WO2015117232A1 - Methods for sequential screening with co-culture based detection of metagenomic elements conferring heterologous metabolite secretion - Google Patents

Methods for sequential screening with co-culture based detection of metagenomic elements conferring heterologous metabolite secretion Download PDF

Info

Publication number
WO2015117232A1
WO2015117232A1 PCT/CA2015/000071 CA2015000071W WO2015117232A1 WO 2015117232 A1 WO2015117232 A1 WO 2015117232A1 CA 2015000071 W CA2015000071 W CA 2015000071W WO 2015117232 A1 WO2015117232 A1 WO 2015117232A1
Authority
WO
WIPO (PCT)
Prior art keywords
reporter
metabolite
interest
mie
metagenomic library
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/CA2015/000071
Other languages
French (fr)
Inventor
Steven HALLAM
Cameron R. STRACHAN
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of British Columbia
Original Assignee
University of British Columbia
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of British Columbia filed Critical University of British Columbia
Priority to US15/115,644 priority Critical patent/US20170226503A1/en
Publication of WO2015117232A1 publication Critical patent/WO2015117232A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1079Screening libraries by altering the phenotype or phenotypic trait of the host
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1082Preparation or screening gene libraries by chromosomal integration of polynucleotide sequences, HR-, site-specific-recombination, transposons, viral vectors
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1086Preparation or screening of expression libraries, e.g. reporter assays
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/10Processes for the isolation, preparation or purification of DNA or RNA
    • C12N15/1034Isolating an individual clone by screening libraries
    • C12N15/1093General methods of preparing gene libraries, not provided for in other subgroups

Definitions

  • This invention relates to the field of metagenomic screening.
  • the invention relates to functional metagenomic library screening methods for detecting metabolite secretion or extracellular chemical transformations.
  • lignin is the second most abundant biopolymer on earth and a promising feedstock for deriving energy and industrial chemical precursors from renewable plant resources 6 -?.
  • the synthesis of lignin occurs within plant cell walls by free radical reactions that cross-link diverse combinations of monoaromatic compounds into a heterogeneous matrix that is resistant to microbial and chemical assailment 8 .
  • Lignin recalcitrance is further reflected in the deposition of coal throughout the Carboniferous period prior to the emergence of fungal enzymes associated with lignolysis in Permian forest soil ecosystems .
  • metagenome screening methods have been developed to isolate useful genes from metagenomes. For example, metagenomic nucleotide sequencing methods 1 , and enzyme activity based screening 2 . Further enzyme activity based screening methods have been developed, such as Substrate-Induced Gene-Expression (SIGEX) screenings and more recently Product-Induced Gene-Expression (PIGEX) screening ⁇ . Furthermore, several screening strategies have been developed to discover genetic elements that are activated in response to a metabolite, including intragenic genomic libraries and promoter trapss.
  • SIGEX Substrate-Induced Gene-Expression
  • PIGEX Product-Induced Gene-Expression
  • the present application is based in part on the discovery that previously
  • MIE metabolite inducible elements
  • a transposon retrofitted MIE library has advantages to other MIE screening methods such as restriction digestion libraries. Restriction digestion libraries have several limitations. For example, if any regulators or machinery is found downstream (for example, beyond an operon and is necessary for the MIE) such other methods would miss it, since the reporter in these systems is the last gene in the construct and thus could inherently limit what could be retrieved.
  • the metabolite of interest is only one enzymatic conversion away from the substrate. Focusing on degree of separation away greatly limits the ability to recover more extensive biosynthetic pathways, whether they comprise an operon, interact with host metabolism, or act in a segmented or distributed pathway between two or more members of the community. This is because the substrate selection creates a bias against the preceding steps in the biosynthesis pathway. Accordingly, to be sure that the biosynthetic pathway of interest is selected, it is often important to consider the media (for example, are all substrates present) and the final product you are interested in detecting.
  • a method including: (a) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene and selectable marker; (b) screening the randomly inserted first metagenomic library by adding a metabolite of interest; (c) detecting reporter gene expression following the addition of the metabolite of interest to identify a metabolite induced element (MIE); (d) preparing a reporter strain, the reporter strain including: (i) the MIE; and (ii) a reporter gene adjacent the MIE; (e) co- culturing heterologous host cells expressing a second metagenomic library with the reporter strain; and (f) detecting the reporter gene activity in the co-culture.
  • MIE metabolite induced element
  • a method including: (a) obtaining a reporter strain, the reporter strain including: (i) a metabolite induced element (MIE), wherein the MIE is responsive to a metabolite of interest; and (ii) a reporter gene adjacent the MIE; (b) co-culturing heterologous host cells expressing a functional metagenomic library with the reporter strain; and (c) detecting the reporter gene activity in the co-culture.
  • MIE metabolite induced element
  • a method including: (a) obtaining a reporter construct, the reporter construct including: (i) a metabolite induced element (MIE), wherein the MIE may be responsive to a metabolite of interest; and (ii) a reporter gene; (b) transforming a reporter strain with the reporter construct from (a); (c) co-culturing the reporter strain with a heterologous host cells expressing a functional metagenomic library; and (d) detecting the reporter gene activity in the co-culture.
  • MIE metabolite induced element
  • a method including: (a) obtaining a reporter construct, the reporter construct including: (i) a metabolite induced element (MIE), wherein the MIE may be responsive to a metabolite of interest; and (ii) a reporter gene; (b) transforming a cell with the reporter construct from (a) to form a reporter strain; (c) growing heterologous host cells expressing a functional metagenomic library; (e) adding the reporter strain from (b) to the MIE.
  • MIE metabolite induced element
  • heterologous host cells expressing a functional metagenomic library to form a co- culture; and (f) detecting the reporter gene activity in the co-culture.
  • the method may further include testing the MIE for specificity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain.
  • the method may further include testing the MIE for sensitivity to the metabolite of interest prior to co-culturing the
  • the method may further include testing the MIE for avidity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain.
  • the method may further include engineering the MIE to obtain the desired substrate specificity, sensitivity, and/or avidity following testing the MIE for specificity, sensitivity and/or avidity to the metabolite of interest.
  • the functional metagenomic library may be a fosmid library.
  • the method may further include mutagenesis of functional metagenomic host cells producing a product that results inreporter strain activity.
  • the method may further include screening for production of the metabolite of interest.
  • the reporter strain cells and the heterologous host cells expressing a functional metagenomic library may be cultured in a plate-based format.
  • the MIE may be obtained from a functional metagenomic library.
  • the reporter strain may be a bacterial cell.
  • the heterologous host cells expressing a functional metagenomic library may be bacterial cells.
  • the bacterial cell may be an E. coli cell.
  • the method may further include isolating the co-culture having reporter gene activity.
  • the method may further include culturing the host cells having reporter gene activity to produce the metabolite of interest.
  • a method including: (a) choosing a first metabolite of interest and a first substrate; (b) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene; (c) screening the randomly inserted first metagenomic library by adding the first metabolite of interest; (d) detecting reporter gene expression following the addition of the first metabolite of interest to identify a first metabolite induced element (MIEi); (e) preparing a first reporter strain, the reporter strain including: (i) the MIEi; and (ii) a reporter gene adjacent to MIEi; (f) co- culturing heterologous host cells expressing a second metagenomic library with the first reporter strain in the presence of the first substrate; (g) detecting the reporter gene activity in the co-culture; and (h) repeat steps (a)-(f) as desired
  • the method may further include testing the one or more MIEs for specificity to the metabolites of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strains.
  • the method may further include testing the one or more MIEs for sensitivity to the metabolites of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strains.
  • the method may further include testing the one or more MIEs for avidity to the metabolites and DNA binding site of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strains.
  • the method may further include engineering the one or more MIEs to obtain the desired substrate specificity, sensitivity and/or avidity following testing the one or more MIEs for specificity, sensitivity and/or avidity to the metabolites of interest.
  • the functional metagenomic library may be a fosmid library.
  • the method may further include mutagenesis of functional metagenomic host cells producing reporter strain activity and further screening for production of the metabolite of interest.
  • the reporter strain cells and the heterologous host cells expressing a functional metagenomic library may be cultured in a plate-based format.
  • the one or more MIEs may be obtained from a functional metagenomic library.
  • the reporter strain may be a bacterial cell.
  • the heterologous host cells expressing a functional metagenomic library may be bacterial cells.
  • the bacterial cell may be E. coli cells.
  • the method may further include isolating the co-culture having reporter gene activity.
  • the method may further include culturing the host cells having reporter gene activity to produce the metabolite of interest.
  • a method including the steps of: (a) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene; (b) screening the randomly inserted first metagenomic library by adding a metabolite of interest; (c) detecting reporter gene expression following the addition of the metabolite of interest to identify a metabolite induced element (MIE); and (d) preparing a reporter strain, the reporter strain including: (i) the MIE; and (ii) a reporter gene adjacent the MIE.
  • the method may further include the step of: (e) co-culturing heterologous host cells expressing a second metagenomic library with the reporter strain.
  • the method may further include the step of: (f) detecting the reporter gene activity in the co-culture.
  • the method may further include testing the MIE for specificity and sensitivity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain.
  • the method may further include engineering the MIE to obtain the desired substrate specificity and sensitivity following testing the MIE for specificity and sensitivity to the metabolite of interest.
  • the functional metagenomic library may be a fosmid library.
  • the method may further include mutagenesis of functional metagenomic host cells producing reporter strain activity and further screening for production of the metabolite of interest.
  • the reporter strain cells and the heterologous host cells expressing a functional metagenomic library may be cultured in a plate-based format.
  • the MIE may be obtained from a functional metagenomic library.
  • the reporter strain may be a bacterial cell.
  • the heterologous host cells expressing a functional metagenomic library may be bacterial cells.
  • the bacterial cell may be an E. coli cell.
  • the bacterial cells may be E. coli cells.
  • the method may further include isolating the co-culture having reporter gene activity.
  • the method may further include culturing the host cells having reporter gene activity to produce the metabolite of interest.
  • FIGURE l shows PemrR-GFP biosensor discovery and characterization, wherein (A) Screening E.coli intragenic regions with monaromatic lignin
  • transformation products including vanillin, vanillic acid, p-coumaric acid, vanillyl alcohol and veratryl alcohol.
  • B Relative reporter signal after incubation with 0.5 mM of select benzene derivatives for 2 hrs. Tree represents hierarchical clustering of the compound similarity using the single linkage algorithm.
  • C Reporter sensitivity after 2 hrs.
  • FIGURES 2A and 2 B show the profiling of monoaromatic compounds by GC- MS, wherein relative ratios of lignin related monoaromatic compounds in culture supernatant as compared to a control strain harboring an empty fosmid. Clones were incubated with both (A) HKL-Fi and (B) HP-LTM in minimal media;
  • FIGURE 3 shows genetic context maps for active fosmids, wherein functional classes related to lignin degradation, CAZy auxiliary enzymes, mobile elements, transposon insertions (Z-score ratio cutoff for decrease in GFP fluorescence, see TABLE 2), and tRNAs are annotated.
  • the G+C ratio for every 200 nucleotides and gene abundance determined by mapping over 500 million illumina reads sourced from the coal bed milieu is also displayed. Connections represent protein homologs with minimum 50% identity and an e-value of 10E-20;
  • FIGURES 7A-F show the growth kinetics of emrR and emrB knockouts in subinhibitory concentrations of monoaromatic compounds, wherein wild-type ( ⁇ ), emrR ⁇ - )(o), and emrB -) n strains were grown in the presence of 0.5 mM of various
  • FIGURE 8 shows the effect of emrR knockout on growth kinetics in the presence of enzyme treated lignin, wherein the effect of 0.5 g/L of HWKL Fi (00 ⁇ ) and DypB N246A treated HWKL Fi (DVX) in emrR and emrB knockout backgrounds
  • FIGURE 11 shows precipitation phenotypes, wherein various fosmid clones incubated alone or in combination with HWKL Fi or HP-LTM in minimal media for 16 hrs.
  • FIGURE 12 shows GC-MS profiles of transposon mutants, wherein the chromatograms compare two transposon mutants identified by screening with the PemrR-GFP biosensor (both interrupting putative oxidoreductase open reading frames).
  • FIGURE 13 shows comparative analysis of active fosmids, wherein the bar graphs show the relative number of annotated genes falling within the six functional classes implicated in lignin transformation phenotypes (out of 813 total genes).
  • FIGURE 14 shows a graphic overview of an embodiment of the method for isolating metabolite induced elements (MIEs) from a metagenomic library and construction of a metagenomic library for sequential screening with co-culture based detection of meteagenomic elements conferring heterologous metabolite secretion products from a functional metagenomic library.
  • MIEs metabolite induced elements
  • FIGURE 15 shows a graphic representation of environmental DNA (i.e.
  • metagenomic DNA libraries being "retroffited” randomly with a promoter less reporter gene (arrows) to produce clones that are screened for induction by addition of a metabolite of interest to identify a metabolite induced element (MIE).
  • MIE metabolite induced element
  • FIGURES 16A and B show a fluoresence plot for a retroffited metagenomic library (constructed using the method in FIGURE 15) that was assayed for fluorescence emitted by a fluorescent marker wherein the library was (A) Uninduced (i.e. no metabolite of interest is added) and (B) Induced (i.e. where the metabolite of interest is added - a pool of pCoumaric acid, Vanillic acid and Vanillin), also showing a circled data point that represents a fosmid clone harboring a putative MIE (pioc2o) selected for further investigation.
  • Uninduced i.e. no metabolite of interest is added
  • Induced i.e. where the metabolite of interest is added - a pool of pCoumaric acid, Vanillic acid and Vanillin
  • FIGURE 17 shows a bar graph of an assay to validate the MIE identified in FIGURE 16 (piOC20), wherein the MIE pioc20 was found to be most responsive to 1 raM pCoumaric acid.
  • 'metagenomic is meant to include any genetic material obtained from an environmental source, as opposed to a laboratory cultured source. In many cases the actual origin (i.e. species or strain) of organism from which the genetic material is obtained may not be known.
  • a 'functional metagenomic library' is a gene library produced from a metagenomic source or sources, wherein the genes within the library are capable of expression.
  • mobile genetic element is meant to include any type of nucleic acid molecule that is capable of movement within a genome and from one genome to another.
  • transposons or transposable elements including
  • retrotransposons DNA transposons, and insertion sequences
  • plasmids plasmids
  • bacteriophage elements including Mu; and group II introns.
  • 'promoter' is meant to include any regulatory region of DNA often acting as a control sequence to regulate adjacent gene transcription.
  • 'reporter' or 'reporter gene' are used interchangeably and are meant to include any gene that when expressed produces a detectable product (for example green fluorescent protein (gfp); luciferase; ⁇ -galactosidase (LacZ); ⁇ -glucuronidase (GUS); chloramphenicol acetyltransf erase (cat); or neomycin phosphotransferase (neo) to name just a few).
  • the detection may be based on a coloured product, a fluorescent, a resistance to an antibiotic or other chemical substrate, etc.
  • Reporters are often placed adjacent to a regulatory sequence and may be an indicator of another genes activity or in the case of the metabolite induced element (MIE) it may be an indication of the activation of the reporter by a metabolite of interest acting through a transcriptional regulatory mechanism and thereby an indication that the metabolite of interest is present.
  • MIE metabolite induced element
  • 'metabolite induced element' or 'MIE' refers to one or more of the following: a promoter; an enhancer; an operator region; a transcriptional regulator; a DNA aptamer; or RNA aptamer, which facilitate a change in gene expression based on the presence of a metabolite of interest.
  • a reporter strain' is meant to refer to a cell comprising an MIE and a reporter gene adjacent the MIE.
  • sensitivity' is meant to refer to the dynamic range of reporter outputs possible with a given MIE.
  • MIE Metabolite Inducible Element
  • promoter trap and intragenic genomic libraries Several screening strategies have been developed to discover genetic elements that are activated in response to a metabolite or a Metabolite Inducible Element (MIE), including promoter trap and intragenic genomic libraries.
  • MIE Metabolite Inducible Element
  • the process described herein may begin by applying one of these methods to recover an inducible element that may then be further engineered, if necessary, to obtain the desired substrate specificity and sensitivity.
  • a MIE may be obtained from a MIE library already discovered. These known MIEs may also, if necessary to obtain the desired substrate specificity and sensitivity, be further engineered.
  • the MIE may then be placed adjacent (usually upstream) of a marker gene, (for example, green fluorescent protein (GFP)), and transformed into a bacterial strain (for example, E.
  • GFP green fluorescent protein
  • a reporter strain may be developed to identify multiple metabolites of interest, by placing different MIEs adjacent different reporters (for example, a product that fluoresces in a different colour). Such reporters may be all in a single reporter strain. Target metabolites may then be selected based on the potential benefit to industry (for example, secreted and/or synthesized by a
  • мем ⁇ ран ⁇ examples include, valuable isomeric compounds used as intermediates in the production of pharmaceuticals and those that can replace expensive crude oil dependent synthesis.
  • the reporter strain therefore senses the presence of a valuable compound/metabolite input and generates an output that can be easily measured with spectroscopic robotics.
  • Functional metagenomic libraries may be constructed in heterologous hosts, (for example, E. coli), to bioprospect the metabolic potential of uncultivated microbes from natural and human engineered ecosystems. Common vehicles for this process are fosmids as they have copy-control systems available for modulating gene expression and can stably harbor up to 40 kB of environmental DNA.
  • the ability to harbor over 40 kB of environmental DNA is important since microbial genes are often found in operons, whereby the genes contained therein are regulated by a single promoter or regulatory signal, and work together to achieve a particular goal. For example, the processing of a substrate to produce a metabolite of interest.
  • a reporter strain may be added in co-culture. If the reporter strain is activated, the compound of interest will have had been secreted by the environmental DNA containing E. coli.
  • the genes involved which can comprise biosynthetic clusters, regulatory machinery and/or secretion apparatuses may be identified through transposon metagenesis and re-screening.
  • reporter constructs may be originally discovered through screening for compound-specific activation prior to interrogating metagenomic libraries.
  • an E. coli library of GFP transcriptional fusions to approximately 2000 promoters on low copy plasmids was screened for substrate-induced expression using a pool of monocyclic aromatic acids.
  • a single reporter was identified that regulates the emrRAB operon encoding a transcriptional regulator (emrR) and multidrug resistance pump (emrAB) for extrusion of toxic compounds.
  • emrR transcriptional regulator
  • emrAB multidrug resistance pump
  • this resistance pump in E. coli was only known to be regulated by a small number of antibiotic substrates that do not include the compounds used in the screen.
  • the substrate range of this reporter system was characterized and showed that sensitivity could be modulated via plasmid copy number.
  • the reporter was then applied in screening a coal bed derived fosmid library before responsible genes were identified on selected clones and the compounds being secreted were identified by gas chromatography-mass spectrometry (GC-MS).
  • GC-MS gas chromatography-mass spectrometry
  • some embodiments of the present methods may also address the problem of availability of MIEs and some embodiments also have the potential to address the inherent host compatibility problems associated with screening
  • the present methods may be iterative and thus more agile than prior art methods.
  • Uchiyama and Miyazakis ligate 7kB fragments into a vector containing a promoter-less GFP. This was building from standard promoter trap methods that have been used in genetics for many years. The use of mobile genetic elements and large inserts (for example, more than lokB) give limitless combinatorial potential, agility and efficiency - to the extent that our method could possibly access every MIE that exists in prokaryotes. The same is not true for the Uchiyama and Miyazakis method. The Uchiyama and Miyazakis method is dependent on ligation, restriction enzymes, and a static vector-based fluorescent marker. This puts both size limitations on the DNA fragments and excludes functioning components that happen to be downstream of the reporter.
  • the genes are restricted to a linear orientation, whereby you can only insert the GFP in order going down the DNA strand.
  • the GFP in order to capture all the functioning components of the operon, it would have to cut the detecting DNA right at the end before the terminator (a range of a few base pairs) or else interrupt the operon as you move toward the promoter.
  • MGE mobile genetic element
  • the marker can insert anywhere in the operon, whether it disrupts a gene or not.
  • the Uchiyama and Miyazakis method is locked in terms of directionality and number of markers.
  • the MGE containing marker can insert in any direction with any number of other markers (or complimentary markers) into the same large insert.
  • MGEs can be non-biased or purposefully bias based on the flanking sequences. You can increase relative amounts of homologous recombination with your insertions (MGEs) and target different DNA properties or sequences. This could be as broad as to target specific GC contents or as specifically to target desired insertion sites. Since DNA synthesis is inexpensive, modifying MGEs in such as way becomes trivial and makes the present method much more agile. MGEs enable all the retrofitting and MIE discovery steps in the method to be performed in vivo. Accordingly, DNA does not need to be cut up each time and re-cloned. Using the methods described herein, existing libraries may be retrofit in the cells they already reside in, which is much more efficient.
  • transposon retrofitted MIE library method do not depend on restriction digestion as does SIGEX. Restriction digestion has several limitations, for example, if any regulators or machinery is downstream (beyond an operon and necessary for the MIE) SIGEX would miss it as GFP is the last gene in the construct. This would inherently limit what could be retrieved.
  • the embodiments of the present method have the potential to identify "unknown” regulators, "unknown” pathways and
  • PIGEX adds a substrate that is one enzymatic conversion away from the step they are targeting. Doing this places limits on the ability to detect biosynthetic pathways (whether they comprise an operon, interact with host metabolism, or a segmented pathway). This is because the substrate creates a heavy selection against the preceding steps in the biosynthesis pathway. To make sure selection is for a biosynthetic pathway, there has to be careful considerations for the media (all substrates present) and the final product being detected.
  • Compatibility is also an issue, wherein the use of large insert libraries can be very powerful in overcoming this, identifying an MIE from a functional metagenomic library, examining the MIE for compatibility with the host strain, which may be selected by the MIE screen, since the same bacteria may be used in the MIE screen and metagenomic library screen.
  • transducer would be limited to what is present in the host. Thus, if it worked in the screen, it is very unlikely to be incompatible with that host.
  • a novel set of genes conferring the ability to secrete aromatics, including those that can be derived from lignin. The detection of heterogeneous aromatic secretion in growth media was identified using the emrR reporter system.
  • the system described has the potential to provide sustainable biological production of pure enantiomeric products. Such products could have decreased costs as compared to chemical synthesis. Furthermore, the methods described herein are promising for bioprospecting applications in the discovery of novel enzyme products for consumer and industrial markets. Furthermore, the number of potential diverse and often extreme environments that may be screened for novel microbial genes that may act as a rich source of material for novel enzyme products is somewhat limitless.
  • Strains, plasmids and oligonucleotides used are set out below. Detailed procedures for construction of vectors, characterization of the PemrR-GFP biosensor and high- throughput screening are described in the Methods section. All DNA manipulations were performed according to standard procedures. Fosmid library preparation, transposon mutagenesis, and purification were performed with kits sourced from Epicenter (IlluminaTM).
  • steps 1-3 show a random insertion of a mobile genetic element (for example, transposons) comprising a promoterless green fluorescent protein (gfp) gene into a metagenomic library to produce a metagenomic library retrofitted with a promoterless reporter.
  • steps 4-6 show screening with for a MIE using a metabolite of interest to obtain a reporter strain (step 7).
  • steps 8-14 a metagenomic library is assembled from bacterial samples obtained from a coal bed, but a person of skill in the art would appreciate that metagenomic libraries may be obtained from any number of sources depending on the metabolites of interest and samples that are available. Furthermore, the metagenomic library produced in steps 8-14 may be the same as the metagenomic library used to produce the metagenomic library retrofitted with a promoterless reporter of steps 1-7 or may be entirely different. In steps 15-18 a co-culture based screening is performed with the previously discovered reporter strain to select a metagenome element conferring metabolite secretion.
  • steps 1-7 may be repeated to identify additional metabolites of interest further down a pathway of interest as many times as needed.
  • the metabolite of interest may be produced by the clone or clones of interest for further characterization, study or as a source of the metabolite of interest.
  • Minimal media consisted of M9 minimal media supplemented with glucose (0.4%), arabinose (100 g ml-i), leucine (40 ⁇ g ml-i), MgS04 (1 mM) and thiamine (2 ⁇ ). Lysogeny broth (LB) and minimal media were supplemented with Kanamycin (50 ⁇ g ml-i), Chloramphenicol (12.5 ⁇ g ml- 1), and Ampicillin (100 ⁇ g ml-i) to maintain pUA66, PCCifos and pBAD24, respectively.
  • emrR JW2659-1
  • emrA JW2660-1
  • emrB BW25112 knockout and cognate wild-type strains were obtained from the Keio collection through the Coli Genetic Stock Center (CGSC). All cultures were grown at 37°C in a 220 r.p.m. rotary shaker unless otherwise stated.
  • the emrRAB promoter region (see the sequence below) and GFP were amplified from the pUA66 backbone with primers Frep (Promoter - EcoRl
  • a library of 1,820 E. coli K12 MC1655 intragenic regions fused to gfpmut2 on low copy plasmids was replicated into 96-well round-bottom culture plates containing M9 minimal medium supplemented with glucose. After growth overnight, a compound pool comprising 1 mM Vanillin, vanillic acid, p-coumaric acid, vanillyl alcohol and veratryl alcohol was added. The plates were then incubated and GFP fluorescence was measured by reading excitation at 481 nm and emission at 508 nm on a Varioscan Flash Spectral Scanning Multimode Reader (Thermo ScientificTM) before selecting the most active clone (all GFP measurements were made as described here).
  • PemrR-GFP biosensor was grown overnight and diluted 1/10 in 180 ⁇ , of LB.
  • the compound of interest dissolved in 20 ⁇ , of 30% DMSO was then added before a 2 hr incubation and subsequent reading of GFP fluorescence.
  • Arabinose was removed from the media when comparing the effect of plasmid copy number.
  • PemrR-GFP was diluted 1/10 and incubated in M9 minimal medium with glucose (0.5%), 0.5 ⁇ g HKL-Fi, manganese (40 mM), glucose oxidase (100 nM) and DypB N246A (50 nM). GFP measurements were made every 30 min.
  • Minimal media was stirring at 37°C before 1 g/L of HP-LTM and HKL-Fi dissolved in DMSO (3% final DMSO) was added.
  • the media (lignin amended media) was allowed to stir for 1 hr before being filtered through a 0.2 ⁇ DMSO safe filter (ExpressPlusTM from MilliporeTM) to remove any precipitate.
  • the EPI300 strains harboring fosmids were then inoculated 1/10,000 in 5 mL of lignin media from an overnight culture in LB. The cultures were allowed to grow for 16 hr before cells were spun down at 16,000 x g for 10 min and culture supernatant was removed. The culture supernatant was acidified using formic acid (10 % final concentration v/v).
  • GCMS was performed using an HP 66890 series GC system fitted with an HP 5973 mass selective detector and a 30 x 250 ⁇ HP-5MS AgilentTM column.
  • the operating conditions were TGC (injector), 280 °C; TMS (ion source), 230 °C; oven time program (To min), 120 °C; T2 min, 120 °C; T45 min, 300 °C (heating rate 4 °C mini); and T54 min, 300 °C.
  • the injector volume was 1 ul.
  • PBAD24 expressing emrR was induced with 0.06 mM arabinose.
  • a fosmid library was prepared from coal bed core samples provided by Alberta
  • 60,000 clone libraries were replicated using a Qpix2 robotic colony picker (GenetixTM) in 384-well black plates. Clones were grown in 45 ⁇ . of LB for 12 hrs and 20 of LB containing HP-LTM (added as described in the GC-MS profile section) was then added for another 5 hr incubation. The PemrR-GFP biosensor was then added by diluting an overnight culture 4 and adding 20 ⁇ L and incubated for 3 hrs before florescent measurements were taken.
  • fosmid DNA was extracted using the FosmidMax DNA preparation kit (EPICENTERTM) according to the manufacturer's protocols. Contaminating E. coli DNA was removed using PlasmidSafe DNaseTM (EPICENTERTM). All DNA concentrations were determined using Quant-iT PicoGreenTM (InvitrogenTM) and 500 ng of each fosmid was sent to Michael Smith's Genome Science Center (B.C., Canada) for sequencing on a Illumina GAIIx sequencer (IlluminaTM).
  • FosmidMax DNA preparation kit EPICENTERTM
  • Contaminating E. coli DNA was removed using PlasmidSafe DNaseTM (EPICENTERTM). All DNA concentrations were determined using Quant-iT PicoGreenTM (InvitrogenTM) and 500 ng of each fosmid was sent to Michael Smith's Genome Science Center (B.C., Canada) for sequencing on a Illumina GAIIx sequencer (IlluminaTM).
  • a Tns transposon mutagenesis library was created using the EZ-Tns kan insertion kit (EPICENTERTM). Approximately 384 mutants were arrayed for re-screening as described in the high-throughput screening section. Mutants were Sanger sequenced (Applied Biosystems 3730 systemTM) at Michael Smith's Genome Science Center (B.C., Canada) and activity was mapped to fosmid position using
  • ORFs open reading frames
  • an E. coli clone library of fluorescent transcriptional reporters was interrogated with a mixture of lignin transformation products including vanillin, vanillic acid and -coumaric acid (FIGURE lA) 16 .
  • the most responsive clone harbored a promoter regulating the emrRAB operon, encoding a negative feedback transcriptional regulator ⁇ emrR) and multidrug resistance pump (emrAB) that is known to act on various structurally unrelated antibiotics 1 ⁇ * 8 . Since the compounds used to identify the emrR promoter were not previously been shown to induce emrRAB expression, response specificity was evaluated using a library of monoaromatic compounds
  • FIGURE lB Sensitivity of detection was observed to increase with promoter copy number reaching a lower detection threshold of 50 ⁇ using the three most active lignin transformation products (FIGURE 4, FIGURE lC).
  • the capacity of this promoter to detect in vitro lignin transformation was demonstrated by monitoring formation of monoaromatic products from a solvent fractionated hardwood kraft lignin (HKL-Fi) using an engineered manganese-oxidizing dye decolorizing peroxidase (DypB N246A) 10 (FIGURE ID).
  • Metagenomic libraries from CO182 and CO183 were constructed using the Fosmid CopyControl system (pCCiFOS) from EpiCentre, as previous reports suggest that increased copy number enhances heterologous gene expression in the EPI300 E. coli host 21 .
  • the PemnR-GFP biosensor (a reporter strain) was transferred to the pCCiFOS vector used in library production to facilitate co-culture based screening using shared antibiotic selection.
  • a total of 46,000 fosmids arrayed in 384-well plates were grown in the presence of HKL-Fi overnight prior to the addition of the biosensor.
  • Co-cultures were subsequently grown for three hours prior to measuring GFP fluorescence. Fluorescent signals were normalized to background and corrected for edge effects. Consequently, 24 fosmids activating the emrR biosensor (16 from CO182 and 8 from CO183) were selected for downstream functional characterization and sequencing (FIGURE 10).
  • mapping the location of each transposon insertion identified six functional classes implicated in lignin transformation phenotypes. These included genes predicted to encode electron transfer (unassigned oxidoreductase activity), co-factor generation (hydrogen peroxide formation), protein secretion
  • 182J 3_F1 _ 1 signal peptide peptidase EHY78341.1 18604 19587 #N/A #N/A
  • PAS PAC sensor hybrid histidine kinase YP 006458683.1 24916 27147 SEC PAS
  • PAS PAC sensor hybrid histidine kinase YP 005940175.1 9671 1 1902 SEC PAS
  • chromatogram compares two transposon mutants (i.e. position 4949 and position 55060) identified by screening with the PemrR-GFP biosensor, wherein both are known to be interrupting putative oxidoreductase open reading frames.
  • the data was normalized to an empty fosmid clone (i.e. i82_o8_C2i).
  • Lignin related compounds 2,4- dihydroxybenzoic acid, i,4-dihydroxy-2,6-dimethoxybenzene and benzoic acid are marked by A, B and C. There are clear differences shown between the two transposon mutants and the empty fosmid clone.
  • FIGURE 13 provides a graphical representation of the relative proportions of genes grouped into six functional classes, implicated in lignin transformation phenotypes (out of 813 total genes) in the active fosmids identified in the exemplary screen. It is interesting to note that these 6 functional classes are consistently represented in the isolated fosmids and with the exception of the secretion apparatus and perhaps the oxidoreductase, these genes are represented quite consistently within the active fosmids identified in this exemplary screen.
  • a metagenomic DNA library was "retroffited” as described herein and shown in
  • FIGURE 15 to identify a metabolite induced element (MIE).
  • MIE metabolite induced element
  • FIGURE 16 fhioresence plots are shown for a retrofflted metagenomic library assayed for fluorescence emitted by the fluorescent marker.
  • FIGURE 16 (A) shows the
  • FIGURE 16 (pioc20), wherein the MIE pioc20 was found to be most responsive to 1 mM pCoumaric acid, which makes the reporter system encoded in pioc20 potentially useful to detect heterologous metabolite secretion of chemical transformation resulting in the production of pCoumaric acid.
  • Zaslaver, A, et al. A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Meth. 3, 623-628 (2006).

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Biomedical Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Crystallography & Structural Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Bioinformatics & Computational Biology (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The present invention relates to methods associated with metagenomic screening for metabolite induced elements (MIEs) and the subsequent use of the MIEs in screening metagenomic libraries to identify metabolic pathways and pathway components in one or more partial or complete operons. In one aspect the method may be an iterative approach to metagenomic screening which involves substrate and product selection.

Description

METHODS FOR SEQUENTIAL SCREENING WITH CO-CULTURE BASED DETECTION OF METAGENOMIC ELEMENTS CONFERRING HETEROLOGOUS METABOLITE SECRETION
TECHNICAL FIELD
This invention relates to the field of metagenomic screening. In particular, the invention relates to functional metagenomic library screening methods for detecting metabolite secretion or extracellular chemical transformations.
BACKGROUND
It has long been appreciated that environmental micro-organisms are an excellent source of solutions to industrial problems. In particular, they may provide a source for enzymes and associated co-factors. However, there is also an increasing awareness that environmental microorganisms can be difficult to culture in the laboratory let alone on an industrial scale.
For example, lignin is the second most abundant biopolymer on earth and a promising feedstock for deriving energy and industrial chemical precursors from renewable plant resources6-?. The synthesis of lignin occurs within plant cell walls by free radical reactions that cross-link diverse combinations of monoaromatic compounds into a heterogeneous matrix that is resistant to microbial and chemical assailment8. Lignin recalcitrance is further reflected in the deposition of coal throughout the Carboniferous period prior to the emergence of fungal enzymes associated with lignolysis in Permian forest soil ecosystems . Although a few bacterial strains and enzymes capable of lignin transformation have been identified, including Enterobacter lignolyticus SCFi and Rhodococcusjostii RHA110 12, white-rot basidiomycetes are currently the major source of lignin transforming enzymes, including laccases, manganese-dependent peroxidases, and lignin peroxidases^. This presents numerous technical challenges associated with the genetic tractability of fungal systems and the expression of fungal-derived enzymes in heterologous hosts such as E. co/zH Implementing high-throughput methods to expedite the discovery of bacterial lignin transformation pathway components provides one promising route toward overcoming these challenges. However, to date efforts to develop such functional screens have been unreliable due to the inherent complexity of the lignin polymer^.
A number of metagenome screening methods have been developed to isolate useful genes from metagenomes. For example, metagenomic nucleotide sequencing methods1, and enzyme activity based screening2. Further enzyme activity based screening methods have been developed, such as Substrate-Induced Gene-Expression (SIGEX) screenings and more recently Product-Induced Gene-Expression (PIGEX) screening^. Furthermore, several screening strategies have been developed to discover genetic elements that are activated in response to a metabolite, including intragenic genomic libraries and promoter trapss.
SUMMARY
The present application is based in part on the discovery that previously
uncharacterized pathways or unknown enzymes or cofactors in a pathway may be identified using the methods described herein. Furthermore, based on insights gained herein, it has been discovered that the process may be applied in an interative manner to discover metabolite inducible elements (MIE) of interest under inducible expression control.
In most known metagenomic screening processes there is often a shortage of MIEs and inherent host incompatibility associated with the MIEs. These may in part be alleviated by screening environmental DNA to identify new MIEs from the same or similar functional metagenomic libraries. Such an approach also makes the processes described herein iterative and agile. Whereby pools of metabolite compounds may be used to screen for MIE's, where different metabolites of interest may be identified or different intermediates in a pathway may be screened to find MIEs. Accordingly, where a step or steps in a pathway was missing or where there was a desire to expand the biosynthesis pathways the method could easily be repeated with a different metabolite of interest and could perhaps even include the addition of further clones in co-culture. Furthermore, it was appreciated herein that the use of intermediate to large insert metagenomic libraries (5-45KB) is beneficial to the success of the methods. For example, where several genes are present in an operon, it is sometime possible to clone the entire operon of interest with an intermediate to large insert library in association with MIEs and their cognate transcriptional regulators. Furthermore, the use of vectors able to
accommodate large inserts (for example, fosmids) can be helpful. Furthermore, a transposon retrofitted MIE library has advantages to other MIE screening methods such as restriction digestion libraries. Restriction digestion libraries have several limitations. For example, if any regulators or machinery is found downstream (for example, beyond an operon and is necessary for the MIE) such other methods would miss it, since the reporter in these systems is the last gene in the construct and thus could inherently limit what could be retrieved.
There are biases based on transcription in any given bacterial host (for example, E. coli), but there is actually a lot of conservation with respect to transcription and translation control across taxa. In fact, some components of the transcription and translation machinery are so conserved they may be used as phylogentic anchors to differentiate taxa on the tree of life.
Often, in functional metagenomic screens, the metabolite of interest is only one enzymatic conversion away from the substrate. Focusing on degree of separation away greatly limits the ability to recover more extensive biosynthetic pathways, whether they comprise an operon, interact with host metabolism, or act in a segmented or distributed pathway between two or more members of the community. This is because the substrate selection creates a bias against the preceding steps in the biosynthesis pathway. Accordingly, to be sure that the biosynthetic pathway of interest is selected, it is often important to consider the media (for example, are all substrates present) and the final product you are interested in detecting.
In accordance with a first aspect of the invention, there is provided a method including: (a) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene and selectable marker; (b) screening the randomly inserted first metagenomic library by adding a metabolite of interest; (c) detecting reporter gene expression following the addition of the metabolite of interest to identify a metabolite induced element (MIE); (d) preparing a reporter strain, the reporter strain including: (i) the MIE; and (ii) a reporter gene adjacent the MIE; (e) co- culturing heterologous host cells expressing a second metagenomic library with the reporter strain; and (f) detecting the reporter gene activity in the co-culture.
In accordance with another aspect of the invention, there is provided a method including: (a) obtaining a reporter strain, the reporter strain including: (i) a metabolite induced element (MIE), wherein the MIE is responsive to a metabolite of interest; and (ii) a reporter gene adjacent the MIE; (b) co-culturing heterologous host cells expressing a functional metagenomic library with the reporter strain; and (c) detecting the reporter gene activity in the co-culture.
In accordance with another aspect of the invention, there is provided a method including: (a) obtaining a reporter construct, the reporter construct including: (i) a metabolite induced element (MIE), wherein the MIE may be responsive to a metabolite of interest; and (ii) a reporter gene; (b) transforming a reporter strain with the reporter construct from (a); (c) co-culturing the reporter strain with a heterologous host cells expressing a functional metagenomic library; and (d) detecting the reporter gene activity in the co-culture.
In accordance with another aspect of the invention, there is provided a method including: (a) obtaining a reporter construct, the reporter construct including: (i) a metabolite induced element (MIE), wherein the MIE may be responsive to a metabolite of interest; and (ii) a reporter gene; (b) transforming a cell with the reporter construct from (a) to form a reporter strain; (c) growing heterologous host cells expressing a functional metagenomic library; (e) adding the reporter strain from (b) to the
heterologous host cells expressing a functional metagenomic library to form a co- culture; and (f) detecting the reporter gene activity in the co-culture.
The method may further include testing the MIE for specificity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain. The method may further include testing the MIE for sensitivity to the metabolite of interest prior to co-culturing the
heterologous host cells expressing a functional metagenomic library with the reporter strain. The method may further include testing the MIE for avidity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain.
The method may further include engineering the MIE to obtain the desired substrate specificity, sensitivity, and/or avidity following testing the MIE for specificity, sensitivity and/or avidity to the metabolite of interest.
The functional metagenomic library may be a fosmid library. The method may further include mutagenesis of functional metagenomic host cells producing a product that results inreporter strain activity. The method may further include screening for production of the metabolite of interest.
The reporter strain cells and the heterologous host cells expressing a functional metagenomic library may be cultured in a plate-based format. The MIE may be obtained from a functional metagenomic library.
The reporter strain may be a bacterial cell. The heterologous host cells expressing a functional metagenomic library may be bacterial cells. The bacterial cell may be an E. coli cell.
The method may further include isolating the co-culture having reporter gene activity.
The method may further include culturing the host cells having reporter gene activity to produce the metabolite of interest.
In accordance with another aspect of the invention, there is provided a method including: (a) choosing a first metabolite of interest and a first substrate; (b) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene; (c) screening the randomly inserted first metagenomic library by adding the first metabolite of interest; (d) detecting reporter gene expression following the addition of the first metabolite of interest to identify a first metabolite induced element (MIEi); (e) preparing a first reporter strain, the reporter strain including: (i) the MIEi; and (ii) a reporter gene adjacent to MIEi; (f) co- culturing heterologous host cells expressing a second metagenomic library with the first reporter strain in the presence of the first substrate; (g) detecting the reporter gene activity in the co-culture; and (h) repeat steps (a)-(f) as desired, wherein the first metabolite of interest may be used as a second substrate and a new metabolite of interest may be a second metabolite of interest and may be used to generate an MIE2.
The method may further include testing the one or more MIEs for specificity to the metabolites of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strains. The method may further include testing the one or more MIEs for sensitivity to the metabolites of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strains. The method may further include testing the one or more MIEs for avidity to the metabolites and DNA binding site of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strains.
The method may further include engineering the one or more MIEs to obtain the desired substrate specificity, sensitivity and/or avidity following testing the one or more MIEs for specificity, sensitivity and/or avidity to the metabolites of interest.
The functional metagenomic library may be a fosmid library.
The method may further include mutagenesis of functional metagenomic host cells producing reporter strain activity and further screening for production of the metabolite of interest.
The reporter strain cells and the heterologous host cells expressing a functional metagenomic library may be cultured in a plate-based format.
The one or more MIEs may be obtained from a functional metagenomic library. The reporter strain may be a bacterial cell. The heterologous host cells expressing a functional metagenomic library may be bacterial cells. The bacterial cell may be E. coli cells.
The method may further include isolating the co-culture having reporter gene activity. The method may further include culturing the host cells having reporter gene activity to produce the metabolite of interest.
In accordance with another aspect of the invention, there is provided a method including the steps of: (a) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene; (b) screening the randomly inserted first metagenomic library by adding a metabolite of interest; (c) detecting reporter gene expression following the addition of the metabolite of interest to identify a metabolite induced element (MIE); and (d) preparing a reporter strain, the reporter strain including: (i) the MIE; and (ii) a reporter gene adjacent the MIE.
The method may further include the step of: (e) co-culturing heterologous host cells expressing a second metagenomic library with the reporter strain. The method may further include the step of: (f) detecting the reporter gene activity in the co-culture. The method may further include testing the MIE for specificity and sensitivity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain. The method may further include engineering the MIE to obtain the desired substrate specificity and sensitivity following testing the MIE for specificity and sensitivity to the metabolite of interest. The functional metagenomic library may be a fosmid library. The method may further include mutagenesis of functional metagenomic host cells producing reporter strain activity and further screening for production of the metabolite of interest. The reporter strain cells and the heterologous host cells expressing a functional metagenomic library may be cultured in a plate-based format. The MIE may be obtained from a functional metagenomic library. The reporter strain may be a bacterial cell. The heterologous host cells expressing a functional metagenomic library may be bacterial cells. The bacterial cell may be an E. coli cell. The bacterial cells may be E. coli cells. The method may further include isolating the co-culture having reporter gene activity. The method may further include culturing the host cells having reporter gene activity to produce the metabolite of interest.
BRIEF DESCRIPTION OF THE DRAWINGS
In drawings which illustrate embodiments of the invention:
FIGURE l shows PemrR-GFP biosensor discovery and characterization, wherein (A) Screening E.coli intragenic regions with monaromatic lignin
transformation products including vanillin, vanillic acid, p-coumaric acid, vanillyl alcohol and veratryl alcohol. (B) Relative reporter signal after incubation with 0.5 mM of select benzene derivatives for 2 hrs. Tree represents hierarchical clustering of the compound similarity using the single linkage algorithm. (C) Reporter sensitivity after 2 hrs. (D) Monitoring in vitro lignin oxidation by DypB N246A in the presence of glucose oxidase, manganese and hydrogen peroxide. Controls did not contain manganese. Error bars represent 95% confidence intervals (11=3);
FIGURES 2A and 2 B show the profiling of monoaromatic compounds by GC- MS, wherein relative ratios of lignin related monoaromatic compounds in culture supernatant as compared to a control strain harboring an empty fosmid. Clones were incubated with both (A) HKL-Fi and (B) HP-L™ in minimal media;
FIGURE 3 shows genetic context maps for active fosmids, wherein functional classes related to lignin degradation, CAZy auxiliary enzymes, mobile elements, transposon insertions (Z-score ratio cutoff for decrease in GFP fluorescence, see TABLE 2), and tRNAs are annotated. The G+C ratio for every 200 nucleotides and gene abundance determined by mapping over 500 million illumina reads sourced from the coal bed milieu is also displayed. Connections represent protein homologs with minimum 50% identity and an e-value of 10E-20;
FIGURES 4A and 4B show the effect of plasmid copy number on PemrR-GFP biosensor activation, wherein compound dependent activation of the PemrR-GFP biosensor was assessed after 2 hrs under single copy Geft) and high-copy (right) number for concentrations of (A) imM and (B) 0.25 mM (Error bars represent 95% confidence intervals (11=3));
FIGURE 5 shows the screening environmental isolates with the PemrR-GFP biosensor, wherein soil isolates, including known lignin degraders R.jostii RHAi and E. lignolyticus SCFi, were cultured in the presence of HP-L™ for 2 weeks with Qeft) and without (right) a solid phase of 0.4% agarose, then culture supernatant was then added to an PemrR-GFP biosensor culture and incubated for 2 hrs before measuring fluorescence (Error bars represent 95% confidence intervals (11=3));
FIGURES 6A-C show emrRAB promoter activation in emrR and emrB knockout backgrounds, wherein the time course GFP fluorescence measurements for 1 mM of vanillin (o), vanillic acid (□), and vanillyl alcohol (Δ) in (A) wild-type, (B) emrR and (C) emrB knockout backgrounds (11=3);
FIGURES 7A-F show the growth kinetics of emrR and emrB knockouts in subinhibitory concentrations of monoaromatic compounds, wherein wild-type (Δ), emrR{- )(o), and emrB -) n strains were grown in the presence of 0.5 mM of various
monoaromatic compounds (11=3) as follows (A) control, (B) vanillic acid, (C) ferulic acid, (D) vanillin, (E) salicylic acid and (F) 4-benzoic acid;
FIGURE 8 shows the effect of emrR knockout on growth kinetics in the presence of enzyme treated lignin, wherein the effect of 0.5 g/L of HWKL Fi (00Δ) and DypB N246A treated HWKL Fi (DVX) in emrR and emrB knockout backgrounds
Figure imgf000010_0001
FIGURES 9A-D show EmrR overexpression improves growth kinetics in inhibitory levels of monoaromatics, wherein growth kinetics with uninduced (circle) and induced (square) expression of emrR from pBAD24 (Error bars represent 95% confidence intervals (11=3)) as follows (A) control, (B) vanillic acid, (C) 4- hydroxybenzoic acid and (D) caffeic acid;
FIGURES 10A and B show Fosmid library screening by co-culture with the PemrR-GFP biosensor, wherein (A) Screening results for 8 x 384-well plates with selected hits (7 diamonds above 1.10 fold increase). (B) Validation of select fosmid clones by repeat screening. Error bars represent 95% confidence intervals (11=3); and
FIGURE 11 shows precipitation phenotypes, wherein various fosmid clones incubated alone or in combination with HWKL Fi or HP-L™ in minimal media for 16 hrs.
FIGURE 12 shows GC-MS profiles of transposon mutants, wherein the chromatograms compare two transposon mutants identified by screening with the PemrR-GFP biosensor (both interrupting putative oxidoreductase open reading frames). The data was normalized to an empty fosmid clone and lignin related compounds 2,4-dihydroxybenzoic acid, i,4-dihydroxy-2,6-dimethoxybenzene and benzoic acid are marked by A, B and C, respectively (n = 2).
FIGURE 13 shows comparative analysis of active fosmids, wherein the bar graphs show the relative number of annotated genes falling within the six functional classes implicated in lignin transformation phenotypes (out of 813 total genes).
FIGURE 14 shows a graphic overview of an embodiment of the method for isolating metabolite induced elements (MIEs) from a metagenomic library and construction of a metagenomic library for sequential screening with co-culture based detection of meteagenomic elements conferring heterologous metabolite secretion products from a functional metagenomic library.
FIGURE 15 shows a graphic representation of environmental DNA (i.e.
metagenomic DNA) libraries being "retroffited" randomly with a promoter less reporter gene (arrows) to produce clones that are screened for induction by addition of a metabolite of interest to identify a metabolite induced element (MIE).
FIGURES 16A and B show a fluoresence plot for a retroffited metagenomic library (constructed using the method in FIGURE 15) that was assayed for fluorescence emitted by a fluorescent marker wherein the library was (A) Uninduced (i.e. no metabolite of interest is added) and (B) Induced (i.e. where the metabolite of interest is added - a pool of pCoumaric acid, Vanillic acid and Vanillin), also showing a circled data point that represents a fosmid clone harboring a putative MIE (pioc2o) selected for further investigation.
FIGURE 17 shows a bar graph of an assay to validate the MIE identified in FIGURE 16 (piOC20), wherein the MIE pioc20 was found to be most responsive to 1 raM pCoumaric acid.
DETAILED DESCRIPTION
Various alternative embodiments and examples are described herein. These
embodiments and examples are illustrative and should not be construed as limiting the scope of the invention.
Definitions
As used herein 'metagenomic' is meant to include any genetic material obtained from an environmental source, as opposed to a laboratory cultured source. In many cases the actual origin (i.e. species or strain) of organism from which the genetic material is obtained may not be known.
As used herein a 'functional metagenomic library' is a gene library produced from a metagenomic source or sources, wherein the genes within the library are capable of expression.
As used herein 'mobile genetic element' is meant to include any type of nucleic acid molecule that is capable of movement within a genome and from one genome to another. For example, transposons or transposable elements (including
retrotransposons, DNA transposons, and insertion sequences); plasmids; bacteriophage elements (including Mu; and group II introns.
As used herein 'promoter' is meant to include any regulatory region of DNA often acting as a control sequence to regulate adjacent gene transcription. As used herein 'reporter' or 'reporter gene' are used interchangeably and are meant to include any gene that when expressed produces a detectable product (for example green fluorescent protein (gfp); luciferase; β-galactosidase (LacZ); β-glucuronidase (GUS); chloramphenicol acetyltransf erase (cat); or neomycin phosphotransferase (neo) to name just a few). The detection may be based on a coloured product, a fluorescent, a resistance to an antibiotic or other chemical substrate, etc. Reporters are often placed adjacent to a regulatory sequence and may be an indicator of another genes activity or in the case of the metabolite induced element (MIE) it may be an indication of the activation of the reporter by a metabolite of interest acting through a transcriptional regulatory mechanism and thereby an indication that the metabolite of interest is present.
As used herein 'metabolite induced element' or 'MIE' refers to one or more of the following: a promoter; an enhancer; an operator region; a transcriptional regulator; a DNA aptamer; or RNA aptamer, which facilitate a change in gene expression based on the presence of a metabolite of interest.
As used herein 'a reporter strain' is meant to refer to a cell comprising an MIE and a reporter gene adjacent the MIE.
As used herein 'specificity' is meant to refer to the dynamic range of metabolites that activate a given MIE.
As used herein 'sensitivity' is meant to refer to the dynamic range of reporter outputs possible with a given MIE.
As used herein 'avidity' is meant to refer to the accumulated strength
of multiple affinities of individual binding reactions.
Several screening strategies have been developed to discover genetic elements that are activated in response to a metabolite or a Metabolite Inducible Element (MIE), including promoter trap and intragenic genomic libraries. The process described herein may begin by applying one of these methods to recover an inducible element that may then be further engineered, if necessary, to obtain the desired substrate specificity and sensitivity. Alternatively, a MIE may be obtained from a MIE library already discovered. These known MIEs may also, if necessary to obtain the desired substrate specificity and sensitivity, be further engineered. The MIE may then be placed adjacent (usually upstream) of a marker gene, (for example, green fluorescent protein (GFP)), and transformed into a bacterial strain (for example, E. coli) to generate a reporter strain. Furthermore, it is also possible that a reporter strain may be developed to identify multiple metabolites of interest, by placing different MIEs adjacent different reporters (for example, a product that fluoresces in a different colour). Such reporters may be all in a single reporter strain. Target metabolites may then be selected based on the potential benefit to industry (for example, secreted and/or synthesized by a
fermentative organism). Examples include, valuable isomeric compounds used as intermediates in the production of pharmaceuticals and those that can replace expensive crude oil dependent synthesis. The reporter strain therefore senses the presence of a valuable compound/metabolite input and generates an output that can be easily measured with spectroscopic robotics. Functional metagenomic libraries may be constructed in heterologous hosts, (for example, E. coli), to bioprospect the metabolic potential of uncultivated microbes from natural and human engineered ecosystems. Common vehicles for this process are fosmids as they have copy-control systems available for modulating gene expression and can stably harbor up to 40 kB of environmental DNA. The ability to harbor over 40 kB of environmental DNA is important since microbial genes are often found in operons, whereby the genes contained therein are regulated by a single promoter or regulatory signal, and work together to achieve a particular goal. For example, the processing of a substrate to produce a metabolite of interest. Once metagenomic libraries are constructed and grown in a plate-based format, a reporter strain may be added in co-culture. If the reporter strain is activated, the compound of interest will have had been secreted by the environmental DNA containing E. coli. The genes involved, which can comprise biosynthetic clusters, regulatory machinery and/or secretion apparatuses may be identified through transposon metagenesis and re-screening. These genes may then provide genetics scaffolds for engineering the desired production rate and titer needed for use in industrial batch fermentations. To date, previously characterized reporters have been applied in various screening strategies. However, the approach described herein is unique, in that, the reporter constructs may be originally discovered through screening for compound-specific activation prior to interrogating metagenomic libraries. In one example, an E. coli library of GFP transcriptional fusions to approximately 2000 promoters on low copy plasmids was screened for substrate-induced expression using a pool of monocyclic aromatic acids. A single reporter was identified that regulates the emrRAB operon encoding a transcriptional regulator (emrR) and multidrug resistance pump (emrAB) for extrusion of toxic compounds. Previously, the expression of this resistance pump in E. coli was only known to be regulated by a small number of antibiotic substrates that do not include the compounds used in the screen. The substrate range of this reporter system was characterized and showed that sensitivity could be modulated via plasmid copy number. The reporter was then applied in screening a coal bed derived fosmid library before responsible genes were identified on selected clones and the compounds being secreted were identified by gas chromatography-mass spectrometry (GC-MS). Overall, the emrR reporter system described herein showed vast potential for use identifying metagenomic library clones useful in the production of fine chemicals relevant to both industrial and pharmaceutical applications.
Due to the iterative nature of the present methods, there are certain advantages to discover both the biosensor and the biosynthetic or catalytic operons of
interest. Furthermore, some embodiments of the present methods may also address the problem of availability of MIEs and some embodiments also have the potential to address the inherent host compatibility problems associated with screening
environmental DNA. The present methods may be iterative and thus more agile than prior art methods.
Uchiyama and Miyazakis ligate 7kB fragments into a vector containing a promoter-less GFP. This was building from standard promoter trap methods that have been used in genetics for many years. The use of mobile genetic elements and large inserts (for example, more than lokB) give limitless combinatorial potential, agility and efficiency - to the extent that our method could possibly access every MIE that exists in prokaryotes. The same is not true for the Uchiyama and Miyazakis method. The Uchiyama and Miyazakis method is dependent on ligation, restriction enzymes, and a static vector-based fluorescent marker. This puts both size limitations on the DNA fragments and excludes functioning components that happen to be downstream of the reporter. The size limitation is significant, since most (independent) genetic circuits in prokaryotes are organized into genomic architectures that range from lokB - sookB (often called genomic islands). Further, the genetic logic that can be performed (to detect things) is constrained by the amount of gene products. Cloning large fragments still remains a very technically daunting and is inefficient, furthermore the Uchiyama and Miyazakis method does little to remedy this.
In terms of the static vector-based fluorescent marker, this not only prevents
downstream functioning components, but also limits the probability of feedback loops (a very common circuit architecture). Accordingly, the genes are restricted to a linear orientation, whereby you can only insert the GFP in order going down the DNA strand. For example, in an operon, in order to capture all the functioning components of the operon, it would have to cut the detecting DNA right at the end before the terminator (a range of a few base pairs) or else interrupt the operon as you move toward the promoter. With a mobile genetic element (MGE), the marker can insert anywhere in the operon, whether it disrupts a gene or not.
Furthermore, the Uchiyama and Miyazakis method is locked in terms of directionality and number of markers. The MGE containing marker can insert in any direction with any number of other markers (or complimentary markers) into the same large insert. Thus demonstrating the possible combinations and possible permutations allowed for by the current methods.
A further benefit of using MGEs is that they can be non-biased or purposefully bias based on the flanking sequences. You can increase relative amounts of homologous recombination with your insertions (MGEs) and target different DNA properties or sequences. This could be as broad as to target specific GC contents or as specifically to target desired insertion sites. Since DNA synthesis is inexpensive, modifying MGEs in such as way becomes trivial and makes the present method much more agile. MGEs enable all the retrofitting and MIE discovery steps in the method to be performed in vivo. Accordingly, DNA does not need to be cut up each time and re-cloned. Using the methods described herein, existing libraries may be retrofit in the cells they already reside in, which is much more efficient.
The transposon retrofitted MIE library method do not depend on restriction digestion as does SIGEX. Restriction digestion has several limitations, for example, if any regulators or machinery is downstream (beyond an operon and necessary for the MIE) SIGEX would miss it as GFP is the last gene in the construct. This would inherently limit what could be retrieved.
Furthermore, where the majority of proteins are not annotated with anything to do with the process being investigated, the current process differs significantly from PIGEX, which looks for known activities. Accordingly, the embodiments of the present method have the potential to identify "unknown" regulators, "unknown" pathways and
"unknown" enzymes/cofactors etc. Furthermore, PIGEX adds a substrate that is one enzymatic conversion away from the step they are targeting. Doing this places limits on the ability to detect biosynthetic pathways (whether they comprise an operon, interact with host metabolism, or a segmented pathway). This is because the substrate creates a heavy selection against the preceding steps in the biosynthesis pathway. To make sure selection is for a biosynthetic pathway, there has to be careful considerations for the media (all substrates present) and the final product being detected.
Compatibility is also an issue, wherein the use of large insert libraries can be very powerful in overcoming this, identifying an MIE from a functional metagenomic library, examining the MIE for compatibility with the host strain, which may be selected by the MIE screen, since the same bacteria may be used in the MIE screen and metagenomic library screen.
One reason for using large insert libraries is to get an independent circuit. Otherwise, the components that sense the compound (say a transcription factor or signal
transducer) would be limited to what is present in the host. Thus, if it worked in the screen, it is very unlikely to be incompatible with that host. For example, a novel set of genes conferring the ability to secrete aromatics, including those that can be derived from lignin. The detection of heterogeneous aromatic secretion in growth media was identified using the emrR reporter system.
Furthermore, the system described has the potential to provide sustainable biological production of pure enantiomeric products. Such products could have decreased costs as compared to chemical synthesis. Furthermore, the methods described herein are promising for bioprospecting applications in the discovery of novel enzyme products for consumer and industrial markets. Furthermore, the number of potential diverse and often extreme environments that may be screened for novel microbial genes that may act as a rich source of material for novel enzyme products is somewhat limitless.
Methods and Materials
Strains, plasmids and oligonucleotides used are set out below. Detailed procedures for construction of vectors, characterization of the PemrR-GFP biosensor and high- throughput screening are described in the Methods section. All DNA manipulations were performed according to standard procedures. Fosmid library preparation, transposon mutagenesis, and purification were performed with kits sourced from Epicenter (Illumina™).
All chemicals used were of analytical grade and purchased from Sigma-Aldrich™.
Monoaromatic lignin transformation products were identified by gas chromatography- mass spectrometry (GC-MS) as previously described.
A graphic representation of an embodiment of the claimed method for (1) isolating metabolite induced elements (MIEs) from a metagenomic library, (2) construction of a metagenomic library, and (3) subsequently sequentially screening in co-culture, where the MIE is used in a reporter strain to act as a biosensor in the detection of
meteagenomic elements producing heterologous metabolite secretion products from the functional metagenomic library (see FIGURE 14 and FIGURE 15). In FIGURE 14 , steps 1-3 show a random insertion of a mobile genetic element (for example, transposons) comprising a promoterless green fluorescent protein (gfp) gene into a metagenomic library to produce a metagenomic library retrofitted with a promoterless reporter. Steps 4-6 show screening with for a MIE using a metabolite of interest to obtain a reporter strain (step 7). In steps 8-14 a metagenomic library is assembled from bacterial samples obtained from a coal bed, but a person of skill in the art would appreciate that metagenomic libraries may be obtained from any number of sources depending on the metabolites of interest and samples that are available. Furthermore, the metagenomic library produced in steps 8-14 may be the same as the metagenomic library used to produce the metagenomic library retrofitted with a promoterless reporter of steps 1-7 or may be entirely different. In steps 15-18 a co-culture based screening is performed with the previously discovered reporter strain to select a metagenome element conferring metabolite secretion. Once the co-culture screening identifies one or more functional metagenomic library clones that produce the metabolite of interest, steps 1-7 may be repeated to identify additional metabolites of interest further down a pathway of interest as many times as needed. Alternatively as shown in step 19, the metabolite of interest may be produced by the clone or clones of interest for further characterization, study or as a source of the metabolite of interest.
Strains and growth conditions
Bacterial strains, plasmids and primers are listed below. Minimal media consisted of M9 minimal media supplemented with glucose (0.4%), arabinose (100 g ml-i), leucine (40 μg ml-i), MgS04 (1 mM) and thiamine (2 μΜ). Lysogeny broth (LB) and minimal media were supplemented with Kanamycin (50 μg ml-i), Chloramphenicol (12.5 μg ml- 1), and Ampicillin (100 μg ml-i) to maintain pUA66, PCCifos and pBAD24, respectively. The emrR (JW2659-1), emrA (JW2660-1), and emrB (BW25112) knockout and cognate wild-type strains were obtained from the Keio collection through the Coli Genetic Stock Center (CGSC). All cultures were grown at 37°C in a 220 r.p.m. rotary shaker unless otherwise stated.
Plasmid Construction
The emrRAB promoter region (see the sequence below) and GFP were amplified from the pUA66 backbone with primers Frep (Promoter - EcoRl
( Forward) GCGGAATTCCGCAGCATTATCATCC) and Rrep (GFP - Hindlll (Reverse) GCGAAGCTTCCTGCAGGTCTGGACATTTAT). The PCR product was digested with EcoRI and Hindlll, and ligated with EcoRI/Hindlll digested PCCifos to generate a PCCi reporter. The PCCifos vector is under a copy-control system which is inducible in the EPI300 background host (EPICENTER™). PCCireporter under high-copy number in EPI300 is referred to as the PemrR-GFP biosensor. For inducible overexpression of emrR, emrR was amplified from E. coli K12 genomic DNA using the primers FemrR (emrR - EcoRI ( Forward) GCGGAATTCatgGATAGTTCGTTTACGCCCA) and RemrR (emrR - HindiII (Reverse) GCGAAGCTTttaGCTCATCGCTTCGAGAACC). The resulting PCR product was also digested with EcoRI and Hindlll, and ligated with EcoRI/Hindlll digested PBAD24, yielding pBAD24emrR.
Sequence of the emrRAB Promoter
CGCAGCATTATCATCCCAACACTGCTTAGTGCGCTGGCCTATGGGCTCGCCTGGAAAGTGATGG CGATTATATAACCCACAAGAATCATTTTTCTAAAACAATACATTTACTTTATTTGTCACTGTCG TTACTATATCGGCTGAAATTAATGAGGTCATACCCAAATGGATAGTTCGTTTACGCCCATTGAA CAAATGCTAAAATTTCGCGCCAGCCGCCACGAAGATTTTCCTT
Screening E.coli reporter library
A library of 1,820 E. coli K12 MC1655 intragenic regions fused to gfpmut2 on low copy plasmids was replicated into 96-well round-bottom culture plates containing M9 minimal medium supplemented with glucose. After growth overnight, a compound pool comprising 1 mM Vanillin, vanillic acid, p-coumaric acid, vanillyl alcohol and veratryl alcohol was added. The plates were then incubated and GFP fluorescence was measured by reading excitation at 481 nm and emission at 508 nm on a Varioscan Flash Spectral Scanning Multimode Reader (Thermo Scientific™) before selecting the most active clone (all GFP measurements were made as described here).
PemrR-GFP biosensor characterization
The PemrR-GFP biosensor was grown overnight and diluted 1/10 in 180 μΐ, of LB. The compound of interest, dissolved in 20 μΐ, of 30% DMSO was then added before a 2 hr incubation and subsequent reading of GFP fluorescence. Arabinose was removed from the media when comparing the effect of plasmid copy number. For in vitro enzyme assays, PemrR-GFP was diluted 1/10 and incubated in M9 minimal medium with glucose (0.5%), 0.5 μg HKL-Fi, manganese (40 mM), glucose oxidase (100 nM) and DypB N246A (50 nM). GFP measurements were made every 30 min.
Environmental Isolate Screening
In vivo isolate cultures were carried out in 1/ 10 diluted low-salt (50 mg/L CaCl2*2H20) LB, 1 g/L of HP-L™ and 1% DMSO that was filtered in a 0.2 μΜ filter (ExpressPlus™) (Millipore™). Cultures were inoculated 1/100 from saturated cultures grown in 1/10 diluted LB and grown in stationary flasks for 2 weeks before cells were centrifuged at 16,000 x g and culture supernatant was removed and filtered with a 0.2 μΜ filter before being assayed with the PemrR -biosensor. The supernatant from duplicate cultures was aliquoted in 180 μΐ. volumes in triplicate. To this, 20 μΐ. of the PemrR-GFP biosensor, diluted 1/4 from an overnight culture in LB, was added and allowed to incubate stationary for 2 hrs before taking GFP measurements.
Gas Chromatography-Mass Spectrometry (GC-MS) Incubated with Lignin
Minimal media was stirring at 37°C before 1 g/L of HP-L™ and HKL-Fi dissolved in DMSO (3% final DMSO) was added. The media (lignin amended media) was allowed to stir for 1 hr before being filtered through a 0.2 μΜ DMSO safe filter (ExpressPlus™ from Millipore™) to remove any precipitate. The EPI300 strains harboring fosmids were then inoculated 1/10,000 in 5 mL of lignin media from an overnight culture in LB. The cultures were allowed to grow for 16 hr before cells were spun down at 16,000 x g for 10 min and culture supernatant was removed. The culture supernatant was acidified using formic acid (10 % final concentration v/v). Acidification precipitated the residual lignin in all the clones, which was removed by centrifugation (16,000 x g for 10 min) and filtration (0.2 μπι DMSO safe filter - Pall™). The clear supernatant was extracted thrice using ethyl acetate (1:1). The extracts were dried over anhydrous magnesium sulfate and the solvent was evaporated under the stream of nitrogen. The air-dried samples were resuspended in 300 μΐ pyridine. To each of the sample, 4-chlorobenzoic acid (100 μg) was added as the internal standard. Subsequently, the samples were derivatized using BSTFA+TMCS- (99:1). GCMS was performed using an HP 66890 series GC system fitted with an HP 5973 mass selective detector and a 30 x 250 μιη HP-5MS Agilent™ column. The operating conditions were TGC (injector), 280 °C; TMS (ion source), 230 °C; oven time program (To min), 120 °C; T2 min, 120 °C; T45 min, 300 °C (heating rate 4 °C mini); and T54 min, 300 °C. The injector volume was 1 ul.
EmrRAB Characterization
All time course OD600 and fluorescence measurements were made on an Infinite 200 PRO plate reader (TECAN™) with wild-type (BW25112), emrR(-) and emrB{-) E.coli strains. Monoaromatic compounds were added in DMSO to a final concentration of 3%. The pUA66 vector harboring the reporter construct was used in the BW25112
background for monitoring fluorescence. For studying the expression of emrR, PBAD24 expressing emrR was induced with 0.06 mM arabinose.
Fosmid Library Production
A fosmid library was prepared from coal bed core samples provided by Alberta
Innovates and DNA was extracted from the homogenized samples using previously described methods3°. The environmental DNA was cloned into the PCCifos copy control vector and transformed into the EPI300 host (EPICENTER™) as previously described21. Both CO182 and CO183 samples yielded approximately 60,000 fosmid clones with an average insert size of 42 kB. Approximately 20,00 clones from each sample were Sanger end sequenced (Applied Biosystems 3730 system™) at Michael Smith's Genome Science Center (B.C., Canada) and metagenomes for the samples have been reported20.
High-throughput functional Screening
For fosmid library screening, 60,000 clone libraries were replicated using a Qpix2 robotic colony picker (Genetix™) in 384-well black plates. Clones were grown in 45 μΐ. of LB for 12 hrs and 20 of LB containing HP-L™ (added as described in the GC-MS profile section) was then added for another 5 hr incubation. The PemrR-GFP biosensor was then added by diluting an overnight culture 4 and adding 20 μL and incubated for 3 hrs before florescent measurements were taken.
Full fosmid sequencing
After 24 active clones were selected, fosmid DNA was extracted using the FosmidMax DNA preparation kit (EPICENTER™) according to the manufacturer's protocols. Contaminating E. coli DNA was removed using PlasmidSafe DNase™ (EPICENTER™). All DNA concentrations were determined using Quant-iT PicoGreen™ (Invitrogen™) and 500 ng of each fosmid was sent to Michael Smith's Genome Science Center (B.C., Canada) for sequencing on a Illumina GAIIx sequencer (Illumina™).
Transposon Mutagenesis
For 11 of the active clones, a Tns transposon mutagenesis library was created using the EZ-Tns kan insertion kit (EPICENTER™). Approximately 384 mutants were arrayed for re-screening as described in the high-throughput screening section. Mutants were Sanger sequenced (Applied Biosystems 3730 system™) at Michael Smith's Genome Science Center (B.C., Canada) and activity was mapped to fosmid position using
BLAST™. Statistically significant decreases in PemrR-GFP activity were then selected using a Z-score ratio.
Bioinformatic Analyses
All open reading frames (ORFs) were determined using Prodigal
(http://prodigal.ornl.gov/) and all ORFs were annotated using BLAST of NCBI nr databases. A custom perl script was designed that uses Circos (http://circos.ca) to visualize homology between fosmids. BLAST was used to map the location of the metagenomic reads (E-value cutoff of iE-10) to the fosmid ORFs and custom python scripts were used to visualize the abundance of each ORF in the metagenome.
Phylogenetic assignment binning was done using Sort-ITEMS
(http://metagenomics.atc.tcs.com/binning/SOrt-ITEMS) .
EXAMPLES
EXAMPLE 1: Identification of Metabolite Induced Element (MIE) for Lignin Transformation Products
It was reasoned that sensing lignin transformation products rather than labeling the lignin polymer itself might improve signal detection across a wide range of substrate specificities. Accordingly, an E. coli clone library of fluorescent transcriptional reporters was interrogated with a mixture of lignin transformation products including vanillin, vanillic acid and -coumaric acid (FIGURE lA)16. The most responsive clone harbored a promoter regulating the emrRAB operon, encoding a negative feedback transcriptional regulator {emrR) and multidrug resistance pump (emrAB) that is known to act on various structurally unrelated antibiotics1^*8. Since the compounds used to identify the emrR promoter were not previously been shown to induce emrRAB expression, response specificity was evaluated using a library of monoaromatic compounds
(FIGURE lB). Sensitivity of detection was observed to increase with promoter copy number reaching a lower detection threshold of 50 μΜ using the three most active lignin transformation products (FIGURE 4, FIGURE lC). The capacity of this promoter to detect in vitro lignin transformation was demonstrated by monitoring formation of monoaromatic products from a solvent fractionated hardwood kraft lignin (HKL-Fi) using an engineered manganese-oxidizing dye decolorizing peroxidase (DypB N246A)10 (FIGURE ID).
Co-culture based detection of lignin transformation products was also demonstrated using bacterial isolates affiliated with multiple phyletic groups, including Enterobacter lignolyticus SCFi and Rhodococcusjostii RHAi (FIGURE 5).
To evaluate the role of the EmrR transcriptional regulator in responding to lignin transformation products, it was shown that emrR is necessary and sufficient for the compound-dependent activation of the emrRAB operon (FIGURE 6). Abolishing emrR, but not emrB activity caused slightly impaired growth kinetics in the presence of several lignin transformation products (FIGURE 7). Moreover, a dramatic lag phase was consistently observed in emrR loss of function mutants exposed to HKL-Fi pretreated with DypB N246A (FIGURE 8).
Complementation by over expression not only rescued the impaired growth phenotype in the presence of monoaromatic compounds, but also increased the growth rate and final biomass accumulation (FIGURE 9). Taken together, these results are consistent with a role for EmrR in regulating an extended metabolic network responsive to monoaromatic exposure in the environment and reinforce the potential of using EmrR and its promoter as a versatile biosensor (PemrR-GFP) in functional screens for lignin transformation pathways. EXAMPLE 2: Functional Metagenomic Library Screening
The structural composition of high molecular weight coal is derived from lignin but made increasingly recalcitrant through the processes of coalification1?. It was reasoned that coal beds would be enriched for bacterial genes encoding lignin transformation pathways, where the primary transformation is not likely to be mediated by fungi9>2°, unlike forest soils. Therefore, bacterial dominated functional metagenomic libraries sourced from standard (CO182) and basal (CO183) coal formations in Alberta, Canada were interrogated for lignin transformation phenotypes using the PemrR-GFP biosensor20. Metagenomic libraries from CO182 and CO183 were constructed using the Fosmid CopyControl system (pCCiFOS) from EpiCentre, as previous reports suggest that increased copy number enhances heterologous gene expression in the EPI300 E. coli host21. In parallel, the PemnR-GFP biosensor (a reporter strain) was transferred to the pCCiFOS vector used in library production to facilitate co-culture based screening using shared antibiotic selection. A total of 46,000 fosmids arrayed in 384-well plates were grown in the presence of HKL-Fi overnight prior to the addition of the biosensor.
Co-cultures were subsequently grown for three hours prior to measuring GFP fluorescence. Fluorescent signals were normalized to background and corrected for edge effects. Consequently, 24 fosmids activating the emrR biosensor (16 from CO182 and 8 from CO183) were selected for downstream functional characterization and sequencing (FIGURE 10).
EXAMPLE 3: Lignin Transformation Testing with Fosmids
To verify the production of lignin transformation products by fosmids activating the PemrR-GFP biosensor, 11 of the most active clones were incubated in the presence of HKL-Fi and a second industrially purified high-performance lignin (HP-L™) substrate22. Lignin transformation products including vanillin, syringaldehyde and syringic acid were then measured by gas chromatography-mass spectrometry (GC-MS). An array of monoaromatic compound profiles were observed for single fosmid incubations, which varied between HKL-Fi and HP-L™ as consistent with different substrate properties or varying specificities of fosmid encoded enzymes (FIGURE 2). Curiously, fosmid co-cultures exhibited synergy in combination, producing
monoaromatic compound profiles that differed from individual fosmid incubation profiles in unexpected ways (FIGURE 2). Moreover, while single fosmid incubations with HWKL Fi led to precipitate formation, only co-culture fosmid incubations were capable of forming precipitates with HP-L™. (FIGURE 11).
The observations confirm that fosmids recovered in the PemrR-GFP biosensor screen confer lignin transformation phenotypes with different end product profiles, similar to observations made for fungal lignin transformation processes2^.
EXAMPLE 4: Gene Analysis
Random transposon mutagenesis identified genes encoded on the 11 characterized fosmids necessary for activating the PemrR-GFP biosensor. Nine out of 11 fosmids contained transposon insertions capable of reducing biosensor activation in two or more genes, suggesting that the observed lignin transforming phenotypes require multiple pathway components (FIGURE 3).
Consistent with this observation, mapping the location of each transposon insertion identified six functional classes implicated in lignin transformation phenotypes. These included genes predicted to encode electron transfer (unassigned oxidoreductase activity), co-factor generation (hydrogen peroxide formation), protein secretion
(secretion apparatus or signal peptide), small molecule transport (multidrug efflux superfamily), motility (methyl accepting chemotaxis proteins (MCP)), and signal transduction (PAS domain containing sensors) pathway components (FIGURE 3). Full-fosmid sequencing and comparative analysis of all 24 fosmids activating the PemrR-GFP biosensor also identified recurring subsets of genes on typically non- syntenic clones encoding one or more of the six functional classes identified by transposon mutagenesis (FIGURE 3).
While electron transfer, co-factor generation and protein secretion have well-defined roles in lignin transformation?*^, the roles of the remaining three functional classes remain uncertain. It is notable that several of the fosmids identified with the PemrR- GFP biosensor actually encode small molecular transport systems similar to emrR and emrB, further reinforcing a role for these genes in regulating microbial responses to monoaromatic exposure in the environment (see TABLES lA and iB). Cell motility could then play a role in establishing optimal cell positioning along transformational gradients.
TABLE 1A - SF-HKL
Figure imgf000027_0001
Concentration: mg/L This relationship between lignin transformation and cell motility is highlighted by a recent study that observed an enrichment of MCP encoding genes and transcripts in wood feeding termites relative to dung-feeding termites25.
Finally, signal transducers could play a role in mediating lignin substrate specificity among and between microbial groups and contribute to gradient formation. Indeed, recent cultivation-dependent studies using nitrated lignin substrates from Wheat, Miscanthus, and Pine identified alternative transformation phenotypes among and between bacterial and fungal isolates^. The necessity of genes encoding both MCP and signal transduction on the fosmids identified in this study directly implicates both of these functional classes in mediating lignin transformation phenotypes in the environment (FIGURE 3).
In addition to the six functional classes described above, 16 of the 24 fully sequenced fosmids harbored mobile genetic elements (MGE). These elements were typically located proximal to one or more of the six functional classes suggesting a role for metabolic island or islet formation in propagating lignin transformation phenotypes in the environment (FIGURE 3). To further explore the relationship between lignin transformation phenotypes and genomic island or islet formation coverage depth, G+C content variation and tRNA positioning on the active fosmids was examined (FIGURE 3). Fragment recruitment of 500 million unassembled Illumina reads sourced from CO182 and CO183 environmental DNA identified abrupt changes in coverage depth in genomic intervals harboring MGE and one or more of the six functional classes consistent with island formation (FIGURE 3). The presence of islands was further supported in 8 of the fosmids where coverage changes were associated with variation in median G+C composition or tRNA gene positioning (FIGURE 3).
As genome regions, opposed to whole genomes, are more likely to sweep through populations, gene frequency can give insight into both the ecological and functional importance of environmental DNA26. Islands and islets have been shown to transfer ecologically important traits throughout a habitat specific horizontal gene pool2?, with notable examples in symbiotic and marine ecosystems26"2?. A number of environmental fosmids that confer lignin transformation phenotypes, share common enzymatic, regulatory and transport features, and display substantial evidence of horizontal gene transfer (HGT) were retrieved. Although the principle of rational engineering has driven the development of modern biorefinery systems, our results demonstrate the utility of exploiting ecological design principles to build a new generation of biorefining organisms through the use of naturally assembled genetic parts.
TABLE 2— Lignin Transformation Positive Clone Genes
Gene ID Annotation Accession Start Stop Signal Class
182 09J1 1J putative aminopeptidase 2 YP 006457178.1 151 1440 #N/A #N/A
182 09 J11 2 NAD(P)(H)-dependent oxidoreductase EHY79679.1 1513 2475 #N/A Oxido
182_09_J11_3 pre gene product YP_005938086.1 2649 4733 #N/A #N/A
182_09_J1 1_4 TPR repeat, SEL1 subfamily protein YP 006457174.1 4905 5372 #N/A #N/A
182 09 Jl 1 5 hypothetical protein PSTAB l 345 YP 004713715.1 5372 5743 #N/A #N/A
182 09 J11 6 Cro/CI family transcriptional regulator EI 53833.1 5740 6066 #N/A #N/A
182_09_J11_7 hypothetical protein A458 07510 YP_006457171.1 6223 6699 #N/A #N/A
182 09 J1 1 8 helix-hairpin-helix repeat-containing compet YP_00652371 1.1 7028 7342 #N/A #N/A
182_09_J11_9 flagellar hook-associated protein FlgL YP OO6523710.1 7463 8731 #N/A Secretion
182 09 Jl 1 10 flagellar hook-associated protein Flg YP 004713710.1 8744 10759 SEC Secretion
182 09 J11 U flagellar rod assembly protein/muramidase YP 006457167.1 10763 1 1935 #N/A Secretion
Fl
182 09J11J2 flagellar basal body P-ring protein YP_006457166.1 1 1946 13046 SEC Secretion
182 09_J11_13 flagellar basal body L-ring protein YP 004713707.1 13061 13756 SEC Secretion
182 09 Jl 1 14 flagellar basal body rod protein FlgG YP 006457164.1 13841 14626 #N/A Secretion
182_09_J1 1_15 flagellar basal body rod protein FlgF YP 00645 163.1 14662 15402 SEC Secretion
182 09 Jl l 16 flagellar hook protein FlgE YP 006523703.1 15598 17184 SEC Secretion
182 09_J11_17 flagellar basal body rod modification protei YP_004713703.1 17214 17897 #N/A Secretion
182_09_J11J8 flagellar basal body rod protein FlgC YP 004713702.1 17917 18360 SEC Secretion
182_09_JI 1_1 flagellar basal body rod protein FlgB YP 004713701.1 18372 18836 #N/A Secretion
182_09J11_20 chemotaxis protein methyltransferase CheR YP 006457158.1 18972 19796 #N/A MACP
182 09 J11 21 chemotaxis protein CheV YP 004713699.1 19831 20763 #N/A MACP
182 09 JU 22 flagellar basal body P-ring biosynthesis pro YP_001171 18.1 20855 21595 SEC Secretion
182 09J1 1 23 negative regulator of flagellin synthesis Fl YP_006457155.1 21709 22038 #N/A Secretion
182_09 J11 24 FlgN family protein EHY75837.1 22074 22544 #N/A Secretion
182 09 Jl l 25 type IV pilus assembly PilZ YP 005938063.1 22604 23350 #N/A Secretion
182 09J1 1 26 phage integrase family site specific ZP_10640976.1 23619 24830 #N/A #N/A recombinase
182J)9_J1 1_27 hypothetical protein PMI32 04729 ZP l 0640977.1 24827 25399 #N/A #N/A
182 09 J 1 1 28 excisionase YP 001350480.1 25528 25728 #N/A #N/A
182 09 J11 30 hypothetical protein G1E 09582 ZP 08139536.1 25862 26206 #N/A #N/A
182 09 J11_31 virulence-associated protein E YP_001350484.1 26260 26727 #N/A #N/A
182 09 Jl l__35 hypothetical protein PfraA_21814 ZP l 0850479.1 27828 28385 #N/A #N/A
182_09_J1 1 36 hypothetical protein P I22 00482 ZP 10695917.1 29037 29210 #N/A #N/A
182J)9_J11_37 hypothetical protein PMI22 00494 ZP 10695929.1 29207 29479 #N/A #N/A
182 09 J 11 41 hypothetical protein YP 001667999.1 30075 32627 #N/A #N/A
182 09 J1 L45 possible bacteriophage terminase small ZP 04979132.1 34092 34493 #N/A #N/A subuni 182 09 Jl 1 46 resolvase ZP 10150764.1 35126 35752 #N/A /A
182_02_CO3_l acyl-CoA dehydrogenase YP_006456114.1 1 1266 /A m/A
182_02_C03 2 peptide methionine sulfoxide reductase YP 006456115.1 1681 2328 SEC Oxido
18202 C03J sensory box protein PASPAC and GAF YP 006456116.1 2440 5112 itWA PAS sensor-containing
182 02 C03 4 TPR repeat-containing protein YP 006456117.1 5223 5750 m/A m/A
18202 C03 5 pyruvate dehydrogenase YP 006456118.1 5838 7844 m/A #N/A dihydrolipoyltransace
182_02__C03_6 2-oxo-acid dehydrogenase El subunit YP_006456119.1 7872 10517 m/A #N/A
182_02_C03_7 bifunctional glutamine-synthetase adenylyltr YP 006456120.1 10784 13729 m/A #N/A
182J)2_C03_8 branched-chain amino acid aminotransferase EHY79420.1 13780 14703 /A #N/A
182 02 C03 lipopolysaccharide heptosyltransferase II YP 006456122.1 14778 15812 #N/A /A
I82 02 C03 10 lipopolysaccharide heptosyltransferase 1 YP 006456123.1 15813 16814 /A /A
182 02 C03J1 UDP-glucose:(heptosyl) LPS alpha 1,3- YP_006456124.1 16814 17935 m/A /A
glucosy
18202 C03 12 lipopolysaccharide core heptose(I) kinase EHY79416.1 17979 18785 m/A /A
RfaP
182 02 C03 13 lipopolysaccharide kinase YP 005940536.1 18785 19519 /A m/A
182_02_C03_14 lipopolysaccharide kinase YP 006456127.1 19516 20259 /A /A
182_02_C03_15 serine/threonine protein kinase YPJW6456128.1 20259 21704 m/A m/A
182 02 C03 16 carbamoylrransferase YP 006456129.1 21717 23471 m/A /A
182 02 C03 17 glycosyl transferase family protein YP 006456130.1 23458 24375 m/A m/A
182_02_C03_18 hypothetical protein A458 02260 YP 006456131.1 24390 25619 m/A /A
18202 C03J9 capsule pol saccharide biosynthesis YP_006456132.1 25874 26743 m/A m/A
182 02 C03 20 O-antigen polymerase protein YP 006456133.1 26740 28497 m/A m/A
182_02_C03_21 toluene tolerance protein YPJJ06456135.1 28520 29122 /A m/A
18202 C03 22 transport protein MsbA YP 00645 136.1 29158 30975 /A #N/A
18202 C03 23 Mig-1 family protein YP 006456137.1 30975 31871 m/A /A
182_02_C03_24 LmbE family protein YP 006456138.1 31875 33269 m/A /A
182 02_C03_25 bifunctional heptose 7-phosphate EHY79406.1 33347 34768 /A /A
kinase/heptose 1
182_02_C03_26 hypothetical protein PstZobeIl_I8470 EHY79405.1 34839 35726 m/A /A
18202 C03_27 aldo/keto reductase family oxidoreductase YP 006456141.1 35817 36626 m/A HPG
182 02 C03 28 oxidoreductase, FAD-binding protein EHY79403.1 36623 37798 /A Oxido
182_02_C03_29 multidrug efflux SMR transporter YP_006456143.1 37859 38191 TM MDES t82JJ2_C03_30 3-deoxy-D-manno-octulosonic-acid YP_001174283.1 38311 39579 /A #N/A transferase
I82 02 C03 31 outer membrane efflux protein TolCType 1 YP 001174282.1 39753 41207 SEC Secretion secretion
182 02 C03_32 thiamine biosynthesis protein ThiC EHY79400.1 41590 43497 #N/A #N/A
182^08 C21_l site-specific recombinase, phage integrase fa ZP 07104809. 1118 1465 #N/A m/A
182 08 C21 2 hypothetical protein CLOSCI 03331 ZP 02433069.1 1684 2343 #N/A m/A
182_08_C21_3 general secretion pathway protein F ZP_09329114.1 2693 3838 #N/A Secretion
182_08_C21_4 luciferase family oxidoreductase ZP 08950429.1 3915 5096 m/A Oxido
I82 08 C21 5 methyl-accepting chemotaxis sensory ZP 09329117.1 5112 5597 /A MACP transduce..
182 08 C21 6 response regulator of the LytR/AlgR family ZP_10389812.1 5714 6478 /A #N/A
182 08 C21J7 integral membrane sensor signal ZP_08948803.1 6459 7580 TM PAS transduction
182_08_C21 8 argininosuccinate lyase ZP 04765045.1 7632 9089 #N/A #N/A
1 2 08 C21 9 catalase ZP 08948807.1 9173 10225 SEC HPG
1 2 08 C21 10 large extracellular alpha-helical protein ZP J 0389820.1 10420 12924 SEC Secretion
Figure imgf000031_0001
synthase A
182 11 B22 9 putative aminopeptidase 2 EHY79680.1 6517 7806 #N/A #N/A
182J 1_B22 10 NAD(P)(H)-dependent oxidoreductase YPJW6457177.1 7879 8841 #N/A Oxido
182 11 B22J 1 periplasmic tail-specific protease YP 005938086. 1 9015 1 1099 #N/A #N/A
182J 1_ B22_12 TPR repeat, SEL1 subfamily protein YPJ106457174.1 1 1271 1 1738 #N/A #N/A
182_11_B22_13 hypothetical protein PSTAB 1345 YP_004713715.1 11738 12106 #N/A #N/A
182_11_B22_14 Cro/CI family transcriptional regulator EIK53833.1 12103 12429 #N/A #N/A
182 11 B22 15 hypothetical protein A458 07510 YP_006457171.1 12586 13062 #N/A #N/A
182_1 1_B22_16 helix-hairpin-helix repeat-containing compet YP 0065237U .1 13390 13704 #N/A #N/A
182_11_B22J7 flagellar hook-associated protein FlgL YP_006523710.1 13825 15093 m/A Secretion
182 11 B22 18 flagellar hook-associated protein Flg YP_004713710.1 15106 17121 SEC Secretion
182_11_B22_19 flagellar rod assembly protein/muramidase YP_004713709. I 17125 18297 #N/A Secretion
Fl
182 11 B22 20 flagellar basal body P-ring protein YP_006457166.1 18308 19408 SEC Secretion
182J 1_B22_21 flagellar basal body L-ring protein YP_004713707.1 19423 201 18 SEC Secretion
182 11 B22 22 flagellar basal body rod protein FlgG YP_006457164.1 20203 20988 Secretion
182 1 1 B22 23 flagellar basal body rod protein FIgF YP_006457163.1 21024 21764 SEC Secretion
182_11_B22_24 flagellar hook protein FlgE YPJW6523703.1 21960 23546 SEC Secretion
182 11 B22 25 flagellar basal body rod modification protei YP 004713703.1 23576 24259 m/A Secretion
182 11 B22 26 flagellar basal body rod protein FlgC YP 004713702.1 24279 24722 SEC Secretion
182_11_B22_27 flagellar basal body rod protein FlgB YP__004713701.1 24734 25198 #N/A Secretion
182 11_B22_28 chemotaxis protein methyltransferase Che YP 006457158.1 25334 26158 m/A ACP
182 11 B22 29 chemotaxis protein CheV YP_004713699.1 26193 27125 /A MACP
182_11_B22_30 flagellar basal body P-ring biosynthesis pro YPJJ01171918.1 27217 27957 SEC Secretion
182 J 1 B22 31 negative regulator of flagellin synthesis Fl YP 006457155.1 28071 28400 #N/A Secretion
182J 1_B22_32 FlgN family protein EHY75837.1 28436 28906 #N/A Secretion
182J 1 B22 33 type IV pilus assembly PilZ YP_005938063.1 28966 29712 #N/A Secretion
182_11_B22_34 hypothetical protein A458_07350 YP_006457139.1 30179 30391 m/A #N/A
182_11_B22_35 hypothetical protein PSTAB J 320 YP 004713690.1 30436 30621 m/A #N/A
182 11 B22 36 alginate biosynthesis transcriptional activa YP_004713688.1 30849 31 166 m/A #N/A
182_1 1_B22_37 oxaloacetate decarboxylase subunit beta YP 005938059.1 31468 32604 m/A #N/A
182 11 B22 38 pyruvate carboxylase subunit B YP_004713686.1 32615 34393 m/A #N/A
182 11 B22 39 sodium pump decarboxylase, gamma YP_006457134. I 34416 34658 m/A #N/A subunit
182_11_B22__40 magnesium transporter YP 004713684.1 34799 36235 m/A #N/A
1 2J 1_B22_41 hypothetical protein PST 1375 YP001 171909.1 36572 37054 /A #N/A
182 11 B22 42 carbon storage regulator YP_001 171908.1 37591 37776 /A m/A
182 1 1 B22 43 aspartate kinase YP_006457130.1 37957 39195 /A #N/A
182 11 B22 44 alan l-tRNA synthetase YP_001 171906.1 39275 40012 #N/A #N/A
182J3 F13J phage integrase family protein EGM 14140.1 3 2480 #N/A #N/A
182J3 F1 2 phage integrase family protein EG 16032.1 2486 3868 #N/A #N/A
182_13_F13_3 oxygen-independent coproporphyrinogen HI YP_006458415.1 4026 4151 #N/A Oxido ox
182J3_F13_4 TetR family transcriptional regulator YP 006458416.1 4183 4803 #N/A #N/A
182_13_F13_5 class V aminotransferase YP_001 173104.1 4879 6012 #N/A #N/A
182 13 F13 6 aromatic amino acid transport protein AroPl YP_006458418.1 6233 7627 #N/A #N/A
1 2J3 F 13 7 hydrolase, TatD family YPJW645841 .1 7739 8524 #N/A m/A
182_13J13_8 type 4 fimbrial biogenesis protein PilZ YP_006458420.1 8628 8984 #N/A Secretion
182J3_F13_9 DNA polymerase III subunit delta' YP 006458421.1 9016 10002 #N/A #N/A
182 13 F13 10 thymidylate kinase YP_001173109.1 9995 10627 #N/A #N/A 182J 3_F13_1 1 hypothetical protein PST 2618 YP 001 1731 10.1 10624 1 1694 #N/A #N/A
182 13 F13J2 4-amino-4-deoxychorismate lyase EHY78332.1 1 1691 12512 #N/A #N/A
182J 3_F 13_13 3-oxoacyl-(acyl carrier protein) synthase 11 EHY78333.1 12509 13753 #N/A #N/A
182 13 F13J4 acyl carrier protein YP 0011731 13.1 13926 14162 #N/A #N/A
182 I 3 F13 15 3-ketoacyl-ACP reductase YP_001 1731 14.1 14355 15098 #N/A #N/A
182_13_F 13_16 malonyl-CoA- YPJ)01173115.1 151 13 16051 #N/A #N/A
182 13_F13_17 plsX gene product YP 005939366.1 161 15 17185 #N/A #N/A
182 13 F13 18 50S ribosomal protein L32 EHY78338.1 17189 17371 #N/A #N/A
182_13_F 13_19 metal-binding protein YP 006458431.1 17384 1791 1 #N/A #N/A
182 13^13 20 Maf-like protein EHY78340.1 18015 18593 #N/A #N/A
182J 3_F1 _ 1 signal peptide peptidase EHY78341.1 18604 19587 #N/A #N/A
182_13_F 13^22 HAD superfamily hydrolase YPJW6458434.1 19577 20263 #N/A #N/A
182J3_ F13_23 ribosomal large subunit pseudouridine YP 006458435.1 20256 21209 #N/A #N/A syntha
182_13_F13_24 ribonuclease E YP_006458436.1 21768 24965 #N/A #N/A
182J 3 F13 25 UDP-N-acetylenolpyruvoylglucosamine YP_006458437.1 25357 26376 #N/A #N/A reductas
182_13_F I 3_26 protein-tyrosine-phosphatase YP 005939375.1 26373 26537 m/A #N/A
182J6__E12_1 putative secreted protein ZP _10760484.1 2 382 SEC Secretion
182_16_E12_2 hypothetical protein YP 001 186721.1 476 1 171 #WA #N/A
182 16_ E12_3 MACP ZPJ 0706566.1 1 168 2310 #N/A MACP
182 16 E12 4 AraC family transcriptional regulator ZPJ19709445.1 2468 3217 #N/A #N/A
182_16__E12_5 methyl-accepting chemotaxis sensory YP 001186850.1 3254 4891 TM MACP transduc
182J6_E12_6 putA gene product NP_249473.1 5214 8381 m/A #N/A
182 16 E12 7 hypothetical protein BN5 00960 ZP_10760509.1 8682 10169 /A #N/A
182_16_E12_8 NADH:flavin oxidoreductase ZP 10788615.1 10278 1 1519 SEC Oxido
182J6_E12_9 response regulator YP 431980.1 1 1752 12867 *N/A #N/A
182 16 E12J0 Multidrug resistance protein YP 004380949.1 12901 16056 m/A MDES
182 16_E12_1 1 RND family efflux transporter MFP subunit YP 001187176.1 16058 17143 SEC MDES
182_16_E12 12 HTH-type transcriptional regulator betl ZPJ0761345.1 17146 17805 m/A #N/A
182 16 E12J3 conserved hypothetical protein, SAM- CBJ39758.1 18244 19002 m/A #N/A dependent m
182 16 El 2 14 FAD-dependent oxidoreductase EJX16335.1 19089 20378 m/A Oxido
182 16 E12J 5 XRE family transcriptional regulator ZPJ 0149413.1 20418 20975 /A #N/A
182 16_E12_16 glutamine synthetase YP_001268868.1 21009 22361 #N/A
182 16 E12J 7 MerR family transcriptional regulator YP 932982.1 22412 22789 m/A /A
182_16_E12J 8 NADPH-dependent reductase EKA 19030.1 22844 23422 #N/A Oxido
182J6_E12J 9 hypothetical protein PST 2845 YP 001 173333.1 23588 24127 #N/A #N/A
182 16 E12 20 hypothetical protein YP 0011881 1 1.1 24085 24297 #N/A #N/A
182 16 E12 21 glycine/D-amino acid oxidase ZP_ 10761703.1 24435 25718 SEC HPG
182J6_E 12_22 threonyl-t NA synthetase YP 004380708.1 26204 28126 #N/A #N/A
182J6JE12 23 translation initiation factor IF-3 YP 001748840.1 28144 28677 #N/A #N/A
182J6 E12 24 50S ribosomal protein L35 YP 004474812.1 28738 28932 #N/A #N/A
182_16_E 12_ 25 rplT gene product YP 001 187472.1 28961 29317 #N/A #N/A
182_16_E12_26 pheS gene product YP_001187473.1 29412 30428 #N/A #N/A
182J6JE12 27 phenylalanyl-tRNA synthetase subunit beta YPJW4380703.1 30471 32273 #N/A #N/A
182_I 6_J1 1_1 Alcohol dehydrogenase GroES domain ZP 09686224.1 182 361 #N/A Oxido protein
182 16J11 2 aromatic hydrocarbon degradation outer AAC03445.1 409 1773 SEC Secretion membrane protein 182_16_J11 3 methyl-accepting chemotaxis YP_933345.1 1897 3249 SEC PAS transducerPAS protein
182 16J11 4 Glycosyl hydrolase, BNR repeat ZP 01893293.1 3749 4765 #N/A #N/A
182 16 J 11 5 RND superfamily exporter YP 005887713.1 4776 7232 TM MDES
182J6J1 I_<5 cox2 cytochrome oxidase subunit ZPJ 1893295.1 7277 9166 SEC Oxido
182_16J11_7 hypothetical protein YP_005887711.1 9185 10489 SEC Secretion
182 16 Jll 8 MACP, PAS domain S-box ZP 01893297.1 10588 12135 W IA MACP
182J6J1] 9 malonate decarboxylase, alpha subunit EHY77067.1 12240 13907 miA #N/A
182 16_J11_10 triphosphoribosyl-dephospho-CoA synthase YP 004716471.1 13907 14782 miA #N/A
182 16 J11 11 malonate decarboxylase subunit delta YP_006455802.1 14785 15084 #N/A #N/A
182 16 J11 12 mdcD gene product YP_005940865.1 15077 15943 #Ν/Α #N/A
182J6J11J3 malonate decarboxylase, gamma subunit EHY77071.1 15940 16725 m/A #N/A
182J6 J11 14 phosphoribosyl-dephospho-CoA transferase YP 004716467.1 16798 17415 #N/A #N/A
182_16_J11 15 malonyl CoA-acyl carrier protein YP 005940862.1 17412 18338 #N/A #N/A transacylas
182_16_J11_16 malonate transporter, MadL subunit EHY77074.1 18463 18885 #N/A #N/A
182 16_J11 17 malonate transporter subunit MadM YP_001174576.1 18891 19655 #N/A #N/A
182_16_J11_18 FAD-dependent oxidoreductase YP 006455809.1 20092 21351 SEC Oxido
182 16 J11J9 LysR family transcriptional regulator EHY77076.1 21665 22582 #N/A #N/A
182 16111 20 hypothetical protein A45800600 YPJW6455811.I 22641 23282 m/A #N/A
182 16 111 21 RNA polymerase sigma factor YPJJ06455812.1 23297 23848 /A #N/A
182J6J1L22 hypothetical protein A458_00610 YP 006455813.1 24041 24313 m/A #N/A
182 16 Jll 23 hypothetical protein PstZobell_06533 EHY77080.1 24330 251 7 m/A #N/A
182J6_J11_24 hypothetical protein PstZobell_06538 EHY77081.1 25154 25930 m/A m/A
182 16 J11 25 DoxX family protein EHY77082.1 25942 26433 /A /A
182 16 J 11 26 hypothetical protein A458 00630 YPJ)06455817.1 26455 26661 /A /A
182J6J1L27 lipase, class 3 YP 006455818.1 26827 28341 /A /A
182 16_J11_28 lipoprotein YP 001186317.1 28975 29718 m/A m/A
182 16 JI1 29 hypothetical protein A458 00645 YPJ)06455820.1 29723 30568 /A /A
1 2J JU 30 Rhs element Vgr protein, type VI secretion YP 0064558 1.1 30565 32076 m/A Secretion system Vgr family protein
182_17_09 1 choline transport protein BetT EHY79645.1 3 1040 /A /A
182_17_09_2 glycine betaine aldehyde dehydrogenase YP 005938402.1 1127 2599 /A Oxido
182J7 09 3 choline dehydrogenase YP 001172266.1 2614 4287 /A HPG
182 17 094 ribosomal protein S12 methylthiotransferase YP 006458067.1 4389 5711 #N/A #N/A
182 17 09 5 YesN family response regulator EIK53762.1 5872 6744 #N/A m/A
182_17_09_6 Flp pilus assembly protein, pilin Flp ZPJ 0704409.1 7093 7284 #N/A Secretion
1 2 1709 7 Flp pilus assembly protein, protease CpaA ZP_10599436.1 7291 7812 SEC Secretion
182J 7 09 8 hypothetical protein ΡΜΓ2601591 ZP 10673849.1 7825 9147 #N/A Secretion
182 1709 9 Flp pilus assembly protein, RcpC family ZPJ0173383.1 9160 9969 TM Secretion
182 17 09 10 type II and III secretion system protein EIK53757.1 10024 11538 SEC Secretion
182J7_09_11 hypothetical protein Y05 15635 EI 53756.1 11554 11823 #N/A #N/A
182 17 09 12 Flp pilus assembly protein TadG EIK53755.I 11834 13168 SEC Secretion
182 17 09 13 Flp pilus assembly protein TadG EIK53754.1 13180 13650 TM Secretion
182__17_09_14 Flp pilus assembly protein TadG ZPJ0665569.I 13650 14153 TM Secretion
182J7 09J5 type II/IV secretion system ATPase TadZ EIK53752.1 14147 15376 #N/A Secretion
182J7_09_16 type IIIV secretion system protein ZP_10614051.1 15366 16787 #N/A Secretion
182_17_09J7 type II secretion system protein F ZP_^10639299.1 16784 17770 #N/A Secretion
182_17_09_18 type II secretion system protein; membrane YP 004355493.1 17781 18749 m/A #N/A
P 182_17_09_19 TPR repeat protein EI 53748.1 187 1 19794 m/A #N/A
182_17_09_20 O-antigen acetylase YP_005938405.1 19807 20877 m/A #N/A
182 17 09 21 glycosyl transferase family protein YP 005938406.1 20900 21973 m/A #N/A
182 17 09 22 hypothetical protein PSTAB 1644 YP 004714014.1 21 85 2 179 /A #N/A
182 17 09 23 hypothetical protein PSTABJ645 YP_004714015.1 22219 22557 /A #N/A
182_17_09_24 glycoside hydrolase family protein YP_001172271.1 22605 23807 m/A #N/A
182_1 _09JK hypothetical protein PST 1752 YP 001172272.1 23864 24910 #N/A /A
182 17 09 26 glycoside hydrolase family protein YPJX) 1172273.1 24965 26071 #N/A #N/A
182_17J9 7 hypothetical protein PstZobell 19633 EHY79634.1 26277 27590 #N/A #N/A
182 17 09J.8 hypothetical protein PST 1755 YP_001172275.1 27616 28866 #N/A #N/A
182 17 09 29 glycosyl transferase, group 1 family protein YP_006458056.1 28808 30172 #N/A #N/A
182 17 09 30 transcriptional activator RfaH EHY79631.1 30180 30689 m/A m/A
182 17 09 31 hypothetical protein YP_0O5938416.1 30744 31487 #N/A #N/A
182 17 09 32 tyrosine-protein kinase YPJX) 1172279.1 31510 33723 #N/A #N/A
182_17_09_33 glycosyl transferase family protein YP 001172280.1 33773 34705 #N/A #N/A
182J7 09J4 polysaccharide biosynthesis protein YP_006458051.1 34674 35285 #N/A #N/A
182_35_020_1 type 4 prepilin peptidase PilD YP_004713329. I 1 165 TM Secretion
182_J35J)20_2 type II secretory pathway, component YP_006458941.1 169 1389 #N;A Secretion
182 35 020 3 type IV-A pilus assembly ATPase PilB YP 006458942.1 1392 3095 #N/A Secretion
182_35_020_4 Tfp structural protein YP 004378671.1 3460 3645 SEC Secretion
182_35_020_6 hypothetical protein YP 004378672.1 4854 5261 #N/A #N/A
182 35 020 7 hypothetical protein YP_004378673. I 5262 6104 #N/A /A
182__35_020_8 putative ABC transporter ATP-binding YP_004378674.1 6101 6997 #N/A MDES protein
182 35 020_9 bifunctional sulfate adenylyltransferase EHY76696.1 7083 8621 #N/A m/A subunit
182_35_020_Ι0 sulfate aden lyltransferase subunit 2 YP 001171589.1 8992 9909 #N/A m/A
182_35_020_1 1 dinuclear metal center protein, putative YP 006458951.1 10095 10853 #N/A HPG hydrolase-oxidas
1 2_35_020_12 2-alkenal reductase EHY76699.1 11014 12171 TM Oxido
182 35 020 13 histidinol-phosphate aminotransferase EHY76700.1 12267 13313 #N/A #N/A
Ι82_35_020_14 bifunctional histidinal dehydrogenase/ histi YP_006458954.1 13410 14720 #N/A #N/A
182_35J)20_15 ATP phosphoribosyltransferase catalytic YP_006458955.1 14890 15522 #N/A #N/A subu
182 35 020 16 UDP-N-acetylglucosamine 1- EHY76703.1 15758 17023 #N/A #N/A carboxyvinyltransferase
182_35__020_17 toluene-tolerance protein EHY76704.1 17127 17366 #N/A #N/A
182_35_020_1 hypothetical protein PST_1042 YP 001171581.1 17466 17957 #N/A #N/'A
182 35 020 19 toluene-tolerance protein YP 004713314.1 17971 18285 #N/A #N/A
182 35 020 20 toluene-tolerance protein EHY76707.1 18278 18925 #N/A /A
182J5_020_21 toluene tolerance ABC transporter YP 001171578.1 18937 1 395 #N/A m/A periplasmi
182 35 020 22 toluene tolerance ABC efflux transporter, pe YPJWl 171577.1 19395 20192 #N/A /A
182_35J)20_23 toluene tolerance ABC efflux transporter, YP 001171576.1 20185 21000 #N/A #N/A
AT
182 35 020J24 hypothetical protein A458 16580 YP 006458964.1 21282 22256 #N/A #N/A
182_35_020_25 Yrbl family phosphatase YP 001 171574.1 22256 22780 #N/A #N/A
182 35_ 020_26 hypothetical protein A458 16590 YP 006458966.1 22789 23361 #N/A #N/A
1 2J5 020 27 OstA family protein YPJ106458967.1 23348 23893 #N/A #N/A
182 35_ 020_28 hypothetical protein CAA1111 1.1 23893 24618 #N/A /A
182_35 020 29 sigma factor sigma-54 CAAI 1 112. I 24764 26272 #N A m/A
Figure imgf000036_0001
Figure imgf000037_0001
Figure imgf000038_0001
183_21_D14_19 hypothetical protein AradN 05929 ZP_08946985.1 20160 21 170 /A #N/A
183_21_D14^20 ATPase ZP_08946986.1 21 191 2211 1 #WA #N/A
183_21_D14_21 histone deacetylase superfamily protein ZP_08946987.1 22154 23107 m/A #N/A
183_21_D14_22 enoyl-CoA hydratase/carnithine racemase ZPJ0392075.1 2 126 2391 1 #N/A #N/A
183 21 D14 23 mechanosensitive ion channel protein MscS ZP_ 09330497.1 2391 1 25233 m/A #N/A
183^21_D14_24 electron transfer flavoprotein subunit alpha YP_001563413.1 25488 26237 m/A Oxido
183_21_ D14_25 electron transfer flavoprotein subunit alpha YP 004490435.1 26390 27322 #N/A Oxido
183_21_D 14 26 acyl-CoA dehydrogenase domain protein ZP_04763262.1 27499 29289 #N/A #N/A
183_21_D14_27 2-nitropropane dioxygenase YP 987024.1 29416 30372 #N/A #N/A
183 21 D14 28 acetate~CoA ligase ZP 08947242.1 30482 32476 #N/A #N/A
183 21 D14 29 cytochrome c class I ZP_09330598.1 33163 33468 SEC Oxido
183_21_D14_30 conserved hypothetical protein ZP_04761189.1 33570 33812 #N/A #N/A
183_21_D14_31 dihydroxy-acid dehydratase ZP_04761188.1 34036 35892 /A #N/A
183 21 D 14 32 virulence-associated protein C YP_002019545. I 361 15 36525 #N/A #N/A
183_21_D 14J3 Virulence-associated protein YP 001 91982.1 36525 36758 #N/A #N/A
183 21 D14 34 type III restriction protein res subunit ZP_08951097.1 36895 38076 #N/A #N/A
183 24 C18J hypothetical protein NP_715697.1 2 685 #N A #N/A
183_24_C18J hypothetical protein PMI14_02990 ZP 10390311.1 836 1678 #N/A /A
183_24_C18_4 lactoylglutathione lyase ZP_09329249.1 1777 2247 #N/A #N/A
I 83_24_C18_5 hypothetical protein EA1 86 1 922 ZPJ)9088162.1 2432 2938 miA #N/A
183_24_C18_6 biotin synthase ZP_08946418.1 3443 4534 #N/A #N/A
183_24_C18 7 response regulator receiver modulated metal ZP_09329251.1 4568 5758 m/A MACP d
183_24_C18_8 hypothetical protein AradN J)3058 ZP_08946416.1 5802 8843 SEC PAS
183 24 C 18 9 Molybdopterin-binding protein KYG 10890 ZP 09329253.1 8862 9398 SEC Oxido
183_24_C18_10 alkylhydroperoxidase AhpD ZP 09329254.1 9640 9993 #N/A Oxido
J 3_24_C 18_l l putative transmembrane protein ZP_047631 18.1 10024 10215 #N/A #N/A
183_24_C18 12 metallo-beta-lactamase superfamily protein ZPJ19329257. I 10313 1 1 173 #N/A #N/A
183_24_C 18_13 Ars family regulatory protein ZP 08950487.1 11279 1 1635 #N/A #N/A
183 24 C 18 14 hypothetical protein KYG 10920 ZP_09329259.1 1 1638 12069 #N/A #N/A
183_24_C18_15 hypothetical protein KYG 10925 ZP_09329260.1 121 17 12557 #N/A #N/A
1 3J!4_C 18_16 hypothetical protein KYG 10930 ZP 09329261.1 12559 12903 #N/A #N/A
183_ 24_C 18_17 site-specific recombinase XerD ZP_10389702.1 12934 14007 #N/A #N/A
183_24_C18_18 KfrA domain-containing protein DNA- YP 004234961.1 14125 15120 #N/A #N/A binding d
183_24_C 18_19 Diguanylate cyclase/phosphodiesterase ZP 10137153.1 15424 17808 #N/A #N/A domain
183_24_C18_20 short-chain dehydrogenase/reductase SDR ZP_08946404.1 17987 18691 #N/A #N/A
183_24_C 18_21 mate efflux family protein ZP 08946403.1 18782 20188 i N/A #N/A
183 24 C 18 22 MaoC-like protein dehydratase ZP 08946402.1 20185 20694 #WA #N/A
183 24 CI 8 23 major facilitator transporter ZP_08946401.1 20737 22014 TM MDES
183_24JT18_24 MarR family transcriptional regulator ZP_08946400.1 22004 22504 #N/A #N/A
183_24_C 18_25 thioesterase superfamily protein ZP 04762462.1 22578 23129 #N/A #N/A
183_24_C 18_26 lactoylglutathione lyase ZP 08946398.1 23126 23539 #N/A #N/A
183_24_C18_27 nicotinamidase-like amidase ZPJ 0390427.1 23665 24270 #N/A #N/A
183 24 C 18 28 NLP/P60 protein ZP_04763442.1 24545 25135 M/A #N/A
I 83J24 C 18 29 hypothetical protein YG 21454 ZP_09331318.1 25183 25566 #WA #N/A
183_24_C 18_30 putative membrane protein ZPJ 0390431.1 25776 26027 /A #N/A
183_26G23 1 cyanophycin synthetase ZPJ 0393306.1 1 1599 /A #N/A
183 26J323_2 CreA family protein ZP 08950440.1 1596 2084 /A #N/A 183_26_ G23J DSBA oxidoreductase ZP_08950443.1 2175 2822 /A Oxido
183 26_ G23_4 hypothetical protein YG_20310 ZP_09331096.1 3134 3418 /A #N/A
183_26_G23_5 hypothetical protein PMI14 061 12 ZPJ0393302.1 3512 4894 m/A /A
183_26_G23_6 glucose-6-phosphate isomerase ZP 09330015.1 4943 6499 m/A m/A
183_26_G23_7 3-oxoacyl-ACP synthase YP_005436677.1 6649 7767 /A #N/A
183_26_G23_8 transaldolase ZP_04763152.1 7847 8794 /A #N/A
183_26_G23_ 9 RpiR family transcriptional regulator ZP 08948106.1 8925 9770 m/A m/A
183_26_G23_10 PEBP family protein ZP_04762018.1 9877 10371 /A m/A
183_26__G23_11 5'-nucleotidase YP 972337.1 10422 12326 /A #N/A
183 26 G23 12 oligopeptide/dipeptide ABC transporter ZP 08948108.1 12514 13518 m/A #N/A
ATPase
183_26_G23_13 oligopeptide/dipeptide ABC transporter ZP 09330000.1 13515 14495 m/A #N/A
ATPase
I83_26_G23_I4 binding-protein-dependent transport systems ZP 09329999.1 14669 15580 /A #N/A i
183_26J323J5 amidohydrolase ZP 089481 12.1 15598 16815 /A #N/A
183_26_G23_16 binding-protein-dependent transport systems YPJW2552144.1 16817 17797 m/A #N/A
183_26_G23_17 family 5 extracellular solute-binding protein ZP 09329995.1 17928 19508 #N/A #N/A
183 26 G23J 8 porin ZP 09329994.1 1981 1 20767 m/A #N/A
1 3 26 G23 1 ubiquinone biosynthesis protein COQ7 ZPJ 03 1 126.1 21084 21701 m/A #N/A
183Jt6_G23_20 OsmC family protein YP_969302.1 21872 22321 /A #N/A
183_26_G23^21 threonine dehydratase ZP 09329991.1 22634 2421 1 m/A #N/A
183 26 G23 22 cobalamin synthase ZP_ 089481 19.1 24510 25328 m/A #N/A
183_26_G23_23 phosphoglycerate mutase YP 984998.1 25325 25939 /A #N/A
183 26 G23 24 methyl-accepting chemotaxis sensory ZP_09328098.1 25932 27578 TM MACP transduce
183_26_G23_25 thiamine biosynthesis protein ThiC ZP 04763400.1 27764 29659 #N/A #N/A
183_26_G23_26 hypothetical protein PMI12 02416 ZP 10568386.1 29919 30095 m/A #N/A
1 3 26 G23 27 udp-3-0-acyl r-acetylglucosamine YP 004128296.1 301 13 31036 /A #N/A deacetylase
183_26_G23_28 cell division protein FtsZ ZP 04763397.1 31 147 32382 m/A #N/A
183^26_G23_29 cell division protein FtsA ZPJM763396.1 32543 33772 /A #N/A
183J½ G23_30 polypeptide-transport-associated domain- ZP 08948139.1 33805 34593 m/A #N/A conta
183_26_G23_31 D-alanine/D-alanine ligase ZP_04763394.1 34590 35576 /A #N/A
183_26_G23_32 UDP-N-acetylmuramate~L-alanine ligase ZP 0932 107.1 35576 37006 /A /A
I 83 26 G23 33 undecaprenyldiphospho- ZPJ)9328108.1 37003 38088 m/A #N/A muramoylpentapeptide be
183 52 02_1 hypothetical protein DelCsl4_2697 YP_004488064.1 1 5196 /A #N/A
183 52 02 3 putative signal peptide protein YP 345289.1 5430 5777 /A #N/A
183_52_02_4 hsdR gene product YP 005974822.1 6304 9102 m/A #N/A
183_52_02_5 hsdM gene product YPJ305974823.1 91 15 10824 m/A #N/A
183 52 02 6 restriction modification system DNA YP_001230860.1 10821 12416 /A m/A specific
183 52 02 7 hypothetical protein AZA 26080 ZP 08870323.1 12413 14287 m/A m/A
183 52 02 8 hypothetical protein YP 005974826.1 14287 15369 /A #N/A
183_52_02_9 hypothetical protein ebA2393 YPJ 58360.1 15453 16082 /A #N/A
183 52 O J0 transcriptional regulator YP_158359.1 16057 17226 m/A /A
183 52 02 11 hypothetical protein NCGM 1179 3188 GAA18352.1 17223 18596 m/A /A
1 3^52_02_12 hypothetical protein ebA2389 YPJ 58357.1 18593 19159 /A /A
183 52 02_13 lSxac2 transposase YP 001 172224.1 19305 19679 #N/A m/A
183 52 02 14 hypothetical protein PflSSlOl 1461 EIK61223.1 19977 20654 #N/A #N/A
Figure imgf000041_0001
183_42_E18_29 auxin efflux carrier ZP 08946084.1 25093 26049 /A #N/A
183 42 E18 30 chromate ion transporter YP_133847.1 26152 27405 /A #N/A
183 42 El 8 31 GMP synthase, large subunit ZP 04762299.1 27490 29130 #N/A #N/A
183_42_E18_32 inosine-5'-monophosphate dehydrogenase ZP 09328399.1 29208 30683 #N/A #N/A
183_42_E18_33 hypothetical protein KYG 06529 ZP_09328398.1 30760 31272 m/A N/A
183_42_E18J4 hypothetical protein PM114 04152 ZP 10391458.1 31295 31633 #N/A #N/A
183_42_E18J5 cyclase/ dehy drase ZP 09328396.1 31626 32066 #N/A #N/A
183_42_E18_36 SsrA-binding protein ZP 03542969.1 32201 32674 m/A #N/A
183_42_E18_37 secreted repeat protein YP 004126579.1 32775 33140 /A #N/A
183 42 E18 38 RNA polymerase subunit sigma-24 YP 002552721.1 3 160 33666 m/A #N/A
182 10 L09 1 LemA family protein ZP J 0200892.1 3 236 m/A #N/A
182_10_L09_2 Heat shock protein HtpX ZP_08647540.1 334 2166 /A #N/A
182 10 L09J hypothetical protein Tmzlt 2019 YP_002355665.1 2373 2813 m/A #N/A
182 10 L094 Putative alphabeta-Hydrolase YP_002354168.1 3060 3941 m/A #N/A
182J0 L09 5 major facilitator transporter YP 284361.1 4029 5195 /A #N/A
182 10 L096 excinuclease ABC subunit C YPJX12355941.1 5297 7114 m/A #N/A
182 10 L09 7 beta-hexosaminidase YP_002355942.1 731 8460 m/A m/A
182_10_L09 holo-acyl-carrier-protein synthase YP 002355943.1 8457 8837 m/A /A
182J0_L09_9 pyridoxine 5'-phosphate synthase YP 002355944.1 8866 9621 m/A m/A
182_10_L09J0 DNA repair protein RecO YP 002355945.1 9621 10373 m/A m/A
182 10 L09J 1 GTP-binding protein Era YP_002355946.1 10389 11321 m/A m/A
182JO L09 12 ribonuclease III YP_002355947.1 11318 11989 /A m/A
182J0L09_13 hypothetical protein Tmzlt_2313 YP 002355948.1 11994 12350 /A /A
182_10_L09J4 lepB gene product YP_933144.1 12423 13211 /A /A
182 10 L09J5 GTP-binding protein LepA YP 002355950.1 13260 15056 m/A m/A
182J0 L09 16 glutaredoxin YP 0023559 1.1 15124 15399 m/A m/A
182_10_L09J7 protease Do YP_002355952.1 15396 16847 m/A /A
182_10_L09_18 positive regulator of sigma E, RseC/MucC YP_002355953.1 16844 17314 /A /A
182_10_L09J9 sigma E regulatory protein, MucB/RseB YP 002355954.1 17311 18282 m/A /A
182 10 L09 20 anti sigma-E protein, RseA YPJ102355955.1 18279 18824 m/A /A
I82_10_L09_21 algU gene product YP 933134.1 18834 19433 m/A /A
182 10 L0922 L-aspartate oxidase YP 002355957.1 19622 21262 /A HPG
182 10 L0923 hypothetical protein YP_933132.1 21343 21852 /A #N/A
I82 0_L09_24 fabFI gene product YP_933131.I 21880 23115 TAT Secretion
I82_10_L09_25 acyl carrier protein YP 002355960.1 23217 23456 m/A #N/A
182 10_L09_26 3-ketoacyl-(acyl-carrier-protein) reductase YPJ)02355961.I 23548 24297 /A #N/A
182 10 L09 27 malonyl CoA-acyl carrier protein YP 002355962.1 24301 25230 m/A #N/A transacylas
182_10_L09_28 3-oxoacyl-(acyl carrier protein) synthase II YP 002355963.1 25267 26232 /A m/A
182 10_L0929 glycerol-3-phosphate acyltransferase PlsX YP 002889409.1 26229 27245 /A m/A
1 2 10 L0930 rpmF gene product YP_933125.1 27339 27518 m/A /A
182 10 L09_31 metal -binding protein YP_002889411.1 27548 28072 /A /A
182__10_L0 _32 maf protein YP 002889412.1 28253 28828 /A m/A
182J0L09_33 uroporphyrin-III C/tetrapyrrole methyltransf YP_002889 13.1 28825 29574 SEC Oxido
182_10_L09_34 HAD-superfamily hydrolase YP 002889414.1 29656 30312 #N/A #N/A
182_07_C02_1 hypothetical protein ebB27 YPJ 57502.1 3 281 #N/A #N/A
182_07_C02 2 hypothetical protein NE1441 NP 841482.1 278 457 #N/A #N/A
182_07_C02_3 hypothetical protein ebA893 YP_157504.1 483 2396 #N/A #N/A
182_07_C02_4 cysteine synthase B YP_002890006.1 2545 3435 #N/A #N/A
Figure imgf000043_0001
182_13_Α07_22 hypothetical protein YP_005939681.1 21873 22850 #N/A #N/A
182J3_A07_23 putative alkyl salicylate esterase YP 001 173386.1 22901 23650 #N/A #N/A
182J3_A07_24 non-heme iron-dependent enzyme EHY76100.1 23643 24623 wA Oxido
182 J 3 _A07_25 PAS PAC sensor hybrid histidine kinase YP 006458683.1 24916 27147 SEC PAS
182J 3 A07 26 PAS domain S-box YP_006458682.1 27386 29071 #N/A PAS
182 13 A07 27 circadian oscillation regulator EHY79520.1 29055 30581 #N/A #N/A
182_13_A07_28 putative ABC 1 protein EHY79521.1 31019 32320 tt A #N/A
182 13 A07 29 short chain dehydrogenase/reductase family EHY79522.1 32341 33042 HWA Oxido oxidor
18 J 3 A07 30 PAS domain S-box YP 005939664.1 33015 35147 #N/A PAS
182J3_A07_31 gamma-glutamyltransferase EHY79524.1 35567 37240 #N/A #N/A
182_13_A07_32 glyoxalase bleomycin resistance YP 006458675.1 37373 37765 #N/A HPG protein/diox
182_13_A07_34 hypothetical protein PST 2282 ΥΡ 0ΟΠ 72783.1 38308 38778 #N/A #N/A
182_13_A07_35 hypothetical protein Pextl si 03389 ZPJ0435433.1 39005 39409 #N/A #N/A
182J 3_A07J6 LysR family transcriptional regulator YP_0064586 1.1 39862 40545 #N/A #N/A
183_29_M04J K+ potassium transporter ZP_08949167.1 1 1551 #N/A #N/A
183J29 i04_2 benzoate transporter ZP 04764009.1 1697 2887 SEC MDES
183_29_M04J glutathione synthetase YP 983953.1 2925 3881 #N/A #N/A
183 29 M04 4 integrase catalytic subunit YP 551887.1 9978 10829 ΛΝ/Α #N/A
183 29JvI04_5 transposase is3/is911 family protein YP 004154633.1 10883 1 1209 #N/A #N/A
183_29_M04_6 DSBA oxidoreductase, Twin-arginine YP 984674.1 11257 1 1910 TAT Oxido translocation pathway signal
183_29_M04_ 7 sporulation domain-containing protein YP 968796.1 11965 12582 #N/A #N/A
183_29_M04_8 arginyl-tRNA synthetase ZP 09331017.1 12597 14294 #N/A #N/A
183_29_M04_9 hypothetical protein Acav 0473 YP_004232963. l 14348 14806 #N/A #N/A
183_29_M04_10 transcriptional regulator, LysR family ZP 04763015.1 14803 15735 #N/A
183_29_M04J 1 coenzyme A transferase ZP 08950393.1 15857 1 803 miA #N/A
183 29 I04_12 malate synthase G ZP 09327224.1 18008 20209 #N/A #N/A
183_29_Μ04_13 putative monovalent cation H+ antiporter ZP 09327225.1 20320 20661 #N/A #N/A subu
183_29_M04J4 putative monovalent cation/H+ antiporter ZP_09327226.1 20672 20947 #N/A #N/A subu
183 29 M04J5 putative K(+)/H(+) antiporter subunit E ZP 09327227.1 20944 21519 #N/A #N/A
183 29 M04 16 putative monovalent cation/H+ antiporter ZP_09327228.1 21516 23150 #N/A #N/A subu
183 29 M04J 7 putative monovalent cation/H+ antiporter ZP 09327229.1 23150 23542 #N/A #N/A subu
183 29 M04 18 putative monovalent cation/H+ antiporter ZP 09327230.1 23598 26441 #N/A #N/A subu
183J29JV104J9 4-oxalocrotonate tautomerase ZP 09327232.1 27298 27486 #N/A #N/A
183_29JvI04_20 emrB/QacA subfamily drug resistance ZP 09327233.1 27661 29133 TM MDES transport
183_29_M04_21 class-II glutamine amidotransferase ZP 09327234.1 29155 29922 #N/A #N/A
183 29 M04 22 glyoxalase/bleomycin resistance ZP 09327922.1 29949 30329 TM HPG protein/dioxy
183_29_M04J>3 hypothetical protein YG 01427 ZP_09327395.1 30741 31250 #N/A #N/A
183 29 M04 24 hypothetical protein Rfer_4013 YP 525242.1 3201 1 32952 #N/A #N/A
183_29_M04_25 transposase, IS4 family protein YP 984420.1 33103 34191 #N/A #N/A
I 83_29_M04_26 hypothetical protein Tmzlt_3596 YP 002890566.1 34340 34744 #N/A #N/A
183 29 M04 27 hypothetical protein ACG50166.1 34968 37064 #WA #N/A
183_29_M04_28 putative transposon resolvase YPJ)03034068.1 37080 37703 #N/A #N/A
Figure imgf000045_0001
182J9_A11 4 recombination associated protein YP_004379126.1 3739 4656 #N/A #N/A
182 19 Al l 5 flagellar hook protein FlgE EI 53823.1 4756 6153 SEC Secretion
182_19_A11_6 flagellar basal body rod modification protei YPJ>06523702.1 6190 6873 #N/A Secretion
182 19 A11 7 flgC gene product YP 001188336.1 6886 7329 SEC Secretion
182J9_A11_8 flagellar basal body rod protein FlgB YP_004713701.1 7332 7736 #N/A Secretion
182_19_A1 1_9 glmS gene product YP_003899504.1 7960 9789 #N/A #N/A
182_19_A11J0 UDP-glucose 4-epimerase ZPJ18824132.1 9804 10820 #N/A #N/A
182J9 A11J 1 glutamyl-tRNA synthetase ZP 10760857.1 10845 12338 #N/A #N/A
182_19_A1 1_12 LysR family transcriptional regulator EJ093868.1 12403 13317 #N/A #N/A
182 19 Al l 13 secretion protein HlyD family protein ZP 09708733.1 13422 14453 TM Secretion
182 19 Al l 14 EmrB/QacA family drug resistance YP 001347371.1 14446 15981 TAT MDES transporter
182 19_A11 15 glycine/D-amino acid oxidase ZP 10990193.1 16187 17467 #N/A HPG
182 19 A11 16 hypothetical protein A471 09819 EJO94022.1 17545 17946 #N/A #N/A
1S2_19_A11 17 TPR repeat-containing protein YP 005428973.1 17946 18896 #N/A /A
182_I9_A11_18 nitrite reductase ZP_08817914.1 191 13 20759 SEC Oxido
182_19_A11_19 cytochrome c551/c552 YP_005029489.1 20832 21188 TAT Oxido
182 19_A11 20 tctraheme protein NirT YPJKH 174001.1 21268 21870 TM Oxido
182_19_A11_21 denitrification system component YP 002889595.1 21922 22800 #N/A #N/A cytochrome
182 I9 A11 22 TPR repeat-containing protein YP 006532722.1 22859 24058 #N/A #N/A
182J9_A11 23 tRNA-dihydroiiridine synthase A EJX 14582.1 24273 25292 #N/A #N/A
182 19 Al l 24 transaldolase B EJ095866.1 25344 26297 #N/A #N/A
182J9_A1 1_25 anti-sigma-factor antagonist YP_001268884.1 26286 26774 #N/A #N/A
182J9 A11 26 response regulator receiver protein YP 001187423.1 26771 27961 #N/A MACP
182 19 A1 1 27 type IV pilus assembly PilZ ZP 09282631.1 28154 28459 #N/A Secretion
182^19_A11_28 VacJ family lipoprotein ZP_09709915.1 28456 29169 #N/A #N/A
182_I9_A11_29 RND family efflux transporter MFP subunit YP_005090623.1 29335 30486 SEC MDES
182 19 Al l 30 macB gene product YP 932115.1 30490 32436 #N/A #N/A
182 19_A1 1 31 RND efflux system, outer membrane YP_ 691970.1 32426 32797 #N/A #N/A
182 06 L14 1 hypothetical protein PSJM300 10595 YP 006524541.1 2 220 #N/A #N/A
182 06 L14 2 hypothetical protein PstZobell 17634 EHY79247.1 234 91 1 #N/A #N/A
182 06 LI4J antirestriction protein family protein YP_004380665.1 1053 1565 #N/A #N/A
18206_LI4_4 hypothetical protein PST 0625 YP_001171173.1 1863 3059 #N/A #N/A
182_06_LI4_5 XRE family transcriptional regulator YP_001171172.1 3059 3310 #N/A #N/A
182_06J.14_6 hypothetical protein PSJM300J0590 YPJW6524540.1 3685 3933 #N/A #N/A
182 06 L14 7 hypothetical protein PSJM300 10585 YPJW6524539.1 3934 4416 #N/A #N/A
182 06 L14 8 ifsy-2 prophage protein ZP 10670406.1 4510 5193 #N/A #N/A
182_06_L14_9 error-prone DNA polymerase EHY77418.1 5280 8369 #N/A #N/A
182 06 L14 10 DNA-specific endonuclease I ZP_04934525.1 8840 9529 #N/A #N/A
182 06 LI 4 11 PAS PAC sensor hybrid histidine kinase YP 005940175.1 9671 1 1902 SEC PAS
182 06 L14J2 hypothetical protein CF510 08712 EIE46546.1 12132 12932 #N/A #N/A
182_06_LI4_14 hypothetical protein YP_002800206.1 13469 13801 #N/A #N/A
182 06 L 14 16 hypothetical protein Aasi 0901 YP 001957997.1 14375 15694 #N/A #N/A
182_06_LI4_17 hypothetical protein HMPREF9551 _05665 ZP_07192991.1 15676 16353 #N/A #N/A
182J)6_L14 18 ABC-type transporter, ATPase and YP 006524532.1 16350 18029 #N/A #N/A permease co
182_06_LI4_19 Zn-dependent hydrolase YPJ)06523933.1 18139 19035 SEC Oxido
182 06 LJ4 20 AraC family transcriptional regulator ZP_09282862.1 19160 20149 #N/A #N/A
182 06 LI4 21 isochorismatase hydrolase YP 006523935.1 20256 20804 #N/A #N/A
Figure imgf000047_0001
GC-MS profiles of transposon mutants are shown in FIGURE 12, where the
chromatogram compares two transposon mutants (i.e. position 4949 and position 55060) identified by screening with the PemrR-GFP biosensor, wherein both are known to be interrupting putative oxidoreductase open reading frames. The data was normalized to an empty fosmid clone (i.e. i82_o8_C2i). Lignin related compounds 2,4- dihydroxybenzoic acid, i,4-dihydroxy-2,6-dimethoxybenzene and benzoic acid are marked by A, B and C. There are clear differences shown between the two transposon mutants and the empty fosmid clone.
FIGURE 13 provides a graphical representation of the relative proportions of genes grouped into six functional classes, implicated in lignin transformation phenotypes (out of 813 total genes) in the active fosmids identified in the exemplary screen. It is interesting to note that these 6 functional classes are consistently represented in the isolated fosmids and with the exception of the secretion apparatus and perhaps the oxidoreductase, these genes are represented quite consistently within the active fosmids identified in this exemplary screen.
EXAMPLE 5: Identification and Testing of MIE pioc20
A metagenomic DNA library was "retroffited" as described herein and shown in
FIGURE 15 to identify a metabolite induced element (MIE). In FIGURE 16 fhioresence plots are shown for a retrofflted metagenomic library assayed for fluorescence emitted by the fluorescent marker. FIGURE 16 (A) shows the
fluorescence emitted by an uninduced (i.e. no metabolite of interest is added) library and (B) shows the fluorescence emitted by an induced (i.e. where the metabolite of interest is added) library. Induction was by a pool of pCoumaric acid, Vanillic acid and Vanillin. The circled data point that represents a fosmid clone harboring a candidate MIE (pioc20) which was selected for further investigation. In FIGURE 17 a bar graph is shown of an assay to validate the resposiveness of the fosmid clone identified in
FIGURE 16 (pioc20), wherein the MIE pioc20 was found to be most responsive to 1 mM pCoumaric acid, which makes the reporter system encoded in pioc20 potentially useful to detect heterologous metabolite secretion of chemical transformation resulting in the production of pCoumaric acid.
Although various embodiments of the invention are disclosed herein, many adaptations and modifications may be made within the scope of the invention in accordance with the common general knowledge of those skilled in this art. Such modifications include the substitution of known equivalents for any aspect of the invention in order to achieve the same result in substantially the same way. Numeric ranges are inclusive of the numbers defining the range. The word "comprising" is used herein as an open-ended term, substantially equivalent to the phrase "including, but not limited to", and the word "comprises" has a corresponding meaning. As used herein, the singular forms "a", "an" and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a thing" includes more than one such thing. Citation of references herein is not an admission that such references are prior art to an
embodiment of the present invention. Any priority document(s) and all publications, including but not limited to patents and patent applications, cited in this specification are incorporated herein by reference as if each individual publication were specifically and individually indicated to be incorporated by reference herein and as though fully set forth herein. The invention includes all embodiments and variations substantially as hereinbefore described and with reference to the examples and drawings. REFERENCES
1. Okuta et al. Gene (1998) 212:221-228.
2. Henne et al. Appl. Environ. Microbiol. (1999) 65:3901-3907.
3. Uchiyama et al. Nature Biotechnology(2005) 23(i):88-93.
4. Uchiyama and Miyazaki Appl. Environ. Microbiol. (2010) 76(2i):7029-7035.
5. Uchiyama and Miyazaki PLOS ONE (2013) 8(9) ^75795.
6. Zakzeski, J.et al. The Catalytic Valorization of Lignin for the Production of Renewable Chemicals. Chem. Rev. 110, 3552- 3599 (2010).
7. Ruiz-Duenas, F.J & Martinez, A.T. Microbial degradation of lignin: how a bulky recalcitrant polymer is efficiently recycled in nature and how we can take advantage of this. Micr Biotechnol. 2, 164-177 (2009).
8. Boerjan, W., Ralph, J. & Baucher, M. Lignin Biosynthesis. Annu. Rev. Plant Biol. 54, 519-546 (2003).
9. Floudas, D. et al. The Paleozoic Origin of Enzymatic Lignin Decomposition Reconstructed from 31 Fungal Genomes. Science 336, 1715-1719 (2012).
10. Singh, R. et al. Improved manganese-oxidizing activity of DypB, a peroxidase from a lignolytic bacterium. ACS Chem. Biol. 8, 700-706 (2013).
11. Khudayakoc, J.I. et al. Global transcriptome response to ionic liquid by a tropical rain forest soil bacterium, Enterobacter lignolyticus. PNAS. doi:io.i073/pnas.ni2750i09 (2012).
12. Brown, M.E., Barros, T. & Chang, C.Y. Identification and characterization of a
multifunctional dye peroxidase from a lignin reactive bacterium. ACS Chem Bio. 7, 2074-2081 (2012).
13. Bugg, T.D.H. et al. Pathways for degradation of lignin in bacteria and fungi. Nat. Prod. Rep. 28, 1883-1896 (2011).
14. Rodgers, C. et al. Designer laccases: a vogue for high-potential fungal enzymes? Trends Biotechnol. 2, 63-72 (2009).
15. Ahmad, M. et al. Development of novel assays for lignin degradation: comparative analyses of bacterial and fungal lignin degraders. Mol. BioSyst. 6, 815-821 (2010).
16. Zaslaver, A, et al. A comprehensive library of fluorescent transcriptional reporters for Escherichia coli. Nat. Meth. 3, 623-628 (2006).
17. Brooun, A., Tomashek, J.J. & Lewis, K. Purification and Ligand Binding of EmrR, a
Regulator of a Multridrug Transporter. J. Bacteriol. 181, 5131-5133 (1999).
18. Xiong, A. et al. The EmrR Protein Represses the Escherichia coli emrRAB Multidrug
Resistance operon by directly binding to its promoter region. Antimicrob. Agents Chemother. 44, 2905-2907 (2000). 19. Strapoc, D. et al. Methane-Producing Microbial Community in a Coal Bed of the Illinois Basin. Appl. Environ. Microbiol. 74, 2424-2432 (2008).
20. An, D. et al. Metagenomics of hydrocarbon resources enviroments indicates aerobic taxa and genes to be unexpectedly common. Environ. Sci. Technol. DOI: 10.1021/684020184 (2013).
21. Martinez, A., Bradley, A.S., Waldbauer, J.R., Summons, R.E. & Delong, E.F. Proteorhodopsin photosystem gene expression enables photophosphorylation in a heterologous host. PNAS 104, 5590-5595 (2007).
22. Arato, C, Pye, E.K. and Gjennestad, G. The lignol approach to biorefining of woody biomass to produce ethanol and chemicals. Appl Biochem Biotech. 123, 871-882 (2005).
23. Arfi, Y. et al. Characterization of salt-adapted secreted lignocellulolytic enzymes from the mangrove fungus Pestalotiopsis sp. Nat. Commun. doi: io.i038/ncomms2850 (2013).
24. Yakovlev, I. A. et al. Genes associated with lignin degradation in the polyphagous white-rot pathogen Heterobasidion irregular show substrate-specific regulation. Fungal Genet. Biol. 56, 17-24 (2013).
25. He, S. et al. Comparative metagenomic and metatransciptomic analysis of hindgut paunch microbiota in wood- and dung feeding higher termites. PLoS ONE. 8(4): e6ii26 (2012).
26. Shapiro, B.J. et al. Population genomic of early events in ecological differentiation of bacteria. Science. 336, 48-51 (2012).
27. Polz, M.F., Aim, E.J. & Hanage, W.P. Horizontal gene transfer and the evolution of bacterial and archaeal population structure. Trends Genet. 29, 170-175 (2013).
28. Oliver, K.M., Degman, P.H., Hunter, M.S. & Moran, N.A. Bacteriophages encode factors required for protection in symbiotic mutualism. Science. 325, 992-994 (2009).
29. Moran, N.A., Degman, P.H., Santos, S.R., Dunbar, H.E. & Ochman, H. The players in mutualistic symbiosis: insects, bacteria, viruses and virulence genes. PNAS. 102, 16919-16926 (2005).
30. Lee, S. & Hallam, S.J. Extraction of high molecular weight DNA from soils and sediments. J. Vis. Exp. (33), ei509, doi:io.379i/i509 (2009).

Claims

CLAIMS What is claimed is:
1. A method comprising:
(a) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene;
(b) screening the randomly inserted first metagenomic library by adding a metabolite of interest;
(c) detecting reporter gene expression following the addition of the metabolite of interest to identify a metabolite induced element (MIE);
(d) preparing a reporter strain, the reporter strain comprising:
(i) the MIE; and
(ii) a reporter gene adjacent the MIE;
(e) co-culturing heterologous host cells expressing a second metagenomic library with the reporter strain; and
(f) detecting the reporter gene activity in the co-culture.
2. A method comprising:
(a) obtaining a reporter strain, the reporter strain comprising:
(i) a metabolite induced element (MIE), wherein the MIE is responsive to a metabolite of interest; and
(ii) a reporter gene adjacent the MIE;
(b) co-culturing heterologous host cells expressing a functional metagenomic library with the reporter strain; and
(c) detecting the reporter gene activity in the co-culture.
3. A method comprising:
(a) obtaining a reporter construct, the reporter construct comprising:
(i) a metabolite induced element (MIE), wherein the MIE is responsive to a metabolite of interest; and (ii) a reporter gene;
(b) transforming a reporter strain with the reporter construct from (a);
(c) co-culturing the reporter strain with a heterologous host cells expressing a functional metagenomic library; and
(d) detecting the reporter gene activity in the co-culture.
A method comprising:
(a) obtaining a reporter construct, the reporter construct comprising:
(i) a metabolite induced element (MIE), wherein the MIE is responsive to a metabolite of interest; and
(ii) a reporter gene;
(b) transforming a cell with the reporter construct from (a) to form a reporter strain;
(c) growing heterologous host cells expressing a functional metagenomic library;
(e) adding the reporter strain from (b) to the heterologous host cells expressing a functional metagenomic library to form a co-culture; and
(f) detecting the reporter gene activity in the co-culture.
The method of any one of claims 1-4, further comprising testing the MIE for specificity and sensitivity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain.
The method of claim 5, further comprising engineering the MIE to obtain the desired substrate specificity and sensitivity following testing the MIE for specificity and sensitivity to the metabolite of interest.
The method of any one of claims 1-6, wherein the functional metagenomic library is a fosmid library.
The method of any one of claims 1-7, further comprising mutagenesis of functional metagenomic host cells producing reporter strain activity and further screening for production of the metabolite of interest.
9. The method of any one of claims 1-8, wherein the reporter strain cells and the heterologous host cells expressing a functional metagenomic library are cultured in a plate-based format.
10. The method of any one of claims 1-9, wherein the MIE is obtained from a
functional metagenomic library.
11. The method of any one of claims 1-10, wherein the reporter strain is a bacterial cell.
12. The method of any one of claims 1-11, wherein the heterologous host cells
expressing a functional metagenomic library are bacterial cells.
13. The method of claim 11, wherein the bacterial cell is an E. coli cell.
14. The method of claim 12, wherein the bacterial cells are E. coli cells.
15. The method of any one of claims 1-14, further comprising isolating the co-culture having reporter gene activity.
16. The method of claim 15, further comprising culturing the host cells having
reporter gene activity to produce the metabolite of interest.
17. A method comprising:
(a) choosing a first metabolite of interest and a first substrate;
(b) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene;
(c) screening the randomly inserted first metagenomic library by adding the first metabolite of interest;
(d) detecting reporter gene expression following the addition of the first metabolite of interest to identify a first metabolite induced element (MIEi);
(e) preparing a first reporter strain, the reporter strain comprising:
(i) the MIEi; and
(ii) a reporter gene adjacent to MIEi; (f) co-culturing heterologous host cells expressing a second metagenomic library with the first reporter strain in the presence of the first substrate;
(g) detecting the reporter gene activity in the co-culture; and
(h) repeat steps (a)-(f) as desired, wherein the first metabolite of interest is used as a second substrate and a new metabolite of interest is a second
metabolite of interest and is used to generate an MIE2.
18. The method of any one of claim 17, further comprising testing the one or more MIEs for specificity and sensitivity to the metabolites of interest prior to co- culturing the heterologous host cells expressing a functional metagenomic library with the reporter strains.
19. The method of claim 18, further comprising engineering the one or more MIEs to obtain the desired substrate specificity and sensitivity following testing the one or more MIEs for specificity and sensitivity to the metabolites of interest.
20. The method of any one of claims 17-19, wherein the functional metagenomic
library is a fosmid library.
21. The method of any one of claims 17-20, further comprising mutagenesis of
functional metagenomic host cells producing reporter strain activity and further screening for production of the metabolite of interest.
22. The method of any one of claims 17-21, wherein the reporter strain cells and the heterologous host cells expressing a functional metagenomic library are cultured in a plate-based format.
23. The method of any one of claims 17-22, wherein the one or more MIEs are
obtained from a functional metagenomic library.
24. The method of any one of claims 17-23, wherein the reporter strain is a bacterial cell.
25. The method of any one of claims 17-24, wherein the heterologous host cells
expressing a functional metagenomic library are bacterial cells.
26. The method of claim 24, wherein the bacterial cell is an E. coli cell.
27. The method of claim 25, wherein the bacterial cells are E. coli cells.
28. The method of any one of claims 17-27, further comprising isolating the co- culture having reporter gene activity.
29. The method of claim 28, further comprising culturing the host cells having
reporter gene activity to produce the metabolite of interest.
30. A method comprising:
(a) randomly inserting a mobile genetic element into a first metagenomic library to produce a randomly inserted first metagenomic library, wherein the mobile genetic element comprises a promoter-less reporter gene;
(b) screening the randomly inserted first metagenomic library by adding a metabolite of interest;
(c) detecting reporter gene expression following the addition of the metabolite of interest to identify a metabolite induced element (MIE); and
(d) preparing a reporter strain, the reporter strain comprising:
(i) the MIE; and
(ii) a reporter gene adjacent the MIE.
31. The method of claim 30, further comprising the step of:
(e) co-culturing heterologous host cells expressing a second metagenomic library with the reporter strain.
32. The method of claim 31, further comprising the step of:
(f) detecting the reporter gene activity in the co-culture.
33. The method of claim 30, 31 or 32, further comprising testing the MIE for
specificity and sensitivity to the metabolite of interest prior to co-culturing the heterologous host cells expressing a functional metagenomic library with the reporter strain.
34. The method of claim 33, further comprising engineering the MIE to obtain the desired substrate specificity and sensitivity following testing the MIE for specificity and sensitivity to the metabolite of interest.
35. The method of any one of claims 30-34, wherein the functional metagenomic library is a fosmid library.
36. The method of any one of claims 30-35, further comprising mutagenesis of functional metagenomic host cells producing reporter strain activity and further screening for production of the metabolite of interest.
37. The method of any one of claims 30-36, wherein the reporter strain cells and the heterologous host cells expressing a functional metagenomic library are cultured in a plate-based format.
38. The method of any one of claims 30-37, wherein the MIE is obtained from a functional metagenomic library.
39. The method of any one of claims 30-38, wherein the reporter strain is a bacterial cell.
40. The method of any one of claims 30-39, wherein the heterologous host cells
expressing a functional metagenomic library are bacterial cells.
41. The method of claim 39, wherein the bacterial cell is an E. coli cell.
42. The method of claim 40, wherein the bacterial cells are E. coli cells.
43. The method of any one of claims 30-42, further comprising isolating the co- culture having reporter gene activity.
44. The method of claim 43, further comprising culturing the host cells having
reporter gene activity to produce the metabolite of interest.
PCT/CA2015/000071 2014-02-06 2015-02-06 Methods for sequential screening with co-culture based detection of metagenomic elements conferring heterologous metabolite secretion Ceased WO2015117232A1 (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
US15/115,644 US20170226503A1 (en) 2014-02-06 2015-02-06 Methods for Sequential Screening with Co-Culture Based Detection of Metagenomic Elements Conferring Heterologous Metabolite Secretion

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US201461936448P 2014-02-06 2014-02-06
US61/936,448 2014-02-06

Publications (1)

Publication Number Publication Date
WO2015117232A1 true WO2015117232A1 (en) 2015-08-13

Family

ID=53777093

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2015/000071 Ceased WO2015117232A1 (en) 2014-02-06 2015-02-06 Methods for sequential screening with co-culture based detection of metagenomic elements conferring heterologous metabolite secretion

Country Status (2)

Country Link
US (1) US20170226503A1 (en)
WO (1) WO2015117232A1 (en)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018140323A1 (en) * 2017-01-24 2018-08-02 Prospect Bio, Inc. Novel biosensors and uses thereof

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP6298404B2 (en) 2011-07-25 2018-03-20 オックスフォード ナノポール テクノロジーズ リミテッド Hairpin loop method for double-stranded polynucleotide sequencing using transmembrane pores
US11155860B2 (en) 2012-07-19 2021-10-26 Oxford Nanopore Technologies Ltd. SSB method
GB201403096D0 (en) 2014-02-21 2014-04-09 Oxford Nanopore Tech Ltd Sample preparation method
GB201609220D0 (en) * 2016-05-25 2016-07-06 Oxford Nanopore Tech Ltd Method
CN113430182B (en) * 2021-08-09 2023-01-13 云南师范大学 Bacterial laccase from Astrospiraceae of elephant intestinal tract and gene thereof
CN113430181B (en) * 2021-08-09 2023-01-13 云南师范大学 Bacterial laccase derived from Asian elephant intestinal metagenome and gene thereof
CN116751804B (en) * 2023-05-08 2024-05-17 石河子大学 Application of VdCreA gene in verticillium dahliae growth, pathogenicity and carbon metabolism inhibition

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5397697A (en) * 1989-01-10 1995-03-14 Ciba-Geigy Corporation Identification of plant-responsive genes of bacteria
DE102012017026A1 (en) * 2012-08-28 2014-03-06 Forschungszentrum Jülich GmbH Sensor for NADP (H) and development of alcohol dehydrogenases

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
STRACHAN ET AL.: "Metagenomic scaffolds enable combinatorial lignin transformation.", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES USA., vol. 111, no. 28, 15 July 2014 (2014-07-15), pages 10143 - 10148, XP055219126, ISSN: 1091-6490, DOI: doi:10.1073/pnas.1401631111 *
UCHIYAMA ET AL.: "Metagenomic screening for aromatic compound-responsive transcriptional regulators.", PLOS ONE., vol. 8, no. Issue 9, 30 September 2013 (2013-09-30), pages 1 - 8, XP055219113, ISSN: 1932-6203 *
UCHIYAMA ET AL.: "Product-induced gene expression, a product-responsive reporter assay used to screen metagenomic libraries for enzyme-encoding genes.", APPLIED AND ENVIRONMENTAL MICROBIOLOGY., vol. 76, no. 21, November 2010 (2010-11-01), pages 7029 - 7035, XP055219110, ISSN: 0099-2240 *
ZASLAVER ET AL.: "A comprehensive library of fluorescent transcriptional reporters for Escherichia coli.", NATURE METHODS., vol. 3, no. 8, August 2006 (2006-08-01), pages 623 - 628, XP055219124, ISSN: 1548-7091 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2018140323A1 (en) * 2017-01-24 2018-08-02 Prospect Bio, Inc. Novel biosensors and uses thereof

Also Published As

Publication number Publication date
US20170226503A1 (en) 2017-08-10

Similar Documents

Publication Publication Date Title
WO2015117232A1 (en) Methods for sequential screening with co-culture based detection of metagenomic elements conferring heterologous metabolite secretion
Wang et al. CRAGE enables rapid activation of biosynthetic gene clusters in undomesticated bacteria
Stroe et al. Targeted induction of a silent fungal gene cluster encoding the bacteria-specific germination inhibitor fumigermin
Mahapatra et al. Metagenomics Approaches in Discovery and Development of New Bioactive Compounds from Marine Actinomycetes: GP Mahapatra et al.
Seyedsayamdost Toward a global picture of bacterial secondary metabolism
Hochmuth et al. Polyketide synthases of bacterial symbionts in sponges–evolution-based applications in natural products research
Iqbal et al. Biocatalysts and small molecule products from metagenomic studies
Katz et al. Culture-independent discovery of natural products from soil metagenomes
Rocha-Martin et al. Emerging strategies and integrated systems microbiology technologies for biodiscovery of marine bioactive compounds
Liu et al. Rational construction of genome-reduced Burkholderiales chassis facilitates efficient heterologous production of natural products from proteobacteria
Gerth et al. Myxobacteria: proficient producers of novel natural products with various biological activities—past and future biotechnological aspects with the focus on the genus Sorangium
Wang et al. Transcriptomic analysis reveals new regulatory roles of Clp signaling in secondary metabolite biosynthesis and surface motility in Lysobacter enzymogenes OH11
Warren et al. Transcription of foreign DNA in Escherichia coli
Rondon et al. Identification and analysis of a siderophore biosynthetic gene cluster from Agrobacterium tumefaciens C58
Leveau The magic and menace of metagenomics: prospects for the study of plant growth-promoting rhizobacteria
Ishida et al. Assembly and absolute configuration of short‐lived polyketides from Burkholderia thailandensis
Wang et al. Response of Pseudomonas fluorescens to dimethyl phthalate
JP2001520022A (en) Screening for new compounds that modulate biological interactions
Hou et al. A single amino acid mutation in Spo0A results in sporulation deficiency of Paenibacillus polymyxa SC2
Patzelt et al. Gene flow across genus barriers–Conjugation of Dinoroseobacter shibae’s 191-kb killer plasmid into Phaeobacter inhibens and AHL-mediated expression of type IV secretion systems
Wang et al. A novel NRPS cluster, acquired by horizontal gene transfer from algae, regulates siderophore iron metabolism in Burkholderia seminalis R456
Hünnefeld et al. The MarR-type regulator MalR is involved in stress-responsive cell envelope remodeling in Corynebacterium glutamicum
Asin-Garcia et al. Metagenomics harvested genus-specific single-stranded DNA-annealing proteins improve and expand recombineering in Pseudomonas species
Uzelac et al. Quorum sensing and RsaM regulons of the rice pathogen Pseudomonas fuscovaginae
Dell et al. Chemical richness and diversity of uncultivated ‘Entotheonella’symbionts in marine sponges

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 15747031

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 15747031

Country of ref document: EP

Kind code of ref document: A1