WO2015133468A1 - Production method for copolymer polyester using recombinant strain having modified protein locus for polyester granule binding - Google Patents

Abstract

The purpose of the present invention is to provide a method by which the composition ratio of monomer units in a copolymer polyhydroxyalkanoic acid is controlled. Provided is a method by which the composition ratio of monomer units within a copolymer PHA is controlled, and in which, in a recombinant strain having copolymer PHA productivity imparted thereto by the insertion of one of more genes that code a polyhydroxyalkanoic acid (PHA) polymer enzyme having wide-substrate specificity into a host that is different to the living organism of the inserted gene, a gene that codes the main PHA granule binding protein in the recombinant strain is made into a gene that codes a PHA granule binding protein deriving from the same living organism as the gene that codes the PHA polymer enzyme.

Description

Production of copolyesters by recombinant strains with modified polyester granule binding protein loci

The present invention is based on poly (3-hydroxybutanoic acid-co-3-hydroxyhexanoic acid), which is one of copolymerized polyhydroxyalkanoic acids, which can be decomposed by microorganisms using vegetable oil as a basic raw material and has excellent biocompatibility. ) By a microorganism and controlling the composition ratio of the monomer units in the copolymer.

石油 Petroleum synthetic plastic, an essential material in modern society, is cheap and easy to process, but it is difficult to dispose of it because of its indegradability. Polyhydroxyalkanoic acid (hereinafter abbreviated as “PHA”) that accumulates in cells as an energy source for microorganisms is expected to be a plastic material of environmentally low load type that uses renewable biomass as a raw material and has biodegradability. Yes. Poly ((R) -3-hydroxybutanoic acid) (hereinafter abbreviated as “P (3HB)”) is a typical PHA biosynthesized by many microorganisms, but is practical because of its physical properties of being hard and brittle. Is difficult.

On the other hand, Aeromonas caviae (hereinafter sometimes abbreviated simply as “A. caviae”) isolated from soil is obtained from (R) -3-hydroxybutanoic acid using (R) -3-hydroxybutanoic acid as a raw material. Poly ((R) -3-hydroxybutanoic acid-co- (R) -3-hydroxyhexanoic acid) copolymer which is a copolyester composed of R) -3-hydroxyhexanoic acid (hereinafter abbreviated as 3HHx) (Hereinafter abbreviated as [P (3HB-co-3HHx)]). It has been found that this P (3HB-co-3HHx) exhibits excellent physical properties rich in flexibility as the 3HHx fraction increases. A. P (3HB-co-3HHx) biosynthesized by Caviae from vegetable oil has a 3HHx fraction of 10 to 20 mol%, showing flexibility suitable for practical use, but its cell accumulation rate is as low as about 15% by weight. It was difficult to apply to actual production (Patent Document 1, Patent Document 2, Non-Patent Document 1).

In order to put microbial polyester into practical use, it is necessary to have a technology for efficiently producing copolymers with various compositions that realize various physical properties. So far, the search for technology to control recombinant copolymer production and copolymer composition by accumulating P (3HB-co-3HHx) and having high growth ability, and the efficient P (3HB) -producing bacterium, Cupriavidas A. P. (3HB) biosynthetic ability-deficient mutant of Necatol (Cupriavidus nector) (hereinafter sometimes simply referred to as “C. necator”). Introduction of PHA synthase gene derived from Caviae strain (Patent Document 3, Non-Patent Document 2), C.I. A. Necrotor strain chromosome Caviae-derived PHA synthase gene introduction (Patent Literature 4, Non-Patent Literature 3), inactivation of 3HB monomer supply enzyme β-ketothiolase gene or acetoacetyl-CoA reductase (Patent Literature 5), R-form-specific enoyl-CoA hydratase gene (phaJ) which converts 2-enoyl-CoA, an intermediate in the fatty acid β-oxidation pathway, to (R) -3-hydroxyacyl-CoA ((R) -3HA-CoA) ) (Patent document 6, non-patent document 3, non-patent document 4), and modification by gene disruption of β-oxidation pathway enzyme (non-patent document 5). However, in metabolic modifications aimed at biosynthesis of copolymerized PHA, the increase in the second and third unit fractions is relative to the decrease in the first unit fraction, resulting in a decrease in production. Is often accompanied. Further technological development is necessary to achieve both high-productivity and biosynthesis of copolymer PHA having a 3HHx fraction as high as about 10 mol%.

JP-A-5-93049 Japanese Patent Laid-Open No. 7-265065 Japanese Patent No. 3062459 JP 2008-86238 A JP 2008-29218 A International Publication WO2011 / 105379

PHA biosynthesized in cells exists as water-insoluble granules in the cells, and its surface is covered with a lipid monolayer, and is a granule-binding protein called phasin, PHA polymerizing enzyme, and PHA which is a degrading enzyme. Depolymerase is bound. The granule-binding protein is an amphipathic protein, and it has been proposed to maintain the granule in the cytoplasm by binding to the highly hydrophobic polyester granule surface and to adjust the ratio of the surface area to the granule volume. Yes. More recently, granule-binding proteins have been found to interact with PHA polymerizing enzymes (Wieczorek, R. et al., J. Bacteriol., 177: 2425-2435 (1995); Potter, M. et. al., Microbiology, 151: 825-833 (2005); Cho, M., et al., Biochemistry, 20: 2276-2288 (2012)). Therefore, the present inventors pay attention to the interaction between the PHA synthase and the granule-binding protein, and C. a. The granule binding protein gene locus of the necator strain was modified. That is, C.I. Considering the possibility that the polymerization characteristics of the PHA synthase can be changed by making the granule-binding protein in the Necator strain cells derived from the same microbial species as the foreign PHA synthase functioning in polymerization, The present inventors have found that an excellent production strain capable of biosynthesizing P (3HB-co-3HHx) having a high 3HHx fraction from a vegetable oil raw material at a high accumulation rate can be provided, and the present invention has been completed.

That is, the present invention is as follows.
[1] A recombinant strain imparted with the ability to produce copolymer PHA by introducing a gene encoding one or more broad substrate specific polyhydroxyalkanoic acid (PHA) polymerase into a host different from the species of the gene. And a gene encoding a main PHA granule-binding protein in the recombinant strain, which is a gene encoding a PHA granule-binding protein derived from the same species as the PHA-polymerizing enzyme. A method for controlling the composition ratio of units.
[2] A recombinant strain imparted with the ability to produce copolymerized PHA introduces one or more genes encoding a broad substrate-specific PHA polymerase and one or more R-isomer-specific enoyl-CoA hydratase genes The method according to [1] above, wherein the strain is a cultured strain.
[3] The copolymerized PHA is poly (3-hydroxybutanoic acid-co-3-hydroxyhexanoic acid), and increases the fraction of 3-hydroxyhexanoic acid in the copolymerized PHA. 2].
[4] The method according to [1] to [3] above, wherein the broad substrate-specific PHA synthase and the PHA granule-binding protein are derived from an A. caviae strain.
[5] The method described in [1] to [4] above, wherein the host is derived from a C. necator strain.
[6] One of the genes encoding a broad substrate-specific PHA synthase is
(A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1; or (b) an activity of hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 under stringent conditions and synthesizing PHA. Consisting of a nucleic acid encoding a protein having:
The gene encoding the PHA granule binding protein used for replacement is
(A) a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2; or (b) an activity that hybridizes with a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2 under stringent conditions and binds to PHA granules. The method according to [1] to [5] above, which comprises a nucleic acid encoding a protein having
[7] The R-form-specific enoyl-CoA hydratase gene is
(A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 3; or (b) hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 3 under stringent conditions and in the middle of the fatty acid β-oxidation system The method according to any one of [1] to [6] above, comprising a nucleic acid encoding a protein having an activity of converting the body into (R) -3-hydroxyacyl-CoA.
[8] One of the genes encoding a broad substrate-specific PHA synthase is
(A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1; or (b) an activity of hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 under stringent conditions and synthesizing PHA. Consisting of a nucleic acid encoding a protein having:
One of the genes encoding PHA granule binding proteins used for replacement is
(A) a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2; or (b) an activity that hybridizes with a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2 under stringent conditions and binds to PHA granules. And a R-form specific enoyl-CoA hydratase gene,
(A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 3; or (b) hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 3 under stringent conditions and in the middle of the fatty acid β-oxidation system The method according to any one of [1] to [7] above, comprising a nucleic acid encoding a protein having an activity of converting the body into (R) -3-hydroxyacyl-CoA.

Efficient production of copolymer polyhydroxyalkanoic acid producing strain and copolymerized polyhydroxyalkanoic acid having a high 3HHx fraction by modifying the granule binding protein locus of P (3HB-co-3HHx) producing bacteria A method can be provided.

Hereinafter, preferred embodiments will be described in detail for the purpose of explaining the present invention.
As described above, the present invention provides a recombinant strain imparted with the ability to produce copolymer PHA by introducing a gene encoding one or more broad substrate-specific PHA synthases into a host different from the species of the gene. A monomer in a copolymerized PHA comprising replacing a gene encoding a main PHA granule-binding protein in the recombinant strain with a gene encoding a PHA granule-binding protein derived from the same species as the PHA-polymerizing enzyme The present invention relates to a method for controlling the composition ratio of units.

(1) Host (microorganism)
The host used in the present invention is not particularly limited as long as it is different from the species of PHA synthase gene (phaC) introduced into the host. necator strain, A. Caviae strain and Escherichia coli Escherichia coli strain can be mentioned. For example, the phaC to be introduced is A.I. When it is derived from a Caviae strain, the host may be any other microbial species (for example, a C. necator strain). According to the present invention, it is possible to use a recombinant strain in which a gene encoding a broad substrate-specific PHA synthase described later is introduced in advance into a host different from the species of the gene. Furthermore, in one embodiment of the present invention, the R-form-specific enoyl-CoA hydratase gene described later may be further introduced into the recombinant strain. For the purpose of the present invention to control the composition ratio of the monomer units in the copolymerized PHA, the foreign species encoding the broad substrate-specific PHA polymerizing enzyme and the species of the gene encoding the PHA granule-binding protein described later are: The same, but preferably different from the species of the recombinant strain.

(2) A foreign gene encoding a broad substrate-specific PHA synthase (foreign phaC)
According to the present invention, for the purpose of controlling the composition ratio of the monomer units in the copolymerized PHA, a foreign gene encoding one or more broad substrate specific PHA polymerases (hereinafter abbreviated as foreign phaC) is used in the host. Can be introduced). Here, the “broad substrate-specific PHA polymerization enzyme” used for controlling the copolymer composition of the present invention is an enzyme whose polymerization activity for synthesizing PHA is not limited to only one type of (R) -3HA-CoA. Say. Even if microorganisms can synthesize PHA in advance, PHA polymerase with broader substrate specificity can be used for microorganisms in which biosynthesis of copolymerized PHA is not possible due to the substrate specificity of PHA polymerase or the composition of the copolymer is limited. By introducing a gene coding for and making the carbon source and culture conditions suitable, PHA in which various 3-hydroxyalkanoic acid units are copolymerized can be synthesized. As an example, a recombinant strain into which a foreign gene of a PHA synthase having activity against (R) -3HA-CoA having 4 to 6 carbon atoms has been introduced may have P ( 3HB-co-3HHx) has been reported (Patent Literature 3, Patent Literature 4, Non Patent Literature 2, and Non Patent Literature 3). Examples of strains expressing such a broad substrate-specific PHA synthase include A. Caviae FA440 strain (FERM P-15786) (Patent No. 3062459), Aeromonas hydrophila WQ strain and 4AK5 strain (Lu, X. et al., FEMS Microbiol. Lett., 243: 149-55 (2005)). Etc. are known.

The exogenous phaC used in the present invention includes single-stranded or double-stranded DNA and its RNA complement. DNA includes, for example, naturally-derived DNA, recombinant DNA, chemically synthesized DNA, DNA amplified by PCR, and combinations thereof. As the nucleic acid used in the present invention, DNA is preferable. As is well known, codons are degenerate and some amino acids have multiple base sequences encoding one amino acid. However, if the base sequence of a nucleic acid encoding a broad substrate-specific PHA synthase is used, Nucleic acids having any base sequence are within the scope of the present invention. As described above, according to the present invention, the number of exogenous phaC introduced into the host may be one or more. Specifically, the number of genes introduced is one, two, three, four, or five, preferably one or two.

In one embodiment of the present invention, the gene encoding a broad substrate-specific PHA synthase used for copolymer composition control is preferably phaC _NSDG . As used herein, “phaC _NSDG ” refers to _A.I. It is a gene that encodes a mutant (NSDG mutant) in which the asparagine at position 149 of serine and the aspartic acid at position 171 are replaced by glycine in the polyhydroxyalkanoic acid synthase derived from Caviae strain. The cloning of the phaC _NSDG gene can be performed by an ordinary molecular biological technique. For example, Tsuge, T .; Et al., FEMS Microbiol. Lett. 277: 217-222 (2007); Kichise, T .; Et al., Appl. Environ. Microbiol. 68: 2411-2419 (2002); JP 2008-29218; International Publication WO2011 / 105369.

In one embodiment of the present invention, the phaC _NSDG gene comprises (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1; or (b) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 and stringent conditions It may consist of a nucleic acid that encodes a protein that hybridizes underneath and has an activity to synthesize PHA. Furthermore, in another embodiment of the present invention, the phaC _NSDG gene comprises (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1; or (b) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 and a string. It may be composed of a nucleic acid that encodes a protein that hybridizes under gentle conditions and has an activity to synthesize PHA.

The phaC _NSDG gene is a synthetic nucleotide designed as a primer based on the nucleotide sequence of SEQ ID NO: 1, as described in Example 1 described later. A site corresponding to substituting asparagine No. 149 with serine and aspartic acid No. 171 with glycine after amplification using chromosomal DNA of Caviae strain or a plasmid containing chromosomal DNA as a template. It can be prepared by introducing specific mutations. As a method for amplifying a nucleic acid, for example, polymerase chain reaction (PCR) (Saiki RK et al., Science, 230, 1350-1354 (1985)), ligase chain reaction (LCR) (Wu DY. , Genomics, 4, 560-569 (1989)), and transcription-based amplification (Kwoh DY et al., Proc. Natl. Acad. Sci. USA, 86, 1173-1177 (1989)). As well as strand displacement reactions (SDA) (Walker GT et al., Proc. Natl. Acad. Sci. USA, 89, 392-396 (1992); Walker GT et al., Nuc. Acids Res., 20, 1691-1696 (1992)), self-retaining sequence replication (3SR) (G atelli J. C., Proc. Natl. Acad. Sci. USA, 87, 1874-1878 (1990)), and Qβ replicase system (Lizardi, PM et al., BioTechnology, 6, 1191-2202 (1988)). However, the present invention is not limited to these. In the present invention, it is preferable to use the PCR method. Methods for introducing mutations into a gene are generally known, for example, site-specific mutagenesis (Current Protocols in Molecular Biology, edited by Ausubel, FM, et al., Unit 8.1-). 8.5, John Wiley & Sons, Inc., NY). In the present invention, QuikChange II XL Site-Directed Mutagenesis Kits (Agilent Technologies) can be used.

As used herein, “under stringent conditions” means to hybridize under moderate or high stringent conditions. Specifically, moderately stringent conditions can be easily determined by those skilled in the art based on, for example, the length of DNA. Basic conditions are described in Sambrook, J. et al. Are shown in Molecular Cloning, A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, 7.42-7.45 (2001), with regard to nitrocellulose filters, 5 × SSC, 0.5% SDS, 1. Pre-wash solution of 0 mM EDTA (pH 8.0), about 50% formamide at about 40-50 ° C., 2 × SSC-6 × SSC (or Stark solution (Stark in about 50% formamide at about 42 ° C.) use of other similar hybridization solutions such as' s solution) and washing conditions of about 60 ° C., 0.5 × SSC, 0.1% SDS. High stringency conditions can also be readily determined by one skilled in the art based on, for example, the length of the DNA. Generally, such conditions include hybridization and / or washing at higher temperatures and / or lower salt concentrations than moderately stringent conditions, such as hybridization conditions as described above, and about 68 ° C. Defined with 0.2 × SSC, 0.1% SDS wash. One skilled in the art will recognize that the temperature and wash solution salt concentration can be adjusted as needed according to factors such as the length of the probe.

Homologous nucleic acids cloned using the nucleic acid amplification reaction or hybridization as described above are at least 30% or more, preferably 50% or more, respectively, more preferably than the base sequence described in SEQ ID NO: 1. Has an identity of 70% or more, even more preferably 90% or more, still more preferably 95% or more, and most preferably 98% or more. Note that the percent identity can be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by Devereux et al., Nucl. Acids Res. , 12, 387 (1984) and determined by comparing sequence information using the GAP computer program (GCG Wisconsin Package, version 10.3) available from the University of Wisconsin Genetics Computer Group (UWGCG). can do.

In a more preferred embodiment of the present invention, the gene encoding a broad substrate-specific PHA synthase is one or two phaC _NSDG genes, and may be a nucleic acid comprising the base sequence represented by SEQ ID NO: 1. Good. As will be understood by those skilled in the art, since genes introduced on the chromosome of the host are appropriately transcribed and further translated into a protein having the desired activity, these genes are suitable on the chromosome. It needs to be integrated so that it is under the control of the promoter.

(3) Gene encoding PHA granule binding protein (phaP)
According to the present invention, in a recombinant strain imparted with the ability to produce a copolymerized PHA by introducing one or more genes encoding a broad substrate-specific PHA synthase, the main PHA granule-binding protein is converted into the PHA. By being derived from the same species as the polymerization enzyme, the composition ratio of the monomer units in the copolymerized PHA can be controlled. Here, “PHA granule-binding protein” used in the present invention means a protein having an activity of binding to the surface of PHA granules accumulated in cells. PhaP1 (Wieczorek, R. et al., J. Bacteriol., 177, 2425-2435 (1995)), PhaP2, PhaP3, PhaP4 (Potter, M. et al., Microbiology, 151, 825-833) (2005) A. PhaP in Caviae FA440 strain (Fukui, T. et al., Biomacromolecules, 2, 148-153 (2001)), PhaP in Paracoccus denitificicans strain (Maehara, A. et al., J. Bacteriol., 181, 294-21-29) Etc. are known. In addition, “major” PHA granule-binding protein means that when a plurality of PHA granule-binding proteins are present in the cell, it is present in the largest amount. In Necator H16 strain, PhaP1 corresponds (Wieczorek, R. et al., J. Bacteriol., 177, 2425-2435 (1995)). In the method of controlling the copolymer composition in the present invention, the exogenous phaC encoding a broad substrate-specific PHA synthase introduced into the host and the gene of the main PHA granule binding protein functioning in the recombinant strain are the same organism. In other words, the phaP present in the recombinant strain imparted with the ability to produce copolymerized PHA as a host is different from the species of foreign phaP introduced for composition control. . Furthermore, as will be readily understood by those skilled in the art, for example, the origin of exogenous phaC encoding a broad substrate-specific PHA synthase is In the case of a Caviae strain, the origin of the foreign phaP introduced into the host is A. An embodiment that is a Caviae strain is included in the present invention. The foreign phaC and foreign phaP introduced into the host are not particularly limited as long as they are the same species.

The phaP used in the present invention includes single-stranded or double-stranded DNA and its RNA complement. DNA includes, for example, naturally-derived DNA, recombinant DNA, chemically synthesized DNA, DNA amplified by PCR, and combinations thereof. As the nucleic acid used in the present invention, DNA is preferable. As is well known, codons are degenerate and some amino acids have multiple base sequences that encode one amino acid. However, if the base sequence of a nucleic acid that encodes a protein having activity to bind to PHA granules, A nucleic acid having any base sequence is also included in the scope of the present invention.

In one embodiment of the present invention, a gene (phaP) encoding a PHA granule-binding protein used for copolymer composition control is A.I. from Caviae strains or C.I. It is preferably derived from a necator strain. As used herein, “phaP _Ac ” refers to A.I. It refers to a gene encoding a PHA granule binding protein derived from a Caviae strain. As phaP _Ac , GenBank GenBank Accession No. Nucleotides 2197-2547 (“ORF1”) in D88825 can be utilized. In this specification, the base sequence of the gene is described in the sequence listing as SEQ ID NO: 2. In addition, isolation and identification of a phaP _Ac gene can be performed by a normal molecular biological technique. As used herein, “phaP1 _Cn ” refers to C.I. It refers to the gene encoding the major PHA granule binding protein derived from the necator strain. As phaP1 _Cn , C.I. Necator genome (NC 　 No. 01576.16.1) can be used. In the present specification, the nucleotide sequence of the gene is described in the sequence listing as SEQ ID NO: 4. The phaP _Ac gene and the phaP1 _Cn gene can be isolated and identified by ordinary molecular biological techniques.

In one embodiment of the present invention, the exogenous phaP introduced into the host is (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 2; or (b) a nucleic acid comprising the base sequence represented by SEQ ID NO: 2; It may consist of a nucleic acid that encodes a protein that hybridizes under stringent conditions and has an activity of binding to PHA granules. Further, in one embodiment of the present invention, the exogenous phaP is (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 2; or (b) a nucleic acid comprising the base sequence represented by SEQ ID NO: 2 and a stringent It may consist of a nucleic acid that encodes a protein that hybridizes under conditions and has an activity of binding to PHA granules. The phaP to be substituted present on the host chromosome is (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 4; or (b) a nucleic acid comprising the base sequence represented by SEQ ID NO: 4. It may be a thing.

The “stringent conditions” are as described above, and the homologous nucleic acid cloned using a nucleic acid amplification reaction, hybridization, or the like, respectively, with respect to the base sequence described in SEQ ID NO: 2, At least 30% or more, preferably 50% or more, more preferably 70% or more, even more preferably 90% or more, still more preferably 95% or more, and most preferably 98% or more. Note that the percent identity can be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by Devereux et al., Nucl. Acids Res. , 12, 387 (1984) and determined by comparing sequence information using the GAP computer program (GCG Wisconsin Package, version 10.3) available from the University of Wisconsin Genetics Computer Group (UWGCG). can do.

In a more preferred embodiment of the present invention, the exogenous phaP introduced into the host may be phaP _Ac and may be a nucleic acid comprising the base sequence represented by SEQ ID NO: 2. As will be understood by those skilled in the art, since genes introduced on the chromosome of the host are appropriately transcribed and further translated into a protein having the desired activity, these genes are suitable on the chromosome. It needs to be integrated so that it is under the control of the promoter.

(4) Gene encoding R-form specific enoyl-CoA hydratase (phaJ)
In the copolymer composition control method according to the present invention, as a host, in addition to a foreign gene encoding a broad substrate-specific PHA polymerase, one or more R isomers are used to efficiently perform biosynthesis of copolymer PHA. A recombinant strain into which a gene (phaJ) encoding specific enoyl-CoA hydratase has been introduced in advance may be used. Here, the “R-form-specific enoyl-CoA hydratase” used in the present invention is an enzyme that converts enoyl-CoA, which is a fatty acid β-oxidation intermediate, into (R) -3HA-CoA, which is a PHA monomer. As long as it has this activity, the origin of the biological species is not particularly limited.

Note that phaJ used in the present invention includes single-stranded or double-stranded DNA and its RNA complement. DNA includes, for example, naturally-derived DNA, recombinant DNA, chemically synthesized DNA, DNA amplified by PCR, and combinations thereof. As the nucleic acid used in the present invention, DNA is preferable. As is well known, codons are degenerate and some amino acids have a plurality of base sequences encoding one amino acid. However, any base sequence of a nucleic acid encoding R-isomer-specific enoyl-CoA hydratase can be used. Nucleic acids having the base sequences are also included in the scope of the present invention.

In one embodiment of the present invention, as phaJ used in the present invention, A. Base sequence of R-specific enoyl-CoA hydratase gene (phaJ _Ac ) derived from Caviae strain: GenBank Accession No. Nucleotides 4475-4879 (“ORF3”) in D88825 can be utilized. As described above, according to the present invention, the number of genes encoding R-isomer specific enoyl-CoA hydratase may be one or more. Specifically, the number of genes introduced is one, two, three, four, or five, preferably one or two.

In one embodiment of the present invention, phaJ introduced into the host is A. Caviae-derived phaJ _Ac is preferable. Isolation and identification of phaJ _Ac can be performed by an ordinary molecular biological technique. For example, Patent Document 3 (described above) may be referred to. Further, in a specific embodiment of the present invention, phaJ is (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 3; or (b) a stringent nucleic acid comprising the nucleic acid comprising the base sequence represented by SEQ ID NO: 3. It may be composed of a nucleic acid that encodes a protein that hybridizes under conditions and has an activity of converting enoyl-CoA, which is a fatty acid β-oxidation intermediate, into (R) -3HA-CoA. Furthermore, in one embodiment of the present invention, phaJ is (a) a nucleic acid comprising the base sequence represented by SEQ ID NO: 3; or (b) a nucleic acid comprising the base sequence represented by SEQ ID NO: 3 and stringent conditions It may be composed of a nucleic acid that encodes a protein that hybridizes below and has an activity of converting a fatty acid β-oxidation intermediate into (R) -3-hydroxyacyl-CoA.

The “stringent conditions” are as described above, and the homologous nucleic acid cloned using a nucleic acid amplification reaction, hybridization, or the like, respectively, with respect to the base sequence described in SEQ ID NO: 3, At least 30% or more, preferably 50% or more, more preferably 70% or more, even more preferably 90% or more, still more preferably 95% or more, and most preferably 98% or more. Note that the percent identity can be determined by visual inspection and mathematical calculation. Alternatively, the percent identity of two nucleic acid sequences can be determined by Devereux et al., Nucl. Acids Res. , 12, 387 (1984) and determined by comparing sequence information using the GAP computer program (GCG Wisconsin Package, version 10.3) available from the University of Wisconsin Genetics Computer Group (UWGCG). can do.

In a more preferred embodiment of the present invention, the gene encoding R-specific enoyl-CoA hydratase introduced into the host may be phaJ _Ac and may be a nucleic acid consisting of the base sequence represented by SEQ ID NO: 3. As will be appreciated by those skilled in the art, these genes are under the control of appropriate promoters in order for the genes introduced into the host to be properly transcribed and further translated into proteins with the desired activity. Need to be incorporated.

(5) Introduction method and positional relationship of foreign phaC, foreign phaP having the same origin as foreign phaC, and phaJ According to the present invention, if the composition ratio of copolymerized PHA synthesized in microbial cells can be controlled, The method for introducing foreign phaC, foreign phaP having the same origin as foreign phaC, and phaJ into the host is not particularly limited, and may be introduction using a plasmid vector capable of autonomous replication in the host. It may be introduced into the chromosome by replacement. As a method for achieving a protein expressed from phaP having the same origin as foreign phaC as the main granule-binding protein in the recombinant strain, homology that replaces all or part of phaP in the host is used. Either exogenous phaP may be introduced by recombination, or exogenous phaP may be introduced by a plasmid vector capable of autonomous replication into a strain in which the function of endogenous phaP has been lost by mutation, destruction, or deletion. In addition, in order for the incorporated genes to be appropriately transcribed and further translated into a protein having the desired activity, these genes need to be incorporated under the control of an appropriate promoter. Further, the number of each gene to be introduced is not limited as long as the desired effect is achieved. Furthermore, the positional relationship of each introduced gene is not particularly limited, and may be arranged on or separated from each other on a chromosome or in an autonomously replicating vector, and a part thereof is introduced into the chromosome by homologous recombination. Then, the rest may be introduced with an autonomously replicating vector, or introduced with a plurality of different compatible autonomously replicating vectors.

In another embodiment of the present invention, as long as the object of the present invention is achieved, a strain in which pphaC _NSDG is pre-integrated on a chromosome may be used. An NSDG strain is exemplified as such a microorganism (see Patent Document 6). Here, “NSDG strain” means C.I. necator, H16 strain (ATCC16699 strain, DSM428 strain) which is a kind of wild strain
The original phaC in the pha operon on the chromosome of This is a recombinant strain in which phaC _NSDG , which is a gene of Caviae-derived PHA synthase mutant enzyme, is substituted by homologous recombination.

In another embodiment of the present invention, a strain in which pphaC _NSDG and phaJ are pre-integrated on a chromosome may be used as long as the object of the present invention is achieved. An example of such a microorganism is the MF02 strain (see Patent Document 6). Here, the MF02 strain is a recombinant strain in which phaJ _Ac is integrated between phaC _NSDG and phaA (β-ketothiolase gene) in the pha operon on the chromosome of NSDG strain.

(6) Construction of a gene replacement vector and production of a recombinant microorganism According to the present invention, homology of each or any combination of these genes for introducing phaC _NSDG , phaP, and phaJ into the host chromosome A gene replacement vector incorporated into a recombination vector or an expression vector incorporating each or any combination of the genes into an autonomously replicating vector is provided. Here, as a method for incorporating a gene into a vector, for example, Sambrook, J. et al. Et al., Molecular Cloning, A Laboratory Manual (3rd edition), Cold Spring Harbor Laboratory, 1.1 (2001). For convenience, a commercially available ligation kit (for example, manufactured by Toyobo Co., Ltd.) can also be used.

A vector can be prepared simply by ligating a desired gene to a recombination vector (for example, plasmid DNA) available in the technical field by a conventional method. As a vector used in the method for controlling the polyhydroxyalkanoic acid copolymer of the present invention, a polyester-polymerizing enzyme gene derived from a microorganism already incorporated in the chromosome of a microorganism is used as a foreign substrate-specific polyester polymerizing enzyme. For the purpose of replacement by gene, but not limited to, homologous recombination vectors pK18mobsacB (Schaffer et al., Gene 145, 69-73 (1994)), pJQ200 (Quantt, J. and Hynes, MP, “ Versatile suicide vectors whos select direct selection for gene replacement in gram-negative bacteria ", Gene (1993) 127: 1 It is preferable to use -21, or the broad host range vectors pBBR1-MCS2 (GenBank Accession No. U23751), pJRD215 (M16198) (Davision, J. et al., (See 1987) Gene, 51,275-80), pJB861 (U82000), pHRP311 (see Parales, RE and Harwood, CS (1993) Gene, 133, 23-30). In addition, plasmids for E. coli such as pBAD24 (GenBank Accession No. X81837), pDONR201, pBluescript, pUC118, pUC18, pUC1 , It can be used pBR322 and the like.

Moreover, those skilled in the art can appropriately select the restriction ends so as to be compatible with the recombinant vector, and further appropriately select a recombinant vector suitable for the host cell in order to express the desired protein. Can do. Such a vector is a region in which the gene used in the present invention functions so as to cause homologous recombination with the gene of the target host cell (if necessary, an autonomous replication origin, a junction transmission region, a selection marker (for example, , Kanamycin resistance gene), etc.) are appropriately arranged or introduced so that the nucleic acid is constructed or constructed so that it is appropriately recombined.

Generally, a transformant can be prepared by incorporating a recombinant vector into a host cell. In this case, the host cell can be either a prokaryotic cell (for example, E. coli (S17-1 strain, etc.), Bacillus subtilis) or a eukaryotic cell (mammalian cell, yeast, insect cell, etc.). Introduction (transformation) of a recombinant vector into a host cell can be performed using a known method. For example, in the case of bacteria (E. coli, Bacillus subtilis, etc.), for example, the method of Cohen et al. (Proc. Natl. Acad. Sci. USA, 69, 2110 (1972)), the protoplast method (Mol. Gen. Genet., 168, 111 (1979)), competent method (J. Mol. Biol., 56, 209 (1971)), calcium chloride method, electroporation method and the like. In addition, the conjugation transfer method can be used to introduce expression vectors into cells belonging to the genus Ralstonia, Alcaligenes, Pseudomonas, etc. (J. Bacteriol., 147, 198). (1981)).

This conjugation transfer method is based on the nature of cells that transfer a chromosome genome or plasmid from one cell to another by contact between cells. For example, self-transmission carrying the target DNA. Starting with conjugation between a donor bacterium into which a sex plasmid has been introduced and a recipient bacterium that does not have the plasmid, a series of bridge formation in both cells, replication and transfer of the plasmid, and separation of the cells upon completion of DNA synthesis It is a means that enables gene transfer by a process.

(7) Synthesis of copolymerized PHA According to the present invention, the synthesis of copolymerized PHA involves introducing a gene encoding one or more broad substrate specific PHA polymerase into a host different from the species of the gene. In the recombinant strain imparted with the ability to produce copolymer PHA, the gene encoding the PHA granule binding protein present on the chromosome of the recombinant strain is derived from the same species as the gene encoding the PHA polymerase. By substituting with a gene encoding a granule-binding protein, copolymerized PHA is generated and accumulated in the recombinant strain or in a culture (for example, a medium), and the desired copolymerized PHA is obtained from the recombinant strain or culture. It is done by collecting. As will be understood by those skilled in the art, the recombinant strain is preferably placed under suitable culture conditions in order to synthesize copolymerized PHA. The culture conditions of the parent strain before performing such recombinant strain culture and gene recombination may be followed. In one specific embodiment of the present invention, the recombinant strain may be grown in a medium containing vegetable oil or fatty acid as a carbon source.

As an example, C.I. As a medium in the case of using a necator strain as a host, vegetable oil that can be assimilated by the microorganism strain or a medium- or long-chain fatty acid having 6 or more carbon atoms was added to restrict any of nitrogen sources, inorganic salts, and other organic nutrient sources. A culture medium is mentioned. Typically, the medium temperature is in the range of 25 ° C. to 37 ° C., and aerobically cultured for 1 to 10 days, so that copolymerized PHA is produced and accumulated in the cells, and then recovered and purified. The desired copolymerized PHA can be prepared. Moreover, when using vegetable oil as a carbon source, generally available vegetable oil can be used as vegetable oil which can be used, The supply source is not specifically limited. Preferred are natural fats such as soybean oil, corn oil, safflower oil, olive oil, palm oil, palm oil, rapeseed oil, fish oil, whale oil, pig oil or cow oil. The concentration of the vegetable oil in the medium is preferably 0.1 to 5%, but can be appropriately adjusted by those skilled in the art.

If necessary, a nitrogen source or an inorganic substance may be added to the medium. Examples of the nitrogen source include ammonia, ammonium chloride, ammonium sulfate, ammonium phosphate and the like, as well as peptone, meat extract, yeast extract, corn steep liquor and the like. Examples of inorganic substances include monopotassium phosphate, dipotassium phosphate, magnesium phosphate, magnesium sulfate, and sodium chloride.

Cultivation is usually carried out using shaking culture, and it is preferable to carry out the aerobic conditions at 25 ° C. to 37 ° C. for at least one day after induction of gene expression. As an antibiotic, kanamycin, ampicillin or the like may be added to the medium. If necessary, arabinose, indoleacrylic acid (IAA), isopropyl-β-D-thiogalactopyranoside (IPTG) or the like can be used as a gene expression inducer. A person skilled in the art can appropriately select culture conditions and conditions for inducing gene expression that are possible for desired gene expression.

(8) Control of composition ratio of monomer units in copolymerized PHA According to the present invention, a gene encoding one or more broad substrate specific PHA polymerases is introduced into a host different from the species of the gene. In the recombinant strain imparted with the ability to produce copolymer PHA, the gene encoding the PHA granule binding protein present in the recombinant strain is derived from the same species as the gene encoding the PHA polymerase. By substituting with a gene encoding, the composition ratio of the monomer units in the copolymerized PHA can be controlled. Here, as used herein, “control” means changing the composition ratio of the monomer units constituting the copolymerized PHA produced by the present invention to a desired value or range. More specifically, such a composition ratio is controlled by selecting genes introduced into the host (ie, exogenous phaC, phaP and phaJ having the same origin as the exogenous phaC), and appropriately changing the species. It can be carried out. Moreover, as one aspect, the expression of these genes introduced onto the chromosome can be performed by changing the activity of regulatory factors (eg, transcription factors, promoters, enhancers). Furthermore, mutation may be added to the gene introduced into the host to alter the function of the gene. These modifications can be performed using a general genetic engineering technique based on the genome information of the host and the base sequence information of the introduced gene. Moreover, you may change suitably the culture conditions of a recombinant strain.

In one embodiment of the present invention, when the copolymer PHA is poly (3-hydroxybutanoic acid-co-3-hydroxyhexanoic acid) (hereinafter sometimes referred to as “P (3HB-co-3HHx)”) The fraction of 3-hydroxyhexanoic acid (3HHx) in the copolymerized PHA can be controlled, and preferably the fraction of 3HHx can be increased, for example as detailed in Example 2 below. In addition, in the NSDG-PA _Cn J strain in which the host was a C. necator strain and phaC _NSDG and phaJ _Ac were introduced, the 3HHx fraction in P (3HB-co-3HHx) was 6.5 mol%. in contrast, the phaP1 _Cn gene present on the chromosome of the strain, by substituting phaP1 _Ac gene from the same A.caviae strain as phaC _NSDG gene, 3 The Hx percentage could be increased to 9.3mol%.

(9) Purification and structural analysis of copolymerized PHA In the present invention, copolymerized PHA can be purified as follows: a transformant is recovered from the medium by centrifugation, washed with distilled water, dried or frozen. dry. Thereafter, the transformant dried in chloroform is suspended and stirred at room temperature for a predetermined time to extract copolymerized PHA. In the extraction stage, heating may be performed if necessary. The residue is removed by filtration, methanol is added to the supernatant to precipitate copolymer PHA, and the precipitate is filtered or centrifuged to remove the supernatant and dried to obtain purified copolymer PHA. Thereafter, although not limited, the composition ratio of the monomer units of the obtained copolymer PHA can be confirmed using NMR (nuclear magnetic resonance) and gas chromatography.

In one embodiment of the present invention, when the copolymerized PHA is P (3HB-co-3HHx), the 3HHx fraction may be at least 1% mol or more, for example, 1 mol%, 2 mol%, 3 mol %, 4 mol%, 5 mol%, 6 mol%, 7 mol%, 8 mol%, 9 mol%, 10 mol%, or more. The 3HHx fraction may be 99 mol% or less, for example, 99 mol%, 98 mol%, 97 mol%, 96 mol%, 95 mol%, 94 mol%, 93 mol%, 92 mol%. 91 mol%, 90 mol%, or less. The possible range of the 3HHx fraction is not limited, but for example, 1 to 99 mol%, 1 to 95 mol%, 1 to 90 mol%, 1 to 85 mol%, 1 to 80 mol%, 1 to 75 mol %, 1 to 70 mol%, 1 to 65 mol%, 1 to 60 mol%, 1 to 55 mol%, 1 to 50 mol%, 1 to 45 mol%, 1 to 40 mol%, 1 to 35 mol%, 1 to 30 mol%, 1 to 25 mol%, 1 to 20 mol%, 2 to 99 mol%, 2 to 95 mol%, 2 to 90 mol%, 2 to 85 mol%, 2 to 80 mol%, 2 to 75 mol%, 2 to 70 mol%, 2 to 65 mol%, 2 to 60 mol%, 2 to 55 mol%, 2 to 50 mol%, 2 to 45 mol%, 2 to 40 mol%, 2 to 35 mol %, 2 to 30 mol%, 2 to 25 mol%, 2 to 20 mol%, 3 to 99 mol%, 3 to 95 mol%, 3 to 90 mol%, 3 to 85 mol% 3 to 80 mol%, 3 to 75 mol%, 3 to 70 mol%, 3 to 65 mol%, 3 to 60 mol%, 3 to 55 mol%, 3 to 50 mol%, 3 to 45 mol%, 3 to 40 mol%, 3 to 35 mol%, 3 to 30 mol%, 3 to 25 mol%, 3 to 20 mol%, 4 to 99 mol%, 4 to 95 mol%, 4 to 90 mol%, 4 to 85 mol %, 4 to 80 mol%, 4 to 75 mol%, 4 to 70 mol%, 4 to 65 mol%, 4 to 60 mol%, 4 to 55 mol%, 4 to 50 mol%, 4 to 45 mol%, 4 to 40 mol%, 4 to 35 mol%, 4 to 30 mol%, 4 to 25 mol%, 4 to 20 mol%, 5 to 99 mol%, 5 to 95 mol%, 5 to 90 mol%, 5 to 85 mol%, 5-80 mol%, 5-75 mol%, 5-70 mol%, 5-65 mol%, 5-60 mol%, 5-55 mol%, 5-50 mol%, 5-45 mol Le%, 5 to 40 mol%, 5 to 35 mol%, 5 to 30 mol%, 5 to 25 mol%, and 5 to 20 mol%. The 3HHx fraction is preferably 3 to 90 mol%, more preferably 4 to 80 mol%, and still more preferably 5 to 70 mol%. Here, the term “mol%” as used herein refers to the sum of the number of moles of each component in a multi-component system divided by the number of moles of a component. The copolymerized PHA obtained by the control method of the present invention is accumulated in the cells at a rate of 50 to 95% by weight, preferably 70 to 95% by weight, based on the dry cell weight.

Hereinafter, the present invention will be described more specifically based on examples. However, the present invention is not limited to the following examples.

Example 1 Production of Vector for Homologous Recombination A series of recombinant vectors used in the present invention were produced as follows. In the following operations, unless otherwise specified, KOD Plus DNA polymerase (Toyobo) is used as a DNA polymerase for PCR, and T4 polynucleotide kinase (Toyobo) is used for 5′-phosphorylation. Bovine small intestine-derived alkaline phosphatase (Toyobo) was used for 5'-dephosphorylation reaction, and Ligation High (Toyobo) was used for ligation of DNA fragments.

(1) Preparation of pK18ms-P1ud C.I. by PCR using the genomic DNA fragment of Necator H16 strain as a template and oligonucleotides of the following Sequence 1 and Sequence 2, and Sequence 3 and Sequence 4 as primers. The upstream region (0.84 kb) and the downstream region (0.81 kb) of the gene phaP1 _Cn encoding the PHA granule binding protein derived from the necator strain were each amplified. PCR was performed for 30 cycles with a reaction of 98 ° C. for 20 seconds, 59 ° C. for 20 seconds, and 68 ° C. for 70 seconds as one cycle.
Sequence 1: CGGGATCCCCTGGTGCACATCCAGGTCGACCACG (SEQ ID NO: 5)
Sequence 2: TGCTGGTCTCCAGTGGTGAACTTC (SEQ ID NO: 6)
Sequence 3: CGGGATCCGACGCGTTCTATGTTGCCTCTCAC (SEQ ID NO: 7)
Sequence 4: TAACTGCCCTGCGTTGAAGATGAC (SEQ ID NO: 8)

Next, the amplified downstream fragment of phaP1 _Cn was 5′-phosphorylated by kinase treatment and ligated with the upstream fragment. Using this ligated fragment as a template, a fragment (1.6 kb) in which the upstream and downstream of phaP1 _Cn were ligated was amplified by PCR using the oligonucleotides of sequence 1 and sequence 3 as primers. PCR was performed for 30 cycles, with a reaction of 98 ° C. for 20 seconds, 59 ° C. for 20 seconds, and 68 ° C. for 2 minutes as one cycle. The amplified upstream / downstream ligated fragment of phaP1 _Cn was 5′-phosphorylated by kinase treatment, and the vector plasmid pK18mobsacB was cleaved with HincII to prepare pK18ms-P1ud linked to the dephosphorylated fragment.

(2) Preparation of pEE32-NSDG pBBREE32-NSDG (Tsuge, T., et al., FEMS Microbiol. Lett (2007)) in which a mutated enzyme gene phaC _NSDG in which a double amino acid mutation is introduced into a PHA synthase derived from Caviae strain is cloned, is used as a template, and the following sequence PhaC _NSDG (1.8 kb) was amplified by PCR using oligonucleotides 5 and 6 as primers. PCR was performed for 30 cycles with a reaction of 98 ° C. for 20 seconds, 61 ° C. for 20 seconds, and 68 ° C. for 3 minutes as one cycle.
Sequence 5: ATGAGCCAACCATCTTATGGCCC (SEQ ID NO: 9)
Sequence 6: TCATGCCGCGTCTCTCCTCTTT (SEQ ID NO: 10)

Next, the phaP _Ac -phaC _Ac -phaJ _Ac EE32 fragment containing the plasmid pEE32 which was cloned (Patent Document 3) as a template, except phaC _Ac by PCR method using oligonucleotides of SEQ 7 and SEQ 8 below the primer The gene region (4.1 kb) was amplified. For PCR, KOD Plus Neo DNA polymerase (Toyobo Co., Ltd.) was used, and the reaction of 98 ° C. for 20 seconds, 61 ° C. for 20 seconds, and 68 ° C. for 2 minutes 30 seconds was performed for 30 cycles.
Sequence 7: GTGCTCTCCCTTCACCCACACCGA (SEQ ID NO: 11)
Sequence 8: GCGCACAATCCCTGGGAAGTAGGCCAGA (SEQ ID NO: 12)

Subsequently, the amplified phaC _NSDG fragment was 5′-phosphorylated by kinase treatment and ligated with the vector fragment obtained by removing phaC _Ac from pEE32. A plasmid in which phaC _NSDG was ligated in the same direction as the upstream and _downstream genes was selected and designated pEE32-NSDG.

(3) Preparation of pK18ms-P1ud-P _Ac A phaP _Ac fragment (0.35 kb) was amplified by PCR using pEE32 as a template and oligonucleotides of the following sequences 9 and 10 as primers. For PCR, a reaction of 98 ° C. for 20 seconds, 59 ° C. for 20 seconds, and 68 ° C. for 50 seconds was performed as 25 cycles.
Sequence 9: ATGAATATGGACGTGATCAAGAGCTTT (SEQ ID NO: 13)
Sequence 10: TCAGGCCTTGCCCGTGCTTTTTCTTGATG (SEQ ID NO: 14)

Next, the entire region (7.3 kb) was amplified by PCR using pK18ms-P1ud as a template and the oligonucleotides of sequence 2 and sequence 4 described above as primers, and at the junction of the phaP1 _Cn upstream region and phaP1 _Cn downstream region. An open vector fragment was obtained. For PCR, KOD Plus Neo DNA polymerase (Toyobo Co., Ltd.) was used, and the reaction was performed 30 cycles at 98 ° C. for 20 seconds, 63 ° C. for 20 seconds, and 68 ° C. for 4 minutes.

Subsequently, the amplified phaP _Ac fragment was 5′-phosphorylated by kinase treatment and ligated with a vector fragment opened from pK18ms-P1ud by PCR amplification. A plasmid in which phaP _Ac was ligated in the same direction as the promoter region was selected and designated pK18ms-P1ud-P _Ac .

(4) Preparation of pK18ms-P1ud-P _Ac CJ The phaP _Ac -phaC _NSDG -phaJ _Ac fragment (2.6 _kb ) was obtained by PCR using pEE32-NSDG as a template and the oligonucleotide of the sequence 6 and the sequence 11 shown below as primers. ) Was amplified. PCR was performed for 30 cycles with a reaction of 98 ° C. for 20 seconds, 61 ° C. for 20 seconds, and 68 ° C. for 3 minutes as one cycle.
Sequence 11: TCGACGCGGCCGCTTCGAAACTAGTTTAAGGCAGCTTGACCACGGCTTCCC (SEQ ID NO: 15)

Next, the amplified phaP _Ac -phaC _NSDG -phaJ _Ac fragment was 5′-phosphorylated by kinase treatment and ligated with the vector fragment opened from the above-mentioned pK18ms-P1ud by PCR amplification. A plasmid in which phaP _Ac -phaC _NSDG -phaJ _Ac was ligated in the same direction as the promoter region was selected and designated pK18ms-P1ud-P _Ac CJ.

(5) Preparation of pK18ms-P1ud-P _Ac J A vector fragment _obtained by removing the phaC _NSDG by PCR using pK18ms-P1ud-P _Ac CJ as a template and the oligonucleotides of the above-mentioned sequence 7 and sequence 12 as primers ( 8.2 kb) was amplified. For PCR, KOD Plus Neo DNA polymerase (manufactured by Toyobo Co., Ltd.) was used, and a reaction of 98 ° C. for 20 seconds and 68 ° C. for 4 minutes 30 seconds was performed for 30 cycles.
Sequence 12: ATGAGCGCACAATCCCTGGAAGTAG (SEQ ID NO: 16)
Next, the vector fragment that had been opened except for phaC _NSDG was 5′-phosphorylated by kinase treatment and self-ligated at both ends to prepare pK18ms-P1ud-P _Ac J.

(6) Preparation of pK18ms-P1ud-P1 _Cn CJ The phaP1 _Cn fragment (0.6 kb) (SEQ ID NO: 4) was amplified by PCR using the genomic DNA of necator H16 strain as a template and oligonucleotides of the following sequences 13 and 14 as primers. PCR was performed for 30 cycles, with a reaction of 98 ° C. for 20 seconds, 54 ° C. for 20 seconds, and 68 ° C. for 50 seconds as one cycle.
Sequence 13: ATGATCCTCACCCCGGGAACAA (SEQ ID NO: 17)
Sequence 14: TCAGGCAGCCCGTCGTCTTCTTTGCCCGT (SEQ ID NO: 18)

Next, phaP1 _Cn upstream-phaP _Ac -phaC _NSDG -phaJ _Ac -phaP1 _Cn downstream fragment (3. p.sup.18 ms-P1ud-P _Ac CJ as a template and PCR using the oligonucleotides of sequence 1 and sequence 3 described above as primers. 3 kb) was amplified. The amplified fragment is 5′-phosphorylated by kinase treatment, ligated to the HincII site of pK18mobsacB, a plasmid in which the fragment is ligated in the opposite direction to pK18ms-P1ud-P _Ac CJ is selected, and pK18ms-P1ud-P _Ac CJ-R.

Subsequently, a vector fragment (9.7 kbp) opened by removing the phaP _Ac by the PCR method using pK18ms-P1ud-P _Ac CJ-R as a template and the oligonucleotides of the sequence 2 and the sequence 15 shown below as primers. Amplified. For PCR, KOD Plus Neo DNA polymerase (Toyobo Co., Ltd.) was used, and the reaction was carried out for 30 cycles, with a reaction of 98 ° C. for 20 seconds, 59 ° C. for 20 seconds, and 68 ° C. for 5 minutes.
Sequence 15: TAACCCCCTGGCTGCCCGTTCGGGGCAGCCACATCTCCCCAT (SEQ ID NO: 19)

Thereafter, the amplified phaP1 _Cn fragment was 5′-phosphorylated by kinase treatment, and ligated with a vector fragment obtained by removing phaP _Ac from K18ms-P1ud-P _Ac CJ-R. A plasmid in which phaP1 _Cn was linked in the same direction as the promoter region and the downstream gene was selected and designated pK18ms-P1ud-P1 _Cn CJ.

(7) Preparation of pK18ms-P1ud-P1 _Cn J A vector fragment obtained by removing the phaP _Ac by PCR using pK18ms-P1ud-P _Ac J as a template and the oligonucleotides of sequence 2 and sequence 15 described above as primers ( 7.9 kbp) was amplified. For PCR, KOD Plus Neo DNA polymerase (Toyobo Co., Ltd.) was used, and the reaction was carried out for 30 cycles, with a reaction of 98 ° C. for 20 seconds, 59 ° C. for 20 seconds, and 68 ° C. for 5 minutes.

Next, the above-mentioned phaP1 _Cn amplified fragment was 5′-phosphorylated by kinase treatment, and ligated with the vector fragment obtained by removing phaP _Ac from pK18ms-P1ud-P _Ac J. A plasmid in which phaP1 _Cn was linked in the same direction as the promoter region and the downstream gene was selected and designated pK18ms-P1ud-P1 _Cn J.

Example 2: Production and PHA biosynthesis of NSDG-P1 _Cn J strain and NSDG-P _Ac J strain The gene (phaJ _Ac ) encoding R-hydratase derived from Caviae strain is C.I. NSDG-P1 _Cn J strain was inserted downstream of phaP1 _Cn of NSDG lines from necator strains, further A. This phaP1 _Cn is phaC _NSDG akin NSDG-P _Ac J strain substituted with phaP _Ac derived from Caviae strain was prepared, and its synthetic ability was examined. Specifically, it is as follows.

Using the recombinant plasmid pK18ms-P1ud-P1 _Cn J obtained in Example 1 (7), C.I. Necator NSDG strain was transformed by conjugation transfer. First, pK18ms-P1ud-P1 _Cn J was introduced into Escherichia coli S17-1 by the calcium chloride method. Next, this recombinant Escherichia coli was cultured overnight at 37 ° C. in 3.0 ml of LB medium (1% tryptone, 1% sodium chloride, 0.5% yeast extract, pH 7.2). In parallel with this, C.I. Necator NSDG strain was cultured overnight at 30 ° C. in 3.0 ml of NR medium (1% fish extract, 1% polypeptone, 0.2% yeast extract). Thereafter, C.I. The culture solution of necator NSDG strain (0.1 ml) was mixed and cultured at 30 ° C. for 6 hours. This bacterial cell mixture was applied to a Simons Citrate agar medium (Difco) supplemented with 0.2 mg / ml kanamycin and cultured at 30 ° C. for 3 days. The recombinant Escherichia coli plasmid is C.I. The bacterial cells transferred to the necator and incorporated into the chromosome by homologous recombination show kanamycin resistance, while the recombinant Escherichia coli cannot grow on the Simmons Citrate agar medium. PK18ms-P1ud-P1 _Cn J incorporated into the chromosome of the recombinant E. coli Necator transformant (pop-in strain). Further, the pop-in strain was cultured in NR medium at 30 ° C. overnight, applied to NR medium supplemented with 10% sucrose, and cultured at 30 ° C. for 3 days. Levansucrase encoded by sacB on the pK18mobsacB-derived vector accumulates toxic polysaccharide in cells using sucrose as a substrate. For this reason, only a strain from which the plasmid region has been eliminated (pop-out strain) can grow in a medium supplemented with 10% sucrose. From these colonies, a clone in which phaJ _Ac was inserted downstream of phaP1 _Cn on the chromosome was selected by the PCR method, and this was designated NSDG-P1 _Cn J strain.

Using the recombinant plasmid pK18ms-P1ud-P _Ac J obtained in Example 1 (5), NSDG strain was similarly transformed by conjugation transfer. PhaP1 _Cn on the chromosome from the colonies resulting pop-out line was replaced in phaP _Ac, further Clones PhaJ _Ac is inserted into the downstream were selected by PCR, which the NSDG-P _Ac J strain did.

Recombinant strains pre-cultured in NR medium (described above) were treated with 100 ml of MB medium (0.9% disodium hydrogen phosphate 12 hydrate, 0.15% potassium dihydrogen phosphate, 0.05% ammonium chloride, % Trace metal solution) and cultured with shaking in a Sakaguchi flask at 30 ° C. for 72 hours. 1% soybean oil was used as a carbon source. In addition, 0.1 mg / ml kanamycin is added to the medium. After culturing, the cells were collected by centrifugation, washed with 70% ethanol to remove the attached oil, and then washed with distilled water. The obtained cells were freeze-dried and the dry cell weight was measured.

2 ml of sulfuric acid-methanol mixture (15:85) and 2 ml of chloroform were added to 10-30 mg of dried cells and sealed, and heated at 100 ° C. for 140 minutes to obtain methyl ester of the degradation product of intracellular polyester. . 1 ml of distilled water was added thereto and stirred vigorously. After allowing to stand and separating into two layers, the lower organic layer was taken out. 0.5 ml of the organic layer was analyzed by capillary glass chromatography. GC-17A manufactured by Shimadzu Corporation was used for the gas chromatograph, and InertCap-1 (column length 25 m, column inner diameter 0.25 mm, liquid film thickness 0.4 μm) manufactured by GL Sciences was used for the capillary column. The temperature was raised from the initial temperature of 100 ° C. at a rate of 8 ° C./min. The prepared recombinant C.I. Table 1 shows the composition of related genes on the chromosome of the necator strain and the results regarding PHA production.

phaC _NSDG was introduced into pha operon on the chromosome, further NSDG-P1 _Cn J strain was inserted PhaJ _Ac to phaP1 _Cn downstream on the chromosome, soy oil carbon source 3HHx fraction of 6.5 mol% P ( 3HB-co-3HHx) was synthesized. In NSDG-P1 _Cn J strain, PHA synthase is A.I. derived from the Caviae strain and the major granule-binding protein is C.I. It is different from the necator strain. On the other hand, phaP1 _Cn on the chromosome is _converted to the same _A.P. In NSDG-P _Ac J strain, which was phaP _Ac derived from Caviae strain, the 3HHx fraction increased from 6.5 mol% to 9.3 mol% while the PHA production amount increased slightly.

Example 3: Production of NSDG-P1 _Cn CJ strain and NSDG-P _Ac CJ strain and biosynthesis of PHA Between NSDG-P1 _Cn J strain phaP1 _Cn and phaJ _Ac , and NSDG-P _Ac J strain phaP _Ac and phaJ prepared NSDG-P1 _Cn CJ Corporation further one copy of phaC _NSDG is inserted between the _Ac, and NSDG-P _Ac CJ strains were examined for their PHA biosynthesis ability. Specifically, it is as follows.

Using the recombinant plasmid pK18ms-P1ud-P1 _Cn CJ obtained in Example 1 (6), NSDG strain was similarly transformed by conjugation transfer. A clone in which phaC _NSDG -phaJ _Ac was inserted downstream of phaP1 _Cn on the chromosome was selected from the obtained popout colonies by PCR, and this was designated NSDG-P1ud-P1 _Cn CJ strain. Similarly, NSDG strain was similarly transformed by conjugative transfer using the recombinant plasmid pK18ms-P1ud-P _Ac CJ obtained in Example 1 (4). PhaP1 _Cn on the chromosome from the colonies resulting pop-out line was replaced in phaP _Ac, further Clones phaC _NSDG -phaJ _Ac is inserted into the downstream were selected by PCR, which NSDG-P _Ac CJ strain was designated.

In the same manner as in Example 2, the PHA production of the above recombinant strain was examined. Table 2 shows the composition of related genes on the chromosome of the prepared recombinant strain and the results relating to PHA production.

The phaC _NSDG introduced into pha operon on the chromosome, NSDG-P1 _Cn CJ strains inserting the phaC _NSDG and PhaJ _Ac further 1 copy phaP1 _Cn downstream on the chromosome, 3HHx fraction from soybean carbon source 10 .5 mol% P (3HB-co-3HHx) was synthesized. In NSDG-P1 _Cn CJ strain, PHA synthase is A.I. derived from the Caviae strain and the major granule-binding protein is C.I. It is different from the necator strain. On the other hand, phaP1 _Cn on the chromosome is _converted to the same _A.P. In NSDG-P _Ac CJ strain, which is phaP _Ac derived from Caviae strain, the 3HHx fraction increased from 10.5 mol% to 17.2 mol% while the PHA production amount increased slightly.

Example 4: Production of MF02-P _Ac strain and PHA biosynthesis The previously produced MF02 strain is a strain in which phaC _NSDG -phaJ _Ac is introduced into the chromosome pha operon, and 4.6 mol% 3HHx from soybean oil. A copolymer is biosynthesized (Patent Document 6). Using this strain as a parent strain, a MF02-P _Ac strain in which the main granule-binding protein gene phaP1 _Cn was replaced with phaP _Ac was prepared, and its PHA biosynthesis ability was examined. Specifically, it is as follows.

Using the recombinant plasmid pK18ms-P1ud-P _Ac obtained in Example 1 (3), the MF02 strain was similarly transformed by conjugation transfer. A clone in which phaP1 _Cn on the chromosome was replaced by phaP _Ac was selected from the obtained popout colonies by PCR, and this was designated as MF02-P _Ac strain.

As a result, the MF02 strain, which is derived from different PHA synthase and main granule binding protein, synthesized P (3HB-co-3HHx) having a 3HHx fraction of 4.6 mol% from a soybean oil carbon source. By replacing phaP1 _Cn on the chromosome of MF02 strain with phaP _Ac derived from the same as phaC _NSDG , the origin of the PHA synthase and the main granule binding protein is the same In the MF02-P _Ac strain derived from Caviae, the 3HHx fraction increased from 4.6 mol% to 6.4 mol% while the PHA production amount increased slightly.

Compared to the case where the origins of PHA synthase and the main granule binding protein are different, the strain with the same microbial species from both has improved the PHA production amount, and the 3HHx fraction is 1.4 to 1.7 times Could be increased. In particular, the NSDG-P _Ac J strain can biosynthesize about 9 mol% 3HHx-containing copolymer PHA that can be expected to show an appropriate degree of crystallinity and flexibility, compared to conventional strains. NSDG-P _Ac CJ strain efficiently biosynthesizes P (3HB-co-3HHx) with a high 3HHx fraction of 17.2 mol%. Such a copolymerized PHA having a high 3HHx fraction has a potential for new applications as a highly flexible bioplastic.

By modifying the granule-binding protein locus of the PHA-producing bacterium, an excellent copolymerized polyhydroxyalkanoic acid producing strain and a method for efficiently producing a copolymerized polyhydroxyalkanoic acid having a high 3HHx fraction are provided. A method for controlling the composition ratio of the monomer units can be provided.

All publications and patent literature cited herein are hereby incorporated by reference in their entirety. While specific embodiments of the invention have been described herein for purposes of illustration, it will be apparent to those skilled in the art that various modifications may be made without departing from the spirit and scope of the invention. It will be easily understood.

Claims (8)

1. In a recombinant strain imparted with the ability to produce copolymerized PHA by introducing a gene encoding one or more broad substrate specific polyhydroxyalkanoic acid (PHA) polymerizing enzymes into a host different from the species of the gene, A gene encoding a major PHA granule-binding protein in a recombinant strain, which is a gene encoding a PHA granule-binding protein derived from the same species as the gene encoding the PHA-polymerizing enzyme. A method for controlling the composition ratio of the monomer units.
2. A recombinant strain imparted with the ability to produce copolymerized PHA introduced with one or more genes encoding a broad substrate-specific PHA polymerase and one or more R-isomer-specific enoyl-CoA hydratase genes The method of claim 1, wherein
3. The process according to claim 1 or 2, wherein the copolymerized PHA is poly (3-hydroxybutanoic acid-co-3-hydroxyhexanoic acid) and increases the fraction of 3-hydroxyhexanoic acid in the copolymerized PHA. .
4. The method according to any one of claims 1 to 3, wherein the broad substrate-specific PHA polymerizing enzyme and the PHA granule-binding protein are derived from an Aeromonas caviae strain.
5. The method according to any one of claims 1 to 4, wherein the host is derived from a C. necator strain.
6. One of the genes encoding a broad substrate specificity PHA synthase is
   (A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1; or (b) an activity of hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 under stringent conditions and synthesizing PHA. Comprising a nucleic acid encoding a protein having; and a gene encoding a PHA granule binding protein used for replacement,
   (A) a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2; or (b) an activity that hybridizes with a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2 under stringent conditions and binds to PHA granules. The method according to any one of claims 1 to 5, which comprises a nucleic acid encoding a protein having
7. The R body specific enoyl-CoA hydratase gene is
   (A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 3; or (b) hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 3 under stringent conditions and in the middle of the fatty acid β-oxidation system The method according to any one of claims 1 to 6, comprising a nucleic acid encoding a protein having an activity of converting the body into (R) -3-hydroxyacyl-CoA.
8. One of the genes encoding a broad substrate specificity PHA synthase is
   (A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 1; or (b) an activity of hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 1 under stringent conditions and synthesizing PHA. Consisting of a nucleic acid encoding a protein having:
   One of the genes encoding PHA granule binding proteins used for replacement is
   (A) a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2; or (b) an activity that hybridizes with a nucleic acid comprising the nucleotide sequence represented by SEQ ID NO: 2 under stringent conditions and binds to PHA granules. And a R-form specific enoyl-CoA hydratase gene,
   (A) a nucleic acid comprising the base sequence represented by SEQ ID NO: 3; or (b) hybridizing with a nucleic acid comprising the base sequence represented by SEQ ID NO: 3 under stringent conditions and in the middle of the fatty acid β-oxidation system The method according to any one of claims 1 to 7, which comprises a nucleic acid encoding a protein having an activity of converting the body into (R) -3-hydroxyacyl-CoA.