WO2015116502A1 - Detection and treatment of gnaq mutant uveal melanoma cells with gold nanoparticles - Google Patents

Abstract

The inventions described herein relate to the use of metallic nanoparticles for the early detection of uveal melanoma. The nanoparticles comprise a nucleic acid having a stem and loop structure that juxtaposes the metallic domain onto a fluorophore to quench the fluorophore. Upon binding to a variant GNAQ sequence, the stem and loop structure is disrupted and the fluorophore fluoresces. In particular embodiments, the metallic domain comprises gold. The inventions described herein further relate to the use of metallic nanoparticles to treat uveal melanoma.

Description

DETECTION AND TREATMENT OF GNAQ MUTANT UVEAL MELANOMA CELLS WITH GOLD NANOP ARTICLES

CROSS-REFERENCE TO RELATED APPLICATIONS

[001] This application claims the benefit of U.S. Provisional Application No. 61/933,881, filed on January 31, 2014, which is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

[002] The inventions described herein relate to the use of gold nanoparticles for the early detection of uveal melanoma. The inventions described herein further relate to the use of gold nanoparticles to treat uveal melanoma.

BACKGROUND

[003] Uveal melanoma (UM) is a cancer of the eye involving the iris, ciliary body, or choroid

(collectively referred to as the uvea). Tumors arise from melanocytes that reside within the uvea. Subtypes of uveal melanoma include choroidal melanoma, ciliary body melanoma, and iris melanoma. Up to 85% of all UMs carry somatic mutations in the alpha subunit of the G- coupled proteins GNAQ and GNA11, leading to anchorage independent growth and proliferation.

[004] UM is the most common primary intraocular malignancy and the most common non- cutaneous melanoma in adults. It affects 5-7 people/million/year. (Shields, Clin. Dermatol. 2009, 27, 122-133; Hu, Yan Ke Xue Bao 2011, 26, 18-22.) UM can arise from melanocytes of the choroid plexus (85%), from the ciliary body (5- 8%) as well as from the iris (3-5%) of the eye. Up to one half of patients develop metastasis invariably targeting the liver (93%), and in some cases the lungs (24%) and bones (16%), with a median survival of only 6-9 month with the onset of symptoms. (Diener-West et ah, Arch. Ophthalmol. 2005, 123, 1639— 1643; Scholes, et al., Invest. Ophthalmol. Vis. Sci. 2003, 44, 1008-101 1. )

[005] Early detection of UM is key in providing successful cancer therapy and improving patient outcomes. Diagnosis of UM is based on clinical findings such as the size and thickness of the lesion, presence of subretinal fluid and orange pigment, tumor margins within 3mm of the ocular disk and clinical symptoms such as impairment of vision. It was found that patients presenting with only one of these findings bear a low risk of having a proliferative tumor (3%), whereas more than two factors increase the likelihood of a malignancy to at least 50%. These criteria are helpful to estimate the biological behavior of large and most medium sized uveal neoplasms and help to distinguish a uveal nevus from a UM. A substantial challenge remains with predicting the biology of small ocular lesions. This lack of early UM diagnostics increases the risk of mortality.

[006] Existing treatments for UM are invasive and include eye removal (enucleation), plaque

brachytherapy, transpupillary thermotherapy, external beam proton therapy, resection of the tumor, gamma knife stereotactic radiosurgery or a combination thereof. Additional surgical treatments include resection techniques such as trans-scleral partial choroidectomy, and transretinal endoresection.

SUMMARY OF THE INVENTION

[007] The inventions described herein provide gold nanoparticles (AuNP), functionalized with specific ligands to detect variant GNAQ transcripts. The inventions further provide real-time mutation analysis of uveal oncogenes in living cells.

[008] In other embodiments, the nanostructures of the invention function as carriers of

oligonucleotides for the treatment of conditions caused by GNAQ variants in subjects. The intracellular release of the oligonucleotides upon recognition of variant GNAQ transcripts leads to effective knockdown of GNAQ and resulting in the reduction of cell viability.

[009] Thus, the invention provides a gold nanoparticle comprising a gold domain; a fluorescent dye; a first nucleic acid having a first portion that is operative to form a stem and a second portion that is operative to form a loop resulting in the first nucleic acid being operative to form a hairpin conformation; wherein the hairpin conformation causes the gold domain to quench the fluorescent dye resulting in the nanoparticle being in an inactive state; wherein a second portion of the first nucleic acid is operative to specifically bind a GNAQ sequence in a second nucleic acid; wherein the hairpin conformation is operable to be disrupted by the second nucleic acid resulting in an active state; and wherein in the active state, the gold domain does not quench the fluorescent dye when the hairpin conformation is disrupted and the fluorescent dye fluoresces. (Figure 1.)

[010] In a preferred embodiment, the first and second portions of the first nucleic acid do not

overlap. In another preferred embodiment, the first and second portions of the first nucleic acid overlap.

[011] In a preferred embodiment, the first nucleic acid has at least 13 of the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2. In a more preferred embodiment, the first nucleic acid has at least 14 of the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2. In a most preferred embodiment, the first nucleic acid has the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2. [012] In another embodiment, the second nucleic acid has at least a 90% sequence identity to SEQ ID NO:4. In a preferred embodiment, the second nucleic acid has the sequence of SEQ ID NO:4.

[013] In another embodiment, metallic nanoparticles of the invention, including the gold

nanoparticles, comprise a fluorescent dye selected from the group consisting of a xanthene derivative, a cyanine derivative, a naphthalene derivative, a coumarin derivative, an oxadiazole derivative, a pyrene derivative, an oxazine derivative, an acridine derivative, an arylmethine derivative, and a tetrapyrrole derivative.

[014] The invention provides a metallic nanoparticle comprising a metallic domain; a fluorescent dye; a first nucleic acid having a first portion that is operative to form a stem and a second portion that is operative to form a loop resulting in the first nucleic acid being operative to form a hairpin conformation; wherein the hairpin conformation causes the metallic domain to quench the fluorescent dye resulting in the nanoparticle being in an inactive state; wherein a second portion of the first nucleic acid is operative to specifically bind a GNAQ sequence in a second nucleic acid; wherein the hairpin conformation is operable to be disrupted by the second nucleic acid resulting in an active state; and wherein in the active state, the metallic domain does not quench the fluorescent dye when the hairpin conformation is disrupted and the fluorescent dye fluoresces. In a preferred embodiment, the metallic domain comprises Co, Ni, Cu, Hg, Pb, Ag, Cr, Fe, or a mixture thereof. In a more preferred embodiment, the metallic mixture further comprises gold.

[015] The invention provides a pharmaceutical composition comprising the gold nanoparticles disclosed above and a physiologically acceptable carrier. In a preferred embodiment, the pharmaceutical composition is formulated for ocular administration. In a more preferred embodiment, the formulation is an eye drop solution.

[016] The invention provides a method of detecting a nucleic acid variant in a subject's eye at a position corresponding to nucleotide 626 of SEQ ID NO:4 comprising administering a fluorescent gold nanoparticle pharmaceutical compositionas disclosed herein to the subject's eye and monitoring the eye for fluorescence.

[017] The invention provides a metallic nanoparticle comprising a first nucleic acid; a metallic domain; and a thiol-releasable linker between the first nucleic acid and the metallic domain; wherein said first nucleic acid specifically binds a GNAQ sequence in a second nucleic acid.

[018] In one embodiment, the first nucleic acid has at least 13 of the 15 nucleotides recited in

positions 6-20 of SEQ ID NO:2. In a preferred embodiment, the first nucleic acid has at least 14 of the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2. In a more preferred embodiment, the first nucleic acid has the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2.

[019] In another embodiment, the second nucleic acid has at least a 90% sequence identity to SEQ ID NO:4. In a more preferred embodiment, the second nucleic acid has the sequence of SEQ ID NO:4.

[020] In some embodiments, the metallic domain comprises silver, cadmium, copper, iron, gold or a mixture thereof.

[021] The invention provides a pharmaceutical composition comprising the metallic nanoparticles disclosed above and a physiologically acceptable carrier. In a preferred embodiment, the pharmaceutical composition is formulated for ocular administration. In a more preferred embodiment, the formulation is an eye drop solution.

[022] The invention provides a method of treating a condition in a subject's eye comprising

administering the pharmaceutical compositions described herein to the subject's eye. In a preferred embodiment, the condition is uveal melanoma.

[023] The invention provides the use of the metalic nanoparticles disclosed herein in the

manufacture of a medicament for the treatment of uveal melanoma.

BRIEF DESCRIPTION OF THE DRAWINGS

[024] Figure 1. Diagram illustrating the gold nanoparticles (AuNPs) of the invention.

[025] Figure 2. Specific detection of wild type or mutant GNAQ transcripts in cell cultures. In the GNAQ mutant cell lines OMM1.3 and Mel202, the AuNP(mut) gave a strong fluorescent signal, whereas the AuNP(wt) did not. In the GNAQ wild type cell lines Sk-Mel-2 and C918, the opposite was observed. Bars represent the increase of fluorescence compared to untreated controls measured by flow cytometric analysis (FACS).

[026] Figure 3. Specificity of AuNPs for mutant or wild-type GNAQ transcripts in cell cultures.

Transcripts were detected using in situ fluorescence staining.

[027] Figure 4. Therapeutic AuNPs targeting mutant GNAQ expression reduced the viability of GNAQ mutant cells. Figure 4a shows immunoblot assays of GNAQ and its downstream effector protein pERK. Actin was used as a negative control. Figure 4b shows the therapeutic AUNPs reduced viability in GNAQ mutant cells.

DETAILED DESCRIPTION OF THE INVENTION

[028] Mutations in the alpha subunit of the G-coupled protein GNAQ/GNA11 in 95% of uveal melanomas cause the substitution of leucine for glutamine (Q209L) or proline for leucine (Q209P). (Raamsdonk, C. D. Van et αί, Nature 2009, 457, 599-602; Raamsdonk, C. D. Van et al, N. Engl. J. Med. 2010, 363, 2191-2199.) This region is responsible for the intrinsic GTPase activity and causes constitutive activation in the absence of the ligand, making GNAQ/GNA1 1 mutations potential targets for treatment and detection. The inventions described herein provide functionalized metallic nanoparticles, including gold nanoparticles (AuNP), to visualize mRNA of mutant GNAQ. Upon binding of the fluorophore-labeled oligonucleotides to its complementary sequence, the quenched fluorescein dissociates from the metallic domain and can be detected. This approach enables the detection of mutant transcripts in live cells in vitro.

[029] The invention further provides gene regulation with nucleic acids that reduce variant protein expression and melanoma cell viability. The nucleic acids are covalently bound to the AuNPs through a novel system that allows their release once the nanostructure reaches the cytoplasm. In one embodiment, the nucleic acids are siRNA. The nanoconjugates prevent siR A degradation and increase its delivery into live cells without the use of transfection or permeabilization reagents.

Definitions

[030] "Aptamers" are nucleic acid-based compounds that have been selected to bind a specific target. An example of an aptamer-based therapeutic compound can be found in

WO07/035922, incorporated by reference herein in its entirety.

[031] An "effective amount" refers to an amount of therapeutic compound that is effective, at dosages and for periods of time necessary, to achieve the desired therapeutic or prophylactic result. A "therapeutically effective amount" of a therapeutic compound may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the antibody to elicit a desired response in the individual. A therapeutically effective amount may be measured, for example, by improved survival rate, more rapid recovery, or amelioration, improvement or elimination of symptoms, or other acceptable biomarkers or surrogate markers. A therapeutically effective amount is also one in which any toxic or detrimental effects of the therapeutic compound are outweighed by the therapeutically beneficial effects. A "prophylactically effective amount" refers to an amount of therapeutic compound that is effective at dosages and for periods of time necessary to achieve the desired prophylactic result. Typically, but not necessarily, since a prophylactic dose is used in subjects prior to or at an earlier stage of disease, the prophylactically effective amount will be less than the therapeutically effective amount.

[032] "Expression vector" refers to a plasmid having one or more genetic signals such as those for transcriptional initiation, transcriptional termination, etc. such that a gene of interest may be cloned in such a plasmid so that it is expressed when properly transformed into a suitable host organism.

[033] "Expression cassette" refers to a portion of an expression plasmid having the gene of interest and sufficient genetic signals for expression of that gene of interest when suitably

transformed into an expression host.

[034] A "fluorescent dye" or "fluorophore" or "fluorochrome" is a fluorescent chemical compound that can re-emit light upon light excitation. Fluorescent dyes typically, but not necessarily, contain several combined aromatic groups, or plane or cyclic molecules with several π bonds.

[035] "Homologs" are bioactive molecules that are similar to a reference molecule at the

nucleotide sequence, peptide sequence, functional, or structural level. Homologs may include sequence derivatives that share a certain percent identity with the reference sequence. Thus, in one embodiment, homologous or derivative sequences share at least a 70 percent sequence identity. In a preferred embodiment, homologous or derivative sequences share at least an 80 or 85 percent sequence identity. In more preferred embodiments, homologous or derivative sequences share at least about an 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99 percent sequence identity. Homologous or derivative nucleic acid sequences may also be defined by their ability to remain bound to a reference nucleic acid sequence under high stringency hybridization conditions. Homologs having a structural or functional similarity to a reference molecule may be chemical derivatives of the reference molecule. Methods of detecting, generating, and screening for structural and functional homologs as well as derivatives are known in the art.

[036] "Hybridization" generally depends on the ability of denatured DNA to reanneal when

complementary strands are present in an environment below their melting temperature. The higher the degree of desired homology between the probe and hybridizable sequence, the higher the relative temperature which can be used. As a result, it follows that higher relative temperatures would tend to make the reaction conditions more stringent, while lower temperatures less so. For additional details and explanation of stringency of hybridization reactions, see Ausubel et al, Current Protocols in Molecular Biology, Wiley Interscience Publishers, (1995).

[037] An "individual," "subject" or "patient" is a vertebrate. In certain embodiments, the vertebrate is a mammal. Mammals include, but are not limited to, primates (including human and non- human primates) and rodents (e.g., mice, hamsters, guinea pigs, and rats). In certain embodiments, a mammal is a human. A "control subject" refers to a healthy subject who has not been diagnosed as having a disease, dysfunction, or condition that has been identified in an individual, subject, or patient. A control subject does not suffer from any sign or symptom associated with the disease, dysfunction, or condition.

[038] A "medicament" is an active drug that has been manufactured for the treatment of a disease, disorder, or condition.

[039] "Morpholinos" are synthetic molecules that are non-natural variants of natural nucleic acids that utilize a phosphorodiamidate linkage, described in U.S. Patent No. 8,076,476, incorporated by reference herein in its entirety.

[040] "Nucleic acids" are any of a group of macromolecules, either DNA, cDNA, RNA, or variants thereof, including siRNA and antagomers, that carry genetic information that may direct cellular functions. The nucleic acids used in the inventions described herein may be single- stranded, double-stranded, linear or circular. The inventions further incorporate the use of nucleic acid variants including, but not limited to, aptamers, PNA, Morpholino, or other non- natural variants of nucleic acids. By way of example, nucleic acids useful for the invention are described in U.S. Patent No. 8,076,476, incorporated by reference herein in its entirety.

[041] "Patient response" or "response" can be assessed using any endpoint indicating a benefit to the patient, including, without limitation, (1) inhibition, to some extent, of disease progression, including slowing down and complete arrest; (2) reduction in the number of disease episodes and/or symptoms; (3) inhibition (i.e., reduction, slowing down or complete stopping) of a disease cell infiltration into adjacent peripheral organs and/or tissues; (4) inhibition (i.e. reduction, slowing down or complete stopping) of disease spread; (5) decrease of an autoimmune condition; (6) favorable change in the expression of a biomarker associated with the disorder; (7) relief, to some extent, of one or more symptoms associated with a disorder; (8) increase in the length of disease-free presentation following treatment; or (9) decreased mortality at a given point of time following treatment.

[042] "Promoter" refers to a polynucleotide sequence which allows and controls the transcription of the genes or sequences functionally connected to them. A promoter contains recognition sequences for binding RNA polymerase and the initiation site for transcription (transcription initiation site). A variety of promoters from various sources are known to those of skill in the art. Promoters of the invention include constitutive, inducible and repressible promoters. The activity of inducible promoters are increased in response to cis- or trans-acting factors or signals.

[043] As used herein, the term "peptide" is any peptide comprising two or more amino acids. The term peptide includes short peptides (e.g., peptides comprising between 2 - 14 amino acids), medium length peptides (15-50) or long chain peptides (e.g., proteins). The terms peptide, medium length peptide and protein may be used interchangeably herein. As used herein, the term "peptide" is interpreted to mean a polymer composed of amino acid residues, related naturally occurring structural variants, and synthetic non-naturally occurring analogs thereof linked via peptide bonds, related naturally-occurring structural variants, and synthetic non- naturally occurring analogs thereof. Synthetic peptides can be synthesized, for example, using an automated peptide synthesizer. Peptides can also be synthesized by other means such as by cells, bacteria, yeast or other living organisms. Peptides may contain amino acids other than the 20 gene-encoded amino acids. Peptides include those modified either by natural processes, such as processing and other post-translational modifications, but also by chemical modification techniques. Such modifications are well described in basic texts and in more detailed monographs, and are well-known to those of skill in the art. Modifications occur anywhere in a peptide, including the peptide backbone, the amino acid side-chains, and the amino or carboxyl termini.

[044] As used herein, a "pharmaceutically acceptable carrier" or "therapeutic effective carrier" is aqueous or nonaqueous (solid), for example alcoholic or oleaginous, or a mixture thereof, and can contain a surfactant, emollient, lubricant, stabilizer, dye, perfume, preservative, acid or base for adjustment of pH, a solvent, emulsifier, gelling agent, moisturizer, stabilizer, wetting agent, time release agent, humectant, or other component commonly included in a particular form of pharmaceutical composition. Pharmaceutically acceptable carriers are well known in the art and include, for example, aqueous solutions such as water or physiologically buffered saline or other solvents or vehicles such as glycols, glycerol, and oils such as olive oil or injectable organic esters. A pharmaceutically acceptable carrier can contain physiologically acceptable compounds that act, for example, to stabilize or to increase the absorption of specific inhibitor, for example, carbohydrates, such as glucose, sucrose or dextrans, antioxidants such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins or other stabilizers or excipients.

[045] "PNA" refers to peptide nucleic acids with a chemical structure similar to DNA or RNA.

Peptide bonds are used to link the nucleotides or nucleosides together.

[046] "Stringency" of hybridization reactions is readily determinable by one of ordinary skill in the art, and generally is an empirical calculation dependent upon probe length, washing temperature, and salt concentration. In general, longer probes require higher temperatures for proper annealing, while shorter probes need lower temperatures.

[047] "Stringent conditions" or "high stringency conditions", as defined herein, can be identified by those that: (1) employ low ionic strength and high temperature for washing, for example 0.015 M sodium chloride/0.0015 M sodium citrate/0.1% sodium dodecyl sulfate at 50°C; (2) employ during hybridization a denaturing agent, such as formamide, for example, 50% (v/v) formamide with 0.1% bovine serum albumin/0.1% Ficoll/0.1% polyvinylpyrrolidone/50 mM sodium phosphate buffer at pH 6.5 with 750 mM sodium chloride, 75 mM sodium citrate at 42°C; or (3) overnight hybridization in a solution that employs 50% formamide, 5 x SSC (0.75 M NaCl, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0.1 % sodium pyrophosphate, 5 x Denhardt's solution, sonicated salmon sperm DNA (50 μΐ/ml), 0.1% SDS, and 10% dextran sulfate at 42°C, with a 10 minute wash at 42°C in 0.2 x SSC (sodium chloride/sodium citrate) followed by a 10 minute high-stringency wash consisting of 0.1 x SSC containing EDTA at 55°C. When a nucleic acid specifically binds another nucleic acid, the binding withstands the stringent conditions as described herein.

[048] A "polyadenylation signal" is a signal sequence which causes cleavage at a specific site at the 3' end of a eukaryotic mRNA molecule and involves a post- transcriptional incorporation of a sequence of about 100-200 adenine nucleotides (polyA tail) at the cleaved 3' end. The polyadenylation signal may comprise the sequence AATAAA about 10-30 nucleotides upstream of the cleavage site and a sequence located downstream. Various polyadenylation elements are known such as tk polyA, SV40 late and early polyA or BGH polyA (described for example in U.S. Pat. No. 5, 122,458, incorporated herein by reference).

[049] A "promoter" refers to a polynucleotide sequence which allows and controls the transcription of the genes or sequences functionally connected to them. A promoter contains recognition sequences for binding RNA polymerase and the initiation site for transcription (transcription initiation site). A suitable functional promoter must be chosen. A variety of promoters from various sources are known to those of skill in the art. Promoters of the invention include constitutive, inducible and repressible promoters. The activity of inducible promoters are increased in response to cis or trans-acting factors or signals. Examples of inducible promoters are the jun, fos, metallothionein and heat shock promoters.

[050] "Transcription-regulatory elements" generally refer to promoters upstream of the gene of interest to be expressed, transcription initiation and termination sites and a polyadenylation signal. Other transcription-regulatory elements include enhancers, locus control regions, and binding sites for cis or trans-acting factors.

[051] The term "transcription initiation site" refers to a nucleic acid sequence that corresponds to the first nucleic acid residue that is transcribed into mRNA. The transcription initiation site may overlap with the promoter sequences.

[052] The term "transcription termination site" refers to a nucleotide sequence that is normally at the 3' end of the nucleic acid sequence being transcribed and brings about the termination of transcription by RNA polymerase. [053] As used herein, "treatment" refers to clinical intervention in an attempt to alter the natural course of the individual or cell being treated, and can be performed before or during the course of clinical pathology. Desirable effects of treatment include preventing the occurrence or recurrence of a disease or a condition or symptom thereof, alleviating a condition or symptom of the disease, diminishing any direct or indirect pathological consequences of the disease, decreasing the rate of disease progression, ameliorating or palliating the disease state, and achieving remission or improved prognosis. In some embodiments, methods and compositions of the invention are useful in attempts to delay development of a disease or disorder.

[054] Uveal melanoma arises from melanocytes within the choroidal plexus of the eye. It presents characteristic cytogenetic alterations and a very strong propensity to metastasize to the liver. Although UM is the most common primary intraocular malignancy in adults, diagnosis of small lesions is still based on morphologic changes of the tumor over time, thus baring the risk of observing, instead of treating a malignancy due to the lack of diagnostic criteria. Up to 85% of all UMs carry somatic mutations in the alpha subunit of the G-coupled proteins GNAQ and GNA11, leading to anchorage independent growth and proliferation.

[055] The invention provides metallic nanoparticles comprising oligonucleotides that are

complementary to GNAQ variants and bear a fluorophore. In preferred embodiments, the metallic nanoparticles comprise a gold domain or gold blended with another metal that quenches the fluorophore. The particles are operative to fold into hairpin structures. When the hairpin structure is formed, the fluorescent tag is in proximity to a metallic domain on the particle and the fluorescence is quenched. Thus, the metallic nanoparticle is in an "inactive" state. The metallic nanoparticles can enter cells without additional transfection steps. Once in the cytoplasm, the nanoparticles may bind to complementary variant GNAQ transcripts. Once bound, the hairpins unfold, the metallic domain is taken out of proximity of the fluorophore. This structural rearrangement of the oligonucleotides (the "active state") leads to an increase of fluorescence, which can be detected. (Figure 1). In preferred embodiments, the metallic nanoparticles are formulated for the delivery to the eye of a subject. In other embodiments, the invention provides a method for delivering the metallic nanoparticles described herein to the eye of a subject and measuring fluorescence using techniques well- known in the art. A fluorescent signal indicates that a plurality of the metallic nanoparticles administered to the eye have formed a duplex with the target sequence in the eye.

[056] The invention additionally provides a therapy for uveal melanomas resulting from

GNAQ/GNA1 1 variants. In this embodiment, metallic nanoparticles, such as gold nanoparticles, containing nucleic acids complementary to the GNAQ/GNA1 1 variants as described herein are functionalized with a linker between the gold portion and the nucleic acid portion of the nanoparticles. In some embodiments, the linkers are cleavable by a thiol- containing molecule, for example, glutathione. Thus, when the therapeutic gold nanoparticles enter the cytoplasm of uveal melanoma cells, the nucleic acids are cleaved from the gold and bind to the GNAQ/GNA1 1 mRNA transcripts. This down-regulates the expression of GNAQ/GNA1 1 variant proteins. In preferred embodiments, the nucleic acids are siRNA, DNA, aptamers, PNA, or morpholinos.

[057] The invention provides novel modifications of nucleic acids that control their release inside cells. In one embodiment, a chemical moiety linked to the nucleic acids to ease their conjugation with AuNPs. In another embodiment, a linker is attached that functions by releasing the nucleic acids from the gold domain in the presence of a thiol such as glutathione. In a preferred embodiment, the invention provides AuNPs comprising siRNAs that are released inside the cytoplasm. The unique properties of the AuNPs disclosed herein allow them to function as carriers of antisense RNA while protecting it from degradation. This increases the uptake into cells without transfection or permeabilization reagents.

[058] In some embodiments, the nucleic acids of the invention are synthesized using methods well- known in the art. In one embodiment, the nucleic acids are generated by enzymes. In exemplary embodiments, the enzymes may include DNA polymerases, RNA polymerases, ligases, and DNA repair enzymes. In another preferred embodiment, the nucleic acids are generated by a polymerase chain reaction (PCR) protocol. See, e.g. U.S. Pat. No. 4,683, 195. In other embodiments, the nucleic acids are chemically synthesized using techniques well- known in the art. Typically, solid-phase nucleic acid synthesizers are used. Exemplary chemistries include phosphodiester synthesis, phosphotriester synthesis, and phosphite triester synthesis. See, e.g., Reese, Colin B. (2005). "Oligo- and poly-nucleotides: 50 years of chemical synthesis". Organic & Biomolecular Chemistry 3 (21): 3851. The skilled artisan would understand that any techniques for synthesizing the nucleic acids and derivatives disclosed herein may be used.

[059] In other embodiments, the nucleic acids of the invention may be expressed in

microorganisms. Promoters for expressing genes of interest are known in the art. In some embodiments, the expression vectors of the invention may have promoters, transcription terminators, or selectable markers. Either inducible or constitutive promoters are

contemplated by the invention.

[060] In a preferred embodiment, the nucleic acids of the invention are expressed in bacterial

systems because of their low cost, high productivity, and rapid use. Thus, the nucleic acids are produced in, for example, Bacillus brevis, Bacillus megaterium, Bacillus subtilis, Caulobacter crescentus, Escherichia coli and their derivatives. Exemplary promoters include the 1-arabinose inducible araBAD promoter (PBAD), the lac promoter, the 1-rhamnose inducible rhaP BAD promoter, the T7 RNA polymerase promoter, the trc and tac promoter, the lambda phage promoter pL, and the anhydrotetracycline-inducible tetA

promoter/ operator.

[061] In some embodiments, the nucleic acids of the invention are expressed in yeast expression systems. Exemplary promoters used in yeast vectors include the promoters for 3- phosphoglycerate kinase (Hitzeman et al, J. Biol. Chem. 255:2073 ((1980)); and other glycolytic enzymes (Hess et al, J. Adv. Enzyme Res. 7: 149 (1968); Holland et al,

Biochemistry 17:4900 (1978)), e.g., enolase, glyceraldehyde-3 -phosphate dehydrogenase, hexokinase, pyvurate decarboxylase, phosphofructokinase, glucose-6-phosphate isomerase, 3- phosphoglycerate mutase, pyruvate kinase, triosephosphate somerase, phosphoglucose isomerase, glucokinase alcohol oxidase I (AOX1), alcohol dehydrogenase 2, isocytochrome C, acid phosphatase, degradative enzymes associated with nitrogen metabolism, and the aforementioned glyceraldehyde-3 -phosphate dehydrogenase, and enzymes responsible for maltose and galactose utilization. Any plasmid vector containing a yeast-compatible promoter and termination sequences, with or without an origin of replication, is suitable. Yeast expression systems are commercially available, for example, from Clontech Laboratories, Inc. (Palo Alto, Calif, e.g. pYEX 4T family of vectors for S. cerevisiae), Invitrogen

(Carlsbad, Calif, e.g. pPICZ series Easy Select Pichia Expression Kit) and Stratagene (La Jolla, Calif, e.g. ESP.TM. Yeast Protein Expression and Purification System for S. pombe and pESC vectors for S. cerevisiae).

[062] In other embodiments, the nucleic acids of the invention are expressed in mammalian

expression systems. Examples of suitable mammalian promoters for use in the invention include, for example, promoters from the following genes: ubiquitin/S27a promoter of the hamster (WO 97/15664), Simian vacuolating virus 40 (SV40) early promoter, adenovirus major late promoter, mouse metallothionein-I promoter, the long terminal repeat region of Rous Sarcoma Virus (RSV), mouse mammary tumor virus promoter (MMTV), Moloney murine leukemia virus Long Terminal repeat region, and the early promoter of human Cytomegalovirus (CMV). Examples of other heterologous mammalian promoters are the actin, immunoglobulin or heat shock promoter(s). In a preferred embodiment, a yeast alcohol oxidase promoter is used.

[063] In additional embodiments, promoters for use in mammalian host cells can be obtained from the genomes of viruses such as polyoma virus, fowlpox virus (UK 2,21 1,504 published 5 Jul. 1989), bovine papilloma virus, avian sarcoma virus, cytomegalovirus, a retrovirus, hepatitis- B virus and Simian Virus 40 (SV40). In further embodiments, heterologous mammalian promoters are used. Examples include the actin promoter, an immunoglobulin promoter, and heat-shock promoters. The early and late promoters of SV40 are conveniently obtained as an SV40 restriction fragment which also contains the SV40 viral origin of replication. Fiers et al, Nature 273 : 1 13-120 (1978). The immediate early promoter of the human

cytomegalovirus is conveniently obtained as a Hindlll E restriction fragment. Greenaway, P. J. et al, Gene 18: 355-360 (1982). The foregoing references are incorporated by reference in their entirety.

[064] In some embodiments, the nucleic acids of the invention are expressed in insect cell

expression systems. Eukaryotic expression systems employing insect cell hosts may rely on either plasmid or baculoviral expression systems. The typical insect host cells are derived from the fall army worm (Spodoptera frugiperda). For expression of a foreign protein these cells are infected with a recombinant form of the baculovirus Autographa californica nuclear polyhedrosis virus which has the gene of interest expressed under the control of the viral polyhedrin promoter. Other insects infected by this virus include a cell line known commercially as "High 5" (Invitrogen) which is derived from the cabbage looper

(Trichoplusia ni). Another baculovirus sometimes used is the Bombyx mori nuclear polyhedorsis virus which infect the silk worm (Bombyx mori). Numerous baculovirus expression systems are commercially available, for example, from Invitrogen (Bac-N- BlueTM.), Clontech (BacPAKTM. Baculovirus Expression System), Life Technologies (BAC-TO-BAC.TM.), Novagen (Bac Vector System.TM.), Pharmingen and Quantum Biotechnologies). Another insect cell host is the common fruit fly, Drosophila melanogaster , for which a transient or stable plasmid based transfection kit is offered commercially by Invitrogen (The DES.TM. System).

[065] In some embodiments, cells are transformed with vectors that express the nucleic acids of the invention. Transformation techniques for inserting new genetic material into eukaryotic cells, including animal and plant cells, are well known. Viral vectors may be used for inserting expression cassettes into host cell genomes. Alternatively, the vectors may be transfected into the host cells. Transfection may be accomplished by calcium phosphate precipitation, electroporation, optical transfection, protoplast fusion, impalefection, and hydrodynamic delivery.

[066] The invention provides for the first time molecular beacons (i.e. oligonucleotide hybridization probes) that detect variant GNAQ and GNA1 1 variants that can be administered directly to a subject's eye and detect or treat uveal melanoma. Molecular beacons are hairpin shaped molecules comprising nucleic acids in a stem and loop orientation with a fluorophore on one end and a quenching group on the other. In an "inactive state, the stem and loop formation juxtaposes the quencher onto the fluorophore and the fluorescence is quenched. Fluorescence is restored when they bind to a target nucleic acid sequence and disrupt the hairpin. This is a novel non-radioactive method for detecting specific sequences of nucleic acids.

[067] The gold nanoparticles of the invention comprise fluorescent dyes or fluorophores that act as tracers attached to the nucleic acids that hybridize to GNAQ variants. In a preferred embodiment, the fluorophore is Fluorescein, or its amine reactive isothiocyanate derivative FITC. In other embodiments, the fluorophore is rhodamine (TRITC), coumarin, or cyanine.

[068] Fluorophores absorb light energy of a specific wavelength and re-emits light at a longer

wavelength. The absorbed wavelengths, energy transfer efficiency, and time before emission depend on both the fluorophore structure and its chemical environment, as the molecule in its excited state interacts with surrounding molecules. Maximum wavelengths of absorption (i.e. excitation) and emission are used in the art to refer to a given fluorophore, but the whole spectrum may be important to consider. In one example, the Absorption/Emission wavelengths are 485 nm and 517 nm. In other embodiments, the excitation wavelength spectrum may be a narrow or a broader band. The emission spectrum may be sharper than the excitation spectrum, and it is of a longer wavelength and correspondingly lower energy. Excitation energies range from ultraviolet through the visible spectrum and near infrared spectrum, and emission energies may continue from visible light into the near infrared and infrared regions.

[069] In one embodiment, the metallic nanoparticles of the invention comprise a non-protein

organic fluorophore. Non-protein organic fluorophores belong to following major chemical families: xanthene derivatives including fluorescein, rhodamine, Oregon green, eosin, and Texas red; cyanine derivatives including cyanine, indocarbocyanine, indocyanine green, oxacarbocyanine, thiacarbocyanine, and merocyanine; naphthalene derivatives including dansyl and prodan derivatives; coumarin derivatives; oxadiazole derivatives including pyridyloxazole, nitrobenzoxadiazole and benzoxadiazole; pyrene derivatives including cascade blue; oxazine derivatives including Nile red, Nile blue, cresyl violet, and oxazine 170; acridine derivatives incuding pro flavin, acridine orange, and acridine yellow;

arylmethine derivatives including auramine, crystal violet, and malachite green; and tetrapyrrole derivatives including porphin, phthalocyanine, and bilirubin.

[070] The metallic nanoparticles of the invention may comprise any fluorescence-quenching

metallic particles. Metallic particles that quench fluorescence are known in the art and include Co, Ni, Cu, Hg, Pb, Ag, Cr, and Fe. The metallic nanoparticles of the invention may incorporate any of these metals. [071] Pharmaceutical compositions of this invention comprise any of the compounds of the present invention, and pharmaceutically acceptable salts thereof, with any pharmaceutically acceptable carrier, adjuvant or vehicle. Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used in the pharmaceutical compositions of the invention include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium

carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat.

[072] Pharmaceutically acceptable salts retain the desired biological activity of the therapeutic composition without toxic side effects. Examples of such salts are (a) acid addition salts formed with inorganic acids, for example, hydrochloric acid, hydrobromic acid, sulfuric acid, phosphoric acid, nitric acid and the like/ and salts formed with organic acids such as, for example, acetic acid, trifluoroacetic acid, tartaric acid, succinic acid, maleic acid, fumaric acid, gluconic acid, citric acid, malic acid, ascorbic acid, benzoic acid, tanic acid, pamoic acid, alginic acid, polyglutamic acid, naphthalenesulfonic acid, naphthalene disulfonic acid, polygalacturonic acid and the like; (b) base addition salts or complexes formed with polyvalent metal cations such as zinc, calcium, bismuth, barium, magnesium, aluminum, copper, cobalt, nickel, cadmium, and the like; or with an organic cation formed from Ν,Ν'- dibenzylethylenediamine or ethlenediamine; or (c) combinations of (a) and (b), e.g. a zinc tannate salt and the like.

[073] The pharmaceutical compositions of this invention may be administered by ocular modes. In some embodiments, the pharmaceutical compositions are delivered via a topical eye drop, a periocular injection (e.g., sub-tenon) or via intravitreal injection. The pharmaceutical compositions of this invention may contain any conventional, nontoxic, pharmaceutically - acceptable carriers, adjuvants or vehicles. Also contemplated, in some embodiments, are pharmaceutical compositions comprising as an active ingredient, therapeutic compounds described herein, or pharmaceutically acceptable salt thereof, in a mixture with a

pharmaceutically acceptable, non-toxic component. In other embodiments, the

pharmaceutical compositions of the invention may be formulated with a semifluoronated alkane as described in U.S. Publication No. US20130266652, incorporated herein by reference in its entirety. [074] The compositions may conveniently be administered in unit dosage form and may be prepared by any of the methods well-known in the pharmaceutical art, for example, as described in Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Co., Easton, PA (1985), incorporated herein by reference in its entirety. Delivery of modified therapeutic compounds described herein to a subject over prolonged periods of time, for example, for periods of one week to one year, may be accomplished by a single administration of a controlled release system containing sufficient active ingredient for the desired release period. Various controlled release systems, such as monolithic or reservoir-type microcapsules, polymeric hydrogels, osmotic pumps, vesicles, micelles, liposomes, transdermal patches, iontophoretic devices and alternative injectable dosage forms may be utilized for this purpose.

[075] One form of controlled-release formulation contains the therapeutic compound or its salt dispersed or encapsulated in a slowly degrading, non-toxic, non-antigenic polymer such as copoly(lactic/glycolic) acid, as described in the pioneering work of Kent et al., US Patent No. 4,675, 189, incorporated by reference herein. The compounds, or their salts, may also be formulated in cholesterol or other lipid matrix pellets, or silastomer matrix implants.

Additional slow release, depot implant or injectable formulations will be apparent to the skilled artisan. See, for example, Sustained and Controlled Release Drug Delivery Systems, JR Robinson ed., Marcel Dekker Inc., New York, 1978; and Controlled Release of

Biologically Active Agents, RW Baker, John Wiley & Sons, New York, 1987. The foregoing are incorporated by reference in their entirety.

[076] An additional form of controlled-release formulation comprises a solution of biodegradable polymer, such as copoly(lactic/glycolic acid) or block copolymers of lactic acid and PEG, is a bioacceptable solvent, which is injected subcutaneous ly or intramuscularly to achieve a depot formulation. Mixing of the therapeutic compounds described herein with such a polymeric formulation is suitable to achieve very long duration of action formulations.

[077] Dosage levels of between about 0.01 and about 100 mg/kg body weight per day, preferably 0.5 and about 50 mg/kg body weight per day of the active ingredient compound are useful in the prevention and treatment of disease. Typically, the pharmaceutical compositions of this invention will be administered from about 1 to about 5 times per day or alternatively, as a continuous infusion. Such administration can be used as a chronic or acute therapy. The amount of active ingredient that may be combined with the carrier materials to produce a single dosage form will vary depending upon the host treated and the particular mode of administration. A typical preparation will contain from about 5% to about 95% active compound (w/w). Preferably, such preparations contain from about 20% to about 80% active compound.

[078] Upon improvement of a patient's condition, a maintenance dose of a compound, composition or combination of this invention may be administered, if necessary. Subsequently, the dosage or frequency of administration, or both, may be reduced, as a function of the symptoms, to a level at which the improved condition is retained when the symptoms have been alleviated to the desired level, treatment should cease. Patients may, however, require intermittent treatment on a long-term basis upon any recurrence of disease symptoms.

[079] In order that the invention described herein may be more fully understood, the following examples are set forth. It should be understood that these examples are for illustrative purposes only and are not to be construed as limiting this invention in any manner.

Example 1: Generation of Fluorescent Gold Nanoparticles that Detect GNAQ Variants

[080] Oligonucleotide Synthesis. Oligonucleotides were prepared using a MerMade4 DNA

Synthesizer using phosphoramidites (Link Technologies, Lanarkshire, UK). DNA

oligonucleotides were prepared at 1 μΜοΙ scale. The oligonucleotides were synthesized in the 3 ' to 5' direction. The last nucleotide (5' end) incorporated into the DNA strand was the phosphoramidite derivative of fluorescein (Link Technologies) using methods well-known in the art. After solid-phase synthesis, the solid support was transferred to a screw-cap glass vial and incubated at 55°C for 4h with 2 mL of ammonia solution (33%). After the vial was cooled on ice, the supernatant was transferred by pipet to microcentrifuge tubes and the solid support and vial were rinsed with water. The combined solutions were evaporated to dryness using an evaporating centrifuge. The oligonucleotides were purified by 20% polyacrylamide gel electrophoresis and the oligonucleotides were eluted from gel fractions using an elutrap system. The solutions were desalted using a NAP- 10 column and concentrated in an evaporating centrifuge.

[081] Gold Nanoparticles. Gold moieties were prepared by the Turkevich method (Kimling, J. et al, JPhys Chem B 2006, 110, 15700-15707; Ambrosi, et al, A. Anal. Chem. 2007, 79, 5232-40). A solution of HAuCU (34.3 mg) in H2O (101 mL) was heated up to reach boiling temperature then a solution of sodium citrate (119.4 mg) in H2O (10.1 mL) was added quickly. The solution was stirred for 10 min and then the removed from the heating source and stirred overnight at room temperature. They were in a stable reddish dispersion where the gold metallic core is decorated with citrate groups. The solution was filtered and stored at 4 C. [082] A UV/Vis spectrum of the solution showed the absorption inflection point at 520 nm, which was defined as the peak value to produce a diameter of 13 nm. This result was consistent with the observation from the high-resolution TEM image, in which a uniform size distribution of about 13 nm in diameter was observed. The concentration of gold moieties was determined to be 12 nM using the Lambert-Beer law and the extinction coefficient of 2.7x 10⁸ M ¹ cm ¹ at 520 nm.

[083] Subsequently, the gold moieties were modified using an excess of oligonucleotides with a dithiolane group on the 3 ' end of the oligonucleotides. The dithiolane moiety allows the functionalization of oligonucleotides due to the high affinity of sulfur to gold.

[084] This group has several advantages compared with the standard thiol groups previously used in the preparation of modified oligonucleotides. First, deprotection of dithiolane group is not required and oligonucleotides can be used after standard synthesis and deprotection. Second, binding is fast and modified AuNPs are more stable compared to AuNPs bearing thiol- modified oligonucleotides, a modified solid support was prepared to introduce this group at the 3 '-end of oligonucleotides. The preparation of this modified solid support involved the reaction between lipoic acid and threoninol to yield the amide derivative (1). Then, the primary hydroxyl group was protected as dimethoxytrytyl group (2) and the secondary hydroxyl group was treated with succinic anhydride to introduce a carboxylic acid moiety. This group was used to attach the molecule to the Controlled Pore Glass (CPG) solid support that gave rise to the desired modified solid support (3).

[085] DIC = diisopropyl carbodiimide; HOBt = 1-hydroxybenzotriazole; DMF =

dimethylformamide; Py = pyridine; DMTrCl = 4,4 ^'-dimethoxyltrityl chloride; DIPEA = N,N- diisopropylethylamine; DMAP = 4-dimethylaminopyridine; CPG = controlled pore glass. [086] Reagents were purchased from Aldrich and used without further purification. Thin layer chromatography was carried out using Silica Gel 60 F254 plates. Column chromatography was performed using Silica Gel (60 A,230 x 400 mesh). All NMR spectra were recorded on Bruker 300 MHz instrument as solutions in the deuterated solvent indicated, and the chemical shifts are reported in parts per million (ppm). Coupling constants are reported in hertz (Hz).

[087] 5 - [(3 S)- 1 ,2-dithiolan-3 -yl] -N-[( 1 R,2 S)-2 -hydroxy- 1 -(hydroxymethyl)propyl]pentanamide ( 1 ).

[088] To a solution of (R)-(+)-l,2-dithiolane-3-pentanoic acid (3.301 mmol, 680 mg, 1.2 eq.) in DMF (0.5 M) at room temperature, N- hydroxybenzotriazole (3.027 mmol, 409 mg, 1.1 eq.) and diisopropylcarbodiimide (3.026 mmol, 468 μΐ, 1.1 eq.) were added. After stirring the mixture 10 min. L- threoninol (2.752 mmol, 289 mg, 1 eq.) was added. The resulting mixture was stirred overnight and then quenched by the addiction of methanol. The solvent was evaporated under vacuum and the residue purified by flash chromatography 20: 1 (CH2CI2: MeOH) to yield 660 mg as a pale yellow oil (82%). H-NMR (300 MHz, CDC ): δ 6.26 (d, J = 6.7 Hz, 1H), 4.17 (d, J= 6.2 Hz, 1H), 3.95 - 3.71 (m, 3H), 3.58 (dt, J= 13.1, 6.5 Hz, 1H),3.48 (s, lH), 3.26 - 3.04 (m, 2H), 2.46 (td, J= 12.4, 6.4 Hz, 1H), 2.27 (t, J= 7.4 Hz, 2H), 1.91 (dq, J= 13.7, 6.9 Hz, 1H), 1.80 - 1.60 (m, 5H), 1.57 - 1.41 (m, 2H), 1.19 (d, J= 6.4 Hz, 3H). ¹³C-NMR (75MHz, CDCb): δ 174.1 (C), 68.7(CH), 65.0(CH₂), 56.4(CH), 54.7(CH), 40.3(CH₂), 38.5(CH₂), 36.5(CH₂), 34.6(CH₂), 28.8(CH₂), 25.5(CH₂), 20.6(CH₃). HR-MS (ESI): m/z calculated for Ci₂H₂₄N0₃S₂ 294.1 192 [M+H]⁺, found 294.1 186.

[089] N-((1R,2S)- 1 - { [bis(4-methoxyphenyl)(phenyl)methoxy]methyl} -2-hydroxypropyl)-5-[(3S)- 1,2- dithiolan-3-yl]pentanamide (2).

[090] To a solution of the corresponding diol (0.682 mmol, 200 mg, 1 eq.) in pyridine (0.2 M) at 0°C, diisopropylethylamine (1.023 mmol, 179 μΐ, 1.5 eq), 4,4^'-dimethoxyltritylchloride (0.819 mmol, 277 mg, 1.2 eq) and dimethylaminopyridine (catalytic amount) were added. After 15 min. the mixture was allowed to reach room temperature. The mixture was stirred overnight and then quenched by the addiction of methanol. The solvent was evaporated under vacuum and the residue purified by flash chromatography 1 :2 (hexane: EtOAc) to yield 270 mg as a white to light yellow foam (66%). ¾-NMR (300 MHz, CDCb): δ 7.28 (m, 9H), 6.83 (d, J= 8.8 Hz, 4H), 6.03 (d, J= 8.7 Hz, 1H),4.10 (m, 1H), 3.93 (dd, J= 8.4, 2.5 Hz, 1H), 3.79 (s, 6H), 3.62 - 3.48 (m, 1H), 3.41 (dd, J= 9.6, 4.3 Hz, 1H), 3.29 (dd, J= 9.6, 3.5 Hz, 1H), 3.23 - 3.05 (m, 3H), 2.44 (td, J= 12.4, 6.4 Hz, 1H), 2.23 (t, J= 7.3 Hz, 2H), 1.90 (td, J = 13.7, 6.9 Hz, 1H), 1.76 - 1.62 (m, 4H), 1.56 - 1.41 (m, 2H), 1.12 (d, J= 6.4 Hz, 3H). ¹³C- NMR (75MHz, CDCb): δ 173.0 (C), 158.6 (2C) (C), 144.3 (C), 135.5 (C), 135.3 (C), 129.9 (2C) (CH), 129.8 (2C) (CH), 127.9 (2C) (CH), 127.8 (2C) (CH), 127.0(CH), 1 13.3 (4C) (CH3), 86.7, 68.6(CH), 65.2(CH₂), 60.3, 56.3(CH), 55.2(CH), 53.3(CH), 40.2(CH₂),

38.4(CH₂), 36.5(CH₂), 34.6(CH₂), 28.9(CH₂), 25.5(CH₂), 19.9(CH₃). HR-MS (ESI): m/z calculated for C₃3H₄i a0₅S₂ 618.2324 [M+Na]⁺, found 618.2296.

[091] CPG Functionalization (two steps)

NH₂-CPG

[092] To a solution of 2 (0.084 mmol, 50 mg, 1 eq) in anhydrous dichloromethane (0.2 M) succinic anhydride (0.109 mmol, 10.9 mg, 1.3 eq), diisopropylethylamine (0.1 18 mmol, 20.5 μΐ, 1.4 eq) dimethylaminopyridine (catalytic amount) were added. The solution was stirred for 16 h at room temperature. The solution was washed with water and extracted with

dichloromethane. The organic layer was dried over MgS0₄, filtered and evaporated under vacuum to yield yellowish oil.

[093] To a solution of DMAP (0.126 mmol, 15.4 mg, 1.5 eq) in acetronitrile (60 mM) the product obtained in the step II was added (0.084 mmol, 58.3 mg, 1 eq). After mixing it well in vortex, the solution was added to a solution of 2,2^'-dithiobis-(5-nitropyridine) (0.126 mmol, 39.0 mg, 1.5 eq) in anhydrous CH₂C1₂ (300 μΐ). The solution was mixed well and added to triphenyl posphine (0.126 mmol, 33.0 mg, 1.5 eq). The mixture was vortexed till all reagents were dissolved giving rise to a reddish solution, which was added to 500 mg of CPG (500 A). After 2h at room temperature, the solution was removed and the CPG washed with methanol (3 x 20 ml) and dry acetronitrile (3 x 20 ml). Once the CPG was dry, 2 ml of a 1 : 1 mixture of the capping reagents (CAP A: 600 μΐ pyridine, 500 μΐ dry THF, 400 μΐ acetic anhydride; CAP B: 1 ml dry THF, 400 μΐ 1 -methylimidazole) was added. After 20 min at room temperature, the CPG was washed with dry acetonitrile (6 x 20 ml) and dried well.

[094] The CPG loading was calculated by detrytylation of the sample as follow: 10 mg of CPG were treated with 5 ml of detrytylation solution (3 ml of perchloric acid and 2 ml of ethanol) for 1 hour. Then 500 μΐ of the mixture were dissolved in 2 ml of the detrytylation solution and absorbance was measured at 498 nm. Functionalization (F) was determined by Lambert- Beer law:

F = (ABS x V) / (ε x g) = M / g

[095] The resulting stably modified AuNPs were characterized. A peak fluorescence emission was recorded at 518nm after 20 minutes incubation with the matching target sequence (excitation at 470 nm). Using these techniques, the following gold nanoparticles were produced:

GNAQ-WT: 5'-Fluoresceine- CCGTCTGACCTTTGGCCCCCGACGG -Ts-Dithiolane GNAQ-MUT: 5'-Fluoresceine- CCGTCTGACCTTGGGCCCCCGACGG -Ts-Dithiolane SCR: 5'-Fluoresceine-CTCCTCGAAGTATTCCGCGGGAG-T₅-Dithiolane

The position of variation is denoted by bold typeface.

Example 2: Detection Of GNAQ Nucleotides in Cell Cultures Using Gold Nanoparticles

[096] The AuNPs of the invention specifically detected mutant GNAQ transcripts in cell cultures.

D04, Sk-Mel-2, C918, OMM1.3 and Mel202 cell lines were maintained in RPMI 1640 media supplemented with 10% FBS and incubated at 37°C under 5% C02. Cells were incubated with AuNPs for 6 hours. The medium was then changed to complete medium not containing AuNP and incubated for 18 hours at 37 degrees Celcius and 5% CO2. Cells were analyzed by fluorescence-activated cell sorting (FACS). As shown in Figure 2, fluorescence increased significantly with AuNP detecting the GNAQ(Q209L) mutation in the two GNAQ mutant cell lines OMM1.3 and Mel202. Fluorescence did not increase in the GNAQ wild type cell line Sk-Mel-2.

[097] Confocal microscopy of mutant cells incubated with AuNPs that recognize mutant GNAQ revealed that the nanostructures released the fluorophore inside the cells. The AuNPs showed high specificity and selectivity for the mutant or wild type transcripts in situ. (Figure 2.) The GNAQ mutant cell line OMM1.3 and Mel202 gave a more than 20-fold increase in fluorescence by flow cytometric analysis when incubated with AuNPs that recognize the mutant transcript (AuNPmut). In contrast, the wild type cell lines Sk-Mel-2 and C918 only had a 3-fold increase in signal. AuNPs directed against the wild type sequence (AuNPwt) only weakly increased fluorescence in mutant cells OMM1.3 and Mel202, but gave an increased fluorescent signal in the GNAQ wild type cell line Sk-Mel-2 and C918 (Figure 2).

These results demonstrated that mutation analysis in total RNA extracts as well as in living cells can be achieved using AuNPs.

[098] AuNPs designed to detect the mutant version of GNAQ were used in in situ fluorescence staining. These AuNPs gave a fluorescent signal in the GNAQ mutant cell line OMM1.3. In contrast AuNPs directed against wild type GNAQ did not give a signal in OMM1.3 cells.

Likewise, AuNPs detecting GNAQ mutations did not give a signal in GNAQ wild type human primary melanocytes (FOM). (Figure 3.)

Example 3: Inhibition of Uveal Melanoma Cells with Gold Nanoparticles

[099] The invention provides novel therapeutic AuNPs that release the nucleic acids in the cells.

The AuNPs have three domains: a nucleic acid, a thiol-cleavable linker, and dithiolane/gold.

When the therapeutic AuNPs are delivered to the cytoplasm, the nucleic acids are separated from the dithiolane/gold moiety by an endogenous thiol such as glutathione. The Therapeutic

AuNPs targeted mutant GNAQ and inhibited its expression. This disrupted the mitogen activated protein kinase signaling pathway (MAPK) downstream of GNAQ and caused cell growth inhibition (Figure 4).

[0100] The therapeutic AuNPs were prepared against GNAQ as described above: The sequences of the therapeutic AuNPs were

5 ' -UAGGGGGCCUAAGGUCAGAdTdT-3 '

5'-UCUGACCUUAGGCCCCCUAdTdTdTdTdT-(Linker)-3'

[0101] The structure of the thiol-cleavable linker was:

[0102] The therapeutic AuNPs knockdown of mutant GNAQ with siRNA -AuNPs resulted in a

significant decrease of cell viability in mutant cells, whereas wild type cells were unaffected. (Figure 4.) Cell lines Sk-Mel-2, C918, Mel202 and OMM1.3 were maintained in RPMI 1640 media supplemented with 10% FBS and incubated at 37°C under 5% CO2. All viability assays were at least carried out in triplicates. Cells were plated 24h prior to AuNP incubation. The relative number of viable cells was calculated using CellTiter-Glo® (Promega, G7570) after 72h of incubation with the indicated conditions. Total luminescence was measured on the SynergyHT plate reader (BioTek) using Gen5 software (Version 1.11.5). [0103] For immunoblotting, cells were incubated with AuNPs for 6h, washed with PBS and lysed using radio-immunoprecipitation (RIP A) buffer (150 mM NaCl, 1% (vol/vol) Nonidet P-40, 0.5% (wt/vol) sodium deoxycholate, 0.1% (wt/vol) SDS, in 50mM Tris-HCl (pH8.0) supplemented with protease and phosphatase inhibitors (78442; Pierce) according to the manufacturer's protocol. Protein concentrations were determined using the BCA Protein Assay kit (23235; Pierce). Total protein in lx Laemmli buffer with 10% 2-mercaptoethanol was separated by SDS-PAGE, transferred 1 h to a PVDF membrane (IPVH00010; Millipore) by electro-blotting with 20% (vol/vol) methanol and blocked for lh in 5% (wt/vol) dry milk/TBS/0.1% (vol/vol) Tween-20. Membranes were incubated overnight at 4°C with primary antiserum following incubation with horseradish peroxidase-conjugated secondary antiserum for 1 h and developed using enhanced chemiluminescence (32106; Pierce) or 64- 20 IBP; Millipore). β-Actin antibody was obtained from Sigma. Phospho-p44/42 MapK (Erkl/2) and GNAQ were obtained from Cell Signaling.

[0104] Figure 4A shows immunoblots of GNAQ, its downstream effector molecule pERK, and Actin which was used as a negative control. The addition of AuNP(mut) caused the down- regulation of GNAQ and pERK protein expression in the OMM1.3 mutant cells but not in the SK-Mel-2 wild-type cells. In both cell types, Actin expression was unaffected. Figure 4b shows that the AuNP(mut) significantly reduced the viability of GNAQ mutant but not wild- type cells.

Sequence Identity Numbers:

SEQ ID NO: 1 - Wild type GNAQ AuNP sequence

CCGTCTGACCTTTGGCCCCCGACGGTTTTT

SEQ ID NO:2 - Mutant GNAQ AuNP sequence

CCGTCTGACCTTGGGCCCCCGACGGTTTTT

SEQ ID NO: 3 - SCR negative Control sequence

CTCCTCGAAGTATTCCGCGGGAGTTTTT

SEQ ID NO:4 -Nucleotide Sequence Encoding Wild Type GNAQ

ATGACTCTGGAGTCCATCATGGCGTGCTGCCTGAGCGAGGAGGCCAAGGAAGCCCGGC GG

ATCAACGACGAGATCGAGCGGCAGCTCCGCAGGGACAAGCGGGACGCCCGCCGGGAGC TC

AAGCTGCTGCTGCTCGGGACAGGAGAGAGTGGCAAGAGTACGTTTATCAAGCAGATGA GA

ATCATCCATGGGTCAGGATACTCTGATGAAGATAAAAGGGGCTTCACCAAGCTGGTGTA T

CAGAACATCTTCACGGCCATGCAGGCCATGATCAGAGCCATGGACACACTCAAGATCCC A

TACAAGTATGAGCACAATAAGGCTCATGCACAATTAGTTCGAGAAGTTGATGTGGAGAA G

GTGTCTGCTTTTGAGAATCCATATGTAGATGCAATAAAGAGTTTATGGAATGATCCTGG A

ATCCAGGAATGCTATGATAGACGACGAGAATATCAATTATCTGACTCTACCAAATACTA T

CTTAATGACTTGGACCGCGTAGCTGACCCTGCCTACCTGCCTACGCAACAAGATGTGCTT

AGAGTTCGAGTCCCCACCACAGGGATCATCGAATACCCCTTTGACTTACAAAGTGTCAT

T

TTCAGAATGGTCGATGTAGGGGGCCAAAGGTCAGAGAGAAGAAAATGGATACACTGCT TT

GAAAATGTCACCTCTATCATGTTTCTAGTAGCGCTTAGTGAATATGATCAAGTTCTCGTG

GAGTCAGACAATGAGAACCGAATGGAGGAAAGCAAGGCTCTCTTTAGAACAATTATCA

CA

TACCCCTGGTTCCAGAACTCCTCGGTTATTCTGTTCTTAAACAAGAAAGATCTTCTAGAG GAGAAAATCATGTATTCCCATCTAGTCGACTACTTCCCAGAATATGATGGACCCCAGAG A

GATGCCCAGGCAGCCCGAGAATTCATTCTGAAGATGTTCGTGGACCTGAACCCAGACAG T

GACAAAATTATCTACTCCCACTTCACGTGCGCCACAGACACCGAGAATATCCGCTTTGTC

TTTGCTGCCGTCAAGGACACCATCCTCCAGTTGAACCTGAAGGAGTACAATCTGGTCTA

A

[0105] All publications and patent documents disclosed or referred to herein are incorporated by reference in their entirety. The foregoing description has been presented only for purposes of illustration and description. This description is not intended to limit the invention to the precise form disclosed. It is intended that the scope of the invention be defined by the claims appended hereto.

Claims

What is claimed:

1. A gold nanoparticle, comprising:

a. a gold domain;

b. a fluorescent dye;

c. a first nucleic acid having a first portion that is operative to form a stem and a second portion that is operative to form a loop resulting in said first nucleic acid being operative to form a hairpin conformation;

wherein said hairpin conformation causes said gold domain to quench said fluorescent dye resulting in said nanoparticle being in an inactive state;

wherein a second portion of said first nucleic acid is operative to specifically bind a GNAQ sequence in a second nucleic acid;

wherein said hairpin conformation is operable to be disrupted by said second nucleic acid resulting in an active state; and

wherein in said active state, said gold domain does not quench said fluorescent dye when said hairpin conformation is disrupted and said fluorescent dye fluoresces.

2. The gold nanoparticle of claim 1, wherein said first and second portions of said first nucleic acid do not overlap.

3. The gold nanoparticle of claim 1, wherein said first and second portions of said first nucleic acid overlap.

4. The gold nanoparticle of any one of claims 1 to 3, wherein said first nucleic acid has at least

13 of the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2.

5. The gold nanoparticle of any one of claims 1 to 3, wherein said first nucleic acid has at least

14 of the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2.

6. The gold nanoparticle of any one of claims 1 to 3, wherein said first nucleic acid has the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2.

7. The gold nanoparticle of any one of claims 1-3, wherein said second nucleic acid has at least a 90% sequence identity to SEQ ID NO:4.

8. The gold nanoparticle of claim 7, wherein said second nucleic acid has the sequence of SEQ ID NO:4.

9. The gold nanoparticle of any one of claims 1 to 8, wherein said fluorescent dye is selected from the group consisting of a xanthene derivative, a cyanine derivative, a naphthalene derivative, a coumarin derivative, an oxadiazole derivative, a pyrene derivative, an oxazine derivative, an acridine derivative, an arylmethine derivative, and a tetrapyrrole derivative.

10. The gold nanoparticle of any one of claims 1 to 8, wherein said fluorescent dye is fluorescein.

11. A metallic nanoparticle, comprising:

a. a metallic domain;

b. a fluorescent dye;

c. a first nucleic acid having a first portion that is operative to form a stem and a second portion that is operative to form a loop resulting in said first nucleic acid being operative to form a hairpin conformation;

wherein said hairpin conformation causes said metallic domain to quench said fluorescent dye resulting in said nanoparticle being in an inactive state;

wherein a second portion of said first nucleic acid is operative to specifically bind a GNAQ sequence in a second nucleic acid;

wherein said hairpin conformation is operable to be disrupted by said second nucleic acid resulting in an active state; and

wherein in said active state, said metallic domain does not quench said fluorescent dye when said hairpin conformation is disrupted and said fluorescent dye fluoresces.

12. The metallic nanoparticle of claim 1 1, wherein said metallic domain comprises Co, Ni, Cu, Hg, Pb, Ag, Cr, Fe, or a mixture thereof.

13. The metallic nanoparticle of claim 12, wherein said metallic mixture further comprises gold.

14. A pharmaceutical composition, comprising the nanoparticle of any one of claims 1 to 13 and a physiologically acceptable carrier.

15. The pharmaceutical composition of claim 14 formulated for ocular administration.

16. The pharmaceutical composition of claim 15, wherein said formulation is an eye drop

solution.

17. A method of detecting a nucleic acid variant in a subject's eye at a position corresponding to nucleotide 626 of SEQ ID NO:4, comprising administering the pharmaceutical composition of any one of claims 14-16 to said subject's eye and monitoring said eye for fluorescence.

18. A metallic nanoparticle, comprising:

a. a first nucleic acid;

b. a metallic domain; and

c. a thiol-releasable linker between said first nucleic acid and said metallic domain; wherein said first nucleic acid specifically binds a GNAQ sequence in a second nucleic acid.

19. The metallic nanoparticle of claim 18, wherein said first nucleic acid has at least 13 of the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2.

20. The metallic nanoparticle of claim 18, wherein said first nucleic acid has at least 14 of the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2.

21. The metallic nanoparticle of of claim 18, wherein said first nucleic acid has the 15 nucleotides recited in positions 6-20 of SEQ ID NO:2.

22. The metallic nanoparticle of of claim 18, wherein said second nucleic acid has at least a 90% sequence identity to SEQ ID NO:4.

23. The metallic nanoparticle of claim 18, wherein said second nucleic acid has the sequence of SEQ ID NO:4.

24. The metallic nanoparticle of claim 18, wherein said metallic domain comprises silver, cadmium, copper, iron, gold or a mixture thereof.

25. A pharmaceutical composition, comprising the gold nanoparticle of any one of claims 18-24 and a physiologically acceptable carrier.

26. The pharmaceutical composition of claim 25 formulated for ocular administration.

27. The pharmaceutical composition of claim 26 wherein said formulation is an eye drop

solution.

28. A method of treating a condition in a subject's eye, comprising administering the

pharmaceutical composition of any one of claims 25-27 to said subject's eye.

29. The method of claim 28, wherein said condition is uveal melanoma.

30. The use of the gold nanoparticle of any one of claims 1-13 in the manufacture of a

medicament for the treatment of uveal melanoma.