WO2015155035A1 - Method for identifying and mapping the epitopes targeted by an antibody response - Google Patents

Abstract

The present invention relates to the identification and mapping of antigenic epitopes for vaccine design and analysis of antibodies present in body fluids (e.g. serum, saliva, urine and other secretions). In particular, it relates to a method for obtaining an epitope profile of an antibody response to an antigen of interest present in an isolated biological sample. By combining the versatility of phage display with the power of next generation sequencing accurate information are obtained on the epitopes targeted by antibodies, said information being particularly useful for vaccine design, evaluation of antibody response in an immunized subject and diagnosis of infections or other diseases.

Description

METHOD FOR IDENTIFYING AND MAPPING THE EPITOPES

TARGETED BY AN ANTIBODY RESPONSE

FIELD OF THE INVENTION

The present invention relates to the identification and mapping of antigenic epitopes for vaccine design and analysis of antibodies present in body fluids (e.g. serum, saliva, urine and other secretions).

BACKGROUND OF THE INVENTION

Measuring the total concentration of antigen-specific serum antibodies is a fundamental step in the diagnosis of infectious and autoimmune diseases and is used to monitor the efficacy of vaccination, which is the most powerful tool to preserve human health and to reduce the costs of medical care.

However, a purely quantitative analysis of serum antibodies is a poor indicator of the complexity of the antibody response, which involves the activation of thousands of different B cell clones and the secretion of a wide variety of antibodies, each directed against a different region of the immunizing antigen(s) (1 ).

For reasons that are only partially understood, the antibodies induced by any immunizing antigen are not equally directed against the various portions of the antigen molecule (2). Often, within an antigen, there are regions that are strongly reactive with antibodies (i.e. immunodominant regions) flanked by domains that seem to be partially or completely ignored by the immune system. Anti-microbial vaccination induces the production of a great variety of antigen-specific antibodies, only a minority of which possesses the ability to protect against target infections (2, 3). Only certain antibodies - those directed against specific "hot spots" of the antigen molecule - have immunoprotective activities. Therefore, pathogens adopt sometimes the strategy of incorporating, in the context of their virulence factors, immunodominant regions that function as "decoys" by preventing the immune system from targeting the "hot spots" (3). In such a scenario, selective removal of the immunodominant regions can boost the immunoprotective properties of the antigen (4). Also in this case, for an efficient selective removal of some parts of the antigen in order to improve its immunogenic properties, information are needed on the specific regions targeted or not-targeted by the elicited immune response.

In view of these considerations there is a need for establishing whether the immune response is optimally targeted against the antigenic residues crucial for immune-mediated protection. This would be particularly helpful for the design of new vaccines and for monitoring the antibody response in the course of preclinical studies and clinical trials involving vaccines.

In particular, there is the need of techniques able of providing a detailed analysis of the fine specificity of vaccine-induced antibody repertoires, more in particular techniques able of identifying the antigenic epitopes targeted by polyclonal antibody responses during deliberate or natural immunization. This would be useful, for example, to guide rational antigen design and develop "epitope-based" vaccines.

Since the ability of certain adjuvants to broaden the antibody repertoire and to provide extended coverage is becoming increasingly clear (5,6), the identification of the targeted epitopes would be also useful for the selection of the most appropriate adjuvants.

Moreover, because the spectrum of antibody specificities varies with age and physiology, repertoire profiles may be useful to specifically tailor vaccine formulations for different age groups and for high-risk populations (7-9).

Epitope characterization is also important in the context of drug design (23).

The most frequently used method involves scanning with overlapping, chemically synthesized peptides to map the linear epitopes of an antigen (24). A limitation of this technique is its relative inability to detect conformational epitopes, which represent more than 90% of B cell epitopes (25, 26).

More informative approaches for epitope characterization involve mutagenesis of antigen residues (e.g. by alanine scanning) or determination of three-dimensional structure of the binding complex (e.g. by X-ray crystallography or NMR), but such procedures are costly, time-consuming, not always successful and often only practically applicable to monoclonal antibodies.

The recent development of high-throughput methods for repertoire data collection - from single cell mass spectroscopy and multicolor flow cytometry to massively parallel sequencing of immunoglobulin transcripts - offers an opportunity to analyze large samples of lymphocyte repertoires (10-12).

Although these methods provide extensive information regarding the diversity of clonotypes and immunoglobulin gene usage they have limited usefulness, by their nature in sampling the antibody repertoire in terms of epitope specificity. Indeed, this kind of methods provide many information on the nucleotide sequences of the involved antibodies but they are not useful in inferring their epitope specificity and reactivity (i.e. which antigen or epitope they bind and with which binding avidity).

Libraries of peptides displayed on the surface of phages or unicellular organisms are a more efficient alternative and have been traditionally used for epitope mapping (13-16). Such libraries, which might comprise overlapping fragments of the antigen or totally random peptides, are subjected to repeated rounds of antibody-mediated selection followed by immunoscreening and/or sequencing of selected clones. The techniques involved in such analysis are, however, labor-intensive, time consuming and can identify only a limited number of epitopes. In fact, the entire process is laborious, requires at least few weeks to be completed and is limited to examination of a few hundred phage clones. Furthermore, most of the recognized epitopes are linear. Some conformational epitopes can be mimicked by peptides (conformational mimotopes), their identification, however, is complex and relies on sophisticated softwares (see below). In summary, epitope identification (both linear and conformational) with these known methods is limited.

Moreover, the results are usually not very accurate especially if carried out on a random peptides library, which is known to provide many false positive hits. Propagation advantage of irrelevant phage clones is as an important source of these false positive hits (37).

For epitope mapping, computational algorithms have been developed, such as Mapitope, which has recently been found to be effective in mapping conformational discontinuous epitopes (35). Mapitope is a computer algorithm for epitope mapping; the algorithm input is a set of affinity isolated peptides obtained by screening phage display peptide-libraries with the antibody of interest and the output is usually 1-3 epitope candidates on the surface of the atomic structure of the antigen. The algorithm works identifying the most statistically significant amino acid pairs within the panel of affinity selected peptides and then mapping them on the surface of the atomic structure of the antigen. This algorithm has been shown to be particularly effective for the prediction of discontinuous conformational epitopes.

EP2478373 describes a method for determining antibody binding affinity to an allergen by incubating an antibody-containing sample from a subject with a peptide library including antigen epitopes. Epitope diversity and binding affinity is determined by microarray immunoassays. In particular, methods for specific characterization of IgE and lgG4 are provided.

A method for mapping epitopes is also disclosed in US2006205089, said method involving contacting a solid support comprising an antibody capable of binding to the target protein with a library of random peptides, determining the amino acid sequence of the selected peptides, computationally aligning the peptide sequences to the target protein, and constructing a surface epitope of the target protein.

WO2013136095 describes a method for identifying and characterizing a member of a peptide library that interacts with a target molecule in situ. The method comprises immobilizing the nucleic acids of the peptide library on a solid support, sequencing them, expressing them to produce the peptide library, contacting the peptides with the target molecule and identifying the peptide which interact with the target molecule by its sequence.

WO2013177214 describes an immunogenic composition obtained in silico by generating a library of potential antigens and then expressing and biochemically testing them. A computation-guided library comprising a plurality of antigen variants, each antigen variant comprising a conserved target epitope region, is created to generate an immunogenic composition. The compositions may be used for the generation of specific antibodies to a single epitope.

US20130149336 describes a method aiming at the identification of the epitopes recognized by antibodies produced in response to antigen exposure. The method involves the screening of a library of peptides expressed on the surface of virus-like particles (VLP) through an affinity selection using monoclonal or polyclonal antibodies; the selected VLPs are then sequenced through deep sequence analysis to identify the recognized peptides. Said VLPs can directly be used as immunogens or as reagents to detect the presence of specific antibody responses. The peptide display and affinity selection platform disclosed are based on a virus-like particle derived from RNA bacteriophage MS2. The antigen fragment library is constructed using oligonucleotides designed by virtually dividing the virus proteome in overlapping fragments of 10 amino acids. For this reason, it is difficult to recognize non linear epitopes using this kind of starting library wherein only short fragments are represented. Therefore this method has the same limitations of conventional scanning with overlapping synthesized peptides and is unsuitable to detect the vast majority of epitopes, which are conformational.

In view of the above, the prior art provides for methods for identifying epitopes targeted by an antibody response. In some cases, a phage-display library is used and affinity-selected peptides are sequenced and analyzed.

However, none of these methods provide an accurate evaluation of the targeted epitopes, in particular because they mainly identify linear epitopes, which are a small minority of total epitopes, and also because they generally do not provide a fine characterization of the starting library. Furthermore, most of the known methods for the evaluation of antibody response in a subject can not be applied to specific serological analysis of immunized patients, since they only provide quantitative information on the presence of an antibody response, and not qualitative information, which in many cases are much more useful (for example for a complete and accurate evaluation of antibody responses beyond the determination of antibody titers which are only quantitative), and/or they take too long to be performed.

In view of the above, there is still the need of a rapid, accurate and efficient method for identifying and mapping the antigenic epitopes targeted by an antibody response. In particular, there is a need of a method of this kind, which can be performed in a sample from an immunized subject in a time-frame comparable with the traditional serological techniques but providing more accurate qualitative information. This means information not only on the amount of antibodies present in the sample but also on the quality and kind of antibody response (which epitopes they bind, which regions are more or less targeted, etc.).

Matochko et al. (36) and Hoen et al. (37) disclose the use of a method of next generation sequencing (lllumina^®) for the analysis of phage-display libraries. These works show the utility of next generation sequencing, in particular lllumina^®, in characterizing the library and following the enrichment process (i.e. the enrichment of the library after one or more selection rounds for high-affinity binders). The method is herein used only on phage-display libraries of random peptides, commercially available, and the works only relate to the analysis and characterization of said libraries and to the identification of peptides with high binding affinity with osteoblast cells (Hoen). They do not relate in any way to the identification or analysis of epitopes.

It is to be noted that the use of libraries of random peptides do not provide good results in the identification of targeted epitopes since they can only provide direct information on the targeted linear epitopes; hints on conformational epitopes can sometimes be obtained using random peptide libraries by the identification of "conformational mimotopes", but such information is only indirect, requires complex software tools and, most importantly, results are unpredictable. Moreover, the use of random peptide libraries in epitope mapping is, in practice, limited to the analysis of monoclonal antibodies. Results obtained after selection with polyclonal antibodies are extremely complex and difficult to interpret, therefore they would not be of any practical use for serological analysis, wherein a polyclonal response is present and clear-cut information on antigen-specific antibody responses are required.

SUMMARY OF THE INVENTION It has surprisingly been found by the inventors of the present invention that by combining the versatility of phage display with the power of next generation sequencing it is possible to obtain, in a time frame close to that of traditional serological techniques, precise qualitative information on the regions of the antigen molecule (epitopes) that are targeted by a serum antibody response.

In particular, it has been found that by performing a massive sequencing using the next generation sequencing technology on a phage-displayed antigen-specific library both before and after an affinity selection by serum antibodies, accurate information are obtained on the epitopes targeted by said antibodies, said information being particularly useful for vaccine design, evaluation of antibody response in an immunized subject and diagnosis of infections or other diseases.

More in particular, the combination of the well-known technique of phage-display with massive sequencing technology applied on an antigen-specific library allows for the screening of fragments of many different lengths and for the identification of both linear and conformational epitopes, thus obtaining an high resolution "epitope profile" for the tested sample. Moreover, sequencing of thousands of fragments, i.e of the entire population of selected fragments, provides unprecedented resolution in epitope profiling. It should be noted that the traditional colony picking technique followed by sequencing of individual clones only allows analysis of dozens of selected clones and the corresponding fragments.

An analysis performed with the new method of the invention can be performed in 1 -2 days, a very short time when compared to the weeks needed with the traditional methods.

It is an object of the present invention a method for identifying the epitopes of an antigen targeted by an antibody response comprising the following steps:

a) providing a phage-displayed library of nucleotide fragments of a sequence encoding for said antigen;

b) amplifying said fragments from the library;

c) sequencing said fragments by means of a next generation sequencing method;

d) conducting at least one round of affinity selection using an isolated animal sample on the library provided in step a);

e) repeating steps b) and c) on the fragments of the phages selected in step d);

f) comparing the output of step c) with the output of step e) thus obtaining an epitope profile of the antibody response to said antigen present in said isolated sample. In an alternative embodiment, the method can also be performed on a library of random peptides.

Therefore, it is also an object of the present invention a method for identifying the epitopes of an antigen targeted by an antibody response comprising the following steps:

a) providing a phage-displayed library of nucleotide fragments of sequences encoding for random peptides;

b) amplifying said fragments from the library;

c) sequencing said fragments by means of a next generation sequencing method;

d) conducting at least one round of affinity selection using an isolated animal sample on the library provided in step a);

e) repeating steps b) and c) on the fragments of the phages selected in step d);

f) comparing the output of step c) with the output of step e) thus obtaining an epitope profile of the antibody response to said antigen present in said isolated sample.

In a preferred embodiment, in step d) said isolated sample is from a subject who has been previously immunized with said antigen so that an antibody response toward said antigen is detectable.

The method of the invention allows the identification and mapping of the epitopes of an antigen, which are targeted by the antibody response elicited in a subject after immunization with said antigen.

The epitope profiles obtained with the method of the invention are particularly useful for the design of improved vaccines specifically and effectively targeting the protective antigenic epitopes (the "hot spots") and for the manufacture of more effective vaccine formulations.

It is therefore an object of the invention a method for designing a vaccine against an antigen comprising the use of an epitope profile for said antigen obtained with the method above described.

The method of the invention provides qualitative information on the antibody response, if any, elicited in said subject after immunization with an antigen of interest by identifying the region of the antigen (i.e. the epitopes) targeted by the antibodies which may be present in the serum of said subject. In case of a vaccination treatment, this method allows to monitor the course of the vaccination and to specifically tailor the treatment according to the response.

It is therefore a further object of the present invention a method for monitoring the course of a vaccination treatment against an antigen in a subject comprising the use of an epitope profile for said antigen obtained performing the method above described in an isolated sample from said subject.

In a preferred embodiment, the isolated sample is a serum sample.

In an alternative embodiment, said sample is from a subject who is suspect of being infected with said antigen.

In this embodiment, the method allows for identifying if the isolated sample, for example serum, from said subject contains antibodies directed towards the antigen of interest.

This allows, firstly, to identify if the subject is immunized or not toward a specific disease. Also, it allows to diagnose if the subject is affected by a particular disease, in particular infectious or tumor diseases, by identifying if an antibody response toward said disease is present. In particular, it allows to specifically determine and evaluate said antibody response by identifying to which parts of the antigen related to the disease the antibody response is directed. This kind of accurate qualitative information, which could not in any way be obtained with traditional methods, which only provides quantitative information, allows for a more accurate diagnosing of the disease and/or for the identification of the most appropriate treatment.

It is therefore a further object of the invention a method for evaluating an antibody response to an antigen in an isolated animal sample comprising the use of an epitope profile obtained with the method above described.

It is also an object of the invention a method for identifying if a subject is immunized toward an antigen comprising the use of an epitope profile obtained performing the method above described on an isolated sample from said subject.

It is also an object of the invention an in vitro method for diagnosing a disease related to an antigen of interest comprising the steps of:

a) providing a phage-displayed library of nucleotide fragments of a sequence encoding for said antigen of interest;

b) amplifying said fragments from the library;

c) sequencing said fragments by means of a next generation sequencing method; d) conducting at least one round of affinity selection using an isolated sample from a subject on the library provided in step a);

e) repeating steps b) and c) on the fragments of the phages selected in step d); f) comparing the output of step c) with the output of step e) thus obtaining an epitope profile of the antibody response to said antigen present in said isolated sample;

g) attributing the obtained epitope profile to the presence of a disease related to said antigen of interest.

It is of particular interest the application of the method of the invention in the qualitative serological analysis of antibody titers.

A method for the serological analysis of antibody titers comprising the use of an epitope profile obtained with the method above described is also an object of the invention.

DESCRIPTION OF THE INVENTION

Definitions

Within the meaning of the present invention, "antibody response" means the response elicited in a subject by an antigen, which involves the activation of the whole immune system of the subject. The antibody response is the result of many different activities and responses from different cells of the immune system. In particular, it comprises the proliferation and differentiation of thousands of different B cell clones, which secrete large quantities of finely tuned antibodies.

Within the meaning of the present invention, "epitope" means the region of an antigen that interacts with an antibody. The strength of the binding between an epitope and an antigen may vary according to the overall stability of the complex.

Within the meaning of the present invention, an "epitope profile" means a profile of all the epitopes targeted by an antibody response.

Within the meaning of the present invention, "epitope mapping" means the process of identifying the binding sites (i.e. the epitopes) of antibodies on their target antigens.

Within the meaning of the present invention, the term "next generation sequencing" means massive parallel sequencing providing a sequence output much higher than that of traditional sequencing (e.g. traditional Sanger sequencing). This term is also often defined as "deep sequencing" or "second-generation sequencing" (38, 39). Within the meaning of the present invention, "subject" is an animal, in particular human, being.

Within the meaning of the present invention, "isolated sample" is a biological sample from an animal subject, in particular human being, which was previously withdrawn. Withdrawal of the sample is not part of the method of the present invention and any direct carrying out of the method of the present invention is herein disclaimed.

Other terms used in the present invention, such as "phage-displayed library", "antigen", "amplification", "sequencing", "affinity selection", and other terms are technical terms, which are fully understood by the person of ordinary experience in the art and are part of the common general knowledge.

Figures

Figure 1. Abundance of NadA fragments in the library. Each point represents the number of unique fragments (vertical axis) displaying the number of copies indicated in the horizontal axis.

Figure 2. NadA fragment length distribution in the unselected library.

Figure 3. Cumulative aminoacid occurrences in NadA protein fragments in the unselected library. Occurrences are shown along the entire NadA sequence.

Figure 4. Changes in NadA library composition after selection with a serum pool from mice immunized with recombinant NadA. Enrichment of phage clones predicted to display authentic NadA fragments on their surface after the first and the second rounds of selection with an immune murine serum pool is shown. The graph shows the occurrence, in terms of cumulative aminoacid positions along the NadA sequence, of NadA fragments recovered after each round of selection.

Figure 5. Changes in NadA library composition after selection with a serum pool from volunteers immunized with the Bexero vaccine. A: enrichment of phage clones predicted to display authentic NadA fragments on their surface after the first and the second rounds of selection. The graph show the occurrence, in terms of cumulative aminoacid positions along the NadA sequence, of NadA fragments recovered after each round of selection. B and C: length distribution of NadA fragments after 1 and 2 rounds of selection, respectively. D and E: enrichment factor of NadA fragments after 1 and 2 rounds of selection, respectively. Fragments above and below the horizontal line starting from zero (vertical axis) are those enriched and depleted, respectively, by the selection process. F and G: enrichment of cumulative aminoacid positions in NadA fragments obtained after 1 and 2 rounds of selection, respectively. These graphs were built from the same data shown in Figures 5D and 5E, respectively. Aminoacid positions above and below the horizontal line are those enriched and depleted, respectively, by the selection process.

Figure 6. Occurrence of cumulative aminoacid positions in NadA fragments obtained after 2 rounds of selection, as determined by traditional random picking of 48 plaques.

DETAILED DESCRIPTION OF THE INVENTION

The inventors of the present invention have found a novel approach based on the combined use of phage-displayed antigen-specific libraries and massively parallel sequencing of both the original library and the entire population of affinity-selected phages.

The use of a deep sequencing method allows for the obtention of sequencing data in a very short time; the performing of the method both before and after the affinity selection allows for the obtainment of a very accurate result which would not otherwise be obtained if the sequencing were performed only on the selected phages, as will be better explained hereafter.

The method of the invention is also named by the present inventors Ig-PROFILER (standing for Immunoglobulin Phage-based Representation OF ImmunoLigand Epitope Repertoire).

It generates in a short time a high-resolution epitope profile of antigen-specific antibody repertoires.

This method merges the efficiency of antigen-specific phage display with the power of next generation sequencing, providing a highly streamlined approach for epitope mapping of both monoclonal and polyclonal antibodies. In combination with a software for data analysis, it provides a detailed map of epitope-bearing antigen fragments recognized by many individual serum samples in a few day frame.

One of the main advantages of the method of the invention is to provide a unique profile of the subject with respect to its antibody response to that particular antigen. This profile can be a source of many information, as, for example, the identification of a particular pathology in a subject and the evaluation of its specific immunological response to that pathology.

With the method of the invention both short and long peptides and polypeptides (of more than 3000 amino acids) can be screened thus allowing the identification of both linear and conformational (non-linear) epitopes.

The method of the invention is also particularly useful for the analysis of polyclonal sera, i.e. sera in which a polyclonal response is present, since said response can be detected only if an antigen-specific library is used and conformational epitopes are represented. In the first step (a) of the method a phage-displayed library of nucleotide fragments of a sequence encoding for the antigen of interest (antigen-specific library) is generated, in which individual phage particles display on their surface fragments of the antigen of various lengths.

The use of an antigen-specific library instead of a random peptides library has the advantage of providing information also on non-linear epitopes, while a random peptides library mainly detect only linear epitopes.

However, the method of the invention can be applied also on a random peptides library, in particular to obtain accurate information on linear epitopes. Therefore, it is also an object of the invention a method, as already above described, for obtaining an epitope profile of an antibody response wherein the starting library is a random peptides library. This mainly allows to obtain information on linear epitopes targeted by an antibody response. A random peptide library can be obtained by methods known in the art. See for example Liu, R., A.M. Enstrom, and K.S. Lam, Combinatorial peptide library methods for immunobiology research. Exp Hematol, 2003. 31 (1 ): p. 1 1-30.

In an embodiment of the invention, the antigen is from a pathogen such as a virus, a bacterium, a parasite, or a microbe. For example, the pathogen can be selected from the group consisting of dengue virus; yellow fever virus; West Nile virus; Japanese encephalitis virus; HIV; HTLV-I, Bunyaviridae viruses including the hantaviruses, Crimean-Congo hemorrhagic fever, Rift Valley fever virus, and severe fever and thrombocytopenia virus; arenaviruses including all agents of South American hemorrhagic fever, Lassa virus and lymphocytic choriomeningitis virus; filoviruses including Ebola and Marburg viruses; paramyxoviruses including morbilliviruses, henipaviruses, respiroviruses including RSV and metapneumovirus and rubellaviruses; Alphaviruses including Chikungunya, O'nyung-nyung, Semliki Forest, Ross River, Sindbis, eastern, western and Venezuelan equine encephalitis; picornaviruses; papillomaviruses including HPV; herpesviruses including HSV-1/2, EBV, CMV, HHV-6, 7, and 8; polyomaviruses including SV 40, JC and BK viruses; poxviruses including variola and vaccinia viruses; bacterial pathogens including any human pathogen such as Staphylococcus spp; Streptococcus spp; Burkholderia spp., Mycobacterium s.p.p., Neisseria s.p.p., Salmonella s.p.p., Bacillus anthracis, Clamydia s.p.p. mycoplasma, E. coli, and other pathogenic coliforms; parasitic pathogens including malaria (Plasmodium spp ) and toxoplasma (Toxoplasma s.p.p.); and pathogenic fungi (including Candida s.p.p., Aspergillus s.p.p. , Cryptococcus neoformans and other yeasts and filamentous fungi) In another embodiment, the antigen is an allergen or an antigen which produces an autoantibody response or a response to a foreign protein or carbohydrate antigen, an autoimmune antigen, an allogeneic protein or allergen.

The antigen can also be a tumor antigen, for example an antigen for breast, liver, pancreas, colorectal, lung, thyroid or prostate cancer.

A phage-displayed library can be generated starting from the gene of the antigen of interest, from genomes, from transcriptomes (after copying mRNA into cDNA), or from synthetic DNA with or without previous enzymatic or physical fragmentation, according to the methods known in the art (40, 41 ).

In an exemplary embodiment, the phage-displayed library is obtained as following.

The gene of the antigen is amplified, for example from an expression plasmid containing a fragment encompassing the whole length of the antigen, using a forward and a reverse primer by a PCR (Polymerase Chain Reaction), as known in the art. The amplified fragment is then purified and digested with a DNase. The fragments are thus separated through agarose gels and each obtained band is cloned in a vector.

Antigen fragments are thus obtained randomly by digestion of the antigen gene. Therefore, fragments of many different lengths are obtained.

In a preferred embodiment, the vector is a lambda vector.

The library is then packaged, generating a number of independent phage clones. The number of independent clones is a measure of the diversity of the library and is related to the percentage of recombinant clones obtained after cloning.

In step b) the phage inserts are amplified in order to obtain a higher number of copies of each fragment. Amplification may be made by common PCR methods (42). One or more amplification rounds can be carried out.

The amplified fragments are subsequently sequenced (step c). Sequencing is performed by a method of next generation sequencing (also known as massively parallel sequencing or deep sequencing) which allows the simultaneous determination of an high number of sequences. Different technologies are commercially available for performing next generation sequencing (NGS). For example, suitable NGS methods are: 454 sequencing, lllumina sequencing, SOLiD™ sequencing, Polonator sequencing, Ion Torrent sequencing, nanopore sequencing and HeliScope Single Molecule sequencing.

A preferred technology for NGS is the lllumina Inc. sequencing. Preferably, a high-diversity library is included within the original antigen-specific library, in order to increase library diversity and allow a better sequencing. For example, the genomic PhiX library, sold by lllumina Inc, may be used.

In a preferred embodiment, both the amplification and the sequencing steps are performed using the lllumina technology. In this case, during the amplification step specific subsequences, called adaptors and required for the subsequent step of sequencing, are added to the nucleotide fragments according to lllumina's instructions. Preferably two PCR are performed before sequencing.

Preferably, sequencing is performed using the commercially available MiSeq kit (lllumina Inc.).

Preferably, sequencing is performed using a paired-end sequencing method, in which both ends of a nucleotide fragment are simultaneously sequenced. This allows for a more rapid sequencing and is particularly useful in the case of long fragments.

Preferably, a multiplexing technique is used so that different samples can be sequenced during the same run, thus allowing a rapid and simultaneous analysis of many combinations sample/library. To perform multiplexing, typically, specific sequences (barcodes or indexes) are added during an amplification step using specific PCR primers.

For example, the commercially available MiSeq kit provides for both paired-end sequencing and multiplexing.

The selection step (d) is carried out using an isolated sample of an animal subject.

The biological sample can be a serum sample or a sample of urine or saliva or any other biological fluid. Preferably, it is a serum sample.

Preferably said animal subject is a human subject.

In an embodiment, it is a sample wherein an antibody response toward the antigen of interest was elicited.

In a preferred embodiment, the sample, preferably the serum sample, is from a subject who has been previously immunized with the antigen in question. For example, it can be from a subject who has been vaccinated against a specific antigen. The antibody response triggered in the subject comprises antibodies present in the serum which bind to one or more peptides expressed on the surface of the phages of the antigen-specific phage-display library previously built in step a).

The subject is an animal or human subject. In an another embodiment, the sample is from a subject who is suspected of being infected by a particular disease.

For example, the sample can be from a subject who is suspected to have or having had an infective, autoimmune or tumor disease.

With regard to this particular embodiment, the method allows to obtain information about the presence of an antibody response in the sample and, in particular, to qualitatively evaluate such antibody response.

Traditional methods cannot always detect the presence of an antibody response or do not provide sufficient data. The method of the invention instead allows to obtain many information on the presence of an antibody response. For example, it can be particularly useful in the context of measuring antibody titers, for example anti-Streptococcus titers.

One or more round of selection affinity can be performed.

Methods for carrying out affinity selection are known and described in the literature. See for example the work of Minenkova et al. (20).

The selected phages are then recovered.

Preferably, solid supports, such as beads, are used to recover the selected phages.

In a preferred embodiment, said solid supports are coated with protein G, which bind to Immunoglobulin G (IgG) antibodies present on the surface of selected phages.

In an alternative embodiment, said solid supports are coated with anti-lgE antibodies, which bind to Immunoglobulin E (IgE) antibodies present on the surface of selected phages. This embodiment is preferred when one wants to study an antibody response to an allergen, since IgE usually play an essential role in allergic diseases.

In an alternative embodiment, said solid supports are coated with Immunoglobulin A (IgA)- binding proteins, as for example Lectin Jacalin or peptide M-lnvivogen, which bind to IgA class antibodies.

The recovered selected phages are then purified and their inserts are amplified and sequenced as above described for step b) and c).

The data (output) obtained by the sequencing of the phage inserts before and after the affinity selection are analyzed and compared (step f).

Preferably said analysis is performed by a software able to process the data generated by the sequencing. Suitable software tools are commercially available.

An example of a suitable software is BWA (Burrows-Wheeler Aligner), see the work of Li H. and Durbin R. (2009) (44).

Another suitable software is FastQC (see website: http://www.bioinformatics.babraham.ac.uk/proiects/fastgc/), which is a tool for analyzing and controlling high throughput sequence data.

After sequencing of the original antigen-specific library, a list of unique insert sequences is generated, which are first subdivided according the presence/absence of heterologous fragments (i.e. of sequences not belonging to the vector or to the adapters used to construct the library). From all the sequences containing heterologous fragments, then those fulfilling the requirements (e.g. presence of a start codon, proper orientation and frame of vector/adaptor/insert/adaptor sequences) for expression of fragments of the chosen gene as fusions to a phage coat protein are extracted. Next, deduced amino acid sequences are divided into "in frame" and "out of frame" categories relative to the authentic reading frame of the heterologous gene used to construct the library. Finally, lists of "in frame" amino acid sequences are analyzed and aligned along the entire length of the protein.

The sequencing of the entire antigen-specific library and the subsequent analysis of the data allow to obtain information about the quality of the library. In particular, data regarding the number of copies of each fragment, the frequency of the "in frame" sequences on the total, the length of fragments and the number of unique sequences are important for defining the quality of the library. More in particular, it allows to know if the generated library is a high- diversity library, which is a preferred requirement for the obtention of better and more accurate results.

The use of traditional methods for assessing the quality of library involves the testing or the sequencing of only few clones thus providing poor and less reliable information. Instead, sequencing of the whole library allows to obtain many useful information necessary for the obtainment of an accurate result.

The analysis of the data obtained after affinity selection allows to specifically identify which fragments have been retained after the selection and to which part of the protein they correspond, thus allowing the identification of the epitopes of the antigen targeted by the antibody response present in the tested sample.

The main information obtained by the analysis and comparison of the data relate to: - the ratio between the frequency of a particular unique sequence before and after affinity selection of the library (also called "enrichment factor");

- The length of each fragment and possible deviations from the expected length;

- The number of copies of clones for each unique sequence, which is an indication of the diversity of the library;

- The amino acid occurrence, as explained below.

In particular, the comparison of step f) allows to "normalize" the data obtained after affinity selection with data obtained for the entire original phage-display library.

For example, if a fragment is highly represented after selection, the comparison with the frequency of said fragment in the original library allows to understand if its high representation is due to retention after selection, i.e. it is truly targeted by the antibody response, or to its high representation in the original library, due for example to bias in the construction of the library.

The "normalization" is also made by comparing the amino acid occurrence in a certain position of the protein before and after the selection. The occurrence of a specific amino acid in a certain position of the gene in a phage-display library should preferably be similar for each position, thus meaning that each fragment of the antigen is equally represented in the library. However, this is not often the case, since due to alterations in the generation of the library some fragments may be more represented than others, thus resulting in different amino acid occurrences. Comparing the amino acid occurrence in a certain position before and after selection allows to normalize the amino acid occurrence obtained after selection with respect to the one originally present in the library, thus allowing to identify if the increase of amino acid occurrence in a certain position is actually due to a retention of that specific fragment after selection or to an higher representation of the amino acid (and thus of the fragment) in the original library.

In view of the above, it is clear that performing the sequencing and the analysis of the obtained data before and after the affinity selection allows the obtainment of more accurate and precise results respect to the method known in the art and, in particular, allows for an higher resolution in the identification of the regions targeted by the antibody response.

Also, the use of methods of massive sequencing allows to obtain the data in a shorter time than with traditional sequencing methods. In particular, they allow to sequence in a short time not only the selected phages but also the entire phage population of the library thus allowing the performing of the above comparison and the obtainment of the high-resolution epitope profile. This short time allows to obtain results in a time-frame comparable to the traditional serological techniques.

The method of the invention can be used to map both discontinuous epitopes, which can be retained only in long fragments and cannot usually be mapped with methods known in the art, and linear ones, which can be precisely mapped using shorter inserts.

In addition, the method is able to process several hundred thousands, as opposed to few hundred, sequences resulting in unprecedented resolution in epitope identification compared to the traditional method. Direct comparison with the latter indicated that the majority of the clones enriched by affinity selection rounds would have been lost by traditional analysis of few hundred clones (for example with the Sanger method).

The method of the invention is also able to isolate weak epitopes from more dominant ones and to rank antigenic fragments for their immunoreactivity, i.e. to rank them for their ability to react with the antibody in question.

The ability of the method to sequence in its entirety the unselected library also allows the identification of the antigen fragments that are commonly rapidly lost during the affinity selection process. These apparently non-immunodominant protein regions are of particular interest as vaccine components, as indicated by recent evidence obtained with streptococcal antigens (4, 18, 27). The potential importance of such non-immunodominant regions is also exemplified by the discovery of protective HIV epitopes that are poorly immunogenic in the context of the native envelope glycoproteins (28). Based on this information, targeted amino acid substitutions are successful in "opening" and stabilizing a protective, non- immunodominant epitope (29-32). Moreover, it is possible to block antibody binding to undesired epitopes functioning as decoys to divert antibodies responses away from neutralizing epitopes (33, 34).

The method of the invention can therefore be used to guide and streamline rational antigen design. For instance, identification with the method of the invention of the epitopes recognized (or ignored) by immune sera in comparison with those bound by protective and non-protective monoclonal antibodies can be used to rapidly establish whether the polyclonal response is missing potentially protective targets.

The method can also be used to quickly screen the responses generated by a variety of mutated antigens and to select, thereby, the most promising candidates. In addition, a variety of adjuvants can be rapidly tested to select the ones capable of re-directing the polyclonal response towards the desired epitopes or of broadening the response for increased coverage against multiple variants of the antigen. The method is also suited to monitor the antibody repertoire of individuals in response to disease-associated antigens and to guide the rational design of drugs or vaccine candidates through epitope mapping.

The method of the invention can therefore be used in the context of vaccination-induced antibody responses, but also in other fields of traditional serology, including the diagnosis of infectious, autoimmune and neoplastic diseases. In particular, it can be used for the serological analysis of polyclonal sera.

The method has been studied as a model antigen on NadA, one of the 4 components of the 4CMenB anti-meningococcal vaccine. We first generated a lambda phage displayed library in which individual phage particles display on their surface NadA fragments of various lengths followed by selection with sera from mice immunized with recombinant NadA and with sera from Bexsero-immunized volunteers and analysis on the lllumina MiSeq platform. The method of the invention allowed to identify immunoreactive epitope-bearing protein fragments and analyze the fine epitope repertoire of antibody responses. Both short aminoacid stretches and extended (up to 220 aminoacid long) epitope-bearing fragments could be identified.

The following examples will further illustrate the invention without limiting it.

EXAMPLES

Materials and Methods

Sera

Twenty-one serum samples from healthy volunteers vaccinated with the 4CMenB vaccine (Bexsero) in the course of a phase I clinical trial were provided by Novartis Vaccines and Diagnostics (NDV, Siena, Italy) (43). Samples were pooled together and used for the selection procedures using a library specific for NadA, one of the 3 recombinant proteins included in the vaccine components (see below).

Anti-NadA mouse immune sera were also used.

To obtain anti-NadA immune sera, CD1 mice (5 wk old) were immunized three times with 50 μg (total protein content) of recombinant NadA. The first immunization was in complete Freund's adjuvant, while the second and third (performed on days 14, and 28) were in Freund's incomplete adjuvant. Control animals received adjuvant only. Three weeks after the last immunization immune sera were collected. The immunization procedures were conducted at the animal facilities of the Metchnikoff Department of the University of Messina according to the European Union guidelines for the handling of laboratory animals and were approved by the relevant local (Comitato Etico per la Sperimentazione Animale) and national (Istituto Superiore di Sanita Permit Numbers: 121/2007 - B) authorities.

NadA library construction

In this study we used a lambda-displayed library containing fragments of the Neisseria meningitidis group B NadA gene. The gene was amplified from the expression plasmid used to produce the recombinant antigen (peT 21 b, kindly provided by NVD). This plasmid contains a fragment encompassing the whole length of the NadA gene with the exception of the portion encoding for the C terminal hydrophobic membrane anchor of NadA (17). To amplify NadA from the expression plasmid we used the primers 961 cL forward (AAACACTTTCCATCCAAAGTACTGACCAC [SEQ ID NO. 1]) and 961 cL reverse (ACCCACGTTGTAAGGTTGGAACAGAC [SEQ ID NO. 2]) that amplified a 1047 nucleotide- long fragment which was purified and Dnase digested as previously described (18,19). After excising a band with the approximate size of 300 bp from agarose gels, 30 ng of DNA were cloned in a lambda vector λΚηι4 (20). The display library was then packaged in vitro using the Gigapack III Gold Packaging Extract (Stratagen), generating approximately (6x10⁴) independent phage clones. For library screening randomly chosen clones were tested by PCR plaque screening (primers K47 GGGCACTCGACCGGAATTATCG [SEQ ID NO.3], K48 GTATGAGCCGGGTCACTGTTG [SEQ ID NO.4]). Cycling parameters were: 94°C-5min, (94°C-15sec, 55°C-15 sec, 72°C-30 sec), 72°C-1 min with VWR Taq DNA polymerase.

Sample preparation for lllumina MiSeq sequencing

In order to amplify the phage inserts and add the adaptors required for sequencing on lllumina Miseq, the unselected or selected libraries were first amplified in E. coli, and the lysates were subjected to polyethylene-glycol NaCI precipitation, as described (20,21 ). Purified suspensions corresponding to 10⁶ phage particles were added to a PCR mix containing the following primers:

≠293: TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCGATTAAATAAGG (SEQ ID NO.5) and

≠294: GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGTAATGGGTAAAG (SEQ ID NO.6).

The above primers contain subsequences (underlined) specific for invariant regions of the Km4 vector that are upstream and downstream respectively, of the inserts. The≠293 and ≠294 primers also include at their 5' ends lllumina adaptor subsequences required for a second amplification step. The first amplification involved initial denaturation (94°C for 5 min) followed by five cycles of denaturation (94°C for 30sec), annealing (30°C for 30 sec and 50°C for 2 min) and extension (72°C for 1 min) and fifteen cycles of denaturation (94°C for 30sec) annealing (60°C for 30sec) and extension (72°C for 1 min).

The PCR products were then purified using a Qiagen QIAquick kit (cat n° 28106) and the eluted DNA (50μΙ in ddH20) quantified using Quant-iT™ DNA Assay Kit (Life Technology: Q33130) and a microplate reader to measure fluorescence (Tecan Infinite® 200 PRO). Samples were stored at -20 °C until sequencing was performed.

Before sequencing, a second PCR step was performed (12 cycles) to add the adapters necessary for sequencing and barcodes (indexes) permitting multiplexing. This step was performed according to lllumina's instructions using the Nextera PCR master Mix kit. Briefly, 5 ng of purified DNA were added to different primers all of which contained adapters (P5 or P7) necessary for binding to the lllumina MiSeq flow cell and different combinations of 8 nucleotides to be used as indexes. Since sample analysis and quantification are crucial to seed the lllumina flow cell at the appropriate density, purity, concentration and length of PCR products were checked using a LabChip^® XT system (Caliper LifeSciences, Perkin Elmer). Next, equal volumes of normalized library were combined, diluted in hybridization buffer, and head-denatured prior to Miseq sequencing according to manufacturer's instructions.

Since our sequencing fragments are identical in the first 48/49 nucleotides and low library diversity does not allow proper matrix calculation by lllumina sequencers, it was necessary to also include (or "spike-in") a high-diversity library such as the genomic PhiX library (lllumina; FC-1 10-3001 ), which accounted for approximately 10% of total sequences. Sequencing was performed using the Miseq Nano kit, v2 paired ends 150bp-long reads (MS-103-1001 ).

Data expression and analysis

After obtaining sequence data from insert amplicons, each univocally definable or "unique" sequence was given the following two attributes: a) copy number; b) frequency, defined as the copy number of that particular sequence divided by the total number of sequences obtained. Unique sequences were grouped in the following three categories: a) "empty" i.e. lacking fragments of the antigen-encoding gene (or lacking nadA fragments, for the purpose of this study); b) "in frame", i.e. sequences bearing antigen gene (or nadA) fragments predicted by bioinformatics analysis to be expressed on the phage surface in the authentic frame of the antigen; c) "out of frame", i.e. sequences bearing nadA fragments, but not predicted to be expressed on the phage surface in the authentic frame (e.g. because of inappropriate position/orientation/reading frame of the nadA fragments). The change in frequency of a particular unique sequence after affinity of selection of the library was described as the "enrichment factor", defined as the ratio between the frequency after selection and the frequency before selection.

Affinity selection

Affinity selection of the library with human or mouse sera was performed as described previously (20). Briefly, magnetic beads linked to Protein G (Dynabeads Protein-G; Dynal) were incubated with library-serum mixtures for 1 h at RT under agitation and washed 10 times with 1 ml of washing solution (1 X PBS, 1 % Triton, 10 mM MgS0₄). The bound phage particles were recovered by infection of E. coli LE392 cells added directly to the beads. After a 20-minute incubation, 10 ml of molten NZY-top agar (48°C) was added to the mixture of infected cells and immediately poured onto NZY plates (15 cm). After overnight incubation, the phage particles were harvested by gentle agitation with 15 ml of SM buffer for 4 hours at 4°C. The phage particles were purified by PEG/NaCI precipitation and stored at 1/10 of the initial volume or used for subsequent selection rounds.

Example 1 - NadA library sequencing

Library sequencing

The gene-specific library that was used in this study is diversified in the phage inserts, each of which contains a fragment of the nadA gene. Since the sequence of this gene is known, the entire sequence of the inserts can be inferred from relatively short (150 bp) reads obtained at each end of insert-containing amplicons (i.e. by paired end sequencing with the lllumina MiSeq). As described in detail under Materials and Methods, purified phages obtained before or after selection with serum antibodies were subjected to a first PCR step to amplify all the variable inserts followed by a second PCR step to add the lllumina sequencing adaptors and the barcodes used for multiplexing. After quality control of the sequencing output and demultiplexing of the data, FASTQ raw files were generated by the MiSeq. We then generated a list of unique insert sequences, which were first subdivided according the presence/absence of heterologous fragments (i.e of sequences not belonging to the vector or to the adapters used to construct the library). From all the sequences containing heterologous fragments, we then extracted those fulfilling the requirements (e.g. presence of a start codon, proper orientation and frame of vector/adaptor/insert/adaptor sequences) for expression of fragments of the chosen gene (in our case nadA) as fusions to phage coat protein D. Next, deduced amino acid sequences were divided into "in frame" and "out of frame" categories relative to the authentic reading frame of the heterologous gene used to construct the library. Finally, lists of "in frame" aminoacid sequences were analyzed and aligned along the entire length of the protein. Characteristics of the library

By sequencing a few hundred clones by the Sanger method, only major defects in a library can be detected. Using the lllumina MiSeq, instead, we were able to cover the entire nadA- specific library, which has a theoretical diversity of 6x10⁴ (as determined by enumeration of independent clones by PFU counts and PCR analysis) and to assess, thereby, its quality in depth. After sequencing the library, we found that 4.8% percent of the sequences containing the nadA gene fulfilled the requirements to be expressed on the phage surface as authentic NadA fragments. This percentage is close to the expected 1/18 value, calculated as the probability that a gene fragment is randomly cloned in the natural frame.

A good antigen-specific library should contain a large diversity of fragments of the gene of interest, while marked overrepresentation of few unique sequences is an indicator of lower quality. Figure 1 describes the distribution of abundances of unique sequences encoding for NadA fragments in the library. No unique fragments were found in copy numbers of 21 or higher and 90% of sequences were found in copy numbers of <5. We were therefore unable to find major overrepresentation of specific antigen fragments. Length distribution of expressed authentic NadA fragments had a mean value of 85 aminoacid residues and ranged from 29 to 210 (Figure 2). Therefore, fragment length distribution corresponded to the expected values, taking into account that DNA fragments underwent size selection (100 to 300 bp) before cloning into the phage vector. As shown in Figure 3, these fragments covered the entire sequence of the protein with no major over or under representations of specific regions. In conclusion, the analysis of NGS data enabled an in-depth evaluation of the characteristics of the NadA library and demonstrated that its fundamental properties were in agreement with its design.

Example 2 - Enrichment of specific sequences after library selection using mouse sera During an antibody-mediated selection process, phages displaying antibody-specific antigenic fragments are expected to be progressively retained and enriched, while those containing antigen fragments not recognized by serum antibodies (or phages that don't express antigen fragments at all) decrease in number. Typically, using gene-specific libraries, the number of phage particles recovered in the output of the first selection round is 3 to 4 orders of magnitude lower than the particles in the original library. Thus, it is possible not only to cover entirely the sequences present in a phage population recovered after selection, but also to sequence at once dozens of such populations in a single MiSeq run by using bar code multiplexing.

To follow the process of antibody-mediated selection, the nadA library was mixed with a pool of sera obtained from mice immunized with recombinant NadA in the presence of Freund's adjuvant Figure 4 shows that during two rounds of selection with the immune serum pool. There was a progressive enrichment of sequences predicted, by bioinformatics analysis, to be expressed on the phage surface as NadA fragments, while unspecific phages (e.g. "out of frame" protein fragments or phages without inserts) were progressively lost. For example, in the output of the second round of selection with the immune serum pool, in frame sequences represented more than >50% of all sequences. These data suggested that phages bearing antigenic NadA fragments were being affinity selected by specific antibodies, and that the decrease in library diversity after selection was not due to increased amplification of irrelevant phage clones, such as for example those bearing sequences favoring replication in the bacterial host or those binding to inert surfaces or to serum components other than specific antibodies.

Example 3 - Identification of immunodominant regions targeted by human sera

Next, it was of interest to ascertain whether immunodominant regions in the antigen molecule could also be identified in human sera after immunization. To this end, two rounds of phage selection were performed on the nadA library using a pool of sera obtained from adults immunized with the 4CMenB Bexsero vaccine, which contains recombinant NadA as one of the antigens. For each selection, over 10⁵ sequences were obtained and analyzed. As observed with mouse sera, there was a marked enrichment of "in frame" sequences over "out of frame" ones and a drastic reduction in irrelevant phages (Figure 5A) and an increase in the average length of selected fragments (Figures 5B and 5C). Figures 5D and 5E show the enrichment factor of NadA fragments after 1 and 2 rounds of selection, respectively, with fragments above the black horizontal line starting from zero being enriched by the selection process, while figures 5F and 5G show the enrichment of cumulative aminoacid positions in NadA fragments obtained after 1 and 2 rounds of selection, respectively: selective enrichment of fragments belonging to certain regions of the protein molecule, with the position of the most enriched fragments along the NadA sequence shown in Fig. 5D and 5E, could be observed.

Immunodominance of regions encoded by sequences that were enriched during the selection process was formally confirmed by measuring the immune reactivity of recombinantly expressed fragments in ELISA and Western blot assays.

Elisa assay results indicated a good correlation between immunoreactivity of the phage clones tested and the enrichment of the corresponding inserts along the nadA gene (see Table 1 ), with the rank order of reactivity of the recombinant fragments closely following the heights of the peaks depicting cumulative aminoacid occurrence along the length of the protein after two rounds of selection. For example, as shown in Table 1 , the fragments encoded by the inserts from clones which shown a serum titer of 400 or higher all mapped to the area of the protein, shown in Fig. 5G, with enrichment factor values above 1 . In contrast, clones bearing fragments that lied outside of this area showed serum titer of 200 or lower.

Table 1 . Immunoreactivity of selected phage clones corresponding to different areas of the N. meningitidis NadA antigen

Interestingly, the immunodominance pattern observed with human sera resembled the one previously observed with mouse sera.

Example 4 - Comparison with the traditional method

Next it was of interest to compare the above-described technology based on massive library sequencing with traditional clone picking. To this end, we randomly picked 48 plaques from the output of the second round of selection with the immune human serum pool and sequenced them by the traditional Sanger method after PCR amplification. Much more time and labor was required to perform this analysis by the traditional method. For example, two weeks were required to analyze a single selection output, including the time and labor employed to interpret 48 sequences. In contrast the analysis of up to 96 outputs from different libraries/sera combinations (i.e. more than 10⁶ sequences in total) could be completed in less than two days by lllumina sequencing. When we compared the results of the two techniques, we noted that 1 1 of the 48 sequences identified by the traditional method would be derived from the most abundant phage populations, as identified by sequencing of the complete round 2 library (Table 1 ). Moreover, since these 1 1 sequences represented four clones only, six of the ten most abundant sequences were missed by the conventional approach. The increased resolution of the NSG method over the traditional one in terms of identification of immunodominant regions is evident when confronting Figure 6 with Figure 5G. For example, three separate immunodominant peaks could be detected in the amino terminal region of NadA by NGS analysis, while only one peak was discernable with traditional analysis.

References

1. Paige, C. J., G. E. Wu. 1989. The B cell repertoire. FASEB J. 3: 1818-1824

2. Holtappels, R. (2005). Dominating immune response. Immunodominance and its significance in immunity. B.I.F. Futura 20, 157-163.

3. Nara, P.L., and Garrity, R. (1998). Deceptive imprinting: A cosmopolitan strategy for complicating vaccination. Vaccine 16, 1780-1787.

4. Nonimmunodominant Regions Are Effective as Building Blocks in a Streptococcal Fusion Protein Vaccine, Margaretha Sta°lhammar-Carlemalm, Johan Waldemarsson, Eskil Johnsson, Thomas Areschoug and Gunnar Lindahl, Cell Host & Microbe 2, 427-434, December 2007

5. Khurana et al, J Infect Dis 2012 15;205(4):610-20;

6. Khurana et al, Sci Transl Med. 2010 2(15):15-20;

7. Bagnoli et al, OMICS 201 1 , 15(9):545-66;

8. Sette&Rappuoli, Immunity 2010 33(4):530-41

9. Sci Transl Med. 2013 Feb 6;5(171 ):171 ra19.Lineage structure of the human antibody repertoire in response to influenza vaccination. Jiang N, He J, Weinstein JA, Penland L, Sasaki S, He XS, Dekker CL, Zheng NY, Huang M, Sullivan M, Wilson PC, Greenberg HB, Davis MM, Fisher DS, Quake SR.

10. Mehr et al Immunol Lett 2012 Aug 10,

1 1. The application of next generation sequencing to the understanding of antibody repertoires Pascale Mathonet and Christopher G. Ullman^* Frontiers in Immunology September 2013 | Volume 4 | Article 265 12. Single-cell based high-throughput sequencing of full-length immunoglobulin heavy and light chain genes. Christian E. Busse, Irina Czogiel, Peter Braun, Peter F. Arndt, Hedda Wardemann, DOI: 10.1002/eji.201343917 European J Immunol

13. Biotechnol Annu Rev. 2004;10:151-88. Phage display for epitope determination: a paradigm for identifying receptor-ligand interactions. Rowley MJ, O'Connor K,

Wijeyewickrema L.

14. Levy, R. et al. Fine and domain-level epitope mapping of botulinum neurotoxin type A neutralizing antibodies by yeast surface display. J. Mol. Biol. 365, 196-210 (2007).

15. Pizzi, E., Cortese, R. & Tramontane A. Mapping epitopes on protein surfaces. Biopolymers 36, 675-680 (1995).

16. Nature Methods, 5: 1039-1045, 2008. Epitope mapping of antibodies using bacterial surface display, Johan Rockberg1 ,2, John Lo^'fblom, Barbara Hjelm, Mathias Uhle^'n & Stefan Sta hl

17. Comanducci M, Bambini S, Brunelli B, Adu-Bobie J, Arico B, et al. (2002) NadA, a novel vaccine candidate of Neisseria meningitidis. J Exp Med 195: 1445- 1454.

18. Cardaci A, Papasergi S, Midiri A, Mancuso G, Domina M et al. (2012) Protective activity of Streptococcus pneumoniae Spr1875 protein fragments identified using a phage displayed genomic library. PLOS ONE 7: e36588. doi:10.1371/journal.pone.0036588. PubMed: 22570729.

19. Papasergi S, Garibaldi M, Tuscano G, Signorino G, Ricci S et al. (2010) Plasminogen- and fibronectin-binding protein B is involved in the adherence of Streptococcus pneumoniae to human epithelial cells. J Biol Chem 285: 7517-7524. doi:10.1074/jbc.M109.062075. PubMed: 20048164

20. Minenkova O. et al. Identification of tumor-associated antigens by screening phage- displayed human cDNA libraries with sera from tumor patients. Int. J. Cancer: 106, 534-544

(2003)

21. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989.

22. BioDrugs. 2007;21 (3):145-56. Epitope mapping: the first step in developing epitope-based vaccines. Gershoni JM, Roitburd-Berman A, Siman-Tov DD, Tarnovitski Freund N, Weiss Y. 23. Irving, M.B., Pan,0. and Scott, J. K. (2001 ) Random-peptide libraries and antigen-fragment libraries for epitope mapping and the development of vaccines and diagnostics. Curr. Opin. Chem. Biol., 5, 314-324.

24. Geysen, H.M., Meloen, R.H. & Barteling, S.J. Use of peptide synthesis to probe viral antigens for epitopes to a resolution of a single amino acid. Proc. Natl. Acad. Sci. USA 81 ,

3998-4002 (1984).

25. Barlow, D.J., Edwards, M.S. & Thornton, J.M. Continuous and discontinuous protein antigenic determinants. Nature 322, 747-748 (1986).

26. van Regenmortel MH: Mapping epitope structure and activity: From one-dimensional prediction to four-dimensional description of antigenic specificity. Methods 1996, 9:465-472.

27. The Hypervariable Region of Streptococcus pyogenes M Protein Escapes Antibody Attack by Antigenic Variation and Weak Immunogenicity Jonas Lannerga ^" rd, 1 ,4 Mattias C.U. Gustafsson,1 ,2,4 Johan Waldemarsson,1 Anna Norrby-Teglund,3 Margaretha Sta ^" lhammar-Carlemalm,1 and Gunnar LindahU ,2,^* Cell Host & Microbe 10, 147-157, August 18, 201 1

28. Curr Pharm Des. 2010 ; 16(33): 3744-3753. Structure-based vaccine design in HIV: blind men and the elephant? Robert Pejchal and Ian A. Wilson

29. Dey B, Pancera M, Svehia K, Shu Y, Xiang S-H, Vainshtein J, Li Y, Sodroski J, Kwong PD, Mascola JR, Wyatt R. Characterization of human immunodeficiency virus type 1 monomeric and trimeric gp120 glycoproteins stabilized in the CD4-bound state: antigenicity, biophysics, and immunogenicity. J Virol. 2007; 81 :5579-5593. [PubMed: 17360741 ]

30. Pantophlet R, Burton DR. Immunofocusing: antigen engineering to promote the induction of HIV- neutralizing antibodies. Trends Mol Med. 2003; 9:468-473. [PubMed: 14604823]

31. Pantophlet R, Wilson IA, Burton DR. Hyperglycosylated mutants of human immunodeficiency virus (HIV) type 1 monomeric gp120 as novel antigens for HIV vaccine design. J Virol. 2003; 77:5889-5901 . [PubMed: 12719582]

32. Pantophlet R, Wilson IA, Burton DR. Improved design of an antigen with enhanced specificity for the broadly HIV-neutralizing antibody b12. Protein Eng Des Sel. 2004; 17:749- 758. [PubMed: 15542540]

33. Ahmed FK, Clark BE, Burton DR, Pantophlet R. An engineered mutant of HIV-1 gp120 formulated with adjuvant Quil A promotes elicitation of antibody responses overlapping the CD4- binding site. Vaccine. 201 1 doi:10.1016/j.vaccine.201 1 .1 1 .089. 34. Selvarajah S, Puffer B, Pantophlet R, Law M, Doms RW, Burton DR. Comparing antigenicity and immunogenicity of engineered gp120. J Virol. 2005; 79:12148-12163. [PubMed: 16160142]

35. Proteins. 2007 Jul 1 ;68(1 ):294-304. Stepwise prediction of conformational discontinuous B-cell epitopes using the Mapitope algorithm. Bublil EM, Freund NT, Mayrose I, Penn O,

Roitburd-Berman A, Rubinstein ND, Pupko T, Gershoni JM.

36. Methods. 2012 Sep;58(1 ):47-55. Deep sequencing analysis of phage libraries using lllumina platform. Matochko WL, Chu K, Jin B, Lee SW, Whitesides GM, Derda R.

37. Anal Biochem. 2012 Feb 15;421 (2):622-31. Phage display screening without repetitious selection rounds, 't Hoen PA, Jirka SM, Ten Broeke BR, Schultes EA, Aguilera B, Pang KH,

Heemskerk H, Aartsma-Rus A, van Ommen GJ, den Dunnen JT.

38. Metzker M.L. (2010). Sequencing technologies- the next generation. Nat Rev Genet. Jan;1 1 (1 ):31-46. doi: 10.1038/nrg2626.

39. Mardis E.R. (2008). Next-generation DNA sequencing methods. Annu Rev Genomics Hum Genet. 9:387-402. doi: 10.1 146/annurev.genom.9.081307.164359.

40. Cardaci A (2012). et al. Protective activity of Streptococcus pneumoniae Spr1875 protein fragments identified using a phage displayed genomic library. PLoS One:7(5):e36588. doi: 10.1371/journal.pone.0036588.

41 . Beghetto E. (2003) Molecular dissection of the human B-cell response against Toxoplasma gondii infection by lambda display of cDNA libraries. Int J Parasitol.:33(2): 163-

73

42. Green M.R. and Sambrook J. (2012). Molecular Cloning: A Laboratory Manual (Fourth Edition). Cold Spring Harbor Laboratory Press. ISBN:978-1-9361 13-42-2

43. Kimura A. et al.(201 1 ) Immunogenicity and Safety of a Multicomponent Meningococcal Serogroup B Vaccine and a Quadrivalent Meningococcal CRM197 Conjugate Vaccine against Serogroups A, C, W-135, and Y in Adults Who Are at Increased Risk for Occupational Exposure to Meningococcal Isolates. Clinical and Vaccine lmmunology,18(3):483-486 , doi: 10.1 128/CVI.00304-10

44. Li H. and Durbin R. (2009) Fast and accurate short read alignment with Burrows-Wheeler Transform. Bioinformatics, 25:1754-60. [PMID: 19451 168]

Claims

1. A method for identifying the epitopes of an antigen targeted by an antibody response comprising the following steps:

a) providing a phage-displayed library of nucleotide fragments of a sequence encoding for said antigen;

b) amplifying said fragments from the library;

c) sequencing said fragments by means of a next generation sequencing method; d) conducting at least one round of affinity selection using an isolated animal sample on the library provided in step a);

e) repeating steps b) and c) on the fragments of the phages selected in step d); f) comparing the output of step c) with the output of step e) thus obtaining an epitope profile of the antibody response to said antigen present in said isolated sample.

2. A method for identifying the epitopes of an antigen targeted by an antibody response comprising the following steps:

a) providing a phage-displayed library of nucleotide fragments of sequences encoding for random peptides;

b) amplifying said fragments from the library;

c) sequencing said fragments by means of a next generation sequencing method; d) conducting at least one round of affinity selection using an isolated animal sample on the library provided in step a);

e) repeating steps b) and c) on the fragments of the phages selected in step d); f) comparing the output of step c) with the output of step e) thus obtaining an epitope profile of the antibody response to said antigen present in said isolated sample.

3. The method according to anyone of claims 1-2 wherein said isolated sample used in step d) is from a subject who has been previously immunized with said antigen.

4. The method according to anyone of claims 1-3 wherein said isolated sample is a serum sample.

5. The method according to anyone of claims 1-4 wherein said isolated sample is from a subject who is suspect of being infected with said antigen.

6. The method according to anyone of claims 1-5 wherein said antigen is from a pathogen selected from the group consisting of dengue virus; yellow fever virus; West Nile virus; Japanese encephalitis virus; HIV; HTLV-I, Bunyaviridae viruses including the hantaviruses, Crimean-Congo hemorrhagic fever, Rift Valley fever virus, and severe fever and thrombocytopenia virus; arenaviruses including all agents of South American hemorrhagic fever, Lassa virus and lymphocytic choriomeningitis virus; filoviruses including Ebola and Marburg viruses; paramyxoviruses including morbilliviruses, henipaviruses, respiroviruses including RSV and metapneumovirus and rubellaviruses; Alphaviruses including Chikungunya, O'nyung-nyung, Semliki Forest, Ross River, Sindbis, eastern, western and Venezuelan equine encephalitis; picornaviruses; papillomaviruses including HPV; herpesviruses including HSV-1/2, EBV, CMV, HHV-6, 7, and 8; polyomaviruses including SV 40, JC and BK viruses; poxviruses including variola and vaccinia viruses; bacterial pathogens including any human pathogen such as Staphylococcus spp; Streptococcus spp; Burkholderia spp., Mycobacterium s.p.p., Neisseria s.p.p., Salmonella s.p.p., Bacillus anthracis, Clamydia s.p.p. mycoplasma, E. coli, and other pathogenic coliforms; parasitic pathogens including malaria (Plasmodium spp) and toxoplasma (Toxoplasma s.p.p.); and pathogenic fungi (including Candida s.p.p., Aspergillus s.p.p., Cryptococcus neoformans).

7. The method according to anyone of claims 1-5 wherein said antigen is an allergen or an antigen which produces an autoantibody response or a response to a foreign protein or carbohydrate antigen, an autoimmune antigen, an allogeneic protein or allergen.

8. The method according to anyone of claims 1 -5 wherein said antigen is a tumor antigen, preferably it is an antigen for breast, liver, pancreas, colorectal, lung, thyroid or prostate cancer.

9. A method for designing a vaccine against an antigen comprising the use of an epitope profile for said antigen obtained with the method of anyone of claims 1 -8.

10. A method for monitoring the course of a vaccination treatment against an antigen in a subject comprising the use of an epitope profile for said antigen obtained with the method of anyone of claims 1-8 in an isolated sample from said subject.

1 1. A method for evaluating an antibody response to an antigen in an isolated animal sample comprising the use of an epitope profile obtained with the method of anyone of claims 1 -8.

12. A method for identifying if a subject is immunized toward an antigen comprising the use of an epitope profile obtained with the method of anyone of claims 1-8 wherein the isolated sample used in step d) of said method is from said subject.

13. An in vitro method for diagnosing a disease related to an antigen of interest comprising the steps of:

a) providing a phage-displayed library of nucleotide fragments of a sequence encoding for said antigen of interest;

b) amplifying said fragments from the library;

c) sequencing said fragments by means of a next generation sequencing method; d) conducting at least one round of affinity selection using an isolated sample from a subject on the library provided in step a);

e) repeating steps b) and c) on the fragments of the phages selected in step d); f) comparing the output of step c) with the output of step e) thus obtaining an epitope profile of the antibody response to said antigen present in said isolated sample;

g) attributing the obtained epitope profile to the presence of a disease related to said antigen of interest.

14. A method for the serological analysis of antibody titers comprising the use of an epitope profile obtained with the method of anyone of claims 1 -8.