Alanine amino acid (Ala) to Tyrosine amino acid (Tyr) was synthetized by IDT (Integrated DNA Technologies) and inserted in the vector pIDT blue. The nucleic acid construct was then inserted as a Kpnl-Bglll fragment into the pMJB3 plasmid between the 2x 35S promoter for constitutive expression and the Nos terminator from Agrobacterium tumefaciens. The resulting plasmid (vector) is named pS189 and represented in Figure 1.

[0056] A Killing Curve concentration for two preferred ALS inhibitors (Foramsulfuron and Ethoxysulfuron) was established as follows: To use optimal concentration of herbicide for selection of transformed sugar beet protoplasts, killing curve was developed on wild type sugar beet protoplasts with the following concentrations (Table 1 and Table 2) . Based on the results obtained from the killing curve experiments concentration of 5xlO^"9M for foramsulfuron and 5xlO^_11M for ethoxysulfuron were selected for using with transformed sugar beet protoplasts with pS189 plasmid DNA carrying the mutated BvALS nucleotide sequence.

Codes Cone . Cone . Weight # /5ml K8 medium

exp Mol

K8 0 0 0 0

Fo-10 1. E^"10 0.045244 yg/l 5μ1 stock Fo 10^"7 /5mlK8

Fo 5-10 5.E-¹⁰ 0.226220 yg/l 25μ1 stock Fo 10^"7 /5mlK8

Fo -9 1.E-°⁹ 0.452440 yg/l 5μ1 stock Fo 10^"6 /5mlK8

Fo 5-9 5.E-⁰⁹ 2.262200 pg/l 25μ1 stock Fo 10^~6 /5mlK8 ;

Fo -8 1.E-°⁸ 4.524400 yg/l 50μ1 stock Fo 10^"6 /5mlK8

Fo 5 -8 5.E-⁰⁸ 22.622000 yg/l 250μ1 stock Fo 10^"6

/5mlK8

Table 1: Concentrations of foramsulfuron used for evaluating optimal lethal dose concentration for sugar beet protoplasts.

Table 2: Concentrations of ethoxysulfuron used for evaluating optimal lethal dose concentration for sugar beet protoplasts . [0057] Transformation and molecular analysis:

Transformation experiments were performed using plasmid DNA (pS189) according to the standard SV's PEG transformation system under two selection media containing foramsulfuron (ALF) at 5xlO^"9M and ethoxysulfuron (ALE) at δχΙΟ^'^Μ concentrations. The selection of only the transformed protoplasts were evidenced by the number of calli recovered from each transformation experiment. As a control experiment, non-transformed protoplasts were placed on foramsulfuron and ethoxysulfuron selection media that did not result in any calli or survival of cells. So far 7 transformation experiments were performed for ALF and 6 experiments for ALE. From ALF experiments, so far the inventors have obtained about 1799 buds and 60 regenerated plantlets (Table 3) .

[0058] These 60 primary transformation events have been screened for ploidy level and resulting in 27 diploid events. Further molecular analysis for the confirmation of presence of transgene by PCR, copy number analysis by taqman analysis and Southern blot analysis will be performed on these events.

Table 3: Overview of transformation experiments of pS189 plasmid with foramsulfuron as selection media. [0059] Various transformation methods can be used by the person skilled in the art. For instance, PEG addition or Agrobacterium mediated transformation vector (Agrobacterium vector) can be used to insert a heterologous nucleotide sequence into a protoplast or a cell susceptible to infection by Agrobacterium.

[0060] The nucleic acid construct according to the invention will comprise a promoter encoding sequence comprising the nucleotide sequence of interest, preferably a gene product of interest as well as the selection marker sequence , poly-adenylation signal , transcription activation sequences (enhancer, such as the translation activator sequence of the Tobacco mosaic virus (TMV) or the Tobacco etch virus (TEV) and other transcription terminator (enhancer) sequence. The person skilled in the art can select suitable sequences for obtaining expression of the selection marker sequence and the nucleotide sequence of interest into the selected cell, tissue and plant.

[0061] (Constitutive) Promoter sequences may be obtained from plant or virus and include, but are not limited to, the 35S or 19S promoter of cauliflower mosaic virus (CAMV) or from the circovirus and promoters isolated from plant genes, or specific to seeds, such as Napin promoter, the phasaeolin promoter, the glutenin promoter, the helianthinin promoter, the albumin promoter, the oesosin promoter, the SAT1 promoter, the SAT3 promoter and inducible promoters, such the Pal promoter, the HMG promoter, RuBisCO promoter and promoter obtained from T- DNA gene of agrobacterium tumefaciens, such as the nopaline promoter and the mannopine synthase promoter.

[0062] Therefore, the present invention is also related to a vector suitable for transforming sugar beet plant cells (possibly using Agrobacterium-mediated process) and comprising at least the (heterologous) nucleic acid construct comprising or consisting of the sequence of interest and the selection marker sequence according to the invention .

[0063] Various Agrobacterium strains can be employed including, but not limited to, Agrobacterium tumefaciens and Agrobacterium rhizogenes. Suitable Agrobacterium tumefaciens strains including A208EHA101 and LBA4404 strains. Suitable strain of Agrobacterium rhizogenes including K599 strain.

[0064] The selection marker sequence can be introduced into the protoplast or cell simultaneously with the nucleotide sequence of interest, preferably upon the same vector and under the control of the same regulatory sequences (same Promoter) but could also be associated in convergent/divergent or collinear manner or through administration of two vectors used simultaneously for transforming plant protoplast or cell.

[0065] In the nucleic acid construct according to the invention, the nucleotide sequence of interest is a gene encoding a protein of interest under the control of a regulatory sequences active into a plant cell such as promoter sequence which is functional in the selected plant cell or plant of interest to confer on the transformed plant novel agronomic properties or improvements in the agronomic quality of the transformed plant. Preferably, these sequences of interest are selected from the group consisting of sequences encoding protein conferring resistance to certain insects, conferring resistance to nematodes, conferring resistance to certain diseases, sequences encoding specific enzymes and/or sequences encoding antibacterial or antifungal peptides or proteins. Introduction of specific mutation in sugar beet ALS gene for providing resistance against ALS-inhibitors using TALEN technology .

[0066] TALEN' s are specific transcription activator- like effector nucleases (artificial restriction enzymes also called DNA Enzymes) that can be engineered to bind and cut the specific DNA sequences in the genome. Once these TALEN' s are introduced into cells, they can be used for genome editing.

[0067] CPS developed TALENs based on their yeast screening platform and provided SV with 3 engineered TALEN couples directed against 3 different target sites in the ALS sequence (target sites in close proximity to ALS113 mutation site) . All three TALEN pairs come in plant expression vectors along with the three specific donor matrix for each TALEN. The mechanism of technology is illustrated in the Figure 4. below; when both the TALEN pair and the donor matrix are co-transformed together, the TALEN pair makes a double stranded cleavage at specific site and then the donor matrix contacting the specific mutation (ALS113) in inserted into the cleavage site based on the homologous recombination of flanking sequences.

TALEN Synthesis

[0068] Three TALENS were designed and produced for introducing a point mutation (A113Y, GCA to TAT) into Sugar Beet 3' ALS gene. Two ALS homologous loci have been identified from Sugar Beet genome and either of them can be used as the target site. TALEN pairs Plasmid name gal37 (sd) gal30 (sd)

BvALSJTOl.l pCLS24852-pCLS24854 0.85 (0.02) 0.87 (0.06)

BvALS_T02.1 pCLS24856-pCLS24858 0.83 (0.03) 0.84 (0.06)

BvALS_T03.1 pCLS24860-pCLS24862 0.91 (0.03) 0.90 (0.06)

List of TALEN produced and validated by yeast

[0069] Three TALEN pairs were synthesized for making the double strand break in the ALS gene near the mutation site. The objective is to measure the efficiency of these three TALEN' s by using deep sequencing method to look for the NHEJ activities and select the one with higher efficiency for carrying sugar beet transformation along with the donor matrix.

TALEN sequences (SEQ ID NO : 2, SEQID NO : 3 and SEQ ID NO : 4)

BvALS_T01 : TATTGAAGATTCATCTTTCGTTTCTCGATTTGGCCCTGATGAACCCAGA BvALS_T02: TCTTGAGCGTGAAGGTGTTACCAATGTGTTTGCTTACCCTGGTGGTGCA BvALS T03: TGAACAAGGCGGGGTTTTCGCCGCCGAGGGATATGCTAGAGCTACTGGA

Validation of TALEN for efficiency in cutting the double stranded DNA

[0070] For each TALEN pair, the inventors have performed Sugar Beet protoplast transformation using SV s standard direct gene transformation protocol. After the transformation process the protoplast were incubated for 24hrs at 26°C. After the incubation, the resulting protoplast were frozen and the DNA isolation was performed according to the SV s standard protocol. The sequences flanking TALENs Recognition Sites were amplified by PCR. Purified PCR products were then sent for 454 deep sequencing. The sequences were analyzed by bioinformatics team for the presence of targeted deletions or insertions resulting from NHEJ (Non-Homologous End Joining) events. [ 0071 ] Based on the limited 454 sequencing results, one can clearly see the TALEN BvALS_T03 cleavage activity

(-2.2% NHEJ mutagenesis rate, see Table 5). Another approach was to clone the PCR fragments and run Sanger sequencing which is a semi-quantitive method, but the skilled person can identify that both BvALS_T02 and BvALS_T03 have good cleavage activities (~5%, Table 5)

Table 5. Sequencing results of PCR products amplified from TALEN transformed sugar beet protoplast DNA.

[ 0072 ] T7E1 is an endonuclease that recognizes mismatched double strand DNA and makes cleavage on the mismatched sites. When the PCR products were denatured and re-annealed, single strand DNA with and without deletions could make double strand DNA that has mismatches. Those DNA were target for T7E1. Compare to 454 sequencing assay, T7E1 assay was simple and low cost. But it's not as sensitive as 454 sequencing, can only detect TALEN activities that exceed 5%.

[ 0073 ] Figure 5 shows the T7E1 assay results. Since there were SNPs between the two ALS genes in sugar beet genome, T7E1 assay indicated some default cuttings even in wildtype material. Those banding pattern may cover the cuttings from BvALS_T01 and BvALS_T03 cleavages. But we can clearly see the extra cutting from BvALS_T02 samples (pointed by red arrows) , indicating BvALS_T02 has significant cutting activity. [0074] Based on the results from different validation analysis, the inventors have considered both BvALS_T02 and BvALS_T03 were good TALEN that can be future used for this project. Given the fact that the donor for BvALS_T02 does not contain any extra mutation other than the three planned mutation, the inventors have selected the BvALS_T02 and its donor for transformation in sugar beet to introduce ALS113 mutation in sugar beet ALS gene. Sugar beet transformation with TALEN and donor matrix combination

[0075] The inventors have initiated the transformation experiments with TALEN BvALS_T02 (pCLS24856- pCLS24858) and its corresponding donor matrix BvALST2 (pCLS26201) to test the efficiency of targeted insertion carrying the mutated ALS. Once the efficiency is determined, the transformation experiments was initiated to regenerate the plants carrying the mutation using the killing curve concentration determined for foramsulfuron and ethoxysulfuron .

Claims

1. A method for the transformation of sugar beet protoplasts comprising the step of:

transforming said protoplasts with a nucleic acid construct comprising a nucleotide sequence of interest and a selection marker sequence,

- applying to an in vitro culture of said protoplasts, one or more ALS inhibitors at a concentration that is lethal to the in vitro culture of the protoplasts and

regenerating sugar beet plants from the surviving protoplasts having integrated the nucleic acid construct comprising the sequence of interest and the marker sequence

wherein the selection marker sequence is the mutated BvALS113 sequence carrying in its sequence a mutation at amino acid 113 position from Alanine to Tyrosine.

2. The method of claim 1, wherein the mutated BvALS113 sequence comprises or consist of SEQ ID

NO: 1.

3. The method of claim 1 or 2 , wherein the nucleic acid sequence further comprises one or more regulatory sequences for expression of the nucleotide sequence of interest and the marker sequence in sugar beet protoplast, cell, tissue and/or plant.

4. The method according to any of the preceding claims, wherein the ALS inhibitor is applied to more than 20 million of protoplasts.

5. The method according to any of the preceding claims wherein the ALS inhibitor is selected from the group consisting of sulfonylurea herbicides, sulfonylaminocarbonyltrazolinone herbicides, imidazolinone herbicides, triazolopyrimidine herbicides, pyrimidinyl (thio) benzoate herbicides or a mixture thereof.

6. The method of claim 5, wherein the sulfonylurea herbicide is selected from the group consisting of Foramsulfuron, iodosulfuron, amidosulfuron, ethoxysulforon, chloramsulfuron, or a mixture thereof.

7. The method according to any of the preceding claims wherein the ALS inhibitor is applied at a concentration comprised between 5xlO^"9M and lxlO^"8M for foramsulfuron, 5xlO^_11M and 5xlO^"10M for ethoxysulfuron .

8. The method according to any of the preceding claims wherein the protoplast are transformed through agrobacterium-mediated process.

9. The method according to any of the preceding claims wherein the selection marker sequence is eliminated by crossing the transformed plants with a non- transformed variety of the same plant.

10. The method according to any of the preceding claims wherein the sequence of interest encodes a peptide conferring resistance to insects, to nematodes or to plant diseases, encodes one or more enzyme (s) or an antifungal or antibacterial peptide.

11. The method according to any of the preceding claims, wherein the protoplasts obtained from stomatal guard cells isolated from the sugar beet plant, are transformed by a nucleic acid construct comprising the nucleotide sequence of interest and transcription Activator-Like Effector Nucleases (TALEN) or one or more vector (s) comprising sequences encoding the said TALEN targeting and processing a target DNA sequence of the protoplast through homologous recombination with the nucleic acid construct comprising the nucleotide sequence of interest

12. A nucleic acid construct comprising or consisting of a nucleotide sequence of interest and a selection marker sequence being the mutated BvALS113 sequence carrying in its sequence a mutation at amino acid 113 position from alanine to Tyrosine.

13. The vector comprising the nucleic acid construct of claim 12 and regulatory sequences for expression of the nucleotide sequence of interest and the selection marker sequence of said nucleic acid construct into a sugar beet protoplast, cell, tissue and/or plant.

14. The transgenic sugar beet cell or plant obtained by the method according to any of the preceding claims or comprising the nucleic acid construct or vector according to any of the preceding claims.