WO2015185902A1

WO2015185902A1 - Nucleic acid amplification system

Info

Publication number: WO2015185902A1
Application number: PCT/GB2015/051585
Authority: WO
Inventors: Robert Powell
Original assignee: Primer Design Ltd
Priority date: 2014-06-02
Filing date: 2015-06-01
Publication date: 2015-12-10
Also published as: GB201409786D0

Abstract

A method for detecting a nucleic acid amplification reaction, said method comprising carrying out a nucleic acid amplification reaction using a primer that binds a target sequence and has a tag sequence at the 5' end which is independent of said target sequence, wherein the method is carried out in the presence of a probe that is substantially homologous to said tag sequence, and a labelling system which is able to produce a detectable signal when the probe is bound to a complementary strand; measuring a signal indicative of the presence of binding of the probe to its complement, and relating this to the occurrence or progress of an amplification reaction. Kits for carrying out the method of the invention are also described and claimed.

Description

Nucleic Acid Amplification System

Field of the invention

The present invention relates to nucleic acid

amplification systems that allow for the detection of

amplification product, optionally in 'real-time' . Novel elements and in particular primers and probes used in this system and kits containing these form a further aspect of the invention .

Background to the Invention

Nucleic acid amplification reactions such as the

polymerase chain reaction (PCR) provide an invaluable tool for producing, detecting and analysing nucleic acids for a wide range of purposes . The specificity of these types of reaction allows the detection of particular target sequences within a background of multiple different sequences. The basic

principle behind many nucleic acid amplification reactions is the use of short 'primer' sequences that are designed to specifically bind to a target sequence and are then extended by the enzymatic addition of individual nucleotides, which are present in excess in the reaction mixture to ensure efficient incorporation. The reaction is controlled by heating and cooling and thermocycling is repeated many times, leading to an increase and in particular an exponential increase in the amount of target sequence present in the sample.

The detection of amplification products using a wide variety of signalling and detection systems is known. Many of these systems can be operated in 'real-time' , allowing the progress of amplification to be monitored as it progresses, allowing for quantification of the product. Many such systems utilise labels and in particular fluorescent labels that are associated with elements such as primers and probes used in the amplification system and which rely on fluorescent energy transfer (FET) as a basis for signalling. A particular form of such fluorescent energy transfer is fluorescent resonance energy transfer or Forster resonance energy transfer (FRET) for signal generation .

A major example of such a process used commercially is the TaqMan® process, in which a dual-labelled probe, carrying both a first label comprising a fluorescent energy donor molecule or reporter and a second label comprising a fluorescent energy acceptor molecule or quencher, is included in a PCR system.

When bound to the probe, these molecules interact so that the fluorescent signal from the donor molecule is quenched by the acceptor. During an amplification reaction however, the probe binds to the target sequence and is digested as the polymerase extends primers used in the PCR. Digestion of the probe leads to separation of the donor and acceptor molecules, so that they no longer interact. In this way, the quenching effect of the acceptor is eliminated, thus modifying emissions from the molecule. This change in emission can be monitored and related to the progress of the amplification reaction. Probe digestion may however slow down the reaction. Additionally,

oligonucleotides carrying multiple labels such as the probes used in this method may be more costly to produce than single labelled oligonucleotides . As they are digested during the course of the reaction, significant concentrations of these probes are required. Furthermore, the digestion process may slow down the progress of the reaction.

Many alternative processes have been developed. In some of these, the primers used in the process are provided with a 'tag' sequence that extends 5' of the binding sequence and which may allow detection of the target sequence. For instance, WO99/66071 describes 'Scorpion'™ primers, which include a 'snap- back' tail that remains single-stranded during the amplification and then is able to bind to the primer extension product directly, giving rise to a detectable signal.

A number of systems include complex reporter priming probes, which are similar to artificial tail sequences provided on amplification primers, but which are required to be extended in order to give rise to a signal. One such system, involving the opening and subsequent cleavage of a 'hairpin' type probe is described in US2003/0165913.

EP-1726664 and US2010/0105050 describe detection systems for a PCR reaction which utilise a pair of labelled

oligonucleotides which bind each other when free in solution as the basis of a signalling mechanism. In both cases, the primer used in the reaction includes a 'tail' region which is similar to one of the labelled oligonucleotides . As the complement to the primer tail is produced in the course of the reaction, one of the labelled olignonucleotide acts as a primer itself, and may be thermodynamically favoured to do so. As a result, it is extended and binds to a longer complement, and so no longer binds the other member of the pair of oligonucleotides,

separating the labels and giving rise to a signal. The

provision of such a complex signalling system involving multiple oligonucleotides adds to the cost of the system. Furthermore, the signal is dependent upon effectively a second PCR based upon the use of the labelled oligonucleotide being carried out simultaneously, leading to complex reaction design.

US2012/0252692 describes a further complex assay, where probes are used to stabilise 3-dimensional duplex structures for detection. The applicants have developed an alternative system which allows more reliable signalling by providing greater flexibility in probe design. In addition, the system may provide for economies of scale since the same probe may be used in multiple detection systems.

Summary of the invention

The applicants have developed a method that utilises a primer having a 5' tag sequence combined with a probe that comprises a sequence that is substantially homologous to the tag sequence and so binds to the complement of tag sequence, which is generated as part of a nascent strand during an amplification reaction, and wherein the simple binding of the probe to the complementary sequence in the nascent strand gives rise to a detectable signal.

As used herein, the expression ^Λ substantially homologous' means that sequences have a high degree of similarity or identity, and so will bind to the same complementary strand. In particular, the sequences are at least 90% identical, in particular at least 95% identical, for example 100% identical. The level of sequence identity is suitably determined using the BLAST computer program. The BLAST software is publicly available at http://blast.ncbi.nlm.nih.gov/Blast.cgi (accessible on 12 March 2009) .

According to the present invention there is provided a method for detecting a nucleic acid amplification reaction, said method comprising carrying out a nucleic acid amplification reaction using a primer that binds a target sequence and has a tag sequence at the 5' end which is independent of said target sequence, wherein the method is carried out in the presence of a probe that comprises a sequence that is substantially homologous to said tag sequence, and a labelling system which is able to produce a detectable signal when the probe is bound to a complementary strand; measuring a signal indicative of the presence of binding of the probe to its complement, and relating this to the occurrence or progress of an amplification reaction. The probe is resistant to polymerase-mediated extension of the 3' end and so is not able to act as a primer in the

amplification reaction.

The labelling system used is one with is able to produce a detectable signal directly whenever the probe hybridises or becomes bound to a complementary strand. Therefore there is no requirement to provide for other processing of the probe in order to generate a signal, for example by any extension, digestion, cutting or anchoring procedures . Thus the design of the amplification reaction may be simplified.

Furthermore, only a single probe olignonucleotide is required and there is no requirement to provide to the reaction mixture any complements for the probe in order to bind the probe until required for use. In fact, in the method of the

invention, such an additional element would be detrimental, and so the probe is designed to be resistant to polymerase mediated extension at the 3' end.

Since the sequence of the probe comprises a sequence which is substantially homologous to the tag sequence, it will bind to the complementary strand, produced during a subsequent cycle of the amplification following extension of the primer sequence. In essence, where target for the primer is present in the reaction, the primer binds to the target and becomes extended as a result. In a subsequent cycle of the amplification, a nascent strand complementary to the primer extension product, for example as a result of the presence in the reaction of a reverse primer is produced. Since the primer extension product

incorporates the primer and also the tag sequence, this nascent strand will incorporate a section which is complementary to the tag sequence of the integrated primer. This sequence will therefore be complementary to and bind to the probe, thereby giving rise to a signal, suitably in a direct manner.

In a particular embodiment, the amplification reaction is an asymmetric reaction, in particular an asymmetric PCR where the forward and reverse primers are present at different concentrations. In a particular embodiment, the amplification is carried out in the presence of an excess of a reverse primer, extension of which results in the production of an excess of the secondary strand, which is then available for binding to the probe. In particular, the reverse primer is present in an amount which is from 2-25 times the molar amount of the forward primer. In this case, although initially the binding of the probe occurs in competition to the binding of the primer, during later cycles probe binding is favoured as an excess of the reverse strand incorporating the complement to the probe is produced .

Furthermore, in a particular embodiment, the forward primer is present in a limited concentration, which is at a lower concentration than is optimal for maximal generation of product, such as cDNA. As the amplification progresses, the concentration of the forward primer reduces further as it is incorporated into the nascent strands such as cDNA.

The asymmetric configuration of the amplification reaction also serves to favour excess synthesis of single stranded DNA which again enhances the concentration of available target for the probe to bind too. The applicants have found that using this approach, the fluorescence signals obtained are comparable to alternative established methods .

Thus, whilst a typical PCR reaction may use equal

concentrations of forward and reverse primers, for example at equal concentrations, for example of about 4 pmol, in a reaction according to the invention, the concentration of the reverse primer is increased for example to about lOpmol. In addition, the concentration of the forward primer is suitably reduced, for example to about 2pmol.

By using the method of the invention, reliable signalling can be achieved, since the tag and probe sequences can be designed so that the probe binds strongly to its complement in the nascent strand at the temperatures used for production of the nucleic acid strands including the complement to the primer extension product. The only constraint on the design of the tag sequence is that it is independent of the target sequence and so does not bind to the target or any other moiety that may be present in a sample. Furthermore, there are economies of scale possible since the same tag can be added to a wide range of primers and the same probe therefore used to detect a wide range of different target sequences in different reactions Thus the probe may be produced in large scale for use in a variety of different reactions .

The probe is essentially a hybridisation probe. It does not interact with any of the enzymes used in the amplification reaction and is not therefore required to be hydrolysed or otherwise digested or affected during the amplification

reaction. This means that the amplification reaction can be relatively rapid, since there is no need to wait for hydrolysis to occur during the amplification reaction.

The labelling system used will be one that is able to detect binding of the probe to its complement. In a particular embodiment, the probe itself carries a labelling system which is able to provide a detectable signal when the probe is in the form of a double stranded nucleic acid.

In a particular embodiment, the probe will be in the form of a 'Molecular Beacon' , for example as described in EP- 0728218. In this embodiment, the probe comprises a pair of interactive labels separated along the length of the probe, and in particular with a first label at one end of the probe and a second label which interacts with the first label at the other end of the probe. Suitably one of the first or second labels is a fluorescent energy donor or reporter molecule and the other is a fluorescent energy acceptor or quencher molecule which is able to absorb fluorescent energy from the donor label. The fluorescent energy acceptor or quencher molecule may itself be fluorescent or it may be a non-fluorescent or Mark' quencher which does not fluoresce, at least not at the wavelengths encountered in a fluorimeter or other device used to monitor the reaction .

The intervening region of the probe includes a self- complementary sequence, meaning that it forms a hairpin' structure for example when free in solution. When in the form of a hairpin, the labels provided at each end of the sequence are brought into close proximity to each other so that

interaction occurs, affecting the signal produced.

However, in the presence of a complement to the probe sequence, the hairpin is ' opened' up as the probe will

preferentially bind to the complement. This has the effect of separating the two labels, and thus giving rise to a change in the signal which may be detected.

In the present invention, the complement to the probe is produced during the second and subsequent stages of the

amplification, as a result of the production of nascent strands obtained by replication of the primer extension product. Thus, a change in signal produced by the binding of the probe to its complement in the nascent strands is able to provide a signal indicative of the progress of the amplification.

Pairs of suitable interacting labels are known in the art. Suitable fluorescent labels are fluorescent dyes such as fluorescein and derivatives thereof such as FAM, JOE, rhodamine dyes such as TAMRA or other dyes such as Cy5 or VIC™, which are well known in the art. Pairs of dyes that form ' FET' pairs are also well-known or may be determined using routine methods. In particular, where pairs of dyes are used, these are suitably dyes that have a FRET interaction

As discussed above, the fluorescent energy acceptor label or quencher may comprise a non-fluorescent acceptor molecule, sometimes known as a "dark quenchers" such as a 'Black Hole Quenchers' , DABCYL or Methyl Red. These may be attached to the primer and/or the probe in a conventional manner.

Alternatively, the probe may carry one or more labels which are able to generate a signal on binding. Such labels are generally fluorescent labels whose fluorescence changes

depending upon the arrangement of the molecules and in particular, whether the nucleic acid to which they are bound is in single or double stranded form. Examples of such labels are used in the so-called Hybeacons™ applications, such as are described for example in EP-1278889. In particular, suitable labels in this case may be derived from three structurally diverse classes of fluorophore ; the fluorescein, sulforhodamine and cyanine dyes (J.Richardson et.al Chembiochem. 2010 Dec 10; 11 ( 18 ) : 2530-3 ) . A single label may be provided on each probe, or more than one label for example, from 2-4 labels may be provided. They may be arranged anywhere along the length of the probe, but are generally arranged internally to maximise signal .

The probe is resistant to polymerase-mediated extension during the amplification. In particular, it is 'blocked' at the 3' end to prevent polymerase-mediated extension of the probe during the reaction. Blocking may be achieved by various means as are well known in the art, including the provision of a phosphate blocking group or by suitable positioning of a moiety such as a label directly on the 3' end of the probe.

Alternatively, short sequences, for example of from 3-10 bases, which are not complementary to the corresponding regions of either the primer or the tag when the probe is bound thereto may be included at the 3' end of the probe. In this instance when bound to the complementary sequence produced during the

amplification, there is no base pairing complementarity at the 3' end of the probe that would allow the polymerase to extend the probe. For example, the probe may be provided with a 3' poly-A motif .

Primers used in the method of the invention comprise a 5' tag sequence which may suitably be from 10 to 25 nucleotides in length and a 3' target binding sequence which will typically be from 12 to 30 nucleotides in length. These may, if required, be separated by a spacer group, in particular a short sequence of from 2-10 random nucleotides for example about 3-4 nucleotides is provided between the tag sequence and the target binding sequence .

By detecting the occurrence of an amplification reaction, the presence or absence of a target nucleic acid sequence in a sample may be determined. Furthermore, the progress of the reaction may be monitored in real-time to provide a

quantification of the amount of target nucleic acid sequence present in the reaction, as is conventional in the art.

Nucleic acids amplified in accordance with the method of the invention will be DNA or RNA molecules and in particular will be DNA molecules . Probes and primers used in the

amplification are suitably DNA molecules .

In this context, a 'target sequence' may be any nucleic acid sequence that is required to be amplified. This may include a characteristic nucleic acid sequence which is required to be amplified for detection, diagnostic or other purposes, or it may include a 'control' sequence, which is deliberately added to a sample or reaction mixture prior to amplification with a view to providing an indication that the conditions applied are suitable for an amplification reaction.

Where an amplification reaction mixture contains more than one sequence for amplification, for instance, a diagnostic and a 'control' sequence, or a plurality of diagnostic sequences, the method can be multiplexed by providing multiple different primers and ensuring that the signal generated by each

combination of primer and probe is different and

distinguishable. This may be achieved in a variety of ways as discussed in more detail below.

In general, each primer binds one target sequence and is provided with a tag sequence which is different to any other tag sequence used in the system. A probe with a sequence

corresponding to each of the tag sequences is also used in the system. Each probe may be differently labelled so that

distinguishable signals are generated depending upon which specific primer sequence has been extended during the

amplification reaction. In this way, the occurrence or progress of multiple different amplification reactions may be determined by detecting the different and distinguishable signals .

Alternatively, similar labels may be used in each probe, but it that case, the probes are designed so that they have different melting points, in particular as a result of a different AT/GC ratio in the sequence. In this case, the occurrence or progress of multiple different amplification reactions may be determined by a melting point analysis and detecting the signals the distinguishable temperatures

characteristic of each probe.

This method of the invention may be particularly suitable for use in genetic analysis, for example for the detection of single nucleotide polymorphisms or SNP analysis. In this case, the reaction is carried out with two different primers, one which is specific for the wild-type sequence and one which is specific for the allele containing the SNP. Specificity in this case is suitably achieved by designing the primer so that the site of the SNP is at or near the 3' end of the primer.

Other measures may be taken to ensure specificity is high.

The nucleic acid amplification reaction may be any

reaction in which a primer is extended by enzymatic addition of one or more nucleotides to it whilst that primer is bound or hybridised to a target sequence. Such reactions include reactions that utilise thermal cycling such as the polymerase chain reaction (PCR) and ligase chain reaction (LCR) as well as isothermal amplification reactions such as nucleic acid sequence based amplification (NASBA) , strand displacement amplification (SDA), transcription mediated amplification (TMA) , Loop-Mediated Isothermal Amplification (LAMP) and rolling circle amplification, 3SR, ramification amplification (as described by Zhang et al . , Molecular Diagnosis (2001) 6 No 2 , p 141-150), recombinase polymerase amplification (available from TwistDx) and others. In particular, however, the nucleic acid

amplification is a PCR.

Typically, in such amplification reactions, a 'reverse primer' is provided which binds to the complement of the target sequence and thus to the primer extension product also, and it is this which is extended to produce the said complement to the primer extension product. As discussed above, in the method of the invention, this reverse primer is suitably present in excess so that it drives the production of an excess of the nascent strand to which the probe may bind.

In a preferred embodiment, the invention can be used in a real-time PCR system. By monitoring the fluorescent signal from the system throughout the amplification reaction, it is possible to produce an authentic amplification plot.

In particular, the signal from a label may be monitored. In particular, the reaction mixture is exposed to fluorescent radiation at the excitation wavelength of the fluorescent energy donor. This means that it will generate a fluorescent signal at a characteristic emission wavelength that will effectively be dependent upon its position in the reaction system. For example, in the case of a probe in the form of a molecular beacon, the signal produced will be quenched if the probe is free in solution and therefore in the form of a 'hairpin' structure as a result of the interaction of the labels .

However, this will not be quenched if opened out and bound to a nascent strand. Thus the signal will be distinguishable.

Alternatively where the probe is labelled with a single label of the 'Hybeacons™' type, the signal from the label will not be quenched when the probe is free in solution, but will be modified, for example, fluorescence may be enhanced if the probe becomes bound to a nascent strand.

The primers and probes as described above may be included into kits for carrying out the method of the invention and such kits form yet a further aspect of the invention.

Thus the invention further provides a kit comprising a primer which binds a target sequence and is provided with a tag sequence which does not bind the target sequence at the 5' end thereof, a probe is substantially homologous to said tag sequence of said primer, and a labelling system which is able to produce a detectable signal when the probe is bound to a complementary strand.

Suitable labelling systems are as described above. In particular, where the probe has a self-complementary region allowing it to form a 'hairpin' structure (a molecular beacon probe), the labelling system comprises a pair of interacting labels, arranged to be brought into close proximity so that interaction occurs, when the probe is in the hairpin

configuration. In particular, one of the labels is in the region of the 3' end and one in the region of the 5' end of the probe .

Alternatively, the probe may carry one or more labels whose signal is modified when the probe is bound to a

complementary strand. The one or more labels are suitably arranged internally along the length of the probe.

In a particular embodiment, the kit further comprises an excess of a reverse primer which binds to a complementary strand of the target sequence.

Kits may be suitable for use in multiplex methods as described above, in which case they may comprise multiple primers with different tag sequences, each in combination with a suitable probe that is substantially homologous to the tag sequence. Each probe/primer combination will be differently labelled or will be distinguishable on the basis of a melting point analysis as described above so that the specific sequence that is amplified may be identified from an analysis of the signal from the reaction.

The kits may comprise other reagents required for carrying out an amplification reaction, such as salts (including

magnesium or manganese salts), enzymes and in particular polymerase enzymes such as thermostable polymerase enzymes, nucleotides and buffers. The elements may be formulated together with the primers and probes as described above or they may be provided separately.

Formulations of the reagents may be supplied in any convenient form, including for example in freeze-dried form.

Detailed description of the invention

The invention will now be particularly described by way of example with reference to the accompanying diagrammatic drawings in which:

Figure 1 is a schematic diagram illustrating an embodiment of the method of the invention, utilising a probe which as the structure of a 'molecular beacon' ;

Figure 2 is a schematic diagram illustrating an alternative embodiment of the method of the invention, utilising an

internally labelled hybridisation probe;

Figure 3 is a schematic diagram illustrating how an embodiment of the method of the invention may be applied to determine the presence of a polymorphism, for example an SNP such as may be found in allele specific amplification;

Figure 4 is a schematic diagram illustrating how an alternative embodiment of the method of the invention may be applied to determine the presence of a polymorphism, for example an SNP such as may be found in allele specific amplification;

Figure 5 shows amplification plots derived from priming on the BRAFV600E allele using a tagged primer in conjunction with a Molecular Beacon probe in accordance with an embodiment of the invention;

Figure 6 shows raw melt curve data (A) and a derivative plot (B) obtained by priming on the BRAFV600E allele using a tagged primer in conjunction with an internal hybridisation probe in accordance with an embodiment of the invention;

Figure 7 shows the results of amplification using a multiplex of allele specific primers for WT and HFE-C282Y alleles, in accordance with an embodiment of the method of the invention. The multiplex was used with a WT template (A) and with the HFE- C282Y template (B) ; and

Figure 8 shows the results of melting curve analysis following amplification using multiplex of allele specific primers for WT and BRAF-V600E, in accordance with an embodiment of the

invention. The multiplex was used with a WT template (dashed line) and with the BRAF-V600E template (solid line) .

In the embodiment illustrated in Figure 1, a primer is provided, having a 3' sequence dependant priming region (1) and a 5' sequence independent tag (2) . In addition, the system comprises a molecular beacon type probe (3) having same sequence as the tag (2) . The probe (3) carries a pair of interacting labels (shown as solid colour) at either end, which are in close proximity when the probe (3) is in the illustrated hairpin' arrangement .

During an amplification reaction, the primer contacts a the target sequence (4) and is extended by a polymerase to make a nascent primary strand (5) (Figure 1A) . During a subsequent amplification cycle, a complimentary primer (6) binds to the nascent primary stand (5) and initiates extension to create a nascent secondary strand (7) . As extension proceeds, the complement to the primer including the complement to the tag (2) is produced (Figure IB) .

The complimentary primer (6) is present at excess

concentration such that an excess of secondary stand (7) is synthesised relative to the first strand (5). The molecular beacon probe (3) binds to the excess secondary strand,

separating the labels and producing a detectable signal, for example by releasing florescence.

In the alternative embodiment illustrated in Figure 2, again a primer having a 3' sequence dependant priming region (1) and a 5' sequence independent tag (2) is provided. In this case, an internally labelled hybridisation probe (3) having substantially the same sequence as the tag (2) is provided. The probe (3) in this case has a short non-complementary region (16) at the 3' end, which prevents extension of the probe by a polymerase .

The primer contacts the target sequence (4) and is extended by a polymerase to make a nascent primary strand (5) (Figure 2A) .

A complimentary primer (6) binds to the primary stand and initiates extension to create the secondary strand (7) (Figure 2B) . The complimentary primer is present at a higher

concentration than the tagged primer leading to excess synthesis of secondary stand relative to the first strand. The

internally labelled hybridisation probe (3) binds to the excess secondary strand and the signal is modified as a result, in particular florescence is enhanced (Figure 2C) .

Thereafter a melt-curve analysis can be performed in which a fluorescence decrease is observed upon heating the post PCR duplex releasing the hybridisation (Figure 2D). Figure 3 illustrates schematically a system comprising diagram comprising two primers (8, 9) each one comprising of an allele specific 3' priming region and a unique and district sequence independent tag. Each tagged primer is paired with its own molecular beacon probe (10, 11) that is substantially homologous to the respective tag. Each molecular beacon probe (10, 11) carries a different fluorescent reporter dye system, producing a different signal. For example, each probe will carry a different fluorescent energy donor molecule, and the same or different fluorescent energy acceptor molecules, provided that the signals produced by the respective systems are distinguishable from each other. During amplification using such as system, the primers (8,9) bind and extend depending on the allele (s) (X and/or Y) present in the target sequence, in a manner illustrated in Figure 1. This generates a signal, in particular a fluorescent signal, through different channels depending on which tag has been incorporated into the PCR product .

In the diagram of Figure 4, two primers (12,13) each one comprising an allele specific 3' priming region and a unique and district sequence independent tag are provided. In this instance, the tags differ by the AT/GC ratio such that the Tm of one tag is lower than the Tm of the other. Each tagged primer is paired with its own internal hybridisation probe (14, 15 respectively) such that and each molecular beacon probe will produce a melt curve at distinct Tm. The primers bind and extend depending on the allele (s) (X or Y) present in the target sequence and fluorescent signal is monitored during the melt curve analysis to produce a distinctive melt pattern depending on which tag has been incorporated into the PCR product .

Example 1- Amplification using a Molecular Beacon probe

Materials & Methods Real time PCR amplification was performed on the bio-rad IQ5 or Applied biosystems 7500 platforms. In the experiment,

PrimerDesign' s PrecisionFAST mastermix was used which has a thermo stable taq polymerase, dNTPs, Magnesium at 5mM final in Tris buffer at pH 8.8

A three step cycling protocol was used as defined below:

95°C 2 mins enzyme activation

45 cycles

95°C 10s

55°C 15s read fluorescence

72°C 15s

In all experiments the primer concentrations used were; tagged forward primer = 2pmol per reaction complimentary reverse primer = lOpmol per reaction

In this asymmetric PCR, not only is the reverse primer present in excess, the tagged forward primer was also at a primer limiting concentration within the reaction.

A tagged forward primer (BRAF-MB-f ) , directed at the BRAFV600E mutation, was prepared having the SEQ ID NO 1.

ACCTGGACCTCTGCCCTCTGGATGGaaccaggtTTGGTCTAGCTACAGT (SEQ ID NO 1) Where bold region = primer specific region

A Molecular Beacon probe of SEQ ID NO 2 was also prepared ACCTGGACCTCTGCCCTCTGGATGGAACCAGGT (SEQ ID NO 2) Bold region = self-complementary 'hairpin' sequences

The probe carried a pair of interacting fluorescent labels, 5' = FAM, 3'=BHQ1.

The reverse primer (BRAF-r) was of SEQ ID NO 3 CTCAATTCTTACCATCCACAAAATG (SEQ ID NO 3)

The fluorescent signal from the reaction mixture was monitored throughout the amplification and the results are shown in Figure 5. A clear increase in fluorescent signal was observed as the amplification progressed. Example 2 — Amplification using an internally labelled

hybridisation probe

Amplification using the methodology described in Example 1 was repeated but this time with the following primers and probe:

BRAF-INT-SNP-f

GTTTGCAGGTCGGTCAGAGTTTGGTCTAGCTACAGA (SEQ ID NO 4)

Bold region = primer specific region

HighTm

GTTlGCAGGlCGGTCAGGGTaaaaa (SEQ ID NO 5)

1 = T-FAM, aaaaa = sequence independent tag,

BRAF-r (excess)

CTCAATTCTTACCATCCACAAAATG (SEQ ID NO 6)

At the end of the amplification reaction, a melt curve analysis was carried out using the bio-rad CFX. The results are shown in Figure 6. A clear melting peak, indicative of the presence of the target sequence is clearly shown. Example 3 -Allele specific priming using two molecular Beacon probes as reporters for each allele Amplification as described in Example 1 was carried out using a multiplex of allele specific primers on both WT and HFE-C282Y alleles. In this case, the primers and probes used were as follows : Tagged Primers (HFE-282-WT)

ACCTGGACCTCTGCCCTCTGGATGGaaccaggtTGGGTGCTCCACCTGGC (SEQ ID NO 7)

HFE-282-SNP

CATTGCCCTCAACGACCACTTTGTCAAGCggcaatTGGGTGCTCCACCTGGT (SEQ ID NO 8)

Probe

WT- 5' = FAM 3'=BHQ1- labelled Molecular beacon

ACCTGGACCTCTGCCCTCTGGATGGAACCAGTT (SEQ ID NO 9)

SNP- 5' = Cy5 3'=BHQ2 labelled Molecular beacon

CATTGCCCTCAACGACCACTTTGTCAAGCGGCAAT (SEQ ID NO 10)

HFE-282-F

GGCTGGATAACCTTGGCTGTA (SEQ ID NO 11)

The results are shown in Figure 7. The results of the use of the multiplex with a WT template is shown in Figure 7 (A) and with the HFE-C282Y template (B) . The signals from the FAM channel were clear in the amplification of the WT template whilst those from the CY5 channel were insignificant, and the reverse was observed during the amplification of the HFE-C282Y template, showing that the system provides a clear signal in a multiplex format .

Example 4 - allele specific priming using two molecular internal hybridisation probes as reporters for each allele

The methodology of Example 2 was repeated in a multiplex format using the following primers and probes : primers

BRAF-INT-SNP-f

GTTTGCAGGTCGGTCAGAGTTTGGTCTAGCTACAGA (SEQ ID NO 4)

BRAF-INT-WT-f

TGAATTGCTAGTCAATAAGAGTTTGGTCTAGCTACAGT (SEQ ID NO 12)

Bold region = primer specific regio

Internal hybridization probes

HIGH-Tm GTTlGCAGGlCGGTCAGGGTaaaaa

LOW-Tm TGAATlGCTAGlCAATAAGGGTaaaaa

1 = T-FAM, aaaaa = sequence independent tag.

Each probe was similarly labelled but had a different melting temperature. The results of the melting curve analysis are shown in Figure 8. Each sample produced a clear and distinct melting point signal corresponding to amplification of the correct target.

Claims

1. A method for detecting a nucleic acid amplification reaction, said method comprising carrying out a nucleic acid amplification reaction using a primer that binds a target sequence and has a tag sequence at the 5' end which is

independent of said target sequence, wherein the method is carried out in the presence of a probe comprising a sequence that is substantially homologous to said tag sequence, and a labelling system which is able to produce a detectable signal when the probe is bound to a complementary strand, wherein the probe is resistant to polymerase-mediated extension of the 3' end during the amplification reaction; measuring a signal indicative of the presence of binding of the probe to its complement, and relating this to the occurrence or progress of an amplification reaction.

2. A method according to claim 1 wherein the amplification reaction is carried out in the presence of an excess of a reverse primer.

3. A method according to claim 1 or claim wherein the amount of the primer that binds a target sequence and has a tag sequence is below that at which optimal amplification occurs.

4. A method according to any one of the preceding claims wherein the 3' end of the probe is blocked to prevent

polymerase-mediated extension of the probe during the reaction.

5. A method according to any one of claims 1 to 3 wherein the probe is provided with a short sequence at the 3' end, said short sequence being non-complementary to the corresponding regions of either the primer or the tag when the probe is bound thereto such that when bound to the complementary sequence produced during the amplification, there is no base pairing complementarity at the 3' end of the probe, so that polymerase- mediated extension is prevented.

6. A method according to any one of the preceding claims wherein the probe carries a labelling system which is able to provide a detectable signal when the probe is in the form of a double stranded nucleic acid.

7. A method according to claim 6 wherein the probe comprises a pair of interactive labels separated along the length of the probe, and wherein the intervening region of the probe includes a self-complementary sequence allowing it to form a hairpin structure when regions of the self-complementary sequence are hybridised together.

8. A method according to claim 6 wherein the probe comprises one or more labels which are able to generate a signal on binding of the probe to a complementary sequence.

9. A method according to any one of the preceding claims wherein the amplification is carried out in the presence of more than one primer sequence, each specific for a different target, and where the tag of each primer is different, and wherein a probe which is substantially homologous to each tag sequence is also provided, and wherein the signals from each probe is monitored to determine the occurrence or progress of

amplification of each target.

10. A method according to claim 9 wherein each probe is differently labelled and can produce distinguishable signals.

11. A method according to claim 9 wherein each probe is similarly labelled has a different melting point, and wherein the occurrence or progress each amplification reactions is determined using a melting point analysis.

12. A method according to any one of claims 9 to 11 for use in genetic analysis .

13. A method according to any one of the preceding claims wherein the amplification reaction is a polymerase chain reaction .

14. A kit comprising a primer which binds a target sequence and is provided with a tag sequence which does not bind the target sequence at the 5' end thereof, a probe which is

substantially homologous to said tag sequence of said primer and which is resistant to polymerase-mediated extension of the 3' end during the amplification reaction, and a labelling system which is able to produce a detectable signal when the probe hybridises to a complementary strand.

15. A kit according to claim 14 wherein where the probe has a self-complementary region allowing it to form a 'hairpin' structure and the labelling system comprises a pair of

interacting labels, arranged to be brought into close proximity so that interaction occurs, when the probe is in the hairpin configuration .

16. A kit according to claim 14 wherein the probe carries one or more labels whose signal is modified when the probe is bound to a complementary strand.

17. A kit according to any one of claims 14 to 16 which further comprises an excess of a reverse primer which binds to a complementary strand of the target sequence.

18. A kit according to any one of the claims 14 to 17 which comprises more than one primers, each with a different tag sequences, and a probe that is substantially homologous to each tag sequence.